WO2008147040A1

WO2008147040A1 - Pbz1 protein involved in senescence and cell death of monocot plants

Info

Publication number: WO2008147040A1
Application number: PCT/KR2008/001926
Authority: WO
Inventors: Kyu Young Kang; Sun Tae Kim; Sang Gon Kim
Original assignee: Industry-Academic Cooperation Foundation Gyeongsang National University
Priority date: 2007-05-29
Filing date: 2008-04-04
Publication date: 2008-12-04
Also published as: KR100877730B1; KR20080104728A

Abstract

The present invention relates to PBZ1 protein that is involved in senescence and cell death of monocot plants, a gene encoding said protein, a promoter for said gene, a recombinant vector comprising said gene or said promoter, plants transformed with said recombinant vector and transgenic seed thereof, a method of inducing plant senescence and cell death by transforming plants with said recombinant vector, a biomarker consisting of an antibody against said PBZ1 protein for identifying plant senescence and cell death, and a method of increasing a disease resistance of plant by transforming the plant with said recombinant vector. According to the present invention, when monocot plants such as rice plant is transformed with the gene comprising the above-described promoter, plants having an excellent protective effect against disease can be developed.

Description

PBZl PROTEIN INVOLVED IN SENESCENCE AND CELL DEATH OF MONOCOT PLANTS

Technical Field

[1] The present invention relates to PBZl protein that is involved in senescence and cell death of monocot plants. More specifically, the present invention relates to PBZl protein that is involved in senescence and cell death of monocot plants, a gene encoding said protein, a promoter for said gene, a recombinant vector comprising said gene or said promoter, plants transformed with said recombinant vector and transgenic seed thereof, a method of inducing plant senescence and cell death by transforming plants with said recombinant vector, a biomarker consisting of an antibody against said PBZl protein for identifying plant senescence and cell death, and a method of increasing a disease resistance of plant by transforming the plant with said recombinant vector. Background Art

[2] Programmed cell death (PCD), a genetically determined process that occurs in response to environmental signals (including abiotic and biotic stresses) and development, plays an essential role in plant growth and survival in multicellular organisms by removing undesirable cells. PCD has been well characterized in animals by genetically controlled processes. In plants, PCD has been observed during developmental events, such as tracheary element development in pea, leaf senescence in rice, cell senescence in Arabidopsis, formation of aerenchyma in water logged roots, seed alurone layer, and during the hypersensitive response (HR) to pathogen attack. Senescence, which is the final stage of plant vegetative and reproductive cell and tissues, has certain features in common with PCD. In the rice plant, the progression of senescence and PCD associated with aerenchyma formation develops in the coleoptiles as well as the leaf (Sodmergen et al., Protoplasma 1989, 152, 65-68).

[3] In particular, lesion mimic mutants (LMMs) exhibiting HR-like lesions in the absence of pathogen attack have been usually used as tools for genetic analysis of PCD during lesion development (Lorrain et al., Trends Plant Sci. 2003, 8, 263-271). Therefore, many LMMs have been isolated and characterized in numerous plant species including maize, barley, soybean, and rice. In addition, LMMs have revealed the induction of a series of defense responses such as callose deposition, inducible expression of defense-related genes, production of reactive oxygen species (ROS), and accumulation of phytoalexins, conferring enhanced resistance to infection by pathogens. In rice, the LMMs, spotted leaf (spll and spll 1), lesion mimic cell death and resistance (cdr), and blast lesion mimic (blm) have been reported to show enhanced resistance to not only rice blast fungus but also bacterial pathogen have been characterized (Kosslak et al., Plant J. 1997, 11, 729-745). So far, three genes of the spl 7, ttml, and spl 11 for controlling lesion mimic phenotypes encoding for a heat stress transcription factor, protein kinase, and a U-box/ARM protein, respectively, have been isolated.

[4] Since proteomics is a powerful tool for identifying proteins that are up- or down- regulated under specific physiological conditions, proteomic approaches have been applied to monitor global changes in protein levels to understand an important aspect of biotic and abiotic stresses in plants. Therefore, comparative proteomics has been used to elucidate differences in protein levels between wild-type and rice LMMs, cdrl, blm, and splβ. For example, defense-related proteins and metabolic enzymes were found to be altered during lesion formation in cdr2. Many pathogen-related (PR) proteins (OsPR5 and OsPRlO), a phytoalexin biosynthesis-related protein (naringenin 7-O-methyltransferase), and three oxidative-stress-related proteins (catalase, ascorbate peroxidae (APX), and superoxide dismutase) were also found to be differentially expressed in the blm mutant (Jung et al., J. ProteomeRes. 2006, 5, 2586-2598).

[5] It has been well-documented that production of PR proteins is induced when plant recognizes the invading pathogen(s) through activation of a host resistance gene, which is accompanied by HR resulting in the triggering of rapid and effective defense responses. Moreover, the induction of PR proteins is also a ubiquitous and common plant response to PCD and pathogen attack. The probenazole (3-allyloxy-l, 2-benzisothiazole-l, 1 -dioxide; PBZ)-induced protein (PBZl), which is a PR 10 family member, was found to be expressed in both in rice suspension-cultured cells and in leaf blades inoculated with blast fungus (Kim et al., Proteomics 2003, 3, 2368-2378). The PBZl protein was also induced upon treatment with jasmonic acid (JA), and in the rice LMMs. To date, the correlation between the accumulation of PBZl and enhanced resistance of LMMs to rice blast fungus has been only associated with three mutants, spll, spl5, and spil l. However, Takahashi et al correlated PBZl gene expression with lesion formation in cdrl, cdrl, and cdr3 mutants (Takahashi et al., Plant J. 1999, 17, 535-545).Furthermore, the inplanta localization of the PBZl protein in rice leaves was found to be correlated with cell death caused by rice blast fungus infection.

[6] In spite of the above research linking PBZl with defense/stress response and LMMs, its biological function remains to be clarified. To address this question, we analyzed the 577/I mutant showing severe lesion mimic phenotype through two-dimensional gel electrophoresis (2-DGE) in conjunction with MALDI-TOF-MS. It was reasoned that a differential proteome analysis of LMMs might broaden our understanding on signaling networks involved in PCD and defense signaling in plants. Among the numerous proteins induced in spll, for example, one significantly and highly induced protein spot in the leaves was identified as rice PBZl. Using detailed immunohistochemistry and PBZl gene promoter experiments in PCD tissues such as LMMs, senescence tissues, seed aleurone layer, and root aerenchyma cells, we attempt to shed new light on PBZl function/role.

Disclosure of Invention Technical Problem

[7] The present invention was devised to meet the above-described needs. Specifically, while studying the pathogen-related protein PR-10, which is related to a disease resistance in monocot plants, inventors of the present invention identified a function of PBZl protein that is involved in senescence and cell death of plants. As a result, the present invention was completed. Technical Solution

[8] One object of the present invention is to provide PBZl protein that is involved in senescence and cell death of monocot plants in order to solve the above-described problems.

[9] Another object of the present invention is to provide a gene encoding said PBZl protein.

[10] Another object of the present invention is to provide a promoter for said gene.

[11] Another object of the present invention is to provide a recombinant vector comprising said gene or said promoter.

[12] Another object of the present invention is to provide plants transformed with said recombinant vector and transgenic seed thereof.

[13] Another object of the present invention is to provide a method of inducing plant senescence and cell death by transforming plants with said recombinant vector.

[14] Another object of the present invention is to provide an antibody against said PBZl protein.

[15] Another object of the present invention is to provide a biomarker consisting of an antibody against said PBZl protein for identifying plant senescence and cell death.

[16] Still another object of the present invention is to provide a method of increasing a disease resistance of plant by transforming the plant with said recombinant vector.

Advantageous Effects

[17] By transforming plants with PBZl gene of the present invention, a transformed plant of which cell death and senescence are controlled and having an excellent protective effect against disease can be produced. Brief Description of the Drawings

[18] Figure 1 shows 2-DGE analysis of PEG-fractionated proteins induced in the leaves of the spll mutant. Protein spots on gels are the enlarged images of differentially induced proteins in rectangles. Protein samples (250 μg) in 15% PEG supernatant fractions were separated on 2-D gels (pi 4-7), followed by colloidal CBB staining. 3-D images were generated by ImageMaster 2D Platinum, Version 5.01 (GE Healthcare Amersham Biosciences). 2D, two dimensional; 3D, three dimensional.

[19] Figure 2 shows quantitative analysis of differentially induced proteins on the 2-D gels. The mean relative expression level of three replicate samples is shown in the histograms based on relative protein intensities compared with background levels. Quantification of 17 protein spots from samples was made with ImageMaster 2D Platinum, Version 5.01 (GE Healthcare Amersham Biosciences). Error bars indicate the standard deviation. Wild type, black bars, spll mutant, white bars.

[20] Figure 3 showsaccumulation of PBZl protein in the spl 1 mutant. A, Enlarged image of PBZl protein induced in spl 1 mutant. 3D, three dimensional. B, Western blot on 2-DGE in spll. C, Western blot on SDS-PAGE. Western blot analyses using the purified PBZl antibody in whole leaves of two LMMs (spll and spll) and wild- type plants were used to monitor the accumulation of PBZl proteins. Leaf inoculated with rice blast fungus (KJ401) was used as a positive control. Protein samples were harvested and separated by SDS-PAGE. The total protein (20 μg) loaded for SDS- PAGE.

[21] Figure 4 showsaccumulation of PBZl protein during leaf senescence. A,

Chlorophyll content at various time points as an indicator of senescence of detached leaves and B, Western blot analysis of PBZl protein with proteins extracted from samples collected at the same time points. C, Chlorophyll content and accumulation of PBZl protein during natural senescence of rice whole plants. 100 refers to fully expanded green leaf (100 % ChI); 80 refers to senescencing leaves (70-95 % ChI); 50 refers to senescing leaves (50-70 % ChI); CBB, Coomassie blue. IB, immuno blot. Each protein sample (20 μg) was loaded onto a 12.5% SDS-PAGE gel. Equal loading of protein was confirmed by Ponceau S staining of the membrane.

[22] Figure 5 showsimmunolocalization of PBZl protein in spll and senescent leaves.

Immunolocalization of PBZl proteins in spll (A and B) and senescent leaves (C). D, Inserted image indicates a negative control used with free PBZl antibody. The sections were incubated with alkaline phosphatase-conjugated anti-rabbit IgG antibody (dilution 1:300) for 1 h and visualized after the addition of NBT/BCIP solution for 20 minutes.

[23] Figure 6 shows accumulation and immunolocalization of PBZl protein in coleoptiles obtained from seedling grown under aerobic or submerged conditions. A, Induction of PBZl protein in the rice coleoptiles obtained from seedlings that had been transferred from submergence (5 days) to aerobic condition. Proteins were extracted at 0, 1, 2, 3, 4, and 5 days after exposure to air. Cross-sections of and senescent coleoptiles of 4 days old seedlings grown under aerobic conditions (B, C, D, F, and G). Each cross- section was treated with purified specific anti-PBZl for immunohistochemical analysis and detected by NBT/BCIP (F, G). Blue-colored signals indicate accumulation of PBZl. Most of PBZl was accumulated in aerenchyma cell (arrow), ae, aerenchyma. E, Cell death in coleoptiles was stained with Evans blue. D, Tissue treated with free antibodies: negative control.

[24] Figure 7 shows accumulation and immnolocalization of PBZl protein in root during aerenchyma formation obtained from seedling grown under aerobic and submerged conditions. A, Induction of PBZl protein in root aerenchyma cell obtained from seedlings that had been transferred from aerobic conditions (5 days) to submergence (48 h). Root sections grown under aerobic (Left in A). Root sections grown for 24 h under submerged conditions (Middle in A). Root sections grown for 48 h under submerged conditions (Right in A). B, Western blot analysis of induced PBZl protein. Proteins were extracted at 0, 3, 6, 12, 24, and 48 h after submergence. For Western blot analysis, total proteins (20 μg/mL) were electrophoresed by SDS-PAGE, and transferred onto a PVDF membrane. C, Immnolocalozation of root submerged for 48 h. Each root cross-section was treated with purified specific anti-PBZl for immunohistochemical analysis and detected by NBT/BCIP. Most of PBZl was accumulated in aerenchyma cell in the root cortex (arrow), ae, Aerenchyma.

[25] Figure 8 showsfluorescence image of PBZl promoter after M. grisea treatment and leaf senescence. A, Transgenic leaves harboring PBZl promoter: :sGFP (PBZl pro::sGFP) chimeric gene were inoculated with compatible race, KJlOl for 3 days. GFP signal specifically appeared (green) in the lesion invaded by rice blast fungus. B, GFP signal in transgenic leaves after induction of senescence by dark condition NS, non senescent leaf. S, senescent leaf.

[26] Figure 9 showsexpression of PBZl protein in seed aleurone layer associated with

PCD. A, Immunolocalization of PBZl in seed aleurone layer. For immunohistochemical analysis, seeds at 72 h after germination were used, cross-sectioned with hand, and analyzed with antibody (dilution; 1/100) against PBZl protein. Tissue treated with pre-immune serum was used for negative control (pre-immune). Sections of seed endosperm were reacted with anti-PBZl. The specimens were incubated with the alkaline phosphatase conjugated anti-rabbit IgG antibody (1:300) for 1 h and detected with NBT/BCIP solution for 20 min for visualization, al, aleurone layer, se, seed endosperm. B and C, Activation of PBZl promoter in seed (B) and hand cut seed germinated for 3 days. C, Observation of sGFP fluorescence in transgenic rice plants expressing PBZl promoter: :sGFP (PBZl pro::sGFP) chimeric gene using confocal microscopy. Propiodium iodide was used as an indicator of cell death. D, Detection of DNA fragmentation using TUNEL in seed aleurone cell during germination. DNA fragmentation in seed aleurone cell after germination for 48 h was detected with an in situ cell death fluorescent detection kit (Boehringer Mannheim GmbH, Germany) and detected DNA fragmentation by adding a fluorescent (FITC) -labeled group to the 3'-ends of broken DNA strands. For nuclear staining, the fluorescent dye DAPI which stains DNA was used. E, Colocalization both of DNA fragmentation and PBZl protein in seed aleurone cell during germination. Rhodamin conjugated secondary antibody (dilution 1:200) was used to detect PBZl protein. Mode for the Invention

[27] In order to achieve the object of the invention described above, the present invention provides PBZl protein consisting of amino acid sequence of SEQ ID NO: 2, that is involved in senescence and cell death of monocot plants.

[28] In order to determine a function of PBZl protein which is pathogen-related protein

PR-10 reported by a Japanese group as a probenazole-induced protein (PBZ) that can be expressed with probenazole treatment, said protein represented as SEQ ID NO: 2 was isolated for the first time according to the present invention. The scope of PBZl protein according to the present invention includes a protein having an amino acid sequence described in SEQ ID NO: 2 that is isolated from rice and functional equivalents of said protein. The term "functional equivalent" means that, as a result of addition, substitution or deletion of amino acid residues, it has an amino acid sequence with at least 70%, preferably at least 80%, more preferably at least 90%, still more preferably at least 95% homology with the amino acid sequence of SEQ ID NO: 2, thus indicating a protein which has substantially the same physiological activity as the protein expressed by SEQ ID NO: 2. The term "substantially the same physiological activity" means that, when a plant is transformed with the gene encoding said protein, a protective effect against disease is exhibited by controlled senescence and cell death of the plant.

[29] Said monocot plants can be rice, barley, wheat, corn, millet, or African millet, etc., but not limited thereto. In addition, according to the present invention, senescence and cell death of plants correspond to an exhibition of PBZl protein function in leaf tissues and root aerenchymal cells, root caps, and seed aleurone cells of rice plant that are involved in PCD.

[30] The present invention further provides a gene encoding said PBZl protein. The gene of the present invention includes genomic DNA and cDNA both encoding PBZl protein. Preferably, the gene of the present invention may comprise a nucleotide sequence represented by SEQ ID NO: 1.

[31] Further, variants of the gene encoding said PBZl protein are within the scope of the present invention. Specifically, said gene may comprise a nucleotide sequence with at least 70%, preferably at least 80%, more preferably at least 90%, still more preferably at least 95% homology with the nucleotide sequence of SEQ ID NO: 1. Said "sequence homology %" for a certain polynucleotide is identified by comparing a comparative region with two sequences that are optimally aligned. In this regard, a part of the polynucleotide in comparative region may comprise an addition or a deletion (i.e., a gap) compared to a reference sequence (without any addition or deletion) relative to the optimized alignment of the two sequences.

[32] The present invention further provides an expression site for said PBZl protein in rice plant.

[33] In order to confirm the plant expression of PBZl protein that is known to be involved in senescence and cell death of plants, leaves obtained from rice plant and the mutants were examined in regard of the expression of PBZl protein. As a result, it was found that the expression of PBZl occurred in both senescent leaves and the mutant. In particular, based on the determination of the amount of chlorophylls which is widely used as a marker for senescence, it was found that PBZl expression increased as the amount of chlorophylls decreased. In addition, for naturally senescent leaves, the accumulation of PBZl protein was observed.

[34] The present invention further provides PBZl gene promoter consisting of a nucleotide sequence of SEQ ID NO: 3, which is involved in senescence and cell death of monocot plants.

[35] The present invention further provides a recombinant vector comprising a gene encoding PBZl protein or PBZl gene promoter.

[36] The term "recombinant" indicates a cell which replicates a heterogeneous nucleotide or expresses said nucleotide, a peptide, a heterogeneous peptide, or a protein encoded by a heterogeneous nucleotide. Recombinant cell can express a gene or a gene fragment that are not found in natural state of cell in a form of a sense or antisense. In addition, a recombinant cell can express a gene that is found in natural state, provided that said gene is modified and re-introduced into the cell by an artificial means.

[37] The term "vector" is used herein to refer DNA fragment (s) and nucleotide molecules that are delivered to a cell. Vector can replicate DNA and be independently reproduced in a host cell. The terms "delivery system" and "vector" are often interchangeably used. The term "expression vector" means a recombinant DNA molecule comprising a desired coding sequence and other appropriate nucleotide sequences that are essential for the expression of the operatively-linked coding sequence in a specific host organism. Promoter, enhancer, termination signal and polyadenylation signal that can be used for an eukaryotic cell are all publicly well known.

[38] In the present invention, PBZ promoter GFP-fused pFANTA vector was constructed by using Gateway cloning system.

[39] The present invention further provides a plant transformed with said recombinant vector.

[40] Plant transformation means any method by which DNA is delivered to a plant. Such transformation method does not necessarily have a period for regeneration and/or tissue culture. Transformation of plant species is now quite general not only for dicot plants but also for monocot plants. In principle, any transformation method can be used for introducing a hybrid DNA of the present invention to an appropriate progenitor cells. It can be appropriately selected from a calcium/polyethylene glycol method for protoplasts (Krens, F.A. et al., 1982, Nature 296, 72-74; Negrutiu I. et al., June 1987, Plant MoI. Biol. 8, 363-373), an electroporation method for protoplasts (Shillito R.D. et al., 1985 Bio/Technol. 3, 1099-1102), a microscopic injection method for plant components (Crossway A. et al., 1986, MoI. Gen. Genet. 202, 179-185), a particle bombardment method for various plant components (DNA or RNA-coated) (Klein T.M. et al., 1987, Nature 327, 70), or a (non-complete) viral infection method in Agrobacterium tumefaciens mediated gene transfer by plant invasion or transformation of fully ripened pollen or microspore, etc. A method preferred in the present invention includes Agrobacterium mediated DNA transfer. In particular, so-called binary vector technique as disclosed in EP A 120 516 and USP No. 4,940,838 can be preferably adopted for the present invention.

[41] In the present invention, callus formation was induced from rice seeds. After selecting callus capable of generating an embryo, it is transformed by using Agrobacterium. The transgenic callus was specifically selected using phosphinothricin. As a result, six lines of transgenic plants were developed and then examined to detect the fluorescence image of PBZl promoter while they remained as seeds or proceeded to germination. In addition, in order to secure R2 seeds of said transformed plants, each of said lines were propagated in a greenhouse or in a package so that a response to rice blast by PBZl promoter line can be followed. Results showed that PBZl promoter was strongly expressed in the tested lines. Furthermore, it was also observed that a strong signal appeared during leaf senescence. These results serve as in vivo evidence supporting that PBZl gene can induce cell death, i.e., PBZl promoter remained unexpressed in the seeds but strongly expressed during the germination process of the seeds. Therefore, by carrying out a plant transformation with PBZl gene promoter of the present invention, a direct control of senescence and cell death of plants can be possible. As a result, it is expected that a plant having an excellent protective effect against disease can be developed.

[42] Said transformed plants can be monocot plants, and preferably rice, barley, wheat, corn, millet, or African millet, etc., but not limited thereto. [43] According to the present invention, in order to confirm whether PBZl protein of a transgenic plant that has been transformed with PBZl gene can actually cause cell death or not, purified PBZl protein was infiltrated into tobacco leaves and their cell death was determined. As a result, it was found that PBZl protein at a concentration of 100 μg/ml can effectively cause cell death of the plant.

[44] The present invention further provides seeds that are obtained from said transgenic plants. Preferably, said seeds originate from monocot plants. More preferably, they originate from rice, barley, wheat, corn, millet, or African millet, etc., but not limited thereto.

[45] The present invention further provides DNA fragmentation of PBZl protein as a marker representing programmed cell death in plant.

[46] As a result of confirming DNA fragmentation in a cell treated with PBZl protein, it was found that DNA fragmentation occurred in such cell. Same result was obtained from TUNEL analysis.

[47] The present invention further provides a method of inducing senescence and cell death in monocot plants which comprises a step of transforming plants with said recombinant vector of the present invention to express PBZl protein. Said protein can be expressed in plant leaves, root aerenchymal cells, root caps, and seed aleurone cells.

[48] The plant which can have a protective effect against disease by having controlled senescence and cell death according to said method of the present invention can be food crops including rice, wheat, barley, corn, soy bean, potato, red bean, oat and millet; vegetable crops including Arabidopsis thaliana, Chinese cabbage, radish, hot pepper, strawberry, tomato, watermelon, cucumber, cabbage, melon, zucchini, scallion, onion and carrot; special crops including ginseng, tobacco, cotton, sesame, sugar cane, sugar beet, wild sesame, peanut and rapseed; fruits including apple, pear, date, peach, kiwi, grape, tangerine, orange, persimmon, plum, apricot and banana; flowers including rose, gladiolus, gerbera, carnation, chrysanthemum, lily, and tulip; and feed crops including rye grass, red clover, orchard grass, alfalfa, tall fescue, and perennial rye grass. Preferably, it can be monocot plants such as rice, barley, wheat, corn, millet, or African millet, etc., but not limited thereto.

[49] The above-described PBZl protein may have a ribonuclease activity. To determine exactly how PBZl protein can cause cell death in plants, a ribonuclease activity of PBZl protein was determined in the present invention. As a result, it was found that PBZl protein has a ribonuclease activity. In this regard, although the relationship between the ribonuclease activity of PBZl protein and cell death is not clearly defined, it has been recently known that a ribonuclease itself is involved in cell death.

[50] The present invention further provides an antibody against PBZl protein of the present invention. The antibody against PBZl protein of the present invention can be either monoclonal antibody or polyclonal antibody. The antibody can be produced according to a method publicly known to a skilled person in the art.

[51] The present invention further provides a biomarker consisting of an antibody against said PBZl protein for identifying plant senescence and cell death. Based on an antibody- antigen reaction using said specific antibody of the present invention, the amount of PBZl protein present in a plant can be measured so that senescence and cell death of the plant can be determined.

[52] The present invention still further provides a method of increasing a disease resistance of monocot plant comprising a step of transforming a plant with said recombinant vector of the present invention to express PBZl protein. Since programmed cell death in plants is a way of protecting plant themselves against plant pathogens and PBZl protein can cause cell death, a disease resistance of monocot plant can be improved by promoting the expression of PBZl protein. Said monocot plants can be rice, barley, wheat, corn, millet, or African millet, etc., but not limited thereto.

[53] The present invention will now be described in greater detail with reference to the following examples. However, they are only to specifically exemplify the present invention and in no case it is construed that the scope of the present invention is limited by these examples.

[54]

[55] Materials and Methods

[56] Plant Material and Treatments

[57] Fourth- and fifth-leaf- stage rice (Oryza sativa L.) seedlings grown under natural light in a greenhouse (20-30⁰C) were used for inoculation of whole plants with the blast fungus (Magnaporthe grisea KJ401 and KJlOl). The LMMs (spl 1 and spYΣ) used in this study were also grown in the greenhouse. For light-induced senescence, leaves detached from fourth- and fifth-leaf stage plants were placed onto Petri dishes containing 20 mL of distilled water, and harvested in accordance with the extent of leaf senescence, which was judged by observing changes in total chlorophyll content. Chlorophyll was analyzed in 80% acetone extracts as described by Bruinsma (Bruinsma, J. Photochem. Photobiol. 1963, 2, 241-249). For submersion studies to induce the coleoptiles senescence, rice seedlings were completely submerged (8 cm below the water surface) in distilled water in a glass bottle as previously reported (Kawai, M.; Uchimiya, H. Ann. Bot. 2000, 86, 405-414). To initiate cell death, seedlings that had been submerged for 5 days were exposed to air for 1, 2, 3, 4, 5, and 6 days. Root aerenchyma formation was performed using the method described by Kawai et al (Kawai et al., Planta 1998, 204, 277-287). Dehulled seeds were germinated at 28⁰C in dark conditions. Endosperm from germinated seeds was excised with a razor blade and then used as samples for this study. [58]

[59] Protein Extraction and 2-DGE

[60] Protein was extracted with Mg/NP-40 buffer (0.5 M Tris-HCl (pH 8.3), 2% v/v NP-

40, 20 mM MgCl₂, 5% β-mercaptoethanol, 1 mM phenyl methyl sulfonyl fluoride, and 1% w/v polyvinyl polypyrrolidone), and fractionated with polyethylene glycol (PEG) 4000. The 15% PEG supernatant fractions were used for 2-DGE analysis, essentially following the method described in Kim et al (Kim et al., Electrophoresis 2001, 22, 2103-2109). Isoelectric focusing (IEF) for the first dimension was carried out using 18 cm (length) glass tube gels. The IEF gel mixture consisted of a 4.5% w/v acrylamide solution, 9.5 M urea, 2% v/v NP-40, and 2.5% v/v pharmalytes (pH 3-10 : pH 5-8 : pH 4-6.5 = 1 : 3.5 : 2.5; Amersham Pharmacia Biotech, San Francisco, CA). Each sample (250 μg) was mixed in the IEF sample buffer and then loaded onto 18 cm IEF gels. SDS-PAGE in the second dimension was carried out as described by Laemmli using 12.5% polyacrylamide gels (Laemmli, U. K. Nature 1970, 227, 680-685). The 2-D gels were stained by colloidal coommassie brilliant blue G-250 (hereafter called colloidal CBB). Three replicated gels were used in this experiment.

[61]

[62] Image and Data Analysis

[63] Gels were scanned (300 dpi, 16 bit gray scale pixel depth, TIFF file) for image/data analysis performed using the ImageMaster 2D Platinum imaging software ver. 5.0 (GE Healthcare Bio-Sciences AB, Uppsala, Sweden). The 2-DGE patterns of protein spots between the spll and the wild-type were compared and the abundance of spots was normalized as relative intensity according to the normalization method provided by the software. The changed (p < 0.05) protein spots were marked and selected for further identification by MS if they were confirmed in three independent sample sets.

[64]

[65] In-GeI Digestion and MALDI-TOF-MS

[66] The excised colloidal CBB-stained protein spot was cut into small pieces, washed with 50% acetonitrile in 0.1 M NH₄HCO₃, and vacuum dried. Protein digestion and all procedures for MALDI-TOF-MS (Voyager STR, PerSeptive Biosystems, Framingham, MA) analysis and searching were followed as described (Kim et al., MoI. Cells 2003, 16, 316-322).The gel pieces were reduced for 45 min at 55⁰C in 10 mM DTT in 0.1 M NH₄HCO₃. After that, the DTT solution was immediately replaced with 55 mM iodo- acetamide in 0.1 M NH₄HCO₃ and incubated for 30 min in room temperature in the dark. Gel pieces were washed with 50% acetonitrile in 0.1 M NH₄HCO₃ and dried in a SpeedVac evaporator. The dried gel pieces were swollen in a minimum volume of a 10 μl digestion buffer containing 25 mM NH₄HCO₃ and 12.5 ng/L of trypsin (Promega, sequencing grade), and incubated in 37⁰C for overnight. Digestion mixture was re- dissolved using a solution of distilled wateπacetonitrileitrifluoroacetic acid (93:5:2). The samples were sonicated for 5 min and centrifuged for 2 min. The matrix solution [dissolved α-cyano-4-hydroxycinnamic acid (Sigma) in acetone (40 mg/mL) and nitrocellulose in acetone (20 mg/mL)], the nitrocellulose solution and isopropanol were mixed 100:50:50. A two-point internal standard for calibration was used with a des- Argl-Bradykinin peak (m/z 904.4681) and an angiotensin 1 peak (m/z 1296.6853). The samples were analyzed using a Voyager-DE STR MALDI-TOF mass spectrometer with following parameters. Parent ion masses were measured in the reflection/delayed extraction mode with an accelerating voltage of 20 kV, a grid voltage of 76%, a guide wire voltage of 0.010%, and a delay time of 150 ns. Peptides were selected in the mass range of 600-2,500 Da. For data processing, the MoverZ

(http://bioinformatics.genomicsolutions.com) software was used. The acquired peak lists were analyzed by database (National Center for Biotechnology Information nonredundant, NCBInr) searches for identification by peptide mass fingerprint (PMF) using ProFound (http://www.unb.br/cbsp/paginiciais/profound.htm) and MASCOT ( www.matrixscience.com). The searching parameters were followed by which Oryza sativa was chosen for the taxonomic category. A peptide mass accuracy of below 50 ppm was applied. The results with MOWSE score higher than 65 (p < 0.05) were consider valuable. Only the best matches with high MOWSE score were selected.

[67]

[68] Western Blot Analysis

[69] The PEG-fractionated samples were analyzed by SDS-PAGE, and transferred onto a polyvinyldiene difluoride (PVDF) membrane with a semi-dry electrophoretic apparatus (Hoefer, San Francisco, CA). The blotted membrane was blocked for 2 h in TTBS (50 mM Tris-HCl pH 8.2, 0.1% v/v Tween 20, and 150 mM NaCl) containing 5% w/v non-fat dry milk. After blocking, the membrane was incubated with the purified PBZl polyclonal antibody (1:1000) in TTBS, The antigen- antibody interaction was carried out for 2 h. The membrane was washed (3 X 20 min) in TTBS, and a secondary goat anti-rabbit IgG conjugated with horseradish peroxidase diluted 1:5000 in TTBS was used for immunodetection. After the blots were washed with TTBS, the immunoblot signals were detected using enhanced chemiluminescent, ECL (PerkinElmer Life Sciences, Boston, MA).

[70]

[71 ] I m mu nolocalization

[72] Preparation of tissue sections and immunolocalization was followed as published previously (Kim et al., Proteomics 2003, 3, 2368-2378). Tissue samples were fixed in phosphate buffer saline (PB S) -buffered paraformaldehyde [2.5% paraformaldehyde (w/v)] at 4⁰C overnight and dehydrated in a graded ethanol series and embedded with Paraplast Plus (Sigma). Specimen (8 μm) was transferred to poly-L-lysine-coated microscope slides that were deparaffinized by washing with xylene for 15 min and re- hydrated in an ethanol series (100, 90, 80, 70, 60, 50, and 35%). For immunohisto- chemistry, thin sections were incubated with the blocking buffer comprising 2% BSA in PBS containing 0.02% sodium azide and 0.05% Tween-20 for 1 h atroom temperature, and incubated with the purified PBZl primary antibody (1:50) in a dilution buffer (PBS containing 0.1% [v/v] Tween 20 [PBS-T] and blocking buffer [1:1, v/v]) for 2 h. The specimens were rinsed three times with PBS-T (10 min each) and incubated with the alkaline phosphatase (Bio-Rad, Hercules, CA) or Rhodamine conjugated anti-rabbit IgG antibody (Bio-Rad, 1:300) for 1 h, followed by three rinses in PBS-T (10 min each). Sample using alkaline phosphatase as a secondary antibody was incubated with NBT/BCIP solution for 20 min prior to visualization.

[73]

[74] Construction of Ti Plasmid Vector Harboring PBZl Promoter and Generation of Transgenic Rice Plants

[75] We searched the rice genome (Oryza sativa L.) database using the PBZl cDNA sequence (GenBank accession number, D38170). To isolate the PBZl promoter from rice genomic DNA, a forward primer (5'-GGTGCATGGTTGCGACCATT-S') (SEQ ID NO: 4) and a reverse primer (5'-AGCTAGTTGCAACTGATCAC-3')(SEQ ID NO: 5) was designed using the PRIMER DESIGNER 4 software program (Scientific and Educational Software) and amplified by PCR. Resulting PCR product showing a 1403 bp genomic DNA fragment was cloned into the pGEM-T Easy vector (Promega, WI) and sequenced. The PBZl promoter was cloned into the pFANTA Gateway vector including GFP as a reporter protein using forward primer (attBl) 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTCCGGTGCATGGTTGCGACCA TT-3' (SEQ ID NO: 6) and reverse primer (attB2)

5'-GGGGACCACTTTGTACAAGAAAGCTGGGTCAGCTAGTTGCAACTGATCA C-3' (SEQ ID NO: 7). The resulting vector for PBZl promoter fused with GFP was introduced into the rice callus to generate transgenic rice plant by the use of Agrobacterium-medi&ted transformation as followed by Jang et al (Jang et al.. Plant Physiol. 2002, 129, 1473-1481). Regenerated plants were selected with 4 mg/mL phos- phinotricin (Duchefa) and 0.5% Basta solution. Senescent leaves senescenced and leaves infected by the rice blast fungus were observed for GFP fluorescence under a LAS3000 (Fujifilm). GFP signal in germinated endosperms was observed under Laser- Scanning Confocal Microscopy (Olympus Co. Ltd., Tokyo, Japan).

[76]

[77] Cell Death Assay

[78] Cell death in senescent coleoptiles and seed aleurone cells were evaluated by histo- chemical analysis using Evans blue staining, which is a non-permeating dye with low toxicity in plant cells and propiodium iodide (3 μg/mL), which is a membrane-impermeable dye that binds to nucleotides and that is generally stained with dead cells, respectively.

[79]

[80] TUNEL for Nuclear DNA Fragmentation

[81] Seed endosperms harvested at 3 days after imbibition were longitudinally sectioned with a razor blade and fixed in 2.5% paraformaldehyde in PBS. TUNEL for nuclear DNA fragmentation was performed using DIG DNA labeling and detection kit according to the manufacturer's instructions (Roche Diagnostics, Mannheim, Germany). Stained sections were observed under a bright-field light microscope and immediately photographed. For nuclear staining, the fluorescent dye DAPI (100 μg/ mL) was used. The samples were examined with light and Laser-Scanning Confocal Microscopy (Olympus Co. Ltd., Tokyo, Japan).

[82]

[83] Example 1. Proteome Analysis of the Rice LMM, spll.

[84] To determine which proteins were specifically induced in LMMs, proteins extracted from the leaves of the spll mutant were analyzed by 2-DGE. We initially examined both the phenotypes of spll and spll mutants, and observed that the spll mutant exhibited more severe lesion formation with large hypersensitive spots compared to the spll mutant. So, we choose the spll mutant for proteome analysis in this study. The total protein extracts from spll mutant leaves were fractionated with PEG and then the supernatant fraction was precipitated with acetone. The resolubilized protein precipitates were analyzed by 2-DGE with the isoelectric focusing (pH 4-7) for the first dimension and SDS-PAGE (12.5%) for the second dimension. Numerous colloidal CBB protein spots were detected on the 2-D gel. Representative proteins that were differentially expressed in the leaves of the spll mutant are shown in Figure 1 (2D, two dimensional; 3D, three dimensional). Eleven spots were found to be increased and seven showed decrease in protein amounts in spll. Proteome analyses with spll mutant resulted in differential changes in the abundance of these proteins. The intensity of these differentially expressed protein spots on the 2-D gels obtained in three independent experiments were quantitatively measured to obtain statistical information on variations in the protein levels using the ImageMaster program (Fig. 2).

[85]

[86] Example 2. Characterization of Differentially Expressed Protein Spots on 2-D

Gels.

[87] We excised the protein spots indicated in Figures 1 and 2 from the 2-D gels, which were digested with trypsin. After extraction of peptides, the proteins were identified by PMF using MALDI-TOF-MS. The resultant mass spectra were searched against the NCBInr protein database for identification using two different PMF search programs, ProFound and MASCOT.

[88] Proteins differentially expressed in spll were identified as thaumatin-like protein

(spot 1), two fructose-bisphosphate aldolases (FBA, spots 4 and 10), three glycer- aldehydes-3-phosphate dehydrogense (G3PDH, spots 9, 14, and 17), peroxidase (spot 5), APX (spot 11), 5-methyltetrahydropteroyltriglutamate homocysteine S- methyltransferase (spot 15), serine hydroxymethyltransferase (spot 16), and PBZl (spot 18). All these proteins were induced in the leaves of the spll mutant. The other proteins including 2-Cys peroxiredoxin (spot T), coproporphyrinogen III oxidase (spot 3), glycosyl hydrolase family 3 (spot 6), rubisco large subunit (spot 7), glutathione reductase (spot 8), sulfilte reductase (spot 12), and alpha subunit NAD-specific isocitrate dehydrogenase (spot 13) were reduced in the leaves of the spll mutant.

[89] Interestingly, coproporphyrinogen III oxidase (spot 2) was reduced in spll, suggesting that the down-regulation of this protein in spll is likely to be a one of the key responses in causing cell death, which occurs during lesion formation. It has been previously reported that lesion mimic phenotypes were produced by the inhibition of protoporphyrinogen oxidase expression.

[90] Many proteins including PR proteins (PR5 and PBZl), oxidative-stress-related proteins, and metabolic enzymes which are either up- or down-regulated in LMMs were identified, implying that disruption of cellular homeostasis by increasing or decreasing of related proteins leads to a wide range of metabolic perturbations and subsequently causes cell death in plants. From the spll proteome analysis, however, we realized that proteins (FBA, G3PDH, and APX) induced in spll were reduced in the two recently characterized LMMs, blm, and splβ. These results suggest that expression patterns of proteins could be differentially regulated since genes causing mutations might display a diverse signaling cross-talk according to genetic background of mutants.

[91]

[92] Example 3. The PBZl Protein Accumulates in Tissues Undergoing PCD

Induced by Abiotic Stresses.

[93] Interestingly, PBZl was highly induced in the spll mutant (Fig. 3A). To verify whether PBZl was indeed induced in spll, the PEG supernatant protein fraction of the spll mutant leaves was examined by SDS-PAGE. Western blot analysis using 2-DGE and SDS-PAGE revealed that the PBZl protein was also accumulated in spll as well as spll (Fig. 3B and C) over no such accumulation in the wild-type. The leaves infected with the incompatible blast fungus (M. grisea strain, KJ401) was used as a positive control.As shown in Figure 3B, the PBZl protein was more markedly ac- cumulated in the leaves of the spl 1 mutant that exhibited more severe lesion formation than in the spl2 mutant.

[94] Expression of PBZl in tissues undergoing cell death was observed in HR induced by the rice blast fungus pathogen and in LMMs (blm, cdr2, and spl 1). This prompted us to further investigate whether this phenomenon extended to other systems in which PCD or cell death occurred. Senescence is a unique developmental process that is characterized by massive PCD and nutrient recycling. The correlation between accumulation of PBZl and senescence was first investigated by monitoring its level during senescence of detached rice leaves (Fig. 4 A and B). The extent of leaf senescence was measured as the change in total chlorophyll content (Fig. 4A). As shown in Figure 4, the accumulation of PBZl protein was gradually increased during leaf senescence of detached leaves (Fig. 4B) and natural leaf senescence (Fig. 4C) of whole plants. In addition, the PBZl protein was also highly accumulated at early stages of leaf senescence in which leaves still had more than 80% chlorophyll. After that, leaf senescence was significantly enhanced.

[95] We performed immunolocalization to determine the precise localization of PBZl in the 577/I mutant and senescent leaf. As shown in Figure 5, accumulation of the PBZl protein in spl 1 was localized around lesion in the leaves (Fig. 5A and B) and senescent leaf (Fig. 5 C and D). These results are in agreement with previous PBZl localization results for which the PBZl protein did accumulate in cells surrounding dead cells resulting from strong HR.

[96] Recently, it was suggested that coleoptiles senescence occurs when elongated co- leoptiles grown under submergence for 5 days were transferred to the aerated condition. Such coleoptiles exhibited cell death events that were associated with senescence. To check whether PBZl protein was associated with coleoptiles senescence, Western blot analysis was performed (Fig 6A). We devised a condition to induce synchronous PCD in coleoptiles from rice seeds by submerging them in water for 4 days followed by transfer to aerobic conditions, in which coleoptiles senescence starts rapidly. Similar to the observations in senescent leaves, the level of PBZl protein was significantly increased as soon as coleoptiles were transferred from the submerged condition to the aerobic environment (Fig. 6A), accompanying to the PCD when stained with Evans blue (Fig. 6E). Because the PBZl protein highly accumulated during coleoptiles senescence, we also examined their cellular localization in senescent coleoptiles by immunohistochemistry. Immunohistochemistry of PBZl revealed that it is expressed in cells adjacent to expanding aerenchyma cells (Fig. 6F and G), where cell death occurs, compared to the negative controls (Fig. 6B, C, and D).

[97] We also investigated PBZl accumulation in roots during aerenchyma formation obtained from seedlings grown under aerobic or submerged conditions. Root aerenchyma cells in the cortex also undergone PCD during development. Formation of root aerenchyma cells occurred in seedlings that had been transferred from aerobic conditions (5 days) to anaerobic ones (48 h) as described by Kawai et al (Kawai et al., Planta 1998, 204, 277-287). Aerenchyma in cortex started to form in the roots of plants following 24 h in submerged conditions and was fully developed by 48 h (Fig. 7A). For Western blot analysis, proteins were extracted at 0, 3, 6, 12, 24, and 48 h after submergence. Western blot analysis revealed that the PBZl expression level gradually increased in accordance with incubation time of anaerobic growth as shown in Figure 7B. In addition, to further investigate whether PBZl is specifically expressed in root aerenchyma cell, immunohistochemistry was performed with roots grown under submergence condition (Fig. 7C). The PBZl signal was dramatically localized in the cortical region where aerenchyma cells develop in the root cortex (Fig 7 C). No signal was detected in negative control performed using the secondary antibody alone.

[98]

[99] Example 4. Promoter Analysis of the PBZl Gene.

[100] To further characterize the PBZl expression and localization pattern, we generated transgenic plants harboring the GFP gene driven by the PBZl promoter using Agrobacterium mediated transformation (Jang et al.. Plant Physiol. 2002, 129, 1473-1481). We cloned a DNA fragment (about 1405 bp) between the rice genomic DNA and used it as the promoter region of PBZl to drive GFP expression. We carefully examined the GFP signals in the leaves of the transgenic plants inoculated with rice blast fungus. As shown in Figure 8A, overall, GFP florescence signals showed strong PBZl promoter activity in or around neighboring cells invaded by rice blast fungus as revealed by immunolocalization. Furthermore, we found that the PBZl promoter was activated during leaf senescence (Fig. 8B), whereas no such signal was detected in senescing non-transgenic plant. This result is consistent with the Western blot and immunolocalization data described above.

[101]

[102] Example 5. The PBZl Protein Accumulates with Developmental PCD Tissues.

[103] So far, we investigated the PBZl expression in cell death tissues caused by biotic and abiotic stresses. To test whether PBZl is induced in development tissues involved in natural PCD as well as biotic and abiotic stresses, we used immunolocalization with the PBZ antibody in seed aleurone cells, which is an example of a typical developmental PCD tissue in plants. The accumulation of PBZl protein in germinated seed endosperm was examined by Western blot analysis in dry, imbibed, and germinating seeds. Results revealed highly accumulated PBZl protein in the seed endosperm at 3 days during seed germination (data not shown), but not imbibed seeds. In addition, im- munohistochemical analysis revealed that PBZl was accumulated to aleurone cells during seed germination (Fig. 9A). Furthermore, intense GFP signal of PBZl promoter transgenic line was also activated in germinated seeds but not in imbibed seeds (Fig. 9B), which is consistent with the Western blot and immunolocalization data. To dissect the signal whether PBZl signal coincides with PCD cells, we used propiodium iodide which an indicator of cell death using 3-day-old germinated seeds. Germinated seeds were cut into half with a razor blade and observed under confocal microscopy. As shown in Figure 9 C, the PBZl signal dramatically coincided with propiodium iodide signal in the seed aleurone layer. The PBZl signal and propiodium iodide signal significantly co-accumulated around root cells where lateral root is emerging, indicating that it undergoes PCD during root growth. Moreover, PBZl protein using immunolocalization was dramatically accumulated in root caps as well as root aerenchyma cells.

[104]

[105] Example 6. In Situ Detection of DNA Fragmentation by TUNEL Analysis.

[106] TUNEL that is typical hallmarks of PCD was employed to examine whether nuclear DNA fragmentation occurs in the seed aleurone layer. DNA fragmentation was detected in paraformaldehyde fixed seed aleurone layer after germination at 3 days. As shown in Figure 9D, the spots visualized in the TUNEL analysis were observed in seed aleulone layer only after staining with 4 ,6 -diaminophenylindol (DAPI). To verify that the TUNEL signals were from nuclei, we stained the nuclei with DAPI. We did not observe digoxigenin incorporation in the aleurone layer of imbibed seeds (data not shown). To investigate whether accumulation of the PBZl protein coincided with seed aleurone layer showing TUNEL signal, we co-analyzed TUNEL and immunoloc- alizaion in the seed aleurone layer (Fig. 9E). The TUNEL signals tightly coincided with localization of the PBZl protein, indicating that PBZl is indeed co-localized with tissues undergoing PCD in development tissues as well as biotic and abiotic stresses.

[107]

[108] Example 7. Putative Function of the PBZl Protein.

[109] In this study, induction and localization of PBZl were observed in rice PCD cells. However, the exact roles and biochemical function of the PBZl protein in plant cytoplasm is still not clear. Mostof the previous publications on the PR-10 family proteins point to aputative RNase function based on amino acidsequence similarity to the ginseng callus RNases.This characteristic featurehas also been reported with the birch pollen Betvland white lupin PR-10-like proteins, both in their native and recombinant forms. Recently, it was reported that RNase LX is specifically expressed during endosperm mobilization and leaf /flower senescence. Using immunofluorescence, RNase LX protein was detected in immature tracheary elements, suggesting a function in xylem differentiation. Walter et al have also proposed that cytosolic ribonucleases could be involved in selective and/or highly regulated de- gradation of existing mRNAs during stress or pathogen attack (Walter et al., Eur. J. Biochem. 1996, 239, 281-293). These results support a physiological function of RNase in selective cell death processes that are also thought to involve PCD. Recently, it was reported that the rice JIOsPRlO protein exhibits RNase activity. However, there is no evidence for RNase activity for PBZl. In general, the PCD process causes hy- drolytic enzymes, such as RNases, DNases, and proteases enriched in lytic compartments, to invade the soluble cell content for degradation (Fukuda, H. Plant Cell 1997, 9, 1147-1156). These proteins are usually considered as biochemical and molecular marker for cell death in plants. However, little is known about cell death marker in rice.

Claims

[I] PBZl protein consisting of amino acid of SEQ ID NO: 2, which is involved in senescence and cell death of monocot plants.

[2] A gene encoding said PBZl protein of Claim 1.

[3] The gene according to Claim 2, characterized in that it consists of nucleotide sequence of SEQ ID NO: 1. [4] PBZl gene promoter consisting of nucleotide sequence of SEQ ID NO: 3, which is involved in senescence and cell death of monocot plants. [5] A recombinant vector comprising the gene according to Claim 2 or PBZl gene promoter according to Claim 4.

[6] A plant transformed with the recombinant vector according to Claim 5.

[7] The plant according to Claim 6, characterized in that said plant is a monocot plant.

[8] Seeds of the transgenic plant according to Claim 6.

[9] A method of inducing senescence and cell death in monocot plants comprising a step of transforming plants with said recombinant vector according to Claim 5 to express PBZl protein. [10] The method according to Claim 9, characterized in that said protein is expressed in plant leaves, root aerenchymal cells, root caps, and seed aleurone cells.

[I I] The method according to Claim 9, characterized in that said monocot plants are rice, barley, wheat, corn, millet, or African millet.

[12] The method according to Claim 9, characterized in that said PBZl protein has a ribonuclease activity. [13] A biomarker consisting of an antibody against said PBZl protein according to

Claim 1 for identifying plant senescence and cell death. [14] A method of increasing a disease resistance of plant comprising a step of transforming the plant with said recombinant vector according to Claim 5 to express PBZl protein.