WO2009009956A1

WO2009009956A1 - A preparation method of sugar alcohol

Info

Publication number: WO2009009956A1
Application number: PCT/CN2008/001312
Authority: WO
Inventors: Jirong Liu; Yunfa Chi
Original assignee: Beijing Great-Genius Science & Technology Development Company
Priority date: 2007-07-13
Filing date: 2008-07-14
Publication date: 2009-01-22
Also published as: CN101092619A

Abstract

A preparation method of sugar alcohol is provided, which comprises integrating sugar reductase and the corresponding isomerase, phosphonate hydrolyase, epimerase and transhydrogenase into the chromosome of the host through homologous recombination method, such that the xylulokinase of the host is inactivated and the transformant can convert sugars into corresponding sugar alcohols, using the sugar metabolic pathway provided by gene recombination.

Description

Method for preparing sugar alcohol

Technical field

The invention belongs to the field of molecular biology, and discloses a method for preparing a sugar alcohol, which has the characteristics of low energy consumption and no pollution to the environment as compared with the conventional method. The sugar alcohol produced by the present invention can be used in food, beverage and the like industries. Background technique

Sugar alcohols such as sorbitol, erythritol, xylitol, etc., have been widely concerned because of their low calorie, metabolism and restriction of insulin, and the prevention of dental caries.

At present, a method for producing sugar alcohols is usually to convert sugar into sugar alcohol by a hydrogenation reduction reaction using a catalyst, for example, a plant having a higher xylose content, such as corn cob, is degraded by dilute acid digestion, and the wood is separated from the degradation product. The sugar is then subjected to a hydrogenation reduction process to produce xylitol. The production of sugar alcohol by this method has the disadvantages of high energy consumption and environmental pollution. Summary of the invention

The object of the invention is to enable microorganisms to convert sugar into sugar alcohols by homologous recombination of genes, thereby providing a low energy consumption and low pollution preparation method of sugar alcohols.

In order to achieve the above object, the present invention first provides a genetically engineered bacteria which utilizes a homologous recombination method to convert a sugar reductase and its corresponding sugar isomerase, phosphoglucose hydrolase, glycotopic enzyme and hydrogen to hydrogen. The coding gene of the enzyme is integrated into the chromosome of the host, and the corresponding xylulose kinase of the host is inactivated during the integration process, so that the obtained transformant can convert the corresponding sugar into a corresponding sugar metabolism pathway provided by genetic recombination. Sugar alcohol.

The above hosts include bacteria, fungi, actinomycetes, animal and plant cells, etc. Among these hosts, the cost of plant and animal cells is relatively high, and bacteria are generally considered to be preferred hosts. In the practice of the present invention, the host for the production of sugar alcohols is Corynebacterium glutamicum, which is currently widely used for the production of MSG.

The genetically engineered bacteria provided by the above method may be a genetically engineered bacteria that converts glucose into xylitol, and the inserted inactivated gene may be a xylose kinase gene, and the specific method is to The sequence flanking the glycan kinase gene and the xylose reductase gene, the xylose isomerase gene, the xylose hydrolase gene, the xylulose epitope enzyme gene, and the transhydrogenase gene are linked to each other, and the xylose kinase gene is flanked by The sequences are located at the 5' and 3' ends, respectively, and are integrated into the locus of the host xylulose kinase gene by homologous recombination and inactivate the gene. In an embodiment of the present invention, the preferred xylose reductase is derived from Neurospora, the xylose isomerase, the xylulose hydrolase, and the transhydrogenase are all derived from Escherichia coli, and the xylose phosphate epitope enzyme is derived from glutamine. Corynebacterium acidophilus.

As is known to those skilled in the art, each enzyme can carry its own promoter and ribosome binding sites, and all enzymes can share a promoter sequence.

For the preparation of xylitol, one promoter common to all enzymes may be an promoter of Corynebacterium glutamicum xylulose kinase or a promoter of Corynebacterium glutamicum lactate dehydrogenase.

Further, the present invention provides a method for producing a sugar alcohol which is obtained by converting the sugar into a sugar alcohol using the above genetically engineered bacteria. The fermentation can be carried out by an immobilization method well known to those skilled in the art. The present invention provides a preferred fermentation method, which is a mixture of sodium alginate solution and bacteria to prepare a mixture of sodium alginate at a final concentration of 1.8 to 2.2% and a bacterial content of about 10 ⁹ pfo/ml. The needle tube is dropped into a 5% CaCl ₂ solution and immobilized for 25-30 minutes; the particles are filtered out, washed with physiological saline, and the washed particles are loaded into an immobilization column, and under the action of a peristaltic pump, 0.5 M glucose was added from the bottom of the column at a column volume of 0.1 column volume per minute, and the reaction liquid flowing out from the top of the column was circulated to ensure that it could react with the genetically engineered bacteria in the immobilized column for 2 hours. Then, the reaction liquid was collected, separated by a fluidized bed, and crystallized to obtain a sugar alcohol.

In the present invention, the term "genetically engineered bacteria" refers to bacteria, fungi, actinomycetes, and plant and animal cells which have been genetically engineered.

The term "phosphohydrolase" means an enzyme having the activity of hydrolyzing a phosphate group, such as "phosphonuosone hydrolase" means an enzyme having a hydrolysis activity of xylulose phosphate;

The term "transhydrogenase" refers to a protease that can convert NADH and NADPH to each other. detailed description The following examples are intended to further illustrate the invention, but are not to be construed as limiting the invention. Modifications or substitutions of the methods, steps or conditions of the invention are intended to be within the scope of the invention.

The technical means used in the examples are conventional means well known to those skilled in the art unless otherwise specified. In the examples, the percentage (%) involved, unless otherwise specified, the percentage between liquids is a volume percentage, the percentage between solids is a weight percentage, and the percentage between solid and liquid is a weight to volume ratio (10%) That is, it means that 10 g of solids per 100 ml of liquid is contained.

The hexose monophosphate pathway is the primary pathway for providing cells with a reducing oxygen donor NADPH and the five carbon sugars required for cell replication. It is also the main pathway in the cell for converting 6 carbon sugars such as glucose into 5 carbon sugars, 4 carbon sugars and 7 carbon sugars.

Xylitol is a product mainly used for human consumption. Therefore, the use of microorganisms for biotransformation requires the use of strains that are harmless or less harmful to humans. Corynebacterium glutamicum is mainly used for the production of MSG and is widely considered to be a safe strain. Compared with other bacteria, Corynebacterium glutamicum has a characteristic that the hexose monophosphate pathway is highly active in the stationary phase of cell growth, and is particularly suitable for biotransformation using the active enzyme contained therein after immobilizing the bacteria. Through the metabolism study of Corynebacterium glutamicum, it is found that the lactate dehydrogenase promoter has high activity in the stationary phase of bacterial growth. Therefore, it is more suitable to place the relevant genes under the control of the promoter. Biotransformation of glucose.

From xylose to xylitol, NADPH is required as a cofactor and is completed by xylose reductase. Phosphoryl xylulose hydrolase and xylose isomerase are required for glucose to become xylose. At the same time, it is necessary to inactivate xylulose kinase which converts xylulose into xylulose in vivo to eliminate inefficient energy-consuming reactions in the body and convert more glucose into xylitol.

From glucose to xylitol, one molecule of NADPH is consumed, and from glucose to xylose, the bacteria produce two molecules of NADPH. To correct this imbalance, a transhydrogenase that converts NADPH and NADH into each other is required. . This allows the excess reduction of cells to be used in the oxidation of cells, supplying cellular energy and making more glucose. Change to xylitol.

The following is a detailed implementation of the present invention by using Corynebacterium glutamicum as an example. The gene sequences of all Escherichia coli and Corynebacterium glutamicum in the examples are from the genome-wide sequence listed on the website of www.tigr.org. Escherichia coli is K12-MG1655, site number is 168927; Corynebacterium glutamicum is ATCC13032 Bielfeld, site number is 196627, and GeneBank of R. sphaeroides xylose reductase is serial number AY876382.

1. Cloning of the homologous sequence of the xyloglucan kinase gene of Corynebacterium glutamicum:

1.1 According to the Corynebacterium glutamicum xylulose kinase gene and its flanking sequences, the following primers were designed to amplify the upstream and downstream sequences of the gene, and then the upstream and downstream sequences were ligated into a fragment by overlapping PCR. ν^ ΐ, Pstl, Nsil, Hindlll, Bspel, Xhol, Kpnl, EcoRl, Nhel, ApaLl and Xmal restriction sites were inserted in the middle of the two for sequential cloning.

1.1. IF XylUp 5 ' gaatccgcggccgccaccatcggcgttgattacgcatt

1.1.1R XylDn 5' aagcttatgcatggtaccgggcccgcggacaagcaaagccttgca

Ggattg (amplification product 534bp)

1.1.2 F Xy lUpl

5' cgcgggcccctgcagatgcataagctttccggactcgagggtaccgaattcgctagcgtgc accccgggttcggccatgagattgtggttcca

1.1.2R XylDnl gaatccgcggccgctgttcaatttggtgcccccctgatc (amplification product 643bp)

1.2 Preparation of Corynebacterium glutamicum Chromosomes DNA:

1.2.1 Corynebacterium glutamicum was grown overnight in LB (1% protein, 0.5% yeast powder, 0.5% NaCi, pH 7.5), and the precipitate was collected by centrifugation.

1.2.2 Suspension of the precipitate in 20% sucrose, 50 mmol/L Tris-HCI (pH 7.6) and 50 mmol

/L EDTA, then add lysozyme to a final concentration of 8 g / m, at 25

The reaction was carried out at ° C for 30 minutes.

1.2.3 Add 10% SDS to a final concentration of 0.5%, and proteinase K to a final concentration of 100 The microgram/ml was reacted at 37 ° C for 10 minutes and then further reacted at 75 ° C for 5 minutes. 1.2.4 Add an equal volume of phenol, mix it upside down ten times, and centrifuge at 3500 rpm for 10 minutes. 1.2.5 Take the supernatant, add 1/2 volume of phenol / chloroform / isoamyl alcohol (25: 24:1), mix and invert the card, and centrifuge at 3500 rpm for 10 minutes.

1.2.6 Take the supernatant, add 1/2 volume of chloroform / isoamyl alcohol (24: 1), mix it upside down ten times,

Centrifuge at 3500 rpm for 10 minutes.

1.2.7 Take the supernatant, add 2 volumes of absolute ethanol, and after 12000 rpm / centrifugation for 10 minutes, discard the supernatant, force into 70% ethanol, and rinse twice. Discard, please dry with air. 1.2.8 Dissolve in sterile water to a concentration of 10 ng / microliter.

1.3 PCR (polymerase chain reaction) amplification of the upstream and downstream sequences of the xyloglucan kinase gene of Corynebacterium glutamicum:

1.3.1 Amplification of the upstream sequence:

ΙΟ χ Ρήι buffer 5.0 μΐ

dNTP 2mM 5.0 μΐ

1.1.1Ρ 2μΜ 5.0 μΐ

1 ·1 ·1Ι 2μΜ 5.0 μΐ

Valley 1 Canine bacillus ^ ^DNAIO nano 5.0 μΐ

Sterile water 24. 5 μ1

Pfu (2.5 μ/μΐ) 0.5 μΐ

And amplification of downstream sequences:

lO x Pfu buffer 5.0 μΐ

dNTP 2mM 5.0 μΐ

1.1.2F 2μΜ 5.0 μΐ

1. Ι .2Ι 2μΜ 5.0 μΐ

Corynebacterium glutamicum chromosome DNA 10 ng / microliter 5.0 μΐ

Sterile water 24.5 μΐ

Pfu (2.5 μ/μΐ) 0.5 μΐ

Reaction procedure: 94 ° C for 2 minutes; then 94 ° C for 30 seconds, 55 ° C for 30 seconds, 72 ° C for 1 minute, cycle 35 times; finally 72 ° C for 10 minutes.

1.3.2 The PCR product was electrophoresed on 1.2% agarose gel, and then the upstream and downstream sequences were recovered by the gel recovery kit of Hangzhou Bori Company, and dissolved in 50 μl of sterile water for use. 1.4 Overlapping PCR amplification of the upstream and downstream sequences of the Corynebacterium glutamicum xylulose kinase gene: The following reaction system was established:

lOxPfo buffer 5.0 μΐ

dNTP 2mM 5.0 μΐ

1.1.ΙΡ2μΜ 5.0 μΐ

1.1.2Κ2μΜ 5.0 μΐ

Step 1.3.2 The upstream fragment obtained 3.0 μΐ

Step 1.3.2 The resulting downstream fragment 3.0 μΐ

Sterile water 19.5μ1

Pfu (2.5 μ/μΐ) 0.5 μΐ

Reaction procedure: 94 ° C for 2 minutes; then 94 ° C for 30 seconds, 55 ° C for 30 seconds, 72 ° C for 1 minute and 30 seconds, cycle 35 times; finally 72 ° C extension for 10 minutes.

The obtained PCR fragment was digested with Noil, and after electrophoresis on 1.2% agarose, it was recovered from the gel for use.

1.5 Construction of cloned homologous sequence fragments using plasmids:

1.5.1 Synthesize the following sequences:

1.5.1FBamHINotIEcoRI

Ggaggattcgcggccgcgaattctcc

1.5. lRBamHINotlEcoRI

Ggagaattcgcggccgcggatcctcc

1.5.2 Dissolve 1.5 μg of each of 1.5 IF and 1.5.1R in 20 μl of sterile water, denature at 95 ° C for 5 minutes, then slowly cool to 25 ° C, add 2.5 μl of 10 χ EcoRl buffer, One microliter of 20 units/microliter of Ecom and BamHL were each reacted at 37 ° C for 4 hours. Then add 180 μl of sterile water, add 50 μl of phenol/chloroform, mix by shaking, centrifuge at 12,000 rpm for 5 minutes, then add 20 μl of 3 M sodium acetate, pH 5.2, add 500 μl. The absolute ethanol was centrifuged at 12,000 rpm for 15 minutes and the supernatant was discarded. Rinse twice with 70% ethanol. After drying in air, add 20 μl of sterile water for use.

1. 5. 3 to 10.0 μl (1.0 μg) pUC18, add 4.0 μl of 10x EcoRl buffer, 24 μl of sterile water, add 1 μl of 20 units/μl of EcoRl each. After reacting with B rniHl for 4 hours at 37 ° C, 1 μl (1 unit / microliter) of calf intestinal alkaline phosphatase was added and reacted at 37 ° C for 30 minutes. Then add 180 μl of sterile water, add 50 μl of phenol/chloroform, mix by shaking, and centrifuge at 12,000 rpm for 5 minutes, then add 20 μl of 3 M sodium acetate, pH 5.2, and add 500 μl. Anhydrous ethanol was centrifuged at 12,000 rpm for 15 minutes, and the supernatant was discarded. Rinse twice with 70% ethanol. After drying in air, add 20 μl of sterile water for use.

4 Take 4 μl of each of the fragments obtained in steps 1.5.2 and 1.5.3, then add 1 μl of T4 DNA ligase buffer, 1 μl of T4 DNA ligase, and connect at 22 °C. 1 hour. Then, 5 μl (3 mg / ml) of yeast tRNA, and 5 μl of 3 M sodium acetate, pH 5.2, and 500 μl of absolute ethanol were added, and the core was centrifuged at 12,000 rpm for 15 minutes, and the supernatant was discarded. Rinse twice with 70% ethanol. After drying in air, 10 μl of sterile water was added, and the electrophoresis was transferred to E. coli and grown overnight on LB/ampicillin medium at 37 °C.

Identification of 5 plasmids. 'Pick a single colony and culture overnight in LB/ampicillin liquid. The corresponding plasmid was prepared and digested with 7 III and Noil, and the 410 bp fragment was released, and the desired plasmid was named pSZTC2000.

Construction of plasmids with homologous sequences:

PSZTC2000 was digested with enzyme and treated with calf intestinal alkaline phosphatase, and the fragment was recovered. And connected with the fragment obtained in step 1.4, precipitated by adding yeast tRNA, 3M sodium acetate and absolute ethanol, rinsed with 70% ethanol, electrolyzed into E. coli, cultured on LB/ampicillin medium at 37 °C. overnight. A single colony was picked and grown overnight in a liquid of LB/ampicillin. The corresponding plasmid was prepared and digested by NWI. The fragment of 1 177 bp was released, and the desired plasmid was designated as pSZTC 2001 after being correctly sequenced. Cloning of the original enzyme gene:

According to the published sequence of the genus Streptococcus mutans xylose reductase-based meat, the following design is designed. , for PCR amplification of the gene.

F NCXRF Xbal

5' ggagaattctctagaaacggaagaggatttttaagatggttcctgctatcaagctcaactccR NC XRR BspEI Xmal Nhel

5' ggagaattctccggacccgggcattccgctagcctaaccgaaaatccagaggttctcagcg

969bp

The genus Streptomyces sp., ATCC10333, grows in protein cum 5.0 g, maltose

40.0 g / liter of the medium was incubated at 30 ° C overnight. After diluting 1:10 on day 2, xylose was added to a final concentration of 1%, and after 3 hours of TC culture, the precipitate was collected by centrifugation. 1 ml of 1 ml of TRIzol RNA isolation reagent (purchased from Invitrogen) was added thereto. After shaking and mixing, and grinding through a mortar, add 0.2 liters of chloroform, mix, place at 25 ° C for 15 minutes, centrifuge at 10 ° C for 10 minutes; transfer the supernatant to a new centrifuge tube, add 0.5 亳The isopropanol was placed at 25 ° C for 15 minutes, centrifuged at 4 ° C for 10 minutes, the supernatant was taken, rinsed with 70% alcohol for 1 time, and dissolved in 12 μl of water. All the centrifugation speed was 12,000 rpm.

Establish the following reaction system:

12.0 μΐ RNA from step 2.2

Random primer 0.5μ /μ1 3.0 μΐ

After mixing, incubate at 65 ° C for 5 minutes, then slowly cool to 25 'C and leave for 10 minutes before adding

10 AffinityScript RT Buffer 2.0μ1

dNTP 25 mM 0.8μ1

Rnase inhibitor 40μ/μ1 Ι.ΟμΙ

Reverse transcriptase Ι.ΟμΙ

(purchased from Stratagene)

The reaction was carried out at 42 ° C for 2 hours.

Establish the following reaction system:

10 Pfu DNA Polymerase Buffer 5.0 μΐ

dNTP 2mM 5.0 μΐ

2.1. IF 2μΜ 5.0 μΐ

2.1.1R 2μΜ 5.0 μΐ

Step 2.3 cDNA 1.0 μΐ Ρίιι 2.5μ/μ1 1.0 μΐ

dH ₂ 0 28.0 μΐ

Reaction procedure: 94 ° C for 2 minutes; then 94 ° C for 15 seconds, 50 ° C for 15 seconds, 72 ° C for 1 minute, cycle 30 times; finally at 72 ° C for 10 minutes.

The obtained PCR fragment was digested with EcoRl, cloned into pUC 19 treated with the same digestion, and confirmed by sequencing, and designated as pSZTC2002.

3. Cloning of the E. coli phosphoxidose hydrolase YidA gene

3. 1 According to the published sequence, the following primers are specially designed for the amplification of the YidA gene: 3. 1. 1F EC YidAFXbal

5' ggagaattctctagaccaatctacctggggaactcatggctattaaactcattgctatcgatatgg 3. 1 . 1R EC YidAR BspEIXmalNhel

Gaattctccggacccgggcattccgctagcttaattcagcacatacttctcaatagcaaacg (amplification product 813bp)

3.2 Prepare E. coli chromosomal DNA according to step 1.2 and make it to a final concentration of 10 ng

/ Microliter.

3.3 Establish the following reaction system:

10 Pfti buffer 5.0 μΐ

dNTP 2mM 5.0 μΐ

3.1.1Ρ 2μΜ 5.0 μΐ

3· 1.1Ι 2μΜ 5.0 μΐ

E. coli chromosome DNA 10 ng / microliter 5.0 μΐ

Sterile water 24.5 μΐ

Pfu (2.5 μ/μΐ) 5.0 μΐ

The obtained PCR fragment was digested with EcoM, cloned into pUC 19 treated with the same digestion, and confirmed by sequencing, and designated as pSZTC2003.

4. Cloning of the E. coli xylose isomerase gene:

4. 1 According to the published sequence, the following primers are specially designed for gene amplification: 4. 1. IF EC XIF Xbal

5 ' ggagaattctctagaacctgattatggagttcaatatgcaagcctattttgaccagctc

4. 1. 1R EC XIR BspEI Xmal Nhel

5' gaagaattctccggacccgggcattccgctagcttatttgtcgaacagataatggtttaccagattt

(amplification product 1323 bp)

4.2 Prepare E. coli chromosomal DNA according to step 1.2 and make it to a final concentration of 10 ng

/ Microliter.

4. 3 Establish the following reaction system:

lO x Pfo buffer 5.0 μΐ

dNTP 2mM 5.0 μΐ

4.1. IF 2μΜ 5.0 μΐ

4.1.1Ι 2μΜ 5.0 μΐ

E. coli chromosome DNA 10 ng / microliter 5.0 μΐ

Sterile water 24.5 μΐ

Pfu (2. 5 μ/μΐ) 5.0 μΐ

Reaction procedure: 94 ° C for 2 minutes; then 94 ° C for 15 seconds, 50 ° C for 15 seconds, 72 ° C for 1 minute and 30 seconds, cycle 30 times; finally at 70 ° C for 10 minutes.

The obtained PCR fragment was digested with EcoR1, cloned into pUC19 treated with the same digestion, and confirmed by sequencing, and designated as pSZTC2004.

5. Cloning of the NADH/NADPH transhydrogenase gene from Escherichia coli:

5. 1 Based on the published sequence, the following primers were specifically designed for the amplification of the NADH/NADPH transhydrogenase gene:

5. l . IF EC TRAF Xbal

5' ggactgcagtctagaccggcggcgaaggcgctgcaatgggcctggttaagcaagg

5. 1. 1R EC TRAR BspEI Xmal Nhel

5' gaactgcagtccggacccgggcattccgctagcttaaaacaggcggtttaaaccgtttaac (amplification product 1335 bp)

5.2 Prepare E. coli chromosomal DNA according to step 1.2 and make it to a final concentration of 10 ng

/ Microliter. 5.3 Establish the following reaction system:

lO x Pfu buffer 5.0 μΐ

dNTP 2mM 5.0 μΐ

5. 1. ΙΡ 2μΜ 5.0 μΐ

5. 1. 1Κ 2μΜ 5.0 μΐ

E. coli chromosome DNA 10 ng / microliter 5.0 μΐ

Sterile water 24.5 μΐ

Pfu (2.5 μ/μΐ) 5.0 μΐ

Reaction procedure: 94 ° C for 2 minutes; then 94 ° C for 15 seconds, 50 Γ 15 seconds, 72 ° C for 1 minute 30 seconds, cycle 30 times; finally at 72 ° C for 10 minutes.

The obtained PCR fragment was digested with Pst\, cloned into pUC 19 treated with the same digestion, and confirmed by sequencing, and designated as pSZTC2005.

6. Cloning of the xylulose epitope enzyme gene of Corynebacterium glutamicum:

6. 1. According to the published sequence, the following primers were specially designed for the amplification of the xylosidase gene of Corynebacterium glutamicum:

6. l . IF CGEPIF Xbal

Ggagaattctctagaagagggctatgatttagggcatggcacaacgtactccactaatc

6. 1. 1R CGEPI BspEI Xmal Nhel

5' ggagaattctccggacccgggcattccgctagcttactgcgcgagtgctcg (amplification product 660bp)

6. 2 Establish the following reaction system:

The obtained PCR fragment was digested with EcoRl and cloned into the same digestion treatment. In pUC19, after sequencing confirmation, it was named pSZTC2006.

7. Cloning of the lactic acid dehydrogenase promoter of Corynebacterium glutamicum:

7. 1 Based on the published sequence, the following primers were specifically designed to amplify the lactate dehydrogenase promoter sequence:

7. l . IF CGLDHPF Xbal

5 ' ggagaattctctagacggaactagctctgcaatgacctg

7. 1. 1R CGLDHPR BspEI Xmal Nhel

5' ggagaattctccggacccgggcattccgctagccgatcccacttcctgatttccctaa (amplification product 348bp)

7.2 Establish the following reaction system:

lO x Pfo buffer 5.0 μΐ

dNTP 2mM 5.0 μΐ

7. 1. ΙΡ 2μΜ 5.0 μΐ

7. 1. 1ί12μΜ 5.0 μΐ

Corynebacterium glutamicum chromosome DNA 10 ng / microliter 5.0 μΐ

Sterile water 24.5 μΐ

Piu (2.5 μ/μΐ) 0.5μ1

Reaction procedure: 94 ° C for 2 minutes; then 94 ° C for 15 seconds, 50 ° C for 15 seconds, 72 ° C for 30 seconds, cycle 30 times; finally at 72 ° C for 10 minutes.

The obtained PCR fragment was digested with EcoRl, cloned into pUC19 treated with the same restriction enzyme, and confirmed by sequencing, and designated as pSZTC2007.

8. Cloning of the chloramphenicol resistance gene:

8. 1 Based on the published sequence of pACYC184, the following primers were designed to amplify the chloramphenicol resistance gene:

8. l . IF CATF Xbal

5' ggactgcagtctagacaggagctaaggaagctaaaatggagaaaaaaatcactggatataccacc

8. 1. 1R CATR BspEI Xmal Nhel

5' ggactgcagtccggacccgggcattccgctagctccggacccgggcattccgctagcttacgcccc gccctg ccac (amplification product 660bp) 8.2 Establish the following reaction system:

lO x Pfo buffer 5.0 μΐ

dNTP 2mM 5.0 μΐ

8. 1. ΙΡ 2μΜ 5.0 μΐ

8. 1. \Κ 2μΜ 5.0 μΐ

pACYC184DNA 10 ng / μl 5.0 μΐ

Sterile water 24.5 μΐ

Pfti (2.5 μ/μΐ) 0.5μ1

Reaction procedure: 94 ° C for 2 minutes; then 94 ° C for 15 seconds, 5 (TC 15 seconds, 72 ° C for 1 minute, cycle 30 times; finally extended at 72 ° C for 10 minutes.

The obtained PCR fragment was digested with ftrt, cloned into pUC19 treated with the same digestion, and confirmed by sequencing, and designated as pSZTC2008.

9. Sequential cloning of xylose reductase, xylulose hydrolase, xylose isomerase, chloramphenicol resistance gene, xylulose epitope enzyme and NADAH/NADPH transhydrogenase:

9.1 pSZTC2001 was digested with N3⁄4I and ^wl, and treated with calf intestinal alkaline phosphatase, and the fragment was recovered for use.

9.2 pSZTC2002, pSZTC2003, pSZTC2004, pSZTC2005, pSZTC2006, pSZTC2007 and pSZTC2008 were digested with Xba\ and BspEl, respectively, and 969 bp, 813 bp, 1323 bp, 1335 bp, 660 bp, 348 bp and 660 bp fragments were recovered from the agarose gel.

3. The fragment obtained by 9.1 was ligated with the 348 bp fragment obtained from pSZTC2007, electroporated into E. coli, and the obtained single plasmid was subjected to EcoRL. The 1525 bp fragment was released, and one of the desired plasmids was used. Named pSZTC2009. .4 pSZTC2009 was digested with Nhel and Xmal and treated with calf intestinal alkaline phosphatase. The recovered fragment was ligated with the 969 bp fragment obtained from pSZTC2002, electroporated into E. coli, and the obtained single plasmid was used. £ RI digestion, where the 2494 bp fragment was released, one of the required plasmids was named pSZTC2010.

.5 pSZTC2010 was digested with Mel and ^, and the calf intestinal alkaline phosphatase was used. The recovered fragment was ligated with the 813 bp fragment obtained from pSZTC2003, electroporated into E. coli, and the obtained single plasmid was digested with coRI, and the 3307 bp fragment was released, and the desired plasmid was used. Named pSZTC2011.

pSZTC201 1 was digested with N1⁄2I and wwl and treated with calf intestinal alkaline phosphatase. The recovered fragment was ligated with the 1323 bp fragment obtained from pSZTC2004, electroporated into E. coli, and the obtained single plasmid was treated with EcoRl. For those who released the 4630 bp fragment, one of the required plasmids was named pSZTC2012.

pSZTC2012 was digested with Nhel and Xmal, and treated with calf intestinal alkaline phosphatase. The recovered fragment was ligated with the 660 bp fragment obtained from pSZTC2008, electroporated into E. coli, and EcoRl was used for the obtained single plasmid. For those who released the 991 bp and 4109 bp fragments, one of the required plasmids was named pSZTC2013.

pSZTC2013 was digested with Nhe\ and Xm d and treated with calf intestinal alkaline phosphatase. The recovered fragment was ligated with the 660 bp fragment obtained from pSZTC2006, electroporated into E. coli, and the obtained single plasmid was used. EcoRl For the release of the 1651 bp and 4109 bp fragments, one of the required plasmids was named pSZTC2014.

pSZTC2014 was digested with Nhel and Xmai and treated with calf intestinal alkaline phosphatase. The recovered fragment was ligated with the 1335 bp fragment obtained from pSZTC2005, electroporated into E. coli, and the obtained single plasmid was released with JScoRl. For the 1143 bp, 1843 bp and 4109 bp fragments, one of the required plasmids was named pSZTC2015.

Construction of xylitol-producing Corynebacterium glutamicum and production of xylitol

The pBSZTC2015 was digested with Nort, and a 7095 bp fragment was recovered to have a fragment amount of 5 μg. Then connect with T4 DNA ligase, add yeast tRNA, 3M The precipitate was recovered from sodium acetate and absolute ethanol at 70 ° /. The ethanol was rinsed twice and then electrolyzed to Corynebacterium glutamicum at 2500 volts and then regenerated on LB/agar medium containing 10 μg/liter chloramphenicol. The obtained chloramphenicol-resistant colonies were identified by using 1. 1. IF and 2. 1. 1R, 5. 1. IF and 5. 1. 1R two pairs of primers, and those having 969 bp and 1335 bp fragments were positive strains. A total of 20 positive strains were obtained, and 3 of them were picked and named as BSZTC2000-2.

10.2 BSZTC2000-2002 was grown overnight in LB/chloramphenicol medium, and the precipitate was collected. After rinsing with 0.1M phosphate buffer, the sodium alginate solution was mixed with the bacteria to make the final concentration of sodium alginate 2%. The bacterial content is about 10 ⁹ pfb/ml; the sodium alginate and the bacterial mixture are dropped into a 5% CaCl ₂ solution by a needle tube, and fixed for 8 hours; the particles are filtered out, washed with physiological saline, and used. .

10.3. The granules obtained in step 10.2 were placed in an immobilization column, and 0.5 M glucose was added from the bottom of the column according to a volume of 0.1 volume per minute under the action of a peristaltic pump to circulate the reaction liquid flowing from the top of the column to ensure The bacteria in the immobilized column were reacted for 2 hours. The reaction solution is then collected, separated by a fluidized bed, and crystallized to obtain xylitol. After high pressure liquid phase analysis, the conversion rates of glucose were 66.8, 68.3% and 70%, respectively. BRIEF DESCRIPTION OF THE SEQUENCE LISTING: SEQ ID N0.1 and 2 in the sequence listing are 1. l. IF XylUp and 1. 1. IR XylDn nucleotide sequence; SEQ ID N0.3 and 4 are 1. 1.2FXylUp 1 and 1. IF NCXRFXbal SEQ ID NO. 7 and 8 are respectively 1. 1. IF NCXRFXbal SEQ ID NO. 7 and 8 are respectively 1.5. IF BamHINotlEcoRI and 1.5. IR BamHINotlEcoRI nucleotide sequence; SEQ ID NO. And 2. 1. IR NC XRR BspEI Xmal Nhel nucleotide sequence; SEQ ID NO. 9 and 10 are respectively 3. 1. IF EC YidAFXbal and 3.1. IR EC YidAR BspEIXmalNhel nucleotide sequence; SEQ ID NO. 11 and 12 are respectively 4. 1. IF EC XIFXbal and 4. 1. IR EC XIR BspEIXmalNhel nucleotide sequence; SEQ ID N0.13 and 14 are respectively 5. 1. IF EC TRAFXbal and 5. 1. IR EC Nucleotide sequence of TRAR BspEIXmalNhel; SEQ ID NO. 15 and 16 are respectively 6. 1. IF CGEP1FXbal and 6.1.1 RCGEPIBspEIXmalNhel nucleotide sequence; SEQ ID NO. 17 and 18 are respectively 7. 1. IF CGLDHPF Xbal And 1. 1. IR CGLDHPR BspEIXmalNhel nucleotide sequence; SEQ ID NO. 19 and 20 are 8. 1. IF CATFXbal and 8. 1. IR CATR BspEIXmalNhel nucleotide sequence. Industrial applicability The invention provides a method for preparing a sugar alcohol, which utilizes a homologous recombination method to integrate a sugar reductase and its corresponding glycogen isomerase, phosphoglucose hydrolase, glycosylase and transhydrogenase encoding genes. On the chromosome of the host, the corresponding glycokinase of the host is inactivated during this integration process, so that the obtained transformant can convert the corresponding sugar into the corresponding sugar alcohol by utilizing the sugar metabolic pathway provided by genetic recombination. In the experiment for converting xylitol from Corynebacterium glutamicum, the conversion rate of glucose to xylitol by the method of the present invention can reach 70% or more, indicating that the method of the present invention is expected to be used for large-scale industrial production.

Claims

Claim

A genetically engineered strain obtained by the following method: using a homologous recombination method, a sugar reductase and its corresponding sugar isomerase, phosphoglucose hydrolase, glycoside enzyme and transhydrogenase The coding gene is integrated into the chromosome of the host, and the corresponding glycokinase of the host is inactivated during this integration process, so that the obtained transformant can convert the corresponding sugar into the corresponding sugar alcohol by using the sugar metabolic pathway provided by genetic recombination.

2. The genetically engineered bacteria according to claim 1, which is obtained by the following method: a flanking sequence of a glycokinase gene and a corresponding sugar reductase gene, a sugar isomerase gene, a phosphohydrolase gene, a glycoform The enzyme gene and the transhydrogenase gene are ligated, and the flanking gene is flanked at the 5th and 3rd ends, respectively, and integrated into the position of the host glycokinase gene by homologous recombination, and the gene is inactivated.

3. The genetically engineered bacteria according to claim 1, wherein the sugar reductase is xylose reductase, the sugar isomerase is xylose isomerase, and the sugar hydrolase is xylone The glycohydrolase, the glycotopic enzyme is a xylulose epitope enzyme.

The genetically engineered bacterium according to claim 3, wherein the xylose reductase is derived from Neurospora crassa.

The genetically engineered bacterium according to claim 3, wherein the xylose isomerase is derived from Escherichia coli.

The genetically engineered bacterium according to claim 3, wherein the phosphoxyl ketose hydrolase is derived from Escherichia coli.

The genetically engineered bacteria according to claim 3, wherein the transhydrogenase is derived from Escherichia coli.

The genetically engineered bacterium according to claim 3, wherein the phosphoxyl ketose epitope enzyme is derived from Corynebacterium glutamicum.

The genetically engineered bacteria according to any one of claims 3 to 8, wherein the host is Corynebacterium glutamicum.

The genetically engineered bacteria according to claim 9, wherein the recombinant sequence is The promoter is a promoter of Corynebacterium glutamicum xylulose kinase, or a promoter of L. glutamicum lactate dehydrogenase.

11. Use of the genetically engineered bacteria according to any one of claims 1 to 10 for the preparation of a sugar alcohol.

12. A process for the preparation of a sugar alcohol which comprises converting a sugar into a sugar alcohol using a genetically engineered bacteria as described in claims 1 to 10.

13. The method of claim 12, wherein the sugar alcohol is produced by an immobilized fermentation process.