WO2009002790A2 - Compositions et procédés pour traiter, réduire, améliorer, soulager ou prévenir la kératoconjonctivite sèche - Google Patents

Compositions et procédés pour traiter, réduire, améliorer, soulager ou prévenir la kératoconjonctivite sèche Download PDF

Info

Publication number
WO2009002790A2
WO2009002790A2 PCT/US2008/067419 US2008067419W WO2009002790A2 WO 2009002790 A2 WO2009002790 A2 WO 2009002790A2 US 2008067419 W US2008067419 W US 2008067419W WO 2009002790 A2 WO2009002790 A2 WO 2009002790A2
Authority
WO
WIPO (PCT)
Prior art keywords
composition
antagonist
seq
compound
combinations
Prior art date
Application number
PCT/US2008/067419
Other languages
English (en)
Other versions
WO2009002790A3 (fr
Inventor
Jinzhong Zhang
Keith Wayne Ward
Original Assignee
Bausch & Lomb Incorporated
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Bausch & Lomb Incorporated filed Critical Bausch & Lomb Incorporated
Publication of WO2009002790A2 publication Critical patent/WO2009002790A2/fr
Publication of WO2009002790A3 publication Critical patent/WO2009002790A3/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/59—Compounds containing 9, 10- seco- cyclopenta[a]hydrophenanthrene ring systems
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/711—Natural deoxyribonucleic acids, i.e. containing only 2'-deoxyriboses attached to adenine, guanine, cytosine or thymine and having 3'-5' phosphodiester links
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00—Drugs for disorders of the senses
    • A61P27/02—Ophthalmic agents

Definitions

  • the present invention relates to compositions for the treatment, reduction, amelioration, alleviation, or prevention of a dry eye condition or a disorder that requires the rewetting of the eye.
  • the present invention relates to pharmaceutical compositions that comprise an inhibitor of, or antagonist to, a toll-like receptor ("TLR) or a TLR coreceptor, for the treatment, reduction, amelioration, alleviation, or prevention of dry eye syndrome.
  • TLR toll-like receptor
  • the present invention relates to methods for treating, reducing, ameliorating, alleviating, or preventing the dry eye syndrome using such an inhibitor of, or antagonist to, TLR or TLR coreceptor.
  • Dry eye also known as keratoconjunctivitis sicca (“KCS")
  • KCS keratoconjunctivitis sicca
  • dry eye conditions result from decreased tear production, excessive tear evaporation, or abnormality in mucin or lipid components of the tear film. Dry eye conditions can be caused by a variety of factors.
  • inflammation may be an important factor in the pathogenesis of KCS.
  • inflammation of the lacrimal and meibomian glands can curb production of the aqueous and lipid components of the tear film, respectively.
  • Sjogren's syndrome is a chronic disorder in which white blood cells, recruited by the pro-inflammatory mediators, attack the moisture-producing glands, such as lacrimal and salivary glands, resulting in their degeneration and inducing their apoptosis.
  • pro-inflammatory mediators including adhesion molecules, IL-I, IL-6, IL-8, and TNF- ⁇
  • IL-I adhesion molecules
  • IL-6 adhesion molecules
  • IL-8 pro-inflammatory mediators
  • TNF- ⁇ also has been found to increase in conjunctival epithelum cells in non-Sj ⁇ gren dry-eye patients.
  • K. Turner et al Cornea, Vol. 19, No. 4, 492 (2000).
  • active T-cell infiltrate in the conjunctiva also has been reported in non-Sj ⁇ gren's syndrome dry eye. See; e.g., M.E. Stern et al., Invest. Ophthalm. & Vis. ScL, Vol. 43, No. 8, 2609 (2002). Dry eye may afflict individuals with differing severity.
  • a patient may experience burning, a feeling of dryness, and other symptoms of ocular discomfort. In severe cases, vision may be substantially impaired.
  • dry eye may have a variety of unrelated pathogenic causes, they all share as a common effect the breakdown of the ocular tear film, with dehydration of and subsequent damage to the exposed outer ocular surfaces, which can lead to apoptosis of ocular epithelial cells. See; e.g., S. Yeh et al., Invest. Ophthalmol. & Vis. ScL, Vol. 44, No. 1, 124 (2003).
  • pro-inflammatory mediators is under the control of several important nuclear transcription factors that are activated by yet other cellular enzymes.
  • Cascades of production of pro-inflammatory cytokines are typically initiated by activation of cellular receptors in response to exposure to pathogens, toxic substances, or other environmental stressors. Thus, intervention in such cascades may be a way to affect positively a dry eye condition.
  • Prior-art therapies for dry eye have included both palliative agents, such as artificial tear formulations, and drugs, such as topical steroids, topical retinoids (e.g., Vitamin A), oral pilocarpine, and topical cyclosporine.
  • the palliative therapies are capable of providing short-term relief from some of the symptoms of dry eye, but frequent application of the palliative products to the eye is required to maintain this relief, since these products generally do not eliminate the physiological sources of the dry eye conditions.
  • the drug therapies that have been proposed in the prior art have had limited success in treating dry eye conditions.
  • One reason for the limited efficacy of prior-art drug therapies has often been attributable to the inability of the drug to eliminate or reduce the root causes of the dry eye conditions.
  • Steroidal drugs also can have side effects that threaten the overall health of the patient.
  • corticosteroids have a greater potential for elevating intraocular pressure (“IOP”) than other compounds in this class.
  • IOP intraocular pressure
  • prednisolone which is a very potent ocular anti-inflammatory agent
  • fluorometholone which has moderate ocular anti-inflammatory activity.
  • the risk of IOP elevations associated with the topical ophthalmic use of glucocorticoids increases over time. In other words, the chronic (i.e., long-term) use of these agents increases the risk of significant IOP elevations.
  • corticosteroids Unlike bacterial infections or acute ocular inflammation associated with physical trauma, which requires short-term therapy on the order of a few weeks, dry eye conditions require treatment for extended periods of time, generally several months or more. This chronic use of corticosteroids significantly increases the risk of IOP elevations. In addition, use of corticosteroids is also known to increase the risk of cataract formation in a dose- and duration-dependent manner. Once cataracts develop, they may progress despite discontinuation of corticosteroid therapy.
  • Chronic administration of glucocorticoids also can lead to drug-induced osteoporosis by suppressing intestinal calcium absorption and inhibiting bone formation.
  • Other adverse side effects of chronic administration of glucocorticoids include hypertension, hyperglycemia, hyperlipidemia (increased levels of triglycerides) and hypercholesterolemia (increased levels of cholesterol) because of the effects of these drugs on the body metabolic processes.
  • the present invention provides compositions for treating, reducing, ameliorating, alleviating, or preventing in a subject a dry eye condition or other disorders that require rewetting of the eye (for example, disorders that require restoring normal tear function).
  • a pharmaceutical composition of the present invention comprises an inhibitor of an activity of, or an antagonist to, at least a toll-like receptor (“TLR”) (such an inhibitor or antagonist hereinafter sometimes referred to as “TLR antagonist”); or an inhibitor of, or an antagonist to, coreceptor of a TLR (such an inhibitor or antagonist hereinafter sometimes referred to as "TLR-coreceptor antagonist”), in an amount effective for treating, reducing, ameliorating, alleviating, or preventing a dry eye condition or disorder in a subject.
  • TLR toll-like receptor
  • such a TLR is a human TLR.
  • such a TLR is expressed in or on a cell associated with an ocular tissue or a tissue adjacent to an eye.
  • such an inhibitor of, or antagonist to, at least one human TLR or a coreceptor of a human TLR is capable of down regulating a TLR signaling pathway.
  • composition of the present invention comprises a compound that is capable of inhibiting an activation of a human TLR signaling pathway.
  • composition of the present invention comprises a TLR antagonist or a TLR-coreceptor antagonist and a nonsteroidal anti-inflammatory medicament.
  • the present invention provides a method for treating, reducing, ameliorating, alleviating, or preventing in a subject a dry eye condition or other disorders that require rewetting of the eye.
  • the method comprises applying a composition to the eye, wherein the composition comprises an inhibitor of, or an antagonist to, at least one human TLR; an inhibitor of, or an antagonist to, a coreceptor of a human TLR; or a compound that is capable of inhibiting an activation of a human TLR signaling pathway; or a combination thereof.
  • Figure 1 shows ODN 2088 inhibition of neutrophil MIP-2 response.
  • Figure 2 shows ODN 2088 inhibition of neutrophil KC response.
  • FIG. 3 shows ODN 2088 inhibition of neutrophil TNF- ⁇ response.
  • Figure 5 shows the effect of the inhibitory ODN 2088 on neutrophil infiltrate after a compromised mouse cornea has been exposed to stimulatory ODN 1826, bacterial DNA, Pam3Cys, or LPS.
  • Figure 6 shows ODN 2088 inhibition of corneal MIP-2, KC, and IP-IO response.
  • Figure 7 shows the effect of the inhibitory ODN (having sequence TTAGGG) on the TLR activation of human cell lines by Pam3Cys, flagellin, or CpGB.
  • the present invention provides pharmaceutical compositions and methods for treating, reducing, ameliorating, alleviating, or preventing in a subject a dry eye condition or other disorders that require rewetting of the eye (for example, disorders that require restoring normal tear function).
  • a pharmaceutical composition of the present invention comprises an inhibitor of an activity of, or an antagonist to, at least a toll-like receptor (“TLR”) (such an inhibitor or antagonist hereinafter sometimes referred to as “TLR antagonist”); or an inhibitor of, or an antagonist to, coreceptor of a TLR (such an inhibitor or antagonist hereinafter sometimes referred to as "TLR-coreceptor antagonist”), in an amount effective for treating, reducing, ameliorating, alleviating, or preventing a dry eye condition or disorder in a subject.
  • TLR toll-like receptor
  • TLR antagonists or “TLR-coreceptor antagonist” also includes compounds that inhibit or impede the expression of such receptor or coreceptors, respectively.
  • such antagonist is present in the composition at concentrations such that the composition is capable of treating, reducing, ameliorating, alleviating, or preventing a dry eye condition or a disorder that requires rewetting of the eye in a subject.
  • such a TLR is a human TLR.
  • such a TLR is expressed in or on a cell associated with an ocular tissue or a tissue adjacent to an eye.
  • the normal flora of a healthy eye includes several types of microorganisms such as Corynebacterium xerosis, Staphylococcus epidermis, saprophytic fungi, Neisseria species, Moraxella species, and nonhemolytic Streptococci. Upon death and disintegration as well as part of the normal growth process, these microorganisms release chemicals and cellular products, which are foreign to the host and activate resident ocular surface cells to produce cytokines and chemokines that can induce a congregation of inflammatory cells of the innate immune system in tissues of the eyes, including the secretory glands that support the function of a healthy ocular surface.
  • microorganisms such as Corynebacterium xerosis, Staphylococcus epidermis, saprophytic fungi, Neisseria species, Moraxella species, and nonhemolytic Streptococci.
  • Adaptive immunity is mediated by T and B lymphocytes that proliferate clonally in response to a specific pathogen or antigen.
  • the generation of acquired immune responses requires a number of days after the host is exposed to the challenge.
  • the innate immune system is activated soon after such pathogenic or antigenic challenge to provide nonspecific protection before the acquired immunity system becomes fully effective.
  • TLRs which have evolved to recognize some common structural features of the diverse microorganisms, which features are referred to as "pathogen-associated molecular patterns" (or "PAMPs").
  • PAMPs pathogen-associated molecular patterns
  • TLR2 recognizes lipoproteins and lipopeptides of a variety of Gram-negative bacteria, peptidoglycan and lipoteicholic acid of Gram-positive bacteria, lipoarabinomannan of Mycobacteria, and several types of atypical lipopolysaccharides ("LPSs") of Leptospira interrogans and Porphyromonas gingivalis.
  • LPSs lipopolysaccharides
  • TLR3 recognizes double-stranded RNA ("dsRNA”) of viruses.
  • TLR4 recognizes LPSs, which are outer-membrane components of Gram-negative bacteria and are structurally different from the atypical LPSs recognized by TLR2.
  • TLR5 recognizes flagellin of Gram-negative bacteria.
  • TLR6 recognizes di-acyl lipopeptides.
  • TLR7 and TLR8 recognize imidazoquinoline compounds, which are structurally related to guanosine nucleoside. Thus, they are predicted to recognize nucleic acid-like structure of viruses or bacteria.
  • TLR8 recently has been indicated to recognize single-stranded RNA of viruses ("ssRNA").
  • TLR9 recognizes the unmethylated CpG motifs of bacterial DNA.
  • ligands of TLRlO have not been ascertained. Additional TLRs may be discovered in the future as knowledge of the immune system continues to expand. TLR expression and function have been demonstrated in the eye. See; e.g., J.H. Chang et al., Br. J. Ophthalmol., Vol. 90, 103 (2006).
  • TLRs act in concert with other TLRs or coreceptors (such as CD14 or MD-2) to initiate intracellular inflammatory cascades, which have the ultimate goal of elimination of the foreign materials from the body.
  • TLRs or coreceptors such as CD14 or MD-2
  • NF- ⁇ B transcription factor
  • AP- 1 mitogen-activated protein kinase
  • components of microbial cells of the normal ocular flora that are not quickly carried away from the cornea surface for example by insufficient production of tear or by being trapped under a contact lens (in the cases of contact lens wearers), coupled with some minor breach of an ocular tissue (such as the corneal epithelial layer, the conjunctiva, lacrimal or meibomian gland), can elicit an innate immune response in otherwise healthy persons, resulting in the recruitment of immune cells to ocular sites.
  • an ocular tissue such as the corneal epithelial layer, the conjunctiva, lacrimal or meibomian gland
  • These immune cells further synthesize and release proinflammatory cytokines such as IL- l ⁇ , IL-3, IL-5, IL-6, IL-8, TNF- ⁇ (tumor necrosis factor- ⁇ ), GM-CSF (granulocyte- macrophage colony-stimulating factor), and MCP-I (monocyte chemotactic protein-1).
  • proinflammatory cytokines such as IL- l ⁇ , IL-3, IL-5, IL-6, IL-8, TNF- ⁇ (tumor necrosis factor- ⁇ ), GM-CSF (granulocyte- macrophage colony-stimulating factor), and MCP-I (monocyte chemotactic protein-1).
  • cytokines such as IL- l ⁇ , IL-3, IL-5, IL-6, IL-8, TNF- ⁇ (tumor necrosis factor- ⁇ ), GM-CSF (granulocyte- macrophage colony-stimulating factor), and MCP-I (monocyte che
  • IL-8 and MCP-I are potent chemoattractants for, and activators of, neutrophils and monocytes, respectively, while GM-CSF prolongs the survival of these cells and increases their response to other proinflammatory agonists.
  • TNF- ⁇ can activate both types of cell and can stimulate further release of IL-8 and MCP- 1 from them.
  • IL-I and TNF- ⁇ are potent chemoattractants for T and B lymphocytes, which are activated to produce antibodies against the foreign pathogen.
  • a prolonged or overactive inflammatory response can be damaging to the surrounding tissues.
  • inflammation causes the blood vessels at the infected site to dilate to increase blood flow to the site. As a result, these dilated vessels become leaky. After prolonged inflammation, the leaky vessels can produce serious edema in, and impair the proper functioning of, the surrounding tissues (see; e.g., V.W.M. van Hinsbergh, Arteriosclerosis, Thrombosis, and Vascular Biology, Vol. 17, 1018 (1997)).
  • the first requirement in the generation of ocular inflammation is an inciting stimulus, which may be a pathogen, as discussed above.
  • Other stimuli for initiation of inflammation also can include a desiccating environmental stress, alterations in the tear film compositions secondary to lacrimal gland or meibomian gland inflammation, interruption of neuronal stimulation for tear secretion, hyperosmolarity, and micro trauma from eyelids during blinking.
  • inflammation is initiated, which can induce loss of ocular immunohomeostasis and trigger a dry eye condition.
  • the present invention provides compositions and methods for treating, reducing, ameliorating, alleviating, or preventing in a subject a dry eye condition or other disorders that require rewetting of the eye, which condition or disorder has an etiology in chronic inflammation.
  • a TLR antagonist or TLR-coreceptor antagonist included in a composition of the present invention, inhibits the binding of ligands to such TLR or TLR coreceptor, respectively, which ligands are capable of activating such TLR or coreceptor, or the binding of such coreceptor to such TLR.
  • said at least one human TLR is selected from the group consisting of TLRl, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLRlO, and combinations thereof.
  • said coreceptor of a human TLR is selected from the group consisting of CD 14, MD-2, and a combination thereof.
  • CD 14 has been shown to be an essential coreceptor for TLR2 and TLR4 activation due to the required formation of the receptor complex comprising CD 14 and TLR2 or TLR4 before the signaling cascades involving these TLRs are initiated.
  • a composition of the present invention comprises an anti- human antibody of TLRl, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLRlO, CD 14, MD-2, or combinations thereof.
  • TLRl human antibody
  • Many of these antibodies are available from eBioscience, San Diego, California.
  • such an antagonist is a monoclonal antibody.
  • such an antagonist is a recombinant antibody of TLRl, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLRlO, CD 14, MD-2, or combinations thereof.
  • a composition of the present invention comprises a soluble form of an extracellular domain of a TLR (“sTLR”) that recognizes a microbe-expressed molecular structure (“MEMS").
  • MEMS microbe-expressed molecular structure
  • sTLR soluble form of an extracellular domain of a TLR
  • MEMS microbe-expressed molecular structure
  • Soluble TLRs are available from, for example, eBioscience, San Diego, California. These molecules may be cleaved into smaller fragments, for example, using enzymatic digestion, and those fragments that recognize a particular MEM at high affinity may be identified through binding assays that are well known in the art.
  • a composition of the present invention comprises a soluble form of a CD14-binding extracellular domain of TLR4 ("sTLR4"), a soluble form of CD14 molecule (“sCD14”), or a soluble form of MD-2 (“sMD-2").
  • sTLR4 binds to CD 14 and prevents it from binding to membrane-bound TLR4 and assisting in activating the signaling cascade involving the same.
  • sCD14 and sMD-2 bind to LPS components of bacteria and prevent its binding to TLR4 and subsequent activation of this TLR.
  • a composition of the present invention comprises a TLR- inhibiting oligodeoxynucleoside ("ODN") that comprises at least three consecutive guanosine deoxynucleotides.
  • ODN TLR- inhibiting oligodeoxynucleoside
  • a composition of the present invention comprises a TLR-inhibiting ODN that comprises at least a GGG ("G-triplet") or GGGG ("G-tetrad") motif.
  • a composition of the present invention comprises a TLR-inhibiting single-stranded ODN that comprises multiple TTAGGG motifs (SEQ. NO. 1) or a sequence of TCCTGGCGGGGAAGT (SEQ. NO. 2).
  • SEQ. NO. 1 is ubiquitously found in human telomeres.
  • SEQ. NO. 2 is a synthetic ODN, known as ODN 2088, available from InvivoGen, San Diego, California.
  • a TLR-inhibiting ODN comprises at least one G-tetrad.
  • a TLR-inhibiting ODN comprises one, two, three, four, or more G-tetrads.
  • a TLR-inhibiting ODN comprises more than one G-tetrad
  • the G-tetrads can be arranged contiguously.
  • the G-tetrads can be separated by one or more different deoxynucleotides, such as one, two, three, four, five, ten, fifteen, twenty, or more deoxynucleoties.
  • the G-tetrads are separated by fewer than 20 other deoxynucleotides.
  • Other suitable inhibiting ODNs include the synthetic ODNs having the sequences: TCCTAACGGGGAAGT (SEQ. NO. 3), TCCTGGAGGGGTTGT (SEQ. NO. 4) (see O. Duramad et al., J.
  • ODNs comprising one or more G-tetrads can self-assemble into four-stranded helices stabilized by planar Hoogsteen base-paired quartets of guanosine. Such four-stranded ODNs are also within the scope of the present invention.
  • a composition of the present invention comprises one or more inhibiting ODNs having SEQ. NO. 21 - SEQ. NO. 29: TCCTGGCGGGGAAGT (SEQ. NO. 21); GCCTGGCGGGGAAGT (SEQ. NO. 22); ACCTGGCGGGGAAGT (SEQ. NO. 23); CCCTGGCGGGGAAGT (SEQ. NO. 24); TCCCGGCGGGGAAGT (SEQ. NO. 25); TCCAGGCGGGGAAGT (SEQ. NO. 26); CCTGGCGGGGAAGT (SEQ. NO. 27); TCCTAGCGGGAAGT (SEQ. NO. 28); and TCCTGGAGGGGAAGT (SEQ. NO. 29).
  • These inhibiting ODNs are disclosed in US Patent Application Publication 2005/0239733, which is incorporated herein by reference, and are shown to inhibit activity of at least one of TLR8 and TLR9.
  • a composition of the present invention comprises a TLR-inhibiting ODN that comprises two, three, four, five, or more TTAGGG motifs.
  • a TLR-inhibiting ODN comprises four TTAGGG motifs.
  • four TTAGGG motifs are arranged contiguously.
  • a composition of the present invention comprises a TLR-inhibiting ODN that comprises two, three, four, five, or more repeats of any one of SEQ. NO. 2 - SEQ. NO. 8, SEQ. NO. 21 - SEQ. NO. 29, or a combination thereof.
  • a composition of the present invention comprises an effective amount of chloroquine, hydroxychloroquine, quinacrine, 9-aminoacridine, 4- aminoquinoline, or a mixture thereof, for inhibiting the activity of TLR9.
  • RA rheumatoid arthritis
  • SLE systemic lupus erythematosus
  • chloroquine has been used clinically for the treatment of RA and SLE. Chloroquine blocks TLR9- dependent signaling through inhibition of the pH-dependent maturation of endosomes by acting as a basic substance to neutralize acidification in the vesicles. H.hacker et al., EMBO J., Vol. 17, 6230 (1998). Therefore, chloroquine can act in a composition of the present invention as a TLR9 immunomodulatory agent.
  • a composition of the present invention comprises an inhibitor to an expression of a human TLR.
  • an inhibitor comprises a ligand of vitamin D receptor ("VDR") or a VDR agonist.
  • VDR vitamin D receptor
  • a ligand of VDR or VDR agonist comprises vitamin D or a vitamin-D analogue.
  • a suitable vitamin-D analogue is calcipotriol ((li?,35 f )-5-[2-[(lR,3ai?,7a5)-l- [(25 r )-5-cyclopropyl-5-hydroxy-pent-3-en-2-yl]-7a-methyl-2,3,3a,5,6,7-hexahydro-lH- inden-4-ylidene]ethylidene]-4-methylidene-cyclohexane-l,3-diol).
  • such a ligand is vitamin D 2 (ergocalciferol or calciferol) or vitamin D 3 (1,25-dihydroxycholeciciferol or calcitriol).
  • such a ligand is vitamin D 3 .
  • vitamin D3 is a bona-fide hormone involved in cell growth, differentiation, and immunomodulation.
  • the active form of vitamin D mediates immunological effects by binding to nuclear VDR, which is present in virtually all tissues and cell types, including both innate and acquired immune cells. Y.Y. Yee et al., Mini Rev. Med. Chem., Vol. 5, 761 (2005).
  • Activated VDR can antagonize the action of transcription factors NF-AT and NF- ⁇ B. Id.
  • activated VDR or vitamin D 3 have been shown to inhibit the expression of proinflammatory cytokines, such as IL-2, IL-6, IL-8, IL- 12, TNF- ⁇ , IFN- ⁇ , and GM-CSF.
  • proinflammatory cytokines such as IL-2, IL-6, IL-8, IL- 12, TNF- ⁇ , IFN- ⁇ , and GM-CSF.
  • vitamin D 3 enhances the production of IL-10 and promotes dendritic cell ("DC") apoptosis, and, thus, inhibits DC-dependent activation of T cells.
  • DC dendritic cell
  • vitamin D3 or its analogues, or other VDR agonists can reduce the sensitization of these cells to MEMs, such as lipoproteins and lipopeptides of a variety of Gram-negative bacteria, peptidoglycan and lipoteicholic acid of Gram-positive bacteria, lipoarabinomannan of Mycobacteria, and other atypical lipopolysaccharides. Consequently, application of a composition of the present invention containing a vitamin D, a vitamin-D analogue, or a VDR agonist can reduce the risk of development, or the severity, of an inappropriate immune response.
  • the term "inappropriate immune response” means a response of the body's immune system to an inciting stimulus, which response is at an unwanted high level that results in a pathological condition.
  • an antagonist to one or more TLR receptors included in a composition of the present invention comprises a quinazoline derivative, as disclosed in US Patent Application Publication 2005/0119273, which is incorporated herein by reference.
  • a quinazoline derivative has a general Formula I.
  • X is a substituted or unsubstituted aryl, alkyl, heterocyclic, or styryl group, optionally attached to the quinazoline by a nitrogen, oxygen, or sulfur atom or by a SO or SO 2 group;
  • Y is absent or is an oxygen atom, a sulfur atom, CR R 10 , or NR 11 , wherein R 9 , R 10 , and R 1 ' are each independently a hydrogen atom or an alkyl, alkenyl, or aryl group, wherein any one of R 9 , R 10 , and R 1 ' optionally is combined with R 3 or R 4 to form a heterocycle;
  • L is absent or is a hydrogen atom, an alkyl or alkenyl group containing from 1 to 10 carbons, or an aryl group;
  • R 3 and R 4 are each independently a hydrogen atom or an alkyl, alkenyl, or aryl group, wherein R 3 and R 4 optionally are combined to form
  • Non-limiting examples of such quinazoline derivatives which are effective in inhibiting one or more of TLR3, TLR7, TLR8, and TLR9, include:
  • composition of the present invention comprises an antagonist to TLR2 receptor, as disclosed in US Patent Application Publication 2005/0113345, which is incorporated herein by reference.
  • an antagonist include the following compounds.
  • a composition of the present invention comprises an antibody that binds to and inhibits the activity of TLR4/MD2 complex in the production of inflammatory cytokines.
  • Non-limiting examples of such antibodies comprise heavy chains comprising one of the following non-limiting examples of complimentary determining regions ("CDRs"): DSYIH (SEQ. NO. 9); WTDPENVNSIYDPRFQG (SEQ. NO. 10); GYNGVYYAMDY (SEQ. NO. 11); DYWIE (SEQ. NO. 12); EILPGSGSTNYNEDFKD (SEQ. NO. 13); EERAYYFGY (SEQ. NO. 14); GGYSWH (SEQ. NO.
  • Such a CDR may comprise a combination of SEQ. No. 9 - SEQ. NO. 20.
  • composition of the present invention comprises an antibody that binds to and inhibits the activity of TLR4/CD14 complex in the production of inflammatory cytokines, as disclosed in US Patent Application Publication 2006/0257411 , which is incorporated herein by reference.
  • an antagonist to a human TLR an antagonist to a coreceptor of a human TLR, or a compound capable of inhibiting activation of a human TLR signaling pathway (“inhibitor of a TLR") is included in a composition of the present invention in an amount from about 0.0001 to about 10 percent by weight of the composition.
  • such an antagonist or an inhibitor of a TLR is present in a composition of the present invention in an amount from about 0.001 to about 5 percent (from about 0.001 to about 2, or from about 0.001 to about 1, or from about 0.001 to about 0.5, or from about 0.001 to about 0.2, or from about 0.001 to about 0.1, or from about 0.01 to about 0.1, or from about 0.01 to about 0.5, or from about 0.001 to about 0.01 , or from about 0.001 to about 0.1 percent) by weight of the composition.
  • composition of the present invention can further comprise an additional medicament selected from the group consisting of immunosuppressants, cyclooxygenase-2 inhibitors, NSAIDs (non-steroidal antiinflammatory drugs), DMARDS (disease-modifying anti-rheumatic drugs), antibiotics, 5 -lipoxygenase inhibitors, LTB 4 antagonists, LTA 4 hydrolase inhibitors, anti-cell adhesion molecules (such as anti E-selectin), and combinations thereof.
  • an additional medicament selected from the group consisting of immunosuppressants, cyclooxygenase-2 inhibitors, NSAIDs (non-steroidal antiinflammatory drugs), DMARDS (disease-modifying anti-rheumatic drugs), antibiotics, 5 -lipoxygenase inhibitors, LTB 4 antagonists, LTA 4 hydrolase inhibitors, anti-cell adhesion molecules (such as anti E-selectin), and combinations thereof.
  • composition of the present invention further comprises an immunosuppressant.
  • immunosuppressants include cyclosporine, tacrolimus, rapamycin, azathioprine, 6-merca ⁇ topurine, and combinations thereof.
  • Each of said additional medicaments when included in a composition, is present in a composition of the present invention in an amount from about 0.001 to about 5 percent (or from about 0.001 to about 2, or from about 0.001 to about 1, or from about 0.001 to about 0.5, or from about 0.001 to about 0.2, or from about 0.001 to about 0.1, or from about 0.01 to about 0.1, or from about 0.01 to about 0.5, or from about 0.001 to about 0.01, or from about 0.001 to about 0.1 percent) by weight of the composition.
  • a composition of the present invention comprises a liquid medium.
  • the liquid medium comprises an aqueous solution.
  • composition of the present invention further comprises a material selected from the group consisting of preservatives, antimicrobial agents, surfactants, buffers, tonicity-modifying agents, chelating agents, viscosity-modifying agents, co-solvents, oils, humectants, emollients, stabilizers, antioxidants and combinations thereof.
  • Water-soluble preservatives that may be employed in a composition of the present invention include benzalkonium chloride, benzoic acid, benzoyl chloride, benzyl alcohol, chlorobutanol, calcium ascorbate, ethyl alcohol, potassium sulfite, sodium ascorbate, sodium benzoate, sodium bisulfite, sodium bisulfate, sodium thiosulfate, thimerosal, methylparaben, ethylparaben, propylparaben, polyvinyl alcohol, and phenylethyl alcohol.
  • Other preservatives useful in the present invention include, but are not limited to, the FDA-approved preservative systems for food, cosmetics, and pharmaceutical preparations. These agents may be present in individual amounts of from about 0.001 to about 5 percent by weight (preferably, about 0.01 percent to about 2 percent by weight).
  • a composition of the present invention comprises an anti-microbial agent.
  • antimicrobial agents include the quaternary ammonium compounds and bisbiguanides.
  • Representative examples of quaternary ammonium compounds include benzalkonium halides and balanced mixtures of n-alkyl dimethyl benzyl ammonium chlorides.
  • antimicrobial agents include polymeric quaternary ammonium salts used in ophthalmic applications such as poly[(dimethyliminio)-2-butene-l,4-diyl chloride], [4-tris(2- hydroxyethyl)ammonio]-2-butenyl-w-[tris(2-hydroxyethyl)ammonio]dichloride (chemical registry number 75345-27-6) generally available as Polyquaternium-1® from ONYX Corporation.
  • polymeric quaternary ammonium salts used in ophthalmic applications such as poly[(dimethyliminio)-2-butene-l,4-diyl chloride], [4-tris(2- hydroxyethyl)ammonio]-2-butenyl-w-[tris(2-hydroxyethyl)ammonio]dichloride (chemical registry number 75345-27-6) generally available as Polyquaternium-1® from ONYX Corporation.
  • Non-limiting examples of antimicrobial biguanides include the bis(biguanides), such as alexidine or chlorhexidine or salts thereof, and polymeric biguanides such as polymeric hexamethylene biguanides ("PHMB”) and their water- soluble salts, which are available, for example, from Zeneca, Wilmington, Delaware.
  • bis(biguanides) such as alexidine or chlorhexidine or salts thereof
  • polymeric biguanides such as polymeric hexamethylene biguanides (“PHMB”) and their water- soluble salts, which are available, for example, from Zeneca, Wilmington, Delaware.
  • PHMB polymeric hexamethylene biguanides
  • a composition of the present invention includes a disinfecting amount of an antimicrobial agent that will at least reduce the microorganism population in the formulations employed.
  • a disinfecting amount is that which will reduce the microbial burden by two log orders in four hours and more preferably by one log order in one hour.
  • such agents are present in concentrations ranging from about 0.00001 to about 0.5 percent (w/v); preferably, from about 0.00003 to about 0.5 percent (w/v); and more preferably, from about 0.0003 to about 0.1 percent (w/v).
  • a composition of the present invention comprises a surfactant.
  • Suitable surfactants can be amphoteric, cationic, anionic, or non-ionic, which may be present (individually or in combination) in amounts up to 15 percent, preferably up to 5 percent weight by volume (w/v) of the total composition (solution).
  • the surfactant is an amphoteric or non-ionic surfactant, which when used imparts cleaning and conditioning properties.
  • the surfactant should be soluble in the lens care solution and non-irritating to eye tissues.
  • Many non-ionic surfactants comprise one or more chains or polymeric components having oxyalkylene (-O-R-) repeats units wherein R has 2 to 6 carbon atoms.
  • Preferred non-ionic surfactants comprise block polymers of two or more different kinds of oxyalkylene repeat units. Satisfactory non- ionic surfactants include polyethylene glycol esters of fatty acids, polysorbates, polyoxyethylene, or polyoxypropylene ethers of higher alkanes (Ci 2 -C is).
  • Non-limiting examples of the preferred class include polysorbate 80 (polyoxyethylene sorbitan monooleate), polysorbate 60 (polyoxyethylene sorbitan monostearate), polysorbate 20 (polyoxyethylene sorbitan monolaurate), commonly known by their trade names of Tween® 80, Tween® 60, Tween® 20), poloxamers (synthetic block polymers of ethylene oxide and propylene oxide, such as those commonly known by their trade names of Pluronic®; e.g., Pluronic® F127 or Pluronic® F108) ), or poloxamines (synthetic block polymers of ethylene oxide and propylene oxide attached to ethylene diamine, such as those commonly known by their trade names of Tetronic®; e.g., Tetronic® 1508 or Tetronic® 908, etc., other nonionic surfactants such as Brij®, Myrj®, and long chain fatty alcohols (i.e., oleyl alcohol, stearyl
  • concentration of a non-ionic surfactant, when present, in a composition of the present invention can be in the range from about 0.001 to about 5 weight percent (or alternatively, from about 0.01 to about 4, or from about 0.01 to about 2, or from about 0.01 to about 1 weight percent).
  • Amphoteric surfactants suitable for use in a composition according to the present invention include materials of the type offered commercially under the trade name "Miranol.” Another useful class of amphoteric surfactants is exemplified by cocoamidopropyl betaine, commercially available from various sources.
  • the foregoing surfactants will generally be present in a total amount from 0.001 to 5 percent weight by volume (w/v), or 0.01 to 5 percent, or 0.01 to 2 percent, or 0.1 to 1.5 percent (w/v).
  • the pH of a composition of the present invention is maintained within the range of 5 to 8, preferably about 6 to 8, more preferably about 6.5 to 7.8.
  • suitable buffers include boric acid, sodium borate, potassium citrate, citric acid, sodium bicarbonate, TRIS, and various mixed phosphate buffers (including combinations OfNa 2 HPO 4 , NaHaPO 4 and KH 2 PO 4 ) and mixtures thereof.
  • Borate buffers are preferred, particularly for enhancing the efficacy of biguanides, when they are used in compositions of the present invention.
  • buffers will be used in amounts ranging from about 0.05 to 2.5 percent by weight, and preferably, from 0.1 to 1.5 percent.
  • the compositions comprise a borate or mixed phosphate buffer, containing one or more of boric acid, sodium borate, potassium tetraborate, potassium metaborate, or mixtures of the same.
  • buffering agents in some instances it may be desirable to include chelating or sequestering agents in the present compositions in order to bind metal ions, which might otherwise react with the lens and/or protein deposits and collect on the lens.
  • Ethylene-diaminetetraacetic acid (“EDTA”) and its salts (disodium) are preferred examples. They are usually added in amounts ranging from about 0.01 to about 0.3 weight percent.
  • Other suitable sequestering agents include phosphonic acids, gluconic acid, citric acid, tartaric acid, and their salts; e.g., sodium salts.
  • compositions of the present invention comprise a tonicity-adjusting agent, to approximate the osmotic pressure of normal lacrimal fluid, which is equivalent to a 0.9 percent solution of sodium chloride or 2.5 percent of glycerol solution.
  • suitable tonicity-adjusting agents include, but are not limited to, sodium and potassium chloride, calcium and magnesium chloride, dextrose, glycerin, mannitol, and sorbitol. These agents are typically used individually in amounts ranging from about 0.01 to 2.5 percent (w/v) and preferably, form about 0.2 to about 1.5 percent (w/v).
  • the tonicity-adjusting agent will be employed in an amount to provide a final osmotic value of 200 to 450 mOsm/kg, more preferably between about 250 to about 350 mOsrn/kg, and most preferably between about 280 to about 320 mOsm/Kg.
  • viscosity-modifying agents Because of their demulcent effect, viscosity-modifying agents have a tendency to enhance the patient's comfort by means of a lubricating film on the eye.
  • the water- soluble viscosity-modifying agents include the cellulose polymers like hydroxyethyl or hydroxypropyl cellulose, carboxymethyl cellulose and the like. Such viscosity- modifying agents may be employed in amounts ranging from about 0.01 to about 4 weight percent or less.
  • the present compositions may also include optional demulcents.
  • composition of the present invention can include additives such as co-solvents, oils, humectants, emollients, stabilizers, or antioxidants for a variety of purposes. These additives may be present in amounts sufficient to provide the desired effects, without impacting the performance of other ingredients.
  • EXPERIMENT 1 Inhibitory ODN suppression of neutrophils activated by synthetic stimulatory ODN sequence, bacterial DNA, and whole bacteria, but not by specific TLR ligand Pam3Cys or LPS.
  • mouse peritoneal neutrophils were isolated from C57BL/6 mice that had received intraperitoneal injection of 1% casein solution containing 0.5mM MgCl 2 and 0.99mM CaCl 2 16 hours and 3 hours prior to harvesting in Hank's balanced salt solution (“HBSS”) lavage. Collected cells were centrifuged (2000rpm, 10 min) and washed twice in HBSS, prior to separation of granulocytes by Percol gradient at 31 ,500 rpm for 20 min. Cells were washed twice and resuspended in Dubelco's modified eagle's medium ("DMEM”) containing 10% fetal calf serum (Invitrogen, Basel Switzerland).
  • DMEM Dubelco's modified eagle's medium
  • compositions of the present invention comprising 0.08 - 10 ⁇ g/ml of inhibitory ODN 2088 (InvivoGen, San Diego, CA; sequence disclosed above) or a control composition containing 20 ⁇ g/ml of the control ODN 1911 (Operon Qiagen, Valencia, California; having a sequence of TCCAGGACTTTCCTCAGGTT), or the medium only, for 30 minutes prior to activation with 20 ⁇ g/ml of stimulatory ODN 1826 (Operon Qiagen, Valencia, California; having a sequence of TCCATGACGTTCCTGACGTT); 20 ⁇ g/ml of endotoxin-free DNA from E.
  • coli Kl 2 (InvivoGen, San Diego, CA); killed Staphylococcus aureus strain E2061740 (3xlO 5 cfu/ml); 100 ng/ml of Pam3Cys (synthetic lipopeptide (S)-(2,3-bis(palmitoyloxy)- (2RS)-propyl)-N-palmitoyl-(R)-Cys-(S)-Ser-(S)-Lys 4 -OH, EMC Microcollections, Tubingen, Germany); or 200 ng/ml of LPS (ultra pure lipopolysaccharide from E. coli 011 1.B4 strain, InvivoGen, San Diego, California).
  • LPS ultra pure lipopolysaccharide from E. coli 011 1.B4 strain, InvivoGen, San Diego, California
  • the composition containing the inhibitory ODN 2088 inhibited proinflammatory cytokine production by neutrophils upon exposure to the synthetic stimulatory ODN 1826 or bacterial DNA in a dose dependent manner Furthermore, the composition containing the inhibitory ODN 2088 prevented the production of proinflammatory cytokines, as exhibited by the nondetectable levels of these four cytokines, when neutrophils were activated with killed Staphylococcus aureus. The production of these pro-inflammatory cytokines was not affected when neutrophils activated by Pam3Cys or LPS were treated with a composition comprising the inhibitory ODN 2088.
  • inhibitory ODN 2088 inhibits the activation of TLR9 while LPS and Pam3Cys activate TLR4 and TLR2, respectively.
  • Other inhibitors of TLR2 and TLR4 activation should be effective in suppressing corneal infiltrate induced by LPS and Pam3Cys, respectively.
  • EXPERIMENT 2-1 Inhibitory ODN suppression of mouse keratitis induced by synthetic stimulatory ODN sequence or bacterial DNA, but not by TLR ligand Pam3Cys or LPS.
  • test solution containing 20 ⁇ g/ml of the synthetic stimulatory ODN 1826, 10 ⁇ g/ml of endotoxin-free DNA from ⁇ . coli K 12, 20 ⁇ g/ml of Pam3Cys, or 20 ⁇ g/ml LPS, along with a composition of the present invention containing the inhibitory ODN 2088, the control composition containing 20 ⁇ g/ml of ODN 1911, or medium only, was applied to a 1 mm 2 abraded area of central C57BL/6 mouse cornea that had been marked by sterile trephine (Miltex, Tuttlingen, Germany) and abraded with an Alger brush II (Alger, Pago Vista, Texas).
  • sterile trephine Miltex, Tuttlingen, Germany
  • the corneal infiltrate was determined as the number of neutrophils per corneal section. The results are shown in Figure 5.
  • the inhibitory ODN 2088 reduced the number of infiltrating neutrophils in response to the stimulatory ODN 1826 or bacterial DNA.
  • the inhibitory ODN 2088 was not effective in suppressing corneal infiltrates in response to Pam3Cys or LPS activation because ODN 2088 inhibits TLR 9 activation while LPS and Pame3Cys activate TLR2 and TLR4, respectively.
  • Other inhibitors of TLR2 and TLR4 activation should be effective in suppressing corneal infiltrate induced by Pam3Cys and LPS, respectively.
  • EXPERIMENT 2-2 Inhibitory ODN suppression of mouse pro-inflammatory cytokines induced by stimulatory ODN.
  • EXPERIMENT 3 Inhibitory ODN and vitamin D suppression of TLR ligand activation of human cell lines.
  • HCEL a human corneal epithelial cell line representative of cells present on the ocular surface
  • HL-60 a neutrophil-like cell line representative of neutrophils present in the tear layer, especially in the closed eye
  • U937 a macrophage cell line representative of dendritic cells of the cornea, especially of those at the limbus
  • compositions of the present invention containing the inhibitory ODN TTAGGG (InvivoGen, San Diego, CA) and vitamin D (l ⁇ ,25- Dihydroxyvitamin D 3 , Sigma-Aldrich, St.
  • prednisolone (1,4-Pregnadiene-l l ⁇ ,17 ⁇ ,21-triol-3,20-dione, Sigma-Aldrich, St. Louis, MO) for 1 hour prior to activation by the TLR ligand Pam3Cys for 6 hour, flagellin (flagellin purified from Salmonella typhimuriutn, InvivoGen, San Diego, California) for 24 hr, or the stimulatory CpG type B ODN 2006 (Invivogen, San Diego, California) for 24 hours.
  • Prednisolone inhibited Pam3Cys and flagellin activation of each cell line, except Pam3Cys activation of U937 cell line. Inhibition of the stimulatory ODN CpGB ODN 2006 was only tested with inhibitory ODN TTAGGG on U937 cells.
  • compositions of the present invention serve to illustrate some non-limiting compositions of the present invention.
  • the ingredients shown in each of Tables 1-10 are mixed to form a pharmaceutical composition for treating, reducing, ameliorating, alleviating, or preventing a dry eye condition or an ophthalmic disorder that requires rewetting of the eye.
  • a preservative other than polyhexamethylenebiguanide HCl may be used in any one of the foregoing formulation, in a suitably effective amount.
  • a composition can be free of preservative if it is formulated to be used as a unit-dose composition.
  • the composition is packaged in individual container that is opened and the contents of the container are used only once.
  • a composition of the present invention is formulated as an eye drop, which is applied in the ocular environment on a periodic basis (for example, daily, once every other day, weekly, bimonthly, or monthly) to provide a treatment, reduction, amelioration, alleviation, or prevention of a dry eye condition or an ophthalmic disorder that requires rewetting of the eye.
  • the present invention also provides a method for reducing risk of development, or severity, of an inappropriate immune response in an eye. The method comprises applying a composition to the eye, wherein the composition comprises an antagonist to at least one human TLR, an antagonist to a coreceptor of a human TLR, or a compound that is capable of inhibiting an activation of a human TLR signaling pathway.
  • the concentration of an antagonist to at least one human TLR, an antagonist to a coreceptor of a human TLR, or a compound that is capable of inhibiting an activation of a human TLR signaling pathway in a composition of the present invention is in any one of the ranges disclosed herein.
  • the present invention provides a method for preparing a composition for the treatment, reduction, amelioration, alleviation, or prevention of an ophthalmic condition in a subject, which has an etiology in inflammation.
  • the method comprises combining at least an antagonist to one human TLR, an antagonist to a coreceptor of a human TLR, or a compound that is capable of inhibiting an activation of a human TLR signaling pathway with a pharmaceutically acceptable carrier, diluent, excipient, additive, or combination thereof.
  • a composition of the present invention is in a form of an emulsion, suspension, or dispersion.
  • the suspension or dispersion is based on an aqueous solution.
  • a composition of the present invention can comprise sterile saline solution.
  • a composition of the present invention can avoid one or more of the side effects of glucocorticoid therapy.
  • Glucocorticoids are among the most potent drugs used for the treatment of allergic and chronic inflammatory diseases.
  • long-term treatment with GCs is often associated with numerous adverse side effects, such as diabetes, osteoporosis, hypertension, glaucoma, or cataract.
  • side effects like other physiological manifestations, are results of aberrant expression of genes responsible for such diseases.
  • Research in the last decade has provided important insights into the molecular basis of GC -mediated actions on the expression of GC- responsive genes. GCs exert most of their genomic effects by binding to the cytoplasmic GC receptor ("GR").
  • GR cytoplasmic GC receptor
  • GCs inhibit the transcription, through the transrepression mechanism, of several cytokines that are relevant in inflammatory diseases, including IL-l ⁇ (interleukin- 1 ⁇ ), IL-2, IL-3, IL-6, IL-11, TNF- ⁇ (tumor necrosis factor- ⁇ ), GM-CSF (granulocyte-macrophage colony-stimulating factor), and chemokines that attract inflammatory cells to the site of inflammation, including IL-8, RANTES, MCP-I (monocyte chemotactic protein-1), MCP-3, MCP-4, MTP-l ⁇ (macrophage-inflammatory protein- l ⁇ ), and eotaxin.
  • IL-8 interleukin- 1 ⁇
  • IL-2 interleukin-2
  • IL-3 interleukin-6
  • GM-CSF granulocyte-macrophage colony-stimulating factor
  • chemokines that attract
  • the present invention provides pharmaceutical compositions for the treatment, reduction, alleviation, or amelioration of a pathological condition having an etiology in inflammation, which compositions avoid generation of one or more adverse side effects of GCs.
  • an adverse side effect of GCs is selected from the group consisting of glaucoma, cataract, hypertension, hyperglycemia, hyperlipidemia (increased levels of triglycerides), and hypercholesterolemia (increased levels of cholesterol).
  • a level of said at least an adverse side effect is determined at about one day after said compounds or compositions are first administered to, and are present in, said subject.
  • a level of said at least an adverse side effect is determined about 30 days after said compounds or compositions are first administered to, and are present in, said subject.
  • a level of said at least an adverse side effect is determined about 2, 3, 4, 5, or 6 months after said compounds or compositions are first administered to, and are present in, said subject.
  • said at least a prior-art glucocorticoid used to treat or reduce the same condition or disorder is administered to said subject at a dose and a frequency sufficient to produce the same beneficial effect on said condition or disorder as a compound or composition of the present invention after about the same elapsed time.
  • said at least a prior-art glucocorticoid is selected from the group consisting of 21-acetoxypregnenolone, alclometasone, algestone, amcinonide, beclomethasone, betamethasone, budesonide, chloroprednisone, clobetasol, clobetasone, clocortolone, cloprednol, corticosterone, cortisone, cortivazol, deflazacort, desonide, desoximetasone, dexamethasone, diflorasone, diflucortolone, difluprednate, enoxolone, fluazacort, flucloronide, flumethasone, flunisolide, fluocinolone acetonide, fluocinonide, fluocortin butyl, fluocortolone, fluorometholone, fluperolone acetate, flupredn
  • said at least a prior-art glucocorticoid is selected from the group consisting of dexamethasone, prednisone, prednisolone, methylprednisolone, medrysone, triamcinolone, loteprednol etabonate, physiologically acceptable salts thereof, combinations thereof, and mixtures thereof.
  • said at least a prior-art glucocorticoid is acceptable for ophthalmic uses.
  • Inhibitors of TLRs or TLR coreceptors are not expected to generate side effects that have been seen with glucocorticoid therapy. However, such effects may still be assessed by a test disclosed below.
  • One of the most frequent undesirable actions of a glucocorticoid therapy is steroid diabetes. The reason for this is the stimulation of gluconeogenesis in the liver by the induction of the transcription of hepatic enzymes involved in gluconeogenesis and metabolism of free amino acids that are produced from the degradation of proteins (catabolic action of glucocorticoids).
  • a key enzyme of the catabolic metabolism in the liver is the tyrosine aminotransferase ("TAT").
  • the activity of this enzyme can be determined photometrically from cell cultures of treated rat hepatoma cells.
  • the gluconeogenesis by a glucocorticoid can be compared to that of a PARP inhibitor by measuring the activity of this enzyme.
  • the cells are treated for 24 hours with the test substance (a PARP inhibitor or glucocorticoid), and then the TAT activity is measured.
  • the TAT activities for the selected PARP inhibitor and glucocorticoid are then compared.
  • Other hepatic enzymes can be used in place of TAT, such as phosphoenolpyruvate carboxykinase, glucose-6- phosphatase, or fructose-2,6-biphosphatase.
  • the levels of blood glucose in an animal model may be measured directly and compared for individual subjects that are treated with a glucocorticoid for a selected condition and those that are treated with a PARP inhibitor for the same condition.
  • IOP Another undesirable result of glucocorticoid therapy is increased IOP in the subject.
  • IOP of subjects treated with glucocorticoid and PARP inhibitor for a condition may be measured directly and compared.
  • Asp Tyr Trp lie Gl u 1 5 ⁇ 210> 13
  • Trp Trp Asn Asp Asn lie Tyr Tyr Asn Thr val Leu Lys Ser 1 5 10 15

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Epidemiology (AREA)
  • Ophthalmology & Optometry (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

L'invention concerne des compositions et des procédés pour traiter, réduire, améliorer, soulager ou prévenir la kératoconjonctivite sèche, ou des troubles ophtalmologiques qui ont une étiologie inflammatoire, avec un antagoniste d'un récepteur de type Toll (« TLR »), des co-récepteurs de celui-ci, ou une combinaison de ceux-ci. Les compositions peuvent également contenir un autre médicament anti-inflammatoire.
PCT/US2008/067419 2007-06-26 2008-06-19 Compositions et procédés pour traiter, réduire, améliorer, soulager ou prévenir la kératoconjonctivite sèche WO2009002790A2 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US94626107P 2007-06-26 2007-06-26
US60/946,261 2007-06-26

Publications (2)

Publication Number Publication Date
WO2009002790A2 true WO2009002790A2 (fr) 2008-12-31
WO2009002790A3 WO2009002790A3 (fr) 2009-03-19

Family

ID=39887712

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2008/067419 WO2009002790A2 (fr) 2007-06-26 2008-06-19 Compositions et procédés pour traiter, réduire, améliorer, soulager ou prévenir la kératoconjonctivite sèche

Country Status (1)

Country Link
WO (1) WO2009002790A2 (fr)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013089835A1 (fr) * 2011-12-12 2013-06-20 The Board Of Trustees Of The University Of Illinois Composition et méthode de traitement de maladies des yeux liées à l'acide nucléique
WO2017085740A1 (fr) * 2015-11-17 2017-05-26 Council Of Scientific & Industrial Système d'administration de médicament à base de nanostructure protéique pour l'administration d'agents thérapeutiques au niveau du segment antérieur de l'œil
WO2019191189A1 (fr) * 2018-03-27 2019-10-03 Neuropore Therapies, Inc. Composés utilisés en tant que modulateurs de signalisation tlr2
US11299487B2 (en) 2019-03-26 2022-04-12 Neuropore Therapies, Inc. Compounds and compositions as modulators of TLR signaling
WO2022073072A1 (fr) * 2020-10-07 2022-04-14 Implicit Bioscience Limited Méthodes et agents pour le traitement d'une maladie oculaire

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0862916A1 (fr) * 1995-11-20 1998-09-09 Kiyoshi Kita Preparation externe contenant de la vitamine d ou de la vitamine k
EP0992242A1 (fr) * 1997-06-10 2000-04-12 New Vision Co., Ltd. Agents prophylactiques et/ou remedes contenant de la vitamine d pour prevenir et/ou traiter le xerosis conjonctival/corneen
US20050265998A1 (en) * 2003-12-10 2005-12-01 Greg Elson Neutralizing antibodies and methods of use thereof
WO2006121871A2 (fr) * 2005-05-06 2006-11-16 The Scripps Research Institute Compositions et procedes pour moduler des cellules via le cd14 et le chemin de signalisation du recepteur 4 de type toll

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0862916A1 (fr) * 1995-11-20 1998-09-09 Kiyoshi Kita Preparation externe contenant de la vitamine d ou de la vitamine k
EP0992242A1 (fr) * 1997-06-10 2000-04-12 New Vision Co., Ltd. Agents prophylactiques et/ou remedes contenant de la vitamine d pour prevenir et/ou traiter le xerosis conjonctival/corneen
US20050265998A1 (en) * 2003-12-10 2005-12-01 Greg Elson Neutralizing antibodies and methods of use thereof
WO2006121871A2 (fr) * 2005-05-06 2006-11-16 The Scripps Research Institute Compositions et procedes pour moduler des cellules via le cd14 et le chemin de signalisation du recepteur 4 de type toll

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
BAUDOUIN C: "[A new approach for better comprehension of diseases of the ocular surface]" JOURNAL FRANÇAIS D'OPHTALMOLOGIE MAR 2007, vol. 30, no. 3, March 2007 (2007-03), pages 239-246, XP002504005 ISSN: 1773-0597 *
CHANG J H ET AL: "Toll-like receptors in ocular immunity and the immunopathogenesis of inflammatory eye disease" BRITISH JOURNAL OF OPHTHALMOLOGY, LONDON, GB, vol. 90, no. 1, 1 January 2006 (2006-01-01), pages 103-108, XP009108391 ISSN: 0007-1161 cited in the application *
MCPHERRAN R R ET AL: "Inflammation in corneal wound healing and dry eye" CLINICAL & REFRACTIVE OPTOMETRY, MEDIACONCEPT, MONTREAL, CA, vol. 16, no. 10, 1 January 2005 (2005-01-01), pages 294-299, XP009104008 ISSN: 1705-4850 *
STERN M E ET AL: "Inflammation in dry eye" OCULAR SURFACE, ETHIS COMMUNICATIONS, NEW YORK, NY, US, vol. 2, no. 2, 1 January 2004 (2004-01-01), pages 124-130, XP001538522 ISSN: 1542-0124 *

Cited By (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10328129B2 (en) 2011-12-12 2019-06-25 The Board Of Trustees Of The University Of Illinois Composition and method for treating nucleic acid-related eye disease
CN104220087A (zh) * 2011-12-12 2014-12-17 美国伊利诺大学理事会 用于治疗核酸相关眼病的组合物及方法
US11376312B2 (en) 2011-12-12 2022-07-05 The Board Of Trustees Of The University Of Illinois Composition and method for treating nucleic acid-related eye disease
US9867871B2 (en) 2011-12-12 2018-01-16 The Board Of Trustees Of The University Of Illinois Composition and method for treating nucleic acid-related eye disease
RU2642609C2 (ru) * 2011-12-12 2018-01-25 Дзе Борд Оф Трастиз Оф Дзе Юниверсити Оф Иллинойс Композиция и способ лечения болезни глаз, связанной с нуклеиновыми кислотами
WO2013089835A1 (fr) * 2011-12-12 2013-06-20 The Board Of Trustees Of The University Of Illinois Composition et méthode de traitement de maladies des yeux liées à l'acide nucléique
GB2558494B (en) * 2015-11-17 2020-11-25 Council Scient Ind Res Protein nanostructure based drug delivery system for the delivery of therapeutic agents to the anterior segment of the eye
GB2558494A (en) * 2015-11-17 2018-07-11 Council Scient Ind Res Protein nanostructure based drug delivery system for the delivery of therapeutic agents to the anterior segment of the eye
CN108697808B (zh) * 2015-11-17 2021-06-01 印度科学工业研究所 用于将治疗剂递送至眼前节的基于蛋白纳米结构的药物递送系统
WO2017085740A1 (fr) * 2015-11-17 2017-05-26 Council Of Scientific & Industrial Système d'administration de médicament à base de nanostructure protéique pour l'administration d'agents thérapeutiques au niveau du segment antérieur de l'œil
WO2019191189A1 (fr) * 2018-03-27 2019-10-03 Neuropore Therapies, Inc. Composés utilisés en tant que modulateurs de signalisation tlr2
CN112020494A (zh) * 2018-03-27 2020-12-01 神经孔疗法股份有限公司 用作tlr2信号转导调节剂的化合物
JP2021519316A (ja) * 2018-03-27 2021-08-10 ニューロポア セラピーズ インコーポレイテッド Ｔｌｒ２シグナル伝達の調節剤としての化合物
US11345713B2 (en) 2018-03-27 2022-05-31 Neuropore Therapies, Inc. Compounds as modulators of TLR2 signaling
US11299487B2 (en) 2019-03-26 2022-04-12 Neuropore Therapies, Inc. Compounds and compositions as modulators of TLR signaling
WO2022073072A1 (fr) * 2020-10-07 2022-04-14 Implicit Bioscience Limited Méthodes et agents pour le traitement d'une maladie oculaire
US11618782B2 (en) 2020-10-07 2023-04-04 Line 6 Biotechnology, Inc. Methods and agents for the treatment of ocular disease

Also Published As

Publication number Publication date
WO2009002790A3 (fr) 2009-03-19

Similar Documents

Publication Publication Date Title
P. Mishra et al. Recent patents and emerging therapeutics in the treatment of allergic conjunctivitis
Carrijo-Carvalho et al. Therapeutic agents and biocides for ocular infections by free-living amoebae of Acanthamoeba genus
Al-Saedi et al. Dry eye disease: present challenges in the management and future trends
DK2790722T3 (en) COMPOSITION AND METHOD OF TREATING NUCLEAR ACID-RELATED EYE DISEASE
CN102811610B (zh) 无刺激性眼科聚维酮碘组合物
Zhao et al. Activation of Toll-like receptors 2 and 4 in Aspergillus fumigatus keratitis
Taube et al. Pattern recognition receptors in microbial keratitis
WO2009002790A2 (fr) Compositions et procédés pour traiter, réduire, améliorer, soulager ou prévenir la kératoconjonctivite sèche
Mai et al. Role of toll-like receptors in human iris pigment epithelial cells and their response to pathogen-associated molecular patterns
KR20190068575A (ko) 안구 표면 항상성의 확립, 회복 및 보존 방법
WO2013012692A1 (fr) Compositions pharmaceutiques comprenant des polysaccharides à base de plante et utilisations de celles-ci
WO2017062491A1 (fr) Compositions thérapeutiques pour le traitement du syndrome de l'œil sec et de maladies de surface oculaire associées
EP3013425A1 (fr) Traitement et diagnostic d'une maladie oculaire
WO2009089399A2 (fr) Compositions comprenant des antagonistes du récepteur ou du co-récepteur de type toll et procédés de neuroprotection oculaire
WO2009089401A2 (fr) Compositions comprenant des antagonistes du récepteur ou du corécepteur de type toll et méthodes pour traiter ou lutter contre une allergie oculaire faisant intervenir lesdites compositions
US20200376019A1 (en) miR29 MIMICS FOR THE TREATMENT OF OCULAR FIBROSIS
JPS62501420A (ja) 眼用ゲル組成物および感染眼病治療方法
JP2021533100A (ja) 眼を治療するための組成物
EP2222299B1 (fr) Compositions et procedes de modulation de la production de cytokines pro-inflammatoires
KR101932862B1 (ko) 안구건조증 예방 및 치료용 조성물
AU2022263530A1 (en) Compositions and methods for treating the eye
US20190247302A1 (en) Materials and methods for treating ophthalmic inflammation
US20230355522A1 (en) Microemulsion for the treatment of dry eye syndrome
WO2018162271A1 (fr) Nanoparticules pour le traitement de la dégénérescence maculaire
AU2012389270B2 (en) siRNA and their use in methods and compositions for the treatment and/or prevention of eye conditions

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 08771419

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase in:

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 08771419

Country of ref document: EP

Kind code of ref document: A2