WO2009023053A2 - Use of rsk inhibitors to impede intracellular pathogen infections - Google Patents

Abstract

A composition comprising a RSK activity inhibiting agent is provided for inhibiting the establishment or maintenance of an intracellular pathogenic infection by pathogens whose pathogenicity derives in part from the pathogens ability to impede endosomal/phagosomal maturation in the host cell. The RSK specific inhibitors used in accordance with the disclosed composition and methods can be selected from any inhibiting moiety including by not limited to anti-sense oligonucleotides, interfering oligonucleotide and kaempferol 3-O-(3',4'-di-O-acetyl- α-L-rhamnopyranoside) and related compounds.

Description

USE OF RSK INHIBITORS TO IMPEDE INTRACELLULAR PATHOGEN

INFECTIONS

CROSS REFERENCE TO RELATED APPLICATIONS: This application claims priority to United States Provisional Patent

Application No. 60/930,876 filed on May 18, 2007, the complete disclosure of which is incorporated herein by reference.

BACKGROUND The Yersinia genus of bacteria comprises several different species, of which three, Y. pestis, Y. pseudotuberculosis, and Y. enterocolitica, are pathogenic for humans. From an epidemiologic perspective, Y. pestis, the causative agent of the plague, has brought about widespread death and devastation, perhaps on a scale unmatched by any other infectious agent in history. The level of depopulation due to Y. pestis infection is staggering. In 1334, 90% (5 million) of the people in the

Chinese province of Hubei were killed by the plague. 20 years later, two-thirds (25 million) of China's population died at the same time that one-third to one-half of the European population succumbed to the infection. Records from cities in the Middle East report up to 1000 deaths per day during the height of this outbreak. Antibiotic intervention has made pandemics of the wild type Y. pestis improbable. However, several countries have weaponized Y. pestis and it is reported the Soviet Union developed a strain that is resistant to 16 antibiotics (Dennis, C. 2001. The bugs of war. Nature 411 :232-5). According to Dr. Kanatjan Alibekov, First Deputy Director of the Soviet Union's biological weapons program, the Soviet Union had a functional plague weapon and the capacity to make and store hundreds of tons of bacteria. A deliberate release of weaponized 7. pestis would probably occur via aerosol dissemination resulting in an outbreak of the highly lethal and contagious pneumonic plague.

Because antibiotic-resistant, weaponized Y. pestis exists, it is necessary to identify new therapeutic interventions that are not easily circumvented by deliberate genetic manipulation or natural genetic drift of the bacteria. Just as the Soviets developed antibiotic resistant strains of Y. pestis, individuals intent upon the deliberate dispersal of pathogenic organisms can circumvent virtually any anti- infective agent that targets the pathogen. However, Y. pestis, like most intracellular pathogens, hijacks the host cell's signaling events and trafficking machinery for establishment and maintenance of infection (Kahn, et al., 2002. Trends Biochem Sci 27:308-14). Because the virulence of intracellular pathogens requires a defined and complex set of host-cell signaling events, it would be much more difficult to create a weaponized strain that exploits a signaling pathway distinct from that which the wild type strain exploits. Thus, the host cell signaling events essential for establishing and maintaining infection provide attractive targets for novel anti-infective agents.

One such set of targets for new anti-infective agents is the signaling events involved in endosomal/phagosomal maturation. For intracellular pathogens to survive in the host cell they must disrupt or avoid the microbicidal machinery. This often involves inhibiting maturation of the endocytotic vesicles and fusion with the lysosomes (See for example, Hackstadt, T. 2000. Traffic 1:93-9 and Scott, et al., 2003. J Membr Biol 193:137-52). Thus, compounds that inhibit the host-cell's signaling events used by the pathogen to impede endosomal/phagosomal maturation would promote fusion of the endocytotic and lysosomal vesicles restoring microbicidal function to the host cell.

The Mitogen-activated Protein Kinase (MAPK) signaling pathway is one key pathway that transduces a large variety of external signals, leading to cellular responses that include growth, differentiation, inflammation and apoptosis. p90 Ribosomal S6 Kinase (RSK) is a serine/threonine kinase that is a downstream component of the Mitogen-activated Protein Kinase (MAPK) signaling pathway. As disclosed herein, RSK activity is involved in the maturation of the endocytotic vesicles. As disclosed herein, applicants have discovered that RSK activity can be inhibited as a means of preventing pathogen disruption of endosomal/phagosomal maturation.

There is a long felt need in the art for new methods and compositions useful for treating or inhibiting pathogenic infection. The present invention satisfies these needs.

SUMMARY

The present application discloses the unexpected result that regulation of RSK activity can impact the establishment and maintenance of an infection by a pathogen microorganism. Applicants have discovered that RSK activity is involved in endosomal/phagosomal maturation and that pathogens impede endosome/phagosome maturation through a mechanism that utilizes RSK activity. Therefore inhibiting the activity of RSK decreases the pathogen's ability to impede endosome/phagosome maturation and can improve the host organism's ability to resist and/or mitigate pathogen infection. More particularly, the present application discloses that an inhibitor of RSK activity protects the host-cell's cytoskeleton from pathogen- induced actin reorganization (Fig. 1), and furthermore that a RSK inhibitor reduces the viability of internalized Y. pseudotuberculosis (Fig 2) through an indirect mechanism.

In accordance with one embodiment, the present invention provides compositions and methods for inhibiting native RSK activity in the cells of a potential host organism as a means of interfering with the ability of a pathogen to avoid the microbicidal machinery of the host. As a result of the treatment with the RSK inhibitor, the infective capabilities of the pathogenic organism are reduced. Current anti-infective agents target the pathogen with antibiotics or anti-adhesion therapeutics. The class of anti-infective agents disclosed herein target the host cell signaling events required by the pathogen to establish and maintain infection. Thus, the present invention encompasses compositions and methods useful for providing protection by targeting the host rather than the pathogen. In one aspect, the host is a human.

Compounds that interfere with the ability of a pathogen to disrupt or avoid the microbicidal machinery of the host cell, particularly any compound that disrupts RSK activity are also encompassed within the scope of compounds suitable for use in the presently disclosed methods. In one embodiment, the class of RSK inhibitors useful for the practice of the invention encompasses compounds such as kaempferol 3-O-(3",4"-di-O-acetyl-α-L-rhamnopyranoside), referred to as SLOlOl, and analogs, derivatives, and modifications thereof (Xu et al., 2006, Biorg. Med. Chem., 14:3974-3977). Additional compounds that function to inhibit the activity of RSK are also suitable for use in the compositions and methods disclosed herein, including but not limited to, antibodies, oligonucleotides, antisense oligonucleotides, small interfering RNAs, protein synthesis inhibitors, and kinase inhibitors.

Although not wishing to be bound by any particular theory, the results disclosed herein suggest that by targeting RSK, a new class of anti-infective agents can provide broad-spectrum protection from numerous intracellular pathogens that impede endosomal/phagosomal maturation. See Table 1 for a list of exemplary pathogens and the pathology resulting from infection from the listed pathogens.

In one aspect, RSK inhibitory compounds are provided having the general structure of formula I:

The known compound kaempferol 3-O-(3",4"-di-O-acetyl-α-L- rhamnopyranoside), referred to as SLOlOl, comprises OH at the Rl position, and OAc at the R2 and R3 positions of formula I (Xu et al., 2006, Biorg. Med. Chem., 14:3974-3977).

In one embodiment, The RSK inhibitory compound is 3Ac-SLOlOl (kaempferol 3-0-(2",3",4"-tri-C>-acetyl-o«-L-rhamnopyranoside)), which has the structure:

OAc 3Ac-SLOlOl

Compositions and methods for preparing and purifying 3Ac-SLOlOl, and biologically active analogs and derivatives thereof are also disclosed herein.

In a further embodiment, the RSK inhibitory compound is kaempferol 3-O-(3", 4"-di-O-butyryl-α-L-rhamnopyranoside) (also referred to as Bu-SLOlOl herein). Bu-SLOlOl has the structure:

Bu-SLOlOl

Compositions and methods for synthesizing and purifying Bu-SLOlOl and biologically active analogs and derivatives thereof are also disclosed herein. The present invention further provides compositions and methods for administering to a subject in need thereof a pharmaceutical composition comprising an effective amount of Bu-SLOlOl, and biologically active analogs and derivatives. The present invention further encompasses the use of kits for administering at least one RSK inhibitory composition disclosed herein. Various aspects and embodiments of the invention are described in further detail below.

BRIEF DESCRIPTION OF THE DRAWINGS Figs 1 A-IE represent photomicrographic images demonstrating that inhibition of RSK activity with SLOlOl interferes with the ability of Yersinia pseudotuberculosis to induce actin reorganization. Primary murine peritoneal macrophages were incubated with 60 μM SLOlOl or vehicle for 4 hours. The treated cells were infected with Y. pseudotuberculosis (MOI = 100) for 2 hours prior to fixation of the cells. Visualization of actin was achieved with phalloidin staining (Figs IA and IB). Hoechst stain was used to visualize the macrophage nucleus as well as the bacteria (Figs 1C and ID). (IA)- Four images demonstrating that Y. pseudotuberculosis infection results in actin accumulation in vehicle-treated cells (Fig. IA) whereas SLOlOl treatment protects the actin cytoskeleton from infection- induced reorganization (Fig. IB). (Fig. IE) represents a photomicrographic image of an infected, vehicle-treated cell taken at a low exposure showing the actin accumulation is a series of thick actin rings enveloping the endosomal vesicles.

Figs 2A & 2B graphically illustrate the results of experiments demonstrating that inhibition of RSK activity results in reduced viability of internalized Y. pseudotuberculosis. Fig. 2A presents data from J774A.1 cells (murine macrophage cell line, ATCC number TIB-67) and primary murine peritoneal macrophages incubated with 60 μM SLOlOl or vehicle for 4 hours prior to infection with Yersinia pseudotuberculosis (MOI = 25). Following a 60 minute incubation, bacteria not attached to the macrophages were removed by washing with fresh growth medium. Twenty-three hours after removal of the excess bacteria, the cells were washed with fresh growth medium and lysed in a hypotonic buffer. The lysate was used to inoculate bacterial cultures. The bacteria were cultured on solid LB agar or in liquid LB medium, and the data presented in Fig. 2A is based on the results using solid LB agar as the media. Fewer viable bacteria are isolated from SLOlO 1 -treated cells than that isolated from vehicle-treated cells. Fig. 2B represents the results of culturing Y. pseudotuberculosis in liquid LB medium in the presence of vehicle or 60 μM SLOlOl . The rate of Y. pseudotuberculosis growth in the presence of SLOlOl was identical to that in the presence of vehicle. Thus, SLOlOl does not directly alter the growth of Y. pseudotuberculosis.

DETAILED DESCRIPTION

ABBREVIATIONS AND ACRONYMS- br- broad

CTKD- C-terminal kinase domain CREB- cyclic adenosine monophosphate response element binding protein d- doublet dd- doublet of doublets

DTT- dithiothreitol eEF2- eukaryotic elongation factor 2

EF2K- EF2 kinase

GST- Glutathione-S-transferase

MAPK- mitogen-activated protein kinase m- multiplet NTKD- N-terminal kinase domain

PDB - phorbol dibutyrate

PKA- protein kinase A

PKC- protein kinase C q- quartet RSK- a 90 kDa ribosomal S6 kinase, also referred to as p90Rsk herein s- singlet t- triplet

DEFINITIONS In describing and claiming the invention, the following terminology will be used in accordance with the definitions set forth below. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. A "bioactive polypeptide" refers to polypeptides which are capable of exerting a biological effect in vitro and/or in vivo.

As used herein, an antimicrobial is a substance that kills, or inhibits the growth or the ability of a microbe (such as bacteria, fungi, or viruses) to infect or maintain an infection in its host cell/organism. As used herein, the term "pharmaceutically acceptable carrier" includes any of the standard pharmaceutical carriers, such as a phosphate buffered saline solution, water, emulsions such as an oil/water or water/oil emulsion, and various types of wetting agents. The term also encompasses any of the agents approved by a regulatory agency of the US Federal government or listed in the US Pharmacopeia for use in animals, including humans.

As used herein the term "pharmaceutically acceptable salt" refers to salts of compounds that retain the biological activity of the parent compound, and which are not biologically or otherwise undesirable. Many of the compounds disclosed herein are capable of forming acid and/or base salts by virtue of the presence of amino and/or carboxyl groups or groups similar thereto.

As used herein, the term "treating" includes prophylaxis of the specific disorder or condition, or alleviation of the symptoms associated with a specific disorder or condition and/or preventing or eliminating said symptoms. For example, as used herein the term "treating an infection" will refer in general to decreasing the number of infectious agents present in a tissue or cell relative to a pretreatment status or relative to an untreated control infected with the relevant pathogen.

As used herein an "effective" amount or a "therapeutically effective amount" of a prodrug refers to a nontoxic but sufficient amount of a bioactive agent to provide the desired effect. For example, an effective amount of an RSK inhibitor is an amount of the inhibitor sufficient to, inter alia, suppress RSK activity as indicated in a serine/threonine kinase assay. The term "effective amount" is used interchangeably with "effective concentration" herein. The amount that is "effective" will vary from subject to subject, depending on the age and general condition of the individual, mode of administration, and the like. Thus, it is not always possible to specify an exact "effective amount." However, an appropriate "effective" amount in any individual case may be determined by one of ordinary skill in the art using routine experimentation. The term, "parenteral" means not through the alimentary canal but by some other route such as subcutaneous, intramuscular, intraspinal, or intravenous.

The term "about," as used herein, means approximately, in the region of, roughly, or around. When the term "about" is used in conjunction with a numerical range, it modifies that range by extending the boundaries above and below the numerical values set forth. For example, in one aspect, the term "about" is used herein to modify a numerical value above and below the stated value by a variance of 20%. As used herein, the term "affected cell" refers to a cell of a subject afflicted with a disease or disorder, which affected cell has an altered phenotype relative to a subject not afflicted with a disease or disorder.

Cells or tissue are "affected" by a disease or disorder if the cells or tissue have an altered phenotype relative to the same cells or tissue in a subject not afflicted with a disease or disorder.

As used herein, an "agonist" is a composition of matter which, when administered to a mammal such as a human, enhances or extends a biological activity attributable to the level or presence of a target compound or molecule of interest in the mammal.

An "antagonist" is a composition of matter which when administered to a mammal such as a human, inhibits a biological activity attributable to the level or presence of a compound or molecule of interest in the mammal.

A disease or disorder is "alleviated" if the severity of a symptom of the disease or disorder, the frequency with which such a symptom is experienced by a patient, or both, are reduced.

As used herein, "amino acids" are represented by the full name thereof, by the three letter code corresponding thereto, or by the one-letter code corresponding thereto, as indicated in the following table:

Full Name Three-Letter Code One-Letter Code

Aspartic Acid Asp D

Glutamic Acid GIu E

Lysine Lys K

Arginine Arg R

Histidine His H

Tyrosine Tyr Y

Cysteine Cys C

Asparagine Asn N

Glutamine GIn Q

Serine Ser S

Threonine Thr T

Glycine GIy G

Alanine Ala A Valine VaI V

Leucine Leu L

Isoleucine He I

Methionine Met M

Proline Pro P

Phenylalanine Phe F

Tryptophan Trp W

The expression "amino acid" as used herein is meant to include compounds having the following general structure:

H R C COOH

NH₂ wherein R represents hydrogen or a hydrocarbon side chain, and includes both natural and synthetic amino acids, and both D and L amino acids. "Standard amino acid" means any of the twenty standard L-amino acids commonly found in naturally occurring peptides. "Nonstandard amino acid residue" means any amino acid, other than the standard amino acids, regardless of whether it is prepared synthetically or derived from a natural source. As used herein, "synthetic amino acid" also encompasses chemically modified amino acids, including but not limited to salts, amino acid derivatives (such as amides), and substitutions. Amino acids contained within the peptides of the present invention, and particularly at the carboxy- or amino- terminus, can be modified by methylation, amidation, acetylation or substitution with other chemical groups which can change the peptide's circulating half-life without adversely affecting their activity. Additionally, a disulfide linkage may be present or absent in the peptides of the invention.

The term "amino acid" is used interchangeably with "amino acid residue," and may refer to a free amino acid and to an amino acid residue of a peptide. It will be apparent from the context in which the term is used whether it refers to a free amino acid or a residue of a peptide. As used herein, an "analog" of a chemical compound is a compound that, by way of example, resembles another in structure but is not necessarily an isomer (e.g., 5-fluorouracil is an analog of thymine).

The term "biological sample," as used herein, refers to samples obtained from a subject, including, but not limited to, skin, hair, tissue, blood, plasma, cells, sweat and urine.

As used herein, a "derivative" of a compound refers to a chemical compound that may be produced from another compound of similar structure in one or more steps, including for example, the replacement of hydrogen by an alkyl, acyl, or amino group.

The use of the word "detect" and its grammatical variants is meant to refer to measurement of the species without quantification, whereas use of the word "determine" or "measure" with their grammatical variants are meant to refer to measurement of the species with quantification. The terms "detect" and "identify" are used interchangeably herein.

As used herein, a "detectable marker" or a "reporter molecule" is an atom or a molecule that permits the specific detection of a compound comprising the marker in the presence of similar compounds without a marker. Detectable markers or reporter molecules include, e.g., radioactive isotopes, antigenic determinants, enzymes, nucleic acids available for hybridization, chromophores, fluorophores, chemiluminescent molecules, electrochemically detectable molecules, and molecules that provide for altered fluorescence-polarization or altered light-scattering.

A "disease" is a state of health of an animal wherein the animal cannot maintain homeostasis, and wherein if the disease is not ameliorated then the animal's health continues to deteriorate.

In contrast, a "disorder" in an animal is a state of health in which the animal is able to maintain homeostasis, but in which the animal's state of health is less favorable than it would be in the absence of the disorder. Left untreated, a disorder does not necessarily cause a further decrease in the animal's state of health. The term "excessive RSK activity", as used herein, refers to an increase in RSK activity in a cell with a disease or disorder, relative to the amount of such RSK activity in an otherwise identical normal cell. As used herein, the term "flavonoid" refers to polyphenols compounds possessing a carbon skeleton having the general structure:

The terms "formula" and "structure" are used interchangeably herein.

As used herein, a "functional" molecule is a molecule in a form in which it exhibits a property by which it is characterized. By way of example, a functional enzyme is one which exhibits the characteristic catalytic activity by which the enzyme is characterized. Any reference to a compound having a "greater uptake" into a cell relative to another compound (e.g., SLOlOl) is intended to portray that a higher concentration of the first compound relative to the second will be present in otherwise identical cells that are exposed to the respective compounds for the same length of time. Accordingly, the first compound either has the ability to enter a cell at a greater rate than the second compound or that the first compound has lower rate of degradation or a lower rate of efflux from the cell relative to the second compound.

The term "inhibit," as used herein, refers to the ability of a compound of the invention to reduce or impede a described function. In one embodiment, inhibition is at least 10%, at least 25%, at least 50%, at least 75% of the activity obtained in the absence of the inhibiting agent.

The phrase "inhibit infection", as used herein, refers to both direct and indirect inhibition of infection, regardless of the mechanism.

The term "inhibit a protein", as used herein, refers to any method or technique which inhibits protein synthesis, levels, activity, or function, as well as methods of inhibiting the induction or stimulation of synthesis, levels, activity, or function of the protein of interest. The term also refers to any metabolic or regulatory pathway which can regulate the synthesis, levels, activity, or function of the protein of interest. The term includes binding with other molecules and complex formation. Therefore, the term "protein inhibitor" refers to any agent or compound, the application of which results in the inhibition of protein function or protein pathway function. However, the term does not imply that each and every one of these functions must be inhibited at the same time. As used herein, "inhibiting RSK" refers to the use of any compound, agent, or mechanism to inhibit RSK synthesis, levels, activity, or function are reduced or inhibited as described above.

As used herein, an "instructional material" includes a publication, a recording, a diagram, or any other medium of expression which can be used to communicate the usefulness of the peptide of the invention in the kit for effecting alleviation of the various diseases or disorders recited herein. Optionally, or alternately, the instructional material may describe one or more methods of alleviating the diseases or disorders in a cell or a tissue of a mammal. As used herein, "modification" of a compound refers to a compound that's structure or composition has been somewhat changed from the original compound.

As used herein, "pharmaceutical compositions" includes formulations for human and veterinary use. The term "protein regulatory pathway", as used herein, refers to both the upstream regulatory pathway which regulates a protein, as well as the downstream events which that protein regulates. Such regulation includes, but is not limited to, transcription, translation, levels, activity, posttranslational modification, and function of the protein of interest, as well as the downstream events which the protein regulates.

The terms "protein pathway" and "protein regulatory pathway" are used interchangeably herein.

As used herein, the term "purified" and the like terms relate to the isolation of a molecule or compound in a form that is substantially free (at least 60% free, 75% free, or 90% free) from other components normally associated with the molecule or compound in a native environment.

The term "regulate" refers to either stimulating or inhibiting a function or activity of interest.

As used herein, the use of the term "RSK" is intended to refer generically to all the human RSK isotypes, including RSKl , RSK2, RSK3, and RSK4. RSKl, RSK2, RSK3, and RSK4 are specific human isotypes that have previously been described in the literature. The term "RSK activity", as used herein, includes synthesis, levels, activity, or function of RSK.

As used herein, the term "RSK inhibitor" includes any compound or condition that specifically inhibits or reduces the kinase activity of RSK or which inhibits any function of RSK. Such inhibitory effects may result from directly, or indirectly, interfering with the protein's ability to phosphorylate its substrate, or may result from inhibiting the expression (transcription and/or translation) of RSK.

The term "standard," as used herein, refers to something used for comparison. For example, it can be a known standard agent or compound which is administered and used for comparing results when administering a test compound, or it can be a standard parameter or function which is measured to obtain a control value when measuring an effect of an agent or compound on a parameter or function. Standard can also refer to an "internal standard", such as an agent or compound which is added at known amounts to a sample and is useful in determining such things as purification or recovery rates when a sample is processed or subjected to purification or extraction procedures before a marker of interest is measured. Internal standards are often a purified marker of interest which has been labeled, such as with a radioactive isotope, allowing it to be distinguished from an endogenous marker.

A "subject" of analysis, diagnosis, or treatment is an animal. Such animals include mammals, preferably a human. The term "host" and "subject" are used interchangeably herein.

As used herein the term "patient" without further designation is intended to encompass any warm blooded vertebrate domesticated animal (including for example, but not limited to livestock, horses, cats, dogs and other pets) and humans.

A "prophylactic" treatment is a treatment administered to a subject, who either does not exhibit signs of a disease or exhibits only early signs of the disease, for the purpose of decreasing the risk of developing pathology associated with the disease. The general chemical terms used in the description of the compounds of the present invention have their usual meanings. For example, the term "alkyl" by itself or as part of another substituent means a straight or branched aliphatic chain having the stated number of carbon atoms. The term "Ci-C_n alkyl" wherein n can be from 1 through 6, as used herein, represents a branched or linear alkyl group having from one to the specified number of carbon atoms. Typical Ci-C₆ alkyl groups include, but are not limited to, methyl, ethyl, n-propyl, iso-propyl, butyl, iso-butyl, sec-butyl, tert-butyl, pentyl, hexyl and the like.

The terms "C₂-C_n alkenyl" wherein n can be from 2 through 6, as used herein, represents an olefϊnically unsaturated branched or linear group having from 2 to the specified number of carbon atoms and at least one double bond. Examples of such groups include, but are not limited to, 1-propenyl, 2-propenyl (-CH₂-CH=CH₂), 1 ,3-butadienyl, (-CH=CHCH=CH₂), 1 -butenyl (-CH=CHCH₂CH₃), hexenyl, pentenyl, and the like.

The term "C₂-C_n alkynyl" wherein n can be from 2 to 6, refers to an unsaturated branched or linear group having from 2 to n carbon atoms and at least one triple bond. Examples of such groups include, but are not limited to, 1-propynyl, 2- propynyl, 1-butynyl, 2-butynyl, 1-pentynyl, and the like.

As used herein the term "aryl" refers to a mono- or bicyclic carbocyclic ring system having one or two aromatic rings including, but not limited to, phenyl, naphthyl, tetrahydronaphthyl, indanyl, indenyl, and the like. The size of the aryl ring and the presence of substituents or linking groups are indicated by designating the number of carbons present. For example, the term "(Ci-C₃ alkyl)(C₆-Cio aryl)" refers to a 5 to 10 membered aryl that is attached to a parent moiety via a one to three membered alkyl chain.

The term "heteroaryl" as used herein refers to a mono- or bi- cyclic ring system containing one or two aromatic rings and containing at least one nitrogen, oxygen, or sulfur atom in an aromatic ring. The size of the heteroaryl ring and the presence of substituents or linking groups are indicated by designating the number of carbons present. For example, the term "(Ci-C_n alkyl)(C₅-C₆ heteroaryl)" refers to a 5 or 6 membered heteroaryl that is attached to a parent moiety via a one to "n" membered alkyl chain. The term "acyl" refers to alkylcarbonyl species and includes any group or radical of the form RCO- where R is an organic group. The term "acyl" further comprises an organic radical derived from an organic acid by removal of the hydroxyl group from the carboxyl group. The terms "acyl" and "OAc" are used interchangeably herein. The term "acylation" refers to the process of adding an acyl group to a compound.

The term butyryl as used herein encompasses its usual meaning in the art. The term "halo" includes bromo, chloro, fluoro, and iodo.

The term "haloalkyl" as used herein refers to a alkyl radical bearing at least one halogen substituent, for example, chloromethyl, fluoroethyl or trifluoromethyl and the like.

The term "C₃-Cn cycloalkyl" wherein n = 3-8, represents the compounds cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl.

The term "heterocyclic group" refers to a C₃-C₈ cycloalkyl group containing from one to three heteroatoms wherein the heteroatoms are selected from the group consisting of oxygen, sulfur, and nitrogen. The term "bicyclic" represents either an unsaturated or saturated stable

7- to 12-membered bridged or fused bicyclic carbon ring. The bicyclic ring may be attached at any carbon atom which affords a stable structure. The term includes, but is not limited to, naphthyl, dicyclohexyl, dicyclohexenyl, and the like.

The term "lower alkyl" as used herein refers to branched or straight chain alkyl groups comprising one to eight carbon atoms, including methyl, ethyl, propyl, isopropyl, n-butyl, t-butyl, neopentyl and the like.

The term "heteroatom" means for example oxygen, sulfur, nitrogen, phosphorus, or silicon (including, any oxidized form of nitrogen, sulfur, phosphorus, or silicon; the quaternized form of any basic nitrogen or; a substitutable nitrogen of a heterocyclic ring.

The compounds of the present invention can contain one or more asymmetric centers in the molecule. In accordance with the present invention any structure that does not designate the stereochemistry is to be understood as embracing all the various optical isomers, as well as racemic mixtures thereof. The present invention includes within its scope all such isomers and mixtures thereof.

The compounds of the present invention may exist in tautomeric forms and the invention includes both mixtures and separate individual tautomers. For example, the following structure:

is understood to represent a mixture of the structures:

EMBODIMENTS

Certain pathogens have developed a mechanism to impede cellular endosome/phagosome maturation as a means of circumventing a host's cells ability to destroy and remove the pathogen from the cell. Applicants have discovered that RSK activity is involved in endosomal/phagosomal maturation and that that pathogenic inhibition of endosome/phagosome maturation requires RSK activity. Accordingly, inhibition of RSK activity as detailed herein has been found to decrease the pathogen's ability to impede endosome/phagosome maturation and can improve the host organism's ability to resist and/or mitigate pathogen infections. One aspect of the present disclosure encompasses the use of agents, which specifically inhibit RSK activity, as novel anti-infective agents. More particularly, in one embodiment a composition and method for inhibiting the ability of intracellular pathogens to initiate or maintain an infection is provided, wherein the targeted pathogen has the capacity to impede endosomal/phagosomal maturation. The method comprises administering an anti-infective pharmaceutical composition that comprises an inhibitor of RSK activity and a pharmaceutically acceptable carrier. In one embodiment the RSK inhibitor is selected from the group consisting of an anti- sense oligonucleotide, an interfering oligonucleotide, an antibody, or a flavonoid-like compound. In one embodiment the RSK inhibiting flavonoid-like compound comprises a compound having the structure of formula II:

wherein Ri, R_2, and R₅ are independently selected from the group consisting of OH, OCOR₈, COR₈, SR₈, and Ci-C₄ alkoxy;

R₃, R₄, R₆₁ R₇ are independently selected from the group consisting of H, OH, OCOR₈, COR₈₁ SR₈, and Ci-C₄ alkoxy;

R₈ is H or Ci-C₄ alkyl; and

R9, Rio and Rn are independently selected from the group consisting of H, OH,

OCOR₈, COR₈, NHOCOR₈ and Ci-C₄ alkoxy, with the proviso that when R₁, R_2, and R₅ are each OH, one of R₉, Rio and Ri ₁ are not OH. In accordance with one embodiment at least one of Ri , R₂, and R5 is SR₈ or alternatively at least one of R₉, Rio and Ri ₁ is NHOCOR₈. In accordance with one embodiment, Ri and R₂ are both OH. In a further embodiment a compound of Formula II is provided wherein R] and R₂ are both OH, R₉, Rio and Rn are independently selected from the group consisting of H, OH and OCOR₈, R₃ and R₇ are each H, and R₄, R₅, and R₆ are independently selected from the group consisting of H, OR₈, OCOR₈, and COR₈, wherein R₈ is H or methyl, with the proviso that R₉, Rio and Ri ₁ are not each OH. In one embodiment Rj , R? and Rs are OH, R₉ and Rio are independently selected from the group consisting of OH, COR₈, Ci-C₄ alkoxy and OCOCH₃, Ri ₁ is OCOCH₃, R₈ is H or methyl, R₃, R₄ and R₇ are each H and R₆ is H or OH. In an alternative embodiment Ri, R₂ and R₅ are each OH, R₉ and Rio are independently selected from the group consisting of OH and OCOCH₃, Ri ₁ is OCOCH₃, R₃, R₄ and R₇ are each H and R₆ is H or hydroxy. In an alternative embodiment a compound is provided having the general structure of Formula II as disclosed above, but having one or more sulfhydryls (-SH) groups substituting at positions on the flavonoid ring that designate a hydroxyl group (i.e., at positions Ri, R_2, R₃, R_4, R₅, R_O and R₇ ). In one embodiment a compound is provided having the general structure of Formula II as disclosed above, wherein one or more sulfhydryls (-SH) groups are present at positions selected from the group consisting of Ri, R₂ and R₅. In a further alternative embodiment a compound is provided having the general structure of Formula II as disclosed above, but having one or more acetamide (NHOCCH₃) groups substituting at positions on the sugar moiety that designate a hydroxyl group (i.e., at positions R₉, Rio and Rn). In one embodiment the acetamide can be a substituted acetamide comprising NHOCOR₈. In one aspect, the compounds encompassed by formula II have greater stability in their interaction with RSK than does SLOlOl in its interaction with RSK. In another aspect, the compounds of formula II have a greater ability to inhibit RSK than does SLOlOl.

In one embodiment the present invention is directed to a compound represented by the general structure:

Rn wherein Rs is H or OH, and R9, Rio and Ri ₁ are independently selected from the group consisting of hydroxy OCOR₈, COR₈, Ci -C₄ alkoxy, and R₈ is H or CH₃, with the proviso that R₉, Rio and Ri ₁ are not all hydroxy. In one embodiment R₆ is H or OH and R9 and Rj ₀ are independently selected from the group consisting of hydroxy and OCOCH₃ and Rn is OCOCH₃. In accordance with one embodiment the RSK inhibitor is SLOlOl . SLOlOl is a kaempferol related compound, wherein kaempferol has the structure:

Kaempferol while SLOlOl has the structure:

wherein R₉ is OH and Rio and Rn are each OAc. Two of the lead compounds of the present invention, 3Ac-SLOlOl and Bu-SLOlOl, have been modified, relative to SLO 101 , on the rhamnose moiety of SLO 101. However, the methods disclosed herein also encompass additional derivative compounds representing modification of the kaempferol structure wherein said compound retains its ability to inhibit RSK activity and interfere with a pathogens ability to maintain an intracellular presence. Therefore, in one embodiment, RSK inhibitor compounds representing derivatives of formula I are provided, wherein R^ Rio and Ri ₁ are independently selected from OH, OAc and butyryl as well as further modifications of such compounds wherein the modifications do not adversely affect the desired activity described herein.

For example, additional compounds are encompassed by the present disclosure wherein the compounds have been modified to include greater stability of interactions between the compound and RSK and thus provide compounds having a greater efficacy than SLOlOl. In one aspect, this is accomplished by replacing the hydroxyl groups of the compound of Formula III with sulfhydryls. In another aspect, this is accomplished by replacing the hydroxyl groups of the sugar moiety of the compound of Formula III with acetamide, or derivatives of acetamide. To that end, the present invention further provides a compound having the structure of formula II:

wherein Ri, R_2j R₃, R_4, R₅, R_6, and R₇ are independently selected from the group consisting of OH, -OCOR₈, -COR_8, -SR_8, and Ci-C₄ alkoxy; R₈ is H or C]-C₄ alkyl; and

R₉, Rio and Rn are independently selected from the group consisting of H, OH,

OCOR₈, COR₈, NHOCOR₈, NHOCR₈ and Ci-C₄ alkoxy. The compounds of formula II may also include acyl and butyryl groups as described for the compounds of formula I.

The compounds comprised by formula II encompass replacing the hydroxyl groups of the flavonoid with sulfhydryls (-SH).

The compounds comprised by formula II further encompass replacing the hydroxyl groups on the sugar with an acetamide (NHOCR₈), including for example:

In cases where compounds are sufficiently basic or acidic to form acid or base salts, use of the compounds as salts may be appropriate. Examples of acceptable salts are organic acid addition salts formed with acids which form a physiological acceptable anion, for example, tosylate, methanesulfonate, acetate, citrate, malonate, tartarate, succinate, benzoate, ascorbate, α-ketoglutarate, and a- glycerophosphate. Suitable inorganic salts may also be formed, including hydrochloride, sulfate, nitrate, bicarbonate, and carbonate salts. Pharmaceutically acceptable salts may be obtained using standard procedures well known in the art, for example by reacting a sufficiently basic compound such as an amine with a suitable acid affording a physiologically acceptable anion. Alkali metal (for example, sodium, potassium or lithium) or alkaline earth metal (for example calcium) salts of carboxylic acids can also be made. The RSK inhibitory compounds can be formulated into pharmaceutical compositions by combining them with an appropriate pharmaceutically acceptable carrier using standard techniques known to those skilled in the art. The compositions may further comprise additional anti-microbial and antibacterial components. Antimicrobial agents suitable for use in accordance with the present invention are known to those skilled in the art and include antibiotics, both natural and synthetic derivatives as well as other compounds known to have anti-microbial activity (see for example US Patent no: 7,358,359, the disclosure of which is incorporated herein by reference). In accordance with one embodiment a pharmaceutically acceptable antimicrobial agent is combined with a RSK inhibitor to treat an established infection by an intercellular pathogen or to treat a patient prophylactically to prevent the establishment of an infection by an intercellular pathogen. The combination therapy can be administered simultaneously by administering a single composition comprising a known anti-microbial agent and a RSK inhibitor or the anti-microbial agent can be administered prior to or after the administration of the RSK inhibitor. Typically the antimicrobial agent is administered within 24 hours before or after the administration of the RSK inhibitor and in one embodiment the two agents are each administered within 12 hours, 8 hours, 4 hours, 2 hours or 1 hour of each other.

Processes for preparing compounds of formula I and formula II are provided as further embodiments of the invention and are illustrated by the following procedures in which the meanings of the generic radicals are as given above unless otherwise qualified.

The compounds of formula I and formula II can be formulated as pharmaceutical compositions and administered to a mammalian host such as a human patient in a variety of forms adapted to the chosen route of administration, i.e., orally or parenterally, by intravenous, intramuscular, topical or subcutaneous routes.

Thus, the present compounds may be systemically administered, e.g., orally, in combination with a pharmaceutically acceptable vehicle such as an inert diluent or an assimilable edible carrier. They may be enclosed in hard or soft shell gelatin capsules, may be compressed into tablets, or may be incorporated directly with the food of the patient's diet. For oral therapeutic administration, the active compound may be combined with one or more excipients and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, and the like. Such compositions and preparations should contain at least 0.1% of active compound. The percentage of the compositions and preparations may, of course, be varied and may conveniently be between about 2 to about 60% of the weight of a given unit dosage form. The amount of active compound in such therapeutically useful compositions is such that an effective dosage level will be obtained.

The tablets, troches, pills, capsules, and the like may also contain the following: binders such as gum tragacanth, acacia, corn starch or gelatin; excipients such as dicalcium phosphate; a disintegrating agent such as corn starch, potato starch, alginic acid and the like; a lubricant such as magnesium stearate; and a sweetening agent such as sucrose, fructose, lactose or aspartame or a flavoring agent such as peppermint, oil of wintergreen, or cherry flavoring may be added. When the unit dosage form is a capsule, it may contain, in addition to materials of the above type, a liquid carrier, such as a vegetable oil or a polyethylene glycol. Various other materials may be present as coatings or to otherwise modify the physical form of the solid unit dosage form. For instance, tablets, pills, or capsules may be coated with gelatin, wax, shellac or sugar and the like. A syrup or elixir may contain the active compound, sucrose or fructose as a sweetening agent, methyl and propylparabens as preservatives, a dye and flavoring such as cherry or orange flavor. Of course, any material used in preparing any unit dosage form should be pharmaceutically acceptable and substantially non-toxic in the amounts employed. In addition, the active compound may be incorporated into sustained-release preparations and devices.

The active compound may also be administered intravenously or intraperitoneally by infusion or injection. Solutions of the active compound or its salts can be prepared in water, optionally mixed with a nontoxic surfactant. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, triacetin, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.

The pharmaceutical dosage forms suitable for injection or infusion can include sterile aqueous solutions or dispersions or sterile powders comprising the active ingredient which are adapted for the extemporaneous preparation of sterile injectable or infusible solutions or dispersions, optionally encapsulated in liposomes. In all cases, the ultimate dosage form should be sterile, fluid and stable under the conditions of manufacture and storage. The liquid carrier or vehicle can be a solvent or liquid dispersion medium comprising, for example, water, ethanol, a polyol (for example, glycerol, propylene glycol, liquid polyethylene glycols, and the like), vegetable oils, nontoxic glyceryl esters, and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the formation of liposomes, by the maintenance of the required particle size in the case of dispersions or by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, buffers or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.

Sterile injectable solutions are prepared by incorporating the active compound in the required amount in the appropriate solvent with various of the other ingredients enumerated above, as required, followed by filter sterilization. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and the freeze drying techniques, which yield a powder of the active ingredient plus any additional desired ingredient present in the previously sterile-filtered solutions. For topical administration, the present compounds may be applied in pure form, i.e., when they are liquids. However, it will generally be desirable to administer them to the skin as compositions or formulations, in combination with a dermatologically acceptable carrier, which may be a solid or a liquid.

Useful solid carriers include finely divided solids such as talc, clay, microcrystalline cellulose, silica, alumina and the like. Useful liquid carriers include water, alcohols or glycols or water-alcohol/glycol blends, in which the present compounds can be dissolved or dispersed at effective levels, optionally with the aid of non-toxic surfactants. Adjuvants such as fragrances and additional antimicrobial agents can be added to optimize the properties for a given use. The resultant liquid compositions can be applied from absorbent pads, used to impregnate bandages and other dressings, or sprayed onto the affected area using pump-type or aerosol sprayers.

Thickeners such as synthetic polymers, fatty acids, fatty acid salts and esters, fatty alcohols, modified celluloses or modified mineral materials can also be employed with liquid carriers to form spreadable pastes, gels, ointments, soaps, and the like, for application directly to the skin of the user.

Examples of useful dermato logical compositions which can be used to deliver the compounds of formula I to the skin are known to the art; for example, see Jacquet et al. (U.S. Pat. No. 4,608,392), Geria (U.S. Pat. No. 4,992,478), Smith et al. (U.S. Pat. No. 4,559,157) and Wortzman (U.S. Pat. No. 4,820,508).

Useful dosages of the compounds of formulas I and II can be determined by comparing their in vitro activity, and in vivo activity in animal models. Methods for the extrapolation of effective dosages in mice, and other animals, to humans are known to the art; for example, see U.S. Pat. No. 4,938,949. Generally, the concentration of the compound(s) of formulas I or II in a liquid composition, such as a lotion, will be from about 0.1-25 wt-%, preferably from about 0.5-10 wt-%. The concentration in a semi-solid or solid composition such as a gel or a powder will be about 0.1-5 wt-%, preferably about 0.5-2.5 wt-%. The amount of the compound, or an active salt or derivative thereof, required for use in treatment will vary not only with the particular salt selected but also with the route of administration, the nature of the condition being treated and the age and condition of the patient and will be ultimately at the discretion of the attendant physician or clinician.

In general, however, a suitable dose will be in the range of from about 0.5 to about 100 mg/kg, e.g., from about 10 to about 75 mg/kg of body weight per day, such as 3 to about 50 mg per kilogram body weight of the recipient per day, preferably in the range of 6 to 90 mg/kg/day, most preferably in the range of 15 to 60 mg/kg/day.

The compound is conveniently administered in unit dosage form; for example, containing 5 to 1000 mg, conveniently 10 to 750 mg, most conveniently, 50 to 500 mg of active ingredient per unit dosage form.

Ideally, the active ingredient should be administered to achieve peak plasma concentrations of the active compound of from about 0.5 to about 75 μM, preferably, about 1 to 50 μM, most preferably, about 2 to about 30 μM. This may be achieved, for example, by the intravenous injection of a 0.05 to 5% solution of the active ingredient, optionally in saline, or orally administered as a bolus containing about 1-100 mg of the active ingredient. Desirable blood levels may be maintained by continuous infusion to provide about 0.01-5.0 mg/kg/hr or by intermittent infusions containing about 0.4-15 mg/kg of the active ingredient(s).

The desired dose may conveniently be presented in a single dose or as divided doses administered at appropriate intervals, for example, as two, three, four or more sub-doses per day. The sub-dose itself may be further divided, e.g., into a number of discrete loosely spaced administrations; such as multiple inhalations from an insufflator or by application of a plurality of drops into the eye.

As used herein, an "instructional material" includes a publication, a recording, a diagram, or any other medium of expression which can be used to communicate the usefulness of the composition of the invention for its designated use. The instructional material of the kit of the invention may, for example, be affixed to a container which contains the composition or be shipped together with a container which contains the composition. Alternatively, the instructional material may be shipped separately from the container with the intention that the instructional material and the composition be used cooperatively by the recipient.

The method of the invention includes a kit comprising an inhibitor identified in the invention and an instructional material which describes administering the inhibitor or a composition comprising the inhibitor to a cell or a subject. This should be construed to include other embodiments of kits that are known to those skilled in the art, such as a kit comprising a (preferably sterile) solvent suitable for dissolving or suspending the composition of the invention prior to administering the compound to a cell or a subject. Preferably the subject is a human. In accordance with the present invention, as described above or as discussed in the Examples below, there can be employed conventional chemical, cellular, histochemical, biochemical, molecular biology, microbiology, and in vivo techniques which are known to those of skill in the art. Such techniques are explained fully in the literature. Without further description, it is believed that one of ordinary skill in the art can, using the preceding description and the following illustrative examples, make and utilize the compounds of the present invention. Therefore, the examples should be construed to encompass any and all variations which become evident as a result of the teaching provided herein.

EXAMPLE l Inhibition of Cell Proliferation by RSK inhibitors

To determine whether SLOlOl-I inhibits RSK in intact cells, phosphorylation of pi 40, a RSK substrate of unknown function, was examined in a human breast cancer cell line, MCF-7. MCF-7 and MCF-IOA cells were pre- incubated with vehicle, 50 μM UO 126 or with SLOlOl-I for 3 hr. Cells were treated with 500 nM PDB for 30 min prior to lysis. Protein concentration of lysates was measured and lysates were electrophoresed, transferred and immunoblotted. Equal loading of lysate was demonstrated by anti-Ran immunoblot. Pre-incubation of cells with 100 μM SLOlOl-I abrogates phorbol dibutyrate (PDB)-induced pl40 phosphorylation as does 50 μM UO 126, a MEK inhibitor. SLOlOl-I does not effect the phosphorylation of Rsk2, or the activation of MAPK. Therefore, SLOlOl-I does not inhibit upstream kinases necessary for PDB-stimulated RSK phosphorylation, namely MAPK, MEK, Raf and PKC. These data indicate that SLOlOl-I is an effective and specific RSK inhibitor in intact cells.

The effect of SLOlOl-I on proliferation of Ha-Ras transformed NIH/3T3 cells and the parental cell line was determined. SLOlOl-I decreased the growth rate of the transformed cells but had little effect on proliferation of the parental line. SLOlOl-I produced striking morphology changes in the transformed cells but not in the parental cell line. The vehicle control treated Ha-Ras transformed cells were elongated whereas in response to SLOlOl-I the cells became much larger and flatter, appearing more like the parental cells, or like Ha-Ras transformed cells treated with UO 126. Removal of SLOlOl-I resulted in growth of the transformed cells and a reversion to their elongated phenotype. These results demonstrate that SLOlOl-I can penetrate intact cells, but is not toxic and preferentially inhibits the growth of oncogene-transformed cells compared to the parental cells.

Whether or not SLOlOl-I could inhibit the growth rate of MCF-7 cells, was also investigated. Remarkably, SLOlOl-I inhibited proliferation of MCF-7 cells but had no effect on the growth of the normal breast cell line, MCF-IOA, even though SLOlOl-I prevented the PDB-induced pi 40 phosphorylation in MCF-IOA cells. Furthermore, SLOlOl-I inhibits the growth rate of MCF-7 cells at an efficacy that parallels its ability to suppress RSK activity in vivo. Reduction of Rskl and Rsk2 levels was also accomplished using short, interfering RNAs (siRNA). Specifically, duplex siRNAs to a sequence in the bluescript plasmid (Control) or to Rskl and Rsk2 were transfected into MCF-7 cells. The sense strand for Rskl has the sequence AAGAAGCUGGACUUCAGCCGU (SEQ ID NO: 3), whereas the sense strand for Rskl has the sequence AACCUAUGGGAGAGGAGGAGA (SEQ ID NO: 4). Medium was replaced 24 hr post-transfection and the cells incubated for an additional 48 hr prior to measuring cell viability. A combination of siRNAs to both Rskl and Rsk2 was effective in reducing MCF-7 proliferation. Methods. Kinase Assays. Glutathione-S-transferase (GST)-fusion protein (1 g) containing the sequence - RRRLASTNDKG (SEQ ID NO: 1, for serine/threonine kinase assays) or -VSVSETDDYAEIIDEEDTFT (SEQ ID NO: 2, for tyrosine kinase assays) was adsorbed in the wells of LumiNunc 96-well polystyrene plates (MaxiSorp surface treatment). The wells were blocked with sterile 3% tryptone in phosphate buffered saline and stored at 4°C for up to 6 months. Kinase (5 nM) in 70 μl of kinase buffer (5 mM -glycerophosphate pH 7.4, 25 mM HEPES pH 7.4, 1.5 mM DTT, 30 mM MgCl₂, 0.15 M NaCl) was dispensed into each well. The compound or vehicle was added, and reactions were initiated by the addition of 30 μl of ATP for a final ATP concentration of 10 μM unless indicated otherwise. Reactions were terminated after 10 to 45 min by addition of 75 μl of 500 mM EDTA, pH 7.5. All assays measured the initial velocity of reaction. After extensive washing of wells, polyclonal phosphospecific antibody developed against the phosphopeptide and HRP-conjugated anti-rabbit antibody (211-035-109, Jackson ImmunoResearch Laboratories) were used to detect serine phosphorylation of the substrate. HRP-conjugated anti-phospho-tyrosine antibody (RC20, BD Transduction Laboratories) was used for phospho-tyrosine detection. His-tagged active RSK and FAK were expressed in Sf9 cells and purified using NiNTA resin (Qiagen). Baculovirus was prepared using the Bac-to-Bac® baculovirus expression system (Invitrogen). PKA was bacterially expressed and activated as described (Anal. Biochem. 245, 115-122 (1997)). Active Mskl and p70 S6 kinase was purchased from Upstate Biotechnology. Immunoprecipitation and kinase assays were performed as previously described (Poteet-Smith et al., J Biol. Chem, 274, 22135-22138 (1999) using the immobilized GST-fusion proteins and ELISAs as above.

Cell Culture. For proliferation studies cells were seeded at 2500 to 5000 cells per well in 96 well tissue culture plates in the appropriate medium as described by American Type Culture Collection. After 24 hr, the medium was replaced with medium containing compound or vehicle as indicated. Cell viability was measured at indicated time points using CellTiter-Glo™ assay reagent (Promega) according to manufacturer's protocol. For in vivo inhibition studies, cells were seeded at 2.5 XlO⁵ cells/well in 12 well cell culture clusters. After 24 hr, the cells were serum starved for 24 hr then incubated with compound or vehicle for 3 hr prior to a 30 min PDB stimulation. Cells were lysed as previously described( J. Biol. Chem. 273, 13317-13323 (1998)). The lysates were normalized for total protein, electrophoresed and immunoblotted. For cell imaging, Ha-Ras-transformed NIH/3T3 cells were seeded on LABTEK II chamber slides (Nalge) at a density of 1 XlO⁴ cells/well. After 24 hr, fresh medium was added the indicated compounds or vehicle. Images were taken 48 hr after treatment at a magnification of 2OX.

Gene Silencing. Custom oligonucleotides to Rskl (AAGAAGCUGGACUUCAGCCGU; SEQ ID NO: 3 and Rsk2 (AACCUAUGGGAGAGGAGGAGA; SEQ ID NO: 4) mRNA (Dharmacon Research Inc.) and TransIT-TKO® siRNA Tranfection Reagent (MIR2150, Minis Corporation) were used for the gene silencing studies. MCF-7 cells were seeded at a density of 1.25XlO⁴ cells per well in 24 well cell culture clusters. After 24 hr, fresh medium was added containing 25 nM oligonucleotide and transfection reagent according to manufacturer's protocol. The transfection medium was replaced after 24 hr. Cells were incubated for an additional 48 hr prior to cell viability measurement.

Breast tissue analysis. Frozen tissue samples were ground using mortar and pestle under liquid nitrogen. Ground tissue was added to heated 2-X SDS loading buffer and boiled for 3 min. Protein concentration of lysates was measured and lysates were electrophoresed on SDS-PAGE and immunoblotted.

EXAMPLE 2

SLOlOl interferes with the ability of Y. pseudotuberculosis to impede endosomal/phagosomal maturation. It is known that Y. pestis and the parent species, Y. pseudotuberculosis impede maturation of the endosome/phagosome. As demonstrated herein the RSK- specific inhibitor, SLOlOl, interferes with the ability of Y. pseudotuberculosis to impede endosomal/phagosomal maturation.

In a typical infection, shortly after Yersinia pseudotuberculosis is internalized into the host cell, the cytoskeleton of the host cell is rearranged resulting in accumulation of a thick actin ring around the early endosomal vesicle (Fig. 1). It has been suggest for Leishmania donovani infections that fusion of the endosomal and lysosomal vesicles is inhibited by enveloping the early endosome with the actin ring (Lerm et al. 2006. Infect Immun 74:2613-8). The Y. pseudotuberculosis-cont&uήng endosomes in macrophages treated with SLOlOl exhibit no actin ring enveloping the early endosomes (Fig. 1). In fact, Y. pseudotuberculosis -induced actin rearrangement is not observed in SLO 101 -treated macrophages. Thus, it appears that SLOlOl treatment protects the host cell cytoskeleton from Y. pseudotuberculosis- induced reorganization. The functional consequence of SLOlOl interfering with the ability Y. pseudotuberculosis to impede endosomal and lysosomal fusion would be the restoration of the microbicidal function of the macrophage. Thus, SLOlOl treatment of macrophages is anticipated to result in fewer bacteria surviving internalization into the host cell. As seen in Fig. 2A, fewer live bacteria are extracted from cells treated with SLOlOl relative to the bacteria extracted from vehicle-treated macrophages. Furthermore, as shown by the data of Fig. 2B, SLOlOl does not directly affect the growth of Y. pseudotuberculosis. Thus, SLO 101 -treatment interferes with accumulation of the actin ring around the early endosome and most likely functions to inhibit infection by restoring function to the microbicidal machinery of the host cell.

The data presented in Figs 1 and 2 demonstrate that SLOlOl represents one member of a novel class of anti-infective agents that protect the host by interfering with the ability of the pathogen to disrupt or avoid the microbicidal machinery of the host cell. Thus, SLOlOl has the potential to provide protection from a number of intracellular pathogens that survive in the host cell by inhibiting endosome/phagosome maturation including those organisms listed in Table 1.

Table 1. List of Intracellular Pathogens that Impede Phagosome Maturation

EXAMPLE 3 Proposed Synthetic Schemes for Preparing RSK Inhibitors

Abreviations used in Examples 3-6 are as follows: TBDPS = tert- butyldiphenylsilyl, THF = tetrahydrofuran, EDCl = l-(3-dimethylaminopropyl)-3- ethylcarbodiimide, DMAP = 4-dimethylaminopyridine, TSOH = 4-toluene sulfonic acid, DMF = dimethylformamide, Bn = benzyl, MTBE = methyl tert-butyl ether.

Proposed Scheme I: Preparation of Protected Kaempferol & Quercetin

DPS

R₀= H or OTBDPS

Proposed Scheme II: Alternative Route for Synthesis of Protected Kaempherol

K₂CO₃, acetone,

Reflux

DPS

Proposed Scheme III: Coupling of Two Fragments and Total Synthesis

* source for preparing the sugar moiety

SLOlOl-I

EXAMPLE 4 Synthesis of the Protected Kaempferol (10)

The synthesis for the Kaempferol half of SLOlOl-I is outlined as follows:

HO

TBDPS TBDPS

4a: R=OEt 4b: R=NH₂

8: R=Bn; R₁= COC₆H₄(4-OTBDPS) 8a: R=H; R₁= COC₆H₄(4-OTBDPS) 8b: R= COC₆H₄(4-OTBDPS); R₁= H

Treatment of commercially available 1 (2Og) with tert- butyldiphenylsilyl chloride (TBDPSCl) and imidazole in THF/CH₂C1₂ gave, after chromatographic purification, 2 (47.3 g, 80%). This compound was characterized by ¹H NMR. and MS.

Oxidation of 2 (21.8g and 25g) using sodium chlorite gave 3 (50g total, quantitative yield). The product was characterized by ¹H and ¹³C NMR, and by MS. Benzyl alcohol (50g) on treatment with NaH (1.2 equiv) and ethyl bromoacetate (1 equiv) in THF gave 4a (32g, 36%), which was characterized by both ¹HNMR, and by MS. Scale up of this reaction yielded lOOg of 4a. Reaction of 4a (5g) with NH₄OH at 0° for 5 h in CH₂Cl₂ gave amide 4b (4.3g, 96%), which was characterized by ¹H NMR and MS. A repeat of this experiment on 45 g of 4a gave 38 g (94%) of 4b. Dehydration of 4b (4.2 g) using POCl₃ in acetonitrile gave 5 (1.75 g, 47%), which was characterized by ¹H NMR, ¹³C NMR and MS. A repeat of this experiment on 38g of 4b gave an additional 15.75 g (47%) of 5. Coupling of 5 (5 g) and phloroglucinol in MTBE with HCl gas bubbling at O⁰C for 3 h gave 6 (2.6 g, 56%), which was characterized by ¹H NMR, ¹³C NMR and MS. Selective protection of 6 (0.5 g) using TBDPSCI (2.5 equiv) and Et₃N (2.5 equiv) in CH₂Cl₂ at room temperature for 16 h gave 7 (1.2 g, 85%), which was characterized by ¹H NMR and MS. Scale-up of this experiment on 2 g of 6 gave an additional 3.4 g (62%) of 7. Condensation of 7 (1.4 g) with 3 (1.35 equiv) in CH₂Cl₂ [EDCI (1.5 equiv), DMAP (0.35 equiv), TsOH (0.35 equiv.] at room temperature for 24 h gave 8 (1.5 g, 72%), which was characterized by ¹H NMR. Scale up gave 35g of purified 8. Compound 8 (6g) was debenzylated using Rh/C as a catalyst (H₂, 60 psi, EtOAc, rt, 24h) to give 8a (1.8g, 33%) along with 2.9g (53%) of the trans-esterifϊed (migration of benzoyl group Ri) product 8b. Both the intermediates 8a and 8b were characterized by ¹H NMR.

EXAMPLE 5 Synthesis of the Protected Rhamnose (20)

The synthesis for the Rhamnose half of SLOlOl-I is outlined as follows:

Reaction of L-rhamnose 11 (50 g) with acetic anhydride (6 equiv), triethylamine (8 equiv) and catalytic 4-dimethylaminopyridine (0.1 equiv) in CH2C12 at room temperature for 16h gave 90 g (98%) of the tetraacetate 12, which was characterized by ¹H NMR and MS and was taken to the next step without further purification. Scale up yielded 260 g of 12. Treatment of 12 (150 g) with thiophenol (1.1 equiv) in the presence Of SnCl₄ (0.7 equiv) in CH₂Cl₂ at 0 ⁰C for 5 h gave 13 [56 g (pure), HO g (with ~10% impurity)], which was characterized by both ¹H NMR and MS. Deacetylation of 13 (56 g) using catalytic K₂CO₃ (0.2 equiv) in THF/MeOH (1 : 1) at room temperature for 16 h provided triol 14 (35 g, 93%), which was characterized by ¹H NMR and MS.

Treatment of 14 (0.3 g) using 2,2-dimethoxypropane with catalytic amount of p-toluenesulfonic acid gave 15 (0.3 g, 86%) as a single anomer, which was characterized by both ¹H NMR and MS. Scale-up of this reaction on 34 g of 14 gave an additional 38 g (97%) of 15. O-Benzylation of 15 (0.3 g) with NaH (1.74 equiv) and benzyl bromide (1.05 equiv) in DMF provided the benzyl ether 16 (0.35 g, 89%), which was characterized by ' H NMR. A repeat of this experiment on 38 g of 15 gave 41 g (83%) of 16. Treatment of 16 (3 g) with trifluoroacetic acid in MeOH at 50⁰C for 16 h gave diol 17 (2.5 g, 93%), which was characterized by ¹H NMR and MS. A repeat of this experiment on 10 g of 16 gave 8.5 g (95%) of 17. Selective O- benzylation of diol 17 (2.5 g) following a literature procedure («-Bu₂SnO, toluene, Dean-Stark, reflux, 4 h to give 18, then W-Bu₄NBr, BnBr, 50 ⁰C, 5 h) gave 19 (2.6 g, 82%), which was characterized by both ¹H NMR and MS. Treatment of 19 (2.5 g,) with acetic anhydride and pyridine gave the acetate 20 (rhamnose part of the molecule) (2.5 g, 91%), which was characterized by ¹H NMR and MS.

Scale-up of the above reactions to get acetate 20 (-20 g) was conducted as follows. Treatment of 16 (25 g) with trifluoroacetic acid in MeOH at 50 ⁰C for 16 h gave diol 17 (21 g, 94%), which was characterized by ¹H NMR and MS. Selective 0-benzylation of diol 17 (29.5 g) following a literature procedure (n- Bu₂SnO, toluene, Dean-Stark, reflux, 4 h to give 18, then /1-Bu₄NBr, BnBr, 50⁰C, 5 h) gave 19 (31 g, 83%), which was characterized by both ¹H NMR and MS. Treatment of 19 (30 g) with acetic anhydride and pyridine gave the acetate 20 (29.3 g, 89%) required for the coupling reaction with 10. The product was characterized by ¹H NMR and MS. EXAMPLE 6 Coupling of the Kaempferol and Rhamnose Moieties

The coupling reation between compounds 20 and 8a to generate SLOlOl-I is outlined as follows:

SLOlOl-I

The coupling of 20 (O.lg) with 8a (1.5 equiv) using 0-glycosidation conditions [ 1 -benzenesulfinyl piperidine (1 equiv), tri-f-butylpyrimidine (2 equiv), triflic anhydride (trifluoromethanesulfonic acid anhydride) (1.1 equiv), CH₂Cl₂, -

6O⁰C, Ih] gave 21 (O.lg, 35%), which was characterized by ¹H NMR. Dehydration of 21 (O.lg) using K₂CO₃ in pyridine at reflux to get 22 is in progress and the remaining steps from 21 to produce SLOlOl-I are well known to those skilled in the art.

The disclosures of each and every patent, patent application, and publication cited herein are hereby incorporated by reference herein in their entirety.

Headings are included herein for reference and to aid in locating certain sections. These headings are not intended to limit the scope of the concepts described therein under, and these concepts may have applicability in other sections throughout the entire specification.

While this invention has been disclosed with reference to specific embodiments, it is apparent that other embodiments and variations of this invention may be devised by others skilled in the art without departing from the true spirit and scope of the invention.

Claims

WHAT IS CLAIMED IS:

1. A method of inhibiting pathogen induced interference of endosomal/phagosomal maturation in eukaryotic cells, said method comprising the step of contacting said cells with a composition comprising an inhibitor of RSK activity.

2. The method of claim 1 wherein the RSK inhibitor is selected from the group consisting of an anti-sense oligonucleotide and an interfering oligonucleotide.

3. The method of claim 2 wherein the RSK inhibitor comprises an interfering oligonucleotide directed against Rskl, Rsk2, Rsk3 or Rsk4.

4. The method of claim 1 wherein the RSK specific inhibitor comprises a compound having the structure of formula II:

wherein Ri, R_2i and R5 are independently selected from the group consisting of OH, OCOR₈, COR₈, SR₈, and Ci-C₄ alkoxy; R₃, R₄, Re_, R₇ are independently selected from the group consisting of

H, OH, OCOR₈, COR₈, SR₈, and Ci-C₄ alkoxy;

R₈ is H or Cj-C₄ alkyl; and R.₉, Rio and Ru are independently selected from the group consisting of H, OH,

OCOR₈, COR₈, NHOCOR₈ and C]-C₄ alkoxy, with the proviso that R₉, Rio and Ri i are not all OH when R), R₂, and R₅ are OH.

5. The method of claim 4 wherein Ri , R₂, and R₅ are independently OH or SR₈.

6. The method of claim 5 wherein one of Ri, R₂, and R₅ is SR₈.

7. The method of claim 4 wherein one of R₉, Rio and Rn is NHOCOR₈.

8. The method of claim 4 wherein Ri and R₂ are both OH;

R₉, Rio and Rn are independently selected from the group consisting of H, OH and OCOR₈;

R₃ and R₇ are each H;

R₄, R5, and R₆ are independently selected from the group consisting of H, OR₈, OCOR₈, and COR₈; and R₈ is H or methyl.

9. The method of claim 4 wherein Ri, R₂ and R₅ are OH; R₉ and Ri₀ are independently selected from the group consisting of

OH, COR₈, Ci -C₄ alkoxy, NHOCOR₈ and OCOCH₃;

Rn is OCOCH₃;

R₈ is H or methyl;

R₃, R₄ and R₇ are each H; and R5 is H or hydroxy.

10. The method of claim 9 wherein R.₉ and R)₀ are independently selected from the group consisting of OH and OCOCH₃.

11. The method of claim 1 further comprising the administration of an anti-microbial agent.

12. A method of treating an intracellular infection by a pathogen selected from the group of organisms consisting of Francisella Tularensis, Yersinia Pestis, Y. pseudotuberculosis, Legionella Pneumophila, Mycobacterium Tuberculosis, Mycobacterium Leprae, Helicobacter Pylori, Salmonella Enterocolitica, Salmonella Typhi, Neisseria Gonorrhea, Brucella, Coxiella, Chlamydia Trachomatis, Leishmania donovani and Toxoplasma gondii, said method comprising the step of contacting infected cells with a composition comprising a RSK inhibitor selected from the group consisting of an anti-sense oligonucleotide, an interfering oligonucleotide and a compound having the structure of formula II:

wherein R], R_2j and R₅ are independently selected from the group consisting of OH, OCOR₈, COR_8, SR₈, and Ci-C₄ alkoxy;

R₃, R₄, R_6, R₇ are independently selected from the group consisting of H, OH, OCOR₈, COR_8, SR₈, and C_rC₄ alkoxy;

R₈ is H or Ci -C₄ alkyl; and R.₉, Rio and Rn are independently selected from the group consisting of H, OH,

OCOR₈, COR₈, NHOCOR₈ and Cj-C₄ alkoxy, with the proviso that R₉, Rio and Ri i are not all OH when Ri , R₂, and R₅ are OH.

13. The method of claim 12 wherein said pathogen is Y. pestis or Y. pseudotuberculosis .

14. A composition for inhibiting intracellular pathogens that impede endosomal/phagosomal maturation, said composition comprising an inhibitor of RSK activity and a known anti-microbial agent.

15. The composition of claim 14 wherein the known anti-microbial agent is an antibiotic.

16. The composition of claim 14 wherein the RSK specific inhibitor is selected from the group consisting of an anti-sense oligonucleotide and an interfering oligonucleotide.

17. The composition of claim 14 wherein the RSK specific inhibitor comprises a compound having the structure of formula II:

wherein Ri, R_2, and R₅ are independently selected from the group consisting of OH, OCOR₈, COR₈, SR₈, and Ci-C₄ alkoxy;

R₃, R₄, R_6, R₇ are independently selected from the group consisting of H, OH, OCOR₈, COR_8, SR_8, and Ci-C₄ alkoxy; R₈ is H or Ci-C₄ alkyl; and

R₉, Rio and Ri ₁ are independently selected from the group consisting of H, OH,

OCOR₈, COR₈, NHOCOR₈ and Ci-C₄ alkoxy, with the proviso that R₉, Rio and R] ₁ are not all OH when Ri, R_2, and R₅ are each OH.

18. The method of claim 17 wherein R] , R_2, and R₅ are independently OH or SR₈.

19. The method of claim 17 wherein Ri, R₂ and R₅ are OH;

R₉ and Rio are independently selected from the group consisting of OH, COR₈, C₁-C₄ alkoxy, NHOCOR₈ and OCOCH₃; R_n is OCOCH₃; R₈ is H or methyl; R₃, R₄ and R₇ are each H; and

R₆ is H or hydroxy.

20. A pharmaceutical composition comprising a compound having the structure of formula II:

wherein Ri, R₂₎ and R₅ are independently selected from the group consisting of OH, OCOR₈, COR_8, SR_8, and Ci-C₄ alkoxy;

R₃, R₄, Re_, R₇ are independently selected from the group consisting of H, OH, OCOR₈, COR₈, SR₈, and Ci -C₄ alkoxy;

R₈ is H or Ci-C₄ alkyl; and

R9, Rio and Rn are independently selected from the group consisting of H, OH,

OCOR₈, COR₈, NHOCOR₈ and Cj-C₄ alkoxy, with the proviso that one of Ri, R₂, and R₅ is SR₈; and a pharmaceutically acceptable carrier.

21. The composition of claim 20 wherein one of R₉, Rio and Ri ₁ is

NHOCOR₈.

22. The composition of claim 20 wherein R₄, and R₇ are each H.