CN105624077B

CN105624077B - Sequential enzyme surface co-display system and application thereof

Info

Publication number: CN105624077B
Application number: CN201410616804.4A
Authority: CN
Inventors: 刘爱骅; 梁波
Original assignee: Qingdao Institute of Bioenergy and Bioprocess Technology of CAS
Current assignee: Qingdao Institute of Bioenergy and Bioprocess Technology of CAS
Priority date: 2014-11-05
Filing date: 2014-11-05
Publication date: 2020-09-18
Anticipated expiration: 2034-11-05
Also published as: CN105624077A

Abstract

The invention relates to the technical field of biotechnology and analysis, in particular to a sequential enzyme proportional bacterial surface co-display system and application thereof. The sequential enzyme surface co-display system comprises a gene sequence (ga) for coding a target protein saccharifying enzyme, a gene sequence (gdh-m) for a glucose dehydrogenase mutant, a gene sequence (coh-dock) for cohesin-dockerin protein and a gene sequence inaPb-N for an ice nuclear protein N-terminal structural domain responsible for transmembrane localization and transport. The bacterial surface display system is used for detecting starch, and the method for detecting the starch is high in sensitivity and simple. The whole-cell catalyst can be applied to the fields of biosensing, food industry, medicine and health, biological energy and the like.

Description

Sequential enzyme surface co-display system and application thereof

Technical Field

The invention relates to the technical field of biotechnology and analysis, in particular to a sequential enzyme surface co-display system and application thereof.

Background

Sequential enzyme sensors refer to the sequential, coordinated completion of a series of catalytic reactions by a variety of related enzymes. The substrate is catalyzed by two steps of enzymes to generate a final product and a byproduct, the byproduct generally has chemical or physical activity and can be converted into a signal to be detected, and the concentration of the substrate is determined according to the detection signal. For example, starch or maltose is hydrolyzed by saccharifying enzyme (GA) to produce glucose, and the glucose is oxidized by Glucose Oxidase (GOD) to produce gluconolactone and hydrogen peroxide, which can be oxidized on an electrode to produce current, thereby realizing the detection. The preparation of the sequential enzyme sensor generally fixes several enzymes on an electrode by methods of chemical crosslinking, embedding and the like, and because the affinities of different enzymes and crosslinking molecules are different, the proportion of the enzymes after fixation is difficult to control, and the accuracy of a detection result is easily influenced. And the spatial position and orientation among the enzymes are uncertain, and the distribution of the active centers of the enzymes after fixation is in a disordered state, thereby influencing the rate of the total reaction. Therefore, the conventional sequential enzyme sensor generally has the problems of poor stability, low sensitivity and poor interchangeability, which is a bottleneck for restricting the development and application of the sequential enzyme sensor. In recent years, various dual-enzyme sensors have been developed by improving the immobilization mode of enzymes, and the stability of the sensors has been improved to some extent. However, excessive chemical cross-linking can lose enzyme activity and reduce assay efficiency. Through molecular level control, the activity of enzyme in the immobilization process can be effectively reserved, and the spatial position of the enzyme can be controlled, however, the current research only stays on a single enzyme molecule, and the improvement effect on a sequential enzyme sensor is very little. A multi-enzyme co-display system is developed, the stability of sequential enzymes is expected to be improved, for example, Zhou et al use a maltose sensor as a research object, a solution of fusion protein is provided, molecular control is carried out from a gene level, a GOD-connecting peptide-GA fusion gene is obtained, the fusion protein is expressed in methylotrophic yeast, the ratio control of two enzymes is realized, the performance of the maltose sensor is obviously improved, and the defects are that the construction method of the fusion protein is complex and the efficiency is low. The development of a simpler sequential enzyme with controllable ratio of multiple enzymes for co-displaying whole cells is the key to solve the bottleneck problem of a sequential enzyme sensor.

saccharifying enzymes, also known as glucoamylase (EC.3.2.1.3, GA), which cleave α -1, 4 glucosidic bonds from non-reducing ends of starch, dextrin or oligosaccharide to produce β -D-glucose and also slowly catalyze α -1, 6 glucosidic bonds to produce glucose are widely distributed in microorganisms, such as yeast, Aspergillus niger, Rhizopus, Thermomyces lanuginosus, etc. in fungi, Bacillus, Thermoanaerobacter, Flavobacterium, etc. in bacteria, GA from Thermoanaerobacter tengconsii has excellent heat stability and is most suitable for use in food productsThe reaction temperature is 75 ℃, and the enzyme activity is basically not changed after the mixture is placed at 70 ℃ for 6 hours. Glucose dehydrogenase (EC 1.1.1.47, GDH) can catalyze glucose to be gluconolactone under the action of coenzyme, and the coenzyme used by different glucose dehydrogenases is different, and common Nicotinamide Adenine Dinucleotide (NAD) is used⁺) Nicotinamide Adenine Dinucleotide Phosphate (NADP)⁺) Pyrroloquinoline quinone (PQQ) and Flavin Adenine Dinucleotide (FAD). The mutant Q252L/E170R/V149K/G259A obtained by site-directed mutagenesis of GDH in Bacillus subtilis has good thermal stability and specificity, has half-lives of 21 days and 3.8 days at 60 ℃ and 65 ℃ respectively, and has no catalytic activity on other sugars such as xylose, galactose, mannose, fructose, sucrose, maltose, cellobiose, ribose and arabinose. The above GA and GDH may be composed of a sequential enzyme system in which the substrate starch or maltose is reacted by GA to produce glucose in the coenzyme NAD⁺Oxidized by GDH under the action of coenzyme NAD⁺Is reduced to NADH, which is measured at 340nm as the absorbance value to represent the total reactivity of the sequential enzyme.

The microbial surface display technology is characterized in that a target protein and an anchoring protein are fused by utilizing a genetic engineering means, so that the target protein is expressed in a host body and displayed on the surface of a microbial cell, and the displayed foreign protein still has an independent spatial structure and relatively complete biological function. Dockerin proteins capable of displaying complex proteins are mainly autotransporter proteins (ATs), Outer Membrane Proteins (OMPs) and Ice Nucleoproteins (INP). INP is found in the genera Erwinia, Pseudomonas and Xanthomonas. In supercooled water, it enables host cells to form ice crystal nuclei. INP consists of an N-terminal domain, a C-terminal domain, and a central domain, where the N-terminal domain is responsible for anchoring to the cell surface. In order to meet the requirements of different enzymatic reactions, a plurality of co-display systems are developed, for example, various lipases, organophosphorus hydrolases and the like are displayed on the surfaces of cells and are applied to the aspects of biocatalysis, environmental management and the like. However, in the above system where a plurality of enzymes are randomly clustered together, the precise ratio and order of the enzymes are not effectively controlled, which will directly affect the catalytic efficiency of the enzymes. Thus, if a system is available in which the ratio and order of one enzyme can be controlled, multiple enzymes can more efficiently utilize substrates for the cascade reaction, thereby maximizing the overall catalytic rate.

Cohesin-dockerin (Coh-Doc) is a pair of proteins with high affinity and is a major component of the fibrin scaffold proteins. Coh-Doc dissociation constant (K)_d) Less than 10^-9M, and also between different species, there is specificity, with coesin from one strain recognizing only the binding of dockerin from that strain or its complex with an enzyme, but not from other species. Cellulosomes are very complex cellulase systems fused to doc domains, brought together by a high affinity to the coh domain of a non-catalytic scaffold protein. The Cohesin-dockerin modules found so far are mainly present in c.thermocellum, c.cellulolyticum, a.cellulolyticus and Clostridium acetobutylicum. To date, researchers have utilized the Coh-Doc interaction to display and assemble multiple enzyme complex systems on the cell surface, with improved overall enzymatic reaction efficiency. In the aspect of a bacterial surface display system, researchers construct a bracket consisting of Coh structural domains of two different types on the surface of lactococcus lactis, and after glucuronidase and galactosidase are fused with corresponding doc structural domains, intracellular expression is carried out in escherichia coli, fusion protein is obtained through purification, and assembly is completed on the surface of lactococcus lactis, and experimental results show that the size and relative position of the protein can influence the catalytic efficiency of the whole complex. The saccharomyces cerevisiae cells can consume glucose to metabolize to produce ethanol, and by utilizing the characteristic, researchers adopt a agglutinin yeast cell surface display system to construct a cellulosome, so that the ethanol is directly produced from cellulose. For example, Tsai et al developed a yeast display system for small scaffold proteins consisting of three distinct Coh domains, an exo-cellulase, an endo-glucanase and a glucosidase fused to the corresponding Doc domains for intracellular expression in E.coli and finally fermentationThe mother cells are incubated with crude enzyme solution of Escherichia coli to complete the assembly of the cellulosome, and the system can realize the synergistic hydrolysis of cellulose. The yeast cellulose bodies constructed by Wen et al can ferment cellulose phosphate, and the ethanol yield is up to 1.8 g/L. In addition, the researchers assembled the three dehydrogenases in a certain order through the interaction of cohesin-dockerin, and showed that the generation efficiency of NADH was increased by 5 times on the surface of yeast. The construction of the above co-display systems is based on the interaction of cohesin-dockerin to display a plurality of enzymes on the surface of a cell such as yeast at a ratio of 1:1, however, there has been no report on the development of a co-display system in which sequential enzymes are displayed at other ratios. In addition, the above research is mainly used for the production of ethanol, and the research on the aspect of biological analysis is very little, so that the research and development of the sequential enzyme sensor by utilizing the sequential enzyme proportional co-display system is of great significance.

Disclosure of Invention

The invention aims to provide a sequential enzyme surface co-display system and application thereof.

In order to achieve the purpose, the invention adopts the technical scheme that:

a sequential enzyme surface co-display system comprises a gene sequence (ga) for coding a target protein saccharifying enzyme, a gene sequence (gdh-m) for a glucose dehydrogenase mutant, a gene sequence (coh-dock) for cohesin-dockerin protein and a gene sequence inaPb-N for an ice nucleoprotein N-terminal structural domain responsible for transmembrane localization and transport.

The display system is used for displaying the mutant encoding the protein saccharifying enzyme and the glucose dehydrogenase on the surface of the bacteria according to any number ratio.

Preferably, the number ratio of the saccharifying enzyme to the glucose dehydrogenase mutant is 1-20: 20-1;

further preferably, the number ratio of the glucoamylase to the glucose dehydrogenase mutant is 1-10: 10-1;

still more preferably, the number ratio of the glucoamylase to the glucose dehydrogenase mutant is 1-5: 5-1;

most preferably, the ratio of the number of saccharifying enzymes to the number of glucose dehydrogenase mutants is 1:1 or 2: 1.

The gene sequence ga for coding the target protein saccharifying enzyme is derived from Thermoanaerobacterctengconsisis and is obtained from a vector pET42 b/ga; the gene sequence gdh-m of the glucose dehydrogenase mutant of the coding target protein is derived from bacillus subtilis and is obtained from a vector pTInaPb-gdh;

the gene coding the ice nucleoprotein is fused with the genes coding two scaffold proteins of CohC and CohT, the fusion is connected to an expression vector pET-28a (+), the expression vector is transformed into Escherichia coli for expression, and the scaffold protein is displayed on the surface of the Escherichia coli through the anchoring effect of the ice nucleoprotein.

The glucoamylase and DocC protein are fused, and the glucose dehydrogenase mutant and DocT protein are fused and expressed in colibacillus cells.

The gene sequence of the cohesin-dockerin protein codes the dockerin protein as follows,

carrying out PCR amplification by using genomic DNA of strains Clostridium cellulolyticum H10 and Clostridium thermocellum TCC27405 as a template and DocC-F/DocC-R and DocT-F/DocT-R as primers to obtain gene fragments dock and doc of the gene fragments coding the dockerin protein, wherein the primers are DocC-F (5 '→ 3'): ACGCGTCGACACAGATCCTGACCCAGTAATTG and DocC-R (5 '→ 3'): CCGCTCGAGGGTAAGTAAGCTTCCAAGCAAC; DocT-F (5 '→ 3'): CATGCCATGGACACTAAATTATACGGCGACGTC and DocT-R (5 '→ 3'): CGCGGATCCGTTCTTGTACGGCAATGTATC.

The gene sequence of the cohesin-dockerin protein codes the cohesin protein as follows,

carrying out PCR amplification by taking the genomic DNA of strains Clostridium cellulolyticum H10 and Clostridium thermocellum TCC27405 as a template and CohC-F/CohC-R and CohT-F/CohT-R as primers to obtain gene fragments CohC and CohT for coding dockerin protein,

the primer is CohC-F (5 '→ 3'):

ATCCCTGGCGATTCTCTTAAAGCGCGGATCCATCCCTGGCGATTCTCTTAAAG

and CohC-R (5 '→ 3'):

TTGAGTACCAGGATCTATAGTTACACATAAGAATGCGGCCGCAGGTGTTGTAGGTGTTGTAGG；

CohT-F (5 '→ 3'): AATGCAACACCGACCAAG and CohT-R (5 '→ 3'): AGGTGTTGTAGGTGTTGTAGG.

The application of a sequential enzyme surface co-display system can be used as a whole-cell catalyst to directly carry out sequential enzyme reaction.

According to the method, saccharifying enzyme and glucose dehydrogenase are proportionally assembled on the surface of escherichia coli through interaction between cohesin-dockerin, and a sequential enzyme proportional to bacterial surface co-display system based on interaction between proteins is obtained.

The sequential enzyme co-display system can be used as a whole-cell catalyst for detecting starch.

The invention is characterized in that a gene coding the ice nucleoprotein is fused with genes coding two scaffold proteins of CohC and CohT, the fusion is connected to an expression vector pET-28a (+), the expression is converted to escherichia coli for expression, and the scaffold proteins are displayed on the surface of the escherichia coli through the anchoring effect of the ice nucleoprotein. And finally assembling the GA and the GDH on the surface of the escherichia coli according to the number proportion required by the experiment through the interaction between cohesin-dockerin to obtain a sequential enzyme proportional bacterial surface co-display system based on the interaction between the proteins.

The detection principle of starch is that starch is hydrolyzed to generate glucose under the catalysis of GA on the surface of thallus, and the glucose is catalyzed by GDH with the help of coenzyme NAD⁺Oxidized to gluconolactone, coenzyme NAD⁺It is reduced to NADH. NADH has a characteristic absorption peak at 340nm, so that the content of starch can be obtained according to the absorption value at 340 nm.

The invention has the following effects:

1. the invention utilizes an ice nucleoprotein surface display system to stably display GA and GDH on the surface of bacteria together, thereby solving the problems of complex extraction process and low stability of intracellular enzyme.

2. Aiming at the problems of poor enzyme stability, low reaction rate and the like of the traditional immobilization sequence, the invention displays GA and GDH on the surface of Escherichia coli in a co-assembly mode according to the ratio of 1:1 or 2:1 through the interaction between cohesin-dockerin.

3. The sequential enzyme proportional bacterial surface co-display system based on the interaction between proteins, which is constructed by the invention, has high sensitivity for starch detection, and has a wider linear range (0.003-0.1%) and a lower detection limit (0.002%).

4. The sequential enzyme co-display strain constructed by the invention can be fixed on an electrode to construct an electrochemical biosensing interface to realize the detection of starch, and the modified electrode can be repeatedly used and has good stability.

5. The sequential enzyme co-display strain constructed by the invention can be developed into a biocatalyst and is used in the fields of biofuel cells and the like.

Drawings

FIG. 1 is an electropherogram of PCR products of the doc and doc genes provided in the examples of the present invention. Wherein M is a DNA molecular weight standard; 1 is the PCR product band of gene docc gene; 2 is the PCR product band of gene doc gene; and 3 is a negative control.

FIG. 2 is a schematic diagram of a sequential enzyme-to-scale bacterial surface co-display system based on interactions between proteins according to an embodiment of the present invention. A is a schematic of a GA and GDH co-display system in a 1:1 ratio; b is a schematic representation of a GA and GDH co-display system in a 2:1 ratio.

Fig. 3 is a graph showing the operation of detecting starch by an ultraviolet-visible spectrophotometer according to an embodiment of the present invention.

Detailed Description

The objects, functions and advantages of the present invention will be further explained with reference to the accompanying drawings.

The invention constructs a sequential enzyme proportional bacterial surface co-display system based on the interaction between proteins, and utilizes a spectrophotometer to detect signals, thereby obtaining the content of starch. The method specifically comprises the following steps:

1. constructing a sequential enzyme proportional bacterial surface co-display system based on the interaction between proteins;

2. GA and GDH are displayed on the surface of Escherichia coli in a 1:1 or 2:1 ratio through the interaction between cohesin-dockerin;

3. and (5) making a working curve of starch detection.

Example 1

Obtaining of cell surface display sequence enzyme expression vector:

1. the gene fragment docc encoding the dockerin protein comes from strain Clostridium cellulolyticum h 10; the doc comes from strain Clostridium thermocellum ATCC27405, wherein the length of the doc gene fragment is 213bp, the length of the doc gene fragment is 204bp, and primers are designed according to the gene sequences of the two, and high-fidelity polymerase is used for respectively amplifying target genes from respective genome DNA. The target gene PCR reaction system is as follows: 0.25. mu.L of Ex Taq, 5. mu.L of 10 XEx Taqbuffer, 4. mu.L of 2.5mM dNTP, 1. mu.L of genomic DNA, 1. mu.L of DocC-F and DocT-F, 1. mu.L of DocC-R and DocT-R, and 37.75. mu.L of ultrapure water. And (3) PCR reaction conditions: 5min at 94 ℃; 30 cycles of 94 ℃ for 30s, 58 ℃ for 30s, 72 ℃ for 20 s; extending for 5min at 72 ℃; after the gene amplification, the size and purity of the target gene were checked by 1% agarose gel (see FIG. 1), and then ligated to pMD-19T simple vector (TaKaRa, cat # 3271); thus, plasmids pMD19T-doc and pMD19T-doc were obtained.

The primers were DocC-F (5 '→ 3'): ACGCGTCGACACAGATCCTGACCCAGTAATTG and DocC-R (5 '→ 3'): CCGCTCGAGGGTAAGTAAGCTTCCAAGCAAC;

DocT-F (5 '→ 3'): CATGCCATGGACACTAAATTATACGGCGACGTC and DocT-R (5 '→ 3'): CGCGGATCCGTTCTTGTACGGCAATGTATC. Wherein the above strains are commercially available.

2. The gene fragment encoding the cohesin protein, cohc, is derived from the strain Clostridium cellulolyticum h 10; coht is from strain Clostridium thermocellum ATCC27405, wherein the length of the cohc gene fragment is 444bp, the length of the coht gene fragment is 1176bp, and primers are designed according to the gene sequences of the coht gene fragment and the coht gene fragment to respectively amplify target genes from respective genome DNA by using high-fidelity polymerase. The target gene PCR reaction system is as follows: mu.L of Ex Taq, 5. mu.L of 10 XExTaq buffer, 4. mu.L of 2.5mM dNTP, 1. mu.L of genomic DNA, 1. mu.L of CohC-F and CohT-F, 1. mu.L of CohC-R and CohT-R, and 37.75. mu.L of ultrapure water. And (3) PCR reaction conditions: 5min at 94 ℃; 30 cycles of 94 ℃ for 30s, 58 ℃ for 30s, 72 ℃ for 1min for 10 s; extending for 5min at 72 ℃; after the gene amplification is finished, the size and the purity of the target gene are detected by using 1 percent agarose gel, and then the target gene is respectively connected with a pMD-19T simple vector (TaKaRa, cat number 3271); thus obtaining plasmids pMD19T-cohc and pMD 19T-coht.

The primer is CohC-F (5 '→ 3'): ATCCCTGGCGATTCTCTTAAAG

And CohC-R (5 '→ 3'): TTGAGTACCAGGATCTATAGTTACAC;

CohT-F(5’→3’):AATGCAACACCGACCAAG

and CohT-R (5 '→ 3'): AGGTGTTGTAGGTGTTGTAGG.

3. Plasmids pMD 19T-dock and pET42b/ga (containing the ga gene in a T.tengconsensis strain) (construction of plasmid pET42b/ga see Zheng, Y.Y., et al, Cloning, expression, and analysis of a thermostable glucoamylase from Thermoanaerobactercentogensis MB4.applied Microbiology and Biotechnology,2010.87(1): p.225-233) were subjected to double digestion simultaneously with Xhol and SalI, the target fragments dock and pET42b-ga containing the same cohesive ends at both ends were recovered using a gel kit, and the two fragments were ligated using T4DNA ligase to obtain a fusion gene of dock and ga.

Plasmid pMD19T-doc and pTInaPb-gdh (containing the gdh gene in mutant Q252L/E170R/V149K/G259A) (construction of plasmid pTInaPb-gdh is described in Liang, B., et al, Simultaneous engineering and specificity of cell surface displayed glucose derivatives restriction-cell restriction-enzyme synthesis-cell biochemical for glucose biosensor Technology 2013.147: p.492-498) was performed Simultaneously with NcoI by double digestion, cutting the desired fragments doct and pET-gdh, and joining the two fragments with T4DNA ligase to obtain a fusion of doct and gdh genes.

4. Plasmid pMD19T-CohC and plasmid pTInaPb-N (Liang, B., et al, Construction of agarose dehydragent displayed on the surface of bacterium of bacteria use circulation protein for sensitive D-Xylose detection. analytical chemistry 2011.84(1): p.275-282) containing INP gene fragment were double-digested simultaneously with BamHI and Sal I, the objective fragments CohC and pET-INP were recovered by cutting gel after agarose gel electrophoresis, and the two fragments were ligated by T4DNA ligase to obtain fusion gene pET-INP-CohC of CohC and INP. Plasmid pMD19T-CohT and pET-INP-CohC are subjected to double digestion by Sal I and Hind III at the same time, the target fragments CohT and pET-INP-CohC are recovered by gel cutting after agarose gel electrophoresis, and the two fragments are connected by T4DNA ligase to obtain the fusion gene pET-INP-CohC-CohT of CohT and INP-CohC. Plasmid pMD19T-CohC and pET-INP-CohC-CohT are subjected to double digestion by Hind III and Not I at the same time, target fragments CohC and pET-INP-CohC-CohT are recovered by cutting gel after agarose gel electrophoresis, and the two fragments are connected by T4DNA ligase to obtain a fusion gene pET-INP-CohC-CohT-CohC of CohC and INP-cohT.

Example 2

Obtaining of cell surface display sequential enzyme thallus:

1. expression of the fusion protein. Escherichia coli BL21(DE3) was transformed with each of the recombinant vectors obtained in example 1, and inoculated into a fresh LB liquid medium containing kanamycin (30. mu.g/ml) after restriction identification was confirmed, and cultured with shaking until the absorbance (OD600) became-0.6, 0.5mM, 0.2mM, and 1mM of IPTG (isopropyl-. beta. -D-thiogalactopyranoside) were added, and cultured at 25 ℃ for 20 hours to induce expression of GA-DocC, DocT-GDH, INP-CohC/CohT, and INP-CohC/CohT/CohC fusion proteins, respectively.

Coli BL21(DE3) was cultured in LB medium with the following composition: 5g/L yeast extract, 10g/L peptone and 10g/L NaCl.

2. And subpackaging the bacterial liquid into 50mL centrifuge tubes, centrifuging at 6000rpm for 5min, removing supernatant, collecting all thalli, washing twice with PBS buffer with pH 7.4, finally resuspending the thalli with 5mL of the same buffer, and storing at 4 ℃ for later use.

3.2 mL of the resulting suspension was added to 15mL of the buffer solution, and GA-DocC and DocT-GDH were suspended in 50mM Tris-HCl buffer solution, pH 8.0 and NaAc-Hac buffer solution, respectively. The ultrasonic conditions are as follows: 6mm probe, 30% power, 5s interval ultrasonic, until the bacteria liquid is clear. The disrupted solution was centrifuged at 12000rpm at 4 ℃ for 30min, and the supernatant was stored. 1mL of the crude enzyme solution of DocT-GDH was mixed with 20. mu.l of a bacterial solution exhibiting INP-CohC/CohT or INP-CohC/CohT/CohC, incubated at 25 ℃ for 2 hours at 180rpm, centrifuged at 6000rpm for 3 minutes to remove the supernatant, washed 2 times with a phosphate buffer of pH 6.2, added with 1.5mL of the crude enzyme solution of GA-DocC, incubated under the same conditions for 2 hours, centrifuged at 6000rpm for 3 minutes to remove the supernatant, and washed 3 times with a phosphate buffer of pH 6.2 to obtain GA and GDH co-displaying whole cells at a ratio of 1:1 or GA and GDH co-displaying whole cells at a ratio of 2:1 (see FIG. 2).

A proportional bacterial surface co-display system of sequential enzymes based on the interaction between proteins is obtained by fusing genes with genes encoding two scaffold proteins of CohC and CohT according to the method described in the above examples, and finally assembling GA and GDH required for a specific experiment on the surface of Escherichia coli in other arbitrary proportions through the interaction between cohesin-dockerin.

Example 3

Determination of Single enzyme Assembly enzyme Activity of GA-DocC and DocT-GDH:

enzyme activity assay for GA-DocC single enzyme assembly. 2.5ml of the GA-DocC crude enzyme solution was mixed with 20. mu.l of the INP-CohC/CohT/CohC bacterial solution. Incubating at 25 deg.C and 180rpm for 2h, centrifuging at 6000rpm for 3min to remove supernatant, washing with the same buffer solution for 2 times, and determining GA enzyme activity. The reaction was carried out at 70 ℃ for 15min using 10mM maltose as a substrate. And after the reaction is finished, measuring the glucose concentration in the product by using a glucose kit. Finally, the enzyme activity of the GA-DocC single enzyme assembly is calculated. GA activity unit U is defined as the amount of enzyme required to release 1. mu. mol glucose per minute under certain reaction conditions. The enzyme activity of the whole cell displayed by GA according to the ratio of 2:1 is 0.82U/OD₆₀₀Whole cells.

And 2, preparing an NADH standard curve. NADH is derived from NAD⁺Is reduced to generate NAD with maximum absorption peak at 340nm⁺Without the absorption peak, we can use spectrophotometry to determine the NADH content generated by GDH catalytic reaction. Firstly preparing 10mM NADH mother liquor, then diluting and preparing NADH with different concentrations (0.01, 0.025, 0.05, 0.1, 0.2 and 0.25mM) respectively, measuring the absorbance value at 340nm after fully mixing, and repeating the parallel test for three times. With NADH concentration as the abscissa, A₃₄₀A standard curve is plotted for the ordinate. The concentration of NADH in the reaction solution was determined from the absorbance at 340nm of the reaction solution using a calibration curve.

Determination of the enzymatic Activity of the Single enzyme Assembly of DocT-GDH. 1.5ml of crude enzyme solution of DocT-GDH was mixed with 20. mu.l of the INP-CohC/CohT/CohC bacterial suspension. Incubating at 25 deg.C and 180rpm for 2h, and centrifuging at 6000rpm for 3minThe cells were washed 2 times with the same buffer to determine GDH enzyme activity. At 50. mu.M glucose and 30. mu.M NAD⁺Reacting for 15min at 40 ℃ by using a substrate, centrifuging at 12000rpm for 1min, and taking the supernatant to determine the light absorption value at 340 nm. And finally calculating the enzyme activity of the single enzyme assembly of the DocT-GDH. GDH viability Unit U is defined as the amount of enzyme required to produce 1. mu. mol NADH per minute under certain reaction conditions. The enzyme activity of whole cells displayed by GDH in a 2:1 ratio was 137.64U/OD600 whole cells.

Example 4

Assembling a sequential enzyme and bacteria surface co-display system, and measuring the starch concentration by means of an ultraviolet-visible spectrophotometer:

1. and (3) assembling a sequential enzyme bacterial surface co-display system. 1mL of DocT-GDH crude enzyme solution is mixed with 20ul of INP-CohC/CohT/CohC bacterial solution, the mixture is incubated for 2h at 25 ℃ and 180rpm, centrifuged at 6000rpm for 3min to remove supernatant, washed with phosphoric acid buffer solution with pH 6.2 for 2 times, added with 1.5mLGA-DocC crude enzyme solution and incubated for 2h under the same conditions, centrifuged at 6000rpm for 3min to remove supernatant, and washed with phosphoric acid buffer solution with pH 6.2 for 3 times to obtain GA and GDH which jointly display whole cells according to the ratio of 2: 1.

2. The method for measuring the starch content by a spectrophotometric method comprises the following steps: starch (0, 0.003%, 0.005%, 0.01%, 0.025%, 0.05%, 0.075%, 0.1%, 0.15%, 0.25%) and 30 μ M Nad at different concentrations⁺As a substrate, GA and GDH obtained by the method are co-displayed in a ratio of 2:1 and whole cells are used as sequential enzyme catalysis elements, the reaction is carried out for 15min at 60 ℃ in a phosphate buffer solution with the pH of 6.2, and the light absorption value at 340nm is measured after the reaction is finished. And (3) taking the starch concentration as an abscissa and taking the light absorption value at 340nm as an ordinate to prepare a starch detection curve. The working curve for starch determination is shown in FIG. 3, the R of which curve²The value reaches 0.996, and the linear fitting degree is good.

Claims

1. A sequential enzyme surface co-display system, comprising: sequential enzyme surface co-display system consisting of gene sequence coding target protein saccharifying enzymegaGlucose dehydrogenase mutant gene sequencegdh-mAnd the gene sequence of cohesin-dockerin proteincoh-dockAnd the gene sequence of the N-terminal domain of ice nucleoprotein responsible for transmembrane localization and transportinaPb-N group Become into；

The display system is used for displaying the mutant of the coded target protein glucoamylase and the glucose dehydrogenase on the surface of the bacteria according to the number ratio;

the number ratio of the glucoamylase to the glucose dehydrogenase mutant is 1:1 or 2: 1;

the gene sequence of the coding target protein saccharifying enzymegaDerived fromThermoanaerobacter tengcongensis(ii) a Gene sequence of glucose dehydrogenase mutant for coding target proteingdh-mDerived from bacillus subtilis, and the mutant has a mutation site of Q252L/E170R/V149K/G259A;

the gene coding the ice nucleoprotein is fused with the genes coding two scaffold proteins of CohC and CohT, the fusion is connected to an expression vector pET-28a (+), the expression is converted to escherichia coli for expression, and the scaffold proteins are displayed on the surface of the escherichia coli through the anchoring effect of the ice nucleoprotein;

saccharifying enzyme is fused with DocC protein, glucose dehydrogenase mutant is fused with DocT protein, and the fusion is expressed in escherichia coli cells;

the gene coding the dockerin protein in the gene sequence of the cohesin-dockerin protein is a strainClostridium cellulolyticumH10 andClostridium thermocellumusing the genome DNA of ATCC27405 as a template and using DocC-F/DocC-R and DocT-F/DocT-R as primers to carry out PCR amplification to obtain a gene fragment for coding dockerin proteindoccAnddoct,

the primers were Doc C-F: 5'-ACGCGTCGACACAGATCCTGACCCAGTAATTG-3'

And Doc C-R: 5'-CCGCTCGAGGGTAAGTAAGCTTCCAAGCAAC-3', respectively;

Doc T-F：5’-CATGCCATGGACACTAAATTATACGGCGACGTC-3’

and Doc T-R: 5'-CGCGGATCCGTTCTTGTACGGCAATGTATC-3', respectively;

the gene coding cohesin protein in cohesin-dockerin protein gene sequence is strainClostridium cellulolyticumH10 andClostridium thermocellumusing the genome DNA of ATCC27405 as a template and using CohC-F/CohC-R and CohT-F/CohT-R as primers to carry out PCR amplification to obtain a gene fragment for coding cohesin proteincohcAndcoht,

the primers were Coh C-F: 5'-ATCCCTGGCGATTCTCTTAAAGCGCGGATCCATCCCTGGCGATTCTCTTAAAG-3'

And

Coh C-R：5’-TTGAGTACCAGGATCTATAGTTACACATAAGAATGCGGCCGCAGGTGTTGTAGGTGTTGTAGG-3’；

Coh T-F：5’-AATGCAACACCGACCAAG-3’

and Coh T-R: 5' -AGGTGTTGTAGGTGTTGTAGG-3.

2. Use of the sequential enzyme surface co-display system of claim 1, wherein: the sequential enzyme co-display system is used as a whole-cell catalyst or a biosensing interface to directly carry out sequential enzyme reaction.

3. Use of the sequential enzyme surface co-display system according to claim 2, wherein: the glucoamylase and the glucose dehydrogenase are proportionally assembled on the surface of the escherichia coli through the interaction between cohesin-dockerin, and the sequential enzyme proportional to the bacterial surface co-display system based on the interaction between proteins is obtained.

4. Use of a sequential enzyme surface co-display system according to claim 3, wherein: the sequential enzyme co-display system is used as a whole-cell catalyst for detecting starch.