WO2008152528A2 - Method for the diagnosis or the screening of an arbovirus infection, reagents useful in said method and their applications - Google Patents
Method for the diagnosis or the screening of an arbovirus infection, reagents useful in said method and their applications Download PDFInfo
- Publication number
- WO2008152528A2 WO2008152528A2 PCT/IB2008/002614 IB2008002614W WO2008152528A2 WO 2008152528 A2 WO2008152528 A2 WO 2008152528A2 IB 2008002614 W IB2008002614 W IB 2008002614W WO 2008152528 A2 WO2008152528 A2 WO 2008152528A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- phoa
- protein
- hybrid protein
- hybrid
- alkaline phosphatase
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
- G01N33/56983—Viruses
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/58—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving labelled substances
- G01N33/581—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving labelled substances with enzyme label (including co-enzymes, co-factors, enzyme inhibitors or substrates)
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/61—Fusion polypeptide containing an enzyme fusion for detection (lacZ, luciferase)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
- C12N2770/00011—Details
- C12N2770/24011—Flaviviridae
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/005—Assays involving biological materials from specific organisms or of a specific nature from viruses
- G01N2333/08—RNA viruses
- G01N2333/18—Togaviridae; Flaviviridae
- G01N2333/183—Flaviviridae, e.g. pestivirus, mucosal disease virus, bovine viral diarrhoea virus, classical swine fever virus (hog cholera virus) or border disease virus
- G01N2333/185—Flaviviruses or Group B arboviruses, e.g. yellow fever virus, japanese encephalitis, tick-borne encephalitis, dengue
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2469/00—Immunoassays for the detection of microorganisms
- G01N2469/20—Detection of antibodies in sample from host which are directed against antigens from microorganisms
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Definitions
- the present invention relates to a method for the diagnosis or the screening of an arbovirus infection and preferably a flaviviridae infection and more preferably a flavi virus infection, reagents useful in said method and their applications.
- Arboviruses ⁇ rthropod- ⁇ orne viruses
- Arboviruses are viruses maintained in nature in cycles involving haematophagous arthropod vectors and susceptible vertebrate hosts. All arboviruses comprising an envelope protein are included in the present invention, even though the description is focused mainly on the flavivirus genus.
- YFV yellow fever virus
- DENV dengue virus
- WNV West Nile virus
- Flaviviral infections are currently detected by several methods, including virus isolation, viral-RNA detection by RT-PCR and immunochemical assays, targeted either at viral proteins or anti-viral immunoglobulin molecules.
- virus isolation viral-RNA detection by RT-PCR
- immunochemical assays targeted either at viral proteins or anti-viral immunoglobulin molecules.
- the kinetics of the appearance and the disappearance for the viral RNAs, viral proteins, virions and different classes of antibodies are well documented for a number of fiaviviruses, during primary or subsequent infections.
- the detection of antibodies that are directed against a virus and present in the serum of patients, by an immunosorbent assay constitutes a well established and recommended method for the diagnosis of infections by fiaviviruses
- the commonly accepted hypothesis is the secondary infection or immune enhancement theory (Halstead, 2003; Mongkolsapaya et al., 2003).
- the other hypothesis emphasizes the involvement of viral factors (McBride and Bielefeldt- Ohmann, 2000).
- the differentiation between primary and secondary infections is therefore a key issue for understanding the pathogenesis of DHF.
- the viral mRNA and antigens are present in both primary and subsequent infections (Alcon et al., 2002). Therefore, the detection of DENV antibodies provides the only method for differentiating the different modes of infection.
- the immunosorbent assays (ISA) for the detection of viral antibodies in the serum of patients belong to two main types: the indirect ISA and the antibody-specific capture ISA.
- a solid support is sensitized with the viral anti- gen (virAg).
- the immobilized antigen is reacted with the human or animal serum under analysis.
- the bound antibodies are revealed with a reporter system, which generally consists of a conjugate between an immunoglobulin binding protein
- IgX-specific indirect ISA Several variations of the indirect ISA have been described, in particular the antigen capture ISA, the epitope blocking ISA, and the avidity ISA (Blitvich et al., 2003; Johnson et al., 2000; Matheus et al., 2005).
- the immobilized Ig binding protein is reacted successively with the serum under analysis, the viral antigen and then a reporter system, which generally consists of a conjugate between an antigen binding molecule (@virAg) and an enzyme (Enz).
- a generic IgX specific capture ISA (XAC-ISA) can be schematized as follows:
- IgM IgG or IgA antibody capture immunosorbent assays
- MAC-ELISA IgG or IgA antibody capture immunosorbent assays
- GAC-ELISA IgA antibody capture immunosorbent assays
- AAC-ELISA IgA antibody capture immunosorbent assays
- the immunosorbent assays for IgM antibodies are among the most useful serologic procedures for determining recent infections by flaviviruses, since these IgM molecules appear early in infection, rise rapidly in the course of the disease, and are usually less cross-reactive with other viruses than IgG antibodies (Kuno, 2003). IgM molecules can be detected as soon as the 5th day after infection but their affinity for a monomeric antigen is generally lower than that of other immunoglobulin molecule types.
- the MAC-ELISA is preferred over the IgM-specific indirect ELISA because the IgG antibodies from previous infections by related viruses can have a suppressive effect on the sensitivity of the latter assay (Vorndam and Kuno, 1997). It is recommended by WHO for the serological diagnosis of several flaviviral infections and in particular dengue (WHO, 1997).
- the MAC-ELISA has the following advantages: If paired serum samples are available, a rising, stable or falling titer in IgM can indicate the time of infection.
- the ratio of IgM to IgG antibody in parallel MAC- and GAC-ELISA on a single sample can be used to differentiate primary from secondary infections since the IgM/IgG ratio is higher than one in the former case and lower in the latter (Innis et al., 1989). It can detect anti-flaviviral IgM in the cerebrospinal fluid and saliva (Kao et al., 2005; Teles et al., 2005). IgA specific ELISAs have also been developed. The IgA response develops after the IgM response but before the IgG one.
- the IgA/IgM ratio in parallel MAC- and AAC-ELISAs can indicate whether the infection is recent or dates from a few months, for DENV and WNV (Prince and Lape-Nixon, 2005; Talarmin et al., 1998).
- the specificity of the immunosorbent assays comes mainly from the interaction between the serum under analysis and the antigen and thus depends on the nature of the antigen preparation. However, it may also come from the nature of the reporter molecule.
- the antigens in use for ISA were mainly extracts of suckling mouse brains (SMB) or cell cultures, infected by the virus under consideration. These are being progressively replaced with recombinant prM/gpE virus like particles (VLP), where prM and gpE are the precursor of the membrane protein and envelope glycoprotein of the virus or with a recombinant extracellular domain (sE) of gpE.
- the non-structural protein NSl has also been used as an antigen in both IgG- specific indirect ELISA and MAC-ELISA.
- NSl can differentiate between primary and secondary infections and correctly identify the serotype of the infecting DENV in the sera of patients with primary infection (Shu et al., 2004; Shu et al., 2003; Shu et al., 2002).
- Many MAC-ELISAs use antiviral polyclonal antibodies as detector molecules. These polyclonal antibodies vary in potency from batch-to-batch and can be virus cross-reactive, which limits the specificity of the tests (Martin et al., 2000).
- mAbs monoclonal antibodies
- pAbs polyclonal antibodies
- Support-@GST : GST-QD6 epitope
- scFv3D6-PhoA where @GST represents antibodies directed against the Glutathione- S-Transferase (GST); GST-(3D6 epitope), a hybrid protein between GST and an epitope of antibody 3D6; and scFv3D6-PhoA, a hybrid protein between a single-chain variable fragment (scFv) of antibody 3D6 and alkaline phosphatase.
- Sandwich ELISA assays are used to detect the presence of an antigen in the serum of patients, but not antibodies directed against an infectious agent as in the current invention. Moreover such methods require the isolation and characterization of at least two non-competing antibodies to be used in the assay.
- ISA is a reverse ELISA (D. Ludolfs et al., 2007) whose format is the following:
- Rhumatoid Factor is an autoimmune antibody that recognizes the Fc fragment of the IgG immunoglobulins
- rED3-HRP is a chemical conjugate between Horseradish Peroxydase (HRP) and a recombinant domain 3 (rED3) of the envelope protein E from the West-Nile virus.
- HRP is a monomeric protein, whereas alkaline phosphatase is dimeric, and the rED3-HRP hybrid protein was obtained by chemical coupling of the two partners, rED3 and HRP.
- ISA is an indirect IgG ELISA (D. W. C. Beasley et al., 2004) whose format is the following:
- Support-rED3 serum :: @IgG-HRP where @IgG-HRP is a chemical conjugate between Horseradish Peroxydase and an antibody directed against human IgGs.
- the specificity of the GAC- or MAC-ELISA does not differ significantly when using either SMB- or cell culture-derived viral antigen (Cardosa et al., 1992).
- MAC-ELISAs that are performed with such preparations of antigen are generally specific of a viral sero-complex but can hardly differentiate the infecting virus within a sero-complex. For example, they can differentiate between infections by DENV and either JEV or WNV (Innis et al., 1989; Martin et al., 2002). However, they have difficulty in differentiating between infections by the four DENV serotypes, even though the signal is the highest for the infecting serotype in most cases (Nawa et al., 2000).
- the prM/gpE VLPs from several flaviviruses perform as well as or better than SMB-derived antigen in MAC-ELISA, according to a number of criteria measuring sensitivity, specificity, accuracy and other statistical tests (Holmes et al., 2005; Martin et al., 2002; Martin et al., 2000; Muerhoff et al., 2002).
- DENV VLPs can successfully detect the infecting serotype in primary infections (Shu et al., 2002; Shu and Huang, 2004).
- SLEV VLPs do not cross-react with IgM antibodies that are directed against WNV or the Powassan virus, contrary to the SMB-derived antigen (Purdy et al., 2004).
- VLPs do no cross-react with IgM antibodies that are directed against JEV, contrary to the commercial antigen (Yoshii et al., 2003).
- WNV For WNV however, VLPs do cross-react with a high proportion of sera from patients that are either infected with or vaccinated against other flaviviruses (JEV, SLEV, DENV, YFV) (Hogrefe et al., 2004).
- JEV, SLEV, DENV, YFV flaviviruses
- YFV flaviviruses
- the extracellular domain sE of gpE expressed as a recombinant protein in drosophila cells, is used in a chromatographic format of the MAC- and GAC-ELISAs.
- This immunochromatographic assay using recombinant sE domains from the four serotypes of DENV, has specificities and sensivities that are comparable to those of conventional MAC- and GAC- ELISAs, performed with SMB extracts as antigens (Cuzzubbo et al., 2001).
- ED3 domain As an antigen in immunoassays: it is highly antigenic and immunogenic; the most strongly neutralizing antibodies are directed against this domain (Crill and Roehrig, 2001; Sanchez et al., 2005); the sequences of the ED3 domains are more distant than those of the other domains of gpE (Gritsun et al., 1995); the antibodies that cross-react with different flaviviruses are directed towards domains EDl and ED2 of gpE more than towards ED3 (Crill and Chang, 2004; Kanai et al., 2006; Modis et al., 2005; Roehrig, 2003; Sanchez et al., 2005).
- TrpE-ED3 For DENV, hybrids TrpE-ED3 between the TrpE protein from E. coli and the four serotypes of the ED3 domain have been compared with cell culture-derived viral antigens.
- the two kinds of antigens are equally sensitive for detecting IgM or IgG antibodies, directed against DENV, in convalescent sera.
- the TrpE-ED3 antigens are more specific than the cell culture-derived antigens for discrimination between DENV infections and YFV or JEV vaccinations (Simmons et al., 1998).
- rED3 recombinant isolated ED3 domains (rED3) can successfully detect the infecting serotype in an immunoblot strip assay (Ludolfs et al., 2002).
- rED3 gives a more sensitive and specific response than an SMB- derived antigen in an IgG-specific indirect ELISA, on panels of monkey, human and horse sera. It can clearly discriminate an IgG response against WNV from those against other related flaviviruses (JEV, SLEV, MVEV) (Beasley et al., 2004).
- JEV, SLEV, MVEV JEV, SLEV, MVEV
- rED3 also gives a more sensitive and specific response than an SMB-derived antigen in an IgG-specific indirect ELISA. It can distinguish between tick-borne (TBEV) and mosquito-borne (YFV, DENV) flaviviruses but cannot distinguish between members of the TBEV serocomplex of flaviviruses (Holbrook et al., 2004).
- the same molecule of IgG, IgA or IgM can bind simultaneously two to five copies of its epitope and this multivalent mode of binding results in a strong apparent affinity (avidity).
- the valence of the antigen is also high in prM/gpE VLPs (Ferlenghi et al., 2001); it is two for a recombinant antigen like the soluble gpE (sE), which is a dimer (Kanai et al., 2006; Modis et al., 2003; Modis et al., 2005; Rey et al., 1995), but only one for an isolated ED3 domain.
- the affinity between a monomeric rED3 domain and one binding site of an IgM may be insufficient for a MAC-ELISA. Similar problems may be encountered with IgG- or IgA-capture ELISAs, especially for a primary infection.
- the ED3 domain contains two cysteine residues. They form a disulfide bond which is necessary for the proper folding and antigenic integrity of the domain (Roehrig et al., 2004).
- rED3 can be produced in the periplasmic space of Escherichia coli, where the essential disulfide bond can form, in a properly folded state. The production in the periplasmic space has the added advantage that the protein can be extracted from the producing bacteria by a simple osmotic shock, in a concentrated and partially purified form.
- the detection system of the assay must be the same for all the tested antigens. This may not be the case when one uses polyclonal antibodies.
- the use of a monoclonal antibody, directed against a common epitope of different viruses or viral serotypes may lead to the following problems, (i) The binding of the antigen to the human serum may mask the epitope of the tracer monoclonal antibody, (ii) The affinities between the tracer antibody and different antigens may depend on the structural context of the epitope. As a result, the relation between the output signal of the assay and the amount of captured antigen may vary for different antigens.
- the present invention relates to a method for the diagnosis or the screening of an arbovirus in a subject or animal host, characterized in that it comprises:
- said arbovirus is preferably a flavivirus.
- said alkaline phosphatase is selected from the group consisting of rat, mouse, chicken, bovine, yeast and bacterial alkaline phosphatases, preferably alkaline phosphatase of E. coll
- said hybrid protein further comprises a polypeptide tag, useful, for instance for purifying said hybrid protein from a periplasmic extract.
- polypeptide tags may be HIS (hexahistidine), c-MYC, HA, VSV-G, HSV, V5 and FLAG (Sigma products).
- said hybrid protein comprises preferably a hexahistidine, an appropriate flaviviral ED3 domain and the alkaline phosphatase of E. coli and comprises SEQ ID NO:25.
- alkaline phosphatase consists of SEQ ID NO: 25.
- said alkaline phosphatase of E. coli is modified. More preferably said alkaline phosphatase of E. coli includes two mutations in its active site: D153G and D330N and comprises SEQ
- alkaline phosphatase consists of SEQ ID NO: 24.
- the detector molecule as specified here above i.e. comprising at least the flaviviral domain ED3 and an alkaline phosphatase of E. coli, and preferably hybrid proteins between a hexahistidine, a flaviviral domain ED3 and an alkaline phosphatase of E. coli, preferably a modified alkaline phosphatase
- the IgX antibody capture immunosorbent assay for the detection of flaviviruses is significantly improved at several levels:
- the detector molecule is preferably a (H6-ED3-PhoA) 2 hybrid; therefore, the binding of the (H6-ED3-PhoA) 2 hybrids was revealed through the enzymatic activity of their PhoA portion.
- microtiter plates to immobilize the anti-IgG or anti-IgM antibodies were used. Other types and formats of supports could be used for these immobilizations, in particular optical fibers.
- an assay with the (H6-ED3 -PhOA) 2 hybrids may be performed for the detection of other immunoglobulin types, IgA and IgE, directed against the ED3 domain, to the detection of immunoglobulins from man and different animals, for instance mouse, bovine and horse, and to their detection in other body fluids than serum.
- This assay may also be performed with the ED3 domains from other arboviruses and other flaviviruses than those cited since the E glycoproteins from the viruses of this taxonomic group have highly homologous structures. It may be performed with hybrids between other antigenic proteins or protein fragments, whether they come from pathogenic agents or not, and whether they are present in a monomeric or multimeric state in these agents.
- Bifunctional dimeric hybrids like (H6-ED3-PhoA) 2 or more generally (Ag-PhoA) 2 have numerous applications. They can be used (i) to detect antibodies directed against the antigen (Ag) that is fused with PhoA; (ii) to detect antibodies directed against the pathogen which the antigen comes from or mimics; (iii) to diagnose infections by a pathogen or validate a vaccination by a pathogen or an immunogen; (iv) to study the epidemiology of a pathogen; (v) to study the interaction between the protein or protein fragment that is fused with PhoA, and molecules, proteins or cells; (vi) to screen and identify, in a chemical library, molecules that modify the interaction between the fused protein or protein fragment and a target molecule, protein of cell.
- the use of rED3 to successfully detect IgM in the serum of infected individuals has not been described previously.
- the current invention relies on the possibility of simultaneously dimerising a recombinant antigen and fusing it with an enzymatic tracer, by constructing a hybrid between its gene sequence and the alkaline phosphatase gene.
- a reagent is obtained that can detect low affinity antibodies; for example IgM immunoglobulins, which are pentameric and appear early in infections by arboviruses.
- This early detection can be used as a tool in the management of epidemics. Therefore, it clearly differs from assays that are based on the detection of IgGs and are only used in retrospective studies, such as variously sandwich, reverse and indirect ELISA.
- the advantages of the methods and reagents according to the current invention over the prior art include: (i) the production of diagnosis reagents in low safety laboratories; (ii) the production of a single reagent per virus, in a single step and without any chemical reaction step; (iii) the ability to detect IgMs, which appear early in infection and have low affinities, with artificial dimeric antigens; (iv) the specificity of detection towards the types of viruses and infections; (iv) the simplification and speeding up of the diagnosis assay by fusion between the antigen and an enzymatic tracer.
- said hybrids (H6-ED3-PhoA) 2 were constructed, at the genetic level between sequences encoding a hexahistidine, the viral domain ED3, and the alkaline phosphatase of E. coll
- the hexahistidine tag enabled the purification of the hybrids on a column of nickel ions.
- PhoA is a dimeric periplasmic protein. The fusion of a passenger protein with PhoA at the genetic level results in the dimerisation of the hybrid protein, its export into the periplasmic space, and the preservation of the folds and functions of the two partners (Boulain and Ducancel, 2004).
- the symmetrical points of insertion for the passenger protein in the crystal structure of the PhoA dimer are located on the same side of the molecule, close to one another (17.6 A) and far from the catalytic sites (> 32.5 A) (Le Du et al., 2002).
- hybrids (ED3-Pho A-Ho) 2 solves the problem of the antigenic valence.
- the hybrids include their own enzymatic tracer and the enzymatic portion of the hybrid does not depend on the nature of its antigenic portion.
- a MAC- or AAC- or MAC-ELISA involves only three participating molecules, according to the scheme:
- the envelope protein domain 3 polypeptide is selected in the group consisting of a yellow fever virus envelope protein domain 3 polypeptide, a West Nile virus envelope protein domain 3 polypeptide, a Dengue virus envelope protein domain 3 polypeptide, a St Louis encephalitis virus envelope protein domain 3 polypeptide, a Murray Valley encephalitis virus envelope protein domain 3 polypeptide and a Japanese encephalitis virus envelope protein domain 3 polypeptide.
- the ED3 domain is in particular from WNV (noted ED3.WN), from Yellow fever virus (ED3-YF) or from Dengue virus (serotypes 1, 2, 3 or 4) and preferably from serotype 1 of DENV (noted ED3.DEN1).
- ED3 polypeptides of Flavivirus are described for instance in International PCT Application WO 2004/016586.
- the instant invention also relates to a hybrid protein, characterized in that it comprises an appropriate polypeptide tag, an arbovirus ED3 domain and an alkaline phosphatase.
- the present invention relates to a hybrid protein which can be used in a method according to the current invention.
- said hybrid protein comprises hexahistidine, an appropriate flaviviral ED3 domain and the alkaline phosphatase of E. coli.
- Said hybrid protein is preferably in a multimeric form and more preferably in a dimeric form, such that for instance (H6-ED3 -PhOA) 2 .
- said hybrid protein comprises hexahistidine, an appropriate flaviviral ED3 domain and the alkaline phosphatase of E. coli.
- Said hybrid protein is preferably in a multimeric form and more preferably in a dimeric form, such that for instance (H6-ED3 -PhOA) 2 .
- hybrid protein H6-ED3.DENl-PhoA presents the sequence (SEQ ID NO:2).
- said hybrid protein H6-ED3.DENl-PhoA
- hybrid protein (H6-ED3.DEN3-PhoA) presents the sequence (SEQ ID NO:6).
- hybrid protein when the ED3 domain is from DEN4 virus, said hybrid protein (H6-ED3.DEN4-PhoA) presents the sequence (SEQ ID NO : 8) .
- hybrid protein H6-ED3.WN-PhoA
- SEQ ID NO: 10 said hybrid protein presents the sequence (SEQ ID NO: 10) and
- hybrid protein when the ED3 domain is from yellow fever virus, said hybrid protein (H6-ED3.YF-PhoA) presents the sequence (SEQ ID NO:12).
- the invention also relates to the nucleic acids encoding the hybrid proteins according to the invention.
- said nucleic acid is selected in the group consisting of
- H6-ED3.DEN2-PhoA hybrid protein SEQ ID NO:5 encoding H6-ED3.DEN3-PhoA hybrid protein
- SEQ ID NO:7 encoding H6-ED3.DEN4-PhoA hybrid protein
- Said hybrid proteins may be obtained according to a method similar as the ones described in EP 0 407 259 and in EP 0 752 475. Preferably they are obtained by inserting the correct ED3 in the expression vector pEBLl (SEQ ID NO:13), containing a modified alkaline phosphatase (SEQ ID NO: 24) comprising two mutations (D153G and D330N), with the numbering of Le Du et al., 2002.
- the invention also relates to a method of preparing a hybrid protein according to the invention, said method being characterized in that it comprises:
- step (d) of purifying is performed by affinity chromatography on a column of NiNTA resin.
- the different expression vectors thus obtained comprise the sequence expressing the appropriate hybrid proteins:
- the expression vector of step (a) is selected in the group consisting of an expression vector of a hybrid protein as defined here above and more preferably the hybrid protein H6-ED3.
- DENl- PhoA pEBLl l, deposited at the CNCM (Collection Nationale de Culture de Microorganismes, 28 rue du Dondel Roux, 75015 PARIS) on April 23, 2007 under the accession number 1-3748) and the hybrid protein H6-ED3.WN-PhoA (pEBL15, deposited at the CNCM (Collection Nationale de Culture de Microorganismes, 28 rue du Do Budapest Roux, 75015 PARIS) on April 23, 2007 under the accession number I- 3749).
- the present invention also relates to a method for screening for arbovirus antibodies and preferably flavi virus antibodies in a subject or an animal, said method comprising:
- Said detection is preferably performed by adding pNPP and measuring the formation of paranitrophenol.
- kits for diagnosing and/or screening for arbovirus antibodies and preferably flavivirus antibodies in a subject comprising:
- an Ig binding protein which is directed against a specific class of Ig molecules of the animal species under consideration and most generally consists of heterologous antibodies (anti-IgX antibodies) and
- hybrid protein comprising at least an arbovirus ED3 domain and an alkaline phosphatase
- - at least one positive control preferably a reference serum from an infected individual and - at least one negative control, preferably a reference serum from a non-infected individual.
- the alkaline phosphatase is a modified alkaline phosphatase including two mutations in its active site: D153G and D330N (with the numbering of Le Du et al.).
- the alkaline phosphatase comprises SEQ ID NO: 24.
- the invention also relates to the use of a hybrid protein comprising an appropriate antigen of a pathogen and an alkaline phosphatase, for an in vitro diagnostic of infections by said pathogen or for studying the epidemiology of said pathogen.
- the invention also relates to the use of a hybrid protein comprising an appropriate antigen of a pathogen and an alkaline phosphatase, for an in vitro validation of a vaccination against said pathogen or an immunogen thereof.
- the invention also relates to the use of a hybrid protein comprising a protein or a fragment thereof and alkaline phosphatase to study the interaction between said protein or fragment thereof fused with PhoA and molecules, proteins or cells.
- the invention also relates to a method for the diagnosis of an infection by a pathogen, for validating a vaccination by a pathogen or an immunogen thereof or for studying the epidemiology of said pathogen, characterized in that it comprises: (i) contacting a sample from a subject or an animal with a solid support sensitized with an Ig binding protein which is directed against a specific class of Ig molecules of the animal species under consideration,
- the invention also relates to a method for studying the interaction between a protein or a fragment thereof fused to PhoA and molecules, proteins or cells, characterized in that it comprises: (i) contacting said molecule, protein or cell with a hybrid protein comprising the protein or a fragment thereof fused to PhoA and (ii) detecting the complex eventually formed between the protein or a fragment thereof fused to PhoA and said molecule, said protein or said cell.
- the invention also relates to a method for screening for anti- arbovirus compounds, said method comprising: (i) contacting an anti-arbovirus antibody or a receptor of a surface molecule of an arbovirus, eventually bound to a solid support with a hybrid protein comprising an epitope of an arbovirus fused to PhoA
- step (iv) detecting if the amount of complex formed between said anti- arbovirus antibody or said receptor and said epitope has decreased in relation to the amount of complex detected in step (ii), by measuring an appropriate signal and comparing the signal obtained with the signal obtained in (ii).
- the formation of the immunocomplex is directly detected by adding 4-nitrophenylphosphate (pNPP) and measuring the formation of paranitrophenol.
- pNPP 4-nitrophenylphosphate
- Figure 1 Structures of plasmids pLBl l, pVP5, pLIP5GN-H6 and pEBLl.
- the bla and aph genes code for resistances to ampicillin and kanamycin respectively. >& for signal sequence and H6 for hexahistidine.
- Bottom part details of the sequence between the 5'-end of the phoA signal sequence and the main part of the phoA gene in pLIP5GN-H6 and pEBLl.
- the vertical arrow indicates the cleavage site of the signal peptide. The residues that do not belong to the phoA gene or its product are italicized.
- Figure 3 Simplified MAC-ELISA of murine serums, performed with the H6-ED3.WN-PhoA hybrid. Closed symbols, serum from a mouse immunized with gpE.WN; open symbols, control serum of a non-immunized mouse. Squares, revelation for 3 h at 25 0 C; circles, revelation overnight at 4°C; diamond, average value of the blanks.
- Figure 4 Specificity of a simplified GAC-ELISA towards the antigen.
- the assay was performed with the H6-ED3.DENl-PhoA and H6-ED3.WN- PhoA hybrids in parallel. Closed symbols, serum from a mouse infected with DENVl; open symbols, control serum of a non-infected mouse. Circles, cognate H6-
- the culture media LB (Sambrook and Russell, 2001) and SB (Pl ⁇ ckthun, 1996) have been described. Ampicillin was used at 200 ⁇ g/mL and kana- mycin at 50 ⁇ g/mL. LB medium with ampicillin was used for all the genetic constructions.
- the preparations of plasmid DNA were performed with the Qiaprep Spin Miniprep Kit, the extraction of DNA from agarose gels with the Gel Extraction Kit (both from Qiagen), the ligations of DNA with the Quick Ligation Kit (Roche), and the polyacrylamide gel electrophoreses with the NuPAGE Novex System (Invitrogen).
- the enzyme linked immunosorbent assays were performed in 96 wells microtitration plates (Maxisorb, Nunc).
- the PBS buffer phosphate buffer saline
- BSA bovine serum albumin
- Xp 5-bromo-4-chloro-3-indolyl phosphate
- Buffer A contained 50 mM Tris-HCl, pH 8.0, 500 niM NaCl; buffer B, 0.05% Tween in PBS; buffer C, 0.1% Tween in PBS; buffer D, 10% ethanolamine, pH 9.8, 0.01 M MgSO 4 ; and buffer E, 20 ⁇ M ZnCl 2 in buffer D.
- Plasmid pLIP5GN-H6 is a derivative of pQUANTAbody (figure 1).
- the FGA/89 strain of serotype 1 of the dengue virus (DENVl; Genbank accession number AF226687) (Duarte dos Santos et al., 2000), the IS-98-ST1 strain of the West Nile virus (WNV; Genbank AF481864; (Malkinson et al., 2002)), the recombinant form MVs chw of the Schwarz strain of the measles virus, and its derivative MVsch w -sEwNV (Despres et al., 2005) have been described.
- pUC-4K carries the aph gene, which confers resistance to kanamycin, in the form of a DNA cassette that is easily mobilisable.
- pQUANTAbody carries a mutant allele of the phoA gene from E. coli, under control of promoter ptac. This allele codes for an alkaline phosphatase (PhoA) with two mutations in its active site, D153G and D330N, and improved catalytic properties (Boulain and Ducancel, 2004; Le Du et al., 2002; Muller et al., 2001).
- pLIP5GN-H6 differs from pQUANTAbody by the presence of six codons of histidine (H6) and the multiple cloning site region, which are both located between codons 27 and 28 of phoA, downstream of the signal sequence ( Figure 1).
- pLBl l and pVP5 carry the gene segments that code for ED3.DEN1 and ED3.WN respectively between the Ncol and Xhol restriction sites of pET20b+ (figure 1).
- MVSchw-sEWNV expresses the soluble form of gpE from WNV.
- Human serums were from the collection of the National Center of Reference for Arboviruses, Institut Pasteur of French Guiana. They were collected from patients who displayed the basic clinical symptoms of dengue (fever, headache, myalgia, arthralgia), associated or not with rash and minor hemorrhagic manifestations. The serums were characterized with standard diagnosis methods, in particular GAC- and MAC-ELISAs using mouse-brain extracts as antigens.
- the goat anti-mouse IgM (Pierce) and IgG (Sigma-Aldrich) were purchased from commercial suppliers.
- the mouse monoclonal antibody mAb4El 1 has been described (Bedouelle et al., 2006). Its epitope at the surface of the ED3.DEN1 domain has been mapped; it is discontinuous and conformational (Lisova et al., 2007).
- a murine serum, directed against DENVl, was obtained by infection of BALB/c mice with the virus on day JO, challenge with the same virus on day J28, and bleeding on day J53.
- a control serum was obtained from non-infected mice of the same species.
- the titer in IgG of the positive serum defined as below and measured by an indirect ELISA against domain ED3.DENl 5 was equal to 30 000 (Despres et al., 2005).
- a serum, directed against sE from WNV was obtained by infection of CD46-IFNAR mice with the recombinant virus MV Sc h w -sEwNV on day JO, and bleeding on day J8.
- a control serum was obtained by infection of mice with the "empty" virus MVschw
- the titers in IgM of the positive and control serums were equal to 1000 and 100 respectively.
- EXAMPLE 2 Construction of the intermediate vector pEBLl, deposited at the CNCM (Collection Nationale de Culture de Microorganismes, 28 rue du Dondel Roux, 75015 PARIS) on April 23, 2007 under the accession number 1-3747
- Plasmid pUC-4K was digested with the Sail enzyme and the DNA fragment that contained the aph gene, was purified by agarose gel electrophoresis.
- pLIP5GN-H6 was also digested with Sail. The purified fragment and the linear vector were recombined by ligation.
- the recombinant plasmid, pEBLl (SEQ ID NO: 13), was recovered by transformation of the ligation mixture into competent cells of XLl- Blue and selection of the transformed cells on LB medium containing both ampicillin and kanamycin.
- XLl-Blue(pEBLl) is an Escherichia coli strain containing the pEBLl plasmid.
- pEBLl was engineered to simplify the construction of fusion proteins between an hexahistidine, a desired passenger protein (ED3 of flavivirus) and an alkaline phosphatase from E.coli with improved catalytic properties.
- a desired passenger protein ED3 of flavivirus
- alkaline phosphatase from E.coli with improved catalytic properties.
- DNA cassette which confers resistance to kanamycin is inserted at the position of the passenger gene.
- the insertion of the passenger gene is easier to perform and to monitor, according to a cloning strategy previously described by Hermann et al.,1990.
- the organism is resistant to ampicillin and kanamycin: this phenotype can be checked by plating the organism on Petri dishes containing LB Agar medium, lOO ⁇ g/ml Ampicillin and 50 ⁇ g/ml Kanamycin.
- the ED3-phoA hybrid genes coding for hybrid proteins between the ED3 domains of flaviviruses and PhoA, were constructed as follows. Plasmid pEBLl (see Example 2) was first digested with the restriction enzyme Smal, the completion of the digestion was verified by electrophoresis, and the digested DNA was desalted by size exclusion chromatography on a Microspin G25 column (Amersham- Biosciences). The linear form of pEBLl was then digested with the SaR enzyme and the restriction cut was monitored by electrophoresis and the appearance of a DNA fragment that corresponded to the cassette of resistance to kanamycin (1252 bp).
- the ED3 gene was amplified by PCR with two oligonucleotide primers and the high fidelity polymerase Pfu-Turbo (Stratagene).
- the primer that hybridized at the 5 '-end of the ED3 gene brought in a SaR site and the primers that hybridized at the 3 '-end, Seal and Spel sites.
- the Seal site (AGT-ACT) was preferred to the Smal site (CCC- GGG) because the latter introduced a rare codon CCC.
- the Seal, Spel and Sail sites were absent from the ED3.DEN1 and ED3. WN genes.
- the PCR products were digested with SaR and Seal.
- the digestion products were purified by electrophoresis through agarose gels and extraction, and then recombined by ligation.
- the recombinant plasmids were introduced into the XLl -Blue strain by transformation and the recombinant bacteria, screened for the formation of blue colonies on Xp indicator medium and sensitivity to kanamycine.
- DENl from plasmid pLBl had the following sequences, where the restriction sites are underlined: 5'-GCCGGCGCnOGACAAAGGGATGTCATATGTGATGTGCAC-S 1 (SEQ ID NO: 14);
- ED3.DENl-PhoA and pEBL15 coding for H6-ED3.WN-PhoA were checked with oligonucleotides that hybridized outside of the cloning region in pEBLl : 5'-GCACTGGCACTCTTACCGTTAC-S' (SEQ ID NO: 18); 5'-CAGTCTGATCACCCGTTAAAC-S' (SEQ ID N0:19).
- EXAMPLE 4 Production and purification of bifunctional ED3-PhoA hybrids
- the H6-ED3-PhoA hybrids were produced from plasmids pEBLl 1 and pEBL15 in strain XLl -Blue.
- a pre-culture of the producing strain was obtained by inoculation of SB broth (1/10 volume) with an isolated colony and overnight incu- bation at 37°C.
- the culture was centrifuged 10 min at 5000 rpm.
- the bacterial pellet was resuspended in 5 mM imidazole, 1 mg/ml polymyxin B sulfate (Sigma- Aldrich) in buffer A (1/40 volume) and the bacterial suspension mildly agitated for 1 h with a magnetic stirrer.
- the periplasmic extract was collected by centrifugation of the suspension for 10 min at 13 000 rpm and frozen at -20°C.
- the ED3-PhoA hybrid was purified from the periplasmic extract by affinity chromatography on a column of NiNTA resin (0,6ml/L of culture, Qiagen).
- the column was loaded with the periplasmic extract and washed with 20 mM imidazole in buffer A (10 volumes of resin). The bound proteins were eluted with a step gradient of 40 to 100 mM imidazole in buffer A. The fractions of purifications were analyzed by SDS-PAGE (12% acrylamide) in reducing conditions. Those that contained H6-ED3-PhoA and were pure at > 90%, were pooled and transferred in PBS buffer by size exclusion chromatography on a PlO column (Amersham biosciences). They were snap-frozen at -80°C either before or after transfer in PBS, indifferently in terms of functional properties (see Results).
- the indirect ELISAs were performed in microtitration plates with volumes of 200 ⁇ L/well.
- Antibody mAb4El l was diluted 10 000-fold with PBS.
- Wells 1 to 11 of a plate were loaded with the antibody solution and well 12 with PBS alone, and the plate was incubated overnight at 4 °C for the reaction of adsorption.
- the wells were washed with buffer B (3 times), blocked with 3% BSA in buffer B for 3 h at 25 °C, and washed again in buffer B (4 times).
- the H6-ED3.DENl-PhoA hybrid (0.2 ⁇ M initial concentration) was diluted twofold serially with 1% BSA in buffer B.
- Wells 1-10 were loaded with the 10 first dilutions of the hybrid, well 11 with the dilution buffer alone, and well 12 with the lowest dilution of the hybrid. The plate was incubated for 1 h at 25 °C for the reaction of capture. The wells were washed as above, and the captured hybrid was revealed by addition of 5 mM (2 mg/ml) pNPP in buffer D. The formation of j ⁇ r ⁇ -nitrophenol was measured after overnight at 4°, using
- H6-ED3-PhoA hybrids Functional properties of the H6-ED3-PhoA hybrids To evaluate the functionality of the H6-ED3-PhoA hybrids, their phosphatase activity was measured and their recognition by monoclonal antibody mAb4El l was assayed.
- the H6-ED3.DENl-PhoA and H6-ED3.WN-PhoA hybrids were active for the dephosphorylation of pNPP into pNP, with & C at values in buffer D and 25 °C equal to 190 ⁇ 18 s "1 and 154 ⁇ 6 s "1 respectively for one molecule of dimer.
- H6-ED3.DENl-PhoA bound immobilized mAb4El 1 specifically in an indirect ELISA which was revealed by its intrinsic phosphatase activity.
- EXAMPLE 5 GAC- and MAC-ELISAs Methods The capture ELISAs were performed in microtitration plates with a volume of 100 ⁇ L/well. The anti-IgG and anti-IgM antibodies were diluted in PBS (final concentrations 1 ⁇ g/mL). Wells 1 to 11 of a plate were loaded with the solution of antibody and well 12 with PBS alone. The plate was incubated overnight at 4 °C for the reaction of adsorption. The next morning, the wells were washed with buffer C (3 times), blocked with 3% (w/v) dry milk in buffer C for 1 h at 37 °C, and then washed with buffer C (3 times).
- the serum under analysis and the control serum were diluted 100 fold with 1% powder-milk in buffer C, then serially; the H6-ED3-PhoA hybrids were diluted in the same buffer (0.5 ⁇ M final concentration of monomer).
- Wells 1-10 were loaded with the 10 first dilutions of the serum, well 11 with the dilution buffer alone, and well 12 with the lowest dilution of the serum.
- the plate was incubated for 1 h at 37 °C for the reaction of antibody capture.
- the wells were washed with buffer C (3 times) and then loaded with the solution of H6-ED3-PhoA.
- the plate was incubated for 1 h at 37 °C for the binding reaction.
- the wells were washed as above and the bound H6-ED3-PhoA molecules revealed by addition of 5 mM pNPP in buffer E.
- a 405nm was measured either after a few hours at 25 °C or overnight at 4 0 C.
- the signal of the serum was considered as significant if its value was at least twice that of the blank controls.
- the titer of the serum was equal to the maximum dilution factor for which the signal remained significant.
- the capture ELISAs were performed for the murine serums as for the human serums, except that some washes were extended, the anti-IgM antibody was used at 2.4 ⁇ g/mL final concentration, H6- ED3.DENl-PhoA at 0.2 ⁇ M final concentration of monomer, and pNPP in buffer D. Results
- an H6-ED3-PhoA hybrid could detect IgGs, directed against the cognate flavivirus, in the serum of an immunized mouse and thus simplify the protocol of GAC-ELISA which is generally used for such a serology. Therefore, an antibody, directed against the murine IgGs, was immobilized in the wells of a microtitration plate by passive adsorption on the plastics. This immobilized antibody was used to capture the IgGs that were present in the mouse serum. The IgGs that were directed against the ED3 domain, were revealed with the H6-ED3-PhoA hybrid, through the binding of its antigenic portion and the catalytic activity of its PhoA portion (Equation 3).
- This assay was performed with the serum of a mouse that had been immunized with DENVl.
- the serum of a non-immunized mouse, a blank test without anti-IgG antibody, and blank tests without serum were used as controls (Materials and Methods).
- the formation of pNP from pNPP, catalyzed by the H6-ED3.DENl -PhoA hybrid and monitored with ⁇ os nm was used as a signal to reveal the binding reaction (Figure 2).
- the A 405nm signal followed a low of saturation as a function of the concentration in immune serum.
- the titer of the immune serum was > 50000 after an overnight revelation (> 12500 after 2.5 h) in these experiments that were repeated three times independently.
- H6-ED3-PhoA hybrid could detect IgMs, directed against a flavivirus, in the serum of an immunized mouse and thus simplify the protocol of MAC-ELISA which is generally used.
- This assay was performed with the serum of a mouse that had been immunized with the chimeric virus MV SC I W -SEWN V , which expresses the secreted form of gpE from WNV.
- the serum of a mouse that had been immunized with the empty vector MVs chw , a blank test without anti-IgM antibody, and blank tests without sera were used as controls (Materials and Methods).
- the H6-ED3.WN-PhoA hybrid was used to reveal the binding reactions (Figure 3).
- the A 405nm signal followed a low of saturation as a function of the concentration in immune serum.
- the titer of the immune serum was > 800 after an overnight revelation (> 400 after 3 h).
- the A 4O5nIn signal for the non-immune serum was at most 1.7 fold higher than the blank signal after an overnight incubation whereas the signal for the immune serum was 2 to 6.4 fold higher than the blank signal, depending on the concentration. These figures were 1.2 fold for the non-immune serum and 2 to 2.6 fold for the immune serum after a revelation of 3h. Note that the signal for the non-immune serum did not differ significantly from the blank signal for relative concentrations of serum ⁇ 2.5 %o. These results confirmed that both portions of H6-ED3.WN-PhoA were simultaneously functional in one molecule of hybrid. They showed that this hybrid could sensitively, quantitatively and specifically assay the presence of IgMs, directed against the ED3.WN domain.
- EXAMPLE 6 Discrimination between flaviviruses by the ED3-PhoA hybrids The specificity of the simplified GAC- and MAC-ELISA according to the invention was tested by performing cross-reactions. The serum of the mouse that had been immunized with the DENVl virus, was submitted to two parallel GAC- ELISAs that were revealed with either the H6-ED3.DENl-PhoA hybrid or with H6- ED3.WN-PhoA ( Figure 4).
- the serum of the mouse that had been immunized with the MVS C I W -SEWNV chimeric virus was submitted to two parallel MAC-ELISAs that were revealed with either the H6-ED3.DENl-PhoA hybrid or with H6-ED3.WN-PhoA ( Figure 5). After an overnight revelation, the cognate signal was up to 5.4 fold higher than the non-cognate signal in the GAC-ELISA, and up to 3.9 fold higher in the MAC-ELISA. Of course, these figures were much higher when the specific signals (signal of the serum minus signal of the blank) were considered. These results showed that the GAC- and MAC-ELISA, as described here, were specific and that they allowed one to determine the identity of the flavivirus that was involved in the infection or immunization.
- EXAMPLE 7 Assay of human serums with the simplified GAC- and MAC- ELISA
- the H6-ED3.DENl-PhoA hybrid was used to test serums from human patients who had been infected with one of the four serotypes DENVl to DENV4 of the dengue virus.
- DENVl three serum samples, taken between days 9 and 28 after the onset of the symptoms, corresponded to primary infections with the dengue virus; two serum samples, taken at days 13 and 18, corresponded to secondary infections.
- DENV2, -3 and -4 the samples were taken between days 8 and 32, and the primary or secondary status of the infection was unknown.
- These serums had been previously assayed by standard methods of GAC- and MAC-ELISA, with suckling mouse brain extracts as antigens.
- the following controls were used: an assay in which the immobilized antibody, directed against human IgG or IgM, was omitted; an assay in which the serum was omitted; and two assays with serums of patients who had not been infected by the dengue virus.
- the A 405nm signal followed a law of saturation as a function of the concentration in serum, for the serums from patients with primary DENVl infections in the MAC-ELISA ( Figure 6) and for the serums from patients with secondary DENVl infections in the GAC-ELISA (not shown). It increased linearly up to a relative concentration of serum > 2.5 %o. Therefore, this relative concentration was used for the following of the analysis. A revelation of the assays during 3 h at 25 0 C was sufficient.
- the simplified MAC-ELISA according to the invention could detect a primary infection with DENVl, and distinguish between infections with DENVl and the other three serotypes.
- Four serum samples gave positive signals in the GAC-ELISA: the two samples from patients with a secondary DENVl infection; one sample (2d) among the six samples from patients with a DENV2 infection; and one sample (4a) among the two samples from patients with a DENV4 infection ( Figure 7B).
- the simplified GAC-ELISA according to the invention could detect a secondary infection with DENVl at day 13 after the onset of symptoms.
- the ratio r of the signals in parallel MAC- and GAC-ELISAs has been used to determine whether an infection by the dengue virus is of the primary or secondary type.
- Such a ratio for the signals in the simplified capture ELISAs according to the invention ( Figure 7C) was calculated.
- the three serums that corresponded to primary infections by DENVl had r > 1.90. All the serums that corresponded to infections by DENV2, -3 and -4, had r ⁇ 1.4, except serums 2d and 4a.
- the serums that corresponded to secondary infections by DENVl, and serums 2d and 4a had r ⁇ 0.4.
- the ratio r could distinguish between primary and secondary infections, and also between primary infections with DENVl and infections with other DENV serotypes.
- the (H6-ED3.DENl-PhoA) 2 hybrid was used successfully in a simplified GAC-ELISA to reveal the presence of IgGs, directed against DENVl, in the serum of a mouse that had been hyper-immunized against this virus, or in the serums of human patients who had endured a secondary infection by this virus.
- the same hybrid was used successfully in a simplified MAC-ELISA to reveal the presence of IgMs, directed against DENVl, in the serums of patients who had endured a primary infection by this virus.
- the simplified GAC-ELISA enabled us to distinguish between infection by DENVl and WNV in the mouse.
- the combination of the simplified GAC- and MAC-ELISAs enabled us to distinguish between an infection by DENVl and an infection by the three other serotypes of DENV in man, and also between a primary and a secondary infection by DENVl.
- the (H6-ED3.WN-PhoA) 2 hybrid was used successfully in a simplified MAC-ELISA to reveal the presence of IgMs, directed against WNV in the serum of a mouse. This simplified MAC-ELISA enabled us to distinguish between infections by WNV and DENVl.
- the high specificity and sensitivity of the simplified GAC- and MAC-ELISAs came likely from two factors: the use of the ED3 domain as an antigen and the independence of the detection system, consisting of the fusion with PhoA, towards the nature of the antigen and its interactions with the immunoglobulins of the serum.
- the specificity of the (H6-ED3-PhoA) 2 bifunctional dimers should be higher than those of the antigens and detection systems that have been used up until now.
- EXAMPLE 8 Assay of human serums with a simplified MAC-ELISA
- serums of patients infected by one of the four serotypes DENl to DEN4 of the dengue virus or by the yellow fever virus (YFV) were collected and characterized by standard methods of MAC-ELISA (Talarmin et al., 1998) and PCR (Lanciotti et al, 1992).
- the standard MAC-ELISA used extracts of infected suckling mouse brains as antigens and the PCR used primers that were specific for each viral serotype (Table I).
- the primer sequences and amplification conditions were as described (Lanciotti et al., 1992). In particular the primer sequences were as follows:Primer Dl: 5'- TCAATATGCTGAAACGCGCGAGAAACCG -3 ' (SEQ ID NO: 26).
- Primer D2 5'- TTGCACCAACAGTCAATGTCTTCAGGTTC -3' (SEQ ID NO: 27).
- Primer TSl 5'- CGTCTCAGTGATCCGGGGG -3' (SEQ ID NO: 28).
- Primer TS2 5'- CGCCACAAGGGGCATGAACAG -3' (SEQ ID NO: 29).
- Primer TS3 5'- TAACATCATCATGAGACAGAGC -3' (SEQ ID NO: 30).
- Primer TS4 5'- CTC TGT TGT CTT AAA CAA GAG A -3' (SEQ ID NO: 31).
- the reactions were allowed to proceed in a thermocycler programmed to incubate for 1 h at 42°C and then to proceed with 35 cycles of denaturation (94°C, 30 s), primer annealing (55°C, 1 min) and primer extension (72°C, 2 min).
- Table I Number of human serums analyzed by simplified MAC and GAC-ELISAs.
- the collected serums were assayed by the simplified MAC-ELISA according to the present invention, with the five corresponding H6-ED3-PhoA hybrids and as previously described (see Example 5).
- the general format of the simplified MAC-ELISA is the following:
- the latter consisted in an assay which was performed in n-plicates (n > 3) and in which the antibody directed against the human IgMs, was omitted.
- Table II gives the proportion of positive signals for each type of serum and hybrid.
- the proportion of positive signals was maximal for the cognate hybrid, except for the serums of patients that were infected by DENV4.
- the proportion of positive signals was maximal with the ED3.DENl-PhoA and ED3.DEN2-PhoA hybrids.
- the DEN2 and YF serums reacted rarely with non-cognate hybrids.
- the DENl serums reacted often with the DEN2 and DEN3 hybrids, and the DEN4 serums with every DEN hybrid.
- the sensitivity of the simplified MAC-ELISA is given in row 1 of Table IV, for each type of serum and cognate hybrid. This sensitivity was high for the DENl and DEN2 serums, medium for the DEN3 and YF serums, and low for the DEN4 serums. If one restricts itself to the four YF serums that came from the Institut Pasteur of Cayenne and corresponded to vaccinated patients, the sensitivity was much higher (four positive signals).
- the ED3.YF-PhoA hybrid whose sequence corresponded to the vaccinal strain 17D of YFV, might detect the IgM that are directed against the vaccinal virus better that those that are directed against wild type strains. Table IV. Sensitivity and specificities of the simplified MAC-ELISAs for human serums.
- sensitivity in row 1 was defined as the proportion of serums that gave a positive signal when assayed with the cognate H6-ED3-PhoA hybrid (see diagonal in Table II).
- DEN serotype specificity in row 2 was defined as the proportion of serums that gave negative signals with the three non-cognate DEN hybrids, among those that gave a positive signal with the cognate DEN hybrid.
- DEN serotype specificity in row 3 was defined as the proportion of serums that gave a higher signal with the cognate DEN hybrid than with the three non-cognate DEN hybrids, among those that gave a positive signal with the cognate hybrid.
- the DEN serotype specificities in rows 2 and 3 were determined with the serums of Table I, column 3.
- Group specificity in row 4 was defined as the proportion of DEN serums that gave a positive signal with the cognate DEN hybrid and a negative signal with the YF hybrid; and as the proportion of YF serums that gave a positive signal with the cognate YF hybrid and a negative signal with all four DEN hybrids.
- Viral specificity in row 5 was defined as the proportion of serums that gave a higher signal with the cognate hybrid than with the non-cognate ones, among those that gave a positive signal with their cognate hybrid.
- the group and viral specificities in rows 4 and 5 were determined with the serums of Table I column 4. See Table II for other details.
- the specificity of the ED3-PhoA hybrids for a DEN serotype in the simplified MAC-ELISAs was calculated as the proportion of serums that gave negative signals with the three non-cognate hybrids (A ⁇ 2A C ), among serums that gave a positive signal with the cognate hybrid (A > 2A C ).
- This specificity of serotype was high for the ED3.DEN2-PhoA hybrid, medium for the DEN3 hybrid, low for the DENl hybrid and nil for the DEN4 hybrid (Table IV, row 2).
- the specificity of the ED3-PhoA hybrids for a viral group in the simplified MAC-ELISAs was calculated on the one hand as the proportion of DEN serums that gave a positive signal with the cognate ED3.DEN-PhoA hybrid and a negative signal with the ED3.YF-PhoA hybrid; and on the other hand as the proportion of YF serums that gave a positive signal with the cognate ED3.YF-PhoA hybrid and a negative signal with all the ED3.DEN-PhoA hybrids.
- This specificity for a viral group was > 89 % in every case and up to 100 % for the ED3.DENl-PhoA and ED3.DEN4-PhoA hybrids (Table IV, row 4).
- the modular structure of the ED3-PhoA hybrids is such that the intensity of the signal in a simplified MAC-ELISA depends only on the properties of recognition between its ED3 portion and the antibodies of the serum. This property enables one to quantitatively compare the signals obtained for a given serum with ED3-PhoA hybrids that carry different ED3 domains. Therefore, the inventors calculated the proportion of serums that gave a positive signal with the cognate ED3- PhoA hybrid, and a higher signal with the cognate hybrid than with the non-cognate ones. The inventors calculated these proportions for the four ED3.DEN hybrids and then for the five ED3-PhoA hybrids.
- Serums of patients infected by one of the three serotypes DENl, DEN2 and DEN3 of the dengue virus were collected and characterized by standard methods of IgG-specific indirect ELISA and PCR.
- the collected serums were assayed by the simplified GAC-ELISA according to the present invention, with the three corresponding H6-ED3-PhoA hybrids, as previously described (see Example 5).
- the general format of the simplified GAC-ELISA is the following: Support-@huIgG :: serum :: (H6-ED3-PhoA) 2 where @huIgG is an antibody directed against the human IgGs.
- the inventors considered that the signal of a serum assay was positive when it was higher than twice the signal of the control. The latter consisted in an assay which was performed in n-plicates (n > 3) and in which the antibody directed against the human IgGs, was omitted.
- Table V the sensitivity and serotype specificity were defined as in Table IV.
- the number and properties of the human serums are given in Table I.
- the H6-ED3-PhoA hybrids characterised in examples 8-11, have enabled the inventors to recognize recent infections by the dengue viruses or the yellow fever virus precociously, by a simplified MAC-ELISA.
- differences in sensitivity could be due to variable levels of immunogenicity of the ED3 domains, according to the virus. Under this assumption, the ED3.DEN4 domain could be less immunogenic than the ED3 domains from the three other serotypes DEN1-DEN3 or from YFV. Alternatively, the differences in sensitivity could be due to the specific strains, and therefore sequences, of viruses that the inventors used to construct the recombinant hybrids. For example, the simplified MAC-ELISA for the infection by YFV could be improved by having two hybrids at one's disposal, one corresponding to the 17D vaccine strain and the other one to a wild type strain.
- the five tested hybrids had a very good specificity of viral group, i. e. dengue group versus yellow fever group, higher than 89 %. They also had a very good specificity of serotype, higher than 89 % except for the DEN4 hybrid, when assays of a same serum with different hybrids were compared quantitatively.
- the results suggested that the antibodies directed against ED3.DEN4 recognize epitopes that are shared between flaviviruses.
- the recombinant H6-ED3-PhoA hybrids can be prepared easily in low safety laboratories. They enable the detection of infections by flaviviruses precociously and allow clinicians to distinguish between groups of viruses or even between serotypes of the dengue virus. References
- Enzyme-linked immunosorbent assay specific to Dengue virus type 1 nonstructural protein NS 1 reveals circulation of the antigen in the blood during the acute phase of disease in patients experiencing primary or secondary infections. J Clin Microbiol 40, 376-381.
- XLl-Blue a high efficiency plasmid transforming recA Escherichia coli strain with beta- galactosidase selection. BioTechniques 5, 376-379.
- IgM capture ELISA for detection of IgM antibodies to dengue virus comparison of 2 formats using hemagglutinins and cell culture derived antigens. Southeast Asian J Trop Med Public Health 23, 726-729.
- IgM immunoglobulin M
- pDAP2 a vector for construction of alkaline phosphatase fusion proteins.
- IgM IgG enzyme-linked immunosorbent assay
- ELISA enzyme-linked immunosorbent assay
- nonstructural protein NSl serotype-specific IgG ELISA for differentiation of primary and secondary dengue virus infections.
- Clin Diagn Lab Immunol 10, 622-630. Shu, P. Y., Chen, L. K. 5 Chang, S. F., Yueh, Y. Y., Chow, L., Chien, L. J., Chin, C, Yang, H. H., Lin, T. H., and Huang, J. H. (2002).
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Hematology (AREA)
- Urology & Nephrology (AREA)
- Food Science & Technology (AREA)
- General Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Biotechnology (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Pathology (AREA)
- Virology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Peptides Or Proteins (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Investigating Or Analysing Biological Materials (AREA)
- Enzymes And Modification Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Priority Applications (7)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2010511745A JP2010530960A (ja) | 2007-06-15 | 2008-06-13 | アルボウイルス感染の診断又はスクリーニング方法、該方法に有用な試剤及びそれらの用途 |
| AU2008263507A AU2008263507B2 (en) | 2007-06-15 | 2008-06-13 | Method for the diagnosis or the screening of an arbovirus infection, reagents useful in said method and their applications |
| EP08807207A EP2170936A2 (en) | 2007-06-15 | 2008-06-13 | Method for the diagnosis or the screening of an arbovirus infection, reagents useful in said method and their applications |
| CN200880103542A CN101784561A (zh) | 2007-06-15 | 2008-06-13 | 用于诊断或筛选节肢介体病毒感染的方法、在所述方法和它们的应用中使用的试剂 |
| CA2690764A CA2690764A1 (en) | 2007-06-15 | 2008-06-13 | Method for the diagnosis or the screening of an arbovirus infection, reagents useful in said method and their applications |
| BRPI0814247-5A2A BRPI0814247A2 (pt) | 2007-06-15 | 2008-06-13 | Método para diagnóstico ou classificação de uma infecção por arbovírus, reagentes úteis no dito método e suas aplicações |
| US12/664,778 US8357496B2 (en) | 2007-06-15 | 2008-06-13 | Method for the diagnosis or the screening of an arbovirus infection, reagents useful in said method and their applications |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP07290749A EP2003144A1 (en) | 2007-06-15 | 2007-06-15 | Method for the diagnosis or the screening of an arbovirus infection, reagents useful in said method and their applications |
| EP07290749.6 | 2007-06-15 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2008152528A2 true WO2008152528A2 (en) | 2008-12-18 |
| WO2008152528A3 WO2008152528A3 (en) | 2009-03-12 |
Family
ID=38740531
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/IB2008/002614 Ceased WO2008152528A2 (en) | 2007-06-15 | 2008-06-13 | Method for the diagnosis or the screening of an arbovirus infection, reagents useful in said method and their applications |
Country Status (8)
| Country | Link |
|---|---|
| US (1) | US8357496B2 (enExample) |
| EP (2) | EP2003144A1 (enExample) |
| JP (1) | JP2010530960A (enExample) |
| CN (1) | CN101784561A (enExample) |
| AU (1) | AU2008263507B2 (enExample) |
| BR (1) | BRPI0814247A2 (enExample) |
| CA (1) | CA2690764A1 (enExample) |
| WO (1) | WO2008152528A2 (enExample) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2272860A1 (en) | 2009-07-10 | 2011-01-12 | Institut Pasteur | Multivalent epitope in complex with a detection marker for the early serodiagnosis of infections |
| US8999675B2 (en) | 2009-08-31 | 2015-04-07 | Gen-Probe Incorporated | Dengue virus assay |
| WO2018115509A3 (en) * | 2016-12-23 | 2018-08-30 | Expres2Ion Biotechnologies Aps | New flavivirus vaccine |
| US10591480B2 (en) | 2016-06-06 | 2020-03-17 | Medizinische Universität Wien | Method for the detection of an IgM antibody specific for a flavivirus in a sample |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR102339120B1 (ko) * | 2012-09-27 | 2021-12-14 | 아이덱스 래보러토리즈, 인코포레이티드 | 슈말렌베르그 바이러스(sbv)의 검출 방법 및 키트 |
| JP5866715B2 (ja) | 2013-10-18 | 2016-02-17 | 国立大学法人九州大学 | タンパク質検出用融合タンパク質およびタンパク質の検出方法 |
| GB201704126D0 (en) * | 2017-03-15 | 2017-04-26 | Blom Nihlén Kim Andrea | Vaccine |
| KR102832926B1 (ko) * | 2017-04-26 | 2025-07-10 | 에프. 호프만-라 로슈 아게 | 가용성 및 면역반응성 지카 바이러스 ns1 폴리펩티드 |
| CN108486219B (zh) * | 2018-03-28 | 2022-02-25 | 中国人民解放军军事科学院军事医学研究院 | 一种检测离体血清样本是否感染乙型脑炎病毒的试剂盒 |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0688364A4 (en) * | 1993-03-09 | 1997-10-15 | Abbott Lab | ENZYMES PRODUCED BY GENETIC ENGINEERING AND CONJUGATES OF SAID ENZYMES FOR DIAGNOSTIC ANALYSIS |
| FR2736065B1 (fr) * | 1995-06-29 | 1997-09-19 | Commissariat Energie Atomique | Phosphatases alcalines bacteriennes modifiees et leurs applications. |
| US7227011B2 (en) * | 1998-06-04 | 2007-06-05 | United States Of America As Represented By The Secretary Of The Department Of Health And Human Services, Centers For Disease Control And Prevention | Nucleic acid vaccines for prevention of flavivirus infection |
| WO2004016586A2 (en) * | 2002-08-16 | 2004-02-26 | Board Of Regents The University Of Texas System | Compositions and methods related to flavivirus envelope protein domain iii antigens |
| DE602005025647D1 (de) * | 2004-07-23 | 2011-02-10 | Novartis Vaccines & Diagnostic | Polypeptide für die oligomerisierung von antigenen |
-
2007
- 2007-06-15 EP EP07290749A patent/EP2003144A1/en not_active Withdrawn
-
2008
- 2008-06-13 US US12/664,778 patent/US8357496B2/en not_active Expired - Fee Related
- 2008-06-13 CA CA2690764A patent/CA2690764A1/en not_active Abandoned
- 2008-06-13 JP JP2010511745A patent/JP2010530960A/ja not_active Ceased
- 2008-06-13 AU AU2008263507A patent/AU2008263507B2/en not_active Ceased
- 2008-06-13 BR BRPI0814247-5A2A patent/BRPI0814247A2/pt not_active IP Right Cessation
- 2008-06-13 WO PCT/IB2008/002614 patent/WO2008152528A2/en not_active Ceased
- 2008-06-13 CN CN200880103542A patent/CN101784561A/zh active Pending
- 2008-06-13 EP EP08807207A patent/EP2170936A2/en not_active Withdrawn
Non-Patent Citations (7)
| Title |
|---|
| BEASLEY DAVID W C ET AL: "Use of a recombinant envelope protein subunit antigen for specific serological diagnosis of West Nile virus infection." JOURNAL OF CLINICAL MICROBIOLOGY JUN 2004, vol. 42, no. 6, June 2004 (2004-06), pages 2759-2765, XP002461178 ISSN: 0095-1137 * |
| CUZZUBBO ANDREA J ET AL: "Comparison of PanBio Dengue Duo enzyme-linked immunosorbent assay (ELISA) and MRL dengue fever virus immunoglobulin M capture ELISA for diagnosis of dengue virus infections in southeast Asia" CLINICAL AND DIAGNOSTIC LABORATORY IMMUNOLOGY, vol. 6, no. 5, September 1999 (1999-09), pages 705-712, XP002461177 ISSN: 1071-412X * |
| KERSCHBAUMER R J ET AL: "PDAP2 : A VECTOR FOR CONSTRUCTION OF ALKALINE PHOSPHATASE FUSION- PROTEINS" IMMUNOTECHNOLOGY, ELSEVIER SCIENCE PUBLISHERS BV, NL, vol. 2, no. 2, 1996, pages 145-150, XP004052678 ISSN: 1380-2933 * |
| LUDOLFS D ET AL: "Reverse ELISA for the detection of anti West Nile virus IgG antibodies in humans" EUROPEAN JOURNAL OF CLINICAL MICROBIOLOGY & INFECTIOUS DISEASES, SPRINGER-VERLAG, BE, vol. 26, no. 7, 7 June 2007 (2007-06-07), pages 467-473, XP019494786 ISSN: 1435-4373 * |
| MONATH T P ET AL: "IMMUNOGLOBULIN M ANTIBODY CAPTURE ENZYME-LINKED IMMUNOSORBENT ASSAY ELISA FOR DIAGNOSIS OF ST-LOUIS ENCEPHALITIS" JOURNAL OF CLINICAL MICROBIOLOGY, vol. 20, no. 4, 1984, pages 784-790, XP002461176 ISSN: 0095-1137 * |
| VAZQUEZ ET AL: "Kinetics of antibodies in sera, saliva, and urine samples from adult patients with primary or secondary dengue 3 virus infections" INTERNATIONAL JOURNAL OF INFECTIOUS DISEASES, INTERNATIONAL SOCIETY FOR INFECTIOUS DISEASES, HAMILTON, CA, vol. 11, no. 3, 24 April 2007 (2007-04-24), pages 256-262, XP022055493 ISSN: 1201-9712 * |
| YANG CHANGSHENG ET AL: "Detection of IgM antibodies to coxsackie B viruses in viral myocarditis by using a synthetic peptide of CVB coat protein VP3" FASEB JOURNAL (FEDERATION OF AMERICAN SOCIETIES FOR EXPERIMENTAL BIOLOGY), BETHESDA, US, vol. 19, no. 4,Suppl S part 1, 6 March 2005 (2005-03-06), pages a44-a45, XP009093052 ISSN: 0892-6638 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2272860A1 (en) | 2009-07-10 | 2011-01-12 | Institut Pasteur | Multivalent epitope in complex with a detection marker for the early serodiagnosis of infections |
| WO2011004324A1 (en) | 2009-07-10 | 2011-01-13 | Institut Pasteur | Multivalent epitope in complex with a detection marker for the early serodiagnosis of infections |
| US8999675B2 (en) | 2009-08-31 | 2015-04-07 | Gen-Probe Incorporated | Dengue virus assay |
| US10591480B2 (en) | 2016-06-06 | 2020-03-17 | Medizinische Universität Wien | Method for the detection of an IgM antibody specific for a flavivirus in a sample |
| WO2018115509A3 (en) * | 2016-12-23 | 2018-08-30 | Expres2Ion Biotechnologies Aps | New flavivirus vaccine |
Also Published As
| Publication number | Publication date |
|---|---|
| EP2003144A1 (en) | 2008-12-17 |
| WO2008152528A3 (en) | 2009-03-12 |
| CN101784561A (zh) | 2010-07-21 |
| BRPI0814247A2 (pt) | 2015-01-06 |
| CA2690764A1 (en) | 2008-12-18 |
| EP2170936A2 (en) | 2010-04-07 |
| JP2010530960A (ja) | 2010-09-16 |
| US20100291586A1 (en) | 2010-11-18 |
| AU2008263507B2 (en) | 2013-09-12 |
| AU2008263507A1 (en) | 2008-12-18 |
| US8357496B2 (en) | 2013-01-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2008263507B2 (en) | Method for the diagnosis or the screening of an arbovirus infection, reagents useful in said method and their applications | |
| Shi et al. | Serologic diagnosis of West Nile virus infection | |
| EP2272860A1 (en) | Multivalent epitope in complex with a detection marker for the early serodiagnosis of infections | |
| Gaspar-Castillo et al. | Structural and immunological basis of cross-reactivity between dengue and Zika infections: Implications in serosurveillance in endemic regions | |
| AnandaRao et al. | A custom-designed recombinant multiepitope protein as a dengue diagnostic reagent | |
| US11913953B2 (en) | Immunoassay methods and compositions for detecting infection involving use of test antigens as cross-reactive control antigens | |
| Kim et al. | Development of a rapid diagnostic test kit to detect IgG/IgM antibody against Zika virus using monoclonal antibodies to the envelope and non-structural protein 1 of the virus | |
| WO2022020733A2 (en) | System and methods for detection of pathogenic viruses | |
| Lazaro-Olan et al. | Analysis of antibody response in human dengue patients from the Mexican coast using recombinant antigens | |
| JP6908299B2 (ja) | サンプル中のフラビウイルスに特異的なIgM抗体の検出方法 | |
| Kim et al. | Optimization of Zika virus envelope protein production for ELISA and correlation of antibody titers with virus neutralization in Mexican patients from an arbovirus endemic region | |
| Niu et al. | Dengue virus envelope domain III protein based on a tetravalent antigen secreted from insect cells: Potential use for serological diagnosis | |
| EP1745291B1 (en) | Detection of west nile virus | |
| CN112341527B (zh) | Hcv重组抗原及应用 | |
| WO2007034507A2 (en) | Tetravalent dengue specific domain iii based chimeric recombinant protein | |
| Ludolfs et al. | Reverse ELISA for the detection of anti West Nile virus IgG antibodies in humans | |
| WO2005014627A1 (en) | Recombinant dengue multi epitope proteins as diagnostic intermediates | |
| Malnero et al. | Expression of recombinant dengue virus type 1 non-structural protein 1 in mammalian cells and preliminary assessment of its suitability to detect human IgG antibodies elicited by viral infection | |
| US10921323B2 (en) | Method for the immunological diagnosis of a sample with a potential infection with an arbovirus and test kits suitable for this purpose | |
| Kim et al. | Temperature-dependent secretion of Zika virus envelope and non-structural protein 1 in mammalian cells for clinical applications | |
| Ma et al. | Development of a sensitive sandwich ELISA for the envelope domain III protein of dengue virus type 2 | |
| Lebani | Antibody discovery for development of a serotyping dengue virus NS1 capture assay | |
| Eltzov et al. | Dengue virus diagnostics | |
| Ganguly | Ultrasensitive Point-of-Care Dengue Diagnostics and Vaccine Applications | |
| Saxena et al. | Heterologous expression of envelope Protein (Domain III) of Dengue Virus Type 2 for Serodiagnosis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| WWE | Wipo information: entry into national phase |
Ref document number: 200880103542.4 Country of ref document: CN |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 08807207 Country of ref document: EP Kind code of ref document: A2 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2008263507 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2690764 Country of ref document: CA Ref document number: 2010511745 Country of ref document: JP |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2008263507 Country of ref document: AU Date of ref document: 20080613 Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2008807207 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 12664778 Country of ref document: US |
|
| ENP | Entry into the national phase |
Ref document number: PI0814247 Country of ref document: BR Kind code of ref document: A2 Effective date: 20091215 |