WO2009022345A1 - Carbamates de phényle destinés au traitement de la sclérose en plaques - Google Patents

Carbamates de phényle destinés au traitement de la sclérose en plaques Download PDF

Info

Publication number
WO2009022345A1
WO2009022345A1 PCT/IL2008/001126 IL2008001126W WO2009022345A1 WO 2009022345 A1 WO2009022345 A1 WO 2009022345A1 IL 2008001126 W IL2008001126 W IL 2008001126W WO 2009022345 A1 WO2009022345 A1 WO 2009022345A1
Authority
WO
WIPO (PCT)
Prior art keywords
subject
multiple sclerosis
rivastigmine
compound
pharmaceutically acceptable
Prior art date
Application number
PCT/IL2008/001126
Other languages
English (en)
Inventor
Marta Weinstock-Rosin
Talma Brenner
Original Assignee
Yissum Research Development Company Of The Hebrew University Of Jerusalem
Hadasit Medical Research Services And Development Ltd.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Yissum Research Development Company Of The Hebrew University Of Jerusalem, Hadasit Medical Research Services And Development Ltd. filed Critical Yissum Research Development Company Of The Hebrew University Of Jerusalem
Publication of WO2009022345A1 publication Critical patent/WO2009022345A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/21—Esters, e.g. nitroglycerine, selenocyanates
    • A61K31/27—Esters, e.g. nitroglycerine, selenocyanates of carbamic or thiocarbamic acids, meprobamate, carbachol, neostigmine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]

Definitions

  • the invention relates to the use of phenyl carbamates, including rivastigmine, for the treatment of multiple sclerosis.
  • MS Multiple sclerosis
  • CNS central nervous system
  • MBP myelin basic protein
  • corticosteroid treatment may be undesirable as these drugs are often poorly tolerated in patients and also inhibit endogenous immunosuppressive mechanisms.
  • Other current treatments of MS include beta interferons, mitoxantrone, natalizumab and glatiramer acetate (GA, Copaxone).
  • G glatiramer acetate
  • Such therapies are typically accompanied by adverse effects, including flu-like symptoms, depression, cytopenias, skin reactions and local pain (as consequences of the subcutaneous administration).
  • Current therapies used for symptomatic treatment of multiple sclerosis are discussed in Henze et al., 2006.
  • WO 2006/130726 is directed to methods for the treatment of a form of multiple sclerosis comprising administering an amount of R(+)-6-(N-methyl, N- ethyl-carbamoyl oxy)-N'-propargyl-l-aminoindan or a pharmaceutically acceptable salt thereof.
  • Ri is hydrogen, lower alkyl, cyclohexyl, allyl or benzyl
  • R 2 is hydrogen, methyl, ethyl or propyl, or
  • Ri and R 2 together with the nitrogen to which they are attached form a morpholino or piperidino radical
  • R 3 is hydrogen or lower alkyl
  • Rj and R 5 are the same or different and each is a lower alkyl
  • the dialkylaminoalkyl group is in the meta, ortho or para position.
  • Rivastigmine is a cholinesterase inhibitor (ChEI) classified as an intermediate- acting or pseudo-irreversible agent and is primarily indicated for the treatment of
  • Rivastigmine is (S)-N-ethyl-N-methyl-3-
  • Rivastigmine Tartrate is represented in Formula (II) below:
  • rivastigmine is a well known drug for preventing cognitive decline and loss of cholinergic function in certain types of dementia.
  • Controlled release oral compositions comprising rivastigmine are described in US 6,565,883.
  • US 6,335,031 discloses formulations of rivastigmine containing an antioxidant suitable for transdermal delivery.
  • EAE allergic encephalomyelitis
  • Parry et al. (2003) reported that administration of rivastigmine to MS patients 150 minutes prior to performing a cognitive task was associated with a relative normalization of the abnormal task-associated brain activation.
  • D'Intino et al. (2005) examined cognitive dysfunction in EAE rats that had recovered their motor function.
  • Daily oral administration of rivastigmine was found to restore cognitive performance, choline acetyltransferase activity in the basal forebrain but not in the cerebral cortex and hippocampus, and nerve growth factor mRNA expression in the cerebral cortex.
  • An anti-inflammatory effect of rivastigmine or an effect of the drug on the motor functions of EAE rats were neither taught nor suggested in these studies.
  • U.S. Patent Application Publication No. 2003/0225031 is directed to pharmaceutical compositions for nasal administration comprising ChE inhibitors, including, inter alia, rivastigmine, and methods of using same for the treatment of Alzheimer's disease and other neurological conditions associated with cognitive impairment in a mammal. According to the '031 application, these conditions include, among others, cognitive disorder associated with MS.
  • cholinergic up-regulation may result in anti-inflammatory effects. It was shown that immune system cells possess various subtypes of muscarinic cholinergic receptors and nicotinic receptors. In addition, lymphocytes synthesize acetylcholine (ACh), which is degraded by acetylcholinesterase (AChE)
  • nicotinic acetylcholine receptor ⁇ 7 subunit is required for inhibition of macrophage TNF release by ACh or nicotine.
  • Saeed et al. (2004) reported that human microvascular endothelial cells express ⁇ 7 nicotinic acetylcholine receptor ( ⁇ 7 nAChR), and that nicotine, a cholinergic agonist thereof, and vagus nerve stimulation inhibit endothelial cell activation, thereby inhibiting leukocyte recruitment in the carrageenan air pouch model of local inflammation.
  • Nizri et al. disclose bi-functional compounds consisting of the non-steroidal anti-inflammatory drug ibuprofen and pyridostigmine, a cholinesterase inhibitor that acts as a cholinergic up-regulator. These bi-functional compounds exhibited improved efficiency in an EAE mouse model compared to ibuprofen alone. Although treatment of mice by pyridostigmine alone resulted in reduced lymphocyte proliferation, such treatment did not change disease severity. Another such bi-functional compound, namely IBU- Octyl-Cytisine, containing ibuprofen and Cytisine as the nicotinic agonist, has been described by Nizri et al. (2007a), which further report that each moiety separately failed to reproduce the effect of this compound.
  • the disclosure further reports that administration of an antisense oligodeoxynucleotide targeted to AChE mRNA, reduced the clinical severity and CNS inflammation intensity in an EAE model. It has been suggested that inhibition of antibody-forming cell response by ChE inhibitors requires their presence in the CNS, based on experiments performed with physostigmine, physostigmine bromide and edrophonium (Langley et al., 2004).
  • U.S. Patent Application Publication No. 2005/0222123 is directed to a method of treating a subject with a cytokine-mediated inflammatory disorder comprising administering to the subject a cholinesterase inhibitor other than galantamine.
  • the '123 application lists a wide range of structurally-unrelated compounds, including nicotinic and muscarinic AChE inhibitors and butyrylcholinesterase inhibitors, as potential inhibitors for treating a variety of disorders.
  • the specification of '123 exemplifies the use of galantamine, tacrine, huperzine, neostigmine and physostigmine in acute inflammatory models of sepsis and endotoxemia in mice.
  • the present invention provides pharmaceutical compositions comprising phenyl carbamates including rivastigmine for treating multiple sclerosis and inhibiting symptoms associated therewith.
  • the invention is based, in part, on the unexpected discovery that rivastigmine can reduce the clinical symptoms associated with inflammation in experimental autoimmune encephalitis (EAE), a well-known model system of multiple sclerosis (MS).
  • EAE experimental autoimmune encephalitis
  • MS model system of multiple sclerosis
  • Rivastigmine was surprisingly found to reduce loss of motor functions when administered chronically to mice upon induction of EAE.
  • rivastigmine was in fact able to reduce demyelination and microglia activation and to preserve axons in treated mice.
  • Rivastigmine also decreased reactivity of encephalitogenic T-cells and production of pro-inflammatory cytokines (TNF- ⁇ , IFN- ⁇ and IL-17).
  • the present invention provides compositions comprising rivastigmine and methods thereof for inhibiting the clinical symptoms associated with inflammation in a subject afflicted with MS, for improving motor function and for inhibiting neurodegeneration and disease progression in MS patients.
  • the present invention is directed to treatment of a subject not otherwise in need of treatment with rivastigmine or other phenyl carbamates.
  • a method of treating multiple sclerosis in a subject in need thereof comprising administering to the subject a therapeutically-effective amount of a pharmaceutical composition comprising a compound of Formula (I): O
  • Ri is hydrogen, lower alkyl, cyclohexyl, allyl or benzyl
  • R 2 is hydrogen, methyl, ethyl or propyl, or
  • Ri and R 2 together with the nitrogen to which they are attached form a morpholino or piperidino radical
  • R 3 is hydrogen or lower alkyl
  • R 4 and R 5 are the same or different and each is a lower alkyl, and the dialkylaminoalkyl group is in the meta, ortho or para position,
  • the active ingredient is N-ethyl-N-methyl- 3-[l-(dimethylamino)ethyl]-phenyl carbamate or a pharmaceutically acceptable salt, hydrate or solvate thereof.
  • the active ingredient is (S)-N- ethyl-N-methyl-3-[l-(dimethylamino)ethyl]-phenyl carbamate (rivastigmine) or a pharmaceutically acceptable salt, hydrate or solvate thereof.
  • the active ingredient is rivastigmine tartrate.
  • the invention provides a method of improving motor function in a subject afflicted with multiple sclerosis, comprising administering to the subject a therapeutically-effective amount of a pharmaceutical composition comprising a compound of Formula (I) as defined herein or a pharmaceutically acceptable salt, hydrate or solvate thereof and a pharmaceutically acceptable carrier, excipient or diluent.
  • the invention provides a method of reducing demyelination in a subject afflicted with multiple sclerosis, comprising administering to the subject a therapeutically-effective amount of a pharmaceutical composition comprising a compound of Formula (I) as defined herein or a pharmaceutically acceptable salt, hydrate or solvate thereof and a pharmaceutically acceptable carrier, excipient or diluent.
  • the invention provides a method of reducing neurodegeneration associated with demyelination in a subject afflicted with multiple sclerosis, comprising administering to the subject a therapeutically-effective amount of a pharmaceutical composition comprising a compound of Formula (I) as defined herein or a pharmaceutically acceptable salt, hydrate or solvate thereof and a pharmaceutically acceptable carrier, excipient or diluent.
  • a method of inhibiting inflammation in a subject afflicted with multiple sclerosis comprising administering to the subject a therapeutically-effective amount of a pharmaceutical composition comprising a compound of Formula (I) as defined herein or a pharmaceutically acceptable salt, hydrate or solvate thereof and a pharmaceutically acceptable carrier, excipient or diluent.
  • the invention provides a method of inhibiting a clinical symptom associated with inflammation in a subject afflicted with multiple sclerosis, comprising administering to the subject a therapeutically-effective amount of a pharmaceutical composition comprising a compound of Formula (I) as defined herein or a pharmaceutically acceptable salt, hydrate or solvate thereof and a pharmaceutically acceptable carrier, excipient or diluent.
  • the invention provides a method of inhibiting the progression of multiple sclerosis in a subject in need thereof, comprising administering to the subject a therapeutically-effective amount of a pharmaceutical composition comprising a compound of Formula (I) as defined herein or a pharmaceutically acceptable salt, hydrate or solvate thereof and a pharmaceutically acceptable carrier, excipient or diluent.
  • a method of treating a multiple sclerosis-related disease selected from the group consisting of: Neuromyelitis Optica (Devic's Disease), Diffuse Sclerosis, Transitional Sclerosis, Acute Disseminated Encephalomyelitis, and Optic Neuritis, comprising administering to the subject a therapeutically-effective amount of a pharmaceutical composition comprising a compound of Formula (I) as defined herein or a pharmaceutically acceptable salt, hydrate or solvate thereof and a pharmaceutically acceptable carrier, excipient or diluent.
  • the multiple sclerosis-related disease is a virus-, bacteria- or parasite- related demyelinating brain disease.
  • the compound utilized in the methods of the invention is rivastigmine or a pharmaceutically acceptable salt, hydrate or solvate thereof, preferably rivastigmine tartrate.
  • the subject is human. In other embodiments, the subject is a non-human mammal.
  • the compounds of the invention are useful for decreasing the frequency or duration of acute exacerbations (or relapses) of the disease in a subject afflicted with MS.
  • the compounds are administered to a subject that is in remission of the disease, to prevent, delay or reduce recurrence of exacerbations.
  • the subject is afflicted with relapsing- remitting MS.
  • the active ingredient may be administered enterally, parenterally or topically.
  • the active ingredient is administered in a manner selected from the group consisting of: orally, subcutaneously and intramuscularly.
  • the active ingredient is formulated in the form of extended release, sustained release or controlled-release formulations.
  • oral sustained release and controlled release formulations are contemplated.
  • the active ingredient is formulated in the form of a transdermal formulation, e.g. as a transdermal delivery device.
  • SI Stimulation Index
  • Figure 8 Amelioration of EAE by treatment with rivastigmine.
  • Figure 8A daily treatment with rivastigmine (0.75 mg/kg, s.c.) ameliorated clinical score of EAE. This effect was reversed in animals treated with the nicotinic antagonist mecamylamine (10 mg/kg, s.c).
  • Figure 8B treatment of EAE induced animals with rivastigmine-loaded mini- osmotic pumps (4.8 mg/kg/day, s.c.) also ameliorated clinical score, even to a larger extent.
  • FIG. 9 Rivastigmine treatment reduced neuropathological parameters of inflammation, demyelination and neurodegeneration. Histological analysis from control- EAE spinal cord tissue taken at peak of disease showed marked inflammatory infiltration and demyelination (A), microglia activation (B) and axonal damage (C). Rivastigmine treatment ameliorated all these parameters (D, E, F). Figure 10. Inhibitory effect of rivastigmine on lymphocyte reactivity ex vivo. Figure 1OA, Treatment with rivastigmine (0.75 mg/kg, s.c.) reduced T-cell proliferation toward the encephalitogenic MOG peptide.
  • Figure 1OB Rivastigmine treatment reduced pro-inflammatory (TNF- ⁇ and IFN- ⁇ ) cytokine production in response to MOG (24 hrs) and also down-regulated IL- 17 mRNA expression (48 hrs, Figure 10C), as assayed by real-time PCR.
  • Figure 1OD IL-10 levels, an anti-inflammatory cytokine, were unaltered (96 hrs).
  • Figure 11 Effects of rivastigmine are dependent on the ⁇ 7 nAChR nicotinic receptor.
  • Figure HA inhibition of T-cell proliferation exerted by rivastigmine (l ⁇ M) is reversed when cells are incubated with ⁇ -bungarotoxin, a nicotinic muscle and neuronal- type blocker.
  • Figure HB T-cells were incubated with anti-sense to the ⁇ 5 nAChR or to ⁇ 7 nAChR (AS- ⁇ 5, AS- ⁇ 7, respectively) for 24 hrs, and then levels of ⁇ 7 nAChR mRNA were determined in the indicated treatments.
  • Rivastigmine reversed the decline in spatial learning performance seen in EAE animals in the Morris water maze. Performance of naive animals in first trial was compared to EAE-induced animals and to animals induced for EAE and treated with Rivastigmine (4.8 mg/kg, mini-pumps).
  • FIG. 14 Antigen presentation ability is affected by rivastigmine treatment. Splenocytes from untreated and treated mice were irradiated and incubated with MOG- specific T-cells in the presence of MOG. Proliferation of T-cells in response to antigen was normalized to the untreated group.
  • FIG. 15 Treatment with rivastigmine suppressed T-cell reactivity during various stages of EAE course.
  • Figure 15 A T-cell proliferation towards the encephalitogenic peptide (MOG 3S-55 ) was assessed at the indicated time points after disease induction.
  • Figure 15B-D Production of pro-inflammatory cytokines was suppressed by rivastigmine at the same time points ( Figure 15B - TNF- ⁇ ; Figure 15C - IFN- ⁇ ; Figure 15D - IL-17).
  • the treatment protocol was similar to that described for assessment of clinical score and reactivity of T-cells on day 9 post immunization.
  • EAE is associated with inflammatory infiltrates in lepto-meninges near the hippocampus.
  • the present invention is directed to the use of rivastigmine, related phenyl carbamates and salts thereof for preparing a medicament for the treatment of multiple sclerosis (MS) and related diseases.
  • the present invention provides compositions comprising these compounds and methods thereof for treating MS and inhibiting clinical symptoms associated therewith.
  • compositions comprising a compound of the general Formula (I):
  • Ri is hydrogen, lower alkyl, cyclohexyl, allyl or benzyl
  • R 2 is hydrogen, methyl, ethyl or propyl, or
  • Ri and R 2 together with the nitrogen to which they are attached form a morpholino or piperidino radical, R 3 is hydrogen or lower alkyl,
  • R 4 and R 5 are the same or different and each is a lower alkyl, and the dialkylaminoalkyl group is in the meta, ortho or para position.
  • the compound is N-ethyl-N-methyl-3-[l- (dimethylamino)ethyl] -phenyl carbamate or a pharmaceutically acceptable salt, hydrate or solvate thereof.
  • the compound is (S)-N-ethyl-N-methyl- 3-[l-(dimethylamino)ethyl]-phenyl carbamate (rivastigmine) or a pharmaceutically acceptable salt, hydrate or solvate thereof.
  • the compound is rivastigmine tartrate.
  • MS Multiple sclerosis
  • CNS central nervous system
  • MS is characterized by chronic inflammation, demyelination and gliosis.
  • Pathologically, MS is characterized by well-demarcated, macroscopic lesions, called plaques, in the brain white matter and, less frequently, gray matter.
  • Acute lesions are characterized by perivenular cuffing and infiltration of T lymphocytes and macrophages, along with a few B cells and plasma cells.
  • MS is reportedly an autoimmune disorder, likely triggered by environmental exposure in a genetically susceptible host.
  • a pharmaceutical composition comprising a compound of the general Formula (I) described above can be administered to patients having multiple sclerosis, including e.g. multiple sclerosis variants such as Neuromyelitis Optica (Devic's Disease), Diffuse Sclerosis, Transitional Sclerosis, Acute Disseminated Encephalomyelitis, and Optic Neuritis.
  • the patients are afflicted with a MS-related disorder selected from the group consisting of virus-, bacteria- or parasite-related demyelinating degenerative brain disease.
  • a MS-related disorder selected from the group consisting of virus-, bacteria- or parasite-related demyelinating degenerative brain disease.
  • Symptoms of MS which are prevented or ameliorated or treated may include: weakness and/or numbness in one or more limbs; tingling of the extremities and tight band-like sensations around the trunk or limbs; dragging or poor control of one or both legs to spastic or ataxic paraparesis; hyperactive tendon reflexes; disappearance of abdominal reflexes; Lhermitte's sign; retrobulbar or optic neuritis; unsteadiness in walking; increased muscle fatiguability; brain stem symptoms (diplopia, vertigo, vomiting); disorders of micturition; hemiplegia; trigeminal neuralgia; other pain syndromes; nystagmus and ataxia; cerebellar-type ataxia; Charcot's triad; diplopia; bilateral internuclear ophthalmoplegia; myokymia or paralysis of facial muscles; deafness; tinnitus; unformed auditory hallucinations (because of involvement cochlear connections
  • cognitive impairment as used herein relates to a disorder in memory, problem solving, abstract reasoning and orientation that weakens an individual's ability to maintain an independent lifestyle. A hallmark is memory impairment with resulting confusion in the conduct of daily affairs.
  • the invention is directed to the treatment of a subject afflicted with relapsing-remitting MS.
  • EAE Experimental autoimmune encephalomyelitis
  • CNS inflammation with macrophage and lymphocytic infiltrates and varying degrees of demyelination.
  • the disease manifests clinically with paralysis, beginning at the tail and spreading rostrally to the hindlimbs and forelimbs, and in advanced stages affects breathing and causes death.
  • a method of treating multiple sclerosis in a subject in need thereof comprising administering to the subject a therapeutically-effective amount of a pharmaceutical composition comprising a compound of Formula (I) as defined herein or a pharmaceutically acceptable salt, hydrate or solvate thereof and a pharmaceutically acceptable carrier, excipient or diluent.
  • treating refers to administering a therapy in amount, manner, and/or mode effective to improve a condition, symptom, or parameter associated with a disorder or to prevent progression of a disorder, to either a statistically significant degree or to a degree detectable to one skilled in the art.
  • An effective amount, manner, or mode can vary depending on the subject and may be tailored to the subject.
  • the term “treating” includes reducing, inhibiting, alleviating and/or ameliorating the non-cognitive clinical manifestations of MS.
  • “treating” may include blocking or reducing the physiological and pathogenic deterioration associated with MS.
  • the treatment may reduce or inhibit the inflammatory response in the brain and other regions of the nervous system, breakdown or disruption of the blood-brain barrier, appearance of lesions in the brain, tissue destruction, demyelination, autoimmune inflammatory response, chronic inflammatory response, neuronal death, and/or neuroglia death.
  • the term further includes inhibition, alleviation and/or amelioration of one or more of the clinical symptoms associated with MS that were listed above, an increase in frequency and duration of MS symptom-free periods, and improvement or inhibition of deterioration in motor performance.
  • Treatment of cognitive impairment associated with MS is explicitly excluded from the scope of the present invention.
  • a method of treating multiple sclerosis in a subject in need thereof comprising administering to the subject a therapeutically-effective amount of a pharmaceutical composition comprising rivastigmine or a pharmaceutically acceptable salt, hydrate or solvate thereof and a pharmaceutically acceptable carrier, excipient or diluent.
  • a method of inhibiting inflammation in a subject afflicted with multiple sclerosis comprising administering to the subject a therapeutically-effective amount of a pharmaceutical composition comprising a compound of Formula (I) as defined herein or a pharmaceutically acceptable salt, hydrate or solvate thereof and a pharmaceutically acceptable carrier, excipient or diluent.
  • a method of inhibiting inflammation in a subject afflicted with multiple sclerosis comprising administering to the subject a therapeutically-effective amount of a pharmaceutical composition comprising rivastigmine or a pharmaceutically acceptable salt, hydrate or solvate thereof and a pharmaceutically acceptable carrier, excipient or diluent.
  • the invention provides a method of improving motor function in a subject afflicted with multiple sclerosis, comprising administering to the subject a therapeutically-effective amount of a pharmaceutical composition comprising a compound of Formula (I) as defined herein or a pharmaceutically acceptable salt, hydrate or solvate thereof and a pharmaceutically acceptable carrier, excipient or diluent.
  • the invention provides a method of improving motor function in a subject afflicted with multiple sclerosis, comprising administering to the subject a therapeutically-effective amount of a pharmaceutical composition comprising rivastigmine or a pharmaceutically acceptable salt, hydrate or solvate thereof and a pharmaceutically acceptable carrier, excipient or diluent.
  • the invention provides a method of reducing demyelination in a subject afflicted with multiple sclerosis, comprising administering to the subject a therapeutically-effective amount of a pharmaceutical composition comprising a compound of Formula (I) as defined herein or a pharmaceutically acceptable salt, hydrate or solvate thereof and a pharmaceutically acceptable carrier, excipient or diluent.
  • the invention provides a method of reducing demyelination in a subject afflicted with multiple sclerosis, comprising administering to the subject a therapeutically-effective amount of a pharmaceutical composition comprising rivastigmine or a pharmaceutically acceptable salt, hydrate or solvate thereof and a pharmaceutically acceptable carrier, excipient or diluent.
  • the invention provides methods of inhibiting neurodegeneration and axonal damage associated with demyelination in a subject afflicted with multiple sclerosis, comprising administering to the subject a therapeutically-effective amount of a pharmaceutical composition comprising a compound of Formula (I) as defined herein or a pharmaceutically acceptable salt, hydrate or solvate thereof and a pharmaceutically acceptable carrier, excipient or diluent.
  • the invention provides methods of inhibiting neurodegeneration and axonal damage associated with demyelination in a subject afflicted with multiple sclerosis, comprising administering to the subject a therapeutically-effective amount of a pharmaceutical composition comprising rivastigmine or a pharmaceutically acceptable salt, hydrate or solvate thereof and a pharmaceutically acceptable carrier, excipient or diluent.
  • the invention provides a method of inhibiting a clinical symptom associated with inflammation in a subject afflicted with multiple sclerosis, comprising administering to the subject a therapeutically-effective amount of a pharmaceutical composition comprising a compound of Formula (I) as defined herein or a pharmaceutically acceptable salt, hydrate or solvate thereof and a pharmaceutically acceptable carrier, excipient or diluent.
  • the invention provides a method of inhibiting a clinical symptom associated with inflammation in a subject afflicted with multiple sclerosis, comprising administering to the subject a therapeutically-effective amount of a pharmaceutical composition comprising rivastigmine or a pharmaceutically acceptable salt, hydrate or solvate thereof and a pharmaceutically acceptable carrier, excipient or diluent.
  • inhibiting a clinical symptom it is meant reduction in severity and/or frequency of one or more MS associated symptoms, elimination of symptom(s) and prevention of the occurrence of symptom(s).
  • the invention provides a method of inhibiting the progression of multiple sclerosis in a subject in need thereof, comprising administering to the subject a therapeutically-effective amount of a pharmaceutical composition comprising a compound of Formula (I) as defined herein or a pharmaceutically acceptable salt, hydrate or solvate thereof and a pharmaceutically acceptable carrier, excipient or diluent.
  • the invention provides a method of inhibiting the progression of multiple sclerosis in a subject in need thereof, comprising administering to the subject a therapeutically-effective amount of a pharmaceutical composition comprising rivastigmine or a pharmaceutically acceptable salt, hydrate or solvate thereof and a pharmaceutically acceptable carrier, excipient or diluent.
  • a pharmaceutical composition comprising rivastigmine or a pharmaceutically acceptable salt, hydrate or solvate thereof and a pharmaceutically acceptable carrier, excipient or diluent.
  • the compounds of Formula (I) as defined herein are known as being useful for treating a subject suffering from senile dementia, Alzheimer's disease, Huntingdon's chorea, tardive dyskinesias, hyperkinesia, mania, acute confusion disorders, Friedrich's ataxia or Down's syndrome.
  • the treatment of a subject afflicted with any of these diseases is excluded from the scope of the present invention.
  • the MS-afflicted subject treated by the methods of the present invention should
  • the compounds of the invention are useful for decreasing the frequency or duration of acute exacerbations (or relapses) of the disease in a subject afflicted with MS.
  • the subject is in a state of remission.
  • the compounds of Formula (I) as defined herein may be used in the form of the free base or a pharmaceutically acceptable salt thereof.
  • a pharmaceutically acceptable salt thereof preferably the hydrogen tartrate (hta) is used.
  • Other pharmacologically acceptable salts of these compounds include, but are not limited to, the acetate, salicylate, fumarate, phosphate, sulphate, maleate, succinate, citrate, tartrate, propionate and butyrate salts thereof.
  • the compounds of Formula (I) as defined herein or physiologically acceptable salt(s) thereof may be compounded with one or more physiologically acceptable vehicles, carriers, excipients, binders, preservatives, stabilizers, flavors, etc., in a unit dosage form as called for by accepted pharmaceutical practice.
  • the amount of active substance in these compositions or preparations is such that a suitable dosage is obtained.
  • pharmaceutically acceptable or “physiologically acceptable” is meant herein a material that is not biologically or otherwise undesirable, i.e., the material may be incorporated into a pharmaceutical composition administered to a patient without causing any undesirable biological effects or interacting in a deleterious manner with any of the other components of the composition in which it is contained.
  • “Pharmacologically active” is meant herein a material that is not biologically or otherwise undesirable, i.e., the material may be incorporated into a pharmaceutical composition administered to a patient without causing any undesirable biological effects or interacting in a deleterious manner with any of the other components of the composition in which it is contained.
  • a pharmaceutically active derivative or metabolite refers to a derivative or metabolite having the same type of pharmacological activity as the parent compound and approximately equivalent in degree.
  • pharmaceutically acceptable or “physiologically acceptable” is used to refer to a derivative (e.g., a salt) of an active agent, it is to be understood that the compound is pharmacologically active as well, i.e., therapeutically effective for the treatment of multiple sclerosis.
  • Carriers or “vehicles” as used herein refer to conventional pharmaceutically acceptable carrier materials suitable for drug administration, and include any such materials known in the art that are nontoxic and do not interact with other components of a pharmaceutical composition or drug delivery system in a deleterious manner.
  • a "pharmaceutically acceptable carrier, excipient or diluent” may refer to a single auxiliary material or to various mixtures and combinations of such non-active ingredients.
  • Illustrative of the adjuvants which may be incorporated in tablets, capsules and the like are the following: a binder such as gum tragacanth, acacia, corn starch or gelatin; an excipient such as dicalcium phosphate; a disintegrating agent such as corn starch, potato starch, alginic acid and the like; a lubricant such as magnesium stearate; a sweetening agent such as sucrose, lactose or saccharin; a flavoring agent such as peppermint, oil of wintergreen or cherry.
  • a binder such as gum tragacanth, acacia, corn starch or gelatin
  • an excipient such as dicalcium phosphate
  • a disintegrating agent such as corn starch, potato starch, alginic acid and the like
  • a lubricant such as magnesium stearate
  • a sweetening agent such as sucrose, lactose or saccharin
  • a flavoring agent such as peppermint
  • tablets may be coated with shellac, sugar or both.
  • a syrup or elixir may contain the active compound, sucrose as a sweetening agent, methyl and propyl parabens as preservatives, a dye and a flavoring such as cherry or orange flavor.
  • suitable pharmaceutical adjuvants and techniques for formulation as well as administration of drugs are described in "Remington's Pharmaceutical Sciences” by E. W. Martin.
  • rivastigmine tartrate may be formulated as capsules for oral administration, containing as inactive ingredients hydroxypropyl methylcellulose, magnesium stearate, microcrystalline cellulose, and silicon dioxide.
  • Each hard-gelatin capsule may contain, for example, gelatin, titanium dioxide and dyes (e.g. red and/or yellow iron oxides; Exelon ® capsules).
  • rivastigmine tartrate may be formulated as an oral solution (comprising e.g. a rivastigmine tartrate concentration equivalent to 2 mg/mL of rivastigmine base), comprising as inactive ingredients citric acid, a dye (e.g. D&C yellow #10), purified water, sodium benzoate and sodium citrate (Exelon ® oral solution).
  • an oral solution comprising e.g. a rivastigmine tartrate concentration equivalent to 2 mg/mL of rivastigmine base
  • inactive ingredients citric acid, a dye (e.g. D&C yellow #10), purified water, sodium benzoate and sodium citrate (Exelon ® oral solution).
  • Sterile compositions for injection can be formulated according to conventional pharmaceutical practice by dissolving or suspending the active substance in a vehicle such as water for injection. Buffers, preservatives, antioxidants and the like can be incorporated as required.
  • Preferred antioxidants for use with the compounds of the present invention include sodium metabisulphite and ascorbic acid.
  • the pharmaceutical composition of the present invention may also be formulated in rectal compositions such as suppositories or retention enemas, using, for example, conventional suppository bases such as cocoa butter or other glycerides.
  • the invention is directed to the use of extended release, sustained release or controlled release formulations of the compounds of Formula (I) as defined herein or salts thereof, including, but not limited to those disclosed by U.S. Patent No. 6,565,883.
  • the composition may comprise a core coated with two films, the first inner film being a semi-permeable to water or body fluids film applied directly on said core and comprising cellulose acetate, the second outer film being a permeable to water or body fluids film comprising ethylcellulose.
  • controlled release is intended to refer to any drug-containing formulation in which release of the drug is not immediate, i.e., with a “controlled release” formulation, oral administration does not result in immediate release of the drug into an absorption pool.
  • controlled release is used interchangeably with "nonimmediate release” as defined in Remington: The Science and Practice of Pharmacy, Nineteenth Ed. (Easton, Pa.: Mack Publishing Company, 1995). As discussed therein, immediate and nonimmediate release can be defined.
  • the drug level achieved is the outcome of rate constants for (1) release of the drug from the formulation, (2) absorption, and (3) elimination, respectively.
  • rate constant for drug release is far greater than the absorption rate constant.
  • controlled release formulations the opposite is true, such that the rate of release of drug from the dosage form is the rate-limiting step in the delivery of the drug to the target area.
  • controlled release as used herein is intended to include any nonimmediate release formulation, including but not limited to sustained release, delayed release and pulsatile release formulations.
  • sustained release is used in its conventional sense to refer to a drug formulation that provides for gradual release of drug over an extended period of time, and that preferably, although not necessarily, results in substantially constant blood levels of drug over an extended time period.
  • delayed release is used in its conventional sense to refer to a drug formulation in which there is a time delay provided between oral administration of a drug dosage form and the release of the drug therefrom. "Delayed release” may or may not involve gradual release of drug over an extended period of time, and thus may or may not be “sustained release”.
  • a controlled release formulation may comprise, for example, controlled release beads comprising the drug.
  • a common type of controlled release beads comprises an inert core, such as a sugar sphere, coated with an inner drug-containing layer and an outer membrane layer controlling drug release from the inner layer.
  • an example of such controlled release beads is described in U.S. Pat. No. 5,783,215 where each bead comprises (i) a core unit of a soluble or insoluble inert material, (ii) a first layer on the core unit comprising an active ingredient dispersed in a hydrophilic polymer, (iii) an optional second layer of hydrophilic polymer covering the first layer, and (iv) an outermost membrane layer effective for controlled release of the active ingredient.
  • a "sealcoat” in the form of a small amount (e.g. 1-3%) of a water-soluble polymer, such as hydroxypropylmethyl cellulose (HPMC) or polyvinylpyrrolidone (PVP), between the inert core and the layer containing the active ingredient.
  • HPMC hydroxypropylmethyl cellulose
  • PVP polyvinylpyrrolidone
  • the purpose thereof is generally to isolate the drug from the core surface in the event that a drug-core chemical interaction is possible, and/or to smooth the surface of the inert core such that the surface area is more consistent from lot to lot to thereby improve the coating quality when the drug layer and the controlled release membrane layers are applied.
  • the cores are typically of a water-soluble or swellable material, and may be any such material that is conventionally used as cores or any other pharmaceutically acceptable water-soluble or water-swellable material made into beads or pellets.
  • the beads are spheres of sucrose/starch (Sugar Spheres NF), sucrose crystals, or extruded and dried spheres typically comprised of excipients such as microcrystalline cellulose and lactose.
  • the substantially water-insoluble material in the first, or sealcoat layer is generally a "GI insoluble” or "GI partially insoluble” film forming polymer (latex or dissolved in a solvent).
  • GI insoluble or "GI partially insoluble” film forming polymer (latex or dissolved in a solvent).
  • ethyl cellulose, cellulose acetate, cellulose acetate butyrate polymethacrylates such as ethyl acrylate/methyl methacrylate copolymer (Eudragit NE-30-D) and ammonio methacrylate copolymer types A and B (Eudragit RL30D and RS30D), and silicone elastomers.
  • a plasticizer is used together with the polymer.
  • plasticizers include: dibutylsebacate, propylene glycol, triethylcitrate, tributylcitrate, castor oil, acetylated monoglycerides, acetyl triethylcitrate, acetyl butylcitrate, diethyl phthalate, dibutyl phthalate, triacetin, fractionated coconut oil (medium-chain triglycerides).
  • the second layer containing the active ingredient may be comprised of the active ingredient (drug) with or without a polymer as a binder.
  • the binder when used, is usually hydrophilic but may be water-soluble or water-insoluble.
  • Exemplary polymers to be used in the second layer containing the active drug are hydrophilic polymers such as polyvinylpyrrolidone (PVP), polyalkylene glycol such as polyethylene glycol, gelatine, polyvinyl alcohol, starch and derivatives thereof, cellulose derivatives, such as hydroxypropylmethyl cellulose (HPMC), hydroxypropyl cellulose, carboxymethyl cellulose, methyl cellulose, ethyl cellulose, hydroxyethyl cellulose, carboxyethyl cellulose, carboxymethylhydroxyethyl cellulose, acrylic acid polymers, polymethacrylates, or any other pharmaceutically acceptable polymer.
  • PVP polyvinylpyrrolidone
  • HPMC hydroxypropylmethyl cellulose
  • HPMC hydroxyprop
  • transdermal pharmaceutical compositions comprising the compounds of Formula (I) as defined herein may be used in accordance with the methods of the present invention. These formulations may optionally be administered using a transdermal device, e.g. a transdermal patch.
  • a transdermal device e.g. a transdermal patch.
  • Exemplary transdermal formulations comprising inter alia rivastigmine and transdermal devices thereof are disclosed in U.S. Patent No. 6,335,031.
  • the compounds according to the invention may be administered by any conventional route, in particular enterally, preferably orally, e.g. in the form of tablets or capsules, or parenterally, e.g. in the form of injectable solutions or suspensions (e.g. for subcutaneous or intramuscular administration).
  • the exact amounts of the compound of Formula (I) as defined herein to be administered may depend on a number of factors, e.g. the drug release characteristics of the compositions, the drug penetration rate observed in vitro and in vivo tests, the duration of action required, the form of the compound of Formula (I), and for transdermal compositions the size of the skin contact area, and the part of the body to which the unit is fixed.
  • the amount of and, e.g. area of the transdermal composition etc. may be determined by routine bioavailability tests comparing the blood levels of active agents after administration of the compound of Formula (I) as defined herein in a composition according to the invention to intact skin and blood levels of the compound of Formula (I) observed after oral administration of a therapeutically effective dose of the compound.
  • rivastigmine is well tolerated in humans at an initial dose of 1.5 mg twice a day orally and the dose may be stepped up to 3 mg twice daily in week 2. Higher dosages are possible, for example 4.5 mg twice daily and even 6 mg twice daily. Tolerability was reported to be even better for a transdermal device, wherein, for example, 24 mg may be absorbed in 24 hours.
  • oral formulations of rivastigmine tartrate as described above may be administered to a subject in need thereof so that a dose equivalent to 1.5 mg rivastigmine is administered twice daily, and this dose may be gradually increased to a maximal daily dose equivalent to between 9-12 mg rivastigmine.
  • Intramuscular and subcutaneous rivastigmine administration can be e.g. from 0.75 mg twice daily to a maximal daily dose equivalent to 5-6 mg rivastigmine.
  • compositions of the invention can be administered alone or in conjunction with other therapeutic modalities. It is appropriate to administer the pharmaceutical compositions of the invention as part of a treatment regimen involving other therapies, such as drug therapy, which comprises e.g. immunosuppressive drugs (e.g. methotrexate, azathioprine, cyclophosphamide, cladribine) and/or other agents used for the treatment of MS such as interferon (IFN)- ⁇ and copolymer-1.
  • immunosuppressive drugs e.g. methotrexate, azathioprine, cyclophosphamide, cladribine
  • MS interferon
  • a method of inhibiting inflammation in a subject afflicted with multiple sclerosis or a multiple sclerosis-related disease comprising administering to the subject a therapeutically-effective amount of a pharmaceutical composition comprising a compound of Formula (I) as defined herein, or a pharmaceutically acceptable salt, hydrate or solvate thereof and a pharmaceutically acceptable carrier, excipient or diluent.
  • said subject is afflicted with multiple sclerosis.
  • the method is used for improving motor function in said subject.
  • the method is used for reducing demyelination in said subject.
  • the method is used for inhibiting neurodegeneration associated with demyelination in said subject.
  • the method is used for inhibiting a clinical symptom associated with inflammation in said subject. In another embodiment, the method is used for inhibiting the progression of multiple sclerosis in said subject. In another embodiment, the method is used for treating a multiple sclerosis-related disease selected from the group consisting of: Neuromyelitis Optica (Devic's Disease), Diffuse Sclerosis, Transitional Sclerosis, Acute Disseminated Encephalomyelitis, and Optic Neuritis, wherein each possibility represents a separate embodiment of the present invention. In another embodiment, the method is used for treating a multiple sclerosis- related disease selected from the group consisting of virus-, bacteria- and parasite-related demyelinating degenerative brain disease wherein each possibility represents a separate embodiment of the present invention.
  • Neuromyelitis Optica Devic's Disease
  • Diffuse Sclerosis Diffuse Sclerosis
  • Transitional Sclerosis Transitional Sclerosis
  • Acute Disseminated Encephalomyelitis and Optic Neuritis
  • the invention provides a method of treating multiple sclerosis in a subject in need thereof, comprising administering to the subject a therapeutically- effective amount of a pharmaceutical composition comprising a compound of the general Formula (I) as defined herein, and pharmaceutically acceptable salts, hydrates or solvates thereof, and a pharmaceutically acceptable carrier, excipient or diluent, whereby the treatment inhibits neurological deterioration or improves non-cognitive functions in said subject.
  • the subject is not otherwise in need of treatment with rivastigmine or other phenyl carbamates.
  • the invention provides use of a compound of Formula (I) as defined herein or a pharmaceutically acceptable salt, hydrate or solvate thereof for the preparation of a medicament useful for treating multiple sclerosis and inhibiting clinical symptoms associated therewith.
  • the medicament is useful for inhibiting inflammation in a subject afflicted with multiple sclerosis or a multiple sclerosis- related disease, for improving motor function in a subject afflicted with multiple sclerosis, for reducing demyelination in a subject afflicted with multiple sclerosis, for inhibiting neurodegeneration associated with demyelination in a subject afflicted with multiple sclerosis, for inhibiting a clinical symptom associated with inflammation in a subject afflicted with multiple sclerosis or for inhibiting the progression of multiple sclerosis.
  • the medicament is useful for treating multiple sclerosis, whereby said medicament inhibits neurological deterioration or improves non-cognitive functions.
  • the invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising a compound of Formula (I) as defined herein, or a pharmaceutically acceptable salt, hydrate or solvate thereof, for treating multiple sclerosis, whereby the composition inhibits neurological deterioration or improves non-cognitive functions.
  • a pharmaceutical composition comprising a compound of the general Formula (I) as defined herein, and pharmaceutically acceptable salts, hydrates or solvates thereof, for inhibiting inflammation in a subject afflicted with multiple sclerosis or a multiple sclerosis-related disease, for improving motor function in a subject afflicted with multiple sclerosis, for reducing demyelination in a subject afflicted with multiple sclerosis, for inhibiting neurodegeneration associated with demyelination in a subject afflicted with multiple sclerosis, for inhibiting a clinical symptom associated with inflammation in a subject afflicted with multiple sclerosis or for inhibiting the progression of multiple sclerosis.
  • a pharmaceutical composition comprising a compound of the general Formula (I) as defined herein, and pharmaceutically acceptable salts, hydrates or solvates thereof, for inhibiting inflammation in a subject afflicted with multiple sclerosis or a multiple sclerosis-related disease, for improving motor function in a subject afflicted with multiple sclerosis
  • the composition is useful for treating a multiple sclerosis-related disease selected from: Neuromyelitis Optica (Devic's Disease), Diffuse Sclerosis, Transitional Sclerosis, Acute Disseminated Encephalomyelitis, and Optic Neuritis, or a multiple sclerosis-related disease selected from virus-, bacteria- and parasite-related demyelinating degenerative brain disease wherein each possibility represents a separate embodiment of the present invention.
  • a multiple sclerosis-related disease selected from: Neuromyelitis Optica (Devic's Disease), Diffuse Sclerosis, Transitional Sclerosis, Acute Disseminated Encephalomyelitis, and Optic Neuritis
  • a multiple sclerosis-related disease selected from virus-, bacteria- and parasite-related demyelinating degenerative brain disease wherein each possibility represents a separate embodiment of the present invention.
  • the compound is N-ethyl-N-methyl-3-[l- (dimethylamino)ethyl] -phenyl carbamate or a pharmaceutically acceptable salt, hydrate or solvate thereof.
  • the compound is (S)-N-ethyl-N-methyl-3-[l- (dimethylamino)ethyl] -phenyl carbamate (rivastigmine) or a pharmaceutically acceptable salt, hydrate or solvate thereof.
  • the compound is rivastigmine tartrate.
  • the subject is selected from the group consisting of humans and non-human mammals.
  • the compound is administered in a manner selected from the group consisting of: orally, subcutaneously and intramuscularly.
  • said compound is formulated in a form selected from the group consisting of extended release, sustained release and controlled-release formulations.
  • said compound is formulated in the form of a transdermal delivery device.
  • the subject is in a state of remission.
  • composition is useful for the preparation of a medicament for treating relapsing-remitting multiple sclerosis.
  • mice C57BL/6JOlaHsd female mice (Harlan) were housed under specific pathogen-free conditions in the Animal Facility at the Hebrew University Medical School, in accordance with NIH guidelines for the care and use of laboratory animals.
  • EAE Experimental Autoimmune Encephalomyelitis
  • mice An additional injection of MOG35-55 peptide in CFA was delivered 7 days later into the right para-lumbar region. All animals were examined daily and evaluated for clinical signs of disease. The clinical status of the mice was scored according to the following scale: 0, without clinical disease; 1, tail weakness; 2, hind limb weakness sufficient to impair righting; 3, one limb plagic; 4, paraplegia with forelimb weakness; 5, quadriplegia; 6, death. Evaluation of central nervous system (CNS) pathology. The spinal cords and brains were removed, fixed in 4% buffered formalin, sectioned, and routinely processed for paraffin embedding. Sections prepared from the same level were stained with hematoxylin and eosin.
  • CNS central nervous system
  • Inflammatory foci containing at least 20 perivascular mononuclear cells were counted in each section. The tissues were sampled on day 32 after disease induction. EAE treatment. Female C57BL were injected daily with rivastigmine from the day of disease induction with 0.75 mg/kg/day, administered either intraperitoneally (i.p.) or subcutaneously (s.c). Control animals received the same volume of vehicle (normal saline or phosphate buffered saline, PBS).
  • vehicle normal saline or phosphate buffered saline, PBS.
  • LNCs lymph node cells
  • cytokine production The levels (pg/ml) of the inflammatory cytokines, tumor necrosis factor-a (TNF- ⁇ ) and interferon- ⁇ (INF- ⁇ ), and of the anti inflammatory cytokine interlukine-10 (IL-IO), were measured in supernatants of lymphocyte cultures by a solid phase ELISA (R&D, Minneapolis, MN, USA). This assay employs a quantitative "sandwich” enzyme immunoassay technique (Barak et al., 2002).
  • Cytotoxicity assay Lymphocyte viability was determined by trypan blue (0.4%, Sigma) exclusion. All cells were viable under the experimental conditions.
  • Statistical analysis Group differences were analyzed by One Way Repeated Measures Analysis of Variance (One Way ANOVA), according to Dunnet's method. Differences in disease severity were analyzed using the Mann - Whitney Rank sum test. A difference between the groups of P ⁇ 0.05 was considered significant.
  • the data are expressed as the mean score ⁇ SE, in 9 control-PBS treated mice, 6 mice receiving rivastigmine.
  • mice were injected i.p. with rivastigmine 0.75mg/kg/day in treated groups and with vehicle in the control group.
  • the data are expressed as the mean score ⁇ SE, in 18 control-PBS treated mice, 16 mice receiving rivastigmine. # Cumulative score: number of days animals were sick x clinical score
  • mice were injected s.c. with rivastigmine 0.75mg/kg/day in treated groups and with vehicle in the control group.
  • the inflammatory process in EAE involves activation of CNS immunocompetent cells, i.e. astrocytes and microglia, and extravasation of activated T cells and macrophages through vessel walls and their subsequent entry and accumulation in inflammatory sites.
  • CNS immunocompetent cells i.e. astrocytes and microglia
  • extravasation of activated T cells and macrophages through vessel walls and their subsequent entry and accumulation in inflammatory sites.
  • the inhibitory effect of rivastigmine on the production of inflammatory mediators by CNS glial cells and on T cell reactivity was tested.
  • Example 1.2 Ex-vivo reactivity of lymphocytes is inhibited by rivastigmine
  • T cell reactivity towards the encephalitogenic MOG peptide was inhibited by daily injection of rivastigmine as shown by the reduction in the stimulation index from 14.4 to 4.9 (Figure 4A).
  • the T-cell reactivity towards the mitogens ConA and LPS was also significantly reduced (Figure 4B).
  • Example 1.3 Effect on CNS inflammation in vivo
  • Brains and spinal cords of PBS and rivastigmine treated mice were fixed and processed for pathological examination of tissue sections.
  • the data are expressed as the mean ⁇ SE number of inflammatory foci (containing at least 20 perivascular mononuclear cells) in each section of tissue meninges and parenchyma.
  • Mini osmotic pumps (Alzet, 2004), containing rivastigmine that was released at the rate of 0.082mg/24hours or PBS as placebo treatment for 28 days, were implanted subcutaneously, one day before disease induction.
  • EAE induction and disease severity assessment were performed as described above. As can be seen in Figure 6, treatment with rivastigmine clearly reduced the clinical symptoms of EAE. As summarized in Table 4, controlled release of rivastigmine 0.082mg rivastigmine/24hours/mouse caused a significant reduction in disease severity and cumulative score, and a significant increase in survival of the mice.
  • Example 1.5 amelioration of EAE with a control drug
  • FIG. 7 and table 5 hereinbelow summarize the course of EAE under daily treatment with s.c. 2mg/day/mouse of the known drug glatiramer acetate (GA, also known as Copaxone) as compared with placebo group. EAE was induced and evaluated as described above.
  • GA glatiramer acetate
  • the brains (minus cerebellum) and tibialis muscles were rapidly removed and homogenized in 0.25mM phosphate containing 1% Triton X-100.
  • Cholinesterase activity was measured in 25 ⁇ l aliquots of the supernatant using acetylthiocholine as a substrate by the spectrophotometic method of EUman et al (Ellman et al.
  • EAE induction and treatment EAE was induced in 8-week-old female C57BL/6 mice by injecting s.c. into the left para-lumbar region 125 ⁇ g of myelin oligodendrocyte glycoprotein 35-55 peptide (MOG 35 - 55 ; synthesized by Sigma Laboratories, Israel) emulsified in complete Freund's adjuvant (CFA) containing 5 mg/ml heat-killed Mycobacterium tuberculosis. Immediately thereafter, and, again, at 48 h, the mice were inoculated i.p. with 0.5 ml of pertussis toxin (350 ng).
  • CFA complete Freund's adjuvant
  • mice were implanted s.c with ALZET ⁇ (DURECT, Cupertino, CA, USA) mini-osmotic pumps, according to the manufacturer's instructions. Pumps were loaded with 3 mg rivastigmine in 220 ⁇ l saline each, corresponding to a daily dose of 4.8 mg/kg (0.8 x 6, as rivastigmine half life in serum is 4 hrs.) for 28 days. Control animals were implanted with pumps releasing the same volume of saline.
  • ALZET ⁇ DURECT, Cupertino, CA, USA
  • the spinal cords were removed 21 days after disease induction (at disease peak) after transcardial perfusion as described previously (Irony-Tur-Sinai et ah, 2006).
  • Longitudinal sections were cut to include the majority of the length of the spinal cord including both gray and white matter, and stained with hematoxylin and eosin. Inflammatory foci containing at least 20 perivascular mononuclear cells were counted in each section.
  • Sections were stained with luxol-fast- blue for myelin visualization and analyzed by light microscopy.
  • immunohistochemistry sections were incubated with primary antibodies anti- neuro filament and anti CD68 (1:300 dilution) and processed according to standard procedures (Das Sarma et ah, 2000). Quantification of the pathologic parameters was based on the methods previously described for the pathologic evaluation of EAE.
  • inflammation none (0), a few inflammatory cells (1), organization of perivascular infiltrates (2), increasing severity of perivascular cuffing with extension into the adjacent tissue (3). Inflammatory foci containing at least 20 perivascular mononuclear cells were counted in each section.
  • the degree of myelin loss, and axonal damage was graded as absent (0), weak (1), moderate (2) and severe (3). For each animal 3 section were studied. The grade of the pathologic parameter was added and the final score was divided by the number of mice in that group.
  • LNCs Mouse lymphocyte proliferation assay: Pooled lymph node cells (LNCs) were prepared from inguinal, axilliary and mesenteric lymph nodes of mice that had been inoculated 9 days earlier with MOG 35-55 peptide in CFA with or without treatment.
  • T-cell reactivity was tested during the various stages of disease (days 14- disease onset, 21- disease peak and day 28 after immunization- chronic phase), T-cells were obtained from spleens and tested as above. The results are expressed as Stimulation
  • SI Setimal cpm of the stimulated cells/mean cpm of the unstimulated cells.
  • Cell treatment with anti-sense Cells were incubated for 24 hrs with anti-sense (AS) to the ⁇ 7 nAChR or ⁇ 5 nAChR as a negative control. After the incubation, cells were treated with rivastigmine as indicated.
  • AS anti-sense
  • the AS used was comprised of phosphorothioate- bond nucleotides (IDT Technologies, Rehovot, Israel) and the sequences used were:
  • RNA and cDNA were prepared using an SV total RNA kit (Promega, Madison, WI, USA). For determination of IL- 17 mRNA level, RNA was prepared from spleens of mice on day 9 after induction of EAE as described above. cDNA was prepared from 200 ⁇ g of total RNA, using MuLV reverse transcriptase (Applied Biosystems, Warrington, UK) and random hexamers according to the manufacturer's instructions for first-strand cDNA synthesis.
  • PCR Quantitative Real-Time Polymerase Chain Reaction
  • HPRT reverse CGAGAGGTCCTTTTCACCAGC (SEQ ID NO:4).
  • ⁇ 7 nAChR forward GACTGTTCGTTTCCCAGATGG (SEQ ID NO:5); ⁇ 7 nAChR reverse: ACGAAGTTGGGAGCCGACATCA (SEQ ID NO:6).
  • 18S forward TCGAGGCCCTGTAATTGGAA (SEQ ID NO:7); 18S reverse: CCCTCCAATGGATCCTCGTT (SEQ ID NO:8).
  • IL- 17 forward CCGCAATGAAGACCCTGATAGA (SEQ ID NO:9);
  • IL-17 reverse TCATGTGGTGGTCCAGCTTTC (SEQ ID NO:10)
  • MOG 35-55 using a commercially available ELISA kit (Biolegend, San Diego, CA, USA). The lymphocytes were collected from the mice 9 days after inoculation with MOG 35 . 55 with or without rivastigmine treatment (0.75 mg/kg, s.c).
  • Flow cytometry analysis Surface markers of leukocytes from pooled spleen cells obtained from control and treated mice (as described in the "Mouse lymphocyte proliferation assay") were analyzed. Cell suspensions were prepared as described previously (Irony-Tur-Sinai et ah, 2006). Stained cells were counted in a fluorescence- activated cell sorter (FACScan, Becton Dickinson, San Jose, CA USA).
  • anti-CD4-FITC (clone GK 1.5, Pharmingen, USA), anti-CD8-FITC (clone 53-6.7, Pharmingen, USA), anti-CD 1 Ib-FITC (clone Ml/70, Pharmingen, USA), anti-MHC class II-FITC (clone 25-5-16S, Serotec, Kidlington, UK).
  • FITC-conjugated rat IgG 2bK (clone A 95-1, Pharmingen, USA)
  • FITC-conjugated rat IgG 2a ⁇ (clone R35-95, Pharmingen, USA)
  • FITC-conjugated mouse IgM (cat.no. X 0934, DakoCytomation, Denmark).
  • mice were placed into the water, facing the maze wall, from one of four start positions evenly spaced around the pool (N, S, E & W). Start positions were chosen randomly at the beginning of each day for all mice. If the mouse failed to find the escape platform within 120 s it was placed on it for 20 sec and then removed from the pool. The mouse was given two trials a day for 5 days between 15:00 and 19:00 hr with an inter-trial interval of 15 min (Wang et al, 2000).
  • MOG- induced EAE mice were treated from the day of induction with 0.75 mg/kg (s.c). This dose of drug inhibited brain cholinesterase by 56.1 ⁇ 2.0% and muscle cholinesterase by 42.4 ⁇ 2.8%, 45 min after injection. Treatment with rivastigmine reduced disease severity and cumulative score by 50- 54% (Fig. 8A and Table 6), and delayed disease onset by 3.5 days (p ⁇ 0.001).
  • a nicotinic receptor blocker, mecamylamine was tested.
  • mice were inoculated daily s.c. with 0.75 mg/kg rivastigmine and with saline in the control group.
  • mice were implanted s.c. with miniosmotic pumps delivering rivastigmine at 4.8 mg/kg/day (see materials and methods) and with saline in the control group.
  • Example 2.2 Attenuation of CNS inflammation, demyelination and neuronal damage by rivastigmine treatment
  • Example 2.3 Rivastigmine treatment reduced MOG-specific T-cell proliferation and pro-inflammatory cytokine production
  • T-cell reactivity was further tested at 14, 21 and 28 days after immunization, corresponding to disease onset, peak and chronic phase, respectively.
  • Figure 15A T-cell proliferation was reduced by 40-80% following rivastigmine treatment as well as the production of pro inflammatory cytokine (40-80%) ( Figure 15B-D).
  • Example 2.4 Effect of rivastigmine on T-cells is ⁇ 7 nAChR dependent
  • the effect of rivastigmine was abolished by ⁇ -bungarotoxin ( ⁇ -btx) a nicotinic antagonist of neuronal and muscle nicotinic receptors. Since the muscle-type nAChR is not expressed on T-cells, ⁇ -btx blockade can be attributed to the ⁇ 7 nAChR. This was confirmed by pre-incubation of T-cells with anti-sense (AS) to this receptor and to the ⁇ 5 nAChR.
  • AS anti-sense
  • ⁇ 7 mRNA was down-regulated by this protocol
  • cells were incubated with rivastigmine and tested for its ability to suppress mitogen-induced proliferation. It was found that T-cells treated with AS- ⁇ 7 were less sensitive to the effects of rivastigmine, while those treated with AS- ⁇ 5 were still responsive (Fig. HC).
  • Example 2.5 Treatment with rivastigmine reduced number of MHC-II + cells
  • Splenocytes from animals treated with the AChEI were analyzed for several cell markers associated with the inflammatory response and antigen presentation.
  • the number of MHC-II + cells was reduced by 30% (from 47% to 32%) (Fig. 12). There was no change in the intensity of the signal, indicating that the number of MHC-II + cells was reduced, and not the number of MHC-II molecules expressed per cell. This was accompanied by a reduction in CDl Ib + (macrophages) (from 28% to 19%), whereas there was no change in CDl Ic + (dendritic cells) or CD19 + (B-cells). Taken together these data support that rivastigmine treatment affected macrophage antigen presentation ability.
  • Example 2.6 Improvement of spatial memory function upon rivastigmine treatment
  • Vagus nerve stimulation attenuates the systemic inflammatory response to endotoxin. Nature 405: 458—462.
  • Kawashima, K., Fujii, T. 2003 a The lymphocytic cholinergic system and its contribution to the regulation of immune activity. Life Sci.74 675-696.
  • Nizri E., Irony-Tur-Sinai, M., Lavon, I., Meshulam, H., Amitai, G., Brenner, T., 2007a.
  • IBU-Octyl-Cytisine a novel bifunctional molecule eliciting anti-inflammatory and cholinergic activity, ameliorates CNS inflammation by inhibition of T-cell activity.
  • Nizri, E., et al., 2007b The role of cholinergic balance perturbation in neurological diseases. Drug News Perspect. 20, 421-9.
  • Nicotinic acetylcholine receptor alpha7 subunit is an essential regulator of inflammation. Nature. 421:384-388.

Abstract

La présente invention concerne l'utilisation de rivastigmine, de carbamates de phényle afférents et de sels de ceux-ci, dans la modulation de la sclérose en plaques (MS) et des troubles associés. La présente invention porte sur des compositions comprenant de la rivastigmine et sur des procédés d'utilisation de ces dernières pour inhiber les symptômes cliniques associés à l'inflammation chez un sujet souffrant de sclérose en plaques, pour améliorer la fonction motrice et pour inhiber la neurodégénérescence et la progression de la maladie chez les patients atteints de sclérose en plaques.
PCT/IL2008/001126 2007-08-14 2008-08-14 Carbamates de phényle destinés au traitement de la sclérose en plaques WO2009022345A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US95566207P 2007-08-14 2007-08-14
US60/955,662 2007-08-14

Publications (1)

Publication Number Publication Date
WO2009022345A1 true WO2009022345A1 (fr) 2009-02-19

Family

ID=39864760

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IL2008/001126 WO2009022345A1 (fr) 2007-08-14 2008-08-14 Carbamates de phényle destinés au traitement de la sclérose en plaques

Country Status (1)

Country Link
WO (1) WO2009022345A1 (fr)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102846612A (zh) * 2011-06-30 2013-01-02 复旦大学 石杉碱甲在制备防治多发性硬化疾病药物中的应用
US20130184338A1 (en) * 2011-12-27 2013-07-18 Bio-Pharm Solutions Co., Ltd. Phenylpropyl carbamate derivatives for use in preventing or treating multiple sclerosis
WO2013118126A1 (fr) 2012-02-12 2013-08-15 Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd. Thérapie au ladostigil pour immunomodulation

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999034782A1 (fr) * 1998-01-12 1999-07-15 Novartis Ag Systeme transdermique contenant un antioxydant
US20030039692A1 (en) * 1998-10-01 2003-02-27 Jorg Ogorka Sustained release oral formulations
US20030119832A1 (en) * 1999-10-19 2003-06-26 David Goldblum Treatment of ocular disorders
US20060183733A1 (en) * 2005-02-11 2006-08-17 Stephen Wills Treating microvasculature diseases with acetyl cholinesterase inhibitors

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999034782A1 (fr) * 1998-01-12 1999-07-15 Novartis Ag Systeme transdermique contenant un antioxydant
US20030039692A1 (en) * 1998-10-01 2003-02-27 Jorg Ogorka Sustained release oral formulations
US20030119832A1 (en) * 1999-10-19 2003-06-26 David Goldblum Treatment of ocular disorders
US20060183733A1 (en) * 2005-02-11 2006-08-17 Stephen Wills Treating microvasculature diseases with acetyl cholinesterase inhibitors

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
NIZRI ET AL: "Anti-inflammatory properties of cholinergic up-regulation: A new role for acetylcholinesterase inhibitors", NEUROPHARMACOLOGY, vol. 50, no. 5, 1 April 2006 (2006-04-01), PERGAMON PRESS, OXFORD, GB, pages 540 - 547, XP005353225, ISSN: 0028-3908 *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102846612A (zh) * 2011-06-30 2013-01-02 复旦大学 石杉碱甲在制备防治多发性硬化疾病药物中的应用
US20130184338A1 (en) * 2011-12-27 2013-07-18 Bio-Pharm Solutions Co., Ltd. Phenylpropyl carbamate derivatives for use in preventing or treating multiple sclerosis
US9624164B2 (en) 2011-12-27 2017-04-18 Bio-Pharm Solutions Co., Ltd. Phenyl carbamate compounds for use in preventing or treating epilepsy
WO2013118126A1 (fr) 2012-02-12 2013-08-15 Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd. Thérapie au ladostigil pour immunomodulation
US9867798B2 (en) 2012-02-12 2018-01-16 Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd. Ladostigil therapy for immunomodulation

Similar Documents

Publication Publication Date Title
RU2264813C2 (ru) Применение ретигабина для невропатических болей
US20020049245A1 (en) Tumor necrosis factor alpha (TNF-alpha) inhibiting pharmaceuticals
US20140303217A1 (en) Dosing regimen for a selective s1p1 receptor agonist
US20210069209A1 (en) Novel pharmaceutical compositions and methods for menopause related anxiety and depression
US11607389B2 (en) Delayed release deferiprone tablets and methods of using the same
CN116712423A (zh) 治疗特定患者群体的神经变性病症的方法
JP2005508346A (ja) 免疫炎症疾患の治療のための組合せ
Gilgun-Sherki et al. Anti-inflammatory drugs in the treatment of neurodegenerative diseases: current state
US11744829B2 (en) Methods for treating neurological conditions and exposure to nerve agents
JP2009501223A (ja) 癲癇発生の処置法
RU2621129C2 (ru) Композиция и способ лечения аутоиммунного заболевания
KR20120050473A (ko) 탈수초성 질환 및 다른 신경계 질환을 앓는 환자에서 신경-인지 및/또는 신경-정신 손상을 개선하기 위한 4-아미노피리딘의 용도
Pouzol et al. Therapeutic potential of ponesimod alone and in combination with dimethyl fumarate in experimental models of multiple sclerosis
Reijerkerk et al. Systemic treatment with glutathione PEGylated liposomal methylprednisolone (2B3-201) improves therapeutic efficacy in a model of ocular inflammation
US20130230586A1 (en) Treatment of Tinnitus and Related Auditory Dysfunctions
WO2009022345A1 (fr) Carbamates de phényle destinés au traitement de la sclérose en plaques
US6531493B1 (en) 3-cyclopropylmethoxy-4-difluoromethoxy-N-(3,5-dichloropyrid-4-yl)benzamide in the treatment of multiple sclerosis
CN101610760A (zh) 恶病质的治疗
Kieseier et al. Oral disease-modifying treatments for multiple sclerosis: the story so far
WO2018116293A1 (fr) Combinaisons de médicaments à faibles doses destinées à être utilisées dans la prévention et le traitement d'une lésion neuronale
WO2017106584A1 (fr) Traitement du système nerveux central et de troubles mentaux avec des agonistes des récepteurs bêta-3 adrénergiques
Davatchi et al. Treatment of Behcet’s disease
WO2009022346A2 (fr) Carbamates de phényle pour traiter l'inflammation gastro-intestinale
KR101016927B1 (ko) 알츠하이머 질환의 치료용 ｎｍｄａ 길항제 및 아세틸콜린에스테라제 억제제의 조합물
JP2018531271A (ja) 静脈内バクロフェン及び治療方法

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 08789799

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 08789799

Country of ref document: EP

Kind code of ref document: A1