WO2008157230A1 - Rsk inhibitors as anti-angiogenic therapeutics - Google Patents

Abstract

A composition comprising a RSK activity inhibiting agent is provided for use in inhibiting angiogenesis. Inhibition of RSK activity has been found by applicant to inhibit endothelial migration, an important first step in the process of angiogenesis. The RSK specific inhibitors used in accordance with the disclosed composition and methods can be selected from any inhibiting moiety including but not limited to anti-sense oligonucleotides, interfering oligonucleotide and kaempferol 3-O-(3',4'-di-O-acetyl-α-L-rhamnopyranoside) and related compounds.

Description

RSK INHIBITORS AS ANTI-ANGIOGENIC THERAPEUTICS

CROSS REFERENCE TO RELATED APPLICATIONS

This application claims priority to United States Provisional Patent Application No. 60/934,528 filed on June 14, 2007, the complete disclosure of which is incorporated herein by reference.

BACKGROUND

Angiogenesis is the development and growth of new capillary blood vessels from the existing vasculature. Increased vascularization is critical in the progression of several pathologies including arthritis, diabetic retinopathy, and tumor proliferation, and is an essential process underlying tumor growth and metastasis. Thus, inhibiting angiogenesis would stop the initial processes involved in progression of inflammatory diseases and cancers. Anti-angiogenic therapy is currently in use to treat multiple pathologies. The purpose of the present disclosure is not to overcome shortcomings that have been identified with previous anti-angiogenic treatments. This present disclosure adds to the options for anti-angiogenic treatments and allows for new unique combinations of anti-angiogenic therapeutics. The Mitogen-activated Protein Kinase (MAPK) signaling pathway is one key pathway that transduces a large variety of external signals, leading to cellular responses that include growth, differentiation, inflammation and apoptosis. p90 Ribosomal S6 Kinase (RSK) is a serine/threonine kinase that is a downstream component of the Mitogen-activated Protein Kinase (MAPK) signaling pathway (see Clark et al., 2005, Cancer Res., 65:3108; Smith et al., 2006, Biorg. Med. Chem., 14:6034; Xu et al., 2006, Biorg. Med. Chem., 14:3974-3977). As disclosed herein, applicants have discovered that RSK activity is required for endothelial cell migration, and accordingly, inhibiting RSK activity represents a novel method for inhibiting angiogenesis.

SUMMARY

The p90-kDa ribosomal S6 kinase (RSK) family members are downstream effectors of mitogen-activated protein kinase (MAPK). The experiments described herein are the first to identify that RSK activity is necessary for migration of endothelial cells. Endothelial cell invasion and migration is an initial step in the process of growing new vessels from existing vasculature. Accordingly, RSK activity represents a novel target for a new class of anti-angiogenesis agents. As disclosed herein a novel method of inhibiting endothelial cell migration is provided comprising the step of contacting endothelial cells with a RSK- specific inhibitor. Contact of endothelial cells by RSK inhibitors inhibits the ability of endothelial cells to conduct the initial steps needed for angiogenesis, leading to alleviation of the symptoms and restoration of the health of patients suffering from diseases associated with inappropriate angiogenic activity. Accordingly, pharmaceutical compositions comprising a RSK specific inhibitor can be used to treat diseases as diverse as arthritis, diabetic retinopathy, and cancer.

In one embodiment compositions comprising a RSK inhibitor, and methods for using such compositions for inhibiting angiogenesis in a subject in need thereof, are provided. In one embodiment, the subject is a human. The RSK specific inhibitors used in accordance with the disclosed methods can be selected from any moiety that disrupts RSK activity, including but not limited to, anti-sense oligonucleotides, interfering oligonucleotides and kaempferol 3-O-(3",4"-di-O-acetyl- α-L-rhamnopyranoside) and related compounds. In accordance with one embodiment, a method of inhibiting angiogenesis is provided, wherein a RSK inhibitor, selected from the group consisting of an anti-sense oligonucleotide and an interfering oligonucleotide, is administered to a patient in need thereof. Alternatively, in one embodiment the administered RSK specific inhibitor comprises a compound having the structure of Formula II:

wherein R₁, R_2i and R₅ are independently selected from the group consisting of OH, OCOR₈, COR₈, SR₈, and C_rC₄ alkoxy;

R₃, R₄, R₆, R₇ are independently selected from the group consisting of H, OH, OCOR₈, COR_8, SR_8, and C₁-C₄ alkoxy;

R₈ is H or Cj-C₄ alkyl; and

R₉, Ri₀ and Rn are independently selected from the group consisting of H, OH, OCOR₈, COR₈, NHOCOR₈ and Ci-C₄ alkoxy, with the proviso that R₉, Ri₀ and Rn are not all OH when Ri, R_2, and R₅ are OH. In a further embodiment R₁, R_2, and R₅ are independently OH or SR₈, and one of R₉, Rio and Rn is NHOCOR₈. In anther embodiment, Ri and R₂ are both OH, R₉, Ri₀ and Rn are independently selected from the group consisting of H, OH and OCOR₈, R₃ and R₇ are each H, R₄, R₅, and R₆ are independently selected from the group consisting of H, OR₈, OCOR₈, and COR₈, and R₈ is H or methyl.

In one embodiment the RSK inhibitor has the structure:

wherein R₉, R₁₀ and Rn are independently selected from the group consisting of H, OH,

OCOR₈, COR₈, NHOCOR₈ and C₁-C₄ alkoxy, with the proviso that R₉, Rio and Rj ₁ are not all OH. In one embodiment, R₉ is OH and Ri₀ and Ri ₁ are each OAc (representing the single compound referred to herein as SLOlOl). Additional derivatives of SlOlOl, as disclosed in Xu et al., 2006, Biorg. Med. Chem., 14:3974- 3977 (the disclosure of which is incorporated herein by reference) can also be used as RSK inhibitors in accordance with the methods disclosed herein.

Although not wishing to be bound by any particular theory, the results disclosed herein suggest that by targeting RSK, a new class of anti-angiogenesis agents can provide broad-spectrum inhibition of angiogenesis in a subject in need thereof.

The present disclosure further encompasses the use of kits for administering at least one compound of the invention to a subject in need thereof.

BRIEF DESCRIPTION OF THE DRAWINGS

Fig. 1. SLOlOl does not inhibit HUVEC cell proliferation. The proliferation rate of human umbilical vein endothelial cells (HUVEC) in the presence of SLO 101 ( 10 - 100 μM) was quantified. The relative cell number, 72 hours after initiation, was determined using the CellTiter-Glo Luminescent Cell Viability assay (Promega) according to manufacturer's protocol. Growth is presented as fold proliferation relative to that observed at initiation of the assay. Bars = SD of 8 data points. Figs. 2A-2F. Inhibiting RSK activity in the human umbilical vein endothelial cells (HUVECs) diminishes migration into a wound. HUVECs were sub- cultured to confluence in 35-mm plates. One hour prior to wounding, the cells were treated with vehicle (Figs. 2A, 2B, or 2D) or 60 μM SLOlOl (Figs. 2C or 2E). Scratches were made in the monolayer of cells using sterile, disposable micropipette tips. Images were captured at 2 hr (Fig. 2A), 10 hr (Figs. 2B and 2C), and 20 hr (Figs. 2D and 2E) after wounding. To demonstrate that the concentration of SLOlOl used in the wound healing assay was sufficient to inhibit RSK activity in the HUVEC cells, the phosphorylation state of a known RSK substrate, ppl40 was examined. HUVEC cells were maintained in complete growth medium and treated in the presence or absence of 60 μM SLOlOl for 2 hours. The cells were either maintained in the complete growth medium or challenged with 500 nM phorbol dibutyrate (PDB) to maximally activate RSK. As seen in Fig. 2F, SLOlOl treatment reduced the phosphorylation of ppl40. SLOlOl treatment also inhibited activation of RSK by PDB-challenge.

Figs. 3A-3F Inhibiting RSK activity in the human lung cancer cell line, CaIu-I, diminishes migration into a wound. CaIu-I cells were sub-cultured to confluence in 35-mm plates. One hour prior to wounding, the cells were treated with vehicle (Figs. 3A-3C) or 60 μM SLOlOl (Figs. 3D-3F). Scratches were made in the monolayer of cells using sterile, disposable micropipette tips. Images were captured either immediately following the wounding (Figs. 3A and 3D), 6 hr (Figs. 3B and 3E), or 24 hours (Figs. 3C and F) after wounding. The ability of the entire monolayer to respond to the wound is depressed in the SLOl 01 -treated cells as indicated by the numerous holes in the monolayer behind the cells at the edge of the wound. The holes are marked by asterisks (*).

Figs. 4A-4H. Reducing RSK expression in the human lung cancer cell line, CaIu-I, inhibits migration into the wound. CaIu-I cells were transiently transfected in suspension with control siRNA (Figs. 4A and 4B), RSKl -specific siRNA (Figs. 4C and 4D), RSK2-specific siRNA (Figs. 4E and 4F) or both RSK-I and RSK2-specific siRNA (Figs. 4G and 4H). After four hours, the transfection medium was removed and the cells were plated in 6-well tissue-culture clusters. Forty-eight hours after transfection, scratches were made in the monolayer of cells using sterile, disposable micropipette tips. Images were captured either immediately following the wounding (Figs 4A, 4C, 4E and 4G), and 19 hours (Figs. 4B, 4D, 4F and 4H) after wounding. The images demonstrate classical wound healing. By 19 hr, the cells transfected with control siRNA have migrated into the wound (Fig. 4B). However, the cells transfected with either RSKl- or RSK2-specific siRNA demonstrate a reduced ability to migrate into the wound (See Figs 4D and 4F, respectively).

Fig 5. SLOlOl reduces expression of the angiogenesis marker, VCAM. HUVEC cells were treated in the presence or absence of 1 μg/ml lipopolysaccharide (LPS) with concomitant treatment of vehicle or SLOlOl at indicated concentrations. Twenty- four hours after LPS treatment, the cells were harvested with SDS lysis buffer in preparation for SDS-PAGE and immunoblot analysis. Lysates were normalized with regard to protein concentration. Equivalent loading is shown by the anti-Ran immunoblot.

DETAILED DESCRIPTION

DEFINITIONS

In describing and claiming the invention, the following terminology will be used in accordance with the definitions set forth below. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

A "bioactive polypeptide" refers to polypeptides which are capable of exerting a biological effect in vitro and/or in vivo.

As used herein, an antimicrobial is a substance that kills, or inhibits the growth or the ability of a microbe (such as bacteria, fungi, or viruses) to infect or maintain an infection in its host cell/organism.

As used herein, the term "pharmaceutically acceptable carrier" includes any of the standard pharmaceutical carriers, such as a phosphate buffered saline solution, water, emulsions such as an oil/water or water/oil emulsion, and various types of wetting agents. The term also encompasses any of the agents approved by a regulatory agency of the US Federal government or listed in the US Pharmacopeia for use in animals, including humans.

As used herein the term "pharmaceutically acceptable salt" refers to salts of compounds that retain the biological activity of the parent compound, and which are not biologically or otherwise undesirable. Many of the compounds disclosed herein are capable of forming acid and/or base salts by virtue of the presence of amino and/or carboxyl groups or groups similar thereto.

As used herein, the term "treating" includes prophylaxis of the specific disorder or condition, or alleviation of the symptoms associated with a specific disorder or condition and/or preventing or eliminating said symptoms.

As used herein an "effective" amount or a "therapeutically effective amount" of a prodrug refers to a nontoxic but sufficient amount of a bioactive agent to provide the desired effect. For example, an effective amount of an RSK inhibitor is an amount of the inhibitor sufficient to, inter alia, suppress RSK activity as indicated in a serine/threonine kinase assay. The term "effective amount" is used interchangeably with "effective concentration" herein. The amount that is "effective" will vary from subject to subject, depending on the age and general condition of the individual, mode of administration, and the like. Thus, it is not always possible to specify an exact "effective amount." However, an appropriate "effective" amount in any individual case may be determined by one of ordinary skill in the art using routine experimentation.

The term, "parenteral" means not through the alimentary canal but by some other route such as subcutaneous, intramuscular, intraspinal, or intravenous. The term "about," as used herein, means approximately, in the region of, roughly, or around. When the term "about" is used in conjunction with a numerical range, it modifies that range by extending the boundaries above and below the numerical values set forth. For example, in one aspect, the term "about" is used herein to modify a numerical value above and below the stated value by a variance of 20%.

As used herein, the term "affected cell" refers to a cell of a subject afflicted with a disease or disorder, which affected cell has an altered phenotype relative to a subject not afflicted with a disease or disorder.

Cells or tissue are "affected" by a disease or disorder if the cells or tissue have an altered phenotype relative to the same cells or tissue in a subject not afflicted with a disease or disorder.

As used herein, an "agonist" is a composition of matter which, when administered to a mammal such as a human, enhances or extends a biological activity attributable to the level or presence of a target compound or molecule of interest in the mammal.

An "antagonist" is a composition of matter which when administered to a mammal such as a human, inhibits a biological activity attributable to the level or presence of a compound or molecule of interest in the mammal. The term as used herein, is intended to encompass without limitation, an antibody, an antigen binding portion thereof or a biosynthetic antibody binding site that binds a particular target protein; an antisense molecule that hybridizes in vivo to a nucleic acid encoding a target protein or a regulatory element associated therewith, or a ribozyme, aptamer, or small molecule that binds to and/or inhibits a target protein, or that binds to and/or inhibits, reduces or otherwise modulates expression of nucleic acid encoding a target protein.

A disease or disorder is "alleviated" if the severity of a symptom of the disease or disorder, the frequency with which such a symptom is experienced by a patient, or both, are reduced.

As used herein, "amino acids" are represented by the full name thereof, by the three letter code corresponding thereto, or by the one-letter code corresponding thereto, as indicated in the following table:

Full Name Three- Letter Code One-Letter Code

Aspartic Acid Asp D

Glutamic Acid GIu E

Lysine Lys K

Arginine Arg R

Histidine His H

Tyrosine Tyr Y

Cysteine Cys C

Asparagine Asn N

Glutamine GIn Q

Serine Ser S

Threonine Thr T Glycine GIy G

Alanine Ala A

Valine VaI V

Leucine Leu L

Isoleucine He I

Methionine Met M

Proline Pro P

Phenylalanine Phe F

Tryptophan Trp W

The expression "amino acid" as used herein is meant to include compounds having the following general structure:

wherein R represents hydrogen or a hydrocarbon side chain, and includes both natural and synthetic amino acids, and both D and L amino acids. "Standard amino acid" means any of the twenty standard L-amino acids commonly found in naturally occurring peptides. "Nonstandard amino acid residue" means any amino acid, other than the standard amino acids, regardless of whether it is prepared synthetically or derived from a natural source. As used herein, "synthetic amino acid" also encompasses chemically modified amino acids, including but not limited to salts, amino acid derivatives (such as amides), and substitutions. Amino acids contained within the peptides of the present disclosure, and particularly at the carboxy- or amino-terminus, can be modified by methylation, amidation, acetylation or substitution with other chemical groups which can change the peptide's circulating half-life without adversely affecting their activity. Additionally, a disulfide linkage may be present or absent in the peptides of the present disclosure. The term "amino acid" is used interchangeably with "amino acid residue," and may refer to a free amino acid and to an amino acid residue of a peptide. It will be apparent from the context in which the term is used whether it refers to a free amino acid or a residue of a peptide. As used herein, an "analog" of a chemical compound is a compound that, by way of example, resembles another in structure but is not necessarily an isomer (e.g., 5-fluorouracil is an analog of thymine).

The term "biological sample," as used herein, refers to samples obtained from a subject, including, but not limited to, skin, hair, tissue, blood, plasma, cells, sweat and urine.

As used herein, a "derivative" of a compound refers to a chemical compound that may be produced from another compound of similar structure in one or more steps, including for example, the replacement of hydrogen by an alkyl, acyl, or amino group.

The terms "cell," "cell line," and "cell culture" as used herein may be used interchangeably. All of these terms also include their progeny, which are any and all subsequent generations. It is understood that all progeny may not be identical due to deliberate or inadvertent mutations. A "control" cell, tissue, sample, or subject is a cell, tissue, sample, or subject of the same type as a test cell, tissue, sample, or subject. The control may, for example, be examined at precisely or nearly the same time the test cell, tissue, sample, or subject is examined. The control may also, for example, be examined at a time distant from the time at which the test cell, tissue, sample, or subject is examined, and the results of the examination of the control may be recorded so that the recorded results may be compared with results obtained by examination of a test cell, tissue, sample, or subject. The control may also be obtained from another source or similar source other than the test group or a test subject, where the test sample is obtained from a subject suspected of having a disease or disorder for which the test is being performed.

A "test" cell, tissue, sample, or subject is one being examined or treated.

A "pathoindicative" cell, tissue, or sample is one which, when present, is an indication that the animal in which the cell, tissue, or sample is located (or from which the tissue was obtained) is afflicted with a disease or disorder. By way of example, the presence of one or more breast cells in a lung tissue of an animal is an indication that the animal is afflicted with metastatic breast cancer. The use of the word "detect" and its grammatical variants is meant to refer to measurement of the species without quantification, whereas use of the word "determine" or "measure" with their grammatical variants are meant to refer to measurement of the species with quantification. The terms "detect" and "identify" are used interchangeably herein.

As used herein, a "detectable marker" or a "reporter molecule" is an atom or a molecule that permits the specific detection of a compound comprising the marker in the presence of similar compounds without a marker. Detectable markers or reporter molecules include, e.g., radioactive isotopes, antigenic determinants, enzymes, nucleic acids available for hybridization, chromophores, fluorophores, chemiluminescent molecules, electrochemically detectable molecules, and molecules that provide for altered fluorescence-polarization or altered light-scattering.

A "disease" is a state of health of an animal wherein the animal cannot maintain homeostasis, and wherein if the disease is not ameliorated then the animal's health continues to deteriorate.

In contrast, a "disorder" in an animal is a state of health in which the animal is able to maintain homeostasis, but in which the animal's state of health is less favorable than it would be in the absence of the disorder. Left untreated, a disorder does not necessarily cause a further decrease in the animal's state of health. The term "excessive RSK activity", as used herein, refers to an increase in RSK activity in a cell with a disease or disorder, relative to the amount of such RSK activity in an otherwise identical normal cell.

As used herein, the term "flavonoid" refers to polyphenolic compounds possessing a carbon skeleton having the general structure:

The terms "formula" and "structure" are used interchangeably herein.

As used herein, a "functional" molecule is a molecule in a form in which it exhibits a property by which it is characterized. By way of example, a functional enzyme is one which exhibits the characteristic catalytic activity by which the enzyme is characterized. Any reference to a compound having a "greater uptake" into a cell relative to another compound (e.g., SLOlOl) is intended to portray that a higher concentration of the first compound relative to the second will be present in otherwise identical cells that are exposed to the respective compounds for the same length of time. Accordingly, the first compound either has the ability to enter a cell at a greater rate than the second compound or that the first compound has lower rate of degradation or a lower rate of efflux from the cell relative to the second compound.

The term "inhibit," as used herein, refers to the ability of a compound of the present disclosure to reduce or impede a described function. In one embodiment, inhibition is at least 10%, at least 25%, at least 50%, at least 75% of the activity obtained in the absence of the inhibiting agent.

The term "inhibit a protein", as used herein, refers to any method or technique which inhibits protein synthesis, levels, activity, or function, as well as methods of inhibiting the induction or stimulation of synthesis, levels, activity, or function of the protein of interest. The term also refers to any metabolic or regulatory pathway which can regulate the synthesis, levels, activity, or function of the protein of interest. The term includes binding with other molecules and complex formation. Therefore, the term "protein inhibitor" refers to any agent or compound, the application of which results in the inhibition of protein function or protein pathway function. However, the term does not imply that each and every one of these functions must be inhibited at the same time.

As used herein, "inhibiting RSK" refers to the use of any compound, agent, or mechanism to inhibit RSK synthesis, levels, activity, or function are reduced or inhibited as described above. As used herein, an "instructional material" includes a publication, a recording, a diagram, or any other medium of expression which can be used to communicate the usefulness of the peptide of the present disclosure in the kit for effecting alleviation of the various diseases or disorders recited herein. Optionally, or alternately, the instructional material may describe one or more methods of alleviating the diseases or disorders in a cell or a tissue of a mammal.

As used herein, "modification" of a compound refers to a compound that's structure or composition has been changed from the original compound. As used herein, "pharmaceutical compositions" includes formulations for human and veterinary use.

The term "protein regulatory pathway", as used herein, refers to both the upstream regulatory pathway which regulates a protein, as well as the downstream events which that protein regulates. Such regulation includes, but is not limited to, transcription, translation, levels, activity, posttranslational modification, and function of the protein of interest, as well as the downstream events which the protein regulates.

The terms "protein pathway" and "protein regulatory pathway" are used interchangeably herein.

As used herein, the term "purified" and the like terms relate to the isolation of a molecule or compound in a form that is substantially free (at least 60% free, 75% free, or 90% free) from other components normally associated with the molecule or compound in a native environment. The term "regulate" refers to either stimulating or inhibiting a function or activity of interest.

As used herein, the use of the term "RSK" is intended to refer genetically to all the human RSK isotypes, including RSKl, RSK2, RSK3, and RSK4. RSKl, RSK2, RSK3, and RSK4 are specific human isotypes that have previously been described in the literature.

The term "RSK activity", as used herein, includes synthesis, levels, activity, or function of RSK.

As used herein, the term "RSK inhibitor" includes any compound or condition that specifically inhibits or reduces the kinase activity of RSK or which inhibits any function of RSK. Such inhibitory effects may result from directly, or indirectly, interfering with the protein's ability to phosphorylate its substrate, or may result from inhibiting the expression (transcription and/or translation) of RSK.

As used herein, "inhibiting RSK" refers to the use of any compound, agent, or mechanism to inhibit RSK synthesis, levels, activity, or function are reduced or inhibited.

As used herein, the term "antibody" refers to immunoglobulin molecules and immunologically active portions of immunoglobulin molecules, i.e., molecules that contain an antigen binding site that immunospecifically binds an antigen. The immunoglobulin molecules can be of any type (e.g., IgG, IgE, IgM, IgD, IgA and IgY), class (e.g., IgGl, IgG2, IgG3, IgG4, IgAl and IgA2) or subclass of immunoglobulin molecule. Moreover, the term "antibody" (Ab) or "monoclonal antibody" (mAb) is meant to include intact molecules, as well as, antibody fragments (including, for example, Fab and F(ab')₂ fragments) which are capable of specifically binding to a protein. Fab and F(ab')₂ fragments lack the Fc fragment of intact antibody, clear more rapidly from the circulation of the animal or plant, and may have less non-specific tissue binding than an intact antibody (Wahl, et al., J Nucl Med 24:316 (1983)). The term "standard," as used herein, refers to something used for comparison. For example, it can be a known standard agent or compound which is administered and used for comparing results when administering a test compound, or it can be a standard parameter or function which is measured to obtain a control value when measuring an effect of an agent or compound on a parameter or function. Standard can also refer to an "internal standard", such as an agent or compound which is added at known amounts to a sample and is useful in determining such things as purification or recovery rates when a sample is processed or subjected to purification or extraction procedures before a marker of interest is measured. Internal standards are often a purified marker of interest which has been labeled, such as with a radioactive isotope, allowing it to be distinguished from an endogenous marker.

A "subject" of analysis, diagnosis, or treatment is an animal. Such animals include mammals, and more typically a human. The term "host" and "subject" are used interchangeably herein.

As used herein the term "patient" without further designation is intended to encompass any warm blooded vertebrate domesticated animal (including for example, but not limited to livestock, horses, cats, dogs and other pets) and humans.

A "prophylactic" treatment is a treatment administered to a subject, who either does not exhibit signs of a disease or exhibits only early signs of the disease, for the purpose of decreasing the risk of developing pathology associated with the disease.

The general chemical terms used in the description of the compounds of the present disclosure have their usual meanings. For example, the term "alkyl" by itself or as part of another substituent means a straight or branched aliphatic chain having the stated number of carbon atoms.

The term "Ci-C_n alkyl" wherein n can be from 1 through 6, as used herein, represents a branched or linear alkyl group having from one to the specified number of carbon atoms. Typical CpC₆ alkyl groups include, but are not limited to, methyl, ethyl, n-propyl, iso-propyl, butyl, iso-butyl, sec-butyl, tert-butyl, pentyl, hexyl and the like.

The terms "C₂-C_n alkenyl" wherein n can be from 2 through 6, as used herein, represents an olefϊnically unsaturated branched or linear group having from 2 to the specified number of carbon atoms and at least one double bond. Examples of such groups include, but are not limited to, 1-propenyl, 2-propenyl (-CH₂-CH=CH₂),

1,3-butadienyl, (-CH=CHCH=CH₂), 1-butenyl (-CH=CHCH₂CH₃), hexenyl, pentenyl, and the like.

The term "C₂-C_n alkynyl" wherein n can be from 2 to 6, refers to an unsaturated branched or linear group having from 2 to n carbon atoms and at least one triple bond. Examples of such groups include, but are not limited to, 1 -propynyl, 2- propynyl, 1-butynyl, 2-butynyl, 1-pentynyl, and the like.

As used herein the term "aryl" refers to a mono- or bicyclic carbocyclic ring system having one or two aromatic rings including, but not limited to, phenyl, naphthyl, tetrahydronaphthyl, indanyl, indenyl, and the like. The size of the aryl ring and the presence of substituents or linking groups are indicated by designating the number of carbons present. For example, the term "(Ci-C₃ alkyl)(C₆-Ci₀ aryl)" refers to a 5 to 10 membered aryl that is attached to a parent moiety via a one to three membered alkyl chain. The term "heteroaryl" as used herein refers to a mono- or bi- cyclic ring system containing one or two aromatic rings and containing at least one nitrogen, oxygen, or sulfur atom in an aromatic ring. The size of the heteroaryl ring and the presence of substituents or linking groups are indicated by designating the number of carbons present. For example, the term "(Ci-C_n alkyl)(C₅-C₆ heteroaryl)" refers to a 5 or 6 membered heteroaryl that is attached to a parent moiety via a one to "n" membered alkyl chain.

The term "acyl" refers to alkylcarbonyl species and includes any group or radical of the form RCO- where R is an organic group. The term "acyl" further comprises an organic radical derived from an organic acid by removal of the hydroxyl group from the carboxyl group. The terms "acyl" and "OAc" are used interchangeably herein. The term "acylation" refers to the process of adding an acyl group to a compound. The term butyryl as used herein is a carboxylic acid with the structural formula CH₃CH₂CH₂-COOH.

The term "halo" includes bromo, chloro, fluoro, and iodo.

The term "haloalkyl" as used herein refers to an alkyl radical bearing at least one halogen substituent, for example, chloromethyl, fluoroethyl or trifluoromethyl and the like.

The term "C₃-Cn cycloalkyl" wherein n = 3-8, represents the compounds cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl.

The term "heterocyclic group" refers to a C₃-C₈ cycloalkyl group containing from one to three heteroatoms wherein the heteroatoms are selected from the group consisting of oxygen, sulfur, and nitrogen.

The term "bicyclic" represents either an unsaturated or saturated stable 7-to 12-membered bridged or fused bicyclic carbon ring. The bicyclic ring may be attached at any carbon atom which affords a stable structure. The term includes, but is not limited to, naphthyl, dicyclohexyl, dicyclohexenyl, and the like.

The term "lower alkyl" as used herein refers to branched or straight chain alkyl groups comprising one to eight carbon atoms, including methyl, ethyl, propyl, isopropyl, n-butyl, t-butyl, neopentyl and the like.

The term "heteroatom" means for example oxygen, sulfur, nitrogen, phosphorus, or silicon (including, any oxidized form of nitrogen, sulfur, phosphorus, or silicon; the quaternized form of any basic nitrogen or; a substitutable nitrogen of a heterocyclic ring.

The compounds of the present disclosure can contain one or more asymmetric centers in the molecule. In accordance with the present disclosure any structure that does not designate the stereochemistry is to be understood as embracing all the various optical isomers, as well as racemic mixtures thereof. The present disclosure includes within its scope all such isomers and mixtures thereof. The compounds of the present disclosure may exist in tautomeric forms and the present disclosure includes both mixtures and separate individual tautomers. For example, the following structure:

NT NH is understood to represent a mixture of the structures:

N NH HN ^X N as well as

EMBODIMENTS As disclosed herein, a novel method of inhibiting angiogenesis is provided. Applicants have discovered that RSK activity is required for endothelial cell migration. Since endothelial migration is an early required step in the process of angiogenesis, a method that inhibits endothelial cell migration will effectively inhibit angiogenesis. Therefore, applicants have discovered that an antagonist of RSK activity can be used to inhibit endothelial cell migration and thus inhibit angiogenesis. In accordance with one embodiment an effective amount of a RSK antagonist is administered to a patient in need of anti-angiogenesis therapy. In one embodiment the patient in need of anti-angiogenesis therapy is suffering from an inflammatory related disease (including for example, rheumatoid arthritis, osteoarthritis, inflammatory lung disease, inflammatory bowel disease, atherosclerosis, psoriasis and diabetic retinopathy). In another embodiment the patient in need of anti-angiogenesis therapy is suffering from a non-leukemia cancer or tumor.

In accordance with one embodiment a method of inhibiting endothelial cell migration (and thus inhibiting angiogenesis) is provided. In one embodiment the method comprises inhibiting angiogenesis in a patient, including a human, in need of anti-angiogenic therapy. The method comprises the step of contacting endothelial cells with a RSK inhibitor. In accordance with one embodiment the RSK inhibitor is formulated in a pharmaceutically acceptable carrier and is administered using standard routes including, but not limited to, topical, oral, intravenous, intramuscular, intra-arterial, intramedullary, intrathecal, intraventricular, transdermal, subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual, or rectal means.

Increased vascularization is critical in the progression of several pathologies including arthritis, diabetic retinopathy, and tumor proliferation, and is an essential process underlying tumor growth and metastasis. Thus, the administration of compositions comprising RSK inhibitors inhibits angiogenesis by stopping the initial processes (i.e., endothelial cell migration) involved in progression of inflammatory diseases and cancers. Therefore, the disclosed RSK inhibitor compositions can be used to treat such pathologies. In accordance with one embodiment pharmaceutical compositions comprising a RSK inhibitor can be injected locally, including injecting adjacent to, or directly into, a site in need of anti- angiogenic therapy. In one embodiment the RSK inhibitor composition is injected into or near a tumor. In an alternative embodiment the RSK inhibitor can be conjugated to a targeting moiety wherein the targeting moiety causes localization of the administered RSK inhibitor to a particular tissue or cell. In accordance with one embodiment the RSK inhibitor is conjugated to an antibody, including for example, an anti-tumor monoclonal antibody.

In accordance with one embodiment, the RSK inhibitor of the anti- angiogenesis compositions may include any drug, chemical compound, siRNA, antisense oligonucleotide, peptide, peptide mimetic, aptamer, antibody, or other material/agent that inhibits RSK function or activity or upstream regulators of RSK, or downstream signal pathways regulated by RSK. In one embodiment the RSK inhibitor is selected from antibodies, oligonucleotides, antisense oligonucleotides, small interfering RNAs, protein synthesis inhibitors, peptide mimetics, aptamers, and kinase inhibitors. In one embodiment the RSK inhibitor is selected from the group consisting of an anti-sense oligonucleotide and an interfering oligonucleotide, and more particularly, in one embodiment the RSK inhibitor comprises an interfering oligonucleotide directed against Rskl, Rsk2, Rsk3 or Rsk4.

The compositions may include additional active components including other known anti-angiogenic agents. In accordance with one embodiment the RSK inhibitory compound is combined with one or more known anti-angiogenic agents selected from the group consisting of 2-methoxyestradiol, prinomastat, batimastat, BAY 12-9566, carboxyamidotriazole, CC- 1088, dextromethorphan acetic, dimethylxanthenone acetic acid, EMD 121974, endostatin, IM-862, marimastat, matrix metalloproteinase, penicillamine, PTK787/ZK 222584, RPI.4610, squalamine, squalamine lactate, SU5416, (+/-)-thalidomide, S-thalidomide, R-thalidomide, TNP- 470, combretastatin, tamoxifen, COL-3, neovastat, BMS-275291, SU6668, interferon- alpha, anti-VEGF antibody, Medi-522 (Vitaxin II), CAI, celecoxib, Interleukin-12, IM862, Amilloride, Angiostatin® Protein, Angiostatin Kl -3, Angiostatin Kl -5, Captopril, DL-alpha-Difluoromethylornithine, DL-alpha-Difluoromethylornithine HCl, Endostatin™ Protein, Fumagillin, Herbimycin A, 4-Hydroxyphenylretinamide, gamma-interferon, Juglone, Laminin, Laminin Hexapeptide, Laminin Pentapeptide, Lavendustin A, Medroxyprogesterone, Medroxyprogesterone Acetate, Minocycline, Minocycline HCl, Placental Ribonuclease Inhibitor, Suramin, Sodium Salt Suramin, Human Platelet Thrombospondin, Tissue Inhibitor of Metalloproteinase 1, Neutrophil Granulocyte Tissue Inhibitor of Metalloproteinase 1, and Rheumatoid Synovial Fibroblast Tissue Inhibitor of Metalloproteinase 2. In accordance with one embodiment the RSK inhibitor is combined with a known anti-angiogenic agent such as Avastin or other monoclonal antibody against VCAM.

In accordance with one embodiment the RSK inhibitor comprises a flavonoid-like compound having the structure of Formula II:

wherein R₁, R_2; and R₅ are independently selected from the group consisting of OH, OCOR₈, COR_8, SR_8, and C₁-C₄ alkoxy;

R₃, R₄, R₆, R₇ are independently selected from the group consisting of H, OH, OCOR₈, COR₈, SR₈, and C₁-C₄ alkoxy; R₈ is H or C₁-C₄ alkyl; and

R.₉, Rio and Rn are independently selected from the group consisting of H, OH,

OCOR₈, COR₈, NHOCOR₈ and C_rC₄ alkoxy. In one embodiment when Ri, R_2; and R₅ are each OH, one of R₉, R₁₀ and Rn are not OH. In accordance with one embodiment at least one of Ri, R_2, and R₅ is SR₈ or alternatively at least one of R9, Rio and Rn is NHOCOR₈. In accordance with one embodiment, Ri and R₂ are both OH. In a further embodiment a compound of Formula II is provided wherein Ri and R₂ are both OH, R₉, R_J0 and Ri ₁ are independently selected from the group consisting of H, OH and OCOR₈, R₃ and R₇ are each H, and R_4, R₅, and R₆ are independently selected from the group consisting of H, OR₈, OCOR₈, and COR₈, wherein R₈ is H or methyl, with the proviso that R₉, Ri₀ and Ri ₁ are not each OH. In one embodiment Ri, R₂ and R₅ are OH, R₉ and Rio are independently selected from the group consisting of OH, COR₈, Ci-C₄ alkoxy and OCOCH₃, R₁₁ is OCOCH₃, R₈ is H or methyl, R₃, R₄ and R₇ are each H and R₆ is H or OH. In an alternative embodiment R], R₂ and R₅ are each OH, R₉ and Rio are independently selected from the group consisting of OH and OCOCH₃, Rn is OCOCH₃, R₃, R₄ and R₇ are each H and R₆ is H or hydroxy.

In an alternative embodiment a compound is provided having the general structure of Formula II as disclosed above, but having one or more sulfhydryls (-SH) groups substituting at positions on the flavonoid ring that designate a hydroxyl group (i.e., at positions Ri, R₂, R₃, R₄₁R₅, R₆ and R₇). In one embodiment a compound is provided having the general structure of Formula II as disclosed above, wherein one or more sulfhydryls (-SH) groups are present at positions selected from the group consisting of Ri, R₂ and R₅. In a further alternative embodiment a compound is provided having the general structure of Formula II as disclosed above, but having one or more acetamide (NHOCCH₃) groups substituting at positions on the sugar moiety that designate a hydroxyl group (i.e., at positions R₉, Rio and Rn). In one embodiment the acetamide can be a substituted acetamide comprising NHOCOR₈. In one aspect, the compounds encompassed by Formula II have greater stability in their interaction with RSK than does SLOlOl in its interaction with RSK. In another aspect, the compounds of Formula II have a greater ability to inhibit RSK than does SLOlOl. In one embodiment the present disclosure is directed to a compound represented by the general structure:

R, wherein R₆ is H or OH, and Rg, R₁₀ and Rn are independently selected from the group consisting of hydroxy OCOR₈, COR₈, C₁-C₄ alkoxy, and R₈ is H or CH₃, with the proviso that R₉, Rj₀ and Rn are not all hydroxy. In one embodiment R₆ is H or OH and R9 and R₁₀ are independently selected from the group consisting of hydroxy and OCOCH₃ and R₁₁ is OCOCH₃. In accordance with one embodiment the RSK inhibitor is SLOlOl.

SLOlOl is a kaempferol related compound, wherein kaempferol has the structure:

Kaempferol while SLOlOl has the structure of Formula I:

wherein R₉ is OH and R₁₀ and Rn are each OAc.

In one embodiment, RSK inhibitor compounds representing derivatives of Formula III are provided, wherein Rg_, Ri₀ and R₁₁ are independently selected from OH, OAc and butyryl as well as further modifications of such compounds wherein the modifications do not adversely affect the desired activity described herein.

For example, additional compounds are encompassed by the present disclosure wherein the compounds have been modified to include greater stability of interactions between the compound and RSK and thus provide compounds having a greater efficacy than SLOlOl . In one aspect, this is accomplished by replacing the hydroxyl groups of the compound of Formula III with sulfhydryls. In another aspect, this is accomplished by replacing the hydroxyl groups of the sugar moiety of the compound of Formula III with acetamide, or derivatives of acetamide. To that end, the present disclosure further provides a compound having the structure of formula II:

wherein R₁, R₂, R₃, R_t1R₅, R₆, and R₇ are independently selected from the group consisting of OH, -OCOR₈, -COR_8, -SR_8, and C₁-C₄ alkoxy;

R₈ is H or CpC₄ alkyl; and

R₉, R₁₀ and R₁₁ are independently selected from the group consisting of H, OH,

OCOR₈, COR₈, NHOCOR₈, NHOCR₈ and C₁-C₄ alkoxy.

The compounds of formula II may also include acyl and butyryl groups. In one embodiment, the compounds comprised by Formula II encompass replacing the hydroxyl groups of the flavonoid with sulfhydryls (-SH).

The compounds comprised by Formula II further encompass replacing the hydroxyl groups on the sugar with an acetamide (NHOCR₈), including for example:

or substituted acetamide such as

In cases where compounds are sufficiently basic or acidic to form acid or base salts, use of the compounds as salts may be appropriate. Examples of acceptable salts are organic acid addition salts formed with acids which form a physiological acceptable anion, for example, tosylate, methanesulfonate, acetate, citrate, malonate, tartarate, succinate, benzoate, ascorbate, oketoglutarate, and a- glycerophosphate. Suitable inorganic salts may also be formed, including hydrochloride, sulfate, nitrate, bicarbonate, and carbonate salts.

Pharmaceutically acceptable salts may be obtained using standard procedures well known in the art, for example by reacting a sufficiently basic compound such as an amine with a suitable acid affording a physiologically acceptable anion. Alkali metal (for example, sodium, potassium or lithium) or alkaline earth metal (for example calcium) salts of carboxylic acids can also be made. In one embodiment aptamers are used to inhibit RSK activity. As used herein the term aptamer refers to a compound that is selected in vitro to bind preferentially to another compound (in this case the identified proteins). In one aspect, aptamers are nucleic acids or peptides, because random sequences can be readily generated from nucleotides or amino acids (both naturally occurring or synthetically made) in large numbers but they need not be limited to these polymers. In another aspect, the nucleic acid aptamers are short strands of DNA that bind protein targets. In one aspect, the aptamers are oligonucleotide aptamers. Oligonucleotide aptamers are oligonucleotides which can bind to a specific protein sequence of interest. A general method of identifying aptamers is to start with partially degenerate oligonucleotides, and then simultaneously screen the many thousands of oligonucleotides for the ability to bind to a desired protein. The bound oligonucleotide can be eluted from the protein and sequenced to identify the specific recognition sequence. Transfer of large amounts of a chemically stabilized aptamer into cells can result in specific binding to a polypeptide of interest, thereby blocking its function. [For example, see the following publications describing in vitro selection of aptamers: Klug et al., MoI. Biol. Reports 20:97-107 (1994); Wallis et al., Chem. Biol. 2:543-552 (1995); Ellington, Curr. Biol. 4:427-429 (1994); Lato et al., Chem. Biol. 2:291-303 (1995); Conrad et al., MoI. Div. 1 :69-78 (1995); and Uphoff et al., Curr. Opin. Struct. Biol. 6:281-287 (1996)].

The present application encompasses the use of siRNA for blocking the pathways and proteins identified herein. An siRNA of the present disclosure can be further used with other regulators described herein, or known in the art, such as peptides, antisense oligonucleotides, nucleic acids encoding peptides described herein, aptamers, antibodies, kinase inhibitors, and drugs/agents/compounds. In one embodiment, an siRNA directed against proteins of the signal transduction pathways described herein. In one aspect, the siRNA is directed against RSK. In one aspect, the siRNA is directed against RSKl . In another aspect, the siRNA is directed against RSK2.

Aptamers offer advantages over other oligonucleotide-based approaches that artificially interfere with target gene function due to their ability to bind protein products of these genes with high affinity and specificity. However, RNA aptamers can be limited in their ability to target intracellular proteins since even nuclease-resistant aptamers do not efficiently enter the intracellular compartments. Moreover, attempts at expressing RNA aptamers within mammalian cells through vector-based approaches have been hampered by the presence of additional flanking sequences in expressed RNA aptamers, which may alter their functional conformation.

The idea of using single-stranded nucleic acids (DNA and RNA aptamers) to target protein molecules is based on the ability of short sequences (20 mers to 80 mers) to fold into unique 3D conformations that enable them to bind targeted proteins with high affinity and specificity. RNA aptamers have been expressed successfully inside eukaryotic cells, such as yeast and multicellular organisms, and have been shown to have inhibitory effects on their targeted proteins in the cellular environment.

In addition to the specific inhibiting compounds disclosed herein, additional compounds and methodologies can be used to inhibit the targeted pathways and enzymatic activities that are known in the art but not specifically disclosed herein. For example, various modulators/effectors are known, e.g. antibodies, biologically active nucleic acids, ribozymes or low-molecular weight organic compounds that recognize specific polynucleotides or polypeptides can also be used in accordance with the disclosed methods. Antibodies directed against proteins, polypeptides, or peptide fragments thereof of the present disclosure may be generated using methods that are well known in the art. For instance, U.S. patent application no. 07/481,491, which is incorporated by reference herein in its entirety, discloses methods of raising antibodies to peptides. For the production of antibodies, various host animals, including but not limited to rabbits, mice, and rats, can be immunized by injection with a polypeptide or peptide fragment thereof. To increase the immunological response, various adjuvants may be used depending on the host species, including but not limited to Freund's (complete and incomplete), mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanins, dinitrophenol, and potentially useful human adjuvants such as BCG (bacille Calmette-Guerin) and corynebacterium parvum. For the preparation of monoclonal antibodies, any technique which provides for the production of antibody molecules by continuous cell lines in culture may be utilized. For example, the hybridoma technique originally developed by Kohler and Milstein (1975, Nature 256:495-497), the trioma technique, the human B- cell hybridoma technique (Kozbor et al, 1983, Immunology Today 4:72), and the EB V-hybridoma technique (Cole et al, 1985, in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96) may be employed to produce human monoclonal antibodies. In another embodiment, monoclonal antibodies are produced in germ-free animals utilizing the technology described in international application no. PCT/US90/02545, which is incorporated by reference herein in its entirety. In accordance with the present disclosure, human antibodies may be used and obtained by utilizing human hybridomas (Cote et al, 1983, Proc. Natl. Acad. Sd. U.S.A. 80:2026-2030) or by transforming human B cells with EBV virus in vitro (Cole et al, 1985, in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96). Furthermore, techniques developed for the production of "chimeric antibodies" (Morrison et al. , 1984, Proc. Natl. Acad. Sd. U.S.A. 81 :6851 -6855; Neuberger et al, 1984, Nature 312:604-608; Takeda et al, 1985, Nature 314:452- 454) by splicing the genes from a mouse antibody molecule specific for epitopes of SLLP polypeptides together with genes from a human antibody molecule of appropriate biological activity can be employed; such antibodies are within the scope of the present disclosure. Once specific monoclonal antibodies have been developed, the preparation of mutants and variants thereof by conventional techniques is also available. In one embodiment, techniques described for the production of single- chain antibodies (U.S. Patent No. 4,946,778, incorporated by reference herein in its entirety) are adapted to produce protein-specific single-chain antibodies. In another embodiment, the techniques described for the construction of Fab expression libraries (Huse et al, 1989, Science 246:1275-1281) are utilized to allow rapid and easy identification of monoclonal Fab fragments possessing the desired specificity for specific antigens, proteins, derivatives, or analogs of the present disclosure.

Antibody fragments which contain the idiotype of the antibody molecule can be generated by known techniques. For example, such fragments include but are not limited to: the F(ab')₂ fragment which can be produced by pepsin digestion of the antibody molecule; the Fab' fragments which can be generated by reducing the disulfide bridges of the F(ab')₂ fragment; the Fab fragments which can be generated by treating the antibody molecule with papain and a reducing agent; and Fv fragments. The generation of polyclonal antibodies is accomplished by inoculating the desired animal with the antigen and isolating antibodies which specifically bind the antigen therefrom.

Monoclonal antibodies directed against full length or peptide fragments of a protein or peptide may be prepared using any well known monoclonal antibody preparation procedures, such as those described, for example, in Harlow et al. (1988, In: Antibodies, A Laboratory Manual, Cold Spring Harbor, NY) and in Tuszynski et al. (1988, Blood, 72:109-115). Quantities of the desired peptide may also be synthesized using chemical synthesis technology. Alternatively, DNA encoding the desired peptide may be cloned and expressed from an appropriate promoter sequence in cells suitable for the generation of large quantities of peptide. Monoclonal antibodies directed against the peptide are generated from mice immunized with the peptide using standard procedures as referenced herein.

A nucleic acid encoding the monoclonal antibody obtained using the procedures described herein may be cloned and sequenced using technology which is available in the art, and is described, for example, in Wright et al, (1992, Critical Rev. in Immunol. 12(3 ,4): 125- 168) and the references cited therein. Further, the antibody of the present disclosure may be "humanized" using the technology described in Wright et al., (supra) and in the references cited therein, and in Gu et al. (1997, Thrombosis and Hematocyst 77(4):755-759).

To generate a phage antibody library, a cDNA library is first obtained from mRNA which is isolated from cells, e.g., the hybridoma, which express the desired protein to be expressed on the phage surface, e.g., the desired antibody. cDNA copies of the mRNA are produced using reverse transcriptase. cDNA which specifies immunoglobulin fragments are obtained by PCR and the resulting DNA is cloned into a suitable bacteriophage vector to generate a bacteriophage DNA library comprising DNA specifying immunoglobulin genes. The procedures for making a bacteriophage library comprising heterologous DNA are well known in the art and are described, for example, in Sambrook et al. (1989, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, NY).

Bacteriophage which encode the desired antibody, may be engineered such that the protein is displayed on the surface thereof in such a manner that it is available for binding to its corresponding binding protein, e.g., the antigen against which the antibody is directed. Thus, when bacteriophage which express a specific antibody are incubated in the presence of a cell which expresses the corresponding antigen, the bacteriophage will bind to the cell. Bacteriophage which do not express the antibody will not bind to the cell. Such panning techniques are well known in the art.

Processes such as those described above, have been developed for the production of human antibodies using M13 bacteriophage display (Burton et al., 1994, Adv. Immunol. 57:191-280). Essentially, a cDNA library is generated from mRNA obtained from a population of antibody-producing cells. The mRNA encodes rearranged immunoglobulin genes and thus, the cDNA encodes the same. Amplified cDNA is cloned into Ml 3 expression vectors creating a library of phage which express human Fab fragments on their surface. Phage which display the antibody of interest are selected by antigen binding and are propagated in bacteria to produce soluble human Fab immunoglobulin. Thus, in contrast to conventional monoclonal antibody synthesis, this procedure immortalizes DNA encoding human immunoglobulin rather than cells which express human immunoglobulin.

The procedures just presented describe the generation of phage which encode the Fab portion of an antibody molecule. However, the present disclosure should not be construed to be limited solely to the generation of phage encoding Fab antibodies. Rather, phage which encode single chain antibodies (scFv/phage antibody libraries) are also included in the present disclosure. Fab molecules comprise the entire Ig light chain, that is, they comprise both the variable and constant region of the light chain, but include only the variable region and first constant region domain (CHl) of the heavy chain. Single chain antibody molecules comprise a single chain of protein comprising the Ig Fv fragment. An Ig Fv fragment includes only the variable regions of the heavy and light chains of the antibody, having no constant region contained therein. Phage libraries comprising scFv DNA may be generated following the procedures described in Marks et al., 1991, J. MoI. Biol. 222:581-597. Panning of phage so generated for the isolation of a desired antibody is conducted in a manner similar to that described for phage libraries comprising Fab DNA.

The present disclosure also encompasses synthetic phage display libraries in which the heavy and light chain variable regions may be synthesized such that they include nearly all possible specificities (Barbas, 1995, Nature Medicine 1 :837-839; de Kruif et al. 1995, J. MoI. Biol.248:97-105).

In the production of antibodies, screening for the desired antibody can be accomplished by techniques known in the art, e.g., ELISA (enzyme-linked immunosorbent assay). Antibodies generated in accordance with the present disclosure may include, but are not limited to, polyclonal, monoclonal, chimeric (i.e., "humanized"), and single chain (recombinant) antibodies, Fab fragments, and fragments produced by a Fab expression library.

The peptides of the present disclosure may be readily prepared by standard, well-established techniques, such as solid-phase peptide synthesis (SPPS) as described by Stewart et al. in Solid Phase Peptide Synthesis, 2nd Edition, 1984, Pierce Chemical Company, Rockford, Illinois; and as described by Bodanszky and Bodanszky in The Practice of Peptide Synthesis, 1984, Springer- Verlag, New York. At the outset, a suitably protected amino acid residue is attached through its carboxyl group to a derivatized, insoluble polymeric support, such as cross-linked polystyrene or polyamide resin. "Suitably protected" refers to the presence of protecting groups on both the α-amino group of the amino acid, and on any side chain functional groups. Side chain protecting groups are generally stable to the solvents, reagents and reaction conditions used throughout the synthesis, and are removable under conditions which will not affect the final peptide product. Stepwise synthesis of the oligopeptide is carried out by the removal of the N-protecting group from the initial amino acid, and couple thereto of the carboxyl end of the next amino acid in the sequence of the desired peptide. This amino acid is also suitably protected. The carboxyl of the incoming amino acid can be activated to react with the N-terminus of the support- bound amino acid by formation into a reactive group such as formation into a carbodiimide, a symmetric acid anhydride or an "active ester" group such as hydroxybenzotriazole or pentafiuorophenly esters.

Examples of solid phase peptide synthesis methods include the BOC method which utilized tert-butyloxcarbonyl as the α-amino protecting group, and the FMOC method which utilizes 9-fluorenylmethyloxcarbonyl to protect the α-amino of the amino acid residues, both methods of which are well known by those of skill in the art.

Incorporation of N- and/or C- blocking groups can also be achieved using protocols conventional to solid phase peptide synthesis methods. For incorporation of C-terminal blocking groups, for example, synthesis of the desired peptide is typically performed using, as solid phase, a supporting resin that has been chemically modified so that cleavage from the resin results in a peptide having the desired C-terminal blocking group. To provide peptides in which the C-terminus bears a primary amino blocking group, for instance, synthesis is performed using a p- methylbenzhydrylamine (MBHA) resin so that, when peptide synthesis is completed, treatment with hydrofluoric acid releases the desired C-terminally amidated peptide. Similarly, incorporation of an N-methylamine blocking group at the C-terminus is achieved using N-methylaminoethyl-derivatized DVB, resin, which upon HF treatment releases a peptide bearing an N-methylamidated C-terminus. Blockage of the C-terminus by esterification can also be achieved using conventional procedures. This entails use of resin/blocking group combination that permits release of side-chain peptide from the resin, to allow for subsequent reaction with the desired alcohol, to form the ester function. FMOC protecting group, in combination with DVB resin derivatized with methoxyalkoxybenzyl alcohol or equivalent linker, can be used for this purpose, with cleavage from the support being effected by TFA in dicholoromethane. Esterification of the suitably activated carboxyl function e.g. with DCC, can then proceed by addition of the desired alcohol, followed by deprotection and isolation of the esterified peptide product.

Incorporation of N-terminal blocking groups can be achieved while the synthesized peptide is still attached to the resin, for instance by treatment with a suitable anhydride and nitrile. To incorporate an acetyl-blocking group at the N- terminus, for instance, the resin-coupled peptide can be treated with 20% acetic anhydride in acetonitrile. The N-blocked peptide product can then be cleaved from the resin, deprotected and subsequently isolated.

To ensure that the peptide obtained from either chemical or biological synthetic techniques is the desired peptide, analysis of the peptide composition should be conducted. Such amino acid composition analysis may be conducted using high- resolution mass spectrometry to determine the molecular weight of the peptide. Alternatively, or additionally, the amino acid content of the peptide can be confirmed by hydrolyzing the peptide in aqueous acid, and separating, identifying and quantifying the components of the mixture using HPLC, or an amino acid analyzer. Protein sequenators, which sequentially degrade the peptide and identify the amino acids in order, may also be used to determine definitely the sequence of the peptide. Prior to its use, the peptide is purified to remove contaminants. In this regard, it will be appreciated that the peptide will be purified so as to meet the standards set out by the appropriate regulatory agencies. Any one of a number of a conventional purification procedures may be used to attain the required level of purity including, for example, reversed-phase high-pressure liquid chromatography (HPLC) using an alkylated silica column such as C4 -, C8- or Cl 8- silica. A gradient mobile phase of increasing organic content is generally used to achieve purification, for example, acetonitrile in an aqueous buffer, usually containing a small amount of trifluoroacetic acid. Ion-exchange chromatography can be also used to separate peptides based on their charge.

It will be appreciated, of course, that the peptides or antibodies, derivatives, or fragments thereof may incorporate amino acid residues which are modified without affecting activity. For example, the termini may be derivatized to include blocking groups, i.e. chemical substituents suitable to protect and/or stabilize the N- and C-termini from "undesirable degradation", a term meant to encompass any type of enzymatic, chemical or biochemical breakdown of the compound at its termini which is likely to affect the function of the compound, i.e. sequential degradation of the compound at a terminal end thereof.

Blocking groups include protecting groups conventionally used in the art of peptide chemistry which will not adversely affect the in vivo activities of the peptide. For example, suitable N-terminal blocking groups can be introduced by alkylation or acylation of the N-terminus. Examples of suitable N-terminal blocking groups include C₁-C₅ branched or unbranched alkyl groups, acyl groups such as formyl and acetyl groups, as well as substituted forms thereof, such as the acetamidomethyl (Acm) group. Desamino analogs of amino acids are also useful N- terminal blocking groups, and can either be coupled to the N-terminus of the peptide or used in place of the N-terminal reside. Suitable C-terminal blocking groups, in which the carboxyl group of the C-terminus is either incorporated or not, include esters, ketones or amides. Ester or ketone-forming alkyl groups, particularly lower alkyl groups such as methyl, ethyl and propyl, and amide-forming amino groups such as primary amines (-NH₂), and mono- and di-alkylamino groups such as methylamino, ethylamino, dimethylamino, diethylamino, methylethylamino and the like are examples of C-terminal blocking groups. Descarboxylated amino acid analogues such as agmatine are also useful C-terminal blocking groups and can be either coupled to the peptide's C-terminal residue or used in place of it. Further, it will be appreciated that the free amino and carboxyl groups at the termini can be removed altogether from the peptide to yield desamino and descarboxylated forms thereof without affect on peptide activity.

Other modifications can also be incorporated without adversely affecting the activity and these include, but are not limited to, substitution of one or more of the amino acids in the natural L-isomeric form with amino acids in the D- isomeric form. Thus, the peptide may include one or more D-amino acid resides, or may comprise amino acids which are all in the D-form. Retro-inverso forms of peptides in accordance with the present disclosure are also contemplated, for example, inverted peptides in which all amino acids are substituted with D-amino acid forms. Acid addition salts of the present disclosure are also contemplated as functional equivalents. Thus, a peptide in accordance with the present disclosure treated with an inorganic acid such as hydrochloric, hydrobromic, sulfuric, nitric, phosphoric, and the like, or an organic acid such as an acetic, propionic, glycolic, pyruvic, oxalic, malic, malonic, succinic, maleic, fumaric, tataric, citric, benzoic, cinnamie, mandelic, methanesulfonic, ethanesulfonic, p-toluenesulfonic, salicyclic and the like, to provide a water soluble salt of the peptide is suitable for use in the present disclosure. The present disclosure also provides for homologs of proteins and peptides. Homologs can differ from naturally occurring proteins or peptides by conservative amino acid sequence differences or by modifications which do not affect sequence, or by both.

For example, conservative amino acid changes may be made, which although they alter the primary sequence of the protein or peptide, do not normally alter its function. To that end, 10 or more conservative amino acid changes typically have no effect on peptide function.

Modifications (which do not normally alter primary sequence) include in vivo, or in vitro chemical derivatization of polypeptides, e.g., acetylation, or carboxylation. Also included are modifications of glycosylation, e.g., those made by modifying the glycosylation patterns of a polypeptide during its synthesis and processing or in further processing steps; e.g., by exposing the polypeptide to enzymes which affect glycosylation, e.g., mammalian glycosylating or deglycosylating enzymes. Also embraced are sequences which have phosphorylated amino acid residues, e.g., phosphotyrosine, phosphoserine, or phosphothreonine.

Also included are polypeptides or antibody fragments which have been modified using ordinary molecular biological techniques so as to improve their resistance to proteolytic degradation or to optimize solubility properties or to render them more suitable as a therapeutic agent. Homologs of such polypeptides include those containing residues other than naturally occurring L-amino acids, e.g., D-amino acids or non-naturally occurring synthetic amino acids. The peptides of the present disclosure are not limited to products of any of the specific exemplary processes listed herein.

Substantially pure protein obtained as described herein may be purified by following known procedures for protein purification, wherein an immunological, enzymatic or other assay is used to monitor purification at each stage in the procedure. Protein purification methods are well known in the art, and are described, for example in Deutscher et al. (ed., 1990, Guide to Protein Purification, Harcourt Brace Jovanovich, San Diego).

The present disclosure also provides nucleic acids encoding peptides, proteins, and antibodies of the present disclosure. By "nucleic acid" is meant any nucleic acid, whether composed of deoxyribonucleosides or ribonucleosides, and whether composed of phosphodiester linkages or modified linkages such as phosphotriester, phosphoramidate, siloxane, carbonate, carboxymethylester, acetamidate, carbamate, thioether, bridged phosphoramidate, bridged methylene phosphonate, bridged phosphoramidate, bridged phosphoramidate, bridged methylene phosphonate, phosphorothioate, methylphosphonate, phosphorodithioate, bridged phosphorothioate or sulfone linkages, and combinations of such linkages. The term nucleic acid also specifically includes nucleic acids composed of bases other than the five biologically occurring bases (adenine, guanine, thymine, cytosine and uracil).

It is not intended that the present disclosure be limited by the nature of the nucleic acid employed. The target nucleic acid may be native or synthesized nucleic acid. The nucleic acid may be from a viral, bacterial, animal or plant source. The nucleic acid may be DNA or RNA and may exist in a double-stranded, single- stranded or partially double-stranded form. Furthermore, the nucleic acid may be found as part of a virus or other macromolecule. See, e.g., Fasbender et al., 1996, J. Biol. Chem. 272:6479-89 (polylysine condensation of DNA in the form of adenovirus).

Nucleic acids useful in the present disclosure include, by way of example and not limitation, oligonucleotides and polynucleotides such as antisense DNAs and/or RNAs; ribozymes; DNA for gene therapy; viral fragments including viral DNA and/or RNA; DNA and/or RNA chimeras; mRNA; plasmids; cosmids; genomic DNA; cDNA; gene fragments; various structural forms of DNA including single-stranded DNA, double-stranded DNA, supercoiled DNA and/or triple-helical DNA; Z-DNA; and the like. The nucleic acids may be prepared by any conventional means typically used to prepare nucleic acids in large quantity. For example, DNAs and RNAs may be chemically synthesized using commercially available reagents and synthesizers by methods that are well-known in the art (see, e.g., Gait, 1985, OLIGONUCLEOTIDE SYNTHESIS: A PRACTICAL APPROACH (IRL Press, Oxford, England)). RNAs may be produce in high yield via in vitro transcription using plasmids such as SP65 (Promega Corporation, Madison, WI).

In some circumstances, as where increased nuclease stability is desired, nucleic acids having modified internucleoside linkages may be preferred. Nucleic acids containing modified internucleoside linkages may also be synthesized using reagents and methods that are well known in the art. For example, methods for synthesizing nucleic acids containing phosphonate phosphorothioate, phosphorodithioate, phosphoramidate methoxyethyl phosphoramidate, formacetal, thioformacetal, diisopropylsilyl, acetamidate, carbamate, dimethylene-sulfide (-CH2- S-CH2), diinethylene-sulfoxide (-CH2-SO-CH2), dimethylene-sulfone (-CH2-SO2- CH2), 2'-O-alkyl, and 2'-deoxy2'-fluoro phosphorothioate internucleoside linkages are well known in the art (see Uhlmann et al., 1990, Chem. Rev. 90:543-584; Schneider et al., 1990, Tetrahedron Lett. 31 :335 and references cited therein).

The nucleic acids may be purified by any suitable means, as are well known in the art. For example, the nucleic: acids can be purified by reverse phase or ion exchange HPLC, size exclusion chromatography or gel electrophoresis. Of course, the skilled artisan will recognize that the method of purification will depend in part on the size of the DNA to be purified.

The term nucleic acid also specifically includes nucleic acids composed of bases other than the five biologically occurring bases (adenine, guanine, thymine, cytosine and uracil).

The present disclosure is also directed to methods of administering the compounds of the present disclosure to a subject. Accordingly, the RSK inhibitory compounds can be formulated into pharmaceutical compositions by combining them with an appropriate pharmaceutically acceptable carrier using standard techniques known to those skilled in the art. The compositions may further comprise additional known anti-inflammatory, anti-angiogenic and anti-cancer agents. In one embodiment the RSK inhibitor is combined in a pharmaceutical composition with a further known anti-angiogenic agent selected from the group consisting of known anti-angiogenic agent is selected from the group consisting of 2-methoxyestradiol, prinomastat, batimastat, BAY 12-9566, carboxyamidotriazole, CC- 1088, dextromethorphan acetic, dimethylxanthenone acetic acid, EMD 121974, endostatin, IM-862, marimastat, matrix metalloproteinase, penicillamine, PTK787/ZK 222584, RPI.4610, squalamine, squalamine lactate, SU5416, (+/-)-thalidomide, S-thalidomide, R-thalidomide, TNP-470, combretastatin, tamoxifen, COL-3, neovastat, BMS- 275291, SU6668, interferon-alpha, anti-VEGF antibody, Medi-522 (Vitaxin II), CAI, celecoxib, Interleukin-12, IM862, Amilloride, Angiostatin® Protein, Angiostatin Kl- 3, Angiostatin Kl-5, Captopril, DL-alpha-Difluoromethylornithine, DL-alpha- Difluoromethylornithine HCl, Endostatin™ Protein, Fumagillin, Herbimycin A, 4- Hydroxyphenylretinamide, gamma-interferon, Juglone, Laminin, Laminin Hexapeptide, Laminin Pentapeptide, Lavendustin A, Medroxyprogesterone, Medroxyprogesterone Acetate, Minocycline, Minocycline HCl, Placental Ribonuclease Inhibitor, Suramin, Sodium Salt Suramin, Human Platelet

Thrombospondin, Tissue Inhibitor of Metalloproteinase 1, Neutrophil Granulocyte Tissue Inhibitor of Metalloproteinase 1, and Rheumatoid Synovial Fibroblast Tissue Inhibitor of Metalloproteinase 2. In on embodiment the RSK inhibitor is combined with a monoclonal antibody against VCAM, including for example the monclonal antibody commercially available under the name Avastin.

In accordance with one embodiment a pharmaceutically acceptable anti-inflammatory, anti-angiogenic or anti-cancer agent is combined with a RSK inhibitor to treat a patient suffering from an inflammatory related disease or cancer. The combination therapy can be administered simultaneously by administering a single composition comprising a known anti-inflammatory, anti-angiogenic and anticancer agent and a RSK inhibitor or the anti-inflammatory, anti-angiogenic and anticancer agent can be administered prior to or after the administration of the RSK inhibitor. Typically the anti-inflammatory, anti-angiogenic and anti-cancer agent is administered within 8 hours before or after the administration of the RSK inhibitor and in one embodiment the two agents are each administered within 4 hours, 2 hours or 1 hour of each other.

Pharmaceutical compositions comprising the present compounds are administered to an individual in need thereof by any number of routes including, but not limited to, topical, oral, intravenous, intramuscular, intra-arterial, intramedullary, intrathecal, intraventricular, transdermal, subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual, or rectal means.

In cases where compounds are sufficiently basic or acidic to form acid or base salts, use of the compounds as salts may be appropriate. Examples of acceptable salts are organic acid addition salts formed with acids which form a physiological acceptable anion, for example, tosylate, methanesulfonate, acetate, citrate, malonate, tartarate, succinate, benzoate, ascorbate, Of-ketoglutarate, and Ot- glycerophosphate. Suitable inorganic salts may also be formed, including hydrochloride, sulfate, nitrate, bicarbonate, and carbonate salts.

Acceptable salts may be obtained using standard procedures well known in the art, for example by reacting a sufficiently basic compound such as an amine with a suitable acid affording a physiologically acceptable anion. Alkali metal (for example, sodium, potassium or lithium) or alkaline earth metal (for example calcium) salts of carboxylic acids can also be made.

Processes for preparing compounds of Formula II and Formula III are provided as further embodiments of the present disclosure and are illustrated by the following procedures in which the meanings of the generic radicals are as given above unless otherwise qualified. The compounds of formula II and formula III can be formulated as pharmaceutical compositions and administered to a mammalian host such as a human patient in a variety of forms adapted to the chosen route of administration, i.e., orally or parenterally, by intravenous, intramuscular, topical or subcutaneous routes.

Thus, the present compounds maybe systemically administered, e.g., orally, in combination with a pharmaceutically acceptable vehicle such as an inert diluent or an assimilable edible carrier. They may be enclosed in hard or soft shell gelatin capsules, may be compressed into tablets, or may be incorporated directly with the food of the patient's diet. For oral therapeutic administration, the active compound may be combined with one or more excipients and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, and the like. Such compositions and preparations should contain at least 0.1% of active compound. The percentage of the compositions and preparations may, of course, be varied and may conveniently be between about 2 to about 60% of the weight of a given unit dosage form. The amount of active compound in such therapeutically useful compositions is such that an effective dosage level will be obtained.

The tablets, troches, pills, capsules, and the like may also contain the following: binders such as gum tragacanth, acacia, corn starch or gelatin; excipients such as dicalcium phosphate; a disintegrating agent such as corn starch, potato starch, alginic acid and the like; a lubricant such as magnesium stearate; and a sweetening agent such as sucrose, fructose, lactose or aspartame or a flavoring agent such as peppermint, oil of wintergreen, or cherry flavoring may be added. When the unit dosage form is a capsule, it may contain, in addition to materials of the above type, a liquid carrier, such as a vegetable oil or a polyethylene glycol. Various other materials may be present as coatings or to otherwise modify the physical form of the solid unit dosage form. For instance, tablets, pills, or capsules may be coated with gelatin, wax, shellac or sugar and the like. A syrup or elixir may contain the active compound, sucrose or fructose as a sweetening agent, methyl and propylparabens as preservatives, a dye and flavoring such as cherry or orange flavor. Of course, any material used in preparing any unit dosage form should be pharmaceutically acceptable and substantially non-toxic in the amounts employed. In addition, the active compound may be incorporated into sustained-release preparations and devices. The active compound may also be administered intravenously or intraperitoneally by infusion or injection. Solutions of the active compound or its salts can be prepared in water, optionally mixed with a nontoxic surfactant. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, triacetin, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.

The pharmaceutical dosage forms suitable for injection or infusion can include sterile aqueous solutions or dispersions or sterile powders comprising the active ingredient which are adapted for the extemporaneous preparation of sterile injectable or infusible solutions or dispersions, optionally encapsulated in liposomes. In all cases, the ultimate dosage form should be sterile, fluid and stable under the conditions of manufacture and storage. The liquid carrier or vehicle can be a solvent or liquid dispersion medium comprising, for example, water, ethanol, a polyol (for example, glycerol, propylene glycol, liquid polyethylene glycols, and the like), vegetable oils, nontoxic glyceryl esters, and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the formation of liposomes, by the maintenance of the required particle size in the case of dispersions or by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, buffers or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.

Sterile injectable solutions are prepared by incorporating the active compound in the required amount in the appropriate solvent with various of the other ingredients enumerated above, as required, followed by filter sterilization. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and the freeze drying techniques, which yield a powder of the active ingredient plus any additional desired ingredient present in the previously sterile-filtered solutions.

For topical administration, the present compounds may be applied in pure form, i.e., when they are liquids. However, it will generally be desirable to administer them to the skin as compositions or formulations, in combination with a dermatologically acceptable carrier, which may be a solid or a liquid.

Useful solid carriers include finely divided solids such as talc, clay, microcrystalline cellulose, silica, alumina and the like. Useful liquid carriers include water, alcohols or glycols or water-alcohol/glycol blends, in which the present compounds can be dissolved or dispersed at effective levels, optionally with the aid of non-toxic surfactants. Adjuvants such as fragrances and additional antimicrobial agents can be added to optimize the properties for a given use. The resultant liquid compositions can be applied from absorbent pads, used to impregnate bandages and other dressings, or sprayed onto the affected area using pump-type or aerosol sprayers.

Thickeners such as synthetic polymers, fatty acids, fatty acid salts and esters, fatty alcohols, modified celluloses or modified mineral materials can also be employed with liquid carriers to form spreadable pastes, gels, ointments, soaps, and the like, for application directly to the skin of the user. Examples of useful dermatological compositions which can be used to deliver the compounds of Formula II to the skin are known to the art; for example, see Jacquet et al. (U.S. Pat. No. 4,608,392), Geria (U.S. Pat. No. 4,992,478), Smith et al. (U.S. Pat. No. 4,559,157) and Wortzman (U.S. Pat. No. 4,820,508). Useful dosages of the compounds of formulas I and II can be determined by comparing their in vitro activity, and in vivo activity in animal models. Methods for the extrapolation of effective dosages in mice, and other animals, to humans are known to the art; for example, see U.S. Pat. No. 4,938,949. Generally, the concentration of the compound(s) of formulas I or II in a liquid composition, such as a lotion, will be from about 0.1-25 wt-%, preferably from about 0.5-10 wt-%. The concentration in a semi-solid or solid composition such as a gel or a powder will be about 0.1-5 wt-%, preferably about 0.5-2.5 wt-%.

The amount of the compound, or an active salt or derivative thereof, required for use in treatment will vary not only with the particular salt selected but also with the route of administration, the nature of the condition being treated and the age and condition of the patient and will be ultimately at the discretion of the attendant physician or clinician.

In general, however, a suitable dose will be in the range of from about 0.5 to about 100 mg/kg, e.g., from about 10 to about 75 mg/kg of body weight per day, such as 3 to about 50 mg per kilogram body weight of the recipient per day, preferably in the range of 6 to 90 mg/kg/day, most preferably in the range of 15 to 60 mg/kg/day.

The compound is conveniently administered in unit dosage form; for example, containing 5 to 1000 mg, conveniently 10 to 750 mg, most conveniently, 50 to 500 mg of active ingredient per unit dosage form.

Ideally, the active ingredient should be administered to achieve peak plasma concentrations of the active compound of from about 0.5 to about 75 μM, preferably, about 1 to 50 μM, most preferably, about 2 to about 30 μM. This may be achieved, for example, by the intravenous injection of a 0.05 to 5% solution of the active ingredient, optionally in saline, or orally administered as a bolus containing about 1-100 mg of the active ingredient. Desirable blood levels may be maintained by continuous infusion to provide about 0.01-5.0 mg/kg/hr or by intermittent infusions containing about 0.4-15 mg/kg of the active ingredient(s). The desired dose may conveniently be presented in a single dose or as divided doses administered at appropriate intervals, for example, as two, three, four or more sub-doses per day. The sub-dose itself may be further divided, e.g., into a number of discrete loosely spaced administrations; such as multiple inhalations from an insufflator or by application of a plurality of drops into the eye.

As used herein, an "instructional material" includes a publication, a recording, a diagram, or any other medium of expression which can be used to communicate the usefulness of the composition of the present disclosure for its designated use. The instructional material of the kit of the present disclosure may, for example, be affixed to a container which contains the composition or be shipped together with a container which contains the composition. Alternatively, the instructional material may be shipped separately from the container with the intention that the instructional material and the composition be used cooperatively by the recipient.

The method of the present disclosure includes a kit comprising an inhibitor identified in the present disclosure and an instructional material which describes administering the inhibitor or a composition comprising the inhibitor to a cell or a subject. This should be construed to include other embodiments of kits that are known to those skilled in the art, such as a kit comprising a (preferably sterile) solvent suitable for dissolving or suspending the composition of the present disclosure prior to administering the compound to a cell or a subject. Preferably the subject is a human. In accordance with the present disclosure, as described above or as discussed in the Examples below, there can be employed conventional chemical, cellular, histochemical, biochemical, molecular biology, microbiology, and in vivo techniques which are known to those of skill in the art. Such techniques are explained fully in the literature. Without further description, it is believed that one of ordinary skill in the art can, using the preceding description and the following illustrative examples, make and utilize the compounds of the present disclosure. Therefore, the examples should be construed to encompass any and all variations which become evident as a result of the teaching provided herein. Techniques not described herein which are useful for practicing the present disclosure are available and known in the art (see

Smith et al., U.S. Patent Application No. 10/517,328; Hecht et al., International Patent Publication WO 2006/086103, published August 17, 2006). Techniques for preparing analogs, derivatives, and modifications of compounds such as SLOlOl are known in the art or described herein. Some examples of diseases which may be treated according to the methods of the present disclosure are discussed herein or are known to those of ordinary skill in the art. The present disclosure encompasses RSK and its signal transduction pathways as a novel target for anti-angiogenic compounds and that RSK-specifϊc inhibitors such as SLOlOl will be useful anti-angiogenic therapeutics.

The disclosures of each and every patent, patent application, and publication cited herein are hereby incorporated by reference herein in their entirety. Headings are included herein for reference and to aid in locating certain sections. These headings are not intended to limit the scope of the concepts described therein under, and these concepts may have applicability in other sections throughout the entire specification.

The disclosures of each and every patent, patent application, and publication cited herein are hereby incorporated herein by reference in their entirety.

While the present disclosure has been disclosed with reference to specific embodiments, it is apparent that other embodiments and variations of this disclosure may be devised by others skilled in the art without departing from the true spirit and scope of the present disclosure.

EXAMPLE 1 RSK activity required for human umbilical vein endothelial cells (HUVEC) migration.

The data produced by the experiments described herein demonstrate that RSK activity is required for migration of human umbilical vein endothelial cells (HUVEC). Migration and invasion of the endothelial cells are the initial steps in angiogenesis. Therefore, treatments that stop migration of endothelial cells will inhibit formation of new vessels from the existing vasculature.

First, it was found that treatment of HUVEC cells with the RSK- specific inhibitor, SLO 101 , does not alter the rate of HUVEC cell growth (Fig. 1 ), but does reduce the ability of the cells to migrate into and close a wound made in a confluent monolayer of cells (Figs. 2A-2F). In these experiments, HUVEC were cells were subcultured to confluence in 35-mm plates. One hour prior to wounding, the cells were treated with vehicle (Figs 2A, 2B, and 2D) or 60 μM SLOlOl (Figs 2C and 2E). Scratches were made in the monolayer of cells using sterile, disposable micropipette tips. Images were captured - 2 hr (Fig. 2A), 10 hr (Fig. 2B and Fig. 2C), and 20 hr (Fig. 2D and Fig. 2E) after wounding. By 10 hr after wounding (Figs. 2B and 2C), the vehicle-treated cells (Fig. 2B) at the wound edge have migrated toward the wound. Gaps in the monolayer behind the wound edge are apparent. The SLOl 01 -treated cells (Fig. 2C) have recovered from the wounding, however they show little signs of polarization toward the wound and no involvement of the cells behind the wound edge. At 20 hr (Fig. 2D), the vehicle-treated cells have migrated into the wound yet the gaps are still present behind the wound edge. The cells at the wound edge in the SLOl 01 -treated well appear to have increased in size to fill the wound rather than migrate into the wound (Fig. 2E) and the monolayered cells behind the wound edge remain tightly packed unlike the vehicle-treated cells. Accordingly the data support the premise that RSK inhibitors are useful tools to stop endothelial cell migration.

To demonstrate that the concentration of SLOlOl used in the wound healing assay was sufficient to inhibit RSK activity in the HUVEC cells, the phosphorylation state of a known RSK substrate, ppl40 was examined. HUVEC cells were seeded at a density of 3 x 10⁵ cells per 35 mm dish and were maintained in complete growth medium. Twenty- four hours after plating, the cells were incubated for an additional 2 hr in the presence or absence of 60 μM SLOlOl. After the 2 hr incubation in the presence or absence of SLOlOl, a subset of cells from each group was challenged with 500 nM phorbol dibutyrate for 30 min to maximally stimulate RSK activity. The cells were harvested and lysates prepared for SDS-PAGE and immunoblot analysis. The phosphorylation state of ppl40 was determined using a phospho-specific antibody generated against the phosphorylated peptide - LAS(P)TND. Equal loading of lysate is demonstrated by the Ran immunoblot.

As seen in Fig. 2F, SLOlOl treatment reduced the phosphorylation of ppl40. Basal phosphorylation of ppl40 induced by complete growth medium is eliminated by SLOlOl treatment. SLOlOl treatment also inhibited activation of RSK by PDB-challenge. Thus, SLOlOl inhibits RSK activity in the HUVEC cells. EXAMPLE 2 RSK activity required for human metastatic non small cell lung cancer cell line

(CaLu-I) migration.

As further proof of RSK' s role in migration, further experiments were conducted demonstrating that inhibiting RSK activity with SLOlOl in the human metastatic non small cell lung cancer cell line, CaLu-I (Figs. 3A-3F) generates the same phenotype as silencing RSK expression using small interfering RNA (Figs. 4A- 4H).

CaLu-I cells were sub-cultured to confluence in 35-mm plates. One hour prior to wounding, the cells were treated with vehicle (Figs. 3 A-3C) or 60 μM SLOlOl (Figs. 3D-3F). Scratches were made in the monolayer of cells using sterile, disposable micropipette tips. Images were captured either immediately following the wounding (Figs. 3A and 3D), 6 hr (Figs. 3B and 3E), or 24 hours (Figs. 3C and 3F) after wounding. At the point of wounding (Figs. 3 A and 3D), the cells at the wound edge show increased light refraction indicating damage. By 6 hr after wounding

(Figs. 3B and 3E), the vehicle-treated cells (Fig. 3B) at the wound edge present wide lamella (indicated by arrows) extending toward the direction of the wound. The SLOl 01 -treated cells (Fig. 3E) have recovered from the wounding as evidenced by the reduced refractivity at the wound edge; however, they show no signs of polarization toward the wound. At 24 hr (Fig. 3C), the vehicle-treated cells have migrated into the wound and are enlarged to re-form the confluent monolayer. However, the SLOlOl- treated cells have not migrated to close the wound (Fig. 3F).

EXAMPLE 3

Reducing RSK expression in the human lung cancer cell line, CaIu-I, inhibits migration into the wound.

CaIu-I cells were transiently transfected in suspension with either control siRNA (Figs. 4A and 4B), RSKl -specific siRNA (Figs. 4C and 4D) RSK2- specifϊc siRNA (Figs. 4E and 4F) or both RSK-I and RSK2-specific siRNA (Figs 4G and 4H). Custom oligonucleotides to Rskl

(AAGAAGCUGGACUUCAGCCGU; SEQ ID NO: 1 and Rsk2 (AACCUAUGGGAGAGGAGGAGA; SEQ ID NO: 2) mRNA (Dharmacon Research Inc.) and Lipofectamine™ 2000 (Invitrogen Corporation Carlsbad, CA 92008) transfection reagent were used for the gene silencing studies.

After four hours, the transfection medium was removed and the cells were plated in 6-well tissue-culture clusters. Forty-eight hours after transfection, scratches were made in the monolayer of cells using sterile, disposable micropipette tips. Images were captured - immediately following the wounding (Figs 4A, 4C, 4E and 4F), and 19 hours (Figs. 4B, 4D, 4F and 4G) after wounding. The images demonstrate classical wound healing. By 19 hr, the cells transfected with control siRNA have migrated into the wound (Fig. 4B). However, the cells transfected with either RSKl - or RSK2-specific siRNA demonstrate a reduced ability to migrate into the wound (Figs. 4D and 4F). Interfering with the expression of both RSKl and RSK2 also results in reduced migration (Fig. 4H). Thus, RSK activity is required for CaIu-I migration. More particularly, the ability of the entire monolayer to respond to the wound is depressed in the SLOl 01 -treated cells (see Example 2; Figs 3A-3F) as well as the siRNA transfected cells as indicated by the numerous holes in the monolayer behind the cells at the edge of the wound. The holes are marked by asterisks (*).

EXAMPLE 4 SLOlOl reduces expression of the angiogenesis marker, VCAM.

HUVEC cells were treated in the presence or absence of 1 μg/ml lipopolysaccharide (LPS) with concomitant treatment with vehicle or SLOlOl at indicated concentrations. Twenty- four hours after LPS treatment, the cells were harvested with SDS lysis buffer in preparation for SDS-PAGE and immunoblot analysis. Lysates were normalized with regard to protein concentration. Equivalent loading is shown by the anti-Ran immunoblot. The data demonstrates that inhibition of RSK activity with SLOlOl reduced expression of the angiogenesis marker VCAM in a dose-dependent manner (see Fig. 5).

EXAMPLE 5

Capillary network formation in HUVEC cells To further characterize the RSK inhibitor, the effect of SLOlOl on development of capillary-like tube formation in HUVEC cells was examined. Interfering with tube formation is a characteristic common to anti-angiogenic treatments. HUVEC cells were seeded at a density of 1 x 10⁵ cells per well in 24-well culture dishes coated in growth factor-reduced Matrigel (BD Biosciences). The cells were treated with vehicle, 60 μM SLOlOl or 20 μM SUl 498 (VEGF receptor inhibitor) for 30 minutes prior to stimulation with 10 ng/ml of VEGF. The cells were incubated at 37° C for 20 hours. Images of the cells were captured for analysis of the capillary-like network.

Stimulation of HUVEC cells with VEGF resulted in accumulation of the cells into flat, polymorphous nodes with multiple tube-like connections between nodes. Treatment of HUVEC cells with VEGF in the presence of SU1498, the VEGF Receptor inhibitor, resulted in accumulation of the cells into rounded nodes with few tube-like projections. HUVEC cells treated with VEGF in the presence of SLOl 01 , the RSK inhibitor, were indistinguishable from those treated with SU1498. A few flat nodes with multiple tube-like projections were observed in the SU1498-treated cells and SLO 101 -treated cells, however, the majority of the nodes in the inhibitor-treated cells were rounded with few projections. Thus, the results from these experiments support the results obtained in Examples 2-5 indicating that inhibition of RSK activity is sufficient to limit VEGF-induced capillary network formation in HUVEC cells.

EXAMPLE 6

Proposed Synthetic Schemes for Preparing RSK Inhibitors Abreviations used in Examples 3-6 are as follows: TBDPS = tert- butyldiphenylsilyl, THF = tetrahydrofuran, EDCl = l-(3-dimethylaminopropyl)-3- ethylcarbodiimide, DMAP = 4-dimethylaminopyridine, TSOH = 4-toluene sulfonic acid, DMF = dimethylformamide, Bn = benzyl, MTBE = methyl tert-butyl ether. Proposed Scheme I: Preparation of Protected Kaempferol &

Quercetin

EDCI₁DMAP₅TSOH₁CH₂CI₂

DPS

R₀= H or OTBDPS

Proposed Scheme II: Alternative Route for Synthesis of Protected

Kaempherol

K₂CO₃, acetone,

Reflux

TBDPS

Proposed Scheme III: Coupling of Two Fragments and Total Synthesis

* source for preparing the sugar moiety

SLOlOl-I

EXAMPLE 7

Synthesis of the Protected Kaempferol (10) The synthesis for the Kaempferol half of SLOlOl-I is outlined as follows:

H

TBDPS

4a: R=OEt 4b: R=NH₂

8: R=Bn; R₁= COC₆H₄(4-OTBDPS) 8a: R=H; R₁= COC₆H₄(4-OTBDPS) 8b: R= COC₆H₄(4-OTBDPS); R₁= H

Treatment of commercially available 1 (2Og) with tert- butyldiphenylsilyl chloride (TBDPSCl) and imidazole in THF/CH₂C1₂ gave, after chromatographic purification, 2 (47.3 g, 80%). This compound was characterized by ¹H NMR. and MS.

Oxidation of 2 (21.8g and 25g) using sodium chlorite gave 3 (5Og total, quantitative yield). The product was characterized by ¹H and ¹³C NMR, and by MS. Benzyl alcohol (50g) on treatment with NaH (1.2 equiv) and ethyl bromoacetate (1 equiv) in THF gave 4a (32g, 36%), which was characterized by both ¹HNMR, and by MS. Scale up of this reaction yielded lOOg of 4a. Reaction of 4a (5g) with NH₄OH at 0° for 5 h in CH₂Cl₂ gave amide 4b (4.3g, 96%), which was characterized by ¹H NMR and MS. A repeat of this experiment on 45 g of 4a gave 38 g (94%) of 4b. Dehydration of 4b (4.2 g) using POCl₃ in acetonitrile gave 5 (1.75 g, 47%), which was characterized by ¹H NMR, ¹³C NMR and MS. A repeat of this experiment on 38g of 4b gave an additional 15.75 g (47%) of 5. Coupling of 5 (5 g) and phloroglucinol in MTBE with HCl gas bubbling at O⁰C for 3 h gave 6 (2.6 g, 56%), which was characterized by ¹H NMR, ¹³C NMR and MS. Selective protection of 6 (0.5 g) using TBDPSCI (2.5 equiv) and Et₃N (2.5 equiv) in CH₂Cl₂ at room temperature for 16 h gave 7 (1.2 g, 85%), which was characterized by ¹H NMR and MS. Scale-up of this experiment on 2 g of 6 gave an additional 3.4 g (62%) of 7. Condensation of 7 (1.4 g) with 3 (1.35 equiv) in CH₂Cl₂ [EDCI (1.5 equiv), DMAP (0.35 equiv), TsOH (0.35 equiv.] at room temperature for 24 h gave 8 (1.5 g, 72%), which was characterized by ¹H NMR. Scale up gave 35g of purified 8. Compound 8 (6g) was debenzylated using Rh/C as a catalyst (H₂, 60 psi, EtOAc, it, 24h) to give 8a (1.8g, 33%) along with 2.9g (53%) of the trans-esterified (migration of benzoyl group R₁) product 8b. Both the intermediates 8a and 8b were characterized by ¹H NMR.

EXAMPLE 8

Synthesis of the Protected Rhamnose (20)

The synthesis for the Rhamnose half of SLOlOl-I is outlined as follows:

Reaction of L-rhamnose 11 (50 g) with acetic anhydride (6 equiv), triethylamine (8 equiv) and catalytic 4-dimethylaminopyridine (0.1 equiv) in CH₂Cl₂ at room temperature for 16h gave 90 g (98%) of the tetraacetate 12, which was characterized by ¹H NMR and MS and was taken to the next step without further purification. Scale up yielded 260 g of 12. Treatment of 12 (150 g) with thiophenol (1.1 equiv) in the presence of SnCl₄ (0.7 equiv) in CH₂Cl₂ at 0⁰C for 5 h gave 13 [56 g (pure), 110 g (with -10% impurity)], which was characterized by both ¹H NMR and MS. Deacetylation of 13 (56 g) using catalytic K₂CO₃ (0.2 equiv) in THF/MeOH (1 :1) at room temperature for 16 h provided triol 14 (35 g, 93%), which was characterized by ' H NMR and MS .

Treatment of 14 (0.3 g) using 2,2-dimethoxypropane with catalytic amount of p-toluenesulfonic acid gave 15 (0.3 g, 86%) as a single anomer, which was characterized by both ¹H NMR and MS. Scale-up of this reaction on 34 g of 14 gave an additional 38 g (97%) of 15. O-Benzylation of 15 (0.3 g) with NaH (1.74 equiv) and benzyl bromide (1.05 equiv) in DMF provided the benzyl ether 16 (0.35 g, 89%), which was characterized by ' H NMR. A repeat of this experiment on 38 g of 15 gave 41 g (83%) of 16. Treatment of 16 (3 g) with trifluoroacetic acid in MeOH at 50 ⁰C for 16 h gave diol 17 (2.5 g, 93%), which was characterized by ¹H NMR and MS. A repeat of this experiment on 10 g of 16 gave 8.5 g (95%) of 17. Selective O- benzylation of diol 17 (2.5 g) following a literature procedure («-Bu₂SnO, toluene, Dean-Stark, reflux, 4 h to give 18, then ^-Bu₄NBr, BnBr, 50 ⁰C, 5 h) gave 19 (2.6 g, 82%), which was characterized by both ¹H NMR and MS. Treatment of 19 (2.5 g,) with acetic anhydride and pyridine gave the acetate 20 (rhamnose part of the molecule) (2.5 g, 91%), which was characterized by ¹H NMR and MS. Scale-up of the above reactions to get acetate 20 (~20 g) was conducted as follows. Treatment of 16 (25 g) with trifluoroacetic acid in MeOH at 50 ⁰C for 16 h gave diol 17 (21 g, 94%), which was characterized by ¹H NMR and MS. Selective (9-benzylation of diol 17 (29.5 g) following a literature procedure (n- Bu₂SnO, toluene, Dean-Stark, reflux, 4 h to give 18, then W-Bu₄NBr, BnBr, 5O⁰C, 5 h) gave 19 (31 g, 83%), which was characterized by both ¹H NMR and MS. Treatment of 19 (30 g) with acetic anhydride and pyridine gave the acetate 20 (29.3 g, 89%) required for the coupling reaction with 10. The product was characterized by ¹H NMR and MS.

EXAMPLE 9

Coupling of the Kaempferol and Rhamnose Moieties

The coupling reation between compounds 20 and 8a to generate SLOlOl-I is outlined as follows:

SLOlOl-I The coupling of 20 (O.lg) with 8a (1.5 equiv) using 0-glycosidation conditions [1-benzenesulfmyl piperidine (1 equiv), tri-t-butylpyrimidine (2 equiv), triflic anhydride (trifluoromethanesulfonic acid anhydride) (1.1 equiv), CH₂Cl₂, - 6O⁰C, Ih] gave 21 (O.lg, 35%), which was characterized by ¹H NMR. Dehydration of 21 (O.lg) using K₂CO₃ in pyridine at reflux to get 22 is in progress and the remaining steps from 21 to produce SLOlOl-I are well known to those skilled in the art.

The disclosures of each and every patent, patent application, and publication cited herein are hereby incorporated by reference herein in their entirety. Headings are included herein for reference and to aid in locating certain sections. These headings are not intended to limit the scope of the concepts described therein under, and these concepts may have applicability in other sections throughout the entire specification.

Claims

WHAT IS CLAIMED IS:

1. A method of inhibiting endothelial cell migration, said method comprising the step of contacting said cells with a RSK inhibitor.

2. The method of claim 1 wherein the RSK inhibitor is selected from the group consisting of an anti-sense oligonucleotide and an interfering oligonucleotide.

3. The method of claim 2 wherein the RSK inhibitor comprises an interfering oligonucleotide directed against Rskl or Rsk2.

4. The method of claim 1 wherein the RSK specific inhibitor comprises a compound having the structure of formula II:

wherein R₁, R_2, and R₅ are independently selected from the group consisting of OH, OCOR₈, COR_8, SR_8, and C₁-C₄ alkoxy;

R₃, R₄, R₆, R₇ are independently selected from the group consisting of H, OH, OCOR₈, COR₈, SR₈, and C₁-C₄ alkoxy;

R₈ is H or C₁-C₄ alkyl; and R₉, R₁₀ and Rn are independently selected from the group consisting of H, OH,

OCOR₈, COR₈, NHOCOR₈ and C₁-C₄ alkoxy, with the proviso that R₉, R₁₀ and Ri ₁ are not all OH when Ri, R_2> and R₅ are OH.

5. The method of claim 4 wherein Ri , R₂, and R₅ are independently OH or SR₈.

6. The method of claim 5 wherein one of Ri , R₂, and R₅ is SR₈.

7. The method of claim 4 wherein one of R₉, Rj₀ and Ri ₁ is NHOCOR₈.

8. The method of claim 4 wherein Ri and R₂ are both OH;

R9, Rio and Rn are independently selected from the group consisting of H, OH and OCOR₈;

R₃ and R₇ are each H;

R₄, R₅, and R₆ are independently selected from the group consisting of H, OR₈, OCOR₈, and COR₈; and R₈ is H or methyl.

9. The method of claim 4 wherein Ri, R₂ and R₅ are OH; R₉ and Ri₀ are independently selected from the group consisting of

OH, COR₈, Ci-C₄ alkoxy, NHOCOR₈ and OCOCH₃;

Rn is OCOCH₃;

R₈ is H or methyl;

R₃, R₄ and R₇ are each H; and R₆ is H or hydroxy.

10. The method of claim 9 wherein Rg and R₁₀ are independently selected from the group consisting of OH and OCOCH₃.

11. The method of claim 1 further comprising the administration of a known anti-angiogenic agent.

12. The method of claim 11 wherein the known anti-angiogenic agent is selected from the group consisting of 2-methoxyestradiol, prinomastat, batimastat, BAY 12-9566, carboxyamidotriazole, CC- 1088, dextromethorphan acetic, dimethylxanthenone acetic acid, EMD 121974, endostatin, IM-862, marimastat, matrix metalloproteinase, penicillamine, PTK787/ZK 222584, RPI.4610, squalamine, squalamine lactate, SU5416, (+/-)-thalidomide, S-thalidomide, R-thalidomide, TNP- 470, combretastatin, tamoxifen, COL-3, neovastat, BMS-275291, SU6668, interferon- alpha, anti-VEGF antibody, Medi-522 (Vitaxin II), CAI, celecoxib, Interleukin-12, IM862, Amilloride, Angiostatin® Protein, Angiostatin Kl-3, Angiostatin Kl-5, Captopril, DL-alpha-Difluoromethylornithine, DL-alpha-Difluoromethylornithine HCl, Endostatin™ Protein, Fumagillin, Herbimycin A, 4-Hydroxyphenylretinamide, gamma-interferon, Juglone, Laminin, Laminin Hexapeptide, Laminin Pentapeptide, Lavendustin A, Medroxyprogesterone, Medroxyprogesterone Acetate, Minocycline, Minocycline HCl, Placental Ribonuclease Inhibitor, Suramin, Sodium Salt Suramin, Human Platelet Thrombospondin, Tissue Inhibitor of Metalloproteinase 1, Neutrophil Granulocyte Tissue Inhibitor of Metalloproteinase 1, and Rheumatoid Synovial Fibroblast Tissue Inhibitor of Metalloproteinase 2.

13. The method of claim 11 wherein the known anti-angiogenic agent is a monoclonal antibody against VCAM.

14. A composition comprising a RSK inhibitor and a known anti- angiogenic agent.

15. The composition of claim 14 wherein the known anti- angiogenic agent is selected from the group consisting of 2-methoxyestradiol, prinomastat, batimastat, BAY 12-9566, carboxyamidotriazole, CC-1088, dextromethorphan acetic, dimethylxanthenone acetic acid, EMD 121974, endostatin, IM-862, marimastat, matrix metalloproteinase, penicillamine, PTK787/ZK 222584, RPI.4610, squalamine, squalamine lactate, SU5416, (+/-)-thalidomide, S-thalidomide, R-thalidomide, TNP-470, combretastatin, tamoxifen, COL-3, neovastat, BMS- 275291 , SU6668, interferon-alpha, anti-VEGF antibody, Medi-522 (Vitaxin II), CAI, celecoxib, Interleukin-12, IM862, Amilloride, Angiostatin® Protein, Angiostatin Kl- 3, Angiostatin Kl -5, Captopril, DL-alpha-Difluoromethylornithine, DL-alpha- Difluoromethylornithine HCl, Endostatin™ Protein, Fumagillin, Herbimycin A, 4- Hydroxyphenylretinamide, gamma-interferon, Juglone, Laminin, Laminin Hexapeptide, Laminin Pentapeptide, Lavendustin A, Medroxyprogesterone, Medroxyprogesterone Acetate, Minocycline, Minocycline HCl, Placental Ribonuclease Inhibitor, Suramin, Sodium Salt Suramin, Human Platelet Thrombospondin, Tissue Inhibitor of Metalloproteinase 1, Neutrophil Granulocyte Tissue Inhibitor of Metalloproteinase 1, and Rheumatoid Synovial Fibroblast Tissue Inhibitor of Metalloproteinase 2.

16. The composition of claim 14 wherein the known anti- angiogenic agent is a monoclonal antibody against VCAM.

17. The composition of claim 14 wherein the RSK specific inhibitor is selected from the group consisting of an anti-sense oligonucleotide and an interfering oligonucleotide.

18. The composition of claim 14 wherein the RSK specific inhibitor comprises a compound having the structure of Formula II:

wherein R₁, R₂, and R₅ are independently selected from the group consisting of OH, OCOR₈, COR₈, SR₈, and C₁-C₄ alkoxy;

R₃, R₄, R₆, R₇ are independently selected from the group consisting of H, OH, OCOR₈, COR_8, SR_8, and C₁-C₄ alkoxy;

R₈ is H or C₁-C₄ alkyl; and

R₉, Rio and Rn are independently selected from the group consisting of H₅ OH,

OCOR₈, COR₈, NHOCOR₈ and C_rC₄ alkoxy, with the proviso that R₉, Rio and Ri ₁ are not all OH when Ri, R_2, and R₅ are each OH.

19. The composition of claim 18 wherein Ri, R_2> and R₅ are independently OH or SR₈.

20. The composition of claim 18 wherein

Ri, R₂ and R₅ are OH;

R₉ and Rio are independently selected from the group consisting of OH, COR₈, Ci-C₄ alkoxy, NHOCOR₈ and OCOCH₃;

R_n is OCOCH₃; R₈ is H or methyl;

R₃, R₄ and R₇ are each H; and

R₆ is H or hydroxy.

21. The composition of claim 14 wherein the RSK inhibitor is conjugated to an antibody.