WO2008157235A1 - Rsk inhibitors as anti-septicemia agents - Google Patents

Abstract

A composition comprising a RSK activity inhibiting agent is provided for use in preventing or treating septicemia. Inhibition of RSK activity has been found by applicant to inhibit pathogenic stimulated expression of adhesion factors in endothelial cells and the pathogenic stimulated expression of nitric oxide synthase by macrophages. The RSK specific inhibitors used in accordance with the disclosed composition and methods can be selected from any inhibiting moiety including but not limited to anti-sense oligonucleotides, interfering oligonucleotide and kaempferol 3-O-(3',4'-di-O-acetyl-α-L-rhamnopyranoside) and related compounds.

Description

RSK INHIBITORS AS ANTI-SEPTICEMIA AGENTS

CROSS REFERENCE TO RELATED APPLICATIONS

This application claims priority to United States Provisional Patent Application No. 60/934,333 filed on June 13, 2007, the complete disclosure of which is incorporated herein by reference.

BACKGROUND

Sepsis remains the 10th leading cause of death in the United States according to the CDC (2003 data) and is the second leading cause of death of those hospitalized in noncoronary intensive care units. It is estimated that there are 18 million cases of sepsis each year worldwide resulting in 1 ,400 deaths per day. Thus, the socioeconomic burden associated with sepsis is considerable. There is a critical need to develop novel therapeutic strategies that will reduce the systemic inflammatory response and ultimately multiple organ dysfunction.

Upon detection of an invading pathogen, the monocytes and macrophages initiate inflammatory cascades resulting in secretion of inflammatory mediators that dramatically alter the function of the endothelial cells. The secreted factors activate endothelial cells at the site of infection, stimulating the endothelium 1) to convert from an anti- to pro-adhesive phenotype, 2) to reorganize factors involved in tight junction formation resulting in increased permeability 3) to release autocrine/paracrine factors that amplify the immune response and, in some cases, 4) to undergo apoptosis further accentuating the inflammatory response (Endemann, D. H. and Schiffπn, E. L. 2004. Endothelial dysfunction. J Am Soc Nephrol 15:1983-92). Endothelium activation upon infection is a localized inflammatory response to an invading pathogen. Endothelium dysfunction associated with sepsis results from a systemic inflammatory response and it is the dysfunction of the endothelium that results in tissue damage leading to multiple organ failure.

The immune response is a complex and highly regulated reaction. Monocytes and macrophages recognize the invading pathogen through receptor interaction with conserved structures of the pathogen. Activation of the macrophages by pathogen derived molecules such as bacterial lipopolysaccharide (LPS) induces transcription of a variety of genes involved in innate immunity. Nilsson, R. et al. (Genomics 88:133-42 (2006)) identified 259 genes induced by LPS-stimulation of macrophages. Among the products of these induced genes are the cytokines and chemokines, TNFα, IL-I α/β, IL-6, IL-12, IL-18, GRO-I, M-CSF, MCP-1/3 and MIP- 1. Other studies have demonstrated LPS-induced expression of VEGF and endothelin-1. Many investigations have demonstrated that endothelial cell activation by macrophages involves LPS-stimulated expression of inducible nitric oxide synthase (iNOS) and COX-2. Examination of arteries from iNOS knockout mouse suggests that iNOS plays an integral role in the development of endothelial dysfunction associated with sepsis (Chauhan, et al., (2003) FASEB J 17:773-5). It is likely that upregulated iNOS expression explains the drop in blood pressure and increased permeability associated with septicemia (see for example, Ferro et al., (1997) Am J Physiol 272:L979-88).

The response of the endothelial cells to the flood of inflammatory mediators is to express adhesion molecules such as P-selectin, E-selectin, ICAM-I and VCAM-I . These alterations convert the endothelial cells from the anti-adhesive to the pro-adhesive phenotype. The adhesion molecules mediate the initial step of leukocyte adherence allowing transmigration of leukocytes into the underlying tissue. Activation of the endothelial cells also results in increased permeability by reorganization of the proteins involved in tight junctions between the cells. Once activated, the endothelial cells produce pro-inflammatory factors such as IL-I, IL-6, IL-8, colony-stimulating factors, gro-α and monocyte chemotactic proteins (Pober, J. S. and Cotran, R. S. (1990) Physiol Rev 70:427-51). These factors act as paracrine signals that recruit additional endothelial cells into the inflammatory response. The inflammatory mediators that activate the endothelium can also result in apoptosis of the endothelial cells, which accentuates the inflammatory response with increased procoagulant activity and increased adhesion to non-activated platelets (Bombeli, et al., (1999) Blood 93:3831-8).

Because the endothelium is both the target for, and the source of, inflammatory mediators, it is a key organ in the development of septicemia. Thus, a therapeutic strategy to limit the development of systemic inflammation should modify the pattern of inflammatory mediators released upon activation, or attenuate the response of the endothelium to the inflammatory mediators. RSK is a serine/threonine kinase that is a downstream component of the Mitogen-activated Protein Kinase (MAPK) signaling pathway. Therefore, unregulated stimulation of the MAPK pathway results in unregulated Rsk catalytic activity. One publication by Cieslik et al. (J Biol Chem 280: 18411 -7 (2005)) reported that inhibition of p90 Ribosomal S6 Kinase (RSK) activity in human fibroblasts inhibited phorbol ester- stimulated COX-2 expression. However, little data has been published regarding the biological role of the Ser/Thr protein kinase RSK family in somatic cells.

There is a long felt need in the art for compositions and methods useful for treating inflammation and septicemia. As disclosed herein, applicants have discovered that RSK activity is involved in such inflammatory processes, and that inhibition of RSK activity can reduce the endothelial dysfunction associated with septicemia.

SUMMARY

The present disclosure provides a method of treating septicemia. Septicemia is characterized by evidence of acute inflammation present throughout the entire body that ultimately results in multiple organ dysfunction. Since the endothelium is both the target for, and the source of, inflammatory mediators, it is a key organ in the development of septicemia. Thus, in accordance with the present disclosure, a therapeutic strategy is provided that is based on the inhibition of RSK activity as a means of limiting the development of systemic inflammation. More particularly, systemic inflammation is controled by modifying the pattern of inflammatory mediators released upon activation, and/or attenuating the response of the endothelium to the inflammatory mediators.

Upon detection of an invading pathogen, monocytes and macrophages initiate inflammatory cascades resulting in secretion of inflammatory mediators that dramatically alter the function of the endothelial cells. Inhibition of RSK activity has been found by applicants to reduce pathogenic stimulated expression of adhesion factors in endothelial cells and to reduce the pathogenic stimulated expression of nitric oxide synthase by macrophages. Accordingly, inhibiting RSK activity provides a means of reducing the systemic inflammatory response associated with septicemia, and thus provide a novel method for preventing dysfunction of the endothelium that results in tissue damage and subsequent multiple organ failure.

In accordance with one embodiment a composition and method are provided for use in preventing or treating septicemia, wherein the composition comprises a RSK inhibiting agent. The RSK specific inhibitors used in accordance with the disclosed methods can be selected from any inhibiting moiety including but not limited to anti-sense oligonucleotides, interfering oligonucleotide and kaempferol 3-O-(3",4"-di-O-acetyl-α-L-rhamnopyranoside) and related compounds.

In accordance with one embodiment, a method of reducing pathogenic stimulated expression of adhesion factors in endothelial cells, or reducing the pathogenic stimulated expression of nitric oxide synthase by macrophages, is provided, wherein an RSK inhibitor is adminstered to an individual in need thereof. In one embodiment the RSK inhibitor is selected from the group consisting of an anti- sense oligonucleotide and an interfering oligonucleotide. Alternatively, in one embodiment the RSK specific inhibitor comprises a compound having the structure of formula II:

wherein R₁, R_2, and R₅ are independently selected from the group consisting of OH, OCOR₈, COR_8, SR_8, and C₁-C₄ alkoxy;

R₃, R₄, R_6> R₇ are independently selected from the group consisting of H, OH, OCOR₈, COR₈, SR₈, and C₁-C₄ alkoxy; R₈ is H or Ci-C₄ alkyl; and

R₉, Rio and Rn are independently selected from the group consisting of

H₅ OH,

OCOR₈, COR₈, NHOCOR₈ and C₁-C₄ alkoxy, with the proviso that R₉, Rio and Ri ₁ are not all OH when R₁, R_2; and R₅ are OH. In a further embodiment R₁, R_2i and R₅ are independently OH or SR₈, and one OfR₉, R₁₀ and Ru is NHOCOR₈. In another embodiment, R₁ and R₂ are both OH, R₉, R₁₀ and Rn are independently selected from the group consisting of H, OH and OCOR₈, R₃ and R₇ are each H, R₄, R₅, and R₆ are independently selected from the group consisting of H, OR₈, OCOR₈, and COR₈, and R₈ is H or methyl.

In one embodiment the RSK inhibitor has the structure:

wherein R₉ is OH and Rio and Rn are each OAc (refered to herein as SLOlOl).

BRIEF DESCRIPTION OF THE DRAWINGS

Fig. 1 SLOlOl inhibition induces eEF2 phosphorylation in J774A.1 cells. J774A.1 cells were serum deprived for 18 hr prior to treatment with vehicle or 60 μM SLOlOl. After 1 hr incubation with SLOlOl, cells were stimulated with DMSO or 500 nM PDB for 15 min. Reactions were terminated with 2X-SDS lysis buffer. Equal loading is demonstrated by the Ran immunoblot. RSK inhibition by SLOlOl in J774A.1 cells increases the concentration of phosphorylated eEF2 levels because RSK no longer inhibits EF2K. The data demonstrates that the phosphorylation state of eEF2 can be used to detect RSK inhibition the macrophages. Figs. 2A & 2B Analysis of LPS stimulated cytokine expression. J774A1 cells were treated with growth medium containing 1 μg/ml LPS and either vehicle or 60 μM SLOlOl . Reactions were terminated with 2X-SDS lysis buffer at indicated time points and the lysates were immunoblotted. LPS treatment activates p42/44 MAPK (Erk 1/2) and does not alter the levels of RSK 1 or RSK2 (Fig. 2A). LPS treatment also increased expression of the cytokines, TNFα and IL-Ib (Fig. 2B). Equal loading is demonstrated by the Ran immunoblot.

Figs. 3 A & 3B RSK inhibition abrogates LPS-induced iNOS expression. J774A1 cells (Fig. 3A) and mouse primary peritoneal macrophages (Fig. 3B) were treated with growth medium containing 1 μg/ml LPS and either vehicle or 60 μM SLOl 01. Twenty-four hours after treatment, reactions were terminated with 2X-SDS lysis buffer and the lysates were immunoblotted. LPS treatment stimulates iNOS expression however, simultaneous contact with LPS and a RSK inhibitor abrogates iNOS expression in both the J774A.1 cells (Fig. 3A) and the primary macrophages (Fig. 3B). Equal loading is demonstrated by the Ran immunoblot.

Fig. 4 RSK inhibition reduces expression of the activation marker, VCAM. HUVEC cells were treated in the presence or absence of 1 μg/ml lipopolysaccharide (LPS) with concomitant treatment with vehicle or SLOlOl at indicated concentrations. Twenty-four hours after LPS treatment, the cells were harvested with SDS lysis buffer in preparation for SDS-PAGE and immunoblot analysis. Lysates were normalized with regard to protein concentration. Equivalent loading is shown by the anti-Ran immunoblot.

DETAILED DESCRIPTION DEFINITIONS

In describing and claiming the present disclosure, the following terminology will be used in accordance with the definitions set forth below. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. A "bioactive polypeptide" refers to polypeptides which are capable of exerting a biological effect in vitro and/or in vivo. As used herein, an antimicrobial is a substance that kills, or inhibits the growth or the ability of a microbe (such as bacteria, fungi, or viruses) to infect or maintain an infection in its host cell/organism.

As used herein, the term "pharmaceutically acceptable carrier" includes any of the standard pharmaceutical carriers, such as a phosphate buffered saline solution, water, emulsions such as an oil/water or water/oil emulsion, and various types of wetting agents. The term also encompasses any of the agents approved by a regulatory agency of the US Federal government or listed in the US Pharmacopeia for use in animals, including humans. As used herein the term "pharmaceutically acceptable salt" refers to salts of compounds that retain the biological activity of the parent compound, and which are not biologically or otherwise undesirable. Many of the compounds disclosed herein are capable of forming acid and/or base salts by virtue of the presence of amino and/or carboxyl groups or groups similar thereto. As used herein, the term "treating" includes prophylaxis of the specific disorder or condition, or alleviation of the symptoms associated with a specific disorder or condition and/or preventing or eliminating said symptoms. For example, as used herein the term "treating an infection" will refer in general to decreasing the number of infectious agents present in a tissue or cell relative to a pretreatment status or relative to an untreated control infected with the relevant pathogen.

As used herein an "effective" amount or a "therapeutically effective amount" of a prodrug refers to a nontoxic but sufficient amount of a bioactive agent to provide the desired effect. For example, an effective amount of an RSK inhibitor is an amount of the inhibitor sufficient to, inter alia, suppress RSK activity as indicated in a serine/threonine kinase assay. The term "effective amount" is used interchangeably with "effective concentration" herein. The amount that is "effective" will vary from subject to subject, depending on the age and general condition of the individual, mode of administration, and the like. Thus, it is not always possible to specify an exact "effective amount." However, an appropriate "effective" amount in any individual case may be determined by one of ordinary skill in the art using routine experimentation. The term, "parenteral" means not through the alimentary canal but by some other route such as subcutaneous, intramuscular, intraspinal, or intravenous.

The term "about," as used herein, means approximately, in the region of, roughly, or around. When the term "about" is used in conjunction with a numerical range, it modifies that range by extending the boundaries above and below the numerical values set forth. For example, in one aspect, the term "about" is used herein to modify a numerical value above and below the stated value by a variance of 20%.

As used herein, the term "affected cell" refers to a cell of a subject afflicted with a disease or disorder, which affected cell has an altered phenotype relative to a subject not afflicted with a disease or disorder.

Cells or tissue are "affected" by a disease or disorder if the cells or tissue have an altered phenotype relative to the same cells or tissue in a subject not afflicted with a disease or disorder. As used herein, an "agonist" is a composition of matter which, when administered to a mammal such as a human, enhances or extends a biological activity attributable to the level or presence of a target compound or molecule of interest in the mammal.

An "antagonist" is a composition of matter which when administered to a mammal such as a human, inhibits a biological activity attributable to the level or presence of a compound or molecule of interest in the mammal.

A disease or disorder is "alleviated" if the severity of a symptom of the disease or disorder, the frequency with which such a symptom is experienced by a patient, or both, are reduced. As used herein, "amino acids" are represented by the full name thereof, by the three letter code corresponding thereto, or by the one-letter code corresponding thereto, as indicated in the following table:

Full Name Three-Letter Code One-Letter Code

Aspartic Acid Asp D

Glutamic Acid GIu E

Lysine Lys K Arginine Arg R

Histidine His H

Tyrosine Tyr Y

Cysteine Cys C

Asparagine Asn N

Glutamine GIn Q

Serine Ser s

Threonine Thr T

Glycine GIy G

AAllaanniinnee AAllaa A

Valine VaI V

Leucine Leu L

Isoleucine He I

Methionine Met M

PPrroolliinnee PPrroo P

Phenylalanine Phe F

Tryptophan Trp W

The expression "amino acid" as used herein is meant to include compounds having the following general structure:

H R C COOH

NH₂ wherein R represents hydrogen or a hydrocarbon side chain, and includes both natural and synthetic amino acids, and both D and L amino acids. "Standard amino acid" means any of the twenty standard L-amino acids commonly found in naturally occurring peptides. "Nonstandard amino acid residue" means any amino acid, other than the standard amino acids, regardless of whether it is prepared synthetically or derived from a natural source. As used herein, "synthetic amino acid" also encompasses chemically modified amino acids, including but not limited to salts, amino acid derivatives (such as amides), and substitutions. Amino acids contained within the peptides of the present disclosure, and particularly at the carboxy- or amino-terminus, can be modified by methylation, amidation, acetylation or substitution with other chemical groups which can change the peptide's circulating half-life without adversely affecting their activity. Additionally, a disulfide linkage may be present or absent in the peptides of the present disclosure.

The term "amino acid" is used interchangeably with "amino acid residue," and may refer to a free amino acid and to an amino acid residue of a peptide. It will be apparent from the context in which the term is used whether it refers to a free amino acid or a residue of a peptide. As used herein, an "analog" of a chemical compound is a compound that, by way of example, resembles another in structure but is not necessarily an isomer (e.g., 5-fluorouracil is an analog of thymine).

The term "biological sample," as used herein, refers to samples obtained from a subject, including, but not limited to, skin, hair, tissue, blood, plasma, cells, sweat and urine.

As used herein, a "derivative" of a compound refers to a chemical compound that may be produced from another compound of similar structure in one or more steps, including for example, the replacement of hydrogen by an alkyl, acyl, or amino group. The use of the word "detect" and its grammatical variants is meant to refer to measurement of the species without quantification, whereas use of the word "determine" or "measure" with their grammatical variants are meant to refer to measurement of the species with quantification. The terms "detect" and "identify" are used interchangeably herein. As used herein, a "detectable marker" or a "reporter molecule" is an atom or a molecule that permits the specific detection of a compound comprising the marker in the presence of similar compounds without a marker. Detectable markers or reporter molecules include, e.g., radioactive isotopes, antigenic determinants, enzymes, nucleic acids available for hybridization, chromophores, fluorophores, chemiluminescent molecules, electrochemically detectable molecules, and molecules that provide for altered fluorescence-polarization or altered light-scattering. A "disease" is a state of health of an animal wherein the animal cannot maintain homeostasis, and wherein if the disease is not ameliorated then the animal's health continues to deteriorate.

In contrast, a "disorder" in an animal is a state of health in which the animal is able to maintain homeostasis, but in which the animal's state of health is less favorable than it would be in the absence of the disorder. Left untreated, a disorder does not necessarily cause a further decrease in the animal's state of health.

The term "excessive RSK activity", as used herein, refers to an increase in RSK activity in a cell with a disease or disorder, relative to the amount of such RSK activity in an otherwise identical normal cell.

As used herein, the term "flavonoid" refers to polyphenols compounds possessing a carbon skeleton having the general structure:

The terms "formula" and "structure" are used interchangeably herein.

As used herein, a "functional" molecule is a molecule in a form in which it exhibits a property by which it is characterized. By way of example, a functional enzyme is one which exhibits the characteristic catalytic activity by which the enzyme is characterized. Any reference to a compound having a "greater uptake" into a cell relative to another compound (e.g., SLOlOl) is intended to portray that a higher concentration of the first compound relative to the second will be present in otherwise identical cells that are exposed to the respective compounds for the same length of time. Accordingly, the first compound either has the ability to enter a cell at a greater rate than the second compound or that the first compound has lower rate of degradation or a lower rate of efflux from the cell relative to the second compound.

The term "inhibit," as used herein, refers to the ability of a compound of the present disclosure to reduce or impede a described function. In one embodiment, inhibition is at least 10%, at least 25%, at least 50%, at least 75% of the activity obtained in the absence of the inhibiting agent. The phrase "inhibit infection", as used herein, refers to both direct and indirect inhibition of infection, regardless of the mechanism.

The term "inhibit a protein", as used herein, refers to any method or technique which inhibits protein synthesis, levels, activity, or function, as well as methods of inhibiting the induction or stimulation of synthesis, levels, activity, or function of the protein of interest. The term also refers to any metabolic or regulatory pathway which can regulate the synthesis, levels, activity, or function of the protein of interest. The term includes binding with other molecules and complex formation. Therefore, the term "protein inhibitor" refers to any agent or compound, the application of which results in the inhibition of protein function or protein pathway function. However, the term does not imply that each and every one of these functions must be inhibited at the same time.

As used herein, "inhibiting RSK" refers to the use of any compound, agent, or mechanism to inhibit RSK synthesis, levels, activity, or function are reduced or inhibited.

As used herein, an "instructional material" includes a publication, a recording, a diagram, or any other medium of expression which can be used to communicate the usefulness of the peptide of the present disclosure in the kit for effecting alleviation of the various diseases or disorders recited herein. Optionally, or alternately, the instructional material may describe one or more methods of alleviating the diseases or disorders in a cell or a tissue of a mammal.

As used herein, "modification" of a compound refers to a compound that's structure or composition has been changed from the original compound.

As used herein, "pharmaceutical compositions" includes formulations for human and veterinary use.

The term "protein regulatory pathway", as used herein, refers to both the upstream regulatory pathway which regulates a protein, as well as the downstream events which that protein regulates. Such regulation includes, but is not limited to, transcription, translation, levels, activity, posttranslational modification, and function of the protein of interest, as well as the downstream events which the protein regulates. The terms "protein pathway" and "protein regulatory pathway" are used interchangeably herein.

As used herein, the term "purified" and the like terms relate to the isolation of a molecule or compound in a form that is substantially free (at least 60%, 75% , or 90% free) from other components normally associated with the molecule or compound in a native environment.

The term "regulate" refers to either stimulating or inhibiting a function or activity of interest.

As used herein, the use of the term "RSK" is intended to refer genetically to all the human RSK isotypes, including RSKl , RSK2, RSK3, and RSK4. RSKl, RSK2, RSK3, and RSK4 are specific human isotypes that have previously been described in the literature.

The term "RSK activity", as used herein, includes synthesis, levels, enzymatic activity, or function of RSK. As used herein, the term "RSK inhibitor" includes any compound or condition that specifically inhibits or reduces the kinase activity of RSK or which inhibits any function of RSK. Such inhibitory effects may result from directly, or indirectly, interfering with the protein's ability to phosphorylate its substrate, or may result from inhibiting the expression (transcription and/or translation) of RSK. The term "standard," as used herein, refers to something used for comparison. For example, it can be a known standard agent or compound which is administered and used for comparing results when administering a test compound, or it can be a standard parameter or function which is measured to obtain a control value when measuring an effect of an agent or compound on a parameter or function. Standard can also refer to an "internal standard", such as an agent or compound which is added at known amounts to a sample and is useful in determining such things as purification or recovery rates when a sample is processed or subjected to purification or extraction procedures before a marker of interest is measured. Internal standards are often a purified marker of interest which has been labeled, such as with a radioactive isotope, allowing it to be distinguished from an endogenous marker. A "subject" of analysis, diagnosis, or treatment is an animal. Such animals include mammals, preferably a human. The term "host" and "subject" are used interchangeably herein.

As used herein the term "patient" without further designation is intended to encompass any warm blooded vertebrate domesticated animal (including for example, but not limited to livestock, horses, cats, dogs and other pets) and humans.

A "prophylactic" treatment is a treatment administered to a subject, who either does not exhibit signs of a disease or exhibits only early signs of the disease, for the purpose of decreasing the risk of developing pathology associated with the disease.

The general chemical terms used in the description of the compounds of the present disclosure have their usual meanings. For example, the term "alkyl" by itself or as part of another substituent means a straight or branched aliphatic chain having the stated number of carbon atoms.

The term "Cl-Cn alkyl" wherein n can be from 1 through 6, as used herein, represents a branched or linear alkyl group having from one to the specified number of carbon atoms. Typical C1-C6 alkyl groups include, but are not limited to, methyl, ethyl, n- propyl, iso-propyl, butyl, iso-butyl, sec-butyl, tert-butyl, pentyl, hexyl and the like. The terms "C₂-C_n alkenyl" wherein n can be from 2 through 6, as used herein, represents an olefinically unsaturated branched or linear group having from 2 to the specified number of carbon atoms and at least one double bond. Examples of such groups include, but are not limited to, 1-propenyl, 2-propenyl (-CH₂-CH=CH₂), 1,3-butadienyl, (-CH=CHCH=CH₂), 1-butenyl (-CH=CHCH₂CH₃), hexenyl, pentenyl, and the like.

The term "C₂-C_n alkynyl" wherein n can be from 2 to 6, refers to an unsaturated branched or linear group having from 2 to n carbon atoms and at least one triple bond. Examples of such groups include, but are not limited to, 1-propynyl, 2- propynyl, 1-butynyl, 2-butynyl, 1-pentynyl, and the like. As used herein the term "aryl" refers to a mono- or bicyclic carbocyclic ring system having one or two aromatic rings including, but not limited to, phenyl, naphthyl, tetrahydronaphthyl, indanyl, indenyl, and the like. The size of the aryl ring and the presence of substituents or linking groups are indicated by designating the number of carbons present. For example, the term "(C₁-C₃ alkyl)(C₆-Ci₀ aryl)" refers to a 5 to 10 membered aryl that is attached to a parent moiety via a one to three membered alkyl chain. The term "heteroaryl" as used herein refers to a mono- or bi- cyclic ring system containing one or two aromatic rings and containing at least one nitrogen, oxygen, or sulfur atom in an aromatic ring. The size of the heteroaryl ring and the presence of substituents or linking groups are indicated by designating the number of carbons present. For example, the term "(Ci-C_n alkyl)(C₅-C₆ heteroaryl)" refers to a 5 or 6 membered heteroaryl that is attached to a parent moiety via a one to "n" membered alkyl chain.

The term "acyl" refers to alkylcarbonyl species and includes any group or radical of the form RCO- where R is an organic group. The term "acyl" further comprises an organic radical derived from an organic acid by removal of the hydroxyl group from the carboxyl group. The terms "acyl" and "OAc" are used interchangeably herein. The term "acylation" refers to the process of adding an acyl group to a compound.

The term butyryl as used herein is a carboxylic acid with the structural formula CH₃CH₂CH₂-COOH. The term "halo" includes bromo, chloro, fluoro, and iodo.

The term "haloalkyl" as used herein refers to a alkyl radical bearing at least one halogen substituent, for example, chloromethyl, fluoroethyl or trifluoromethyl and the like.

The term "C₃-Cn cycloalkyl" wherein n = 3-8, represents the compounds cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl.

The term "heterocyclic group" refers to a C₃-C₈ cycloalkyl group containing from one to three heteroatoms wherein the heteroatoms are selected from the group consisting of oxygen, sulfur, and nitrogen. The term "bi cyclic" represents either an unsaturated or saturated stable

7- to 12-membered bridged or fused bi cyclic carbon ring. The bicyclic ring may be attached at any carbon atom which affords a stable structure. The term includes, but is not limited to, naphthyl, dicyclohexyl, dicyclohexenyl, and the like.

The term "lower alkyl" as used herein refers to branched or straight chain alkyl groups comprising one to eight carbon atoms, including methyl, ethyl, propyl, isopropyl, n-butyl, t-butyl, neopentyl and the like.

The term "heteroatom" means for example oxygen, sulfur, nitrogen, phosphorus, or silicon (including, any oxidized form of nitrogen, sulfur, phosphorus, or silicon; the quaternized form of any basic nitrogen or; a substitutable nitrogen of a heterocyclic ring. The compounds of the present disclosure can contain one or more asymmetric centers in the molecule. In accordance with the present disclosure any structure that does not designate the stereochemistry is to be understood as embracing all the various optical isomers, as well as racemic mixtures thereof. The present disclosure includes within its scope all such isomers and mixtures thereof. The compounds of the present disclosure may exist in tautomeric forms and the present disclosure includes both mixtures and separate individual tautomers. For example, the following structure:

N NH is understood to represent a mixture of the structures:

EMBODIMENTS

As disclosed herein RSK has been found to play a role in the general inflammatory response associated with septicemia and other inflammatory based diseases and conditions. Accordingly, RSK respresents a novel target for new antiinflammatory agents that will limit the development of systemic inflammation. The data presented herein indicates that RSK inhibitors will be useful as anti- inflammatory agents comparable to non steroidal anti-inflammatory drugs and COX-2 inhibitors (aspirin, ibuprofen, acetaminophen, celebrex, vioxx). Accordingly, one aspect of the present disclosure is directed to a method of treating diseases associated with chronic inflammation, wherein the method comprises the step of administering a composition comprising a RSK inhibitor to a patient in need thereof. Thus, RSK inhibitors may be used to treat pathologies including but not limited to rheumatoid arthritis, inflammatory bowel syndrome, atherosclerosis, multiple sclerosis, asthma, and diabetes.

A systemic inflammatory response is also associated with the endothelium dysfunction that occurs with sepsis, and it is the dysfunction of the endothelium that results in tissue damage leading to multiple organ failure. In accordance with one embodiment of the present disclosure a method is provided for preventing or limiting endothelial cell dysfunction associated with sepsis. Accordingly, in one embodiment a method of inhibiting pathogenic stimulated expression of adhesion factors in endothelial cells is provided, wherein the method comprises contacting the cells with a RSK antagonist. In another embodiment a method of inhibiting pathogenic stimulated expression of nitric oxide synthase by macrophage is provided, wherein the method comprises contacting the cells with a RSK antagonist. Applicants have discovered that RSK activity is involved in the expression of adhesion factors by endothelial cells and stimulated expression of nitric oxide synthase by macrophages. Accordingly, contacting these cells by adminstering a pharmaceutical composition comprising a RSK inhibitor can be used to treat a patient suffering from, or at risk of developing, sepsis or septicemia. More particularly, in one embodiment inhibition of RSK activity is used to treat septicemia by modifying the pattern of inflammatory mediators released upon activation, and/or by attenuating the response of the endothelium to such inflammatory mediators.

As used herein, an antagonist or blocking agent may comprise, without limitation, an antibody, an antigen binding portion thereof or a biosynthetic antibody binding site that binds a particular target protein; an antisense molecule that hybridizes in vivo to a nucleic acid encoding a target protein or a regulatory element associated therewith, or a ribozyme, aptamer, or small molecule that binds to and/or inhibits a target protein, or that binds to and/or inhibits, reduces or otherwise modulates expression of nucleic acid encoding a target protein.

One aspect of the present disclosure encompasses the use of agents, which specifically inhibit RSK activity, as novel anti-inflamitory/anti-septicemia agents. The method comprises administering an anti-inflamitory pharmaceutical composition that comprises an inhibitor of RSK activity and a pharmaceutically acceptable carrier. In one embodiment, the present disclosure encompasses any drug, chemical compound, siRNA, antisense oligonucleotide, peptide, peptide mimetic, aptamer, antibody, or other material/agent that inhibits RSK function or activity or upstream regulators of RSK, or downstream signal pathways regulated by RSK. In one embodiment the RSK inhibitor is selected from antibodies, oligonucleotides, antisense oligonucleotides, small interfering RNAs, protein synthesis inhibitors, peptide mimetics, aptamers, and kinase inhibitors.

In one embodiment aptamers are used to inhibit RSK activity. As used herein the term aptamer refers to a compound that is selected in vitro to bind preferentially to another compound (in this case the identified RSK protein or other activator of RSK expression or activity). In one aspect, aptamers are nucleic acids or peptides, because random sequences can be readily generated from nucleotides or amino acids (both naturally occurring or synthetically made) in large numbers, but they need not be limited to these polymers. In another aspect, the nucleic acid aptamers are short strands of DNA that bind protein targets. In one aspect, the aptamers are oligonucleotide aptamers. Oligonucleotide aptamers are oligonucleotides which can bind to a specific protein sequence of interest. A general method of identifying aptamers is to start with partially degenerate oligonucleotides, and then simultaneously screen the many thousands of oligonucleotides for the ability to bind to a desired protein. The bound oligonucleotide can be eluted from the protein and sequenced to identify the specific recognition sequence. Transfer of large amounts of a chemically stabilized aptamer into cells can result in specific binding to a polypeptide of interest, thereby blocking its function. [For example, see the following publications describing in vitro selection of aptamers: Klug et al., MoI. Biol. Reports 20:97-107 (1994); Wallis et al., Chem. Biol. 2:543-552 (1995); Ellington, Curr. Biol. 4:427-429 (1994); Lato et al., Chem. Biol. 2:291-303 (1995); Conrad et al., MoI. Div. 1 :69-78 (1995); and Uphoff et al., Curr. Opin. Struct. Biol.

6:281-287 (1996)].

Aptamers offer advantages over other oligonucleotide-based approaches that artificially interfere with target gene function due to their ability to bind protein products of these genes with high affinity and specificity. However,

RNA aptamers can be limited in their ability to target intracellular proteins since even nuclease-resistant aptamers do not efficiently enter the intracellular compartments.

Moreover, attempts at expressing RNA aptamers within mammalian cells through vector-based approaches have been hampered by the presence of additional flanking sequences in expressed RNA aptamers, which may alter their functional conformation.

The idea of using single- stranded nucleic acids (DNA and RNA aptamers) to target protein molecules is based on the ability of short sequences (20 mers to 80 mers) to fold into unique 3D conformations that enable them to bind targeted proteins with high affinity and specificity. RNA aptamers have been expressed successfully inside eukaryotic cells, such as yeast and multicellular organisms, and have been shown to have inhibitory effects on their targeted proteins in the cellular environment.

The present application also encompasses the use of siRNA for blocking the pathways and proteins identified herein. An siRNA of the present disclosure can be further used with other regulators described herein, or known in the art, such as peptides, antisense oligonucleotides, nucleic acids encoding peptides described herein, aptamers, antibodies, kinase inhibitors, and drugs/agents/compounds. In one embodiment, an siRNA directed against proteins of the signal transduction pathways described herein, m one aspect, the siRNA is directed against RSK. hi one aspect, the siRNA is directed against RSKl . In another aspect, the siRNA is directed against RSK2.

In accordance with one embodiment the RSK inhibitor is a kaempferol like compound such as SLOlOl, or a closely related compound. Kaempferol has the structure:

Kaempferol while SLOlOl has the structure:

wherein R₉ is OH and R₁₀ and R₁₁ are each OAc.

In one embodiment, RSK inhibitor compounds representing derivatives of formula I are provided, wherein R^ R_1O and Rj₁ are independently selected from OH, OAc and butyryl as well as further modifications of such compounds wherein the modifications do not adversely affect the desired activity described herein.

For example, additional compounds are encompassed by the present disclosure wherein the compounds have been modified to include greater stability of interactions between the compound and RSK and thus provide compounds having a greater efficacy than SLO 101. In one aspect, this is accomplished by replacing the hydroxyl groups of the compound of Formula I with sulfhydryls. In another aspect, this is accomplished by replacing the hydroxyl groups of the sugar moiety of the compound of Formula I with acetamide, or derivatives of acetamide. To that end, the present disclosure further provides a compound having the structure of formula II:

wherein R₁, R_2> R₃, R₄, R₅, R₆₁ and R₇ are independently selected from the group consisting of OH, -OCOR₈, -COR₈, -SR₈₁ and Cj-C₄ alkoxy;

R₈ is H or C₁-C₄ alkyl; and

R₉, R₁₀ and Rn are independently selected from the group consisting of H, OH,

OCOR₈, COR₈, NHOCOR₈, NHOCR₈ and Ci-C₄ alkoxy.

The compounds of formula II may also include acyl and butyryl groups as described for the compounds of formula I.

The compounds comprised by formula II encompass replacing the hydroxyl groups of the flavonoid with sulfhydryls (-SH).

The compounds comprised by formula II further encompass replacing the hydroxyl groups on the sugar with an acetamide (NHOCR₈), including for example:

In another embodiment the RSK inhibitor is a flavonoid-like compound having the structure of formula II:

wherein Ri, R_2; and R₅ are independently selected from the group consisting of OH, OCOR₈, COR_8, SR_8, and C_rC₄ alkoxy;

R₃, R₄, R₆, R₇ are independently selected from the group consisting of H, OH, OCOR₈, COR₈, SR₈, and C₁-C₄ alkoxy; R₈ is H or C₁-C₄ alkyl; and

R₉, Rio and Rj ₁ are independently selected from the group consisting of H, OH,

OCOR₈, COR₈, NHOCOR₈ and Ci-C₄ alkoxy, with the proviso that when Ri, R₂, and R₅ are each OH, one of R₉, R₁₀ and Rn are not OH. In accordance with one embodiment at least one of Ri, R_2, and R₅ is SR₈, or alternatively, at least one of R₉, Rio and Rn is NHOCOR₈. In accordance with one embodiment, Ri and R₂ are both OH. In a further embodiment a compound of Formula II is provided wherein Ri and R₂ are both OH, R₉, R₁₀ and Rn are independently selected from the group consisting of H, OH and OCOR₈, R₃ and R₇ are each H, and R₄, R₅, and R₆ are independently selected from the group consisting of H, OR₈, OCOR₈, and COR₈, wherein R₈ is H or methyl, with the proviso that R₉, R₁₀ and R₁₁ are not each OH. In one embodiment Ri, R₂ and R₅ are OH, R₉ and R₁₀ are independently selected from the group consisting of OH, COR₈, C₁-C₄ alkoxy and OCOCH₃, R₁₁ is OCOCH₃, R₈ is H or methyl, R₃, R₄ and R₇ are each H and R₆ is H or OH. In an alternative embodiment R₁, R₂ and R₅ are each OH, Rg and R_1O are independently selected from the group consisting of OH and OCOCH₃, R₁₁ is OCOCH₃, R₃, R₄ and R₇ are each H and R₆ is H or hydroxy. In an alternative embodiment a compound is provided having the general structure of Formula II as disclosed above, but having one or more sulfhydryls (-SH) groups substituting at positions on the flavonoid ring that designate a hydroxyl group (i.e., at positions Ri, R_2j R₃, R₄, R₅, R₆ and R₇ ). hi one embodiment a compound is provided having the general structure of Formula II as disclosed above, wherein one or more sulfhydryls (-SH) groups are present at positions selected from the group consisting of Ri, R₂ and R₅. In a further alternative embodiment a compound is provided having the general structure of Formula II as disclosed above, but having one or more acetamide (NHOCCH₃) groups substituting at positions on the sugar moiety that designate a hydroxyl group (i.e., at positions R₉, Ri₀ and Rn). In one embodiment the acetamide can be a substituted acetamide comprising NHOCORs. In one aspect, the compounds encompassed by formula II have greater stability in their interaction with RSK than does SLOlOl in its interaction with RSK. In another aspect, the compounds of formula II have a greater ability to inhibit RSK than does SLOlOl. In one embodiment the present disclosure is directed to a compound represented by the general structure:

III

wherein R₆ is H or OH, and Rg, R₁₀ and R₁₁ are independently selected from the group consisting of hydroxy OCOR₈, COR₈, C₁-C₄ alkoxy, and R₈ is H or CH₃, with the proviso that R₉, R₁₀ and Rn are not all hydroxy. In one embodiment R₆ is H or OH and R₉ and R₁₀ are independently selected from the group consisting of hydroxy and OCOCH₃ and R₁₁ is OCOCH₃.

In cases where compounds are sufficiently basic or acidic to form acid or base salts, use of the compounds as salts may be appropriate. Examples of acceptable salts are organic acid addition salts formed with acids which form a physiological acceptable anion, for example, tosylate, methanesulfonate, acetate, citrate, malonate, tartarate, succinate, benzoate, ascorbate, α-ketoglutarate, and a- glycerophosphate. Suitable inorganic salts may also be formed, including hydrochloride, sulfate, nitrate, bicarbonate, and carbonate salts.

Pharmaceutically acceptable salts may be obtained using standard procedures well known in the art, for example by reacting a sufficiently basic compound such as an amine with a suitable acid affording a physiologically acceptable anion. Alkali metal (for example, sodium, potassium or lithium) or alkaline earth metal (for example calcium) salts of carboxylic acids can also be made.

In accordance with one embodiment method of inhibiting pathogenic stimulated expression of nitric oxide synthase by macrophages, and/or inhibiting pathogenic stimulated expression of adhesion factors in endothelial cells is provided. The method comprises contacting the respective cells with a composition comprising a RSK activity inhibiting agent. The RSK specific inhibitors used in accordance with the disclosed composition and methods can be selected from any inhibiting moiety including but not limited to anti-sense oligonucleotides, interfering oligonucleotide and kaempferol 3-O-(3",4"-di-O-acetyl-α-L-rhamnopyranoside) and related compounds. In one embodiment the RSK inhibitor is a compound comprising the structure of Formula II:

wherein R), R_2> and R₅ are independently selected from the group consisting of OH, OCOR₈, COR₈, SR₈, and C₁-C₄ alkoxy;

R₃, R₄, R₆, R₇ are independently selected from the group consisting of H, OH, OCOR₈, COR_8, SR_8, and C₁-C₄ alkoxy;

R₈ is H or Ci-C₄ alkyl; and

R₉, Rio and Rn are independently selected from the group consisting of H, OH,

OCOR₈, COR₈, NHOCOR₈ and C_rC₄ alkoxy, with the proviso that R₉, Rio and Ri 1 are not all OH when Ri, R₂, and R₅ are OH. In one embodiment the Rsk inhibitor is SlOlOl . the composition comprising the RSK inhibitor may further comprise additional active agents including other know anti-inflammatory agents or antimicrobial agents, including for exmple antibiotics.

In accordancew with tone embodiment the RSK inhibitory compositions disclosed herein are used to treat diseases associated with chronic inflammation such as rheumatoid arthritis, inflammatory bowel syndrome, atherosclerosis, multiple sclerosis, asthma, and diabetes. In accordance with one embodiment the RSK inhibitory compositions are used to treat sepsis and more particularly septicemia. In addition to the specific inhibiting compounds disclosed herein, additional compounds and methodologies, that are known in the art but not specifically disclosed herein, can be used to inhibit the targeted pathways and enzymatic activities. For example, various modulators/effectors are known, e.g. antibodies, biologically active nucleic acids, ribozymes or low-molecular weight organic compounds that recognize specific polynucleotides or polypeptides. Antibodies directed against proteins, polypeptides, or peptide fragments thereof of the present disclosure may be generated using methods that are well known in the art. For instance, U.S. patent application no. 07/481,491, which is incorporated by reference herein in its entirety, discloses methods of raising antibodies to peptides. For the production of antibodies, various host animals, including but not limited to rabbits, mice, and rats, can be immunized by injection with a polypeptide or peptide fragment thereof. To increase the immunological response, various adjuvants may be used depending on the host species, including but not limited to Freund's (complete and incomplete), mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanins, dinitrophenol, and potentially useful human adjuvants such as BCG (bacille Calmette-Guerin) and corynebacterium parvum.

For the preparation of monoclonal antibodies, any technique which provides for the production of antibody molecules by continuous cell lines in culture may be utilized. For example, the hybridoma technique originally developed by

Kohler and Milstein (1975, Nature 256:495-497), the trioma technique, the human B- cell hybridoma technique (Kozbor et al, 1983, Immunology Today 4:72), and the EBV-hybridoma technique (Cole et al, 1985, in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96) may be employed to produce human monoclonal antibodies. In another embodiment, monoclonal antibodies are produced in germ-free animals utilizing the technology described in international application no. PCT/US90/02545, which is incorporated by reference herein in its entirety.

In accordance with the present disclosure, human antibodies may be used and obtained by utilizing human hybridomas (Cote et al, 1983, Proc. Natl. Acad. ScL U.S.A. 80:2026-2030) or by transforming human B cells with EBV virus in vitro (Cole et al, 1985, in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96). Furthermore, techniques developed for the production of "chimeric antibodies" (Morrison et al, 1984, Proc. Natl. Acad. ScL U.S.A. 81:6851-6855; Neuberger et al, 1984, Nature 312:604-608; Takeda et al, 1985, Nature 314:452- 454) by splicing the genes from a mouse antibody molecule specific for epitopes of SLLP polypeptides together with genes from a human antibody molecule of appropriate biological activity can be employed; such antibodies are within the scope of the present disclosure. Once specific monoclonal antibodies have been developed, the preparation of mutants and variants thereof by conventional techniques is also available.

In one embodiment, techniques described for the production of single- chain antibodies (U.S. Patent No. 4,946,778, incorporated by reference herein in its entirety) are adapted to produce protein-specific single-chain antibodies. In another embodiment, the techniques described for the construction of Fab expression libraries (Huse et al, 1989, Science 246:1275-1281) are utilized to allow rapid and easy identification of monoclonal Fab fragments possessing the desired specificity for specific antigens, proteins, derivatives, or analogs of the present disclosure.

Antibody fragments which contain the idiotype of the antibody molecule can be generated by known techniques. For example, such fragments include but are not limited to: the F(ab')₂ fragment which can be produced by pepsin digestion of the antibody molecule; the Fab' fragments which can be generated by reducing the disulfide bridges of the F(ab')₂ fragment; the Fab fragments which can be generated by treating the antibody molecule with papain and a reducing agent; and Fv fragments.

The generation of polyclonal antibodies is accomplished by inoculating the desired animal with the antigen and isolating antibodies which specifically bind the antigen therefrom.

Monoclonal antibodies directed against full length or peptide fragments of a protein or peptide may be prepared using any well known monoclonal antibody preparation procedures, such as those described, for example, in Harlow et al. (1988, In: Antibodies, A Laboratory Manual, Cold Spring Harbor, NY) and in Tuszynski et al. (1988, Blood, 72:109-115). Quantities of the desired peptide may also be synthesized using chemical synthesis technology. Alternatively, DNA encoding the desired peptide may be cloned and expressed from an appropriate promoter sequence in cells suitable for the generation of large quantities of peptide. Monoclonal antibodies directed against the peptide are generated from mice immunized with the peptide using standard procedures as referenced herein.

A nucleic acid encoding the monoclonal antibody obtained using the procedures described herein may be cloned and sequenced using technology which is available in the art, and is described, for example, in Wright et al. (1992, Critical Rev. in Immunol. 12(3 ,4) : 125- 168) and the references cited therein. Further, the antibody of the present disclosure may be "humanized" using the technology described in Wright et al., (supra) and in the references cited therein, and in Gu et al. (1997, Thrombosis and Hematocyst 77(4):755-759).

To generate a phage antibody library, a cDNA library is first obtained from mRNA which is isolated from cells, e.g., the hybridoma, which express the desired protein to be expressed on the phage surface, e.g., the desired antibody. cDNA copies of the mRNA are produced using reverse transcriptase. cDNA which specifies immunoglobulin fragments are obtained by PCR and the resulting DNA is cloned into a suitable bacteriophage vector to generate a bacteriophage DNA library comprising DNA specifying immunoglobulin genes. The procedures for making a bacteriophage library comprising heterologous DNA are well known in the art and are described, for example, in Sambrook et al. (1989, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, NY).

Bacteriophage which encode the desired antibody, may be engineered such that the protein is displayed on the surface thereof in such a manner that it is available for binding to its corresponding binding protein, e.g., the antigen against which the antibody is directed. Thus, when bacteriophage which express a specific antibody are incubated in the presence of a cell which expresses the corresponding antigen, the bacteriophage will bind to the cell. Bacteriophage which do not express the antibody will not bind to the cell. Such panning techniques are well known in the art.

Processes such as those described above, have been developed for the production of human antibodies using Ml 3 bacteriophage display (Burton et al., 1994, Adv. Immunol. 57:191-280). Essentially, a cDNA library is generated from mRNA obtained from a population of antibody-producing cells. The mRNA encodes rearranged immunoglobulin genes and thus, the cDNA encodes the same. Amplified cDNA is cloned into M 13 expression vectors creating a library of phage which express human Fab fragments on their surface. Phage which display the antibody of interest are selected by antigen binding and are propagated in bacteria to produce soluble human Fab immunoglobulin. Thus, in contrast to conventional monoclonal antibody synthesis, this procedure immortalizes DNA encoding human immunoglobulin rather than cells which express human immunoglobulin.

The procedures just presented describe the generation of phage which encode the Fab portion of an antibody molecule. However, the present disclosure should not be construed to be limited solely to the generation of phage encoding Fab antibodies. Rather, phage which encode single chain antibodies (scFv/phage antibody libraries) are also included in the present disclosure. Fab molecules comprise the entire Ig light chain, that is, they comprise both the variable and constant region of the light chain, but include only the variable region and first constant region domain (CHl) of the heavy chain. Single chain antibody molecules comprise a single chain of protein comprising the Ig Fv fragment. An Ig Fv fragment includes only the variable regions of the heavy and light chains of the antibody, having no constant region contained therein. Phage libraries comprising scFv DNA may be generated following the procedures described in Marks et al., 1991, J. MoI. Biol. 222:581-597. Panning of phage so generated for the isolation of a desired antibody is conducted in a manner similar to that described for phage libraries comprising Fab DNA.

The present disclosure should also be construed to include synthetic phage display libraries in which the heavy and light chain variable regions may be synthesized such that they include nearly all possible specificities (Barbas, 1995, Nature Medicine 1 :837-839; de Kruif et al. 1995, J. MoL Biol.248:97-105).

In the production of antibodies, screening for the desired antibody can be accomplished by techniques known in the art, e.g., ELISA (enzyme-linked immunosorbent assay). Antibodies generated in accordance with the present disclosure may include, but are not limited to, polyclonal, monoclonal, chimeric (i.e., "humanized"), and single chain (recombinant) antibodies, Fab fragments, and fragments produced by a Fab expression library. The peptides of the present disclosure may be readily prepared by standard, well-established techniques, such as solid-phase peptide synthesis (SPPS) as described by Stewart et al. in Solid Phase Peptide Synthesis, 2nd Edition, 1984, Pierce Chemical Company, Rockford, Illinois; and as described by Bodanszky and Bodanszky in The Practice of Peptide Synthesis, 1984, Springer- Verlag, New York. At the outset, a suitably protected amino acid residue is attached through its carboxyl group to a derivatized, insoluble polymeric support, such as cross-linked polystyrene or polyamide resin. "Suitably protected" refers to the presence of protecting groups on both the α-amino group of the amino acid, and on any side chain functional groups. Side chain protecting groups are generally stable to the solvents, reagents and reaction conditions used throughout the synthesis, and are removable under conditions which will not affect the final peptide product. Stepwise synthesis of the oligopeptide is carried out by the removal of the N-protecting group from the initial amino acid, and couple thereto of the carboxyl end of the next amino acid in the sequence of the desired peptide. This amino acid is also suitably protected. The carboxyl of the incoming amino acid can be activated to react with the N-terminus of the support- bound amino acid by formation into a reactive group such as formation into a carbodiimide, a symmetric acid anhydride or an "active ester" group such as hydroxybenzotriazole or pentafluorophenly esters. Examples of solid phase peptide synthesis methods include the BOC method which utilized tert-butyloxcarbonyl as the α-amino protecting group, and the FMOC method which utilizes 9-fluorenylmethyloxcarbonyl to protect the α-amino of the amino acid residues, both methods of which are well known by those of skill in the art. Incorporation of N- and/or C- blocking groups can also be achieved using protocols conventional to solid phase peptide synthesis methods. For incorporation of C-terminal blocking groups, for example, synthesis of the desired peptide is typically performed using, as solid phase, a supporting resin that has been chemically modified so that cleavage from the resin results in a peptide having the desired C-terminal blocking group. To provide peptides in which the C-terminus bears a primary amino blocking group, for instance, synthesis is performed using a p- methylbenzhydrylamine (MBHA) resin so that, when peptide synthesis is completed, treatment with hydrofluoric acid releases the desired C-terminally amidated peptide. Similarly, incorporation of an N-methylamine blocking group at the C-terminus is achieved using N-methylaminoethyl-derivatized DVB, resin, which upon HF treatment releases a peptide bearing an N-methylamidated C-terminus. Blockage of the C-terminus by esterification can also be achieved using conventional procedures. This entails use of resin/blocking group combination that permits release of side-chain peptide from the resin, to allow for subsequent reaction with the desired alcohol, to form the ester function. FMOC protecting group, in combination with DVB resin derivatized with methoxyalkoxybenzyl alcohol or equivalent linker, can be used for this purpose, with cleavage from the support being effected by TFA in dicholoromethane. Esterification of the suitably activated carboxyl function e.g. with DCC, can then proceed by addition of the desired alcohol, followed by deprotection and isolation of the esterified peptide product.

Incorporation of N-terminal blocking groups can be achieved while the synthesized peptide is still attached to the resin, for instance by treatment with a suitable anhydride and nitrile. To incorporate an acetyl-blocking group at the N- terminus, for instance, the resin-coupled peptide can be treated with 20% acetic anhydride in acetonitrile. The N-blocked peptide product can then be cleaved from the resin, deprotected and subsequently isolated. To ensure that the peptide obtained from either chemical or biological synthetic techniques is the desired peptide, analysis of the peptide composition should be conducted. Such amino acid composition analysis may be conducted using high- resolution mass spectrometry to determine the molecular weight of the peptide. Alternatively, or additionally, the amino acid content of the peptide can be confirmed by hydrolyzing the peptide in aqueous acid, and separating, identifying and quantifying the components of the mixture using HPLC, or an amino acid analyzer. Protein sequenators, which sequentially degrade the peptide and identify the amino acids in order, may also be used to determine definitely the sequence of the peptide. Prior to its use, the peptide is purified to remove contaminants. In this regard, it will be appreciated that the peptide will be purified so as to meet the standards set out by the appropriate regulatory agencies. Any one of a number of a conventional purification procedures may be used to attain the required level of purity including, for example, reversed-phase high-pressure liquid chromatography (HPLC) using an alkylated silica column such as C4 -, C8- or Cl 8- silica. A gradient mobile phase of increasing organic content is generally used to achieve purification, for example, acetonitrile in an aqueous buffer, usually containing a small amount of trifluoroacetic acid. Ion-exchange chromatography can be also used to separate peptides based on their charge.

It will be appreciated, of course, that the peptides or antibodies, derivatives, or fragments thereof may incorporate amino acid residues which are modified without affecting activity. For example, the termini may be derivatized to include blocking groups, i.e. chemical substituents suitable to protect and/or stabilize the N- and C-termini from "undesirable degradation", a term meant to encompass any type of enzymatic, chemical or biochemical breakdown of the compound at its termini which is likely to affect the function of the compound, i.e. sequential degradation of the compound at a terminal end thereof. Blocking groups include protecting groups conventionally used in the art of peptide chemistry which will not adversely affect the in vivo activities of the peptide. For example, suitable N-terminal blocking groups can be introduced by alkylation or acylation of the N-terminus. Examples of suitable N-terminal blocking groups include Ci-C₅ branched or unbranched alkyl groups, acyl groups such as formyl and acetyl groups, as well as substituted forms thereof, such as the acetamidomethyl (Acm) group. Desamino analogs of amino acids are also useful N- terminal blocking groups, and can either be coupled to the N-terminus of the peptide or used in place of the N-terminal reside. Suitable C-terminal blocking groups, in which the carboxyl group of the C-terminus is either incorporated or not, include esters, ketones or amides. Ester or ketone-forming alkyl groups, particularly lower alkyl groups such as methyl, ethyl and propyl, and amide-forming amino groups such as primary amines (-NH₂), and mono- and di-alkylamino groups such as methylamino, ethylamino, dimethylamino, diethylamino, methylethylamino and the like are examples of C-terminal blocking groups. Descarboxylated amino acid analogues such as agmatine are also useful C-terminal blocking groups and can be either coupled to the peptide's C-terminal residue or used in place of it. Further, it will be appreciated that the free amino and carboxyl groups at the termini can be removed altogether from the peptide to yield desamino and descarboxylated forms thereof without affect on peptide activity.

Other modifications can also be incorporated without adversely affecting the activity and these include, but are not limited to, substitution of one or more of the amino acids in the natural L-isomeric form with amino acids in the D- isomeric form. Thus, the peptide may include one or more D-amino acid resides, or may comprise amino acids which are all in the D-form. Retro-inverso forms of peptides in accordance with the present disclosure are also contemplated, for example, inverted peptides in which all amino acids are substituted with D-amino acid forms. Acid addition salts of the present disclosure are also contemplated as functional equivalents. Thus, a peptide in accordance with the present disclosure treated with an inorganic acid such as hydrochloric, hydrobromic, sulfuric, nitric, phosphoric, and the like, or an organic acid such as an acetic, propionic, glycolic, pyruvic, oxalic, malic, malonic, succinic, maleic, fumaric, tataric, citric, benzoic, cinnamie, mandelic, methanesulfonic, ethanesulfonic, p-toluenesulfonic, salicyclic and the like, to provide a water soluble salt of the peptide is suitable for use in the present disclosure.

The present disclosure also provides for homologs of proteins and peptides. Homologs can differ from naturally occurring proteins or peptides by conservative amino acid sequence differences or by modifications which do not affect sequence, or by both.

For example, conservative amino acid changes may be made, which although they alter the primary sequence of the protein or peptide, do not normally alter its function. To that end, 10 or more conservative amino acid changes typically have no effect on peptide function.

Modifications (which do not normally alter primary sequence) include in vivo, or in vitro chemical derivatization of polypeptides, e.g., acetylation, or carboxylation. Also included are modifications of glycosylation, e.g., those made by modifying the glycosylation patterns of a polypeptide during its synthesis and processing or in further processing steps; e.g., by exposing the polypeptide to enzymes which affect glycosylation, e.g., mammalian glycosylating or deglycosylating enzymes. Also embraced are sequences which have phosphorylated amino acid residues, e.g., phosphotyrosine, phosphoserine, or phosphothreonine.

Also included are polypeptides or antibody fragments which have been modified using ordinary molecular biological techniques so as to improve their resistance to proteolytic degradation or to optimize solubility properties or to render them more suitable as a therapeutic agent. Homologs of such polypeptides include those containing residues other than naturally occurring L-amino acids, e.g., D-amino acids or non-naturally occurring synthetic amino acids. The peptides of the present disclosure are not limited to products of any of the specific exemplary processes listed herein.

Substantially pure protein obtained as described herein may be purified by following known procedures for protein purification, wherein an immunological, enzymatic or other assay is used to monitor purification at each stage in the procedure. Protein purification methods are well known in the art, and are described, for example in Deutscher et al. (ed., 1990, Guide to Protein Purification, Harcourt Brace Jovanovich, San Diego).

The present disclosure also provides nucleic acids encoding peptides, proteins, and antibodies of the present disclosure. By "nucleic acid" is meant any nucleic acid, whether composed of deoxyribonucleosides or ribonucleosides, and whether composed of phosphodiester linkages or modified linkages such as phosphotriester, phosphoramidate, siloxane, carbonate, carboxymethylester, acetamidate, carbamate, thioether, bridged phosphoramidate, bridged methylene phosphonate, bridged phosphoramidate, bridged phosphoramidate, bridged methylene phosphonate, phosphorothioate, methylphosphonate, phosphorodithioate, bridged phosphorothioate or sulfone linkages, and combinations of such linkages. The term nucleic acid also specifically includes nucleic acids composed of bases other than the five biologically occurring bases (adenine, guanine, thymine, cytosine and uracil).

It is not intended that the present disclosure be limited by the nature of the nucleic acid employed. The target nucleic acid may be native or synthesized nucleic acid. The nucleic acid may be from a viral, bacterial, animal or plant source. The nucleic acid may be DNA or RNA and may exist in a double-stranded, single- stranded or partially double-stranded form. Furthermore, the nucleic acid may be found as part of a virus or other macromolecule. See, e.g., Fasbender et al., 1996, J. Biol. Chem. 272:6479-89 (polylysine condensation of DNA in the form of adenovirus).

Nucleic acids useful in the present disclosure include, by way of example and not limitation, oligonucleotides and polynucleotides such as antisense DNAs and/or RNAs; ribozymes; DNA for gene therapy; viral fragments including viral DNA and/or RNA; DNA and/or RNA chimeras; mRNA; plasmids; cosmids; genomic DNA; cDNA; gene fragments; various structural forms of DNA including single-stranded DNA, double-stranded DNA, supercoiled DNA and/or triple-helical DNA; Z-DNA; and the like. The nucleic acids may be prepared by any conventional means typically used to prepare nucleic acids in large quantity. For example, DNAs and RNAs may be chemically synthesized using commercially available reagents and synthesizers by methods that are well-known in the art (see, e.g., Gait, 1985, OLIGONUCLEOTIDE SYNTHESIS: A PRACTICAL APPROACH (IRL Press, Oxford, England)). RNAs may be produce in high yield via in vitro transcription using plasmids such as SP65 (Promega Corporation, Madison, WI).

In some circumstances, as where increased nuclease stability is desired, nucleic acids having modified internucleoside linkages may be preferred. Nucleic acids containing modified internucleoside linkages may also be synthesized using reagents and methods that are well known in the art. For example, methods for synthesizing nucleic acids containing phosphonate phosphorothioate, phosphorodithioate, phosphoramidate methoxyethyl phosphoramidate, formacetal, thioformacetal, diisopropylsilyl, acetamidate, carbamate, dimethylene-sulfide (-CH₂- S-CH₂), diinethylene-sulfoxide (-CH2-SO-CH2), dimethylene-sulfone (-CH2-SO2- CH2), 2'-O-alkyl, and 2'-deoxy2'-fluoro phosphorothioate internucleoside linkages are well known in the art (see Uhlmann et al., 1990, Chem. Rev. 90:543-584; Schneider et al., 1990, Tetrahedron Lett. 31 :335 and references cited therein).

The nucleic acids may be purified by any suitable means, as are well known in the art. For example, the nucleic: acids can be purified by reverse phase or ion exchange HPLC, size exclusion chromatography or gel electrophoresis. Of course, the skilled artisan will recognize that the method of purification will depend in part on the size of the DNA to be purified. The term nucleic acid also specifically includes nucleic acids composed of bases other than the five biologically occurring bases (adenine, guanine, thymine, cytosine and uracil).

The present disclosure is also directed to methods of administering the compounds of the present disclosure to a subject. Accordingly, the RSK inhibitory compounds can be formulated into pharmaceutical compositions by combining them with an appropriate pharmaceutically acceptable carrier using standard techniques known to those skilled in the art. The compositions may further comprise additional anti-microbial and antibacterial components or other anit-inflammatory agents known to those skilled in the art. Anti-microbial agents suitable for use in accordance with the present disclosure are known to those skilled in the art and include antibiotics, both natural and synthetic derivatives as well as other compounds known to have antimicrobial activity (see for example US Patent no: 7,358,359, the disclosure of which is incorporated herein by reference). In accordance with one embodiment a pharmaceutically acceptable anti-microbial agent is combined with a RSK inhibitor to treat a patient at risk of sepsis or currently afflicted with sepsis. The combination therapy can be administered simultaneously by administering a single composition comprising a known anti-microbial agent and a RSK inhibitor or the anti-microbial agent can be administered prior to or after the administration of the RSK inhibitor. Typically the antimicrobial agent is administered within 8 hours before or after the administration of the RSK inhibitor and in one embodiment the two agents are each administered within 4 hours, 2 hours or 1 hour of each other.

Pharmaceutical compositions comprising the present compounds are administered to an individual in need thereof by any number of routes including, but not limited to, topical, oral, intravenous, intramuscular, intra-arterial, intramedullary, intrathecal, intraventricular, transdermal, subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual, or rectal means.

In cases where compounds are sufficiently basic or acidic to form acid or base salts, use of the compounds as salts may be appropriate. Examples of acceptable salts are organic acid addition salts formed with acids which form a physiological acceptable anion, for example, tosylate, methanesulfonate, acetate, citrate, malonate, tartarate, succinate, benzoate, ascorbate, α-ketoglutarate, and a- glycerophosphate. Suitable inorganic salts may also be formed, including hydrochloride, sulfate, nitrate, bicarbonate, and carbonate salts.

Acceptable salts may be obtained using standard procedures well known in the art, for example by reacting a sufficiently basic compound such as an amine with a suitable acid affording a physiologically acceptable anion. Alkali metal (for example, sodium, potassium or lithium) or alkaline earth metal (for example calcium) salts of carboxylic acids can also be made.

Processes for preparing compounds of Formula I and Formula II are provided as further embodiments of the present disclosure and are illustrated by the following procedures in which the meanings of the generic radicals are as given above unless otherwise qualified.

The compounds of formula I and formula II can be formulated as pharmaceutical compositions and administered to a mammalian host such as a human patient in a variety of forms adapted to the chosen route of administration, i.e., orally or parenterally, by intravenous, intramuscular, topical or subcutaneous routes.

Thus, the present compounds may be systemically administered, e.g., orally, in combination with a pharmaceutically acceptable vehicle such as an inert diluent or an assimilable edible carrier. They may be enclosed in hard or soft shell gelatin capsules, may be compressed into tablets, or may be incorporated directly with the food of the patient's diet. For oral therapeutic administration, the active compound may be combined with one or more excipients and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, and the like. Such compositions and preparations should contain at least 0.1% of active compound. The percentage of the compositions and preparations may, of course, be varied and may conveniently be between about 2 to about 60% of the weight of a given unit dosage form. The amount of active compound in such therapeutically useful compositions is such that an effective dosage level will be obtained.

The tablets, troches, pills, capsules, and the like may also contain the following: binders such as gum tragacanth, acacia, corn starch or gelatin; excipients such as dicalcium phosphate; a disintegrating agent such as corn starch, potato starch, alginic acid and the like; a lubricant such as magnesium stearate; and a sweetening agent such as sucrose, fructose, lactose or aspartame or a flavoring agent such as peppermint, oil of wintergreen, or cherry flavoring may be added. When the unit dosage form is a capsule, it may contain, in addition to materials of the above type, a liquid carrier, such as a vegetable oil or a polyethylene glycol. Various other materials may be present as coatings or to otherwise modify the physical form of the solid unit dosage form. For instance, tablets, pills, or capsules may be coated with gelatin, wax, shellac or sugar and the like. A syrup or elixir may contain the active compound, sucrose or fructose as a sweetening agent, methyl and propylparabens as preservatives, a dye and flavoring such as cherry or orange flavor. Of course, any material used in preparing any unit dosage form should be pharmaceutically acceptable and substantially non-toxic in the amounts employed. In addition, the active compound may be incorporated into sustained-release preparations and devices.

The active compound may also be administered intravenously or intraperitoneally by infusion or injection. Solutions of the active compound or its salts can be prepared in water, optionally mixed with a nontoxic surfactant.

Dispersions can also be prepared in glycerol, liquid polyethylene glycols, triacetin, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.

The pharmaceutical dosage forms suitable for injection or infusion can include sterile aqueous solutions or dispersions or sterile powders comprising the active ingredient which are adapted for the extemporaneous preparation of sterile injectable or infusible solutions or dispersions, optionally encapsulated in liposomes. In all cases, the ultimate dosage form should be sterile, fluid and stable under the conditions of manufacture and storage. The liquid carrier or vehicle can be a solvent or liquid dispersion medium comprising, for example, water, ethanol, a polyol (for example, glycerol, propylene glycol, liquid polyethylene glycols, and the like), vegetable oils, nontoxic glyceryl esters, and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the formation of liposomes, by the maintenance of the required particle size in the case of dispersions or by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, buffers or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin. Sterile injectable solutions are prepared by incorporating the active compound in the required amount in the appropriate solvent with the various other ingredients enumerated above, as required, followed by filter sterilization. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and the freeze drying techniques, which yield a powder of the active ingredient plus any additional desired ingredient present in the previously sterile-filtered solutions.

For topical administration, the present compounds may be applied in pure form, i.e., when they are liquids. However, it will generally be desirable to administer them to the skin as compositions or formulations, in combination with a dermatologically acceptable carrier, which may be a solid or a liquid.

Useful solid carriers include finely divided solids such as talc, clay, microcrystalline cellulose, silica, alumina and the like. Useful liquid carriers include water, alcohols or glycols or water-alcohol/glycol blends, in which the present compounds can be dissolved or dispersed at effective levels, optionally with the aid of non-toxic surfactants. Adjuvants such as fragrances and additional antimicrobial agents can be added to optimize the properties for a given use. The resultant liquid compositions can be applied from absorbent pads, used to impregnate bandages and other dressings, or sprayed onto the affected area using pump-type or aerosol sprayers. Thickeners such as synthetic polymers, fatty acids, fatty acid salts and esters, fatty alcohols, modified celluloses or modified mineral materials can also be employed with liquid carriers to form spreadable pastes, gels, ointments, soaps, and the like, for application directly to the skin of the user.

Examples of useful dermatological compositions which can be used to deliver the compounds of formula I to the skin are known to the art; for example, see Jacquet et al. (U.S. Pat. No. 4,608,392), Geria (U.S. Pat. No. 4,992,478), Smith et al. (U.S. Pat. No. 4,559,157) and Wortzman (U.S. Pat. No. 4,820,508). Useful dosages of the compounds of formulas I and II can be determined by comparing their in vitro activity, and in vivo activity in animal models. Methods for the extrapolation of effective dosages in mice, and other animals, to humans are known to the art; for example, see U.S. Pat. No. 4,938,949. Generally, the concentration of the compound(s) of formulas I or II in a liquid composition, such as a lotion, will be from about 0.1-25 wt-%, preferably from about 0.5-10 wt-%. The concentration in a semi-solid or solid composition such as a gel or a powder will be about 0.1-5 wt-%, preferably about 0.5-2.5 wt-%.

The amount of the compound, or an active salt or derivative thereof, required for use in treatment will vary not only with the particular salt selected but also with the route of administration, the nature of the condition being treated and the age and condition of the patient and will be ultimately at the discretion of the attendant physician or clinician.

In general, however, a suitable dose will be in the range of from about 0.5 to about 100 mg/kg, e.g., from about 10 to about 75 mg/kg of body weight per day, such as 3 to about 50 mg per kilogram body weight of the recipient per day, preferably in the range of 6 to 90 mg/kg/day, most preferably in the range of 15 to 60 mg/kg/day.

The compound is conveniently administered in unit dosage form; for example, containing 5 to 1000 mg, conveniently 10 to 750 mg, most conveniently, 50 to 500 mg of active ingredient per unit dosage form.

Ideally, the active ingredient should be administered to achieve peak plasma concentrations of the active compound of from about 0.5 to about 75 μM, preferably, about 1 to 50 μM, most preferably, about 2 to about 30 μM. This may be achieved, for example, by the intravenous injection of a 0.05 to 5% solution of the active ingredient, optionally in saline, or orally administered as a bolus containing about 1-100 mg of the active ingredient. Desirable blood levels may be maintained by continuous infusion to provide about 0.01-5.0 mg/kg/hr or by intermittent infusions containing about 0.4-15 mg/kg of the active ingredient(s). The desired dose may conveniently be presented in a single dose or as divided doses administered at appropriate intervals, for example, as two, three, four or more sub-doses per day. The sub-dose itself may be further divided, e.g., into a number of discrete loosely spaced administrations; such as multiple inhalations from an insufflator or by application of a plurality of drops into the eye.

In accordance with one embodiment a kit is provided comprising a RSK specific inhibitor and instructional materials. As used herein, an "instructional material" includes a publication, a recording, a diagram, or any other medium of expression which can be used to communicate the usefulness of the composition of the present disclosure for its designated use. The instructional material of the kit of the present disclosure may, for example, be affixed to a container which contains the composition or be shipped together with a container which contains the composition. Alternatively, the instructional material may be shipped separately from the container with the intention that the instructional material and the composition be used cooperatively by the recipient.

The method of the present disclosure includes a kit comprising an inhibitor identified in the present disclosure and an instructional material which describes administering the inhibitor or a composition comprising the inhibitor to a cell or a subject. This should be construed to include other embodiments of kits that are known to those skilled in the art, such as a kit comprising a (preferably sterile) solvent suitable for dissolving or suspending the composition of the present disclosure prior to administering the compound to a cell or a subject. Preferably the subject is a human.

In accordance with the present disclosure, as described above or as discussed in the Examples below, there can be employed conventional chemical, cellular, histochemical, biochemical, molecular biology, microbiology, and in vivo techniques which are known to those of skill in the art. Such techniques are explained fully in the literature.

Without further description, it is believed that one of ordinary skill in the art can, using the preceding description and the following illustrative examples, make and utilize the compounds of the present disclosure. Therefore, the examples should be construed to encompass any and all variations which become evident as a result of the teaching provided herein. EXAMPLE 1

Inhibition of Cell Proliferation by RSK inhibitors To determine whether SLOlOl-I inhibits RSK in intact cells, phosphorylation of pi 40, a RSK substrate of unknown function, was examined in a human breast cancer cell line, MCF-7. MCF-7 and MCF-IOA cells were pre- incubated with vehicle, 50 μM U0126 or with SLOlOl-I for 3 hr. Cells were treated with 500 nM PDB for 30 min prior to lysis. Protein concentration of lysates was measured and lysates were electrophoresed, transferred and immunoblotted. Equal loading of lysate was demonstrated by anti-Ran immunoblot. Pre-incubation of cells with 100 μM SLO 101 - 1 abrogates phorbol dibutyrate (PDB)-induced p 140 phosphorylation as does 50 μM U0126, a MEK inhibitor. SLOlOl-I does not effect the phosphorylation of Rsk2, or the activation of MAPK. Therefore, SLOlOl-I does not inhibit upstream kinases necessary for PDB-stimulated RSK phosphorylation, namely MAPK, MEK, Raf and PKC. These data indicate that SLOlOl-I is an effective and specific RSK inhibitor in intact cells.

The effect of SLOlOl-I on proliferation of Ha-Ras transformed NIH/3T3 cells and the parental cell line was determined. SLOlOl-I decreased the growth rate of the transformed cells but had little effect on proliferation of the parental line. SLOlOl-I produced striking morphology changes in the transformed cells but not in the parental cell line. The vehicle control treated Ha-Ras transformed cells were elongated whereas in response to SLOlOl-I the cells became much larger and flatter, appearing more like the parental cells, or like Ha-Ras transformed cells treated with UO 126. Removal of SLOlOl-I resulted in growth of the transformed cells and a reversion to their elongated phenotype. These results demonstrate that SLOl 01 -1 can penetrate intact cells, but is not toxic and preferentially inhibits the growth of oncogene-transformed cells compared to the parental cells.

Whether or not SLOlOl-I could inhibit the growth rate of MCF-7 cells, was also investigated. Remarkably, SLOlOl-I inhibited proliferation of MCF-7 cells but had no effect on the growth of the normal breast cell line, MCF-IOA, even though SLOlOl-I prevented the PDB-induced pl40 phosphorylation in MCF-IOA cells. Furthermore, SLOlOl-I inhibits the growth rate of MCF-7 cells at an efficacy that parallels its ability to suppress RSK activity in vivo. Reduction of Rskl and Rsk2 levels was also accomplished using short, interfering RNAs (siRNA). Specifically, duplex siRNAs to a sequence in the bluescript plasmid (Control) or to Rskl and Rsk2 were transfected into MCF-7 cells. The sense strand for Rskl has the sequence AAGAAGCUGGACUUCAGCCGU (SEQ ID NO: 3), whereas the sense strand for Rskl has the sequence

AACCUAUGGGAGAGGAGGAGA (SEQ ID NO: 4). Medium was replaced 24 hr post-transfection and the cells incubated for an additional 48 hr prior to measuring cell viability. A combination of siRNAs to both Rskl and Rsk2 was effective in reducing MCF-7 proliferation.

Methods.

Kinase Assays. Glutathione-S-transferase (GST)-fusion protein (1 g) containing the sequence - RRRLASTNDKG (SEQ ID NO: 1, for serine/threonine kinase assays) or -VSVSETDD Y AEIIDEEDTFT (SEQ ID NO: 2, for tyrosine kinase assays) was adsorbed in the wells of LumiNunc 96-well polystyrene plates (MaxiSorp surface treatment). The wells were blocked with sterile 3% tryptone in phosphate buffered saline and stored at 4°C for up to 6 months. Kinase (5 nM) in 70 μl of kinase buffer (5 mM -glycerophosphate pH 7.4, 25 mM HEPES pH 7.4, 1.5 mM DTT, 30 mM MgCl₂, 0.15 M NaCl) was dispensed into each well. The compound or vehicle was added, and reactions were initiated by the addition of 30 μl of ATP for a final ATP concentration of 10 μM unless indicated otherwise. Reactions were terminated after 10 to 45 min by addition of 75 μl of 500 mM EDTA, pH 7.5. All assays measured the initial velocity of reaction. After extensive washing of wells, polyclonal phosphospecific antibody developed against the phosphopeptide and HRP-conjugated anti-rabbit antibody (211-035-109, Jackson ImrnunoResearch Laboratories) were used to detect serine phosphorylation of the substrate. HRP-conjugated anti-phospho-tyrosine antibody (RC20, BD Transduction Laboratories) was used for phospho-tyrosine detection. His-tagged active RSK and FAK were expressed in Sf9 cells and purified using NiNTA resin (Qiagen). Baculovirus was prepared using the Bac-to-Bac® baculovirus expression system (Invitrogen). PKA was bacterially expressed and activated as described (Anal. Biochem. 245, 115-122 (1997)). Active Mskl and p70 S6 kinase was purchased from Upstate Biotechnology. Immunoprecipitation and kinase assays were performed as previously described (Poteet-Smith et al., J Biol. Chem, 274, 22135-22138 (1999) using the immobilized GST-fusion proteins and ELISAs as above.

Cell Culture. For proliferation studies cells were seeded at 2500 to 5000 cells per well in 96 well tissue culture plates in the appropriate medium as described by American Type Culture Collection. After 24 hr, the medium was replaced with medium containing compound or vehicle as indicated. Cell viability was measured at indicated time points using CellTiter-Glo™ assay reagent (Promega) according to manufacturer's protocol. For in vivo inhibition studies, cells were seeded at 2.5 XlO⁵ cells/well in 12 well cell culture clusters. After 24 hr, the cells were serum starved for 24 hr then incubated with compound or vehicle for 3 hr prior to a 30 min PDB stimulation. Cells were lysed as previously described( J. Biol. Chem. 273, 13317-13323 (1998)). The lysates were normalized for total protein, electrophoresed and immunoblotted. For cell imaging, Ha-Ras-transformed NIH/3T3 cells were seeded on LABTEK II chamber slides (Nalge) at a density of 1 Xl O⁴ cells/well. After 24 hr, fresh medium was added the indicated compounds or vehicle. Images were taken 48 hr after treatment at a magnification of 2OX.

Gene Silencing. Custom oligonucleotides to Rskl (AAGAAGCUGGACUUCAGCCGU; SEQ ID NO: 3 and Rsk2 (AACCUAUGGGAGAGGAGGAGA; SEQ ID NO: 4) mRNA (Dharmacon Research Inc.) and TransIT-TKO® siRNA Tranfection Reagent (MIR2150, Mirus Corporation) were used for the gene silencing studies. MCF-7 cells were seeded at a density of 1.25XlO⁴ cells per well in 24 well cell culture clusters. After 24 hr, fresh medium was added containing 25 nM oligonucleotide and transfection reagent according to manufacturer's protocol. The transfection medium was replaced after 24 hr. Cells were incubated for an additional 48 hr prior to cell viability measurement.

Breast tissue analysis. Frozen tissue samples were ground using mortar and pestle under liquid nitrogen. Ground tissue was added to heated 2-X SDS loading buffer and boiled for 3 min. Protein concentration of lysates was measured and lysates were electrophoresed on SDS-PAGE and immunoblotted. EXAMPLE 2 Inhibition of RSK Activity Reduce LPS Activated Macrophage Secretions

To determine that SLOlOl inhibits RSK activity in J774A.1 murine macrophages, the effect of SLOlOl on phosphorylation of eukaryotic elongation factor (eEF2) was investigated. The translocation step in mRNA translation is mediated by eEF2. The activity of eEF2 is regulated by phosphorylation such that in the unphosphorylated state eEF2 is active and in the phosphorylated state eEF2 is inactive. This phosphorylation is produced by a highly specific kinase, EF2 kinase (EF2K). RSK phosphorylates and inactivates EF2K in response to mitogenic stimulations, which leads to a decrease in eEF2 phosphorylation (Wang, et al. Embo J 20:4370-9). Under conditions in which RSK activity is low, as during serum deprivation, eEF2 is phosphorylated by the active EF2K. However, stimulation of RSK activity by mitogens such as phorbol dibutyrate (PDB) results in reduced phosphorylation of eEF2 due to inactivation of EF2K by RSK. Therefore, the phosphorylation state of eEF2 is an indicator of RSK activity. As expected, RSK inhibition by SLOlOl increases peEF2 levels because RSK no longer inhibits EF2K (Fig. 1). The levels of total eEF2 were not altered by any of the treatments. Thus SLOlOl inhibits RSK activity in J774A.1 cells and the phosphorylation state of eEF2 can be used to detect RSK inhibition the macrophages. LPS activation of macrophages results in secretion of factors that stimulate the innate immune system. To examine the effect of RSK inhibition on the expression of these factors, J774A.1 cells were treated with 1 μg/ml LPS (Escherichia coli 0111 :B4, Sigma L4391) and 60 μM SLOlOl or vehicle. Twenty-four hours after LPS treatment the cells were lysed as previously described (Traish, et al., 1998. J. Biol. Chem. 273 : 13317-13323) in preparation for immunoblot analysis. Expression of the pro-inflammatory factors, TNFα, IL-Ib, the anti-inflammatory factor, IL-10 and inducible nitric oxide synthase was examined by immunoblot of the cell lysates. Analysis revealed that LPS treatment resulted in activation of p42/44 MAPK (Erk 1/2) and increased expression of the cytokines, TNFα and IL-Ib (Figs. 2A & 2B). Inhibition of RSK with SLO 101 did not alter the expression of TNFα, IL- 1 b of IL- 10. However, RSK inhibition by SLOlOl abrogated the induction of iNOS expression (Fig. 3A). In addition, RSK inhibition was shown to have the same effect in primary murine peritoneal macrophages (see Fig. 3B).

These data indicate that inhibition of RSK activity in the macrophages does not simply shut down the immune response of the macrophage due to general toxicity. Therefore, RSK inhibition modifies the pattern of factors expressed upon LPS exposure by altering expression of specific LPS-induced genes. It was previously shown that RSK activity is required for phorbol ester induced COX-2 expression in human fibroblasts (Cieslik, et al, 2005. J Biol Chem 280:18411-7). As demonstrated herein, RSK activity is required for LPS-stimulated iNOS expression. Thus, RSK activity is essential for induction of at least two factors integral to the inflammatory response of macrophages to LPS-challenge.

Additionally, we demonstrate that inhibition of RSK in human umbilical vein endothelial cells (HUVEC) attenuates LPS-induced expression of vascular cell adhesion molecule (VCAM) (see Fig. 4). The reduction in endothelial cell adhesion molecule expression should interfere with the conversion of the cells from the anti- to pro-adhesive phenotype. Therefore, inhibition of RSK not only alters LPS-induced macrophage secretions but also attenuates LPS activation of endothelial cells.

The data provided in Figs 1-4 supports the use of RSK inhibitors as pharmacological agents to treat and recalibrate inflammatory responses. Accordingly, RSK inhibitors will be useful therapeutic agents for reducing the development of septicemia as well as for treating diseases associated with chronic inflammation such as rheumatoid arthritis, inflammatory bowel syndrome, atherosclerosis, multiple sclerosis, asthma, and diabetes.

EXAMPLE 3

Proposed Synthetic Schemes for Preparing RSK Inhibitors Abreviations used in Examples 3-6 are as follows: TBDPS = tert- butyldiphenylsilyl, THF = tetrahydrofuran, EDCl = l-(3-dimethylaminopropyl)-3- ethylcarbodiimide, DMAP = 4-dimethylaminopyridine, TSOH = 4-toluene sulfonic acid, DMF = dimethylformamide, Bn = benzyl, MTBE = methyl tert-butyl ether. Proposed Scheme I: Preparation of Protected Kaempferol & Quercetin

EDCl, DMAP, TsOH, CH₂Cl₂

DPS

R₀ = H or OTBDPS

Proposed Scheme II: Alternative Route for Synthesis of Protected Kaempherol

K.₂CO₃, acetone,

Reflux

TBDPS

DPS

Proposed Scheme III: Coupling of Two Fragments and Total Synthesis

TBDPSO O

J. Org. Chem. 1996, 61, 605-615*

* source for preparing the sugar moiety OTBDPS

SLOlOl-I

EXAMPLE 4

Synthesis of the Protected Kaempferol (10) The synthesis for the Kaempferol half of SLOlOl-I is outlined as follows:

4a: R=OEt 4b: R=NH₂

8: R=Bn; R₁= COC₆H₄(4-OTBDPS) 8a: R=H; R₁= COC₆H₄(4-OTBDPS) 8b: R= COC₆H₄(4-OTBDPS); R₁= H Treatment of commercially available 1 (2Og) with tert- butyldiphenylsilyl chloride (TBDPSCl) and imidazole in THF/CH₂C1₂ gave, after chromatographic purification, 2 (47.3 g, 80%). This compound was characterized by ¹H NMR. and MS. Oxidation of 2 (21.8g and 25g) using sodium chlorite gave 3 (50g total, quantitative yield). The product was characterized by ¹H and ¹³C NMR, and by MS.

Benzyl alcohol (5Og) on treatment with NaH (1.2 equiv) and ethyl bromoacetate (1 equiv) in THF gave 4a (32g, 36%), which was characterized by both ¹HNMR, and by MS. Scale up of this reaction yielded lOOg of 4a. Reaction of 4a (5g) with NH₄OH at 0° for 5 h in CH₂Cl₂ gave amide 4b (4.3g, 96%), which was characterized by ¹H NMR and MS. A repeat of this experiment on 45 g of 4a gave 38 g (94%) of 4b. Dehydration of 4b (4.2 g) using POCl₃ in acetonitrile gave 5 (1.75 g, 47%), which was characterized by ¹H NMR, ¹³C NMR and MS. A repeat of this experiment on 38g of 4b gave an additional 15.75 g (47%) of 5. Coupling of 5 (5 g) and phloroglucinol in MTBE with HCl gas bubbling at 0⁰C for 3 h gave 6 (2.6 g,

56%), which was characterized by ¹H NMR, ¹³C NMR and MS. Selective protection of 6 (0.5 g) using TBDPSCI (2.5 equiv) and Et₃N (2.5 equiv) in CH₂Cl₂ at room temperature for 16 h gave 7 (1.2 g, 85%), which was characterized by ¹H NMR and MS. Scale-up of this experiment on 2 g of 6 gave an additional 3.4 g (62%) of 7. Condensation of 7 (1.4 g) with 3 (1.35 equiv) in CH₂Cl₂ [EDCI (1.5 equiv), DMAP (0.35 equiv), TsOH (0.35 equiv.] at room temperature for 24 h gave 8 (1.5 g, 72%), which was characterized by ¹H NMR. Scale up gave 35g of purified 8. Compound 8 (6g) was debenzylated using Rh/C as a catalyst (H₂, 60 psi, EtOAc, rt, 24h) to give 8a (1.8g, 33%) along with 2.9g (53%) of the trans-esterified (migration of benzoyl group Ri) product 8b. Both the intermediates 8a and 8b were characterized by ¹H NMR. EXAMPLE 5

Synthesis of the Protected Rhamnose (20) The synthesis for the Rhamnose half of SLOlOl-I is outlined as follows:

Reaction of L-rhamnose 11 (50 g) with acetic anhydride (6 equiv), triethylamine (8 equiv) and catalytic 4-dimethylaminopyridine (0.1 equiv) in CH₂Cl₂ at room temperature for 16h gave 90 g (98%) of the tetraacetate 12, which was characterized by ¹H NMR and MS and was taken to the next step without further purification. Scale up yielded 260 g of 12. Treatment of 12 (150 g) with thiophenol (1.1 equiv) in the presence of SnCl₄ (0.7 equiv) in CH₂Cl₂ at 0 ⁰C for 5 h gave 13 [56 g (pure), HO g (with ~10% impurity)], which was characterized by both ¹H NMR and MS. Deacetylation of 13 (56 g) using catalytic K₂CO₃ (0.2 equiv) in THF/MeOH (1 : 1) at room temperature for 16 h provided triol 14 (35 g, 93%), which was characterized by ¹ H NMR and MS .

Treatment of 14 (0.3 g) using 2,2-dimethoxypropane with catalytic amount of p-toluenesulfonic acid gave 15 (0.3 g, 86%) as a single anomer, which was characterized by both ¹H NMR and MS. Scale-up of this reaction on 34 g of 14 gave an additional 38 g (97%) of 15. O-Benzylation of 15 (0.3 g) with NaH (1.74 equiv) and benzyl bromide (1.05 equiv) in DMF provided the benzyl ether 16 (0.35 g, 89%), which was characterized by ' H NMR. A repeat of this experiment on 38 g of 15 gave 41 g (83%) of 16. Treatment of 16 (3 g) with trifluoroacetic acid in MeOH at 50 ⁰C for 16 h gave diol 17 (2.5 g, 93%), which was characterized by ¹H NMR and MS. A repeat of this experiment on 10 g of 16 gave 8.5 g (95%) of 17. Selective O- benzylation of diol 17 (2.5 g) following a literature procedure («-Bu₂SnO, toluene, Dean-Stark, reflux, 4 h to give 18, then R-Bu₄NBr, BnBr, 50 ⁰C, 5 h) gave 19 (2.6 g, 82%), which was characterized by both ¹H NMR and MS. Treatment of 19 (2.5 g,) with acetic anhydride and pyridine gave the acetate 20 (rhamnose part of the molecule) (2.5 g, 91%), which was characterized by ¹H NMR and MS. Scale-up of the above reactions to get acetate 20 (~20 g) was conducted as follows. Treatment of 16 (25 g) with trifluoroacetic acid in MeOH at 50 ⁰C for 16 h gave diol 17 (21 g, 94%), which was characterized by ¹H NMR and MS. Selective O-benzylation of diol 17 (29.5 g) following a literature procedure (n- Bu₂SnO, toluene, Dean-Stark, reflux, 4 h to give 18, then W-Bu₄NBr, BnBr, 50⁰C, 5 h) gave 19 (31 g, 83%), which was characterized by both ¹H NMR and MS. Treatment of 19 (30 g) with acetic anhydride and pyridine gave the acetate 20 (29.3 g, 89%) required for the coupling reaction with 10. The product was characterized by ¹H NMR and MS.

EXAMPLE 6

Coupling of the Kaempferol and Rhamnose Moieties The coupling reation between compounds 20 and 8a to generate SLOlOl-I is outlined as follows:

SLOlOl-I

The coupling of 20 (O.lg) with 8a (1.5 equiv) using O-glycosidation conditions [1-benzenesulfinyl piperidine (1 equiv), tri-t-butylpyrimidine (2 equiv), triflic anhydride (trifluoromethanesulfonic acid anhydride) (1.1 equiv), CH2C12, - 60oC, Ih] gave 21 (O.lg, 35%), which was characterized by IH NMR. Dehydration of 21 (O.lg) using K2CO3 in pyridine at reflux to get 22 is in progress and the remaining steps from 21 to produce SLOlOl-I are well known to those skilled in the art. The disclosures of each and every patent, patent application, and publication cited herein are hereby incorporated by reference herein in their entirety.

Headings are included herein for reference and to aid in locating certain sections. These headings are not intended to limit the scope of the concepts described therein under, and these concepts may have applicability in other sections throughout the entire specification.

While the present disclosure has been disclosed with reference to specific embodiments, it is apparent that other embodiments and variations of the present disclosure may be devised by others skilled in the art without departing from the true spirit and scope of the present disclosure.

Claims

WHAT IS CLAIMED IS:

1. A method of inhibiting pathogenic stimulated expression of nitric oxide synthase by macrophages, said method comprising the steps of contacting said macrophage cells with a composition comprising an inhibitor of RSK activity.

2. The method of claim 1 wherein the RSK inhibitor is selected from the group consisting of an anti-sense oligonucleotide and an interfering oligonucleotide.

3. The method of claim 2 wherein the RSK inhibitor comprises an interfering oligonucleotide directed against Rskl or Rsk2.

4. The method of claim 1 wherein the RSK specific inhibitor comprises a compound having the structure of formula II:

wherein R₁, R₂, and R₅ are independently selected from the group consisting of OH, OCOR₈, COR_8, SR_8, and C₁-C₄ alkoxy;

R₃, R₄, R₆, R₇ are independently selected from the group consisting of H, OH, OCOR₈, COR_8, SR_8, and C₁-C₄ alkoxy;

R₈ is H or C₁-C₄ alkyl; and Rg, Rio and Rn are independently selected from the group consisting of H, OH,

OCOR₈, COR₈, NHOCOR₈ and C₁-C₄ alkoxy, with the proviso that R₉, Rio and Rj i are not all OH when Ri, R_2i and R₅ are OH.

5. The method of claim 4 wherein Ri , R₂, and R₅ are independently OH or SR₈.

6. The method of claim 5 wherein one of Ri, R_2, and R₅ is SR₈.

7. The method of claim 4 wherein one of R₉, R₁₀ and R₁₁ is NHOCOR₈.

8. The method of claim 4 wherein Ri and R₂ are both OH;

R9, Ri₀ and R₁] are independently selected from the group consisting of H, OH and OCOR₈;

R₃ and R₇ are each H;

R₄, R₅, and R₆ are independently selected from the group consisting of H, OR₈, OCOR₈, and COR₈; and R₈ is H or methyl.

9. The method of claim 4 wherein R], R₂ and R₅ are OH; R9 and Ri₀ are independently selected from the group consisting of

OH, COR₈, Ci-C₄ alkoxy, NHOCOR₈ and OCOCH₃;

R_n is OCOCH₃;

R₈ is H or methyl;

R₃, R₄ and R₇ are each H; and R₆ is H or hydroxy.

10. The method of claim 9 wherein R₉ and R₁₀ are independently selected from the group consisting of OH and OCOCH₃.

11. A method of inhibiting pathogenic stimulated expression of adhesion factors in endothelial cells, said method comprising the steps of contacting said endothelial cells with a composition comprising an inhibitor of RSK activity.

12. The method of claim 11 wherein the RSK inhibitor is selected from the group consisting of an anti-sense oligonucleotide and an interfering oligonucleotide.

13. The method of claim 12 wherein the RSK inhibitor comprises an interfering oligonucleotide directed against Rskl or Rsk2.

14. The method of claim 11 wherein the RSK specific inhibitor comprises a compound having the structure of formula II:

wherein R₁, R₂, and R₅ are independently selected from the group consisting of OH, OCOR₈, COR₈₁ SR_8, and C₁-C₄ alkoxy; R₃, R₄, R₆, R₇ are independently selected from the group consisting of

H, OH, OCOR₈, COR₈, SR₈, and C₁-C₄ alkoxy; R₈ is H or CpC₄ alkyl; and

R₉, R₁₀ and R₁₁ are independently selected from the group consisting of H₅ OH,

OCOR₈, COR₈, NHOCOR₈ and C₁-C₄ alkoxy, with the proviso that R₉, Rio and Ri ₁ are not all OH when Rj, R₂, and R₅ are OH.

15. The method of claim 14 wherein Ri , R_2, and R₅ are independently OH or SR₈.

16. The method of claim 15 wherein one of Ri, R₂, and R₅ is SR₈.

17. The method of claim 14 wherein one of R₉, Ri₀ and Ri ₁ is NHOCOR₈.

18. The method of claim 14 wherein

Ri and R₂ are both OH;

R₉, Rio and Ri₁ are independently selected from the group consisting of H, OH and OCOR₈;

R₃ and R₇ are each H; R₄, R₅, and R₆ are independently selected from the group consisting of

H, OR₈, OCOR₈, and COR₈; and R₈ is H or methyl.

19. The method of claim 14 wherein R₁, R₂ and R₅ are OH;

R₉ and Ri₀ are independently selected from the group consisting of OH, COR₈, Ci-C₄ alkoxy, NHOCOR₈ and OCOCH₃;

Rn is OCOCH₃;

R₈ is H or methyl; R₃, R₄ and R₇ are each H; and

R₆ is H or hydroxy.

20. The method of claim 19 wherein

R.₉ and R₁₀ are independently selected from the group consisting of OH and OCOCH₃.

21. The method of claim 11 further comprising the administration of an anti-microbial agent.

22. A method of treating diseases associated with chronic inflammation, said method comprising the step of administering a composition comprising a RSK inhibitor to a patient in need thereof.

23 The method of claim 22 wherein the disease is selected from the group consisting of rheumatoid arthritis, inflammatory bowel syndrome, atherosclerosis, multiple sclerosis, asthma, and diabetes.

24. The method of claim 22 wherein the RSK inhibitor is selected from the group consisting of an anti-sense oligonucleotide and an interfering oligonucleotide.

25. The method of claim 22 wherein the RSK specific inhibitor comprises a compound having the structure of formula II:

wherein Ri, R₂, and R₅ are independently selected from the group consisting of OH, OCOR₈, COR₈, SR₈, and C₁-C₄ alkoxy;

R₃, R₄, R₆, R₇ are independently selected from the group consisting of H, OH, OCOR₈, COR_8, SR_8, and C₁-C₄ alkoxy;

R₈ is H or CpC₄ alkyl; and

Rg, R₁₀ and R₁₁ are independently selected from the group consisting of H₅ OH,

OCOR₈, COR₈, NHOCOR₈ and C₁-C₄ alkoxy, with the proviso that R₉, Rio and R₁₁ are not all OH when Ri, R_2j and R₅ are OH.

26. The method of claim 25 wherein Ri, R_2, and R₅ are independently OH or SR₈.

27. The method of claim 26 wherein one of Ri, R_2, and R₅ is SR₈.

28. The method of claim 24 wherein

Ri, R₂ and R₅ are OH;

R₉ and Rio are independently selected from the group consisting of OH and OCOCH₃; ■

Rn is OCOCH₃; R₈ is H or methyl;

R₃, R₄ and R₇ are each H; and

R₆ is H or hydroxy.