WO2009003274A1 - Gène de susceptibilité pour une affection intestinale inflammatoire - Google Patents

Gène de susceptibilité pour une affection intestinale inflammatoire Download PDF

Info

Publication number
WO2009003274A1
WO2009003274A1 PCT/CA2008/001181 CA2008001181W WO2009003274A1 WO 2009003274 A1 WO2009003274 A1 WO 2009003274A1 CA 2008001181 W CA2008001181 W CA 2008001181W WO 2009003274 A1 WO2009003274 A1 WO 2009003274A1
Authority
WO
WIPO (PCT)
Prior art keywords
ptprs
seq
nucleic acid
disease associated
disease
Prior art date
Application number
PCT/CA2008/001181
Other languages
English (en)
Inventor
Aleixo Muise
Daniela Rotin
Original Assignee
The Hospital For Sick Children
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The Hospital For Sick Children filed Critical The Hospital For Sick Children
Publication of WO2009003274A1 publication Critical patent/WO2009003274A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2803—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/40—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against enzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/172—Haplotypes
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/06—Gastro-intestinal diseases
    • G01N2800/065—Bowel diseases, e.g. Crohn, ulcerative colitis, IBS

Definitions

  • the disclosure relates to inflammatory bowel disease and particularly to methods and compositions for screening for, diagnosing the presence or progression of, or detecting the risk of developing ulcerative colitis and/or colonic Crohn's disease in a subject.
  • IBD Inflammatory bowel disease
  • CD Crohn's disease
  • UC ulcerative colitis
  • CD and UC there are a number of subtypes relating to disease location and disease behaviour. The diseases share many symptoms but have distinct phenotypes based on clinical, radiological, biochemical and histological differences. IBD subgroup diagnosis in some cases can be very difficult. Disease differentiation is important since UC and CD are treated differently. While both are often initially treated with steroids, CD is usually treated with biological therapies and immuno-modulators; while UC is treated with aspirin. The definitive treatment for UC is colectomy.
  • Crohn's disease can be further subdivided by disease location that includes terminal ileum, colonic, and ileocolonic disease. These various disease locations may respond differently to therapy and may have different susceptibility genes.
  • the inventors have shown that three SNPs in the receptor protein tyrosine phosphatase sigma gene (PTPRS - encoding PTP ⁇ ), rs8100586, rs886936, and rs17130, are associated with a subcategory of inflammatory bowel disease, ulcerative colitis.
  • the inventors have also shown that one SNP, rs8100586, is also associated with colonic Crohn's disease in patients with inflammatory bowel disease.
  • the inventors have further identified novel point mutations and splice variants that are associated with ulcerative colitis. Detection of these disease associated PTPRS gene variants is indicative of ulcerative colitis or an increased risk of developing ulcerative colitis.
  • novel PTPRS nucleic acids and polypeptides and uses thereof that the inventors have determined are associated with disease.
  • the disclosure provides novel isolated PTPRS nucleic acids, including SEQ ID NOs: 8, 9 and 21.
  • the novel isolated PTPRS polypeptides including SEQ ID NOs: 5, 6 and 10 are provided.
  • Another aspect of the disclosure relates to methods of screening for, diagnosing the presence of, or detecting a risk of developing, ulcerative colitis.
  • One embodiment provides a method of screening for, diagnosing, or detecting a risk of developing ulcerative colitis and/or diseases related to ulcerative colitis including detecting the presence of at least one disease associated PTPRS gene variant in a sample of a subject.
  • the presence of a disease associated PTPRS gene variant is indicative of ulcerative colitis (and/or related disease) or an increased risk of developing ulcerative colitis (and/or related disease) compared to a subject not having the disease associated gene variant of PTPRS.
  • the disclosure further relates to methods of screening for, diagnosing the presence of, or detecting a risk of developing, inflammatory bowel disease.
  • the disclosure provides methods of screening for, diagnosing the presence of, or detecting a risk of developing, inflammatory bowel disease comprising detecting the presence of at least one disease associated PTPRS gene variant in a sample of a subject.
  • the presence of the disease associated PTPRS gene variant is indicative of inflammatory bowel disease or an increased risk of developing inflammatory bowel disease compared to a subject not having the disease associated gene variant of PTPRS.
  • the at least one disease associated PTPRS gene variant is a SNP, a deletion, or a point mutation.
  • the at least one disease associated PTPRS gene variant includes: (a) risk allele rs8100586 (SEQ ID NO: 1 ), (b) risk allele rs886936 (SEQ ID NO: 2),
  • the subject was previously diagnosed as having inflammatory bowel disease but not diagnosed as having ulcerative colitis or misdiagnosed as having Crohn's disease or indeterminate colitis.
  • the subject is human.
  • the subject is a biological relative of a human with ulcerative colitis.
  • the subject is a first degree relative of a human with ulcerative colitis.
  • the sample is a bodily sample selected from blood, stool and/or tissue.
  • the presence of a disease associated PTPRS gene variant comprises a nucleic acid and is detected by amplifying the nucleic acid using PCR.
  • the presence of a disease associated PTPRS gene variant is detected using a nucleic acid that specifically binds a disease associated gene variant of PTPRS nucleic acid. In another embodiment, the presence of a disease associated PTPRS gene variant is detected using an antibody that specifically recognizes a protein corresponding to a disease associated PTPRS gene variant.
  • the protein corresponding to the disease associated PTPRS gene is selected from the group consisting of the deletion of all or part of the amino acids encoded by exon 9 (Ig-like 3 domain); deletion of all or part of amino acids 240-329 of SEQ ID NO:4, the deletion of all or part of the amino acids encoded by exon 8 and 9 (SEQ ID NO:5 deleted from amino acids 236-239 and 240-329), and the presence of glycine amino acid corresponding to position 316 of SEQ ID NO: 10.
  • the disclosure provides a method of detecting a response to therapy in a subject having ulcerative colitis.
  • the method includes detecting PTPRS protein enzyme activity in a first sample from a subject undergoing treatment where the sample is optionally taken before, during, and/or after therapy, and comparing the first sample PTPRS protein enzyme activity to PTPRS protein enzyme activity in a second sample taken from the subject, subsequent to the first sample. An increase in enzyme activity in the subsequent sample is indicative of the subject responding to therapy.
  • Ulcerative colitis is curable by surgery, while Crohn's Disease can recur at the surgical site. It is thus useful to know which patients of inflammatory bowel disease are candidates for surgery. Accordingly, another aspect provides for a method of determining a need for surgery in a subject having inflammatory bowel disease including detecting a disease associated PTPRS gene variant in a sample from the subject where the presence of the disease associated PTPRS gene variant is indicative that the subject is a candidate for needing surgery.
  • Another aspect provides a method for reducing the risk of developing ulcerative colitis or treating ulcerative colitis including the steps of determining if the subject possesses a disease associated PTPRS gene variant; and of the subject possesses a disease associated PTPRS gene variant, then administering a probiotic selected from £. coli Nissle 1917, VSL#3, milk with bifidobacteria, and Saccharomyces boulardil.
  • One aspect of the disclosure provides a method of treating a subject with ulcerative colitis by administering a binding agent that bands an extracellular domain of PTPRS polypeptide and inhibits bacteria or neutrophil binding to PTPRS polypeptide.
  • the binding agent is an antibody.
  • the antibody is a neutralizing antibody.
  • the present application also provides compositions and kits useful for screening, diagnosing the presence of, or detecting a risk of developing, ulcerative colitis in a subject.
  • the kit includes a composition described herein.
  • the composition includes an isolated nucleic acid sequence that specifically hybridizes to a disease associated PTPRS gene variant.
  • the isolated nucleic acid sequence specifically hybridizes to at least one of SEQ ID NO:1 , 2, 3, 8, 9 or 21 and/or their complements.
  • the isolated nucleic acid sequence specifically hybridizes to SEQ ID NO:1 when SNP rs8100586 is an adenine nucleotide.
  • the isolated nucleic acid sequence specifically hybridizes to SEQ ID NO:1 when SNP rs8100586 is an adenine nucleotide. In another embodiment, the isolated nucleic acid sequence specifically hybridizes to SEQ ID NO:2 when the SNP rs886936 is an adenine nucleotide. In still another embodiment, the isolated nucleic acid sequence specifically hybridizes to SEQ ID NO:8, where SEQ ID NO: 8 is a splice variant associated with disease. In yet another embodiment, the isolated nucleic acid sequence specifically hybridizes to SEQ ID NO: 9 when nucleotide 358 is a guanine nucleotide.
  • these isolated nucleic acid sequences can be used as probes to detect the presence of at least one of the disease associated PTPRS gene variants.
  • Disease associated PTPRS gene variants including a mutation can be detected using such methods as PCR. Accordingly, one aspect provides a composition including isolated nucleic acid primers that can amplify a sequence containing a region including a disease associated PTPRS gene variant. In one embodiment, the region includes rs8100586. In another embodiment the region includes rs886936. In still another embodiment, the region includes rs17130. In another embodiment, the disease associated PTPRS gene variant detected includes an exon 9 deleted PTPRS variant.
  • the exon 9 deleted PTPRS gene variant detected includes SEQ ID NO: 21.
  • the region includes a G mutant PTPRS variant.
  • the primers include all or part of SEQ ID NO: 11 and/or SEQ ID NO: 12.
  • the primers include all or part of SEQ ID: 13 and/or SEQ ID NO: 14.
  • the primers include all or part of SEQ ID NO: 15 and/or SEQ ID NO: 16.
  • the primers include all or part of SEQ ID NO: 17 and/or SEQ ID NO: 18.
  • the primers include all or part of SEQ ID NO: 19 and SEQ ID NO: 20.
  • the nucleic acid hybridizes to the sequence in SEQ ID NO: 1 and is capable of amplifying the region including rs8100586. In another embodiment, the nucleic acid hybridizes to the sequence in SEQ ID NO:2 and is capable of amplifying a region including rs886936. In still another embodiment, the nucleic acid hybridizes to the sequence in SEQ ID NO: 3 and is capable of amplifying a region including rs17130. In another embodiment, the nucleic acid is a primer suitable for SNuPe analysis. In another embodiment, the composition includes at least two nucleic acids.
  • the kit includes at least one nucleic acid sequence described herein that specifically hybridizes to a disease associated PTPRS gene variant. In another embodiment, the kit includes at least one nucleic acid sequence that specifically hybridizes with at least one of:
  • the kit includes a nucleic acid sequence for genotyping.
  • the kit includes a nucleic acid sequence that specifically genotypes a disease associated gene variant of PTPRS of:
  • the kit for screening for, detecting or diagnosing a subject with ulcerative colitis or an increased risk of developing ulcerative colitis can also include a binding protein that binds a protein of a disease associated gene variant of PTPRS.
  • this binding protein is an antibody.
  • the antibody is labeled.
  • the present disclosure provides methods of screening for, diagnosing the presence of, or detecting a risk of developing, colonic Crohn's disease in IBD patients.
  • the presence of the disease associated PTPRS gene variant rs8100586 in a subject with IBD is indicative of colonic Crohn's disease or an increased risk of developing colonic Crohn's disease compared to a subject not having the disease associated gene variant of PTPRS rs8100586.
  • the subject is human.
  • the subject is a biological relative of a human with colonic Crohn's disease.
  • the subject is a first degree relative of a human with colonic Crohn's disease.
  • the sample obtained is a bodily sample that is either blood, stool, and/or tissue.
  • disease associated PTPRS gene variant is detected using PCR.
  • disease associated PTPRS gene variant is detected using a nucleic acid that specifically binds to rs8100586 disease associated PTPRS gene variant.
  • the disclosure provides a method of differentiating between having or developing ulcerative colitis from having or developing colonic Crohn's disease.
  • the disclosure provides a method of differentiating between, a diagnosis or risk of developing ulcerative colitis from a diagnosis or risk of developing Crohn's disease in a subject having the risk allele rs8100856 by detecting the presence of the at least one additional disease associated PTPRS gene variant.
  • the presence of at least one additional disease associated gene variant is indicative of ulcerative colitis or an increased risk of developing ulcerative colitis.
  • kits for screening for, detecting or diagnosing a subject with colonic Crohn's disease or an increased risk of developing colonic Crohn's disease containing a composition including for example, a primer of all or part of SEQ ID NO:11 , 12, 19 and/or 20 that detects for example a region containing rs8100586 and/or which specifically hybridizes to SEQ ID NO:1.
  • the kit contains at least one nucleic acid sequence that specifically hybridizes to rs8100586.
  • the kit includes a nucleic acid sequence for genotyping rs8100586.
  • the nucleic acid sequence for genotyping rs8100586 disease associated PTPRS gene variant is SEQ ID NO: 11 and/or SEQ ID NO: 12.
  • the isolated nucleic acid is SEQ ID NO: 7 deleted for all or part of nucleotides corresponding to exon 9 (nucleotides 954-1222) of the PTPRS gene.
  • the isolated nucleic acid is a PTPRS nucleic acid deleted for all or part of nucleotides 941-1222 of SEQ ID NO: 7.
  • the isolated nucleic acid is a PTPRS nucleic acid deleted for nucleotides corresponding to SEQ ID NO: 8.
  • the isolated nucleic acid is all or part of SEQ ID NO: 21.
  • the isolated nucleic acid is SEQ ID NO: 21. In another embodiment the isolated nucleic acid contains SEQ ID NO: 8. [0026] The isolated nucleic acid can also include a PTPRS transcript mutated for a nucleotide corresponding to nucleotide 1180 of PTPRS isoform 1 (nucleotide 358 of SEQ ID NO: 9) wherein the mutated nucleotide at this position is a guanine. In one embodiment, the sequence is SEQ ID NO: 9.
  • the disclosure also provides for an isolated polypeptide containing a PTPRS polypeptide deleted for all or part of amino acids encoded by exon 9 of the PTPRS gene.
  • the polypeptide is SEQ ID NO: 4 deleted for all or part of amino acids 236-329.
  • the isolated polypeptide is a PTPRS polypeptide deleted for all or part of SEQ ID NO: 6.
  • the isolated polypeptide includes SEQ ID NO: 6.
  • the disclosure also provides for a PTPRS polypeptide having amino acid corresponding to 316 of SEQ ID NO: 10 mutated to glycine, as well as the SEQ ID NO: 10.
  • the disclosure provides an isolated nucleic acid selected from SEQ ID NO: 22-25.
  • the isolated nucleic acid includes SEQ ID NO: 22.
  • the isolated polypeptide is selected from SEQ ID NOs: 26-28.
  • the disclosure also provides for a method of detecting the presence of at least one isolated nucleic acid or polypeptide disclosed herein in a sample of a subject.
  • the nucleic acid detected is SEQ ID NO: 7 deleted for all or part of exon 9 and its corresponding polypeptide or SEQ ID NO: 4 deleted for all or part of amino acids 236-329.
  • the nucleic acid detected is SEQ ID NO: 7 deleted for all or part of nucleotides 941-1222, the nucleic acid deleted for SEQ ID NO: 8, all or part of SEQ ID NO: 21 , SEQ ID NO: 21 , SEQ ID NO: 8, a PTPRS transcript mutated for nucleotide 1180 of isoform 1 to guanine, or a PTPRS transcript mutated at nucleotide 358 of SEQ ID NO: 9.
  • the polypeptide detected is a polypeptide deleted for all or part of SEQ ID NO: 6, a polypeptide of SEQ ID NO: 6, a polypeptide of SEQ ID NO: 5, a polypeptide including a PTPRS polypeptide where amino acid 316 of SEQ ID NO: 10 is mutated to glycine, or a polypeptide of SEQ ID NO: 10.
  • the nucleic acid affected is a nucleic acid consisting of one of SEQ ID NOs: 22-25.
  • the nucleic acid is SEQ ID NO: 22.
  • the polypeptide detected is selected from the group consisting of one of SEQ ID NOs: 26-28. The presence of such a nucleic acid or polypeptide is indicative of ulcerative colitis or an increased risk of developing ulcerative colitis compared to a subject not having the disease associated gene variant of PTPRS.
  • Figure 1 is a linkage disequilibrium plot of SNPs across the PTPRS gene and flanking regions. SNPs were chosen using Haploview
  • FIG. 2A is a schematic diagram of PTPRS protein (PTP ⁇ ).
  • PTP ⁇ is a member of the LAR phosphatase family and is characterized by an extracellular domain composed of 3 immunoglobulin-like (Ig - small light shaded ovals) repeats and 5-8 fibronectin type III (FNIII - squares) repeats (resembling cell adhesion molecules), a single transmembrane domain and two intracellular catalytic domains (PTPase - large ovals).
  • Figure 2B is a schematic diagram of different isoforms of
  • PTPRS protein (PTP ⁇ ).
  • the PTPRS gene has 37 exons and encodes 4 isoforms (marked 1-4) determined by alternate splicing ("+” denotes isoform includes sequence encoding the element; "-" denotes isoform does not include sequence encoding the element), lsoforms-1 and -2 are long forms and lsoforms-3 and -4 are short forms with 4 FNIII domains (4-7) removed.
  • lsoforms-2 and -3 have microexon A (meA) spliced out.
  • lsoform-2 has meC removed from the FNIII domain. MeC is in an FNIII domain that is spliced out in isoforms-3 and -4.
  • Only isoform-1 has meA, meB, meC and meD.
  • Figure 3A is a diagram illustrating the protein sequence of normal and abnormally spliced PTPRS protein.
  • Three healthy control individuals from the "Centre d'Etude du Polymorphisme Humain" (CEPH 1334.13, 1340.11 and 1340.12) with homozygote C nucleotide at rs8100856 (SEQ ID NO:1) and either GG or AG at rs886936 (SEQ ID NO: 2) and at rs17130 (SEQ ID NO:3) were compared with three subjects (CEPH 1340.01 , 1344.13 and 1362.02) with homozygote nucleotide A for all SNPs resulting in the 3-marker haplotype found to be associated with UC.
  • Amino acid sequence of the control subjects (top) (SEQ ID NO:4) and the 3-marker-haplotype associated with UC (bottom) (SEQ ID NO:5) are shown.
  • the middle sequence (SEQ ID NO:6) shows the amino acids that are removed in the alternate splicing of exon 8 and 9 found in the 3-marker-haplotype.
  • Figure 3B is a schematic diagram illustrating the subunits in normally and abnormally spliced (rs17130, rs886936 and rs8100586 3-marker haplotype) PTPRS protein.
  • Exon 9 Ig-like domain 3, is spliced out along with meB usually found in isoform-1. This splicing variant is only in-frame in isoform-1.
  • Figure 3C is a PCR analysis Showing Alternate Splicing of exon
  • Figures 4A is a 10x magnification of colon tissue showing
  • Figure 4B is a 25x magnification of the colon tissue in Figure 4A.
  • Figure 4C is a 25x magnification of hematoxylin and eosin
  • Figure 4D is a 25x magnification of hematoxylin and eosin (H&E) stained distal colon in PTPRS-KO (-/-) littermates of mice in 4C and shows mild abnormalities including architectural abnormalities and crypt branching (arrows).
  • Figure 4E is a transmission electron micrograph (400Ox magnification) of the distal colon of wild-type mice (+/+).
  • Figure 4F is a transmission electron micrograph (400Ox magnification) of the distal colon of PTPRS-KO (-/-) littermates of mice in 4E and shows the abnormal morphology in the epithelium of the distal colon of the PTPRS-KO mice.
  • Figure 5A(a) is a 10 x magnification of hematoxylin and eosin (H
  • Figure 5A(c) is a 25x magnification of hematoxylin and eosin
  • Figure 5B(a) is a graph showing the disease activity index (DAI) of DSS treated mice.
  • DAI score was significantly higher in the PTPRS-KO mice compared with the WT mice from the second day to the end of DSS treatment (p ⁇ 0.001 , Wilcoxon rank sum).
  • Figure 5B(b) is a graph sowing the disease activity index (DAI) of C. rodentium inoculated mice.
  • DAI disease activity index
  • Figure 5C(a) is a graph showing the weight loss of DSS treated mice. PTPRS-KO mice treated with 3% DSS lost significantly more weight than the WT mice following six days of DSS treatment (p values as indicated in Figure; Wilcoxon rank sum).
  • Figure 5C(b) is a graph showing the weight loss of C. rodentium inoculated mice.
  • Figure 5D is a graph illustrating rectal bleeding in DSS treated mice.
  • Figure 5E is a graph showing bacterial translocation in DSS treated mice and C. rodentium inoculated mice.
  • Figures 6A and 6B are transmission electron micrographs (4000x magnification) of the distal colon of PTPRS-KO mice, 10 days after C rodentium infection.
  • Panel (A) shows C rodentium in the lumen of the colon (arrow).
  • Panel (B) shows increased anoikis (arrow).
  • FIG. 6C is series of immunoblots showing a substrate trapping assay identifying E-cadherin and ⁇ -catenin as colonic substrates.
  • Catalytically-inactive trapping mutant of PTP ⁇ GST- ⁇ D1 (DA)
  • WT controls GST- ⁇ DI(WT)
  • DA Catalytically-inactive trapping mutant of PTP ⁇
  • WT controls GST- ⁇ DI(WT)
  • the controls fusion proteins used for the pulldown assays are shown below each panel.
  • FIG. 6D is a series of immunoblots showing that E-cadherin is hyper-Tyr-phosphorylated in colons of the PTP ⁇ -KO mice.
  • Colon from PTPRS-KO mice (-/-) or WT sibling (Sib) controls were lysed and proteins in the lysate immunoprecipitated (IP) with either anti-pTyr or anti-E-cadherin antibodies.
  • the IPs were then immunoblotted with either anti-phosphotyrosine (anti-pTyr) or anti-E-cadherin antibodies.
  • Figure 7A shows the amino acid position mutated in GIy mutant
  • Figure 7B shows the amino acid position mutated in GIy mutant PTPRS polypeptide variant isoform 2 and amino acids corresponding to deletion of exon 9 in deletion PTPRS polypeptide variant isoform 2.
  • Figure 7C shows the amino acid position mutated in GIy mutant
  • PTPRS polypeptide variant isoform 3 and amino acids corresponding to deletion of exon 9 in deletion PTPRS polypeptide variant isoform 3.
  • Figure 7D shows the amino acid position mutated in GIy mutant
  • PTPRS polypeptide variant isoform 4 and amino acids corresponding to deletion of exon 9 in deletion PTPRS polypeptide variant isoform 4.
  • the three SNPs (rs8100586, rs886936, and rs17130) in the PTPRS gene associated with UC are located in introns adjacent to microexon B (meB).
  • the 3-marker haplotype associated with UC results in novel alternate splicing of meB and exon 9, producing novel PTPRS transcript- (SEQ ID NOs: 8 and 21) and polypeptide- (SEQ ID NOs: 5-6) splice variants.
  • This novel splicing results in the complete removal of the third immunoglobulin like (Ig-like) domain from the extracellular domain of the PTPRS protein, PTP ⁇ , likely altering ligand recognition or dimerization that is important for ligand binding.
  • the inventors further show that PTPRS knockout mice have mild colitis and develop severe colitis when challenged with two known inducers of colitis in mice. Further, the inventors have found that known adherens junction proteins, E-cadherin and ⁇ -catenin, act as substrates for PTP ⁇ in the colon. Therefore, alterations in the human PTPRS gene can lead to UC through defects in barrier defense. The inventors have further identified a point mutation in exon 9 of the PTPRS gene that is associated with UC or an increased risk of developing UC.
  • nucleotide 1180 of isoform 1 PTPRS gene transcript which is adenine (A) in the non-disease associated sequence (SEQ ID NO: 7), is mutated to guanine (G) in subjects with UC or a risk of developing UC (nucleotide 358 of SEQ ID NO: 9; nucleotide 1180 of SEQ ID NO: 22).
  • the nucleotide change causes the amino acid coded for by the codon comprising the mutation to change from serine (Ser) (amino acid 316 in SEQ ID NO: 4) to glycine (GIy) (amino acid 316 of SEQ ID NO: 10).
  • Ser serine
  • GIy glycine
  • the point mutants are thereby detectable in all isoforms.
  • the position of the nucleotide and/or amino acid corresponding to nucleotide in isoform 1 however varies in each isoform.
  • the position of the mutated nucleotide is 1141 in isoform 2 (SEQ ID NO: 23), 1141 in isoform 3 (SEQ ID NO: 24) and 1154 in isoform 4 (SEQ ID NO: 25).
  • the position of the mutated amino acid is 303 in isoform 2 (SEQ ID NO: 26), 303 in isoform 3 (SEQ ID NO: 27) and 307 in isoform 4 (SEQ ID NO: 28).
  • a person skilled in the art would readily be able to determine the nucleotide or amino acid corresponding to nucleotide 1180 of isoform 1 (SEQ ID NO: 7) in other isoforms and PTPRS transcripts.
  • the disclosure provides a novel isolated PTPRS nucleic acid deleted for all or part of the sequence corresponding to exon 9 of the PTPRS gene (SEQ ID NO: 7 deleted for all or part of nucleotides 954 - 1222 (for isoform 1).
  • the novel isolated nucleic acid comprises a PTPRS nucleic acid deleted for all or part of the sequence corresponding to nucleotides 14 to 282 of SEQ ID NO: 8.
  • the isolated nucleic acid comprises a PTPRS nucleic acid deleted for all of the nucleotides in SEQ ID NO: 8
  • the isolated nucleic acid comprises all or part of SEQ ID NO: 8.
  • the isolated nucleic acid comprises SEQ ID NO: 21
  • the isolated nucleic acid comprises a
  • nucleotide corresponding to nucleotide 1180 of PTPRS isoform 1 is mutated to guanine.
  • nucleotide 1180 is guanine (SEQ ID NO: 22).
  • the isolated nucleic acid comprises SEQ ID NO: 9 wherein nucleotide 358 is guanine.
  • the isolated nucleic acid comprises a PTPRS sequence wherein nucleotide 1141 of PTPRS isoform 2 is mutated (SEQ ID NO:22), 1141 of PTPRS isoform 3 is mutated (SEQ ID NO:23) or 1154 of PTPRS isoform 4 is mutated (SEQ ID NO: 23).
  • the disclosure also provides novel polypeptides.
  • the disclosure provides a novel isolated PTPRS polypeptide deleted for all or part of the amino acid sequence corresponding to exon 9 of the PTPRS gene (SEQ ID NO: 4 deleted for all or part of amino acids 240 to 329).
  • the novel isolated polypeptide comprises a PTPRS polypeptide deleted for all or part of the sequence corresponding to amino acids 5 to 94 of SEQ ID NO: 6. Amino acids 5 to 94 of SEQ ID NO: 6 correspond to the amino acids encoded by exon 9.
  • the isolated polypeptide comprises of a PTPRS polypeptide deleted for all or part of the amino acids 5 to 94 of SEQ ID NO: 6.
  • the isolated polypeptide consists of all or part of SEQ ID NO: 6. In yet another embodiment, the isolated polypeptide comprises SEQ ID NO: 5. In another embodiment, the isolated polypeptide comprises a PTPRS polypeptide wherein the amino acid corresponding to amino acid 316 of PTPRS isoform 1 (amino acid 316 of SEQ ID NO: 10) is mutated. In another embodiment the amino acid is mutated to glycine. In one embodiment, the isolated polypeptide comprises SEQ ID NO: 10.
  • These variants of the PTPRS gene are associated with UC and are thereby useful for screening for, diagnosing the presence of, and detecting a risk of developing, UC.
  • UC is a subcategory of IBD
  • the disease associated PTPRS gene variants are also useful for screening for, diagnosing the presence of, and detecting a risk of developing, IBD.
  • PTPRS disease associated gene variants comprise variant PTPRS nucleic acids including gene and transcript sequences and variant PTPRS polypeptides which are associated with IBD and UC including the variants described below in Table A:
  • ID NO:2 is an adenine (“A”) nucleotide (risk allele rs886936); c) variants comprising SNP rs17130 wherein nucleotide 301 of SEQ
  • ID NO:3 is an adenine ("A") nucleotide (risk allele rs17130); d) variants where all or part of sequence corresponding to exon 9 is deleted (exon 9 deleted PTPRS variant deleted for part of all of nucleotides 954 to 1222 in SEQ ID NO:7, or 14 to 282 of SEQ ID NO: 8); e) variants where sequence corresponding to exon 8 and all or part of exon 9 are deleted (exon 8 and exon 9 deleted PTPRS variant, deleted for nucleotides 1 to12 and all or part of nucleotides 14 to 282 of SEQ ID NO: 8; deleted for nucleotides 941 to 953 and all or part of nucleotides 954 to 1222 of SEQ ID NO: 7); f) variants comprising a point mutation in exon 9 at nucleotides corresponding to nucleotide 1180 of isoform 1 PTPRS transcript (nucleotide 358 of SEQ ID NO: 9;
  • These disease associated PTPRS gene variants are useful for diagnosing IBD and detecting a risk of developing IBD and also more particularly, for diagnosing UC and detecting a risk of developing UC.
  • the disclosure provides a method of screening for, diagnosing the presence of, or detecting a risk of developing, inflammatory bowel disease comprising detecting the presence of a disease associated PTPRS gene variant in a sample of a subject.
  • the presence of a disease associated gene variant of PTPRS is indicative of inflammatory bowel disease or an increased risk of developing inflammatory bowel disease compared to a subject not having the disease associated gene variant of PTPRS.
  • the method comprises detecting at least one disease associated PTPRS gene variant selected from the disease associated PTPRS gene variants described in Table A.
  • the disclosure provides a method of screening for, diagnosing the presence of, or detecting a risk of developing, ulcerative colitis comprising detecting the presence of a disease associated PTPRS gene variant in a sample of a subject.
  • the presence of a disease associated gene variant of PTPRS is indicative of ulcerative colitis or an increased risk of developing ulcerative colitis compared to a subject not having the disease associated gene variant of PTPRS.
  • two or more disease associated gene variants of PTPRS are screened for, diagnosed, or detected.
  • the method comprises detecting at least one disease associated PTPRS gene variant selected from the disease associated PTPRS gene variants described in Table A.
  • PTPRS gene variant rs8100856 is associated with colonic Crohn's disease (colonic CD) as well as UC in subjects diagnosed with inflammatory bowel disease (IBD).
  • Disease associated PTPRS gene variant rs8100856 was not associated with CD or any subtype of CD using family based association testing.
  • PTPRS may be involved in a generalizable colonic IBD. Crohn's disease that affects the colon is less frequent in adults than CD that affects the small bowel. Ulcerative colitis and colonic colitis although distinct diseases have common features and it is possible that these disease may share common susceptibility genes.
  • the disclosure also provides a method of screening for, diagnosing the presence of, or detecting a risk of developing, colonic Crohn's disease and/or ulcerative colitis in subjects with IBD.
  • the method of screening for, diagnosing, detecting a risk of developing colonic Crohn's disease and/or ulcerative colitis comprises detecting the presence of disease associated PTPRS variant rs8100586 in a sample of the subject with IBD, where the presence of the disease associated PTPRS variant is indicative of colonic Crohn's disease and/or ulcerative colitis or an increased risk of developing colonic Crohn's disease and/or ulcerative colitis, compared to a subject not having the disease associated gene variant of PTPRS.
  • Ulcerative colitis and colonic Crohn's disease are optionally differentiated by a further step of detecting an additional disease associated PTPRS disease variant, wherein the presence of disease associated PTPRS gene variant rs8100586 and an additional disease associated PTPRS gene variant is indicative of a subject having UC or an increased risk of developing UC.
  • the method comprises detecting at least two disease associated PTPRS gene variants selected from the disease associated PTPRS gene variants described in Table A wherein one of the at least two disease associated PTPRS gene variants is disease associated PTPRS gene variant rs8100586.
  • ulcerative colitis and colonic Crohn's disease are optionally differentiated in a subject by a further step of determining one or more characteristic UC findings, wherein a subject with IBD positive for PTPRS gene variant rs ⁇ 100586 and exhibiting one or more clinical, endoscopic, radiological, biochemical or histpathologic findings characteristic of UC, has UC.
  • subjects with IBD means a patient diagnosed with IBD or having either a histophathologic finding indicative of disease or at least two characteristic feature of IBD.
  • the characteristic features are optionally clinical, endoscopic, radiologic, biochemical or histopathologic findings indicative of IBD.
  • negative subject refers to a subject negative for or not having one or more disease associated gene variants of PTPRS.
  • the term "risk” and "increased risk” as used herein refers to a subject having a predisposition to developing a disease.
  • the predisposition is optionally inherited, or optionally somatic.
  • the increased risk is relative to a subject not having one or more disease associated PTPRS gene variants, (for example, relative to a healthy person with no measurable genetic risk of developing UC or colonic CD)For example, a subject has a risk or an increased risk of developing UC if said subject has a family history of IBD or UC and/or one or more disease associated PTPRS gene variants.
  • UC inflammatory bowel disease
  • IBD inflammatory bowel disease
  • Ulcerative colitis is a chronic spontaneously remitting and relapsing disorder of the large intestine that extends from the rectum in a continuous fashion.
  • the main histological features include inflammation of the superficial mucosal layers with infiltration of lymphocytes and granulocytes and loss of goblet cells with the presence of ulcerations and crypt abscesses.
  • UC associated PTPRS gene variants The disease associated PTPRS gene variants have been found to be significantly associated with UC and are optionally referred to as UC associated PTPRS gene variants.
  • UC associated PTPRS gene variants means gene, nucleic acid and/or polypeptide sequence variants of PTPRS which are associated with ulcerative colitis or an increased risk of developing ulcerative colitis.
  • colonic CD Crohn's disease
  • the disclosure provides in one aspect, various isolated nucleic acid and polypeptide PTPRS molecules. These and other variants are associated with disease. Accordingly the disclosure provides, in another aspect, methods of screening for, diagnosing the presence of, or detecting a risk or developing, PTPRS associated diseases comprising detection of a disease associated PTPRS variant in a sample of a subject.
  • PTPRS refers to the gene including PTPRS gene introns and exons, mRNA, cDNA or nucleic acid corresponding to receptor protein tyrosine phosphatase sigma (encoding PTP- ⁇ ), or a fragment or variant thereof, typically, encoding human PTP- ⁇ or a fragment or variant thereof and includes all naturally occurring variants, isoforms and mutated forms including isoforms and variants described herein and including sequences deposited in Genbank under accession number NM_002850 (Isoform 1); NM_130854 (isoform 2); NM_130853 (Isoform 3); and NM_130855 (isoform 4).
  • PTPRS also optionally refers to a protein, polypeptide, fragment, variant or isoform encoded by the PTPRS gene or corresponding artificial sequence.
  • isoforms of PTPRS protein Four naturally occurring isoforms of PTPRS protein are known, lsoforms-1 and -2 are long forms and lsoforms-3 and -4 are short forms with 4 FNIII domains (4-7) removed, lsoforms-2 and -3 have microexon A (meA) spliced out.
  • lsoform-2 has meC removed from the FNIII domain. MeC is in an FNIII domain that is spliced out in isoforms-3 and -4.
  • PTPRS polypeptide sequences include those described herein as well as those deposited in Genbank under accession numbers NP_570925 (isoform 4), NP_570924 (isoform 2), NP_570923 (isoform 3) and NP_002841 (isoform 1).
  • SEQ ID NO: 1 provides PTPRS gene sequence comprising disease associated PTPRS gene variant SNP rs8100856 (risk allele rs8100586);
  • SEQ ID NO: 2 provides PTPRS gene sequence comprising disease associated PTPRS gene variant SNP rs886936 (risk allele 886936);
  • SEQ ID NO: 3 provides PTPRS gene sequence comprising disease associated PTPRS gene variant SNP rs17130 (risk allele rs17130);
  • SEQ ID NO: 4 provides non-disease associated PTPRS polypeptide sequence, also referred to as PTPsigma or PTP ⁇ ;
  • SEQ ID NO:5 provides PTPRS polypeptide sequence comprising disease associated PTPRS gene variant polypeptide deleted for Ig-like3 domain and the meB domain (meB and Ig-like3 deleted PTPRS polypeptide variant);
  • SEQ ID NO: 6 provides the deleted PTPRS polypeptide sequence comprising the Ig-like3 and meB domains that are
  • Sequence 22 provides a full length nucleotide sequence of G mutant PTPRS variant isoform 1
  • sequence 23 provides a full length nucleotide sequence of G mutant PTPRS variant isoform 2
  • sequence 24 provides a full length nucleotide sequence of G mutant PTPRS variant isoform 3
  • sequence 25 provides a full length nucleotide sequence of G mutant PTPRS variant isoform 4.
  • Sequence 26 provides a full length amino acid sequence for GIy mutant PTPRS polpeptide variant (isoform 2)
  • sequence 27 provides a full length amino acid sequence for GIy mutant PTPRS polpeptide variant (isoform 3)
  • sequence 28 provides a full length amino acid sequence for GIy mutant PTPRS polypeptide variant (isoform 4).
  • Related PTPRS sequences such as other naturally occurring human PTPRS transcripts can be obtained by employing stringent hybridization methods known in the art and later described.
  • disease associated PTPRS gene variants means sequence variants of PTPRS that are associated with a disease, associated with an increased risk of developing a disease and/or prognostic for developing a disease such as IBD 1 UC and/or colonic CD.
  • the disease associated PTPRS gene variants comprise nucleic acid variants of PTPRS and/or poylpeptide variants of PTPRS.
  • splice variants and/or isoforms of PTPRS are known, a person skilled in the art will understand more than one isoform can comprise certain disease associated PTPRS gene variants.
  • SEQ ID NO: 10 provides amino acid sequence for disease associated PTPRS gene variant, GIy mutant PTPRS polypeptide in the background sequence of the naturally occurring isoform 1.
  • SEQ ID NOs: 26-28 are also disease associated PTPRS gene variants.
  • SEQ ID NO: 22 which is a G mutant PTPRS variant, occurs in the background sequence of naturally occurring isoform 1
  • nucleic acids of other isoforms eg deleted for exon 8) having a corresponding "G" mutation, are also disease associated PTPRS gene variants (eg. SEQ ID NOs: 23-25).
  • Nucleic acid PTPRS gene variants associated with disease comprise PTPRS risk alleles comprising SNP rs8100586 (SEQ ID NO: 1) optionally referred to as risk allele rs8100586; SNP rs886936 (SEQ ID NO: 2), optionally referred to as risk allele rs886936; and SNP rs17130 (SEQ ID NO: 3), optionally referred to as risk allele rs17130; PTPRS gene transcripts and nucleic acids that comprise alternatively spliced forms of PTPRS associated with disease including exon 9 deleted PTPRS variant (SEQ ID NO: 7 deleted for all or part of nucleotides 954 to 1222), exon 8 and exon 9 deleted variant (deleted for nucleotides 941-953 and all or part of 954 to 1222 of SEQ ID NO: 7); and/or mutations associated with disease including G mutant PTPRS
  • Disease associated PTPRS gene variants also comprise polypeptide disease associated PTPRS gene variants, including Ig-like3 deleted PTPRS polypeptide variant (deleted for amino acids 240 to 329 of SEQ ID NO: 4; meB and Ig-like3 deleted PTPRS polypeptide variant (deleted for amino acids 236 to 239 and all or part of 240 to 329 of SEQ ID NO:4; and/or deleted for all of 1-4 and all or part of 5 to 94 SEQ ID NO: 6) and and GIy mutant PTPRS polypeptide variant mutated for amino acid 316 of SEQ ID NO:10.
  • Ig-like3 deleted PTPRS polypeptide variant (deleted for amino acids 240 to 329 of SEQ ID NO: 4; meB and Ig-like3 deleted PTPRS polypeptide variant (deleted for amino acids 236 to 239 and all or part of 240 to 329 of SEQ ID NO:4; and/or deleted for all of 1-4 and all or part of 5 to 94
  • SNP means a single nucleotide polymorphism which is a single nucleotide position in a genomic sequence for which two or more alternative alleles are present in a given population such as the human population.
  • Disease associated PTPRS gene variant risk allele rs8100586, comprise a homozygote "A" (adenine) nucleotide (nucleotide 201 of SEQ ID NO: 1) at the nucleotide identified by rs8100586 in the disease associated allele whereas the non-disease associated allele comprises a "C" (cytosine) nucleotide at this position.
  • Risk allele rs8100586 is at contig position 4454057, chromosome position 5195333, plus strand .
  • Disease associated PTPRS gene variant risk allele rs886936 comprises homozygote "A" nucleotide (nucleotide 226 of SEQ ID NO:2) at the nucleotide identified by rs886936 in the disease associated allele whereas the non-disease associated allele comprise a "G" (guanine) nucleotide at this position.
  • Risk allele rs886936 is found at contig position 4449677, chromosome position 5190953, plus strand.
  • Disease associated PTPRS gene variant risk allele rs17130 comprises an "A" nucleotide (nucleotide 301 of SEQ ID NO: 3) at the nucleotide identified by rs17130 whereas the non-disease associated allele comprises a "G" nucleotide at this position.
  • Risk allele rs17130 is found at contig position 4451215, chromosome position 5192491 minus strand. Correct
  • allele means any one of a series of two or more different gene sequences that occupy the same position or locus on a chromosome.
  • allelic variant means any two or more alternative forms of a gene such as PTPRS.
  • a "disease associated PTPRS allelic variant” as used herein means a form of the gene PTPRS having a sequence which is more prevalent in subjects with a disease.
  • a UC associated PTPRS allelic variant as used herein means a form of the gene PTPRS having a sequence which is more prevalent in subjects with UC than in subjects not having UC.
  • UC associated PTPRS allelic variant is used interchangeably with UC associated PTPRS gene variant.
  • risk allele means a PTPRS allelic variant that is associated with a disease such as IBD, ulcerative colitis or colonic CD or a risk of developing a disease such as IBD, ulcerative colitis or colonic CD.
  • Risk allele rs8100586 (SEQ ID NO:1) as used herein means the allele variant having nucleotide identified by reference SNP8100586 that is associated with a disease or risk of developing a disease, for example developing IBD, UC or colonic CD. Risk allele rs8100586 has an "A" nucleotide at rs8100586.
  • Risk allele rs886936 (SEQ ID NO:2) as used herein means the allele variant having nucleotide identified by reference SNP 886936 that is associated with a disease or risk or developing a disease. Risk allele rs886936 has an "A" nucleotide at rs886936.
  • Risk allele rs17130 (SEQ ID NO:3) as used herein means the allele variant having nucleotide identified by reference SNP 17130 that is associated with a disease or risk or developing a disease. Risk allele rs17130 has an "A" nucleotide at rs17130.
  • exon 9 deleted PTPRS variant is a PTPRS transcript characterized by deletion of the nucleotides that corresponding to exon 9 and which encode the Ig-like3 domain in PTP ⁇ . Exon 9 corresponds to nucleotides 954 to 1222 in SEQ ID NO: 7.
  • the deletion disease associated PTPRS gene variant "exon 8 and exon 9 deleted PTPRS variant” (SEQ ID NO: 21 , deleted for SEQ ID NO: 8) is characterized by deletion of nucleotides 941 to 953 and part or all of nucleotides 954 to 1222 of SEQ ID NO: 7 in PTPRS nucleic acids.
  • Exon 8 which corresponds to the meB domain, is spliced out in non-disease associated transcripts and/or isoforms of PTPRS.
  • Disease associated PTPRS gene variant transcripts have exon 8 and exon 9 spliced out (SEQ ID NO: 8). This variant is present in isoform 1.
  • the point mutant disease associated PTPRS gene variant "G mutant PTPRS variant” is a variant of exon 9 which has a G nucleotide corresponding to position 1180 of the PTPRS transcript (isoform-l) (position 358 of SEQ ID NO: 9) instead of an "A" nucleotide which is found in the corresponding position in non-disease associated PTPRS transcript sequence (SEQ ID NO: 7).
  • Sequence corresponding to exon 9 is normally present in each of the naturally occurring isoforms 1-4, hence mutation of the residue corresponding to nucleotide 358 of SEQ ID NO: 9 is present in the gene and can be present in any of the isoforms as a person skilled in the art would recognize.
  • the disclosure provides a method of screening for, diagnosing the presence of, or detecting a risk of developing, IBD comprising detecting the presence of one or more disease associated gene variants of PTPRS wherein the variant is a disease associated SNP, a deletion or a point mutation described herein including variants described in Table A.
  • the disclosure provides a method of screening for, diagnosing the presence of, or detecting a risk of developing, ulcerative colitis comprising detecting the presence of one or more disease associated gene variants of PTPRS wherein the variant comprises a SNP, a deletion or a point mutation.
  • two or more disease associated gene variants of PTPRS are detected.
  • the two or more disease associated PTPRS gene variants detected are optionally SNP, deletion, point mutation, nucleic acid and/or polypeptide disease associated PTPRS gene variants or a combination of these.
  • the two or more disease associated PTPRS gene variants detected comprise a SNP disease associated PTPRS gene variant, such as risk allele rs8100586 and a deletion disease associated PTPRS gene variant such, as exon 9 deleted PTPRS variant.
  • the two or more disease associated PTPRS gene variants detected consist of risk allele rs8100586 (SEQ ID NO: 1) and risk allele rs886936 (SEQ ID NO: 2) which is referred to herein as the 2- marker haplotype.
  • the disease associated PTPRS gene variants detected consist of risk allele rs8100586, (SEQ ID NO:1), rs886936 (SEQ ID NO:2) and rs17130 (SEQ ID NO:3), herein referred to as the 3-marker haplotype.
  • the two or more disease associated PTPRS gene variants are selected from the group of risk alleles rs8100586 (SEQ ID NO: 1) rs886936 (SEQ ID NO: 2) and rs17130 (SEQ ID NO:3).
  • the disease associated PTPRS gene variation are selected from the group of variants described herein including the variants described in Table A.
  • PTPRS gene variants result in altered PTPRS polypeptide sequence.
  • sequence corresponding to the non-disease associated PTPRS polypeptide of isoforms 2 and 3- is illustrated in Figure 3A (top sequence) and in SEQ ID NO: 4.
  • the 2-marker and the 3-marker haplotype PTPRS gene variant result in splicing of PTPRS producing the polypeptide sequence in SEQ ID NO: 5 and Figure 3A (bottom sequence).
  • This PTPRS polypeptide isoform has the amino acids shown in Figure 3A, middle sequence (SEQ ID NO: 6) deleted compared to non- disease associated PTPRS polypeptide (SEQ ID NO: 4).
  • the disclosure in certain embodiments provides methods for detecting disease associated PTPRS gene variants wherein the variant is a disease associated PTPRS polypeptide variant.
  • PTP ⁇ protein, polypeptide or fragment thereof corresponding to a PTPRS gene, gene variant, mRNA, cDNA, nucleic acid or a fragment thereof.
  • PTPRS protein four naturally occurring isoforms of PTPRS protein are known, lsoforms-1 and -2 are long forms and lsoforms-3 and -4 are short forms with 4 FNIII domains (4-7) removed, lsoforms-2 and -3 have microexon A (meA) spliced out. lsoform-2 has meC removed from the FNIII domain.
  • MeC is in an FNIII domain that is spliced out in isoforms-3 and -4. Only isoform-1 has meA, meB, meC and meD.
  • Disease associated PTPRS gene polypeptide variants include deletion PTPRS polypeptide variants and mutation PTPRS polypeptide variants.
  • the deletion disease associated PTPRS gene variant "immunoglobulin-like 3 deleted PTPRS polypeptide variant" alternatively referred to as Ig3deleted- or Ig-like3 deleted- PTPRS polypeptide variant is a PTPRS polypeptide characterized by deletion of all or part of the amino acids 240 to 329 of SEQ ID NO: 4 which corresponds to amino acids coded for by exon 9.
  • the deletion disease associated PTPRS gene variant "meB and Ig-like 3 deleted PTPRS polypeptide variant” is characterized by deletion of all of the amino acids encoded by exon 8 and all or part of the amino acids encoded by exon 9.
  • the amino acids encoded by exon 8 correspond to amino acids 236 to 239 of SEQ ID NO: 4 and the amino acids encoded by exon 9 correspond to amino acids 240 to 329 of SEQ ID NO: 4.
  • the point mutant disease associated PTPRS gene variant is a PTPRS polypeptide characterized by mutation of the amino acid coded for by the codon comprising nucleotide 1180 of the PTPRS transcript isoform 1.
  • Non-disease associated PTPRS comprises a serine residue at this codon (amino acid 316 of SEQ ID NO: 4) whereas the disease associated variant comprises a glycine residue (amino acid 316 of SEQ ID NO: 10).
  • amino acid is present in alternate isoforms of PTPRS, corresponding amino acid in alternate isoforms are also point mutant disease associated PTPRS gene variants.
  • a person skilled in the art will recognize that the described mutations are detectable in the various isoforms of PTPRS and are not limited to the sequences presented herein.
  • the method of screening for, diagnosing the presence of, or detecting a risk of developing, IBD ulcerative colitis, and/or colonic CD involves detecting at least one disease associated PTPRS gene variant nucleic acid or polypeptide.
  • the disease associated PTPRS gene variant is detected, in one aspect of the disclosure, using compositions comprising isolated nucleic acids useful for detecting disease associated PTPRS variants.
  • the disease associated PTPRS gene variant is detecting using a probe that specifically hybridizes to the disease associated PTPRS gene variant DNA or RNA.
  • a disease associated PTPRS gene variant is detected using a composition comprising at least one nucleic acid useful for amplifying the region comprising the diseases associated PTPRS gene variant.
  • Polypeptide disease associated PTPRS gene variants are in one embodiment detected using a binding agent. i) Detecting Nucleic Acid Variants
  • a person skilled in the art will appreciate that a number of methods can be used to measure or detect the presence of a nucleic acid disease associated PTPRS gene variant. For example a variety of techniques are known in the art for detecting an SNP within a sample, including genotyping, microarrays, Restriction Fragment Length Polymorphism, Southern Blots, SSCP, dHPLC, single nucleotide primer extension, allele- specific hybridization, allele-specific primer extension, oligonucleotide ligation assay, and invasive signal amplification, Matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry, and Fluorescence polarization (FP).
  • MALDI-TOF Matrix-assisted laser desorption/ionization time-of-flight
  • FP Fluorescence polarization
  • the risk allele or SNP disease PTPRS associated gene variants are detected in one embodiment by genotyping. Methods of genotyping are well known in the art. In one method, primers flanking the SNP corresponding to a disease associated PTPRS gene variant are selected and used to amplify the region comprising the SNP. The amplified region is sequenced and analysed for the presence of the SNP disease associated PTPRS gene variant. In another embodiment, the method of detecting a risk allele or SNP disease associated PTPRS gene variant comprises using a probe that specifically hybridizes a disease associated PTPRS gene variant.
  • an amplified region comprising the SNP is hybridized using a composition comprising a probe specific for the disease associated PTPRS gene variant under stringent hybridization conditions.
  • Risk alleles are optionally detected using restriction enzymes.
  • amplified products can be digested with a restriction enzyme that specifically recognizes sequence comprising the disease associated PTPRS gene variant but does not recognize the corresponding non-disease associated sequence.
  • PCR is used to amplify DNA comprising a risk allele, amplified PCR products are subjected to restriction enzyme digestion under suitable conditions and restriction products are assessed. If for example the disease associated PTPRS gene variant is digested by the restriction enzyme, digestion is indicative of detecting a disease associated PTPRS gene variant.
  • a sample comprising DNA comprising rs17130 is amplified, amplified PCR products are subjected to restriction enzyme digestion using HpyF10V1 (Fermentas), and restriction products are separated electrophorectically. Digestion of the amplified region is indicative of the presence of risk allele rs17130.
  • the amplified fragment is digested with an isoschizomer. In a further embodiment the isoschizomer is Mwol.
  • Disease associated PTPRS gene variants comprising a mutation such as the G mutant PTPRS variant, can also be detected by a variety of methods known in the art. For example, PCR and RT-PCR and primers flanking the mutation can be employed to amplify PTPRS gene sequences and transcripts respectively in a sample comprising DNA (for PCR) or RNA (for RT-PCR). The amplified products are optionally sequenced to determine if the disease associated PTPRS gene variant is present in the sample. Alternatively the variant is detected using a composition comprising a probe specific for the disease associated G mutant PTPRS variant to hybridize to the amplified sequence.
  • the disclosure provides in one aspect, methods for detecting mutation disease associated PTPRS gene variants.
  • a sample comprising genomic DNA is obtained and primers flanking the gene mutation are used to amplify the region comprising the mutation. Sequencing is optionally employed to determine if the mutation is present in the sample.
  • a sample comprising RNA is reverse transcribed, primers flanking the mutation are used to amplify the region comprising the mutation, and sequencing is employed to determine if the mutation is present in the sample.
  • the mutation disease associated PTPRS gene variant is detected using a composition comprising a probe specific for the mutated sequence.
  • spliced or deleted nucleic acid disease associated PTPRS gene variants are optionally detected by a variety of techniques known in the art including microarrays, Northern Blots and other hybridization assays, PCR based assays and/or combinations of these.
  • RT- PCR is used in one embodiment to amplify PTPRS transcripts in a sample and a hybridization assay using a composition comprising a probe specific for an alternatively spliced or deletion disease associated PTPRS gene variant is used to detect whether the disease associated PTPRS gene variant is present in the sample.
  • compositions comprising isolated nucleic acids that are useful for detecting disease.
  • composition comprising an isolated nucleic acid sequence that specifically hybridizes to a disease associated PTPRS gene variant nucleic acid or its complement and/or specifically hybridizes to sequence in proximity to a disease associated PTPRS gene variant.
  • the composition comprises an isolated nucleic acid that specifically hybridizes to, or proximal to, a disease associated PTPRS gene variant sequence, or its complement, described herein, including a disease associated PTPRS gene variant described in Table A.
  • composition in one embodiment comprises an isolated nucleic acid that specifically hybridizes to at least one of SEQ ID NO: 1 , 2, 3 or their complements, optionally comprising a disease-associated SNP as follows: rs8100586 wherein nucleotide 201 in SEQ ID NO: 1 is A; rs886936 wherein nucleotide 226 in SEQ ID NO: 2 is A; and/or rs17130 wherein nucleotide 301 in SEQ ID NO: 3 is A.
  • the composition comprises an isolated nucleic acid that specifically hybridizes to, or proximal to, a disease associated PTPRS gene variant comprising a deletion.
  • composition in another embodiment comprises an isolated nucleic acid sequence that specifically hybridizes the G mutant PTPRS variant having point mutation at nucleotide 358 of SEQ ID NO: 8 (position 1180 of PTPRS lsoform 1 transcript).
  • compositions of the disclosure comprising nucleic acids that specifically hybridize to at least one disease associated PTPRS gene variant are useful as probes to screen for, detect or diagnose the presence of at least one disease associated gene variant of PTPRS associated with ulcerative colitis or a risk of developing ulcerative colitis.
  • the nucleic acid sequences optionally hybridize or bind genomic including intronic and/or exonic sequence, cDNA or RNA disease associated PTPRS gene variant nucleic acids.
  • the disease associated PTPRS gene variant nucleic acids are optionally single or double stranded. Alternatively the nucleic acid sequences hybridize to the complement of any of these sequences.
  • isolated nucleic acids that bind to disease associated PTPRS gene variants such as a SNP allelic variant at high stringency, are used as probes to determine the presence of the disease associated allele.
  • the nucleic acids are labeled with a detectable marker.
  • the isolated nucleic acid that binds risk allele rs8100856 disease associated PTPRS gene variant (SEQ ID NO: 1) or its complement comprises all or part of SEQ ID NO: 1 or its complement.
  • the isolated nucleic acid that binds risk allele rs886936 disease associated PTPRS gene variant (SEQ ID NO: 2) or its complement comprises all or part of SEQ ID NO:2 or its complement.
  • the isolated nucleic acid that binds risk allele rs17130 disease associated PTPRS gene variant (SEQ ID NO: 3) or its complement comprises all or part of SEQ ID NO: 3).
  • the isolated nucleic acid in another embodiment, binds sequence upstream and/or downstream of a deletion in a deletion disease associated PTPRS gene variant.
  • the isolated nucleic acid specifically binds sequence that is upstream and downstream of sequence deleted in exon 9 deleted PTPRS gene variant (nucleotides 954 to 1222 of SEQ ID NO: 7) or its complement, or specifically binds sequence that is upstream and downstream of the sequence deleted in exon 8 and exon 9 deleted PTPRS gene variant (SEQ ID NO: 8) or its complement and comprises all or part of nucleotides 1 to 941 and 1222 to 7347 of SEQ ID NO: 7.
  • the isolated nucleic acid that binds the disease associated PTPRS gene variant in SEQ ID NO: 8 or its complement comprises all or part of SEQ ID NO: 8 or its complement.
  • the isolated nucleic acid that binds G mutant PTPRS variant comprises all or part of SEQ ID NO: 9 or its complement.
  • the composition comprises an isolated nucleic acid having 0-10, 10-20, 20-50, 50-100, 100-200, or more than 200 nucleotides of one of the aforementioned sequences. The composition is useful to screen for, detect or diagnose the presence of at least one disease associated PTPRS gene variant associated with IBD or a risk of developing IBD, ulcerative colitis or a risk of developing ulcerative colitis, or a ulcerative colitis associated disease.
  • the disclosure provides a composition comprising at least two isolated nucleic acid sequences that specifically hybridize to SEQ ID NO: 1 or its complement, optionally comprising rs8100856 or at least two isolated nucleic acid sequences that specifically hybridize to SEQ ID NO: 2 or its complement optionally comprising rs886936 or at least two isolated nucleic acid sequences that bind to SEQ ID NO: 3 or its complement, optionally comprising rs17130.
  • the composition is useful as probes to screen for, diagnose the presence of, or detect a risk of developing, IBD and/or ulcerative colitis.
  • the isolated nucleic acids are labeled with a detectable marker.
  • At least two isolated nucleic acid sequences that bind SEQ ID NO:1 and optionally comprise rs8100856 are useful as probes to screen for, to diagnose the presence of, or detect an increased risk of developing, colonic CD in subjects with IBD.
  • the at least two isolated nucleic acid sequences are labeled with different detectable markers.
  • one isolated nucleic acid sequence labeled with one marker specifically hybridizes to a disease associated risk allele or its complement and a second isolated nucleic acid labeled with a second marker, specifically hybridizes to a non-disease associated allelic variant or its complement. Detection of each signal allows discrimination between subjects that are negative, heterozygote or homozygote for the disease associated PTPRS gene variant SNP.
  • the marker or label is typically capable of producing, either directly or indirectly, a detectable signal.
  • the label may be radio- opaque or a radioisotope, such as 3 H, 14 C, 32 P, 35 S, 123 I, 125 1, 131 I; a fluorescent (fluorophore) or chemiluminescent (chromophore) compound, such as fluorescein isothiocyanate, rhodamine or luciferin; an enzyme, such as alkaline phosphatase, beta-galactosidase or horseradish peroxidase; an imaging agent; or a metal ion.
  • the nucleic acids are labeled with 6-FAM or VIC. 6-FAM gives a blue fluorescence upon activation and VIC gives a red fluorescence upon activation. Other fluorescent dyes are available but 6-FAM and VIC are most common.
  • isolated nucleic acid refers to a nucleic acid substantially free of cellular material or culture medium, for example, when produced by recombinant DNA techniques, or chemical precursors, or other chemicals when chemically synthesized.
  • An "isolated nucleic acid” is also substantially free of sequences which naturally flank the nucleic acid (i.e. sequences located at the 5' and 3 1 ends of the nucleic acid) from which the nucleic acid is derived.
  • nucleic acid is intended to include DNA and RNA and can be either double stranded or single stranded.
  • probe refers to a nucleic acid sequence that will hybridize to a nucleic acid target sequence.
  • the probe hybridizes to SEQ ID NO: 1 comprising disease associated SNP PTPRS gene variant rs8100586; or SEQ ID NO: 2 comprising disease associated SNP PTPRS gene variant rs886936 or SEQ ID NO: 3 comprising disease associated SNP PTPRS gene variant rs17130 or their complements.
  • the probe hybridizes to SEQ ID NO: 8 or their complements.
  • the length of probe depends on the hybridization conditions and the sequences of the probe and nucleic acid target sequence.
  • the probe is 8-100, 8-200 or 8-500 nucleotides in length, such as 1-7, 8-10, 11- 15, 16-20, 21-25, 26-50, 51-75, 76-100, 101-150 or 151-200 nucleotides in length or at least 200, 250, 400, 500 or more nucleotides in length.
  • 10, 15, 20 or 25 nucleotides provide a lower end for the aforementioned nucleotide ranges.
  • the phrase "specifically hybridizes to the disease associated allelic variant or risk allele or its complement” means that under the same conditions, the isolated nucleic acid sequence will not hybridize to the sequence shown in the non-disease associated allelic variant, or its complement or preferentially hybridizes to the risk allele sequence or its complement.
  • a nucleic acid that specifically hybridizes to the genomic sequences of the disease associated PTPRS allelic variant or risk allele in SEQ ID NO: 1(i.e. where nucleotide 201 is "A") will not hybridize to the non-disease associated PTPRS allelic variant in SEQ ID NO: 1 (i.e. where nucleotide 201 is "C").
  • the isolated nucleic acid optionally hybridizes the deleted or spliced transcript or cDNA and/or a position proximal to the deleted portion of the splice variant.
  • hybridize refers to the sequence specific non- covalent binding interaction with a complementary nucleic acid.
  • One aspect of the disclosure provides an isolated nucleotide sequence, which hybridizes to the risk allele in SEQ ID NO: 1 or its complement or the risk allele of SEQ ID NO: 2 or its complement or the risk allele of SEQ ID NO: 3 or its complement.
  • the hybridization is under high stringency conditions.
  • high stringency conditions it is meant that conditions are selected which promote selective hybridization between two complementary nucleic acid molecules in solution. Hybridization may occur to all or a portion of a nucleic acid sequence molecule.
  • the hybridizing portion is typically at least 5-14, 15-20, 21-25, 26-30, 31-40, 41-50 or 50, 50-100, 100-200 or 200 or more or more nucleotides in length.
  • Tm 81.5 0 C - 16.6 (Log10 [Na+]) + 0.41(%(G+C) - 600/I), or similar equation). Accordingly, the parameters in the wash conditions that determine hybrid stability are sodium ion concentration and temperature.
  • a 1% mismatch may be assumed to result in about a 1°C decrease in Tm, for example if nucleic acid molecules are sought that have a >95% identity, the final wash temperature will be reduced by about 5 0 C. Based on these considerations those skilled in the art will be able to readily select appropriate hybridization conditions. In preferred embodiments, stringent hybridization conditions are selected.
  • nucleic acid sequences that are primers are useful to amplify DNA or RNA sequences containing a disease associated PTPRS gene variant. Accordingly, in one embodiment, the disclosure provides a composition comprising at least one isolated nucleic acid sequence that is a specific primer able to amplify a sequence comprising a disease associated PTPRS gene variant. In one embodiment the primer that binds to a disease associated PTPRS gene variant is selected from the group comprising SEQ ID NO: 11-20.
  • the composition comprises an isolated nucleic acid that is a specific primer able to amplify a sequence comprising SNP rs8100586 (SEQ ID NO: 1), rs886936 (SEQ ID NO: 2) rs17130 (SEQ ID NO:3); sequence upstream and downstream of sequence corresponding to exon 9 (corresponding to sequence upstream of 954 and downstream of 1222 in SEQ ID NO: 7), sequence upstream and downstream of sequence corresponding to exon 8 and exon 9 (corresponding to sequence upstream of 941 and downstream of 1222 in SEQ ID NO: 7) or G mutant PTPRS variant having a (comprising nucleotide 358 of SEQ ID NO: 9).
  • one or more isolated nucleic acid sequences useful for amplifying SNP rs8100586 are selected from the group consisting of:
  • one or more isolated nucleic acid sequences, useful for amplifying SNP rs886936 are selected from the group consisting of:
  • one or more isolated nucleic acid sequences useful for amplifying SNP rs17130 are selected from the group consisting of:
  • one or more isolated nucleic acid sequences useful for amplifying a G mutant PTPRS gene variant (SEQ ID NO: 9) and deletion disease associated PTPRS gene variants (deleted for all or part of SEQ ID NO:8) are selected from the group comprising: 5" to 3' ATC AAA CAG CTG CGA TCA G (SEQ ID NO: 19) 3' to 5' GGA TTT ATA TTC GAT GAC G (SEQ ID NO: 20)
  • the isolated nucleic acid sequences are useful for primer extension genotyping.
  • Methods of primer extension genotyping are well known in the art. For example, methods such as those described in Huang et al. Auto-validation of fluorescent primer extension genotyping assay using signal clustering and neural networks BMC Bioinformatics 2004 5:36 are optionally employed with the methods of the disclosure.
  • one primer binds upstream of the nucleotide identified by rs8100586 (SEQ ID NO: 1) at position 5195333 and another primer binds downstream from the nucleotide identified by rs8100586 (SEQ ID NO: 1).
  • one primer hybridizes within 1-4, 5-14, 15-20, 21-25, 26-30, 31- 40, 41-50, 50-100, 100-200, or 200-500 or more base pairs 5 1 of rs8100586 and another primer hybridizes within 1-4, 5-14, 15-20, 21-25, 26-30, 31-40, 41-50 or 50, 50-100, 100-200, or 200-500 or more base pairs 3 1 of rs8100586 in PTPRS.
  • one primer hybridizes within 200 base pairs 5 1 of rs8100586 in PTPRS and another primer hybridizes within 200 base pairs 3' of rs ⁇ 100586 (SEQ ID NO: 1).
  • one primer is upstream of the nucleotide identified by rs886936 (SEQ ID NO:2) at position 5190953 and another primer is downstream from the nucleotide at position identified by rs886936 (SEQ ID NO: 2).
  • one primer hybridizes within 1-4, 5-14, 15-20, 21-25, 26-30, 31-40, 41-50 or 50 or more base pairs of the 5' of the SNP rs886936 in PTPRS and another primer hybridizes within 1-4, 5-14, 15-20, 21-25, 26-30, 31-40, 41-50, or 50, 50-100, 100-200, or 200-500 or more base pairs of the 3 1 of the SNP rs886936 in PTPRS.
  • one primer hybridizes within 200 base pairs 5' of rs886936 in PTPRS and another primer hybridizes within 200 base pairs 3 1 of rs886936 (SEQ ID NO: 2).
  • one primer is upstream of the nucleotide identified by rs17130 and another primer is downstream from the nucleotide at position identified by rs17130 (SEQ ID NO: 3) at position 301.
  • one primer hybridizes, within 1-4, 5-14, 15-20, 21-25, 26-30, 31-40, 40-50 or 50, 100-200 or 200-500 or more base pairs of the 5 1 of the SNP rs17130 in PTPRS and another primer hybridizes within 50-100, 100-200 or 200-500 base pairs of the 3 1 of the SNP rs17130 in PTPRS.
  • one primer hybridizes within 200 base pairs 5 1 of rs17130 in PTPRS and another primer hybridizes within 200 base pairs 3' of rs17130 (SEQ ID NO: 3).
  • the primers for amplifying the rs ⁇ 100586 SNP comprise all or part of SEQ ID NOS: 11-12.
  • primers for amplifying the rs886936 SNP comprise all or part of SEQ ID NO: 13 and SEQ ID NO: 14.
  • the primers for amplifying the rs17130 SNP comprise all or part of SEQ ID NO: 15 and SEQ ID NO: 16 or SEQ ID NO: 17 and SEQ ID NO: 18.
  • primers for amplifying exon 9 deleted PTPRS variant, exon 8 and exon 9 deleted PTPRS variant and/or G mutant PTPRS variant comprise all or part of SEQ ID NO: 19 and SEQ ID NO: 20.
  • primers are optionally selected upstream or downstream of the identified SNP rs8100586 rs886936, rs17130 in SEQ ID NO: 1 , 2 or 3 respectively.
  • primers are selected flanking a mutation site or flanking a deletion in a disease associated PTPRS gene splice variant.
  • Amplified sequences are optionally sequenced to determine if the subject has a disease associated PTPRS gene variant.
  • amplified sequences are digested with a restriction endonuclease that recognizes either the disease associated PTPRS gene variant or the non- disease associated corresponding sequence, so that only one is cleaved, permitting discrimination between non-disease and disease associated PTPRS gene variant sequences.
  • the presence of nucleic acid transcripts of disease associated PTPRS gene variants are optionally detected by comparing transcript size to non-disease associated transcript size.
  • the disclosure provides in one aspect detecting mRNA and/or transcripts of PTPRS to determine if a subject sample has a disease associated PTPRS gene variant mRNA. For example, in one method, mRNA is separated by gel electrophoresis or other suitable method, hybridized to a probe that selectively binds isoform-1 transcripts of PTPRS and the sizes of PTPRS mRNA transcripts are determined.
  • Disease associated PTPRS gene variant mRNA that is deleted for sequence corresponding to exon 9 and exon 8 sequences is smaller in size than corresponding non-disease associated PTPRS mRNA and the presence of said smaller mRNA is indicative of ulcerative colitis or an increased risk of developing ulcerative colitis (see Figure 3C).
  • Another aspect provides detecting the presence of one or more disease associated PTPRS gene variants wherein the disease associated PTPRS gene variant is a polypeptide.
  • the inventors have identified disease associated PTPRS gene variants that correspond to altered splicing protein isoforms. For example, the
  • 2 marker haplotype and the 3 marker haplotype result in a novel splicing of the PTPRS gene transcript removing the third Ig-like domain (exon-9) from the ectodomain of PTP ⁇ (SEQ ID NO: 5).
  • Subjects with said 2 marker or 3 marker haploytype hence have a novel exon-9 deleted PTPRS polypeptide isoform.
  • the presence of a polypeptide disease associated PTPRS gene variant is detected using a binding agent that binds a disease associated PTPRS gene variant polypeptide.
  • Binding agents that bind only the disease associated variant are useful, as are binding agents that permit discrimination between disease associated and non-disease associated PTPRS polypeptides, by for instance permitting discrimination between the molecular weight of non-disease associated and disease associated variants .
  • the 3-marker or 2-marker haplotype result in alternative splicing of the PTPRS transcript removing sequences for exon 9 (Ig-like3) and optionally exon 8 (meB).
  • the protein encoded is deleted for amino acids coded for by exon 9 and 8 (SEQ ID NO: 5). These amino acids that are spliced out (SEQ ID NO: 6) have an approximate molecular weight of 10.34kDa.
  • non-disease associated isoform 1 of PTPRS polypeptide differs in molecular weight from the disease associated polypeptide deleted for Ig-like3 and meB domains by approximately 10.34 kDa.
  • Polypeptides separated by size e.g. using SDS-PAGE
  • bound with a binding agent that binds both disease associated PTPRS gene variant polypeptides and non-disease associated PTPRS and which is labeled, permits detection of disease associated PTPRS gene variant polypeptides.
  • the binding agent is an antibody.
  • the antibody is labeled.
  • a sample from a subject is separated according to polypeptide size; optionally separated by electrophoresis, and detected with an antibody that specifically recognizes PTPRS polypeptides.
  • a PTPRS isoform 1 polypeptide that exhibits decreased molecular weight, wherein the decrease corresponds approximately to the molecular weight of all or part of the Ig-like3 and/or Ig-like3 and meB domains is a disease associated PTPRS gene variant and is indicative of IBD or ulcerative colitis, or an increased risk of developing IBD or ulcerative colitis.
  • the antibody in one embodiment is useful for detecting the molecular sizes of non-disease associated and disease associated PTPRS gene variant polypeptides.
  • the antibody recognizes an epitope present in both disease associated and non-disease associated PTPRS polypeptide.
  • the antibody detects an epitope present in a disease associated PTPRS gene variant polypeptide or fragments thereof that is not present in a non-disease PTPRS polypeptide.
  • Antibodies recognizing novel epitopes in disease associated PTPRS gene variants such as exon-9 deleted PTPRS variant specifically recognize disease associated PTPRS gene variant polypeptides. Accordingly, in one embodiment an antibody recognizing a disease associated PTPRS gene variant polypeptide is used to detect the presence of a disease associated PTPRS gene variant indicative of IBD or an increased risk of developing IBD. In another embodiment an antibody recognizing a disease associated PTPRS gene variant polypeptide is used to detect the presence of a disease associated PTPRS gene variant indicative of UC or an increased risk of developing UC.
  • the novel disease associated PTPRS epitopes are used to make antibodies specific to disease associated PTPRS gene variant polypeptides.
  • the antibody made is isolated.
  • the isolated antibody is made by administering an antigen corresponding to a disease associated PTPRS epitope to an animal and isolating antibodies that bind specifically to the immunizing antigen.
  • the term "antigen" as used herein means a substance that produces an immune response and antibodies specific for the antigen.
  • the antigen for example is a peptide or peptide mimetic corresponding to a disease associated epitope.
  • antibody includes monoclonal antibodies, polyclonal antibodies, humanized antibodies chimeric antibodies, antibody fragments (e.g., Fab, and F(ab')2) and recombinantly produced binding partners.
  • the antibody may be from recombinant sources and/or produced in transgenic animals.
  • antibody fragment used herein includes Fab, Fab', F(ab')2, scFv, dsFv, ds-scFv, dimers, minibodies, diabodies, and multimers thereof and bispecific antibody fragments.
  • humanized antibody used herein means that the antibody or fragment comprises human conserved framework regions and the hypervariable regions are of non-human origin.
  • the hypervariable region alternatively referred to as the antigen binding domain may be from a mouse or another species.
  • Humanized forms of rodent antibodies can be generated by a number of approaches including CDR grafting (Riechmann et al. Nature, 332:323-327, 1988) and by resurfacing (Pedersen et al. J MoI Biol, 235: 959- 973, 1994).
  • Human antibodies specific to a particular antigen may be identified by a number of approaches including a phage display strategy (Jespers et al. Bio/Technology, 12: 899-903, 1994) and transgenic animals (US Patent Nos. 6,150,584; 6,114,598; and 5,770,429).
  • Humanized or human antibodies may be selected from any class of immunoglobulins including: IgM, IgG, IgD, IgA or IgE; and any isotype, including: IgGI , lgG2, lgG3 and lgG4.
  • the humanized or human antibody may include sequences from one or more than one isotype or class; exist in monomeric or polymeric form; and be produced as antigen binding fragments such as Fab, Fab 1 F(ab') 2 , Fd, Fv and single domain antibody fragments, or as single chain antibodies in which the heavy and light chains are linked by a spacer.
  • kits for screening for, diagnosing the presence of, or detecting a risk of developing, IBD 1 UC and/or colonic CD provides in one embodiment, a kit for screening, for diagnosing the presence of, or detecting a risk of developing, UC. In another embodiment, the disclosure provides a kit comprising compositions of the disclosure for screening for, diagnosing the presence of, or detecting a risk of developing, colonic CD. . In one embodiment the kits comprise, one or more compositions of the disclosure and instructions for use.
  • the kit comprises nucleic acids that specifically hybridize to a disease associated gene variant of PTPRS.
  • Another aspect of the disclosure provides a kit comprising nucleic acid sequences where the sequences are primers.
  • the kits optionally provide reagents to detect one or more disease associated PTPRS gene variants.
  • the kit comprises a binding agent such as an antibody that specifically binds a disease associated PTPRS gene variant polypeptide and instructions for use.
  • the kit comprises an isolated antibody specific for an epitope present in a disease associated PTPRS gene variant that is not present in a non-disease associated PTPRS isoform.
  • the disclosure provides methods of screening for, diagnosing the presence of, or detecting a risk of developing, IBD, ulcerative colitis and/or colonic CD.
  • the method comprises detecting the presence of at least one disease associated PTPRS gene variant in a sample of a subject. Detection of one or more disease associated PTPRS gene variants such as the gene variants described in Table A indicates that the subject has ulcerative colitis and/or has a increased risk of developing ulcerative colitis. As ulcerative colitis is a subcategory of IBD, the presence of at least one disease associated PTPRS gene variants in the sample of the subject also indicates that the subject has IBD.
  • the method of screening for, diagnosing the presence of, or detecting a risk of developing, IBD and/or ulcerative colitis comprising detecting the presence of at least one disease associated PTPRS gene variant in a sample of a subject, is useful for discriminating between different types of IBD. Accordingly, in one embodiment the method is used to differentiate subjects having UC from subjects having CD and/or other gastrointestinal illnesses. In another embodiment the method is used to differentiate subjects having UC, from subjects having small bowel Crohn's disease or indeterminate colitis.
  • the subjects being screened optionally have a known risk of developing IBD.
  • the subject has IBD.
  • the subject has a family history or predisposition to IBD.
  • the presence of a disease associated PTPRS gene variant is indicative of UC or an increased risk of developing UC compared to a subject not having one or more disease associated PTPRS gene variants.
  • the methods of the disclosure are used to differentiate subjects having UC and colonic CD, the method comprising detecting the presence of at least one disease associated PTPRS gene variant selected from the group provided in Table A wherein the at least one disease associated PTPRS gene variant is not SNP risk allele rs8100856.
  • a subject having said at least one disease associated PTPRS gene variant indicates the subject has UC, and not colonic CD.
  • a subject who is "has a predisposition to" IBD and/or UC means a subject having symptoms or a predisposition to developing IBD based, example, on a family history of IBD and/or UC that is indicative of a genetic predisposition.
  • a predisposition may also exist where the subject has one or more symptoms associated with IBD. Similarly, such a subject optionally has a predisposition towards developing IBD, UC or CD.
  • the method is also useful for detecting genetic predisposition to developing IBD, ulcerative colitis and/or colonic Crohn's disease.
  • the sample tested is that of a subject biologically related to a human with IBD ulcerative colitis, or colonic CD.
  • the method can be employed where the subject is a first, second or third degree relative.
  • a "first degree relative” as used herein refers to any relative who is one meiosis away from the subject or subject and includes an offspring, sibling or parent.
  • a “second degree relative” as used herein is any relative who is two meiosis away from the subject of subject in a pedigree and includes a grand parent, grand child, uncle, aunt, nephew, nephew and half-siblings.
  • a “third degree relative” as used herein is any relative who is three meiosis away in a pedigree.
  • the subject or individual is any animal, preferably a human.
  • the subject or individual does not have ulcerative colitis and is a first degree relative of a human with diagnosed ulcerative colitis.
  • the individual who does not have active or diagnosed ulcerative colitis, ulcerative colitis, IBD or colonic CD is a sibling of a human with UC, IBD or colonic CD.
  • the subject is a second or third degree relative of a human with UC, IBD or colonic CD.
  • the methods of the disclosure are useful for detecting whether a subject diagnosed with UC, IBD or colonic CD is responding to therapy.
  • the PTPRS gene encodes a phosphatase which is an enzyme that catalyzes the removal of phosphatase groups from biomolecules.
  • Response to therapy is optionally monitored by measuring PTPRS poypeptide enzymatic activity and correlating with disease response to therapy.
  • PTPRS protein enzyme activity is measured in a sample taken from a subject undergoing treatment and having or suspected of having UC, or undergoing treatment and having or suspected of having an increased risk of developing UC, wherein the sample is optionally taken before, during and/or after therapy, and compared to PTPRS protein enzyme activity measured in a second sample taken from said subject, subsequent to said first sample.
  • a change, typically an increase, in enzyme activity in said subsequent sample is indicative of responding to therapy.
  • Enzyme activity is detected using methods readily known in the art.
  • PTPRS protein substrates can be used with in vitro assays to measure PTPRS protein enzyme activity in a sample of a subject.
  • the method comprises measuring the enzymatic activity of PTPRS, by determining the ability of PTPRS to dephosphorylate colonic substrates which are optionally E-cadherin and ⁇ -catenin, and correlating enzymatic activity with disease activity.
  • the amount, or phosphorylation level of PTPRS protein enzyme substrates, such as E-cadherin and ⁇ -catenin is measured.
  • E-cadherin and/or ⁇ -catenin protein amounts and/or phosphorylation levels are measured in a first sample, taken from a subject undergoing treatment and having or suspected of having ulcerative colitis, or having or suspected of having an increased risk of developing ulcerative colitis, wherein said first sample is optionally taken before, during and/or after therapy and measuring E-cadherin and/or ⁇ -catenin protein amounts and/or phosphorylation levels in a subsequent sample taken from said subject, wherein a change in polypeptide amounts and/or typically a decrease in phosphorylation levels is indicative of responding to therapy.
  • a change in phosphorylation levels as used herein means a change that is, for example, at least 50% more or less compared to a comparator sample. For example, there is a change in phosphorylation of ⁇ -catenin polypeptide if ⁇ -catenin in a subsequent sample is at least 50% more phosphorylated or at least 50% less phosphorylated compared to the level of phosphorylation of ⁇ -catenin in the previous sample.
  • the methods of the disclosure are optionally used to assess the need for surgery to treat a subject with IBD. Allelic variants have been associated with increased risk of needing surgery.
  • the disclosure provides in one embodiment a method useful for determining the need for surgery in a subject having or suspected of having IBD or UC or having increased risk of developing IBD or UC.
  • the method comprises: assaying a sample from a subject having or suspected of having UC for one or more disease associated PTPRS gene variants; and correlating the presence of said one or more disease associated PTPRS gene variants with risk of needing surgery.
  • Another aspect of the disclosure provides a method for reducing the risk of developing ulcerative colitis or a disease associated with ulcerative colitis in subjects having or suspected of having an increased risk of developing UC in subjects having or suspected of having UC.
  • the disclosure provides a method of managing ulcerative colitis.
  • Probiotics have been demonstrated to reduce the risk of developing ulcerative colitis and are beneficial for managing UC.
  • probiotics including E. coli Nissle 1917, VSL#3, milk with bifidobacteria, and Saccharomyces boulardii are effective in the prevention of relapse, the induction of remission and the maintenance of remission of mild to moderate ulcerative colitis (reviewed in Mach T. Journal of Physiology and Pharmacology, 57(Suppl 9): 23-33, 2006; see also Rafter et al. Am J Clin Nutr. 2007 Feb;85(2):488-96).
  • a subject identified as having a disease associated PTPRS gene variant is administered a probiotic to reduce the risk of developing ulcerative colitis and/or colon cancer associated with ulcerative colitis.
  • a subject identified as having a disease associated PTPRS gene variants and diagnosed as having UC is administered a probiotic to manage disease progress prevent relapse and/or induce remission.
  • Any of the methods of the disclosure to screen for, diagnose the presence of, or detect a risk of developing, IBD and/or ulcerative colitis can be combined with traditional diagnostic techniques for diagnosing IBD and/or ulcerative colitis. The method is optionally combined with assessing other diagnostic parameters such as duration of disease and association with primary sclerosing cholangitis.
  • pharmacogenomic therapies may be developed for specific genotypes of disease associated PTPRS gene variants.
  • genotyping for the allelic variants associated with ulcerative colitis is optionally used to determine if a specific therapy should be followed.
  • sample refers to any bodily sample that comprises DNA, RNA, and/or protein.
  • the sample comprises blood.
  • the sample comprises stool.
  • the sample comprises tissue and/or a tissue biopsy.
  • the sample may be optionally fractionated, purified, extracted or modified.
  • the sample is in other embodiments optionally fixed, frozen or fresh.
  • a person skilled in the art will understand that there are multiple ways to process a sample and would prepare the sample appropriately accordingly to the method selected to detect the disease associated gene variant or variants of PTPRS.
  • sample refers to a genomic sequence comprising genomic sequence of the PTPRS gene of a subject.
  • the genomic sequence is analysed for the presence of at least one disease associated PTPRS gene variant to screen for, detect or diagnose a risk of developing IBD and/or ulcerative colitis.
  • the PTPRS gene encodes a protein that is a cell adhesion molecule.
  • the PTPRS protein comprises immunoglobulin and fibronectin repeats in its extracellular domain which are involved in protein binding.
  • the inventors have found that the disease associated gene variants of PTPRS include deletions in the immunoglobulin-like domain (Ig-like3 domain).
  • the inventors have identified a role for the PTPRS protein, PTP ⁇ , in maintaining adherens junction proteins in a dephosphorylated state and thereby protecting barrier defense in the colon.
  • the disclosure provides a method of treating a subject who has ulcerative colitis comprising administering a binding agent that binds an extracellular domain of PTPRS protein and inhibits bacteria or neutrophil binding to PTPRS protein.
  • the binding agent is an antibody.
  • the antibody is a neutralizing antibody.
  • neutralizing antibody means an immunoglobulin molecule that reacts with its antigen thereby preventing or reducing access by other entities such as bacteria or neutrophils to sites on the antigen that are obscured by the neutralizing antibody.
  • the antibody is a humanized antibody.
  • This design captured all 54 unique SNPs using 36 tagged SNPs and captured 100% of alleles with r 2 > 0.8 (MAF 0.001). Once SNP were selected they were cross-referenced for compatibility in the GoldenGate Assay®. Thirty-six tagged SNPs and 8 additional non-synonymous coding region SNPs located in coding regions were identified (these SNPs are captured by the tagged
  • Genotype analysis of the Toronto samples was done using the lllumina® genotyping system and genotype analysis of the Pittsburgh samples was done using Taqman®.
  • Genotyping for rs17130 was done using Cleaved Amplified Polymorphic Sequence. Here DNA was amplified using the primers. GCTTAAGCAGGCATGTTCCCAT and GTCATCACAGCAGCTGCCATT to yield a 259bp product. PCR was carried out in 10 ⁇ L reactions with 1.75mM magnesium chloride, 20OnM dNTPs, and .25 ⁇ L AmpliTaq (ABI), combined with 50ng of genomic DNA. Subsequent to PCR, 4 ⁇ l_ of PCR products were digested with 1.5 units of HpIOVI (Fermentas), an isochizomer of Mwol, in a 10 ⁇ l_ reaction.
  • HpIOVI Fermentas
  • Primers used to detect mutation and altered splicing include: 5' to 3' ATC AAA CAG CTG CGA TCA G (SEQ ID NO: 19) 3' to 5' GGA TTT ATA TTC GAT GAC G (SEQ ID NO: 20) Animal Experimentation
  • PTPRS-KO mice were generated, bred and genotyped (on a C57B16/129 background) as previously described 11 . Mice used in these experiments were between 8 and 12 wks old and all control mice were littermates of the PTPRS-KO mice. Mice were housed in pathogen free environment and fed standard diet with free access to water. Animal care and all experiments were approved by the Animal Care Ethics panel at the Hospital for Sick Children. For C. rodentium experiments, the mice were transferred to the containment facility at least 3 days prior to pathogen inoculation.
  • C. rodentium strain DBS 100 was grown as described previously 19 and mice were inoculated by oral gavage with 0.1 ml suspension (in sterile PBS) containing 10 9 cfu of C. rodentium. The mice were monitored daily as above, and rectal swabbed for C. rodentium colonization. At time of sacrifice the mice were treated as above.
  • GST fused to the inactive mutant of the first catalytic domain of PTPS (GST-PTPaDI(DA)), or a catalytically active construct (GST- PTPaDI(WT)) was incubated with lysates prepared from colons of the PTPRS-KO mice, and trapping of E-cadherin and ⁇ -catenin detected by immunoblotting with antibodies (E-cadherin BD 610181; ⁇ -catenin BD 610153) to these proteins, as described 23 .
  • Kaplan Meier curve was plotted to analyze time to first rectal bleeding following DSS administration, utilizing the log rank test to compare the WT with the PTPRS-KO mice.
  • Lin Ninety-five percent confidence intervals (Cl) were calculated for all point estimates.
  • Hazard ratio was calculated after confirming the assumption of proportional hazards. All comparisons were made using two sided significance levels of p ⁇ 0.05.
  • Statistical analyses were performed using SPSS V12.0, and figures were plotted using Prism 4 for windows (GraphPad Software, Inc).
  • Linkage disequilibrium between markers and haplotype structures were first calculated using FBAT with haplotypes being estimated from unphased input using an accelerated EM algorithm. Haplotype association testing was performed using the HBAT option within the FBAT software package. Haploview was then used to map the linkage disequilibrium patterns across the markers and to determine the distinct haplotype blocks. Throughout the report, all p-values reported are uncorrected except where stated. Corrected p-values were calculated empirically using the permutation testing option (100,000 permutations) within Haploview.
  • the genotype data was first analysed to determine the presence of any Mendelian inconsistencies and departures from Hardy-Weinberg equilibrium; families with >2 Mendelian errors were removed from the dataset.
  • family-based association analyses the affection status for each individual was coded 9 times to reflect all possible combinations of disease (IBD, CD, UC) and ethnicity (Jewish, non-Jewish) phenotype.
  • counts of untransmitted and transmitted alleles from heterozygous parents to affected offspring were determined using the standard transmission/disequilibrium test implemented in the haploview software package
  • PTPRS is located on human chromosome 19p13 9 in the region of peak LOD score (D19S591/D5S247-GATA21G05) 6 in IBD6.
  • PTPRS is a susceptibility gene for IBD in this region, the inventors identified
  • FIG. 1 shows the linkage disequilibrium pattern across the PTPRS gene and flanking regions for all 33 SNPs for UC trios.
  • Table 3 shows the demographs of the patients that were used in the study.
  • Table 3 shows the above association.
  • PTPRS may be a susceptibility gene for UC in the IBD6 locus.
  • Table 1 shows Transmission Disequilibrium Testing for 33 SNPs from 409 pedigrees (409 nuclear families, 1276 persons) for IBD (Table 1A), from 127 pedigrees (127 nuclear families, 397 persons) for UC (Table 1B) 1 and from 263 pedigrees (263 nuclear families, 822 persons) for CD (Table 1C) using FBAT-e.
  • Table 1 A TDT for IBD rs740058 1 0.789 195 286.000 290.000 69.500 -0.480 0.631364 rs740058 2 0.211 195 130.000 126.000 69.500 0.480 0.631364 rs758512 2 0.848 160 245.000 244.500 60.750 0.064 0.948851 rs758512 3 0.152 160 103.000 103.500 60.750 -0.064 0.948851 rs4807718 1 0.695 235 336.000 327.500 109.750 0.811 0.417156 rs4807718 3 0.305 235 182.000 190.500 109.750 -0.811 0.417156 rs735538 1 0.070 84 44.000 48.500 29.250 -0.832 0.405381 rs735538 3 0.930 84 138.000 133.500 29.250 0.832 0.405381 rslO518244 1 0.959 55 89.000 9
  • Example 3 To determine if the region containing the three SNPs found here to be associated with UC leads to alternative splicing, genotyped immortalized lymphoblast cell lines derived from individuals from the Centre d'Etude du Polymorphisme Humainwere compared with three individuals with the 3- marker haplotype associated with UC with three individuals homozygous for the nucleotide not associated with UC. mRNA was isolated from the lymphoblast cell lines and a DNA fragment corresponding to amino acids 191 to 371 of PTP ⁇ was amplified using PCR. All three control individuals had the expected 168 amino acid sequence that was a 100% match with either isoform-2 or -3 ( Figure 3A).
  • mice previously generated were investigated 11 . These mice exhibit high neonatal mortality 11 . Mice that survive the high neonatal mortality suffer severe cachexia 11 ' 12 . Surviving mice appear phenotypically normal except for mild gastrointestinal histological abnormalities and significant growth failure compared to their wild-type (WT) littermate. 11 ' 15 . All cohorts of PTPRS-KO mice displayed mild gastrointestinal abnormalities including colitis 11 ' 15 . Using the LacZ insert knocked-in in this mouse model, PTPRS was found to be expressed throughout the gastrointestinal tract ( Figure 4A, B).
  • PTPRS-KO mice displayed a mild form of colitis with histological architectural distortion and crypt branching (Figure 4C, D) and a histological score 16 of 1.5 compared to wild-type (WT) littermates (Figure 5b).
  • the architectural distortion is further evident on electron micrograph (Figure 4E 1 F).
  • DAI Disease Activity Index
  • Example 6 To further demonstrate that PTPRS-KO mice have an increased susceptible to colitis, Citrobacter rodentium was used as an experimental model of colitis. 19 . As shown in Figure 5E(b), the PTPRS-KO mice had significant weight loss while the WT mice continued to gain weight during the entire experiment period (p ⁇ 0.001 , Wilcoxon rank sum). The PTPRS mice had significantly worse median DAI (p ⁇ 0.001 , Wilcoxon rank sum test; Figure 5B(b)) and histological scores (p ⁇ 0.001 , Wilcoxon rank sum test; Figure 5A(c)) compared to WT littermates.
  • N-cadherin and ⁇ -catenin are in vivo substrates for PTP ⁇ in the nervous system 23 .
  • substrate trapping experiments 23 ' 38 were performed to test whether E-cadherin and ⁇ -catenin were in vivo substrates for PTP ⁇ in the colon.
  • Figure 6C shows that these proteins are indeed colonic substrates for PTP ⁇ .
  • the inventors showed that E-cadherin is hyper-Tyrosine phosphorylated in the colons of the PTPRS-KO mice relative to sibling controls (Figure 6D).
  • E-cadherin 24 ' 25 and ⁇ -catenin 25 are involved in colonic physiology, with a cadherin dominant negative mouse model expressed in the gut causing intestinal inflammation 26 .
  • Phosphorylation of E-cadherin 28 ' 29 and ⁇ -catenin 30"32 results in cellular redistribution of E- cadherin and cell disassociation leading to disassembly of the adherens junction 33 .
  • the inventors show that three adjacent tag SNPs (rs886936, rs8100586, and rs17130) within the PTPRS gene have significant association with UC.
  • the 3-marker haplotype associated with UC results in novel alternate splicing of meB and exon 9. This novel splicing completely removes the third immunoglobulin like (Ig-like) domain of PTP ⁇ , likely altering ligand recognition or dimerization that is important for ligand binding.
  • PTPRS is known to be expressed in the human colon 10 and the inventors demonstrate that PTPRS-KO mice develop spontaneous mild colitis and are susceptible to induced colitis.
  • SNuPE Single Nucleotide Primer Extension
  • SNP is extended by a single dideoxynucleoside triphosphate (ddNTP) complementary to the polymorphic base.
  • ddNTP dideoxynucleoside triphosphate
  • Time-of-Flight Mass Spectrometry enables absolute molecular weight determination of the extended primers and accurate identification of the targeted base.
  • the method is non-gel based, amenable to automation and multiplexing and allows detection of heterozygotes.
  • Example 8 SNP disease associated PTPRS gene variants rs8100586, rs886936, and rs17130 result in the abnormal splicing of isoform 1 of PTPRS and the deletion of the 3 rd Ig domain of the PTPRS protein; resulting in the joining of the 2 nd Ig domain with the FNIII domain ( Figure 3B).
  • Antibodies directed against the epitopes created by the joining the 2 nd Ig domain and the FNIII domain of PTPRS specifically recognize disease associated PTPRS gene variant polypeptides.
  • a sample from a subject comprising protein is obtained and a protein fraction is separated by gel electrophoresis, transferred to a membrane and probed with an antibody that recognizes and epitope created as a disease associated PTPRS gene variant polypeptide.
  • Neutralizing antibodies that bind PTPRS extra cellular domain are administered to human UC subjects.
  • a pharmaceutical composition comprising 0.2 to 250 ⁇ g/kg of the antibody is administered by intravenous injection.
  • the antibodies are administered to the subjects at days 1 , 2 and 7 and weekly afterwards.
  • the dosing is once per week, twice per week, three times per week, or once per two weeks.
  • dosing varies depending on the physiological condition of the patient and the response of the patient to treatment.
  • Subjects are monitored for indications of slowing or arrest of disease progression. Autoimmune manifestations are also monitored.
  • Example 10 To determine if PTPRS was involved in CD, a subanalysis of the IBD patients in the initial study was conducted. While rs886936 and rs8100586 were significantly associated with UC, none of the SNPs were associated with CD. The sub-analysis showed that if one was diagnosed with IBD and had rs8100586 they were more likely to have UC or colonic CD (colon only with no small bowel involvement). However, these SNPs were not found to be associated with CD (or any subtype of CD) using Family Based association testing. This indicates the PTPRS is involved in a generalizable colonic IBD.
  • IBD- colonic- includes ulcerative colitis and colonic CD (excludes small bowl CD and ileal-colonic CD). Comparisons made were between patients with IBD and colonic only (UC and colinic CD) vs any small bowel involvement.
  • N-Cadherin Is an In Vivo Substrate for Protein Tyrosine Phosphatase Sigma (PTP ⁇ sigma» and Participates in PTP ⁇ sigma ⁇ -Mediated Inhibition of Axon Growth. MoI Cell Biol 27, 208- 19 (2007).

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Analytical Chemistry (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biophysics (AREA)
  • Pathology (AREA)
  • General Engineering & Computer Science (AREA)
  • Physics & Mathematics (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Cell Biology (AREA)
  • Food Science & Technology (AREA)
  • General Physics & Mathematics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

La présente invention concerne une affection intestinale inflammatoire et, en particulier des procédés et des compositions de criblage pour diagnostiquer la présence ou la progression d'une rectocolite hémorragique et/ou de la maladie de Crohn colique, ou pour détecter le risque de développer ces dernières chez un sujet. Dans un mode de réalisation, l'invention concerne un procédé de criblage pour diagnostiquer la présence d'une rectocolite hémorragique, ou pour détecter le risque de développer cette dernière, comprenant la détection de la présence d'au moins un variant de gène PTPRS associé à la maladie dans un échantillon d'un sujet, la présence du variant de gène PTPRS associé à la maladie indiquant une rectocolite hémorragique ou un risque accru de développer une rectocolite hémorragique par rapport à un sujet négatif n'ayant pas de variant de gène de la PTPRS associé à la maladie.
PCT/CA2008/001181 2007-06-29 2008-06-30 Gène de susceptibilité pour une affection intestinale inflammatoire WO2009003274A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US94720407P 2007-06-29 2007-06-29
US60/947,204 2007-06-29

Publications (1)

Publication Number Publication Date
WO2009003274A1 true WO2009003274A1 (fr) 2009-01-08

Family

ID=40225672

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CA2008/001181 WO2009003274A1 (fr) 2007-06-29 2008-06-30 Gène de susceptibilité pour une affection intestinale inflammatoire

Country Status (1)

Country Link
WO (1) WO2009003274A1 (fr)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011079668A1 (fr) * 2009-12-29 2011-07-07 上海新号源生物科技有限公司 Groupe de gènes ptpα mutants dans la tumeur maligne et son procédé de production
EP2531859A2 (fr) * 2010-02-02 2012-12-12 La Jolla Institute for Allergy and Immunology Compositions et procédés de modulation de protéines tyrosine kinases récepteurs
JP2014524733A (ja) * 2011-04-28 2014-09-25 Ｓｂｉバイオテック株式会社 抗ヒト受容体型プロテインチロシンホスファターゼσ抗体
EP2576838A4 (fr) * 2010-06-04 2019-05-15 Nestec S.A. Procédés pour l'amélioration de diagnostic de la recto-colite hémorragique
CN112831558A (zh) * 2021-03-10 2021-05-25 北京科力丹迪生物医疗科技有限公司 克罗恩病易感基因的早筛方法及试剂盒

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007041317A2 (fr) * 2005-09-29 2007-04-12 Viral Logic Systems Technology Corp. Compositions immunomodulatrices et leurs utilisations

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007041317A2 (fr) * 2005-09-29 2007-04-12 Viral Logic Systems Technology Corp. Compositions immunomodulatrices et leurs utilisations

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
DATABASE GENBANK [online] STRAUSBERG R.L. ET AL.: "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences", Database accession no. (BC029496) *
MUISE A.M. ET AL.: "Protein-tyrosine phosphatase sigma is associated with ulcerative colitis", CURRENT BIOLOGY, vol. 17, no. 14, 17 July 2007 (2007-07-17), pages 1212 - 1218, XP022152453 *
RIOUX J.D. ET AL.: "Genomewide search in Canadian families with inflammatory bowel disease reveals two novel susceptibility loci", AMERICAN JOURNAL OF HUMAN GENETICS, vol. 66, no. 6, June 2000 (2000-06-01), pages 1863 - 1870, XP001016365 *
VAN HEEL D.A. ET AL.: "The IBD6 Crohn's disease locus demonstrates complex interactions with CARD15 and IBD5 disease-associated variants", HUMAN MOLECULAR GENETICS, vol. 12, no. 20, 15 October 2003 (2003-10-15), pages 2569 - 2575 *

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011079668A1 (fr) * 2009-12-29 2011-07-07 上海新号源生物科技有限公司 Groupe de gènes ptpα mutants dans la tumeur maligne et son procédé de production
EP2531859A2 (fr) * 2010-02-02 2012-12-12 La Jolla Institute for Allergy and Immunology Compositions et procédés de modulation de protéines tyrosine kinases récepteurs
EP2531859A4 (fr) * 2010-02-02 2013-07-31 Jolla Inst Allergy Immunolog Compositions et procédés de modulation de protéines tyrosine kinases récepteurs
EP2576838A4 (fr) * 2010-06-04 2019-05-15 Nestec S.A. Procédés pour l'amélioration de diagnostic de la recto-colite hémorragique
JP2014524733A (ja) * 2011-04-28 2014-09-25 Ｓｂｉバイオテック株式会社 抗ヒト受容体型プロテインチロシンホスファターゼσ抗体
JP2017048183A (ja) * 2011-04-28 2017-03-09 Ｓｂｉバイオテック株式会社 抗ヒト受容体型プロテインチロシンホスファターゼσ抗体
US9803026B2 (en) 2011-04-28 2017-10-31 Sbi Biotech Co., Ltd. Anti-human receptor-type protein tyrosine phosphatase sigma antibody
EP3232202B1 (fr) * 2011-04-28 2020-02-19 SBI Biotech Co., Ltd. Anticorps anti-protéine tyrosine phosphatase humaine de type récepteur
US10730955B2 (en) 2011-04-28 2020-08-04 Sbi Biotech Co., Ltd. Polynucleotides encoding anti-human receptor-type protein tyrosine phosphatase sigma antibodies
CN112831558A (zh) * 2021-03-10 2021-05-25 北京科力丹迪生物医疗科技有限公司 克罗恩病易感基因的早筛方法及试剂盒

Similar Documents

Publication Publication Date Title
Souto et al. Genome-wide linkage analysis of von Willebrand factor plasma levels: results from the GAIT project
US20070059722A1 (en) Novel genes and markers associated to type 2 diabetes mellitus
US20060099610A1 (en) Method and kit for detecting a risk of acute myocardial infarction
MX2011010101A (es) Dispositivo de administracion de farmaco con un vastago de piston mejorado.
CA2725709A1 (fr) Genes de predisposition a une degenerescence maculaire liee a l'age (dmla) sur le chromosome 10q26
US20100099083A1 (en) Crohn disease susceptibility gene
CA2569083A1 (fr) Detection d'association de maladies a l'expression aberrante de glycogene synthase kinase 3.beta.
JP2014097060A (ja) ２型糖尿病の遺伝的感受性変異体
US20070015170A1 (en) Method and kit for detecting a risk of coronary heart disease
WO2009003274A1 (fr) Gène de susceptibilité pour une affection intestinale inflammatoire
US20120003182A1 (en) Genetic severity markers in multiple sclerosis
US20100167285A1 (en) Methods and agents for evaluating inflammatory bowel disease, and targets for treatment
US10174377B2 (en) Method for diagnosing and assessing risk of pancreatitis using genetic variants
US7754422B2 (en) Method of judging inflammatory disease
CA2793210A1 (fr) Determination d'une predisposition a un evenement cardiaque soudain
US20080194419A1 (en) Genetic Association of Polymorphisms in the Atf6-Alpha Gene with Insulin Resistance Phenotypes
US9157119B2 (en) Methods for diagnosing skin diseases
US8530167B2 (en) Diagnostic and therapeutic uses of GNPTAB, GNPTG, and NAGPA in stuttering
JP2023516497A (ja) Ｉｌ３３にリスクアレルを有する対象を治療するための治療方法
Aoude et al. A BAP1 Mutation in a Danish Family Predisposes to Uveal Melanoma and Other
Itokawa This work was partly funded by a Grant-in-Aid for Scientific Research (C) from the JSPS, Japan (No. 14570953). We thank Dr Meerabux for her critical reading of the manuscript.

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 08772841

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 08772841

Country of ref document: EP

Kind code of ref document: A1