WO2008128103A1 - A novel gene associated with fragile x syndrome and fragile x tremor ataxia syndrome - Google Patents

A novel gene associated with fragile x syndrome and fragile x tremor ataxia syndrome Download PDF

Info

Publication number
WO2008128103A1
WO2008128103A1 PCT/US2008/060112 US2008060112W WO2008128103A1 WO 2008128103 A1 WO2008128103 A1 WO 2008128103A1 US 2008060112 W US2008060112 W US 2008060112W WO 2008128103 A1 WO2008128103 A1 WO 2008128103A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
fragile
fmr4
fragments
syndrome
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2008/060112
Other languages
French (fr)
Inventor
Claes Wahlestedt
Ahmad Khalil
Mohammad Ali Faghihi
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Scripps Research Institute
Original Assignee
Scripps Research Institute
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Scripps Research Institute filed Critical Scripps Research Institute
Publication of WO2008128103A1 publication Critical patent/WO2008128103A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6809Methods for determination or identification of nucleic acids involving differential detection
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/30Psychoses; Psychiatry
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/30Psychoses; Psychiatry
    • G01N2800/302Schizophrenia

Definitions

  • This invention relates to a novel gene of fragile X syndrome and fragile X tremor ataxia syndrome, compositions, diagnostics and methods of use.
  • the novel gene is termed, herein, fragile X mental retardation 4 gene (FMR4).
  • Fragile X syndrome which is the most common cause of inherited mental retardation is thought to be caused by the expansion of CGG repeats in the 5' UTR of the fragile X mental retardation 1 gene (FMRl).
  • FMRl fragile X mental retardation 1 gene
  • Normal individuals have a range of 5-50 repeats and express FMRl, individuals with 55-200 repeats are permutation carriers and express comparable or higher levels of FMRl than normal individuals.
  • the expansion of CGG repeats above 200 is thought to lead to the absence of FMRl mRNA and consequently the fragile X mental retardation protein (FMRP).
  • the severity of the FXS phenotypes is highly variable and difficult to predict with current methods, especially in neonates. There is a need in the art to identify hereditary diseases and provide accurate and efficient diagnosis.
  • FMR4 a new gene
  • RACE rapid amplification of cDNA ends
  • a nucleic acid comprises the sequence of SEQ ID NO: 9, mutants, variants, alleles, complementary sequence and fragments thereof. Examples of allelic variation and variants of FMR4 are shown in Table 2.
  • a nucleic acid comprises the sequences as set forth in Table 2, variants, mutants, complementary sequences and fragments thereof.
  • the sequence of SEQ ID NO: 9, mutants, variants, alleles, complementary sequence and fragments thereof is expressed by an expression vector.
  • the expression vector comprises a promoter wherein the promoter is an inducible promoter, constitutive promoter, tissue specific promoter or bi-directional promoter.
  • a peptide is encoded by a nucleic acid comprising the sequence of SEQ ID NO: 9 mutants, variants, alleles, complementary sequence and fragments thereof.
  • an antibody specific for a peptide encoded by a nucleic acid comprises the sequence of SEQ ID NO: 9 mutants, variants, alleles, complementary sequence and fragments thereof.
  • a biomarker diagnostic of Fragile X syndrome and fragile X tremor ataxia syndrome comprises a peptide encoded by a nucleic acid comprising the sequence of SEQ ID NO: 9 mutants, variants, alleles, complementary sequence and fragments thereof.
  • an isolated primer comprises any one or more of SEQ ID NOS: 1-8 and 10-12.
  • an isolated set of primers comprise SEQ ID NOS: 1 and 3; SEQ ID NOS: 2 and 4; SEQ ID NOS: 7 and 8; SEQ ID NOS: 10-12 or combinations thereof.
  • a method of diagnosing fragile X syndrome and fragile X tremor ataxia syndrome comprises obtaining a biological sample from a patient; identifying SEQ ID NO: 9 or a portion thereof; detecting the presence, absence or variation in concentration of a peptide encoded by SEQ ID NO: 9 mutants, variants, alleles, complementary sequence and fragments thereof; comparing the concentrations of the peptide between a normal individual, a permutation carrier and the patient; and, diagnosing fragile X syndrome and fragile X tremor ataxia syndrome.
  • the patient can be any age, for example, an embryo, neonate, infant, child, teenager or adult.
  • a peptide or nucleic acid of SEQ ID NOS: 1-12 is identified by an antibody, aptamers and/or assays such as, for example, RIA, ELISA, gels, Western Blots, Northern Blots, PCR, and the like.
  • a method of treating and/or preventing a patient afflicted with fragile X syndrome and fragile X tremor ataxia syndrome comprises administering to a patient a composition comprising a vector expressing SEQ ID NO: 9, mutants, variants and fragments thereof; and, treating and/or preventing a patient afflicted with fragile X syndrome and fragile X tremor ataxia syndrome.
  • a method of treating and/or preventing a patient afflicted with fragile X syndrome and fragile X tremor ataxia syndrome comprises administering to a patient a composition comprising a peptide encoded by SEQ ID NO: 9, mutants, variants and fragments thereof; and, treating and/or preventing a patient afflicted with fragile X syndrome and fragile X tremor ataxia syndrome.
  • a method of treating and/or preventing a patient afflicted with fragile X syndrome and fragile X tremor ataxia syndrome comprises administering to a patient a composition comprising an antibody that specifically binds to a peptide encoded by SEQ ID NO: 9, mutants, variants and fragments thereof; and, treating and/or preventing a patient afflicted with fragile X syndrome and fragile X tremor ataxia syndrome.
  • a method of treating and/or preventing a patient afflicted with fragile X syndrome and fragile X tremor ataxia syndrome comprises administering to a patient a composition comprising a peptide encoded by SEQ ID NO: 9, mutants, variants and fragments thereof; and, treating and/or preventing a patient afflicted with fragile X syndrome and fragile X tremor ataxia syndrome.
  • a method of treating and/or preventing a patient afflicted with fragile X syndrome and fragile X tremor ataxia syndrome comprises administering to a patient a composition comprising an siRNA that specifically SEQ ID NO: 9, mutants, variants and fragments thereof; and, treating and/or preventing a patient afflicted with fragile X syndrome and fragile X tremor ataxia syndrome.
  • a kit comprises primers of SEQ ID NOS: 1-8 and 10- 12; thermostable polymerase, and A, G, C, T nucleotides.
  • a kit comprises SEQ ID NO: 9, peptides thereof, or antibodies specific for SEQ ID NO: 9 or peptide. Other aspects of the invention are described infra.
  • Figure 1 is a scan of a gel showing the results of a Northern blot analysis.
  • Figure 2 is a graph showing the expression analysis of FMRl and FMR4 in normals, premutation and full mutation patients.
  • Figures 3A-3B show that FMR4 is silenced in fragile X syndrome.
  • Figure 3A is a graph showing RNA from four normal, four premutation and four full mutation FXS patients isolated from untransformed leucocytes was reverse transcribed using random hexamers. Quantitative RT-PCR analysis revealed that FMR4, similar to FMRl, is up-regulated in premutation carriers and shut down in full mutation fragile X patients (P ⁇ 0.0001).
  • Figure 3B is a scan of a blot showing RNA from untransformed leucocytes were reversed transcribed and the cDNA was used for PCR analysis. FMR4 is expressed in normal and premutation carriers but no bands were observed in the full mutation fragile X patients (35 cycles).
  • FMRl bands were observed in normal, premutation, and one of the full mutation patients (35 cycles). To account for any possible DNA contamination, no reverse transcriptase control for all samples was used in the PCR (lanes next to bands are all negative indicating no DNA contamination was present). Error bars: s.d.
  • Figures 4A-4D are graphs showing that there is no direct cross-regulation between FMRl and FMR4.
  • Figure 4A three distinct siRNAs were used against FMRl to transfect HEK- 293T cells. Two out of the three siRNAs resulted in a significant knockdown of FMRl (80%), but did not affect FMR4 RNA levels.
  • Figure 4B three distinct siRNAs were used against FMR4 Xo transfect HEK-293T cells. All three siRNAs resulted in a significant knockdown of FMR4 but did not affect FMRl RNA levels.
  • Figure 4C is a graph showing that significant knockdown of FMR 4 via siRNA C did not result in a change in FMRl RNA levels at any of the time points tested (24, 48, 72, or 144 hours post transfection).
  • Figure 4D The entire sequence of FMR4 was cloned into a pcDNA3.1 vector with a CMV promoter. The pcDNA3.1 vector containing the FMR4 sequence and the original pcDNA3.1 (without the FMR4 insert) were transfected in HEK-293T cells. At 72 hours post transfection, RNA was isolated and reversed transcribed and used for RT-PCR analysis. There is a highly significant increase in the FMR4 RNA levels but no effect on FMRl RNA. Error bars: s.d.
  • FIG. 5 is a graph showing FMR4 has a similar half-life to FMRl.
  • HEK-293T cells were treated with ⁇ -amanitin (blocks RNA polymerase II) and the levels 0 ⁇ FMR4 and FMRl were measured by RT-PCR at 0, 6, 12 and 24 hours post treatment. Both FMR4 and FMRl have similar half-lives. These experiments also further confirm that FMR4 is a product of RNA polymerase II.
  • Figures 6A and 6B show the identification and sequence analysis of FMR4.
  • Figure 6A is a schematic representation showing known genes in Xq27.3-28 including the newly identified FMR4.
  • FMR4 is transcribed upstream of FMRl and in the opposite direction.
  • Figure 6B shows the sequence of FMR4 (SEQ ID NO: 9) obtained by rapid amplification of cDNA ends (RACE).
  • Figures 7A-7C show the expression analysis of FMR4.
  • Figure 7A is a graph showing RT-PCR analysis of FMR4 and FMRl in seven different human fetal tissues (week 12), RNA from each tissue was pooled from at least three fetuses (GBiosciences). The RNA expression of FMRl and FMR4 were normalized to whole embryo (set as 100%). Both transcripts are expressed in all the tissues tested with notably high expression of FMR4 in the kidney and heart.
  • Figure 7B is a graph showing RNA expression in the human adult brain. RNA was extracted from six postmortem human adult brains from three different regions, thereafter; cDNA synthesis followed by RT-PCR was performed on all samples to measure the relative quantities of FMRl and FMR4.
  • Figure 7C is a graph showing RT-PCR analysis of FMR4 and FMRl in several regions of two monkeys brains. The RNA expression 0 ⁇ FMR4 and FMRl were normalized to the insula (set as 100%).
  • Figures 8A-8D are graphs showing that FMR4 affects proliferation in human cells.
  • Figure 8A cell proliferation assay showing that the knockdown of FMR4 via three distinct siRNAs in HEK-293T cells, but not knockdown of FMRl, resulted in decrease in cell proliferation in comparison to cells which are treated with a negative control siRNA. Cell proliferation was measured based on luciferase activity in these cells at 72 hours post siRNA transfection.
  • Figure 8B cell proliferation assay showing that the knockdown of FMR4 via three distinct siRNAs in HeLa cells resulted in decrease in cell proliferation in comparison to cells which are treated with a negative control siRNA (P ⁇ 0.0001).
  • Figures 8C-8D in both HEK-293T and HeLa cells, overexpression of FMR4 resulted in an increase in cell proliferation in comparison to cells treated with a control vector. Error bars: s.d.
  • Figures 9A-9B are graphs showing the effect of FMR4 on cell proliferation is not observed in non-primates. Since FMR4 is a primate-specific transcript its effect on cell proliferation was examined in non-primates using mouse N2A cells. Both the siRNA knockdown of FMR4 (as a negative control experiment) and the over-expression of FMR4 on cell proliferation in N2A cells were examined.
  • Figure 9A Mouse N2A cells were transfected with FMR4 siRNA C and a control siRNA. Simultaneously, cells were transfected with pGL3 (luciferase) vector. At 72 hours post transfection luciferase activity was measured and data are graphed as a percentage of control siRNA.
  • Figure 9B Mouse N2A cells were transfected with FMR4 over-expression vector and a control vector (no FMR4 insert). Simultaneously, cells were transfected with pGL3 (luciferase) vector. At 72 hours post transfection luciferase activity was measured and data are graphed as a percentage of control vector. Unlike human cells which show an increase in cell proliferation when transfected with the FMR4 vector, mouse N2A cells did not show any change in proliferation.
  • pGL3 luciferase
  • Figures 10A- 1OC show FMR4 has an antiapoptotic function in human cells.
  • Figure 1OA shows cell cycle analysis of control cells (red) and cells treated with two different siRNAs against FMR4 (green and blue) shows that knockdown of FMR4 resulted in a highly significant increase in the number of cells in Sub-Gl and a modest but significant decrease in the number of cells in the S phase indicating a possible role in apoptosis.
  • Figure 1OB are scans showing microscope images of cells (DAPI stained) treated with a control siRNA and cells treated with FMR4 siRNA for 72 hours prior to a TUNEL assay.
  • FIG. 1 OC is a graph showing quantification of cells following a TUNEL assay indicated that there is at least a two-fold change in the number of cells undergoing apoptosis in the FMR4 siRNA treated cells in comparison to the control siRNA treated cells. Error bars: s.d.
  • compositions comprising FMR4 gene, mutants, variants, alleles, complements, encoded products and fragments thereof are described. Methods comprising the compositions described herein, diagnose, prevent and treat disorders associated with FMR4 deficiencies.
  • FMR4 new gene
  • Bioinformatics analysis shows that the genomic sequence for FMR4 is present in primates but not in other species.
  • Northern blot analyses in ten different human tissues show that FMR4 mRNA is present in the brain, liver, placenta, small intestine, colon, and spleen but not in the testes, ovary or prostate.
  • FMR4 is a primate specific transcript which could perhaps help explain the failure of mouse models to fully recapitulate all of the human phenotypes in fragile X syndrome.
  • a nucleic acid comprises SEQ ID NO: 9.
  • a nucleic acid comprises SEQ ID NO: 9, mutants, variants, alleles, complementary sequences, ribonucleotide sequences, encoded products and fragments thereof.
  • a nucleic acid is identified by hybridization of SEQ ID NOS: 1-12 to a nucleic acid molecule.
  • One of skill in the art can identify the stringency of hybridization to be used, e.g. low to high stringency.
  • the stringency of hybridization is defined as equilibrium hybridization under the following conditions: 42° C, 2X SSC, 0.1% SDS (low stringency); 50° C, 2X SSC, 0.1% SDS (medium stringency); and 65° C, 2X SSC, 0,1% SDS (high stringency). If washings are necessary to achieve equilibrium, the washings are performed with the hybridization solution for the particular stringency desired. In general, the higher the temperature, the higher is the homology between two strands hybridizing at equilibrium.
  • complementary means one strand of a double-stranded nucleic acid, in which all the bases are able to form base pairs with a sequence of bases in another strand. Also, complementary is defined as not only those completely matching within a continuous region of at least 15 contiguous nucleotides, but also those having identity of at least 50%, preferably 70%, more preferably 80%, still more preferably 90%, and most preferably 95% or higher within that region. As used herein, "percent identity" of two nucleic acids is determined using the algorithm of Karlin and Altschul ⁇ Proc. Natl. Acad. Set. USA 87: 2264-2268, 1990) modified as in Karlin and Altschul ⁇ Proc. Natl. Acad. Sci.
  • the variant includes a nucleotide sequence that is at least 65% identical to the nucleotide sequence shown in SEQ ID NOS: 1 to 12. More preferably, the variant is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more, identical to the nucleotide sequence shown in SEQ ID NOS: 1 to 12.
  • the comparison is made with the full length of the reference sequence.
  • the variant is shorter than the reference sequence, e.g., shorter than SEQ ID NOS: 1 to 12
  • the comparison is made to segment of the reference sequence of the same length (excluding any loop required by the homology calculation).
  • alleles and variants have been identified at base positions: 223- 227, 223-232, 257, 320, 504, 600, 689, 912-914, 991, 1675, 1793 of SEQ ID NO: 9 (FMR4). See, for example, Table 2.
  • a base "position” as used herein refers to the location of a given base or nucleotide residue within a nucleic acid.
  • nucleic acid of the present invention preferably comprises at least 15, 20, 30, 40, 50, 100, 150, 200, 300, 400, 500, 1000, 1500, 2000, 2500, or 3000 nucleotides.
  • the nucleic acid of the present invention includes polynucleotides used as probes or primers specifically hybridizing with the nucleotide sequence of SEQ ID NO: 9 or its complement.
  • the term "specifically hybridizing” means that hybridizing under a normal hybridization condition, preferably a stringent condition with the nucleotide sequence of SEQ ID NO: 9, but not crosshybridizing with DNAs encoding other polypeptides.
  • the primers or probes comprise SEQ ID NOS: 1 to 12.
  • the primers and probes comprise at least 15 continuous nucleotides within the nucleotide sequence of SEQ ID NO: 9 or complementary to the sequence.
  • the primers comprises 15 to 100 nucleotides, and preferably 15 to 35 nucleotides
  • the probes comprise at least 15 nucleotides, preferably at least 30 nucleotides, containing at least a portion or the whole sequence of SEQ ID NO: 9.
  • the primers for example, SEQ ID NOS: 1 to 8, 10, 11 and 12 can be used for amplification of the nucleic acid encoding the polypeptide of the present invention and the probes can be used for the isolation or detection of the nucleic acid encoding the polypeptide of the present invention.
  • the primers and probes of the present invention can be prepared, for example, by a commercially available oligonucleotide synthesizing machine.
  • the probes can be also prepared as double-stranded DNA fragments which are obtained by restriction enzyme treatments and the like.
  • isolated primers comprise SEQ ID NOS: 1-8 and 10- 12.
  • a nucleic acid sequence is identified by use of primers in assays such as polymerase chain reaction assays, primer extension, sequencing etc. Examples of these techniques such as PCR are described in detail in the examples section which follows.
  • the nucleic acid molecules comprise chimeric nucleobases. For example, to increase or decrease hybridization of the primers, one or more nucleotides in any one of SEQ ID NOS: 1-8 and 10-12 are substituted with modified nucleotides.
  • oligonucleotides of this invention are chimeric oligonucleotides.
  • "Chimeric oligonucleotides” or “chimeras”, in the context of this invention, are oligonucleotides which contain two or more chemically distinct regions, each made up of at least one nucleotide. These oligonucleotides typically contain at least one region of modified nucleotides that confers one or more beneficial properties (such as, for example, increased nuclease resistance, increased uptake into cells, increased binding affinity for the RNA target) and a region that is a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids.
  • RNase H is a cellular endonuclease which cleaves the RNA strand of an RNA:DNA duplex. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of antisense inhibition of gene expression. Consequently, comparable results can often be obtained with shorter oligonucleotides when chimeric oligonucleotides are used, compared to phosphorothioate deoxyoligonucleotides hybridizing to the same target region. Cleavage of the RNA target can be routinely detected by gel electrophoresis and, if necessary, associated nucleic acid hybridization techniques known in the art.
  • a chimeric oligonucleotide comprises at least one region modified to increase target binding affinity, and, usually, a region that acts as a substrate for RNAse H.
  • Affinity of an oligonucleotide for its target is routinely determined by measuring the T m of an oligonucleotide/target pair, which is the temperature at which the oligonucleotide and target dissociate; dissociation is detected spectrophotometrically. The higher the T m , the greater the affinity of the oligonucleotide for the target.
  • the region of the oligonucleotide which is modified comprises at least one nucleotide modified at the 2' position of the sugar, most preferably a 2'-O-alkyl, 2'-O-alkyl-O-alkyl or 2'-fluoro- modified nucleotide.
  • RNA modifications include 2'-fluoro, 2'-amino and 2' O-methyl modifications on the ribose of pyrymidines, abasic residues or an inverted base at the 3' end of the RNA.
  • RNAse H is a cellular endonuclease that cleaves the RNA strand of RNA:DNA duplexes; activation of this enzyme therefore results in cleavage of the RNA target, and thus can greatly enhance the efficiency of RNAi inhibition. Cleavage of the RNA target can be routinely demonstrated by gel electrophoresis.
  • the chimeric oligonucleotide is also modified to enhance nuclease resistance.
  • Cells contain a variety of exo- and endo-nucleases which can degrade nucleic acids. A number of nucleotide and nucleoside modifications have been shown to make the oligonucleotide into which they are incorporated more resistant to nuclease digestion than the native oligodeoxynucleotide. Nuclease resistance is routinely measured by incubating oligonucleotides with cellular extracts or isolated nuclease solutions and measuring the extent of intact oligonucleotide remaining over time, usually by gel electrophoresis.
  • Oligonucleotides which have been modified to enhance their nuclease resistance survive intact for a longer time than unmodified oligonucleotides.
  • a variety of oligonucleotide modifications have been demonstrated to enhance or confer nuclease resistance.
  • Oligonucleotides which contain at least one phosphorothioate modification are presently more preferred.
  • oligonucleotide modifications which enhance target binding affinity are also, independently, able to enhance nuclease resistance.
  • oligonucleotides envisioned for this invention include those comprising modified backbones, for example, phosphorothioates, phosphotriesters, methyl phosphonates, short chain alkyl or cycloalkyl intersugar linkages or short chain heteroatomic or heterocyclic intersugar linkages.
  • oligonucleotides with phosphorothioate backbones and those with heteroatom backbones particularly CH 2 -NH-O-CH 2 , CH, ⁇ N(CH 3 )-O-CH 2 [known as a methylene(methylimino) or MMI backbone], CH 2 -O-N (CH 3 )-CH 2 , CH 2 -N (CH 3 )-N (CH 3 )- CH 2 and O— N (CH 3 ) ⁇ CH 2 -CH 2 backbones, wherein the native phosphodiester backbone is represented as O--P--O--CH).
  • oligonucleotides having morpholino backbone structures are also preferred.
  • oligonucleotides having morpholino backbone structures are also preferred.
  • oligonucleotides having morpholino backbone structures are also preferred.
  • the phosphodiester backbone of the oligonucleotide is replaced with a polyamide backbone, the nucleobases being bound directly or indirectly to the aza nitrogen atoms of the polyamide backbone (Nielsen et al. Science 1991, 254, 1497).
  • Oligonucleotides may also comprise one or more substituted sugar moieties.
  • Preferred oligonucleotides comprise one of the following at the 2 1 position: OH, SH, SCH 3 , F, OCN, OCH 3 OCH 3 , OCH 3 O(CH 2 ) n CH 3 , 0(CH 2 ) n NH 2 or O(CH 2 ) n CH 3 where n is from 1 to about 10; Ci to Ci 0 lower alkyl, alkoxyalkoxy, substituted lower alkyl, alkaryl or aralkyl; Cl; Br; CN; CF 3 ; OCF 3 ; O ⁇ , S-, or N-alkyl; O-, S-, or N-alkenyl; SOCH 3 ; SO 2 CH 3 ; ONO 2 ; NO 2 ; N 3 ; NH 2 ; heterocycloalkyl; heterocycloalkaryl; aminoalkylamino; polyalkylamino; substituted silyl; an RNA cleaving group; a reporter group; an intercalator; a
  • a preferred modification includes 2'-methoxyethoxy [2'-0-CH 2 CH 2 OCH 3 , also known as 2'-O-(2-methoxyethyl)] (Martin et al., HeIv. Chim. Acta, 1995, 78, 486).
  • Other preferred modifications include 2'- methoxy (2'-0--CH 3 ), 2'-propoxy (2'-OCH 2 CH 2 CH 3 ) and 2'-fluoro (2'-F).
  • Similar modifications may also be made at other positions on the oligonucleotide, particularly the 3' position of the sugar on the 3' terminal nucleotide and the 5' position of 5' terminal nucleotide.
  • Oligonucleotides may also have sugar mimetics such as cyclobutyls in place of the pentofuranosyl group.
  • Oligonucleotides may also include, additionally or alternatively, nucleobase (often referred to in the art simply as “base”) modifications or substitutions.
  • nucleobase often referred to in the art simply as “base”
  • “unmodified” or “natural” nucleobases include adenine (A), guanine (G), thymine (T), cytosine (C) and uracil (U).
  • Modified nucleobases include nucleobases found only infrequently or transiently in natural nucleic acids, e.g., hypoxanthine, 6-methyladenine, 5- Me pyrimidines, particularly 5-methylcytosine (also referred to as 5-methyl-2' deoxycytosine and often referred to in the art as 5-Me-C), 5-hydroxymethylcytosine (HMC), glycosyl HMC and gentobiosyl HMC, as well as synthetic nucleobases, e.g., 2-aminoadenine, 2-
  • a "universal" base known in the art e.g., inosine, may be included.
  • 5-Me-C substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2 0 C. (Sanghvi, Y. S., in Crooke, S. T. and Lebleu, B., eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278) and are presently preferred base substitutions.
  • Another modification of the oligonucleotides of the invention involves chemically linking to the oligonucleotide one or more moieties or conjugates which enhance the activity or cellular uptake of the oligonucleotide.
  • Such moieties include but are not limited to lipid moieties such as a cholesterol moiety, a cholesteryl moiety (Letsinger et ah, Proc. Natl. Acad. ScL USA 1989, 86, 6553), cholic acid (Manoharan et al. Bioorg. Med. Chem. Let. 1994, 4, 1053), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al. Ann. N. Y. Acad. Sci. 1992, 660, 306; Manoharan et al. Bioorg. Med. Chem. Let.
  • lipid moieties such as a cholesterol moiety, a cholesteryl moiety (Letsinger et ah, Proc. Natl. Acad. ScL USA 1989, 86, 6553), cholic acid (Manoharan et al. Bioorg. Med. Chem. Let. 1994,
  • a phospholipid e.g., di-hexadecyl-rac- glycerol or triethylammonium l,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al. Tetrahedron Lett. 1995, 36, 3651 ; Shea et al. Nucl. Acids Res. 1990, 18, 3777), a polyamine or a polyethylene glycol chain (Manoharan et al. Nucleosides & Nucleotides 1995, 14, 969), or adamantane acetic acid (Manoharan et al. Tetrahedron Lett.
  • a phospholipid e.g., di-hexadecyl-rac- glycerol or triethylammonium l,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate
  • Oligonucleotides comprising lipophilic moieties, and methods for preparing such oligonucleotides are known in the art, for example, U.S. Pat. Nos. 5,138,045, 5,218,105 and 5,459,255.
  • oligonucleotides which are chimeric oligonucleotides as hereinbefore defined.
  • the nucleic acid molecule of the present invention is conjugated with another moiety including but not limited to abasic nucleotides, polyether, polyamine, polyamides, peptides, carbohydrates, lipid, or polyhydrocarbon compounds.
  • abasic nucleotides polyether, polyamine, polyamides, peptides, carbohydrates, lipid, or polyhydrocarbon compounds.
  • these molecules can be linked to one or more of any nucleotides comprising the nucleic acid molecule at several positions on the sugar, base or phosphate group.
  • the oligonucleotides used in accordance with this invention may be conveniently and routinely made through the well-known technique of solid phase synthesis. Equipment for such synthesis is sold by several vendors including Applied Biosystems.
  • any other means for such synthesis may also be employed; the actual synthesis of the oligonucleotides is well within the talents of one of ordinary skill in the art. It is also well known to use similar techniques to prepare other oligonucleotides such as the phosphorothioates and alkylated derivatives. It is also well known to use similar techniques and commercially available modified amidites and controlled-pore glass (CPG) products such as biotin, fluorescein, acridine or psoralen-modified amidites and/or CPG (available from Glen Research, Sterling VA) to synthesize fluorescently labeled, biotinylated or other modified oligonucleotides such as cholesterol-modified oligonucleotides.
  • CPG controlled-pore glass
  • LNA monomers to enhance the potency, specificity and duration of action and broaden the routes of administration of oligonucleotides comprised of current chemistries such as MOE, ANA, FANA, PS etc (ref: Recent advances in the medical chemistry of antisense oligonucleotide by Uhlman, Current Opinions in Drug Discovery & Development 2000 VoI 3 No 2). This can be achieved by substituting some of the monomers in the current oligonucleotides by LNA monomers.
  • the LNA modified oligonucleotide may have a size similar to the parent compound or may be larger or preferably smaller.
  • LNA-modified oligonucleotides contain less than about 70%, more preferably less than about 60%, most preferably less than about 50% LNA monomers and that their sizes are between about 10 and 25 nucleotides, more preferably between about 12 and 20 nucleotides.
  • any nucleic acid in purified or non-purified form, can be utilized as the starting material from a cohort or individual.
  • the process may employ, for example, DNA or RNA, including messenger RNA, which DNA or RNA may be single stranded or double stranded.
  • a DNA-RNA hybrid which contains one strand of each may be utilized.
  • nucleic acid sequence to be amplified may be only a fraction of a larger molecule, or it may be present initially as a discrete molecule where the selected sequence constitutes the entire nucleic acid.
  • the selected sequence need not be purified; it may be a minor fraction of a complex mixture, such as a portion of the FMR4 gene contained in human genomic DNA.
  • the starting nucleic acid may contain two or more selected nucleic acid sequences, which may be the same or different. Therefore, the process is useful not only for producing large amounts of one specific nucleic acid sequence, but also for amplifying simultaneously two or more selected nucleic acid sequences located on the same or different nucleic acid molecules.
  • the nucleic acid or acids may be obtained from any source, for example, from plasmids, from cloned DNA or RNA, or from natural DNA or RNA from any source, including bacteria, yeast, viruses, organelles, and higher organisms such as plants or animals.
  • DNA or RNA may be extracted from any nucleic acid containing sample such as blood, tissue material such as chorionic villi or amniotic cells by a variety of techniques such as that described by Maniatis et ai, Molecular Cloning: A Laboratory Manual (1982), 280-281.
  • the cells may be directly used without purification of the nucleic acid.
  • a cellular sample can be suspended in hypotonic buffer and heated to about 90-100 0 C, until cell lysis and dispersion of intracellular components occurs. Such a process generally takes from about 1 to 15 minutes. After the heating step, the amplification reagents may be added directly to the lysed cells.
  • Antibodies and Aptamers Antibodies that specifically bind to FMR4 are provided. Such antibodies may be used in methods of isolating pure FMR4 and in methods of identifying individuals who have fragile X syndrome and fragile X tremor ataxia syndrome. That is, by identifying individuals whose tissue shows an absence or deficiency in FMR4 as compared to a normal subject, a diagnosis of fragile X syndrome and fragile X tremor ataxia syndrome is indicated.
  • aptamer or “selected nucleic acid binding species” shall include non-modified or chemically modified RNA or DNA.
  • the method of selection may be by, but is not limited to, affinity chromatography and the method of amplification by reverse transcription (RT) or polymerase chain reaction (PCR).
  • antibody is meant to refer to complete, intact antibodies, and Fab fragments and F(ab) 2 fragments thereof.
  • Complete, intact antibodies include monoclonal antibodies such as murine monoclonal antibodies, chimeric antibodies and humanized antibodies.
  • Antibodies that bind to an epitope which is present on FMR4 are useful to isolate and purify the FMR4 from both natural sources and recombinant expression systems using well known techniques such as affinity chromatography. Such antibodies are useful to detect the presence of such protein in a sample and to determine if cells are expressing the protein.
  • nucleic acid molecules that encode FMR4 may each be isolated from a cDNA library, using probes which are designed based upon the nucleotide sequence information disclosed in SEQ ID NO: 9.
  • the present invention relates to an isolated nucleic acid molecule that comprises a nucleotide sequence that encodes FMR4.
  • the isolated nucleic acid molecules of the invention are useful to prepare constructs and recombinant expression systems for preparing FMR4.
  • a cDNA library may be generated by well known techniques.
  • a cDNA clone which contains one of the nucleotide sequences set out is identified using probes that comprise at least a portion of the nucleotide sequence disclosed in SEQ ID NO: 9.
  • the probes generally have at least 16 nucleotides, preferably 24 nucleotides.
  • the probes are used to screen the cDNA library using standard hybridization techniques.
  • genomic clones may be isolated using genomic DNA from any human cell as a starting material.
  • the present invention relates to isolated nucleic acid molecules that comprise a nucleotide sequence identical or complementary to a fragment of SEQ ID NO: 9 which is at least 10 nucleotides.
  • the isolated nucleic acid molecules comprise or consist of a nucleotide sequence identical or complementary to a fragment of SEQ ID NO: 9 which is 15-150 nucleotides.
  • the isolated nucleic acid molecules comprise or consist of a nucleotide sequence identical or complementary to a fragment of SEQ ID NO: 9 which is 15-30 nucleotides.
  • the cDNA that encodes FMR4 may be used as a molecular marker in electrophoresis assays in which cDNA from a sample is separated on an electrophoresis gel and probes are used to identify bands which hybridize to such probes.
  • cDNA from a sample is separated on an electrophoresis gel and probes are used to identify bands which hybridize to such probes.
  • SEQ ID NOS: 1-12 or portions thereof may be used as a molecular marker in electrophoresis assays in which cDNA from a sample is separated on an electrophoresis gel and specific probes are used to identify bands which hybridize to them, indicating that the band has a nucleotide sequence complementary to the sequence of the probes.
  • the isolated nucleic acid molecule provided as a size marker will show up as a positive band which is known to hybridize to the probes and thus can be used as a reference point to the size of cDNA that encodes FMR4.
  • Electrophoresis gels useful in such an assay include standard polyacrylamide gels as described in Sambrook et al., Molecular Cloning a Laboratory Manual, (1989) Second Ed., Cold Spring Harbor Press, New York, which is incorporated herein by reference.
  • the present invention also includes labeled oligonucleotides which are useful as probes for performing oligonucleotide hybridization methods to identify FMR4 between individuals.
  • the present invention includes probes that can be labeled and hybridized to unique nucleotide sequences that encode FMR4.
  • the nucleic acids of SEQ ID NOS: 1-12, and/or SEQ ID NOS: 1-4, 7-8, and 10-12 or combinations thereof can be used as probes to identify FMR4.
  • the probes are labeled with radiolabeled nucleotides or are otherwise detectable by readily available nonradioactive detection systems.
  • probes comprise oligonucleotides consisting of between 10 and 100 nucleotides.
  • probes comprise oligonucleotides consisting of between 10 and 50 nucleotides. In some preferred, probes comprise oligonucleotides consisting of between 12 and 20 nucleotides.
  • the probes preferably contain nucleotide sequence completely identical or complementary to a fragment of a unique nucleotide sequence of FMR4.
  • nucleic acid molecule that encodes FMR4 can isolate the nucleic acid molecule that encodes FMR4 and insert it into an expression vector using standard techniques and readily available starting materials.
  • a recombinant expression vector comprises a nucleotide sequence that encodes FMR4 that comprises the sequence of SEQ ID NO: 9.
  • the term "recombinant expression vector” is meant to refer to a plasmid, phage, viral particle or other vector which, when introduced into an appropriate host, contains the necessary genetic elements to direct expression of the coding sequence that encodes FMR4.
  • the coding sequence is operably linked to the necessary regulatory sequences.
  • Expression vectors are well known and readily available. Examples of expression vectors include plasmids, phages, viral vectors and other nucleic acid molecules or nucleic acid molecule containing vehicles useful to transform host cells and facilitate expression of coding sequences.
  • a host cell comprises a recombinant expression vector that includes a nucleotide sequence that encodes FMR4, such as for example, SEQ ID NO: 9.
  • Host cells for use in well known recombinant expression systems for production of proteins are well known and readily available. Examples of host cells include bacteria cells such as E. coli, yeast cells such as S. cerevisiae, insect cells such as S. frugiperda, non-human mammalian tissue culture cells Chinese hamster ovary (CHO) cells and human tissue culture cells such as HeLa cells.
  • Expression systems containing the requisite control sequences are readily available and known in the art for a variety of hosts. See e.g., Sambrook et al., Molecular Cloning a Laboratory Manual, Second Ed., Cold Spring Harbor Press, New York (1989).
  • a wide variety of eukaryotic hosts are also now available for production of recombinant foreign proteins. As in bacteria, eukaryotic hosts may be transformed with expression systems which produce the desired protein directly, but more commonly signal sequences are provided to effect the secretion of the protein.
  • Eukaryotic systems have the additional advantage that they are able to process introns which may occur in the genomic sequences encoding proteins of higher organisms. Eukaryotic systems also provide a variety of processing mechanisms which result in, for example, glycosylation, carboxy-terminal amidation, oxidation or derivatization of certain amino acid residues, conformational control, and so forth. Commonly used eukaryotic systems include, but is not limited to, yeast, fungal cells, insect cells, mammalian cells, avian cells, and cells of higher plants. Suitable promoters are available which are compatible and operable for use in each of these host types as well as are termination sequences and enhancers, e.g. the baculovirus polyhedron promoter. As above, promoters can be either constitutive or inducible. For example, in mammalian systems, the mouse metallothionein promoter can be induced by the addition of heavy metal ions.
  • the DNA encoding the polypeptide is suitably ligated into the expression vector of choice.
  • the DNA is operably linked to all regulatory elements which are necessary for expression of the DNA in the selected host.
  • One having ordinary skill in the art can, using well known techniques, can prepare expression vectors for recombinant production of the polypeptide.
  • the expression vector including the DNA that encodes FMR4 is used to transform the compatible host which is then cultured and maintained under conditions wherein expression of the foreign DNA takes place.
  • the protein of the present invention thus produced is recovered from the culture, either by lysing the cells or from the culture medium as appropriate and known to those in the art.
  • One having ordinary skill in the art can, using well known techniques, isolate FMR4 that is produced using such expression systems.
  • the methods of purifying FMR4 from natural sources using antibodies which specifically bind to FMR4, fragments, mutants, variants etc, as described above, may be equally applied to purifying FMR4 produced by recombinant DNA methodology.
  • Examples of genetic constructs include the FMR4 coding sequence operably linked to a promoter that is functional in the cell line into which the constructs are transfected.
  • Examples of constitutive promoters include promoters from cytomegalovirus or SV40.
  • Examples of inducible promoters include mouse mammary leukemia virus or metallothionein promoters.
  • Treatment is an intervention performed with the intention of preventing the development or altering the pathology or symptoms of a disorder. Accordingly, treatment refers to both therapeutic treatment and prophylactic or preventative measures. Treatment may also be specified as palliative care. Those in need of treatment include those already with the disorder as well as those in which the disorder is to be prevented.
  • compositions of the invention are administered to patients for the treatment of fragile X syndrome and fragile X tremor ataxia syndrome (FXTAS).
  • FMR4 is elevated in both fragile X syndrome and fragile X tremor ataxia syndrome (FXTAS) as shown in the examples which follow.
  • compositions are administered as a replacement therapy, such as for example, in fragile X syndrome.
  • Peptides encoded by SEQ ID NO: 9 can be administered to a patient, for example, in the form of a peptide in a pharmaceutical compositions, as a vector expressing SEQ ID NO: 9, and the like.
  • FMR4 expression can be disrupted, modulated, increased, decreased, silenced by antibodies specific to FMR4, siRNA, antisense oligonucleotides, small molecule inhibition of FMR4 peptides and the like.
  • FMR4 expression is disrupted or modulated to decrease the levels to those levels found in normal individuals, e.g. non carriers.
  • the disruption of a desired target nucleic acid can be carried out in several ways known in the art.
  • siRNA e.g., ribozymes
  • Enzymatic nucleic acid molecules are nucleic acid molecules capable of catalyzing one or more of a variety of reactions, including the ability to repeatedly cleave other separate nucleic acid molecules in a nucleotide base sequence-specific manner.
  • Such enzymatic nucleic acid molecules can be used, for example, to target virtually any RNA transcript (Zaug et al., 324, Nature 429 1986; Cech, 260 JAMA 3030, 1988; and Jefferies et al., 17 Nucleic Acids Research 1371 , 1989).
  • Enzymatic nucleic acid molecules can be designed to cleave specific RNA targets within the background of cellular RNA. Such a cleavage event renders the mRNA non-functional and abrogates protein expression from that RNA. In this manner, synthesis of a protein associated with a disease state can be selectively inhibited.
  • enzymatic nucleic acids with RNA cleaving activity act by first binding to a target RNA. Such binding occurs through the target binding portion of a enzymatic nucleic acid which is held in close proximity to an enzymatic portion of the molecule that acts to cleave the target RNA.
  • the enzymatic nucleic acid first recognizes and then binds a target RNA through complementary base pairing, and once bound to the correct site, acts enzymatically to cut the target RNA. Strategic cleavage of such a target RNA will destroy its ability to direct synthesis of an encoded protein.
  • ribozymes that are optimal for catalytic activity would contribute significantly to any strategy that employs RNA-cleaving ribozymes for the purpose of regulating gene expression.
  • the hammerhead ribozyme functions with a catalytic rate (k cat ) of about 1 min "1 in the presence of saturating (10 mM) concentrations of Mg + cofactor.
  • An artificial "RNA ligase" ribozyme has been shown to catalyze the corresponding self-modification reaction with a rate of about 100 min "1 .
  • RNA phosphodiester cleavage of an RNA substrate by an RNA catalyst that fits the
  • Catalytic RNAs designed based on the "hammerhead” motif have been used to cleave specific target sequences by making appropriate base changes in the catalytic RNA to maintain necessary base pairing with the target sequences (Haseloff and Gerlach, Nature, 334, 585 (1988); Walbot and Bruening, Nature, 334, 196 (1988); Uhlenbeck, O. C. (1987) Nature, 328: 596-600; Koizumi, M., Iwai, S. and Ohtsuka, E. (1988) FEBS Lett., 228: 228- 230).
  • RNA interference has become a powerful tool for blocking gene expression in mammals and mammalian cells. This approach requires the delivery of small interfering
  • RNA either as RNA itself or as DNA, using an expression plasmid or virus and the coding sequence for small hairpin RNAs that are processed to siRNAs.
  • This system enables efficient transport of the pre-siRNAs to the cytoplasm where they are active and permit the use of regulated and tissue specific promoters for gene expression.
  • Peptides/Polypeptides include peptides encoded by SEQ ID NOS: 1-12, mutants, fragments, and variants thereof.
  • the peptides are encoded by SEQ ID NO: 9, mutants, fragments and variants thereof.
  • compositions comprise a polypeptide that is at least about 85% identical to the amino acid sequence of FMR4. In some embodiments, the polypeptide is at least about 90%, 95%, 99%, or 100% identical to the full length sequence of FMR4, mutants, fragments and variants fragment thereof. In some embodiments, the peptide is at least about 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 39, 40, 45, 50, 55, 60, 65, 70, 75, 80 or more amino acids long.
  • a "polypeptide comprising a fragment of FMR4 or the peptide encoded by SEQ ID NO: 9" includes less than the full length of each, but can include other (i.e., non- FMR4 proteins or fragments thereof, e.g., fluorescent proteins such as green fluorescent protein (GFP), red fluorescent protein (RFP), blue fluorescent protein (BFP) or yellow fluorescent protein (YFP), or peptides that enhance delivery, e.g., a TAT protein transduction domain (PTD).
  • GFP green fluorescent protein
  • RFP red fluorescent protein
  • BFP blue fluorescent protein
  • YFP yellow fluorescent protein
  • PTD TAT protein transduction domain
  • isolated polypeptide used here in means a polypeptide that is substantially pure and free from other biological macromolecules.
  • the substantially pure polypeptide is at least 75% (e.g., at least 80, 85, 95, or 99%) pure by dry weight. Purity can be measured by any appropriate standard method, for example by column chromatography, polyacrylamide gel electrophoresis, or HPLC analysis.
  • the polypeptides of the present invention includes variants of peptides encoded by SEQ ID NO: 9 as long as the variants are at least 50% identical to peptides encoded by SEQ ID NO: 9.
  • the variants may be a polypeptide comprising the amino acid sequence of peptides encoded by SEQ ID NO: 9 in which one or more amino acids have been substituted, deleted, added, and/or inserted.
  • the variants may also be a polypeptide encoded by a nucleic acid comprising a strand that hybridizes under high stringent conditions to a nucleotide sequence consisting of SEQ ID NO: 9.
  • Polypeptides having amino acid sequences modified by deleting, adding and/or replacing one or more amino acid residues of a certain amino acid sequence have been known to retain the original biological activity (Mark, D. F. et al., Proc. Natl. Acad. Sci. USA (1984) 81, 5662-5666, Zoller, M. J. & Smith, M., Nucleic Acids Research (1982) 10, 6487-6500, Wang, A. et al., Science 224, 1431-1433, Dalbadie-McFarland, G. et al., Proc. Natl. Acad. Sci. USA (1982) 79, 6409-6413).
  • the number of amino acids that are mutated by substitution, deletion, addition, and/or insertion is not particularly restricted. Normally, it is 20% or less, preferably 15% or less, and more preferably 10% or less of the total amino acid residues.
  • amino acid residue to be mutated it is preferable to be mutated into a different amino acid in which the properties of the amino acid side-chain are conserved.
  • properties of amino acid side chains are, hydrophobic amino acids (A, I, L, M, F, P, W, Y, V), hydrophilic amino acids (R, D, N, C, E, Q, G, H, K, S, T), and amino acids comprising the following side chains: an aliphatic side-chain (G, A, V, L, I, P); a hydroxyl group containing side-chain (S, T, Y); a sulfur atom containing side-chain (C, M); a carboxylic acid and amide containing side-chain (D, N, E, Q); abase containing side-chain (R, K, H); and an aromatic containing side-chain (H, F, Y, W) (The parenthetic letters indicate the one-letter codes of amino acids).
  • a "conservative amino acid substitution" is a replacement
  • the fragment is a polypeptide having an amino acid sequence which is partly, but not entirely, identical to the above polypeptides of this invention.
  • the polypeptide fragments of this invention usually consist of 8 amino acid residues or more, and preferably 12 amino acid residues or more (for example, 15 amino acid residues or more).
  • Examples of preferred fragments include truncation polypeptides, having amino acid sequences lacking a series of amino acid residues including either the amino terminus or carboxyl terminus, or two series of amino acid residues, one including the amino terminus and the other including the carboxyl terminus.
  • fragments featured by structural or functional characteristics are also preferable, which include those having ⁇ -helix and ⁇ -helix forming regions, ⁇ -sheet and ⁇ -sheet forming regions, turn and turn forming regions, coil and coil forming regions, hydrophilic regions, hydrophobic regions, ⁇ -amphipathic regions, ⁇ - amphipathic regions, variable regions, surface forming regions, substrate-binding regions, and high antigenicity index region.
  • Biologically active fragments are also preferred. Biologically active fragments mediate the activities of the polypeptides of this invention, which fragments include those having similar or improved activities, or reduced undesirable activities.
  • fragments having the activity to transduce signals into cells via binding of a ligand, and furthermore, fragments having antigenicity or immunogenicity in animals, especially humans are included.
  • These polypeptide fragments preferably retain the antigenicity of the polypeptides of this invention.
  • an addition variant includes a fusion protein of the polypeptide of the present invention and another peptide or polypeptide. Fusion proteins can be made by techniques well known to a person skilled in the art, such as by linking the DNA encoding the polypeptide of the invention with DNA encoding other peptides or polypeptides, so as the frames match, inserting this into an expression vector and expressing it in a host. There is no restriction as to the peptides or polypeptides fused to the polypeptide of the present invention.
  • peptides for example, FLAG (Hopp, T. P. et al., Biotechnology (1988) 6, 1204- 1210), 6X His containing six His (histidine) residues, 1OX His, Influenza agglutinin (HA), human c-myc fragment, VSP-GP fragment, pi 8HIV fragment, T7-tag, HSV-tag, E-tag, SV40T antigen fragment, lck tag, ⁇ -tubulin fragment, B-tag, Protein C fragment, fluorescent proteins such as green fluorescent protein (GFP), red fluorescent protein (RFP), blue fluorescent protein (BFP) or yellow fluorescent protein (YFP), or peptides that enhance delivery, e.g., a TAT protein transduction domain (PTD) and such, can be used as peptides that are fused to the polypeptide of the present invention.
  • FLAG Hopp, T. P. et al., Biotechnology (1988) 6, 1204- 1210
  • Fusion proteins can be prepared by fusing commercially available DNA encoding these peptides or polypeptides with the DNA encoding the polypeptide of the present invention and expressing the fused DNA prepared.
  • the variant polypeptide is preferably at least 65% identical to the amino acid sequence encoded by SEQ ID NO: 9. More specifically, the modified polypeptide is at least 65%,
  • percent identity of two amino acid sequences is determined in the same manner as described above for the nucleic acids.
  • the polypeptide of the present invention can be prepared by methods known to one skilled in the art, as a natural polypeptide or a recombinant polypeptide made using genetic engineering techniques as described above.
  • a natural polypeptide can be obtained by preparing a column coupled with an antibody obtained by immunizing a small animal with the recombinant polypeptide, and performing affinity chromatography for extracts of liver tissues or cells expressing high levels of the polypeptide of the present invention.
  • a recombinant polypeptide can be prepared by inserting DNA encoding the polypeptide of the present invention (for example, DNA comprising the nucleotide sequence of SEQ ID NO: 9) into a suitable expression vector, introducing the vector into a host cell, allowing the resulting transformant to express the polypeptide, and recovering the expressed polypeptide.
  • the variant polypeptide can be prepared, for example, by inserting a mutation into the amino acid sequence encoded by SEQ ID NO: 9 by a known method such as the PCR- mediated, site-directed-mutation-induction system (GIBCO-BRL, Gaithersburg, Md.), oligonucleotide-mediated, sight-directed-mutagenesis (Kramer, W. and Fritz, H J (1987) Methods in Enzymol. 154:350-367).
  • a known method such as the PCR- mediated, site-directed-mutation-induction system (GIBCO-BRL, Gaithersburg, Md.), oligonucleotide-mediated, sight-directed-mutagenesis (Kramer, W. and Fritz, H J (1987) Methods in Enzymol. 154:350-367).
  • compositions typically include the active ingredient and a pharmaceutically acceptable carrier.
  • pharmaceutically acceptable carrier includes saline, solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration.
  • Supplementary active compounds can also be incorporated into the compositions.
  • a pharmaceutical composition is formulated to be compatible with its intended route of administration.
  • routes of administration include parenteral, e.g., intravenous, intradermal, subcutaneous, oral (e.g., inhalation), transdermal (topical), transmucosal, and rectal administration.
  • Solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose. pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide.
  • the parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.
  • compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion.
  • suitable carriers include physiological saline, bacteriostatic water, CremophorTM (BASF, Parsippany, N.J.) or phosphate buffered saline (PBS).
  • the composition must be sterile and should be fluid to the extent that easy syringability exists. It should be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi.
  • the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyetheylene glycol, and the like), and suitable mixtures thereof.
  • the proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants.
  • Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like.
  • isotonic agents for example, sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride in the composition.
  • Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.
  • Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization.
  • dispersions are prepared by incorporating the active compound into a sterile vehicle, which contains a basic dispersion medium and the required other ingredients from those enumerated above.
  • the preferred methods of preparation are vacuum drying and freeze-drying which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
  • Oral compositions generally include an inert diluent or an edible carrier.
  • the active compound can be incorporated with excipients and used in the form of tablets, troches, or capsules, e.g., gelatin capsules.
  • Oral compositions can also be prepared using a fluid carrier for use as a mouthwash.
  • Pharmaceutically compatible binding agents, and/or adjuvant materials can be included as part of the composition.
  • the tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or corn starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring.
  • a binder such as microcrystalline cellulose, gum tragacanth or gelatin
  • an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or corn starch
  • a lubricant such as magnesium stearate or Sterotes
  • a glidant such as colloidal silicon dioxide
  • the compounds can be delivered in the form of an aerosol spray from pressured container or dispenser which contains a suitable propellant, e.g., a gas such as carbon dioxide, or a nebulizer.
  • a suitable propellant e.g., a gas such as carbon dioxide, or a nebulizer.
  • a suitable propellant e.g., a gas such as carbon dioxide, or a nebulizer.
  • Compositions for inhalation can also include propellants, surfactants, and other additives, e.g., to improve dispersion, flow, and bioavailability.
  • Systemic administration can also be by transmucosal or transdermal means.
  • penetrants appropriate to the barrier to be permeated are used in the formulation.
  • penetrants are generally known in the art, and include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives.
  • Transmucosal administration can be accomplished through the use of nasal sprays or suppositories.
  • the active compounds are formulated into ointments, salves, gels, or creams as generally known in the art.
  • Compounds comprising nucleic acids e.g.
  • SEQ ID NOS: 1-12 preferably SEQ ID NO: 9, mutants, fragments and variants thereof, can also be administered by transfection or infection using methods known in the art, including but not limited to the methods described in McCaffrey et al. (2002), Nature, 418(6893), 38-9 (hydrodynamic transfection); Xia et al. (2002), Nature Biotechnol, 20(10), 1006-10 (viral-mediated delivery); or Putnam (1996), Am. J. Health Syst. Pharm., 53(2), 151-160, erratum at Am. J. Health Syst. Pharm., 53(3), 325 (1996).
  • Compounds comprising nucleic acids can also be administered by method suitable for administration of DNA vaccines.
  • the compounds are prepared with carriers that will protect the active ingredient against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems.
  • a controlled release formulation including implants and microencapsulated delivery systems.
  • Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid.
  • Such formulations can be prepared using standard techniques.
  • the materials can also be obtained commercially from Alza Corporation and Nova Pharmaceuticals, Inc.
  • Liposomal suspensions (including liposomes targeted to infected cells with monoclonal antibodies to viral antigens) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Pat. No. 4,522,811.
  • the compounds are modified to enhance delivery into cells, e.g., by the addition of an optimized or native TAT protein transduction domain (PTD), e.g., as described in Ho et al, Cancer Res. 61(2):474-7 (2001).
  • PTD TAT protein transduction domain
  • the polypeptide can be a fusion protein comprising an active portion (e.g., an active fragment of Apoptin) and a TAT PTD fused in frame.
  • treatment is defined as the application or administration of a therapeutic agent described herein, or identified by a method described herein, to a patient, or application or administration of the therapeutic agent to an isolated tissue or cell line from a patient, who has a disease, a symptom of disease or a predisposition toward a disease, with the purpose to cure, heal, alleviate, relieve, alter, remedy, ameliorate, improve or affect the disease, the symptoms of disease, or the predisposition toward disease.
  • routes of administration include parenteral, e.g., intravenous, intradermal, subcutaneous, oral (e.g., inhalation), transdermal (topical), transmucosal, and rectal administration.
  • Therapeutic agents include, for example, proteins, nucleic acids, small molecules, peptides, antibodies, siRNAs, ribozymes, and antisense oligonucleotides. Dosage, toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD 50 (the dose lethal to 50% of the population) and the ED 50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD 50 /ED 50 . Compounds that exhibit high therapeutic indices are preferred.
  • While compounds that exhibit toxic side effects may be used, care should be taken to design a delivery system that targets such compounds to the site of affected tissue in order to minimize potential damage to uninfected cells and, thereby, reduce side effects.
  • the data obtained from the cell culture assays and animal studies can be used in formulating a range of dosage for use in humans.
  • the dosage of such compounds lies preferably within a range of circulating concentrations that include the ED 50 with little or no toxicity.
  • the dosage may vary within this range depending upon the dosage form employed and the route of administration utilized.
  • the therapeutically effective dose can be estimated initially from cell culture assays.
  • a dose may be formulated in animal models to achieve a circulating plasma concentration range that includes the IC 50 (i.e., the concentration of the test compound which achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma may be measured, for example, by high performance liquid chromatography.
  • a therapeutically effective amount of a compound means an amount sufficient to produce a therapeutically (e.g., clinically) desirable result.
  • the compositions can be administered one from one or more times per day to one or more times per week; including once every other day.
  • certain factors can influence the dosage and timing required to effectively treat a subject, including but not limited to the severity of the disease or disorder, previous treatments, the general health and/or age of the subject, and other diseases present.
  • treatment of a subject with a therapeutically effective amount of the compounds of the invention can include a single treatment or a series of treatments.
  • the invention provides for diagnosis of fragile X syndrome and fragile X tremor ataxia syndrome.
  • the FMR4 is upregulated in permutation carriers and become silenced in fragile X patients.
  • Bioinformatics analysis shows that the genomic sequence for FMR4 is present in primates but not in other species.
  • Northern blot analyses in ten different human tissues show that FMR4 mRNA is present in the brain, liver, placenta, small intestine, colon, and spleen but not in the testes, ovary or prostate.
  • oligonucleotides comprising SEQ ID NOS: 1-12 are used in a variety of diagnostic assays.
  • the sequences can be radiolabeled to identify hybridization, used of the primers in PCR, generation of peptides, aptamers and antibodies directed to the desired sequences, etc.
  • a method of diagnosing fragile X syndrome and fragile X tremor ataxia syndrome comprises obtaining a biological sample from a patient; identifying SEQ ID NO: 9 or a portion thereof; detecting the presence, absence or variation in concentration of a peptide encoded by SEQ ID NO: 9 mutants, variants, alleles, complementary sequence and fragments thereof; comparing the concentrations of the peptide between a normal individual, a permutation carrier and the patient.
  • a method of diagnosing fragile X syndrome and fragile X tremor ataxia syndrome comprises obtaining a biological sample from a patient identifying SEQ ID NO: 9 or a portion thereof; detecting the presence, absence or variation in concentration of a peptide encoded by SEQ ID NO: 9 mutants, variants, alleles, complementary sequence and fragments thereof; comprising antibodies specific to these peptides.
  • Bio samples include solid and body fluid samples.
  • the biological samples used in the present invention can include cells, protein or membrane extracts of cells, blood or biological fluids such as ascites fluid or brain fluid (e.g., cerebrospinal fluid).
  • solid biological samples include, but are not limited to, samples taken from tissues of the central nervous system, bone, breast, kidney, cervix, endometrium, head/neck, gallbladder, parotid gland, prostate, pituitary gland, muscle, esophagus, stomach, small intestine, colon, liver, spleen, pancreas, thyroid, heart, lung, bladder, adipose, lymph node, uterus, ovary, adrenal gland, testes, tonsils and thymus.
  • body fluid samples include, but are not limited to blood, serum, semen, prostate fluid, seminal fluid, urine, saliva, sputum, mucus, bone marrow, lymph, and tears.
  • sample is used herein in its broadest sense.
  • a sample comprising polynucleotides, polypeptides, peptides, antibodies and the like may comprise a bodily fluid; a soluble fraction of a cell preparation, or media in which cells were grown; a chromosome, an organelle, or membrane isolated or extracted from a cell; genomic DNA, RNA, or cDNA, polypeptides, or peptides in solution or bound to a substrate; a cell; a tissue; a tissue print; a fingerprint, skin or hair; and the like.
  • a method of diagnosing fragile X syndrome and fragile may comprise a bodily fluid; a soluble fraction of a cell preparation, or media in which cells were grown; a chromosome, an organelle, or membrane isolated or extracted from a cell; genomic DNA, RNA, or cDNA, polypeptides, or peptides in solution or bound to a substrate; a cell; a tissue; a tissue print; a fingerprint, skin or hair
  • X tremor ataxia syndrome comprises detecting GC-rich region of the FMR4 gene in normals, carriers and afflicted individuals. These can be detected by PCR methods, e.g. real-time PCR, cloning etc.
  • the patient or individual is a mammal. This includes humans of any age. For example, an embryo, neonate, infant, child, teenager or adult.
  • an FMR4 peptide or nucleic acid is identified by an antibody or aptamer.
  • a kit comprises primers of SEQ ID NOS: 1-8 and 10- 12; thermostable polymerase, and A, G, C, T nucleotides.
  • a kit comprises SEQ ID NO: 9, peptides thereof, or antibodies specific for SEQ ID NO: 9 or peptide thereof.
  • a PCR reaction on the first PCR reaction product. That is, if difficult to detect quantities of amplified DNA are produced by the first reaction, a second PCR can be performed to make multiple copies of DNA sequences of the first amplified DNA.
  • a nested set of primers are used in the second PCR reaction. The nested set of primers hybridize to sequences downstream of the 5' primer and upstream of the 3' primer used in the first reaction.
  • the present invention includes oligonucleotide which are useful as primers for performing PCR methods to amplify mRNA or cDNA that encodes FMR4 protein, for example, SEQ ID NOS: 1-8 and 10-12.
  • diagnostic kits can be assembled which is useful to practice methods of detecting the presence of mRNA or cDNA that encodes FMR4 in tissue samples.
  • Such diagnostic kits comprise oligonucleotides which are useful as primers for performing PCR methods.
  • diagnostic kits according to the present invention comprise a container comprising a size marker to be run as a standard on a gel used to detect the presence of amplified DNA.
  • the size marker is the same size as the DNA generated by the primers in the presence of the mRNA or cDNA encoding FMR4.
  • a kit comprises reagents for identifying and measuring the levels of FMR4 in FXS and FXTAS using real-time PCR (RT-PCR).
  • the kit can include one or more of SEQ ID NOS: 1-12. Another method of determining whether a sample contains cells expressing FMR4 is by
  • Northern blot analysis of mRNA extracted from a tissue sample.
  • the techniques for performing Northern blot analyses are well known by those having ordinary skill in the art and are described in Sambrook, J. et al., Molecular Cloning: A Laboratory Manual, (1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y.
  • mRNA extraction, electrophoretic separation of the mRNA, blotting, probe preparation and hybridization are all well known techniques that can be routinely performed using readily available starting material.
  • One having ordinary skill in the art, performing routine techniques could design probes to identify mRNA encoding FMR4 using the information in SEQ ID NO: 9.
  • the mRNA is extracted using poly dT columns and the material is separated by electrophoresis and, for example, transferred to nitrocellulose paper. Labeled probes made from an isolated specific fragment or fragments can be used to visualize the presence of a complementary fragment fixed to the paper.
  • diagnostic kits can be assembled which is useful to practice methods of detecting the presence of mRNA that encodes FMR4 in tissue samples by Northern blot analysis.
  • Such diagnostic kits comprise oligonucleotides which are useful as probes for hybridizing to the mRNA.
  • the probes may be radiolabeled.
  • diagnostic kits according to the present invention comprise a container comprising a size marker to be run as a standard on a gel.
  • diagnostic kits according to the present invention comprise a container comprising a positive control which will hybridize to the probe.
  • Another method of detecting the presence of mRNA encoding FMR4 protein is by oligonucleotide hybridization technology.
  • Oligonucleotide hybridization technology is well known to those having ordinary skill in the art. Briefly, detectable probes which contain a specific nucleotide sequence that will hybridize to nucleotide sequence of mRNA encoding FMR4 protein. RNA or cDNA made from RNA from a sample is fixed, usually to filter paper or the like. The probes are added and maintained under conditions that permit hybridization only if the probes fully complement the fixed genetic material. The conditions are sufficiently stringent to wash off probes in which only a portion of the probe hybridizes to the fixed material. Detection of the probe on the washed filter indicates complementary sequences. One having ordinary skill in the art, using the sequence information disclosed in SEQ ID NO: 9 can design probes which are fully complementary to mRNA sequences but not genomic DNA sequences. Hybridization conditions can be routinely optimized to minimize background signal by non-fully complementary hybridization.
  • the present invention includes labeled oligonucleotides which are useful as probes for performing oligonucleotide hybridization. That is, they are fully complementary with mRNA sequences but not genomic sequences. For example, the mRNA sequence includes portions encoded by different exons.
  • the labeled probes of the present invention are labeled with radiolabeled nucleotides or are otherwise detectable by readily available nonradioactive detection systems.
  • diagnostic kits can be assembled which is useful to practice oligonucleotide hybridization methods of the invention. Such diagnostic kits comprise a labeled oligonucleotide which encodes portions of FMRl encoded by different exons.
  • labeled probes of the oligonucleotide diagnostic kits according to the present invention are labeled with a radionucleotide.
  • the oligonucleotide hybridization-based diagnostic kits according to the invention preferably comprise DNA samples that represent positive and negative controls.
  • a positive control DNA sample is one that comprises a nucleic acid molecule which has a nucleotide sequence that is fully complementary to the probes of the kit such that the probes will hybridize to the molecule under assay conditions.
  • a negative control DNA sample is one that comprises at least one nucleic acid molecule, the nucleotide sequence of which is partially complementary to the sequences of the probe of the kit. Under assay conditions, the probe will not hybridize to the negative control DNA sample.
  • Another aspect of the invention relates to methods of analyzing tissue samples which are fixed sections routinely prepared by surgical pathologists to characterize and evaluate cells.
  • the cells are from brain tissue or testicular tissue and are analyzed to determine and evaluate the extent O ⁇ FMR4 expression.
  • the present invention relates to in vitro kits for evaluating tissues samples to determine the level of FMR4 expression and to reagents and compositions useful to practice the same.
  • the tissue is analyzed to identify the presence or absence of the FMR4 protein.
  • Techniques such as FMR4/anti-FMR4 binding assays and immunohistochemistry assays may be performed to determine whether FMR4 is absent in cells in the tissue sample which are indicative of fragile X syndrome and fragile X tremor ataxia syndrome or upregulated which is indicative and diagnostic of premutation carriers.
  • tissue samples are analyzed to identify whether FMRl and FMR4 protein is being expressed in cells in the tissue sample which indicate a lack of fragile X syndrome and fragile X tremor ataxia syndrome.
  • the presence of mRNA that encodes the FMR4 protein or cDNA generated therefrom can be determined using techniques such as in situ hybridization, immunohistochemistry.
  • In situ hybridization technology is well known by those having ordinary skill in the art. Briefly, cells are fixed and detectable probes which contain a specific nucleotide sequence are added to the fixed cells. If the cells contain complementary nucleotide sequences, the probes, which can be detected, will hybridize to them.
  • One having ordinary skill in the art, using the sequence information in SEQ ID NO: 9 can design probes useful in in situ hybridization technology to identify cells that express FMR4.
  • the probes are detectable by fluorescence.
  • a common procedure is to label probe with biotin-modified nucleotide and then detect with fluorescently-tagged avidin.
  • the probe does not itself have to be labeled with florescent but can be subsequently detected with florescent marker.
  • Probes will hybridize to the complementary nucleic acid sequences present in the sample. Using a fluorescent microscope, the probes can be visualized by their fluorescent markers.
  • diagnostic kits can be assembled which is useful to practice in situ hybridization methods of the invention are fully complementary with mRN A sequences but not genomic sequences.
  • the mRNA sequence includes portions encoded by different exons. It is preferred that labeled probes of the in situ diagnostic kits according to the present invention are labeled with a fluorescent marker. ⁇
  • Immunohistochemistry techniques may be used to identify and essentially stain cells with FMR4.
  • Anti-FMR4 antibodies are contacted with fixed cells and the FMR4 present in the cells reacts with the antibodies.
  • the antibodies are detectably labeled or detected using labeled second antibody or protein A to stain the cells.
  • kits for performing immunoassays to determine the presence or absence of FMR4 protein in a sample from an individual.
  • Kits may additionally include one or more of the following: means for detecting antibodies bound to FMR4 present in a sample, instructions for performing the method, and diagrams or photographs that are representative of how positive and/or negative results appear.
  • kits may comprise optional positive controls such as FMR4 protein.
  • optional negative controls may be provided.
  • Immunoassay methods may be used to identify individuals with fragile X syndrome and fragile X tremor ataxia syndrome by detecting the absence or deficiency of FMR4 in sample of tissue or body fluid using antibodies which bind to FMR4.
  • the antibodies are preferably monoclonal antibodies.
  • the antibodies are preferably raised against FMR4 made in human cells. Immunoassays are well known and there design may be routinely undertaken by those having ordinary skill in the art. The techniques for producing monoclonal antibodies are outlined in Harlow, E. and D. Lane (1988) Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, N. Y., which is incorporated herein by reference, provide detailed guidance for the production of hybridomas and monoclonal antibodies which specifically bind to FMR4.
  • immunoassays comprise allowing proteins in the sample to bind a solid phase support such as a plastic surface. Detectable antibodies are then added which selectively binding to FMR4. Detection of the detectable antibody indicates the presence of FMR4.
  • the detectable antibody may be a labeled or an unlabelled antibody.
  • Unlabelled antibody may be detected using a second, labeled antibody that specifically binds to the first antibody or a second, unlabelled antibody which can be detected using labeled protein A, a protein that complexes with antibodies.
  • Various immunoassay procedures are described in Immunoassays for the 80's, Voller, et al., Ed., University Park, 1981, which is incorporated herein by reference.
  • Simple immunoassays may be performed in which a solid phase support is contacted with the test sample. Any proteins present in the test sample bind the solid phase support and can be detected by a specific, detectable antibody preparation. Such a technique is the essence of the dot blot, Western blot and other such similar assays. Other immunoassays may be more complicated but actually provide excellent results.
  • Typical and preferred immunometric assays include "forward" assays for the detection of a protein in which a first anti-protein antibody bound to a solid phase support is contacted with the test sample. After a suitable incubation period, the solid phase support is washed to remove unbound protein. A second, distinct anti-protein antibody is then added which is specific for a portion of the specific protein not recognized by the first antibody. The second antibody is preferably detectable. After a second incubation period to permit the detectable antibody to complex with the specific protein bound to the solid phase support through the first antibody, the solid phase support is washed a second time to remove the unbound detectable antibody. Alternatively, the second antibody may not be detectable.
  • a third detectable antibody which binds the second antibody is added to the system.
  • This type of "forward sandwich” assay may be a simple yes/no assay to determine whether binding has occurred or may be made quantitative by comparing the amount of detectable antibody with that obtained in a control.
  • Such "two-site” or “sandwich” assays are described by Wide, Radioimmune Assay Method, (1970) Kirkham, Ed., E. & S. Livingstone, Edinburgh, pp. 199- 206, which is incorporated herein by reference.
  • a simultaneous assay involves a single incubation step wherein the first antibody bound to the solid phase support, the second, detectable antibody and the test sample are added at the same time. After the incubation is completed, the solid phase support is washed to remove unbound proteins. The presence of detectable antibody associated with the solid support is then determined as it would be in a conventional "forward sandwich” assay.
  • the simultaneous assay may also be adapted in a similar manner for the detection of antibodies in a test sample.
  • the "reverse” assay comprises the stepwise addition of a solution of detectable antibody to the test sample followed by an incubation period and the addition of antibody bound to a solid phase support after an additional incubation period.
  • the solid phase support is washed in conventional fashion to remove unbound protein/antibody complexes and unreacted detectable antibody.
  • the determination of detectable antibody associated with the solid phase support is then determined as in the "simultaneous" and "forward" assays.
  • the reverse assay may also be adapted in a similar manner for the detection of antibodies in a test sample.
  • the first component of the immunometric assay may be added to nitrocellulose or other solid phase support which is capable of immobilizing proteins.
  • the first component for determining the presence of FMR4 in a test sample is anti-FMR4 antibody.
  • solid phase support or “support” is intended any material capable of binding proteins.
  • Solid phase supports include glass, polystyrene, polypropylene, polyethylene, dextran, nylon, amylases, natural and modified celluloses, polyacrylamides, agaroses, and magnetite. The nature of the support can be either soluble to some extent or insoluble for the purposes of the present invention.
  • the support configuration may be spherical, as in a bead, or cylindrical, as in the inside surface of a test tube or the external surface of a rod. Alternatively, the surface may be flat such as a sheet, test strip, etc.
  • a preferred solid phase support is a 96- well microtiter plate. To detect the presence of FMR4, detectable anti-FMR4 antibodies are used. Several methods are well known for the detection of antibodies.
  • One method in which the antibodies can be detectably labeled is by linking the antibodies to an enzyme and subsequently using the antibodies in an enzyme immunoassay (EIA) or enzyme-linked immunosorbent assay (ELISA), such as a capture ELISA.
  • EIA enzyme immunoassay
  • ELISA enzyme-linked immunosorbent assay
  • the enzyme when subsequently exposed to its substrate, reacts with the substrate and generates a chemical moiety which can be detected, for example, by spectrophotometric, fluorometric or visual means.
  • Enzymes which can be used to detectably label antibodies include, but are not limited to malate dehydrogenase, staphylococcal nuclease, delta-5-steroid isomerase, yeast alcohol dehydrogenase, alpha-glycerophosphate dehydrogenase, triose phosphate isomerase, horseradish peroxidase, alkaline phosphatase, asparaginase, glucose oxidase, beta- galactosidase, ribonuclease, urease, catalase, glucose-6-phosphate dehydrogenase, glucoamylase and acetylcholinesterase.
  • malate dehydrogenase staphylococcal nuclease
  • delta-5-steroid isomerase yeast alcohol dehydrogenase
  • alpha-glycerophosphate dehydrogenase alpha-glycerophosphate dehydrogenase
  • triose phosphate isomerase horseradish
  • radioactive isotopes Another method in which antibodies can be detectably labeled is through radioactive isotopes and subsequent use in a radioimmunoassay (RIA) (see, for example, Work, et al., Laboratory Techniques and Biochemistry in Molecular Biology, North Holland Publishing Company, N. Y., 1978, which is incorporated herein by reference).
  • the radioactive isotope can be detected by such means as the use of a gamma counter or a scintillation counter or by autoradiography.
  • Isotopes which are particularly useful for the purpose of the present invention are 3 H, 125 I, 131 1, 35 S, and 14 C.
  • One skilled in the art would readily recognize other radioisotopes which may also be used.
  • fluorescent-labeled antibody it is also possible to label the antibody with a fluorescent compound.
  • fluorescent labeling compounds fluorescein isothiocyanate, rhodamine, phycoerythrin, phycocyanin, allophycocyanin, o-phthaldehyde and fluorescamine.
  • fluorescein isothiocyanate fluorescein isothiocyanate
  • rhodamine phycoerythrin
  • phycocyanin allophycocyanin
  • o-phthaldehyde fluorescamine
  • Antibodies can also be detectably labeled using fluorescence-emitting metals such as
  • metals can be attached to the protein-specific antibody using such metal chelating groups as diethylenetriaminepentaacetic acid (DTPA) or ethylenediamine-tetraacetic acid (EDTA).
  • DTPA diethylenetriaminepentaacetic acid
  • EDTA ethylenediamine-tetraacetic acid
  • Antibodies can also be detectably labeled by coupling to a chemiluminescent compound.
  • the presence of the chemiluminescent-labeled antibody is determined by detecting the presence of luminescence that arises during the course of a chemical reaction.
  • particularly useful chemoluminescent labeling compounds are luminol, isoluminol, theromatic acridinium ester, imidazole, acridinium salt and oxalate ester.
  • chemoluminescent labeling compounds are luminol, isoluminol, theromatic acridinium ester, imidazole, acridinium salt and oxalate ester.
  • chemiluminescent compounds which may also be used.
  • a bioluminescent compound may be used to label antibodies.
  • Bioluminescence is a type of chemiluminescence found in biological systems in which a catalytic protein increases the efficiency of the chemiluminescent reaction. The presence of a bioluminescent protein is determined by detecting the presence of luminescence.
  • Important bioluminescent compounds for purposes of labeling are luciferin, luciferase and aequorin. One skilled in the art would readily recognize other bioluminescent compounds which may also be used. Detection of the protein-specific antibody, fragment or derivative may be accomplished by a scintillation counter if, for example, the detectable label is a radioactive gamma emitter.
  • detection may be accomplished by a fluorometer if, for example, the label is a fluorescent material.
  • the detection can be accomplished by colorometric methods which employ a substrate for the enzyme. Detection may also be accomplished by visual comparison of the extent of enzymatic reaction of a substrate in comparison with similarly prepared standards.
  • detection may also be accomplished by visual comparison of the extent of enzymatic reaction of a substrate in comparison with similarly prepared standards.
  • binding activity of a given lot of antibodies may be determined according to well known methods. Those skilled in the art will be able to determine operative and optimal assay conditions for each determination by employing routine experimentation.
  • kits include antibodies for detection of FMR4 and identifying variants thereof, using Western blot analysis.
  • Positive and negative controls may be performed in which known amounts of FMR4 and no FMR4, respectively, are added to assays being performed in parallel with the test assay.
  • One skilled in the art would have the necessary knowledge to perform the appropriate controls.
  • an “antibody composition” refers to the antibody or antibodies required for the detection of the protein.
  • the antibody composition used for the detection of FMR4 in a test sample comprises a first antibody which binds FMR4, as well as a second or third detectable antibody that binds the first or second antibody, respectively.
  • a standard immunometric assay such as the one described herein may be performed.
  • a first anti-FMR4 antibody which recognizes, for example, a specific portion of FMR4 is added to a 96-well microtiter plate in a volume of buffer. The plate is incubated for a period of time sufficient for binding to occur and subsequently washed with PBS to remove unbound antibody. The plate is then blocked with a PBS/BSA solution to prevent sample proteins from non-specifically binding the microtiter plate. Test sample are subsequently added to the wells and the plate is incubated for a period of time sufficient for binding to occur. The wells are washed with PBS to remove unbound protein.
  • Labeled anti-FMR4 antibodies which recognize portions of FMR4 not recognized by the first antibody, are added to the wells.
  • the plate is incubated for a period of time sufficient for binding to occur and subsequently washed with PBS to remove unbound, labeled anti-FMR4 antibody.
  • the amount of labeled and bound anti-FMRl antibody is subsequently determined by standard techniques.
  • Kits which are useful for the detection of FMR4 in a test sample comprise a container comprising anti-FMR4 antibodies and a container or containers comprising controls.
  • Controls include one control sample which does not contain FMR4 and/or another control sample which contained FMR4.
  • the anti-FMR4 antibodies used in the kit are detectable such as being detectably labeled. If the detectable anti-FMR4 antibody is not labeled, it may be detected by second antibodies or protein A, for example, which may also be provided in some kits in separate containers. Additional components in some kits include solid support, buffer, and instructions for carrying out the assay.
  • the immunoassay is useful for detecting FMR4 in homogenized tissue samples and body fluid samples including the plasma portion or cells in the fluid sample.
  • the detection can also include other antibodies such as those detecting FMRl, FMR2, FMR3, etc, nucleic acids, peptides, for example, as a control, as part of the detection and the like.
  • Western blots may be used in methods of identifying individuals suffering from fragile X syndrome and fragile X tremor ataxia syndrome by detecting presence of FMR4 in samples of tissue, such as for example, brain and testes.
  • Western blots use detectable anti-FMR4 antibodies to bind to any FMR4 present in a sample and thus indicate the presence of the protein in the sample.
  • Kits which are useful for the detection of FMR4 in a test sample by Western blot comprise a container comprising FMR4 antibodies and a container or containers comprising controls.
  • Controls include one control sample which does not contain FMR4 and/or another control sample which contained FMR4.
  • the anti-FMR4 antibodies used in the kit are detectable such as being detectably labeled. If the detectable anti-FMR4 is not labeled, it may be detected by second antibodies or protein A for example which may also be provided in some kits in separate containers. Additional components in some kits include instructions for carrying out the assay.
  • the means to detect anti-FMR4 antibodies that are bound to FMR4 include the immunoassays described above.
  • aspects of the present invention also include various methods of determining whether a sample contains cells that express FMR4 by sequence-based molecular analysis. Several different methods are available for doing so including those using Polymerase Chain
  • PCR PCR Reaction
  • Northern blot technology oligonucleotide hybridization technology
  • in situ hybridization technology samples are screened to determine the presence or absence of mRNA that encodes FMR4.
  • the invention relates to oligonucleotide probes and primers used in the methods of identifying mRNA that encodes FMR4 and to diagnostic kits which comprise such components.
  • mRNA sequence-based methods for determining whether a sample mRNA encoding FMR4 include but are not limited to PCR technology, Northern and Southern blot technology, in situ hybridization technology and oligonucleotide hybridization technology.
  • the genomic sequence for FMRl locus was obtained from the UCSC (genome.ucsc.edu) website.
  • RACE-ready cDNA (0.5 ng/ ⁇ l) from SH-S Y5 Y cells for 5' and 3' RACE was custom made by Ambion, Inc.
  • RACE primers were designed using Primer3 software (frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi) and the name and sequence of the RACE primers for FMR4 is listed below in Table 1 :
  • First PCR was carried out using 10 ⁇ l of RACE-ready cDNA and the second PCR was carried out using 2 ⁇ l of the first PCR product. PCR conditions were as follow: 94°C for 5 minutes, (94°C for 30 seconds, 59°C for 30 seconds, 72°C for 3 minutes) for 35 cycles, 72°C for 10 minutes. Both first and second PCR products were ran on a 2% agarose gel and bands of interest were cut, purified, cloned into pGEM T-easy vector (Promega) before sending for sequencing.
  • RNA Extraction and cDNA synthesis Total RNA was extracted using Quiagen RNeasy mini kit (catalogue # 74106). RNA concentrations were measured using The NanoDrop® ND- 1000 UV-Vis Spectrophotometer. Equal amounts of RNA were reversed transcribed using TaqMan reverse transcription reagents (part # N808-0234) according to the manufacturer's protocol.
  • RT-PCR Real-Time PCR Real-Time PCR
  • the PCR reactions contained 20-40 ng cDNA, Universal Mastermix (Applied Biosystems, Foster City, CA), 300 nM of forward and reverse primers, and 200 nM of probe in a final reaction volume of 15 ⁇ l.
  • the primers and probe were designed using File-Builder software (Applied Biosystem, Foster City, CA).
  • the PCR conditions were as follows: 50°C for 2 mm then 95°C for 10 mm then 40 cycles of 95 0 C for 15 s and 60 0 C for 1 mm. The results are based on cycle threshold (Ct) values.
  • PCR FMRl forward primer C ACCTC AAAGCGAGC AC ATA SEQ ID NO: 5
  • reverse primer C AATAGC AGTGACCCC AGGT SEQ ID NO: 6
  • FMR4 forward primer AACTAGGAACAGTGGCAACCA SEQ ID NO: 7
  • reverse primer TGAGTTGAGGAAAGGCGAGT SEQ ID NO: 8
  • FMR4 forward primer ACACCCTGTGCCCTTTAAGG (SEQ ID NO: 10)
  • FMR4 reverse primer TCAAAGCTGGGTCTGAGGAAAG (SEQ ID NO: 11)
  • Reporter probe: TCGGGATCTCAAAATGT (SEQ ID NO: 12).
  • Fluorotect Green-Lys is a BIODPY labeled lysine that allows the addition of a fluorescent amino acid to any newly synthesized peptide (unlabeled lysine is also included in the reaction mixture) allowing for fluorescent detection of such peptides.
  • a human ready-to-hybridize northern blot membrane was purchased from Ambion (cat# 3141) which has 2 ⁇ g of poly(A) RNA per lane isolated from human brain, liver, placenta, small intestine, colon, pancreas, spleen, prostate, testes, and ovary. The membrane was initially incubated with 15 ml of prewarmed hybridization solution (Ambion, cat#8670) for 1 hour at 65 0 C.
  • Northern blot probes ( 32 P) were generated using Amersham rediprime II random prime labeling system (RPN 1633) according to the manufacturer's protocol.
  • the sequences of FMRl and FMR4 siRNAs are listed in Table 2.
  • the entire cDNA sequence of FMR4 was cloned into pcDNA3.1 vector.
  • the vector was sequenced to verify the insertion of the FMR4 sequence.
  • the vector was transfected into several human and mouse cell lines using standard procedures.
  • HEK-293T cells were cultured in 6 well plates. Twenty-four hours later, cells were treated with 50 ⁇ g/ml of ⁇ -amanitin. Cells were harvested for RNA isolation and RT-PCR at 0, 6, 12, and 24 hours post treatment. Three independent samples were taken for each data point and all samples had untreated and untransfected matching samples for RNA purification and data analysis.
  • PGL3 vector luciferase vector with SV40 promoter
  • 2OnM of siRNA and transfection reagents Lipofectamine 2000 0.2% and OptiMEM, Invitrogen, CA
  • Equal number of cells 20,000 per well
  • Bright-Glo luciferase reagent Promega, Madison, WI
  • Luciferase activity was measured by Analyst GT Multimode Reader (Molecular Devices, Sunnyvale, CA) and plotted against control siRNA.
  • FMR4 was knocked down using two different siRNAs (4 repeats each), and we used a control negative siRNA (4 repeats also) to examine the effects of FMR4 on the cell cycle.
  • the cells were prepared for flow cytometry as follows: cells were washed with PBS, trypsynized and centrifuged at 1,000 rpm for 10 minutes. Then the cells were washed again with PBS before being fixed with 70% ethanol at -20°C overnight. The next day the cells were centrifuged, washed with PBS and re-suspended in 38mM sodium citrate, 69 ⁇ M propidium iodide and 19 ⁇ g/ml RNAse A for flow cytometry analysis. Results were analyzed using FlowJo analysis software.
  • HEK-293T cells were plated on cover slips prior to treatment with a control siRNA or siRNAs against FMR4. At 72 hours post transfection, the cells were fixed with 4% paraformaldehyde (pH 7.4) for 15 min at room temperature, followed by permeabilization with 0.1% triton-X in PBS. TdT- mediated dUTP nick end labeling (TUNEL) reaction mixture was added to the cells and incubated at 37 0 C for 1 hour (Roche, Indianapolis, IN). The cells were then stained with DAPI and images were captured using a confocal microscope.
  • TUNEL TdT- mediated dUTP nick end labeling
  • RT-PCR Real time PCR
  • PCR primers were designed at various regions of the FMRl genomic sequence including upstream and downstream sequences surrounding FMRl to search for other transcripts.
  • a new transcript was detected that we termed FMR4 upstream of FMRl transcription start site in several cell lines that were examined including lymphoblasts, HEK-293, and SH-SY5Y cells.
  • RACE rapid amplification of cDNA ends
  • Bioinformatic analysis shows that the genomic sequence encompassing FMR4 is only present in primates.
  • Northern blot analysis shows that this transcript is expressed in several human tissues including brain, liver, placenta, small intestine, colon and spleen but not in the pancreas, testes, ovaries or prostate ( Figure 1). This is in contrast to FMRl which shows high levels of expression in the testes, ovaries and prostate ( Figure 1).
  • FMR4 is unregulated in premutation carriers and shut down in full mutation patients:
  • FMR4 are upregulated in permutation patients, and shut down in full mutation patients
  • FMRl and a control negative siRNA were used to transfect HEK-293T cells.
  • One set of HEK-293T cells were transfected for 72 hours, and another set of cells were transfected for
  • FMR4 may code for a small peptide: Next, ESTScan 2 (embnet.org/software/ESTScan2.html) was used to determine if FMR4 had an open reading frame. According to this software, FMR4 has a small open reading frame that codes for a 25 amino acid peptide. Using several protein homology search websites including NCBI, the new peptide does not seem to have any homology with any known proteins.
  • FMRl and FMR4 mRNA have similar half-lives'.
  • HEK-293 cells were treated with 50 ⁇ M of ⁇ -amanitin (which inhibits RNA pol II) and the RNA was isolated at 0, 6, 12 and 24 hours post treatment. Actin was used as a positive control and 18S was used as a negative control
  • FMR4 is a primate- specific transcript it is possible that FMR4 is responsible for some of the phenotypes found in human but not in these mice. Future experiments involving the knockdown of this transcript in primates (e.g., monkeys) could help elucidate the specific role of this transcript in fragile X syndrome. Also, transgenic mice that overexpress FMR4 could provide insights into this new gene.
  • Example 2 Identification and expression analysis ofFMR4
  • genomic approaches including rapid amplification of cDNA ends (RACE), regular and real time PCR (RT-PCR), transcripts upstream of FMRl that could also be affected by the CGG repeat expansion were searched.
  • Identification of a novel 2.4 kb long noncoding RNA, which we named FMR4 was shown to reside upstream and may share a bidirectional promoter with FMRl ( Figures 6A, 6B).
  • FMR4 was indeed a noncoding RNA in vitro transcription/translation was carried out followed by mass spectrometry analysis; however, no protein was detected indicating that FMR4 is most likely a noncoding RNA.
  • Northern blot analysis showed that FMRl was expressed in the majority of the human tissues examined consistent with previous reports. FMR4 was expressed in several adult human tissues including brain, liver, placenta, small intestine, colon and spleen but not in the pancreas, testes, ovaries or prostate.
  • FMR4 is ubiquitously expressed during human development: Since FMR4 is expressed in several human adult tissues, its expression levels were examined in human fetal tissues. Using RT-PCR RNA expression levels of FMR4 were measured in seven different human fetal tissues (12 weeks); the RNA from each tissue was pooled from at least three different embryos (GBiosciences). It was found that FMR4 was expressed in all the tissues examined including the brain. Notably, FMR4 was highly expressed in the kidney and heart at that stage of human development ( Figure 7A).
  • FMR4 is expressed in human and monkey brain: To determine whether FMR4 shows differential expression within different regions of the human brain, the RNA concentrations of both FMRl and FMR4 were examined by Real-Time PCR (RT-PCR) using tissue from six postmortem human brains (from four males and two females aged 61-91 years) and studied three different regions (cerebellum, frontal cortex, and hippocampus). By this quantitative method, RT-PCR, both FMRl and FMR4 were shown to display robust expression levels in all three brain regions tested ( Figure 7B). To determine if FMR4 was also expressed in other primates, the expression of FMR4 was examined in Rhesus monkey brain regions using RT- PCR.
  • RT-PCR Real-Time PCR
  • RNA from each brain region was isolated from two monkeys and DNAse treated prior to cDNA synthesis.
  • FMR4 was found to be expressed in all the monkey brain regions tested with high expression in the cerebellum and interior parietal cortex (Figure 7C) confirming that FMR4 was expressed in other primates in addition to humans.
  • the CGG expansion affects transcription in both directions of a bidirectional promoter: To determine if the expression of FMR4 was affected by the CGG expansion in the 5' UTR of FMRl that occurs in FXS and/or FXTAS, the relative expression 0 ⁇ FMR4 and FMRl was investigated by RT-PCR in untransformed leukocytes from four control, four premutation and four FXS patients. FMR4 expression, similar to FMRl, was found to be significantly up- regulated in premutation carriers, and shut down in full mutation (FXS) patients (P ⁇ 0.0001) ( Figure 3A). All the samples tested had a matching control without the reverse transcriptase to account for possible DNA contamination.
  • FMR4 was detectable in both the normal and premutation carriers but not in the full mutation fragile X patients.
  • FMRl was detectable in the normal, premutation carriers and one out of the four fragile X patients ( Figure 3B).
  • FMR4 is a product of RNA polymerase II and has a similar half-life to FMRl: To measure the relative half-lives of FMRl and FMR4, HEK-293T cells were treated with 50 ⁇ M of ⁇ -amanitin (an inhibitor of RNA polymerase II) and RNA was isolated at 0, 6, 12 and 24 hours post treatment (six repeats each). All treated samples had a matching control which did not receive ⁇ -amanitin (untreated samples). Actin was used as a positive control and 18S rRNA was used as a negative control (a product of RNA polymerase I). The levels of Actin, 18S, FMRl, and FMR4 were measured by RT-PCR.
  • FMR4 siRNA C was used, which caused the highest level of FMR4 knockdown among the siRNAs tested for a time course experiment.
  • HEK-293T cells were transfected with FMR4 siRNA C and RNA was collected at 24, 48, 72 and 144 hours post transfection. This siRNA caused a significant knockdown of FMR4 but did not affect FMRl levels at any of the time points tested ( Figure 4C).
  • FMR4 was cloned into a pcDNA3.1 vector with a CMV promoter and overexpressed FMR4 in HEK- 293T cells, a pcDNA3.1 vector without the FMR4 insert was used as a control.
  • RNA was isolated, reversed transcribed and used for RT-PCR analysis.
  • FMR4 affects cell proliferation in human cells: To uncover a possible function for FMR4, the effects of three distinct and efficacious siRNAs against FMR4 on cell proliferation were examined using a luciferase reporter system (see methods). HEK-293T cells were transfected with either siRNAs targeting FMR4 (C, G, and H), FMRl, or a control siRNA. All cells were simultaneously co-transfected with a pGL3 (luciferase) vector. At 72 hours post transfection, luciferase activity, which is a marker of cell proliferation, was measured using an Analyst GT Multimode Reader (Molecular Devices) and all data points were plotted as a percentage of control siRNA treated cells.
  • FMR4 has antiapoptotic properties: To further characterize the manner in which FMR4 affects cell proliferation, FMR4 was knocked down using two different siRNAs (four repeats each), and a control negative siRNA was used (four repeats also) to examine the effects of FMR4 on the cell cycle in HEK-293T cells. At 72 hours post transfection, propidium iodide FACS analysis was performed (see methods) and it was found that the siRNAs knockdown of FMR4 resulted in an increase in the number of cells in the Sub-Gl phase and a modest but significant decrease in the number of cells in S phase of the cell cycle (Figure 10A).
  • FMR4 may have an antiapoptotic function in human cells; a fluorescent TUNEL assay was next performed and a significant increase in apoptosis was found in cells treated with FMR4 siRNA (72 hours post transfection) compared to cells treated with a control siRNA, further indicating that FMR4 has an antiapoptotic function in human cells ( Figures 1 OB-I OC).
  • aPosition Nucleotide position on the FMR4 sequence
  • bS2D ID our internal variant ID
  • cVariant status Once we detect a variant we redo the PCR and re-sequence the proband in order to eliminate false positive dInheritance mode: Once we detect a variant we analyse the parents to determinate the inheritance mode (de novo vs. transmitted). Frequent variant are not tested for inheritance mode. Only rare variant (frequency ⁇ 1%)

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Analytical Chemistry (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Biochemistry (AREA)
  • Wood Science & Technology (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Pathology (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Food Science & Technology (AREA)
  • Cell Biology (AREA)
  • General Physics & Mathematics (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

Identification and isolation of a novel gene and products thereof. Methods of diagnosing, treating and/or preventing fragile X syndrome and fragile X tremor ataxia syndrome are provided.

Description

A NOVEL GENE ASSOCIATED WITH FRAGILE X SYNDROME AND FRAGILE X TREMOR ATAXIA SYNDROME
FIELD OF THE INVENTION
This invention relates to a novel gene of fragile X syndrome and fragile X tremor ataxia syndrome, compositions, diagnostics and methods of use. The novel gene is termed, herein, fragile X mental retardation 4 gene (FMR4).
BACKGROUND
Fragile X syndrome (FXS) which is the most common cause of inherited mental retardation is thought to be caused by the expansion of CGG repeats in the 5' UTR of the fragile X mental retardation 1 gene (FMRl). Normal individuals have a range of 5-50 repeats and express FMRl, individuals with 55-200 repeats are permutation carriers and express comparable or higher levels of FMRl than normal individuals. The expansion of CGG repeats above 200 is thought to lead to the absence of FMRl mRNA and consequently the fragile X mental retardation protein (FMRP). Nevertheless, recent studies have shown that some fragile X males with hypermethylated full mutation alleles continue to produce FMRl mRNA (in some cases comparable to those of normal individuals) despite the expectation that FMRl should be silent. A deletion of 1.6 kb proximal to the CGG repeat of the FMRl gene causes clinical phenotype of FXS.
The severity of the FXS phenotypes is highly variable and difficult to predict with current methods, especially in neonates. There is a need in the art to identify hereditary diseases and provide accurate and efficient diagnosis.
SUMMARY
Here we report the discovery of a new gene (FMR4), which is upregulated in permutation carriers and becomes silenced in fragile X patients. Bioinformatics analysis shows that the genomic sequence for FMR4 is highly conserved in primates but not in other species. Using genomic approaches, including rapid amplification of cDNA ends (RACE) we identified FMR4 as a novel gene upstream of FMRl . Northern blot analyses in different human tissues shows, so far, that the FMR4 transcript is present in the brain, placenta, small intestine, colon and spleen. By real time PCR (RT-PCR) this transcript was detected in several human cell types including HEK-293, SH-SY5Y and white blood cells.
In a preferred embodiment, a nucleic acid comprises the sequence of SEQ ID NO: 9, mutants, variants, alleles, complementary sequence and fragments thereof. Examples of allelic variation and variants of FMR4 are shown in Table 2.
In one preferred embodiment, a nucleic acid comprises the sequences as set forth in Table 2, variants, mutants, complementary sequences and fragments thereof.
In another preferred embodiment, the sequence of SEQ ID NO: 9, mutants, variants, alleles, complementary sequence and fragments thereof is expressed by an expression vector. Preferably, the expression vector comprises a promoter wherein the promoter is an inducible promoter, constitutive promoter, tissue specific promoter or bi-directional promoter.
In another preferred embodiment, a peptide is encoded by a nucleic acid comprising the sequence of SEQ ID NO: 9 mutants, variants, alleles, complementary sequence and fragments thereof. In another preferred embodiment, an antibody specific for a peptide encoded by a nucleic acid comprises the sequence of SEQ ID NO: 9 mutants, variants, alleles, complementary sequence and fragments thereof.
In another preferred embodiment, a biomarker diagnostic of Fragile X syndrome and fragile X tremor ataxia syndrome comprises a peptide encoded by a nucleic acid comprising the sequence of SEQ ID NO: 9 mutants, variants, alleles, complementary sequence and fragments thereof.
In another preferred embodiment, an isolated primer comprises any one or more of SEQ ID NOS: 1-8 and 10-12.
In another preferred embodiment, an isolated set of primers comprise SEQ ID NOS: 1 and 3; SEQ ID NOS: 2 and 4; SEQ ID NOS: 7 and 8; SEQ ID NOS: 10-12 or combinations thereof.
In another preferred embodiment, a method of diagnosing fragile X syndrome and fragile X tremor ataxia syndrome comprises obtaining a biological sample from a patient; identifying SEQ ID NO: 9 or a portion thereof; detecting the presence, absence or variation in concentration of a peptide encoded by SEQ ID NO: 9 mutants, variants, alleles, complementary sequence and fragments thereof; comparing the concentrations of the peptide between a normal individual, a permutation carrier and the patient; and, diagnosing fragile X syndrome and fragile X tremor ataxia syndrome. The patient can be any age, for example, an embryo, neonate, infant, child, teenager or adult.
In another preferred embodiment, a peptide or nucleic acid of SEQ ID NOS: 1-12, is identified by an antibody, aptamers and/or assays such as, for example, RIA, ELISA, gels, Western Blots, Northern Blots, PCR, and the like.
In another preferred embodiment, a method of treating and/or preventing a patient afflicted with fragile X syndrome and fragile X tremor ataxia syndrome comprises administering to a patient a composition comprising a vector expressing SEQ ID NO: 9, mutants, variants and fragments thereof; and, treating and/or preventing a patient afflicted with fragile X syndrome and fragile X tremor ataxia syndrome.
In another preferred embodiment, a method of treating and/or preventing a patient afflicted with fragile X syndrome and fragile X tremor ataxia syndrome comprises administering to a patient a composition comprising a peptide encoded by SEQ ID NO: 9, mutants, variants and fragments thereof; and, treating and/or preventing a patient afflicted with fragile X syndrome and fragile X tremor ataxia syndrome.
In another preferred embodiment, a method of treating and/or preventing a patient afflicted with fragile X syndrome and fragile X tremor ataxia syndrome comprises administering to a patient a composition comprising an antibody that specifically binds to a peptide encoded by SEQ ID NO: 9, mutants, variants and fragments thereof; and, treating and/or preventing a patient afflicted with fragile X syndrome and fragile X tremor ataxia syndrome.
In another preferred embodiment, a method of treating and/or preventing a patient afflicted with fragile X syndrome and fragile X tremor ataxia syndrome comprises administering to a patient a composition comprising a peptide encoded by SEQ ID NO: 9, mutants, variants and fragments thereof; and, treating and/or preventing a patient afflicted with fragile X syndrome and fragile X tremor ataxia syndrome.
In another preferred embodiment, a method of treating and/or preventing a patient afflicted with fragile X syndrome and fragile X tremor ataxia syndrome comprises administering to a patient a composition comprising an siRNA that specifically SEQ ID NO: 9, mutants, variants and fragments thereof; and, treating and/or preventing a patient afflicted with fragile X syndrome and fragile X tremor ataxia syndrome.
In another preferred embodiment, a kit comprises primers of SEQ ID NOS: 1-8 and 10- 12; thermostable polymerase, and A, G, C, T nucleotides. In another preferred embodiment, a kit comprises SEQ ID NO: 9, peptides thereof, or antibodies specific for SEQ ID NO: 9 or peptide. Other aspects of the invention are described infra.
BRIEF DESCRIPTION OF THE DRAWINGS
The invention is pointed out with particularity in the appended claims. The above and further advantages of this invention may be better understood by referring to the following description taken in conjunction with the accompanying drawings, in which: Figure 1 is a scan of a gel showing the results of a Northern blot analysis. Figure 2 is a graph showing the expression analysis of FMRl and FMR4 in normals, premutation and full mutation patients.
Figures 3A-3B show that FMR4 is silenced in fragile X syndrome. Figure 3A is a graph showing RNA from four normal, four premutation and four full mutation FXS patients isolated from untransformed leucocytes was reverse transcribed using random hexamers. Quantitative RT-PCR analysis revealed that FMR4, similar to FMRl, is up-regulated in premutation carriers and shut down in full mutation fragile X patients (P < 0.0001). Figure 3B is a scan of a blot showing RNA from untransformed leucocytes were reversed transcribed and the cDNA was used for PCR analysis. FMR4 is expressed in normal and premutation carriers but no bands were observed in the full mutation fragile X patients (35 cycles). FMRl bands were observed in normal, premutation, and one of the full mutation patients (35 cycles). To account for any possible DNA contamination, no reverse transcriptase control for all samples was used in the PCR (lanes next to bands are all negative indicating no DNA contamination was present). Error bars: s.d.
Figures 4A-4D are graphs showing that there is no direct cross-regulation between FMRl and FMR4. Figure 4A: three distinct siRNAs were used against FMRl to transfect HEK- 293T cells. Two out of the three siRNAs resulted in a significant knockdown of FMRl (80%), but did not affect FMR4 RNA levels. Figure 4B: three distinct siRNAs were used against FMR4 Xo transfect HEK-293T cells. All three siRNAs resulted in a significant knockdown of FMR4 but did not affect FMRl RNA levels. Figure 4C: is a graph showing that significant knockdown of FMR 4 via siRNA C did not result in a change in FMRl RNA levels at any of the time points tested (24, 48, 72, or 144 hours post transfection). Figure 4D: The entire sequence of FMR4 was cloned into a pcDNA3.1 vector with a CMV promoter. The pcDNA3.1 vector containing the FMR4 sequence and the original pcDNA3.1 (without the FMR4 insert) were transfected in HEK-293T cells. At 72 hours post transfection, RNA was isolated and reversed transcribed and used for RT-PCR analysis. There is a highly significant increase in the FMR4 RNA levels but no effect on FMRl RNA. Error bars: s.d.
Figure 5 is a graph showing FMR4 has a similar half-life to FMRl. HEK-293T cells were treated with α-amanitin (blocks RNA polymerase II) and the levels 0ΪFMR4 and FMRl were measured by RT-PCR at 0, 6, 12 and 24 hours post treatment. Both FMR4 and FMRl have similar half-lives. These experiments also further confirm that FMR4 is a product of RNA polymerase II.
Figures 6A and 6B show the identification and sequence analysis of FMR4. Figure 6A is a schematic representation showing known genes in Xq27.3-28 including the newly identified FMR4. FMR4 is transcribed upstream of FMRl and in the opposite direction. Figure 6B shows the sequence of FMR4 (SEQ ID NO: 9) obtained by rapid amplification of cDNA ends (RACE).
Figures 7A-7C show the expression analysis of FMR4. Figure 7A is a graph showing RT-PCR analysis of FMR4 and FMRl in seven different human fetal tissues (week 12), RNA from each tissue was pooled from at least three fetuses (GBiosciences). The RNA expression of FMRl and FMR4 were normalized to whole embryo (set as 100%). Both transcripts are expressed in all the tissues tested with notably high expression of FMR4 in the kidney and heart. Figure 7B is a graph showing RNA expression in the human adult brain. RNA was extracted from six postmortem human adult brains from three different regions, thereafter; cDNA synthesis followed by RT-PCR was performed on all samples to measure the relative quantities of FMRl and FMR4. Both FMRl and FMR4 are highly expressed in all the human brain regions tested. Figure 7C is a graph showing RT-PCR analysis of FMR4 and FMRl in several regions of two monkeys brains. The RNA expression 0ΪFMR4 and FMRl were normalized to the insula (set as 100%).
Figures 8A-8D are graphs showing that FMR4 affects proliferation in human cells. Figure 8A: cell proliferation assay showing that the knockdown of FMR4 via three distinct siRNAs in HEK-293T cells, but not knockdown of FMRl, resulted in decrease in cell proliferation in comparison to cells which are treated with a negative control siRNA. Cell proliferation was measured based on luciferase activity in these cells at 72 hours post siRNA transfection. Figure 8B: cell proliferation assay showing that the knockdown of FMR4 via three distinct siRNAs in HeLa cells resulted in decrease in cell proliferation in comparison to cells which are treated with a negative control siRNA (P<0.0001). Figures 8C-8D: in both HEK-293T and HeLa cells, overexpression of FMR4 resulted in an increase in cell proliferation in comparison to cells treated with a control vector. Error bars: s.d.
Figures 9A-9B are graphs showing the effect of FMR4 on cell proliferation is not observed in non-primates. Since FMR4 is a primate-specific transcript its effect on cell proliferation was examined in non-primates using mouse N2A cells. Both the siRNA knockdown of FMR4 (as a negative control experiment) and the over-expression of FMR4 on cell proliferation in N2A cells were examined. Figure 9A: Mouse N2A cells were transfected with FMR4 siRNA C and a control siRNA. Simultaneously, cells were transfected with pGL3 (luciferase) vector. At 72 hours post transfection luciferase activity was measured and data are graphed as a percentage of control siRNA. Figure 9B: Mouse N2A cells were transfected with FMR4 over-expression vector and a control vector (no FMR4 insert). Simultaneously, cells were transfected with pGL3 (luciferase) vector. At 72 hours post transfection luciferase activity was measured and data are graphed as a percentage of control vector. Unlike human cells which show an increase in cell proliferation when transfected with the FMR4 vector, mouse N2A cells did not show any change in proliferation.
Figures 10A- 1OC show FMR4 has an antiapoptotic function in human cells. Figure 1OA shows cell cycle analysis of control cells (red) and cells treated with two different siRNAs against FMR4 (green and blue) shows that knockdown of FMR4 resulted in a highly significant increase in the number of cells in Sub-Gl and a modest but significant decrease in the number of cells in the S phase indicating a possible role in apoptosis. Figure 1OB are scans showing microscope images of cells (DAPI stained) treated with a control siRNA and cells treated with FMR4 siRNA for 72 hours prior to a TUNEL assay. A significant number of cells are undergoing apoptosis (FITC) in the FMR4 siRNA treated cells in comparison to the control siRNA treated cells. Figure 1 OC is a graph showing quantification of cells following a TUNEL assay indicated that there is at least a two-fold change in the number of cells undergoing apoptosis in the FMR4 siRNA treated cells in comparison to the control siRNA treated cells. Error bars: s.d.
DETAILED DESCRIPTION Compositions comprising FMR4 gene, mutants, variants, alleles, complements, encoded products and fragments thereof are described. Methods comprising the compositions described herein, diagnose, prevent and treat disorders associated with FMR4 deficiencies. Here we report the discovery of a new gene (FMR4), which is upregulated in permutation carriers and becomes silenced in fragile X patients. Bioinformatics analysis shows that the genomic sequence for FMR4 is present in primates but not in other species. Northern blot analyses in ten different human tissues show that FMR4 mRNA is present in the brain, liver, placenta, small intestine, colon, and spleen but not in the testes, ovary or prostate. These findings are significant since: 1) unlike FMR2 and FMR3, the newly discovered FMR4 transcript resides in the FMRl locus and relates directly to the fragile X syndrome and 2) FMR4 is a primate specific transcript which could perhaps help explain the failure of mouse models to fully recapitulate all of the human phenotypes in fragile X syndrome.
Compositions
In a preferred embodiment, a nucleic acid comprises SEQ ID NO: 9.
As used herein, "a", "an," and "the" include plural references unless the context clearly dictates otherwise. In another preferred embodiment, a nucleic acid comprises SEQ ID NO: 9, mutants, variants, alleles, complementary sequences, ribonucleotide sequences, encoded products and fragments thereof.
In another preferred embodiment, a nucleic acid is identified by hybridization of SEQ ID NOS: 1-12 to a nucleic acid molecule. One of skill in the art can identify the stringency of hybridization to be used, e.g. low to high stringency.
The stringency of hybridization is defined as equilibrium hybridization under the following conditions: 42° C, 2X SSC, 0.1% SDS (low stringency); 50° C, 2X SSC, 0.1% SDS (medium stringency); and 65° C, 2X SSC, 0,1% SDS (high stringency). If washings are necessary to achieve equilibrium, the washings are performed with the hybridization solution for the particular stringency desired. In general, the higher the temperature, the higher is the homology between two strands hybridizing at equilibrium.
The term "complement" used herein means one strand of a double-stranded nucleic acid, in which all the bases are able to form base pairs with a sequence of bases in another strand. Also, complementary is defined as not only those completely matching within a continuous region of at least 15 contiguous nucleotides, but also those having identity of at least 50%, preferably 70%, more preferably 80%, still more preferably 90%, and most preferably 95% or higher within that region. As used herein, "percent identity" of two nucleic acids is determined using the algorithm of Karlin and Altschul {Proc. Natl. Acad. Set. USA 87: 2264-2268, 1990) modified as in Karlin and Altschul {Proc. Natl. Acad. Sci. USA 90:5873-5877, 1993). Such an algorithm is incorporated into the NBLAST and XBLAST programs of Altschul et al. (J. MoI. Biol. 215:403-410, 1990). BLAST nucleotide searches are performed with the NBLAST program, score=100, wordlength=12. Homology search of protein can readily be performed, for example, in DNA Databank of JAPAN (DDBJ), by using the FASTA program, BLAST program, etc. BLAST protein searches are performed with the XBLAST program, score=50, wordlength=3. Where gaps exist between two sequences, Gapped BLAST is utilized as described in Altsuchletal. (Nucleic Acids Res. 25: 3389-3402, 1997). When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs (e.g, XBLAST and NBLAST) are used.
Preferably, the variant includes a nucleotide sequence that is at least 65% identical to the nucleotide sequence shown in SEQ ID NOS: 1 to 12. More preferably, the variant is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more, identical to the nucleotide sequence shown in SEQ ID NOS: 1 to 12. In the case of a variant which is longer than or equivalent in length to the reference sequence, e.g., SEQ ID NOS: 1 to 12, the comparison is made with the full length of the reference sequence. Where the variant is shorter than the reference sequence, e.g., shorter than SEQ ID NOS: 1 to 12, the comparison is made to segment of the reference sequence of the same length (excluding any loop required by the homology calculation).
In non-limiting examples, alleles and variants have been identified at base positions: 223- 227, 223-232, 257, 320, 504, 600, 689, 912-914, 991, 1675, 1793 of SEQ ID NO: 9 (FMR4). See, for example, Table 2. A base "position" as used herein refers to the location of a given base or nucleotide residue within a nucleic acid.
There is no restriction on length of the nucleic acid of the present invention, but it preferably comprises at least 15, 20, 30, 40, 50, 100, 150, 200, 300, 400, 500, 1000, 1500, 2000, 2500, or 3000 nucleotides.
The nucleic acid of the present invention includes polynucleotides used as probes or primers specifically hybridizing with the nucleotide sequence of SEQ ID NO: 9 or its complement. The term "specifically hybridizing" means that hybridizing under a normal hybridization condition, preferably a stringent condition with the nucleotide sequence of SEQ ID NO: 9, but not crosshybridizing with DNAs encoding other polypeptides. In a preferred embodiment, the primers or probes comprise SEQ ID NOS: 1 to 12.
The primers and probes comprise at least 15 continuous nucleotides within the nucleotide sequence of SEQ ID NO: 9 or complementary to the sequence. In general, the primers comprises 15 to 100 nucleotides, and preferably 15 to 35 nucleotides, and the probes comprise at least 15 nucleotides, preferably at least 30 nucleotides, containing at least a portion or the whole sequence of SEQ ID NO: 9. The primers, for example, SEQ ID NOS: 1 to 8, 10, 11 and 12 can be used for amplification of the nucleic acid encoding the polypeptide of the present invention and the probes can be used for the isolation or detection of the nucleic acid encoding the polypeptide of the present invention. The primers and probes of the present invention can be prepared, for example, by a commercially available oligonucleotide synthesizing machine. The probes can be also prepared as double-stranded DNA fragments which are obtained by restriction enzyme treatments and the like.
In another preferred embodiment, isolated primers comprise SEQ ID NOS: 1-8 and 10- 12.
In another preferred embodiment, a nucleic acid sequence is identified by use of primers in assays such as polymerase chain reaction assays, primer extension, sequencing etc. Examples of these techniques such as PCR are described in detail in the examples section which follows. In another preferred embodiment, the nucleic acid molecules comprise chimeric nucleobases. For example, to increase or decrease hybridization of the primers, one or more nucleotides in any one of SEQ ID NOS: 1-8 and 10-12 are substituted with modified nucleotides.
Certain preferred oligonucleotides of this invention are chimeric oligonucleotides. "Chimeric oligonucleotides" or "chimeras", in the context of this invention, are oligonucleotides which contain two or more chemically distinct regions, each made up of at least one nucleotide. These oligonucleotides typically contain at least one region of modified nucleotides that confers one or more beneficial properties (such as, for example, increased nuclease resistance, increased uptake into cells, increased binding affinity for the RNA target) and a region that is a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids. By way of example, RNase H is a cellular endonuclease which cleaves the RNA strand of an RNA:DNA duplex. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of antisense inhibition of gene expression. Consequently, comparable results can often be obtained with shorter oligonucleotides when chimeric oligonucleotides are used, compared to phosphorothioate deoxyoligonucleotides hybridizing to the same target region. Cleavage of the RNA target can be routinely detected by gel electrophoresis and, if necessary, associated nucleic acid hybridization techniques known in the art. In one preferred embodiment, a chimeric oligonucleotide comprises at least one region modified to increase target binding affinity, and, usually, a region that acts as a substrate for RNAse H. Affinity of an oligonucleotide for its target (in this case, a nucleic acid encoding ras) is routinely determined by measuring the Tm of an oligonucleotide/target pair, which is the temperature at which the oligonucleotide and target dissociate; dissociation is detected spectrophotometrically. The higher the Tm, the greater the affinity of the oligonucleotide for the target. In a more preferred embodiment, the region of the oligonucleotide which is modified comprises at least one nucleotide modified at the 2' position of the sugar, most preferably a 2'-O-alkyl, 2'-O-alkyl-O-alkyl or 2'-fluoro- modified nucleotide. In other preferred embodiments, RNA modifications include 2'-fluoro, 2'-amino and 2' O-methyl modifications on the ribose of pyrymidines, abasic residues or an inverted base at the 3' end of the RNA. Such modifications are routinely incorporated into oligonucleotides and these oligonucleotides have been shown to have a higher Tm (i.e., higher target binding affinity) than; 2'-deoxyoligonucleotides against a given target. The effect of such increased affinity is to greatly enhance RNAi oligonucleotide inhibition of gene expression. RNAse H is a cellular endonuclease that cleaves the RNA strand of RNA:DNA duplexes; activation of this enzyme therefore results in cleavage of the RNA target, and thus can greatly enhance the efficiency of RNAi inhibition. Cleavage of the RNA target can be routinely demonstrated by gel electrophoresis. In another preferred embodiment, the chimeric oligonucleotide is also modified to enhance nuclease resistance. Cells contain a variety of exo- and endo-nucleases which can degrade nucleic acids. A number of nucleotide and nucleoside modifications have been shown to make the oligonucleotide into which they are incorporated more resistant to nuclease digestion than the native oligodeoxynucleotide. Nuclease resistance is routinely measured by incubating oligonucleotides with cellular extracts or isolated nuclease solutions and measuring the extent of intact oligonucleotide remaining over time, usually by gel electrophoresis. Oligonucleotides which have been modified to enhance their nuclease resistance survive intact for a longer time than unmodified oligonucleotides. A variety of oligonucleotide modifications have been demonstrated to enhance or confer nuclease resistance. Oligonucleotides which contain at least one phosphorothioate modification are presently more preferred. In some cases, oligonucleotide modifications which enhance target binding affinity are also, independently, able to enhance nuclease resistance. Some desirable modifications can be found in De Mesmaeker et al. Ace. Chem. Res. 1995, 28:366-374. Specific examples of some preferred oligonucleotides envisioned for this invention include those comprising modified backbones, for example, phosphorothioates, phosphotriesters, methyl phosphonates, short chain alkyl or cycloalkyl intersugar linkages or short chain heteroatomic or heterocyclic intersugar linkages. Most preferred are oligonucleotides with phosphorothioate backbones and those with heteroatom backbones, particularly CH2 -NH-O-CH2, CH,~N(CH3)-O-CH2 [known as a methylene(methylimino) or MMI backbone], CH2 -O-N (CH3)-CH2, CH2 -N (CH3)-N (CH3)- CH2 and O— N (CH3)~CH2 -CH2 backbones, wherein the native phosphodiester backbone is represented as O--P--O--CH). The amide backbones disclosed by De Mesmaeker et al. Ace. Chem. Res. 1995, 28:366-374) are also preferred. Also preferred are oligonucleotides having morpholino backbone structures (Summerton and Weller, U.S. Pat. No. 5,034,506). In other preferred embodiments, such as the peptide nucleic acid (PNA) backbone, the phosphodiester backbone of the oligonucleotide is replaced with a polyamide backbone, the nucleobases being bound directly or indirectly to the aza nitrogen atoms of the polyamide backbone (Nielsen et al. Science 1991, 254, 1497). Oligonucleotides may also comprise one or more substituted sugar moieties. Preferred oligonucleotides comprise one of the following at the 21 position: OH, SH, SCH3, F, OCN, OCH3 OCH3, OCH3 O(CH2)n CH3, 0(CH2)n NH2 or O(CH2)n CH3 where n is from 1 to about 10; Ci to Ci0 lower alkyl, alkoxyalkoxy, substituted lower alkyl, alkaryl or aralkyl; Cl; Br; CN; CF3 ; OCF3; O~, S-, or N-alkyl; O-, S-, or N-alkenyl; SOCH3; SO2 CH3; ONO2; NO2; N3; NH2; heterocycloalkyl; heterocycloalkaryl; aminoalkylamino; polyalkylamino; substituted silyl; an RNA cleaving group; a reporter group; an intercalator; a group for improving the pharmacokinetic properties of an oligonucleotide; or a group for improving the pharmacodynamic properties of an oligonucleotide and other substituents having similar properties. A preferred modification includes 2'-methoxyethoxy [2'-0-CH2 CH2 OCH3, also known as 2'-O-(2-methoxyethyl)] (Martin et al., HeIv. Chim. Acta, 1995, 78, 486). Other preferred modifications include 2'- methoxy (2'-0--CH3), 2'-propoxy (2'-OCH2 CH2CH3) and 2'-fluoro (2'-F). Similar modifications may also be made at other positions on the oligonucleotide, particularly the 3' position of the sugar on the 3' terminal nucleotide and the 5' position of 5' terminal nucleotide. Oligonucleotides may also have sugar mimetics such as cyclobutyls in place of the pentofuranosyl group.
Oligonucleotides may also include, additionally or alternatively, nucleobase (often referred to in the art simply as "base") modifications or substitutions. As used herein, "unmodified" or "natural" nucleobases include adenine (A), guanine (G), thymine (T), cytosine (C) and uracil (U). Modified nucleobases include nucleobases found only infrequently or transiently in natural nucleic acids, e.g., hypoxanthine, 6-methyladenine, 5- Me pyrimidines, particularly 5-methylcytosine (also referred to as 5-methyl-2' deoxycytosine and often referred to in the art as 5-Me-C), 5-hydroxymethylcytosine (HMC), glycosyl HMC and gentobiosyl HMC, as well as synthetic nucleobases, e.g., 2-aminoadenine, 2-
(methylamino)adenine, 2-(imidazolylalkyl)adenine, 2-(aminoalklyamino)adenine or other heterosubstituted alkyladenines, 2-thiouracil, 2-thiothymine, 5-bromouracil, 5- hydroxymethyluracil, 8-azaguanine, 7-deazaguanine, N6 (ό-aminohexyl)adenine and 2,6- diaminopurine. Kornberg, A., DNA Replication, W. H. Freeman & Co., San Francisco, 1980, pp75-77; Gebeyehu, G., et al. Nucl. Acids Res. 1987, 15:4513). A "universal" base known in the art, e.g., inosine, may be included. 5-Me-C substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.20C. (Sanghvi, Y. S., in Crooke, S. T. and Lebleu, B., eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278) and are presently preferred base substitutions. Another modification of the oligonucleotides of the invention involves chemically linking to the oligonucleotide one or more moieties or conjugates which enhance the activity or cellular uptake of the oligonucleotide. Such moieties include but are not limited to lipid moieties such as a cholesterol moiety, a cholesteryl moiety (Letsinger et ah, Proc. Natl. Acad. ScL USA 1989, 86, 6553), cholic acid (Manoharan et al. Bioorg. Med. Chem. Let. 1994, 4, 1053), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al. Ann. N. Y. Acad. Sci. 1992, 660, 306; Manoharan et al. Bioorg. Med. Chem. Let. 1993, 3, 2765), a thiocholesterol (Oberhauser et al., Nucl. Acids Res. 1992, 20, 533), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al. £M50 J. 1991, 10, 11 1 ; Kabanov et al. FEBS Lett. 1990, 259, 327; Svinarchuk et al. Biochimie 1993, 75, 49), a phospholipid, e.g., di-hexadecyl-rac- glycerol or triethylammonium l,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al. Tetrahedron Lett. 1995, 36, 3651 ; Shea et al. Nucl. Acids Res. 1990, 18, 3777), a polyamine or a polyethylene glycol chain (Manoharan et al. Nucleosides & Nucleotides 1995, 14, 969), or adamantane acetic acid (Manoharan et al. Tetrahedron Lett. 1995, 36, 3651). Oligonucleotides comprising lipophilic moieties, and methods for preparing such oligonucleotides are known in the art, for example, U.S. Pat. Nos. 5,138,045, 5,218,105 and 5,459,255.
It is not necessary for all positions in a given oligonucleotide to be uniformly modified, and in fact more than one of the aforementioned modifications may be incorporated in a single oligonucleotide or even at within a single nucleoside within an oligonucleotide. The present invention also includes oligonucleotides which are chimeric oligonucleotides as hereinbefore defined.
In another embodiment, the nucleic acid molecule of the present invention is conjugated with another moiety including but not limited to abasic nucleotides, polyether, polyamine, polyamides, peptides, carbohydrates, lipid, or polyhydrocarbon compounds. Those skilled in the art will recognize that these molecules can be linked to one or more of any nucleotides comprising the nucleic acid molecule at several positions on the sugar, base or phosphate group. The oligonucleotides used in accordance with this invention may be conveniently and routinely made through the well-known technique of solid phase synthesis. Equipment for such synthesis is sold by several vendors including Applied Biosystems. Any other means for such synthesis may also be employed; the actual synthesis of the oligonucleotides is well within the talents of one of ordinary skill in the art. It is also well known to use similar techniques to prepare other oligonucleotides such as the phosphorothioates and alkylated derivatives. It is also well known to use similar techniques and commercially available modified amidites and controlled-pore glass (CPG) products such as biotin, fluorescein, acridine or psoralen-modified amidites and/or CPG (available from Glen Research, Sterling VA) to synthesize fluorescently labeled, biotinylated or other modified oligonucleotides such as cholesterol-modified oligonucleotides.
In accordance with the invention, use of modifications such as the use of LNA monomers to enhance the potency, specificity and duration of action and broaden the routes of administration of oligonucleotides comprised of current chemistries such as MOE, ANA, FANA, PS etc (ref: Recent advances in the medical chemistry of antisense oligonucleotide by Uhlman, Current Opinions in Drug Discovery & Development 2000 VoI 3 No 2). This can be achieved by substituting some of the monomers in the current oligonucleotides by LNA monomers. The LNA modified oligonucleotide may have a size similar to the parent compound or may be larger or preferably smaller. It is preferred that such LNA-modified oligonucleotides contain less than about 70%, more preferably less than about 60%, most preferably less than about 50% LNA monomers and that their sizes are between about 10 and 25 nucleotides, more preferably between about 12 and 20 nucleotides.
Anyone of SEQ ID NOS: 1-8 and 10-12 can be used in a PCR or any other suitable assay, for identification and diagnosis of the disease and identification of carriers for screening patients at risk. Thus, for example, any nucleic acid, in purified or non-purified form, can be utilized as the starting material from a cohort or individual. However, if the sample lacks the selected sequence, the process would not amplify any sequence. Thus, the process may employ, for example, DNA or RNA, including messenger RNA, which DNA or RNA may be single stranded or double stranded. In addition, a DNA-RNA hybrid which contains one strand of each may be utilized. A mixture of any of these nucleic acids may also be employed, or the nucleic acids produced from a previous amplification reaction herein using the same or different primers may be so utilized. The selected nucleic acid sequence to be amplified may be only a fraction of a larger molecule, or it may be present initially as a discrete molecule where the selected sequence constitutes the entire nucleic acid.
The selected sequence need not be purified; it may be a minor fraction of a complex mixture, such as a portion of the FMR4 gene contained in human genomic DNA. The starting nucleic acid may contain two or more selected nucleic acid sequences, which may be the same or different. Therefore, the process is useful not only for producing large amounts of one specific nucleic acid sequence, but also for amplifying simultaneously two or more selected nucleic acid sequences located on the same or different nucleic acid molecules.
The nucleic acid or acids may be obtained from any source, for example, from plasmids, from cloned DNA or RNA, or from natural DNA or RNA from any source, including bacteria, yeast, viruses, organelles, and higher organisms such as plants or animals. DNA or RNA may be extracted from any nucleic acid containing sample such as blood, tissue material such as chorionic villi or amniotic cells by a variety of techniques such as that described by Maniatis et ai, Molecular Cloning: A Laboratory Manual (1982), 280-281.
For the process using sequence-specific probes to detect the amplified material, the cells may be directly used without purification of the nucleic acid. For example, a cellular sample can be suspended in hypotonic buffer and heated to about 90-1000C, until cell lysis and dispersion of intracellular components occurs. Such a process generally takes from about 1 to 15 minutes. After the heating step, the amplification reagents may be added directly to the lysed cells. Antibodies and Aptamers: Antibodies that specifically bind to FMR4 are provided. Such antibodies may be used in methods of isolating pure FMR4 and in methods of identifying individuals who have fragile X syndrome and fragile X tremor ataxia syndrome. That is, by identifying individuals whose tissue shows an absence or deficiency in FMR4 as compared to a normal subject, a diagnosis of fragile X syndrome and fragile X tremor ataxia syndrome is indicated.
As used herein, the term "aptamer" or "selected nucleic acid binding species" shall include non-modified or chemically modified RNA or DNA. The method of selection may be by, but is not limited to, affinity chromatography and the method of amplification by reverse transcription (RT) or polymerase chain reaction (PCR).
As used herein, the term "antibody" is meant to refer to complete, intact antibodies, and Fab fragments and F(ab)2 fragments thereof. Complete, intact antibodies include monoclonal antibodies such as murine monoclonal antibodies, chimeric antibodies and humanized antibodies. Antibodies that bind to an epitope which is present on FMR4 are useful to isolate and purify the FMR4 from both natural sources and recombinant expression systems using well known techniques such as affinity chromatography. Such antibodies are useful to detect the presence of such protein in a sample and to determine if cells are expressing the protein.
The production of antibodies and the protein structures of complete, intact antibodies, Fab fragments and F(ab)2 fragments and the organization of the genetic sequences that encode such molecules are well known and are described, for example, in Harlow, E. and D. Lane (1988) Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., which is incorporated herein by reference. Briefly, for example, FMR4 or an immunogenic fragment thereof, is injected into mice. The spleen of the mouse is removed; the spleen cells are isolated and fused with immortalized mouse cells. The hybrid cells, or hybridomas, are cultured and those cells which secrete antibodies are selected. The antibodies are analyzed and, if found to specifically bind to protein, the hybridoma which produces them is cultured to produce a continuous supply of antibodies.
Vectors: Using standard techniques and readily available starting materials, nucleic acid molecules that encode FMR4 may each be isolated from a cDNA library, using probes which are designed based upon the nucleotide sequence information disclosed in SEQ ID NO: 9.
The present invention relates to an isolated nucleic acid molecule that comprises a nucleotide sequence that encodes FMR4. The isolated nucleic acid molecules of the invention are useful to prepare constructs and recombinant expression systems for preparing FMR4. A cDNA library may be generated by well known techniques. A cDNA clone which contains one of the nucleotide sequences set out is identified using probes that comprise at least a portion of the nucleotide sequence disclosed in SEQ ID NO: 9. The probes generally have at least 16 nucleotides, preferably 24 nucleotides. The probes are used to screen the cDNA library using standard hybridization techniques. Alternatively, genomic clones may be isolated using genomic DNA from any human cell as a starting material. The present invention relates to isolated nucleic acid molecules that comprise a nucleotide sequence identical or complementary to a fragment of SEQ ID NO: 9 which is at least 10 nucleotides. In some embodiments, the isolated nucleic acid molecules comprise or consist of a nucleotide sequence identical or complementary to a fragment of SEQ ID NO: 9 which is 15-150 nucleotides. In some embodiments, the isolated nucleic acid molecules comprise or consist of a nucleotide sequence identical or complementary to a fragment of SEQ ID NO: 9 which is 15-30 nucleotides.
The cDNA that encodes FMR4 may be used as a molecular marker in electrophoresis assays in which cDNA from a sample is separated on an electrophoresis gel and probes are used to identify bands which hybridize to such probes. For example, anyone of SEQ ID NOS: 1-12 or portions thereof, may be used as a molecular marker in electrophoresis assays in which cDNA from a sample is separated on an electrophoresis gel and specific probes are used to identify bands which hybridize to them, indicating that the band has a nucleotide sequence complementary to the sequence of the probes. The isolated nucleic acid molecule provided as a size marker will show up as a positive band which is known to hybridize to the probes and thus can be used as a reference point to the size of cDNA that encodes FMR4. Electrophoresis gels useful in such an assay include standard polyacrylamide gels as described in Sambrook et al., Molecular Cloning a Laboratory Manual, (1989) Second Ed., Cold Spring Harbor Press, New York, which is incorporated herein by reference.
The present invention also includes labeled oligonucleotides which are useful as probes for performing oligonucleotide hybridization methods to identify FMR4 between individuals. Accordingly, the present invention includes probes that can be labeled and hybridized to unique nucleotide sequences that encode FMR4. For example, the nucleic acids of SEQ ID NOS: 1-12, and/or SEQ ID NOS: 1-4, 7-8, and 10-12 or combinations thereof, can be used as probes to identify FMR4. The probes are labeled with radiolabeled nucleotides or are otherwise detectable by readily available nonradioactive detection systems. In some preferred embodiments, probes comprise oligonucleotides consisting of between 10 and 100 nucleotides. In some preferred, probes comprise oligonucleotides consisting of between 10 and 50 nucleotides. In some preferred, probes comprise oligonucleotides consisting of between 12 and 20 nucleotides. The probes preferably contain nucleotide sequence completely identical or complementary to a fragment of a unique nucleotide sequence of FMR4.
One having ordinary skill in the art can isolate the nucleic acid molecule that encodes FMR4 and insert it into an expression vector using standard techniques and readily available starting materials.
In a preferred embodiment, a recombinant expression vector comprises a nucleotide sequence that encodes FMR4 that comprises the sequence of SEQ ID NO: 9. As used herein, the term "recombinant expression vector" is meant to refer to a plasmid, phage, viral particle or other vector which, when introduced into an appropriate host, contains the necessary genetic elements to direct expression of the coding sequence that encodes FMR4. The coding sequence is operably linked to the necessary regulatory sequences. Expression vectors are well known and readily available. Examples of expression vectors include plasmids, phages, viral vectors and other nucleic acid molecules or nucleic acid molecule containing vehicles useful to transform host cells and facilitate expression of coding sequences. The recombinant expression vectors of the invention are useful for transforming hosts to prepare recombinant expression systems for preparing FMR4 or for use in therapy. In another preferred embodiment, a host cell comprises a recombinant expression vector that includes a nucleotide sequence that encodes FMR4, such as for example, SEQ ID NO: 9. Host cells for use in well known recombinant expression systems for production of proteins are well known and readily available. Examples of host cells include bacteria cells such as E. coli, yeast cells such as S. cerevisiae, insect cells such as S. frugiperda, non-human mammalian tissue culture cells Chinese hamster ovary (CHO) cells and human tissue culture cells such as HeLa cells.
One having ordinary skill in the art may use other commercially available expression vectors and systems or produce vectors using well known methods and readily available starting materials. Expression systems containing the requisite control sequences, such as promoters and polyadenylation signals, and preferably enhancers, are readily available and known in the art for a variety of hosts. See e.g., Sambrook et al., Molecular Cloning a Laboratory Manual, Second Ed., Cold Spring Harbor Press, New York (1989). A wide variety of eukaryotic hosts are also now available for production of recombinant foreign proteins. As in bacteria, eukaryotic hosts may be transformed with expression systems which produce the desired protein directly, but more commonly signal sequences are provided to effect the secretion of the protein. Eukaryotic systems have the additional advantage that they are able to process introns which may occur in the genomic sequences encoding proteins of higher organisms. Eukaryotic systems also provide a variety of processing mechanisms which result in, for example, glycosylation, carboxy-terminal amidation, oxidation or derivatization of certain amino acid residues, conformational control, and so forth. Commonly used eukaryotic systems include, but is not limited to, yeast, fungal cells, insect cells, mammalian cells, avian cells, and cells of higher plants. Suitable promoters are available which are compatible and operable for use in each of these host types as well as are termination sequences and enhancers, e.g. the baculovirus polyhedron promoter. As above, promoters can be either constitutive or inducible. For example, in mammalian systems, the mouse metallothionein promoter can be induced by the addition of heavy metal ions.
The particulars for the construction of expression systems suitable for desired hosts are known to those in the art. Briefly, for recombinant production of the protein, the DNA encoding the polypeptide is suitably ligated into the expression vector of choice. The DNA is operably linked to all regulatory elements which are necessary for expression of the DNA in the selected host. One having ordinary skill in the art can, using well known techniques, can prepare expression vectors for recombinant production of the polypeptide.
The expression vector including the DNA that encodes FMR4 is used to transform the compatible host which is then cultured and maintained under conditions wherein expression of the foreign DNA takes place. The protein of the present invention thus produced is recovered from the culture, either by lysing the cells or from the culture medium as appropriate and known to those in the art. One having ordinary skill in the art can, using well known techniques, isolate FMR4 that is produced using such expression systems. The methods of purifying FMR4 from natural sources using antibodies which specifically bind to FMR4, fragments, mutants, variants etc, as described above, may be equally applied to purifying FMR4 produced by recombinant DNA methodology.
Examples of genetic constructs include the FMR4 coding sequence operably linked to a promoter that is functional in the cell line into which the constructs are transfected. Examples of constitutive promoters include promoters from cytomegalovirus or SV40. Examples of inducible promoters include mouse mammary leukemia virus or metallothionein promoters. Those having ordinary skill in the art can readily produce genetic constructs useful for transfecting with cells with DNA that encodes FMR4 from readily available starting materials.
Treatment
Treatment is an intervention performed with the intention of preventing the development or altering the pathology or symptoms of a disorder. Accordingly, treatment refers to both therapeutic treatment and prophylactic or preventative measures. Treatment may also be specified as palliative care. Those in need of treatment include those already with the disorder as well as those in which the disorder is to be prevented.
In a preferred embodiment, the compositions of the invention are administered to patients for the treatment of fragile X syndrome and fragile X tremor ataxia syndrome (FXTAS). FMR4 is elevated in both fragile X syndrome and fragile X tremor ataxia syndrome (FXTAS) as shown in the examples which follow.
In one embodiment, the compositions are administered as a replacement therapy, such as for example, in fragile X syndrome. Peptides encoded by SEQ ID NO: 9 can be administered to a patient, for example, in the form of a peptide in a pharmaceutical compositions, as a vector expressing SEQ ID NO: 9, and the like. In another embodiment, FMR4 expression can be disrupted, modulated, increased, decreased, silenced by antibodies specific to FMR4, siRNA, antisense oligonucleotides, small molecule inhibition of FMR4 peptides and the like. Preferably, in the case of fragile X tremor ataxia syndrome (FXTAS), FMR4 expression is disrupted or modulated to decrease the levels to those levels found in normal individuals, e.g. non carriers. The disruption of a desired target nucleic acid can be carried out in several ways known in the art. For example, siRNA. Enzymatic nucleic acid molecules (e.g., ribozymes) are nucleic acid molecules capable of catalyzing one or more of a variety of reactions, including the ability to repeatedly cleave other separate nucleic acid molecules in a nucleotide base sequence-specific manner. Such enzymatic nucleic acid molecules can be used, for example, to target virtually any RNA transcript (Zaug et al., 324, Nature 429 1986; Cech, 260 JAMA 3030, 1988; and Jefferies et al., 17 Nucleic Acids Research 1371 , 1989).
Because of their sequence-specificity, trans-cleaving enzymatic nucleic acid molecules show promise as therapeutic agents for human disease (Usman & McSwiggen, 1995 Ann. Rep. Med. Chem. 30, 285-294; Christoffersen and Marr, 1995 J. Med. Chem. 38, 2023-2037). Enzymatic nucleic acid molecules can be designed to cleave specific RNA targets within the background of cellular RNA. Such a cleavage event renders the mRNA non-functional and abrogates protein expression from that RNA. In this manner, synthesis of a protein associated with a disease state can be selectively inhibited.
In general, enzymatic nucleic acids with RNA cleaving activity act by first binding to a target RNA. Such binding occurs through the target binding portion of a enzymatic nucleic acid which is held in close proximity to an enzymatic portion of the molecule that acts to cleave the target RNA. Thus, the enzymatic nucleic acid first recognizes and then binds a target RNA through complementary base pairing, and once bound to the correct site, acts enzymatically to cut the target RNA. Strategic cleavage of such a target RNA will destroy its ability to direct synthesis of an encoded protein. After an enzymatic nucleic acid has bound and cleaved its RNA target, it is released from that RNA to search for another target and can repeatedly bind and cleave new targets. Several approaches such as in vitro selection (evolution) strategies (Orgel, 1979, Proc. R.
Soc. London, B 205, 435) have been used to evolve new nucleic acid catalysts capable of catalyzing a variety of reactions, such as cleavage and ligation of phosphodiester linkages and amide linkages, (Joyce, 1989, Gene, 82, 83-87; Beaudry et al., 1992, Science 257, 635-641 ; Joyce, 1992, Scientific American 267, 90-97; Breaker et al., 1994, TIBTECH 12, 268; Bartel et al, 1993, Science 261 :1411-1418; Szostak, 1993, TIBS 17, 89-93; Kumar et al., 1995, FASEB J., 9, 1 183; Breaker, 1996, Curr. Op. Biotech., 1, 442).
The development of ribozymes that are optimal for catalytic activity would contribute significantly to any strategy that employs RNA-cleaving ribozymes for the purpose of regulating gene expression. The hammerhead ribozyme, for example, functions with a catalytic rate (kcat) of about 1 min"1 in the presence of saturating (10 mM) concentrations of Mg + cofactor. An artificial "RNA ligase" ribozyme has been shown to catalyze the corresponding self-modification reaction with a rate of about 100 min"1. In addition, it is known that certain modified hammerhead ribozymes that have substrate binding arms made of DNA catalyze RNA cleavage with multiple turn-over rates that approach 100 min'1. Finally, replacement of a specific residue within the catalytic core of the hammerhead with certain nucleotide analogues gives modified ribozymes that show as much as a 10-fold improvement in catalytic rate. These findings demonstrate that ribozymes can promote chemical transformations with catalytic rates that are significantly greater than those displayed in vitro by most natural self-cleaving ribozymes. It is then possible that the structures of certain self-cleaving ribozymes may be optimized to give maximal catalytic activity, or that entirely new RNA motifs can be made that display significantly faster rates for RNA phosphodiester cleavage. Intermolecular cleavage of an RNA substrate by an RNA catalyst that fits the
"hammerhead" model was first shown in 1987 (Uhlenbeck, O. C. (1987) Nature, 328: 596- 600). The RNA catalyst was recovered and reacted with multiple RNA molecules, demonstrating that it was truly catalytic.
Catalytic RNAs designed based on the "hammerhead" motif have been used to cleave specific target sequences by making appropriate base changes in the catalytic RNA to maintain necessary base pairing with the target sequences (Haseloff and Gerlach, Nature, 334, 585 (1988); Walbot and Bruening, Nature, 334, 196 (1988); Uhlenbeck, O. C. (1987) Nature, 328: 596-600; Koizumi, M., Iwai, S. and Ohtsuka, E. (1988) FEBS Lett., 228: 228- 230). This has allowed use of the catalytic RNA to cleave specific target sequences and indicates that catalytic RNAs designed according to the "hammerhead" model may possibly cleave specific substrate RNAs in vivo, (see Haseloff and Gerlach, Nature, 334, 585 (1988); Walbot and Bruening, Nature, 334, 196 (1988); Uhlenbeck, O. C. (1987) Nature, 328: 596- 600).
RNA interference (RNAi) has become a powerful tool for blocking gene expression in mammals and mammalian cells. This approach requires the delivery of small interfering
RNA (siRNA) either as RNA itself or as DNA, using an expression plasmid or virus and the coding sequence for small hairpin RNAs that are processed to siRNAs. This system enables efficient transport of the pre-siRNAs to the cytoplasm where they are active and permit the use of regulated and tissue specific promoters for gene expression. Peptides/Polypeptides: In some embodiments, the peptides used in treatment include peptides encoded by SEQ ID NOS: 1-12, mutants, fragments, and variants thereof. Preferably, the peptides are encoded by SEQ ID NO: 9, mutants, fragments and variants thereof.
In some embodiments, the compositions comprise a polypeptide that is at least about 85% identical to the amino acid sequence of FMR4. In some embodiments, the polypeptide is at least about 90%, 95%, 99%, or 100% identical to the full length sequence of FMR4, mutants, fragments and variants fragment thereof. In some embodiments, the peptide is at least about 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 39, 40, 45, 50, 55, 60, 65, 70, 75, 80 or more amino acids long. A "polypeptide comprising a fragment of FMR4 or the peptide encoded by SEQ ID NO: 9" includes less than the full length of each, but can include other (i.e., non- FMR4 proteins or fragments thereof, e.g., fluorescent proteins such as green fluorescent protein (GFP), red fluorescent protein (RFP), blue fluorescent protein (BFP) or yellow fluorescent protein (YFP), or peptides that enhance delivery, e.g., a TAT protein transduction domain (PTD).
The term "isolated polypeptide" used here in means a polypeptide that is substantially pure and free from other biological macromolecules. The substantially pure polypeptide is at least 75% (e.g., at least 80, 85, 95, or 99%) pure by dry weight. Purity can be measured by any appropriate standard method, for example by column chromatography, polyacrylamide gel electrophoresis, or HPLC analysis.
The polypeptides of the present invention includes variants of peptides encoded by SEQ ID NO: 9 as long as the variants are at least 50% identical to peptides encoded by SEQ ID NO: 9. The variants may be a polypeptide comprising the amino acid sequence of peptides encoded by SEQ ID NO: 9 in which one or more amino acids have been substituted, deleted, added, and/or inserted. The variants may also be a polypeptide encoded by a nucleic acid comprising a strand that hybridizes under high stringent conditions to a nucleotide sequence consisting of SEQ ID NO: 9.
Polypeptides having amino acid sequences modified by deleting, adding and/or replacing one or more amino acid residues of a certain amino acid sequence, have been known to retain the original biological activity (Mark, D. F. et al., Proc. Natl. Acad. Sci. USA (1984) 81, 5662-5666, Zoller, M. J. & Smith, M., Nucleic Acids Research (1982) 10, 6487-6500, Wang, A. et al., Science 224, 1431-1433, Dalbadie-McFarland, G. et al., Proc. Natl. Acad. Sci. USA (1982) 79, 6409-6413). The number of amino acids that are mutated by substitution, deletion, addition, and/or insertion is not particularly restricted. Normally, it is 20% or less, preferably 15% or less, and more preferably 10% or less of the total amino acid residues.
As for the amino acid residue to be mutated, it is preferable to be mutated into a different amino acid in which the properties of the amino acid side-chain are conserved. Examples of properties of amino acid side chains are, hydrophobic amino acids (A, I, L, M, F, P, W, Y, V), hydrophilic amino acids (R, D, N, C, E, Q, G, H, K, S, T), and amino acids comprising the following side chains: an aliphatic side-chain (G, A, V, L, I, P); a hydroxyl group containing side-chain (S, T, Y); a sulfur atom containing side-chain (C, M); a carboxylic acid and amide containing side-chain (D, N, E, Q); abase containing side-chain (R, K, H); and an aromatic containing side-chain (H, F, Y, W) (The parenthetic letters indicate the one-letter codes of amino acids). A "conservative amino acid substitution" is a replacement of one amino acid belonging to one of the above groups with another amino acid in the same group. A deletion variant includes a fragment of the amino acid sequence encoded by SEQ ID
NO: 9. The fragment is a polypeptide having an amino acid sequence which is partly, but not entirely, identical to the above polypeptides of this invention. The polypeptide fragments of this invention usually consist of 8 amino acid residues or more, and preferably 12 amino acid residues or more (for example, 15 amino acid residues or more). Examples of preferred fragments include truncation polypeptides, having amino acid sequences lacking a series of amino acid residues including either the amino terminus or carboxyl terminus, or two series of amino acid residues, one including the amino terminus and the other including the carboxyl terminus. Furthermore, fragments featured by structural or functional characteristics are also preferable, which include those having α-helix and α-helix forming regions, β-sheet and β-sheet forming regions, turn and turn forming regions, coil and coil forming regions, hydrophilic regions, hydrophobic regions, α-amphipathic regions, β- amphipathic regions, variable regions, surface forming regions, substrate-binding regions, and high antigenicity index region. Biologically active fragments are also preferred. Biologically active fragments mediate the activities of the polypeptides of this invention, which fragments include those having similar or improved activities, or reduced undesirable activities. For example, fragments having the activity to transduce signals into cells via binding of a ligand, and furthermore, fragments having antigenicity or immunogenicity in animals, especially humans are included. These polypeptide fragments preferably retain the antigenicity of the polypeptides of this invention. Further, an addition variant includes a fusion protein of the polypeptide of the present invention and another peptide or polypeptide. Fusion proteins can be made by techniques well known to a person skilled in the art, such as by linking the DNA encoding the polypeptide of the invention with DNA encoding other peptides or polypeptides, so as the frames match, inserting this into an expression vector and expressing it in a host. There is no restriction as to the peptides or polypeptides fused to the polypeptide of the present invention.
Known peptides, for example, FLAG (Hopp, T. P. et al., Biotechnology (1988) 6, 1204- 1210), 6X His containing six His (histidine) residues, 1OX His, Influenza agglutinin (HA), human c-myc fragment, VSP-GP fragment, pi 8HIV fragment, T7-tag, HSV-tag, E-tag, SV40T antigen fragment, lck tag, α-tubulin fragment, B-tag, Protein C fragment, fluorescent proteins such as green fluorescent protein (GFP), red fluorescent protein (RFP), blue fluorescent protein (BFP) or yellow fluorescent protein (YFP), or peptides that enhance delivery, e.g., a TAT protein transduction domain (PTD) and such, can be used as peptides that are fused to the polypeptide of the present invention.
Fusion proteins can be prepared by fusing commercially available DNA encoding these peptides or polypeptides with the DNA encoding the polypeptide of the present invention and expressing the fused DNA prepared.
The variant polypeptide is preferably at least 65% identical to the amino acid sequence encoded by SEQ ID NO: 9. More specifically, the modified polypeptide is at least 65%,
70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more, identical to the amino acid sequence encoded by SEQ ID NO: 9. In the case of a modified polypeptide which is longer than or equivalent in length to the reference sequence, e.g., the amino acid sequence encoded by SEQ ID NO: 9, the comparison is made with the full length of the reference sequence. Where the modified polypeptide is shorter than the reference sequence, e.g., the amino acid sequence encoded by SEQ ID NO: 9, the comparison is made to segment of the reference sequence of the same length. Variant polypeptides are also inclusive of SEQ ID NOS: 1-12 and products thereof.
As used herein, "percent identity" of two amino acid sequences is determined in the same manner as described above for the nucleic acids.
The polypeptide of the present invention can be prepared by methods known to one skilled in the art, as a natural polypeptide or a recombinant polypeptide made using genetic engineering techniques as described above. For example, a natural polypeptide can be obtained by preparing a column coupled with an antibody obtained by immunizing a small animal with the recombinant polypeptide, and performing affinity chromatography for extracts of liver tissues or cells expressing high levels of the polypeptide of the present invention. A recombinant polypeptide can be prepared by inserting DNA encoding the polypeptide of the present invention (for example, DNA comprising the nucleotide sequence of SEQ ID NO: 9) into a suitable expression vector, introducing the vector into a host cell, allowing the resulting transformant to express the polypeptide, and recovering the expressed polypeptide.
The variant polypeptide can be prepared, for example, by inserting a mutation into the amino acid sequence encoded by SEQ ID NO: 9 by a known method such as the PCR- mediated, site-directed-mutation-induction system (GIBCO-BRL, Gaithersburg, Md.), oligonucleotide-mediated, sight-directed-mutagenesis (Kramer, W. and Fritz, H J (1987) Methods in Enzymol. 154:350-367).
Methods of Formulation: The compounds described herein can be incorporated into pharmaceutical compositions. Such compositions typically include the active ingredient and a pharmaceutically acceptable carrier. As used herein the language "pharmaceutically acceptable carrier" includes saline, solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. Supplementary active compounds can also be incorporated into the compositions.
A pharmaceutical composition is formulated to be compatible with its intended route of administration. Examples of routes of administration include parenteral, e.g., intravenous, intradermal, subcutaneous, oral (e.g., inhalation), transdermal (topical), transmucosal, and rectal administration. Solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose. pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. The parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.
Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor™ (BASF, Parsippany, N.J.) or phosphate buffered saline (PBS). In all cases, the composition must be sterile and should be fluid to the extent that easy syringability exists. It should be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyetheylene glycol, and the like), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin. Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle, which contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and freeze-drying which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
Oral compositions generally include an inert diluent or an edible carrier. For the purpose of oral therapeutic administration, the active compound can be incorporated with excipients and used in the form of tablets, troches, or capsules, e.g., gelatin capsules. Oral compositions can also be prepared using a fluid carrier for use as a mouthwash. Pharmaceutically compatible binding agents, and/or adjuvant materials can be included as part of the composition. The tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or corn starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring. For administration by inhalation, the compounds can be delivered in the form of an aerosol spray from pressured container or dispenser which contains a suitable propellant, e.g., a gas such as carbon dioxide, or a nebulizer. Such methods include those described in U.S. Pat. No. 6,468,798. Compositions for inhalation can also include propellants, surfactants, and other additives, e.g., to improve dispersion, flow, and bioavailability.
Systemic administration can also be by transmucosal or transdermal means. For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art, and include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives. Transmucosal administration can be accomplished through the use of nasal sprays or suppositories. For transdermal administration, the active compounds are formulated into ointments, salves, gels, or creams as generally known in the art. Compounds comprising nucleic acids e.g. SEQ ID NOS: 1-12, preferably SEQ ID NO: 9, mutants, fragments and variants thereof, can also be administered by transfection or infection using methods known in the art, including but not limited to the methods described in McCaffrey et al. (2002), Nature, 418(6893), 38-9 (hydrodynamic transfection); Xia et al. (2002), Nature Biotechnol, 20(10), 1006-10 (viral-mediated delivery); or Putnam (1996), Am. J. Health Syst. Pharm., 53(2), 151-160, erratum at Am. J. Health Syst. Pharm., 53(3), 325 (1996). Compounds comprising nucleic acids can also be administered by method suitable for administration of DNA vaccines. These methods include gene guns, bio injectors, and skin patches as well as needle-free methods such as the micro-particle DNA vaccine technology disclosed in U.S. Pat. No. 6,194,389, and the mammalian transdermal needle-free vaccination with powder-form vaccine as disclosed in U.S. Pat. No. 6,168,587. Additionally, intranasal delivery is possible, as described in, inter alia, Hamajima et al. (1998), Clin. Immunol. Immunopathol., 88(2), 205-10. Liposomes (e.g., as described in U.S. Pat. No. 6,472,375) and microencapsulation can also be used. Biodegradable targetable microparticle delivery systems can also be used (e.g., as described in U.S. Pat. No. 6,471,996).
In one embodiment, the compounds are prepared with carriers that will protect the active ingredient against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Such formulations can be prepared using standard techniques. The materials can also be obtained commercially from Alza Corporation and Nova Pharmaceuticals, Inc. Liposomal suspensions (including liposomes targeted to infected cells with monoclonal antibodies to viral antigens) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Pat. No. 4,522,811.
In some embodiments, the compounds (e.g., polypeptides) are modified to enhance delivery into cells, e.g., by the addition of an optimized or native TAT protein transduction domain (PTD), e.g., as described in Ho et al, Cancer Res. 61(2):474-7 (2001). Where the compound is a polypeptide, the polypeptide can be a fusion protein comprising an active portion (e.g., an active fragment of Apoptin) and a TAT PTD fused in frame.
The pharmaceutical compositions can be included in a container, pack, or dispenser together with instructions for administration. Methods of Treatment: As used herein, the term "treatment" is defined as the application or administration of a therapeutic agent described herein, or identified by a method described herein, to a patient, or application or administration of the therapeutic agent to an isolated tissue or cell line from a patient, who has a disease, a symptom of disease or a predisposition toward a disease, with the purpose to cure, heal, alleviate, relieve, alter, remedy, ameliorate, improve or affect the disease, the symptoms of disease, or the predisposition toward disease.
Examples of routes of administration include parenteral, e.g., intravenous, intradermal, subcutaneous, oral (e.g., inhalation), transdermal (topical), transmucosal, and rectal administration.
Therapeutic agents include, for example, proteins, nucleic acids, small molecules, peptides, antibodies, siRNAs, ribozymes, and antisense oligonucleotides. Dosage, toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50/ED50. Compounds that exhibit high therapeutic indices are preferred. While compounds that exhibit toxic side effects may be used, care should be taken to design a delivery system that targets such compounds to the site of affected tissue in order to minimize potential damage to uninfected cells and, thereby, reduce side effects. The data obtained from the cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. The dosage of such compounds lies preferably within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. For any compound used in the method of the invention, the therapeutically effective dose can be estimated initially from cell culture assays. A dose may be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 (i.e., the concentration of the test compound which achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma may be measured, for example, by high performance liquid chromatography.
As defined herein, a therapeutically effective amount of a compound (i.e., an effective dosage) means an amount sufficient to produce a therapeutically (e.g., clinically) desirable result. The compositions can be administered one from one or more times per day to one or more times per week; including once every other day. The skilled artisan will appreciate that certain factors can influence the dosage and timing required to effectively treat a subject, including but not limited to the severity of the disease or disorder, previous treatments, the general health and/or age of the subject, and other diseases present. Moreover, treatment of a subject with a therapeutically effective amount of the compounds of the invention can include a single treatment or a series of treatments.
Diagnostics
In a preferred embodiment, the invention provides for diagnosis of fragile X syndrome and fragile X tremor ataxia syndrome. The FMR4 is upregulated in permutation carriers and become silenced in fragile X patients. Bioinformatics analysis shows that the genomic sequence for FMR4 is present in primates but not in other species. Northern blot analyses in ten different human tissues show that FMR4 mRNA is present in the brain, liver, placenta, small intestine, colon, and spleen but not in the testes, ovary or prostate. In a preferred embodiment, oligonucleotides comprising SEQ ID NOS: 1-12 are used in a variety of diagnostic assays. For example, the sequences can be radiolabeled to identify hybridization, used of the primers in PCR, generation of peptides, aptamers and antibodies directed to the desired sequences, etc.
In one embodiment, a method of diagnosing fragile X syndrome and fragile X tremor ataxia syndrome comprises obtaining a biological sample from a patient; identifying SEQ ID NO: 9 or a portion thereof; detecting the presence, absence or variation in concentration of a peptide encoded by SEQ ID NO: 9 mutants, variants, alleles, complementary sequence and fragments thereof; comparing the concentrations of the peptide between a normal individual, a permutation carrier and the patient.
In another preferred embodiment, a method of diagnosing fragile X syndrome and fragile X tremor ataxia syndrome comprises obtaining a biological sample from a patient identifying SEQ ID NO: 9 or a portion thereof; detecting the presence, absence or variation in concentration of a peptide encoded by SEQ ID NO: 9 mutants, variants, alleles, complementary sequence and fragments thereof; comprising antibodies specific to these peptides.
"Biological samples" include solid and body fluid samples. The biological samples used in the present invention can include cells, protein or membrane extracts of cells, blood or biological fluids such as ascites fluid or brain fluid (e.g., cerebrospinal fluid). Examples of solid biological samples include, but are not limited to, samples taken from tissues of the central nervous system, bone, breast, kidney, cervix, endometrium, head/neck, gallbladder, parotid gland, prostate, pituitary gland, muscle, esophagus, stomach, small intestine, colon, liver, spleen, pancreas, thyroid, heart, lung, bladder, adipose, lymph node, uterus, ovary, adrenal gland, testes, tonsils and thymus. Examples of "body fluid samples" include, but are not limited to blood, serum, semen, prostate fluid, seminal fluid, urine, saliva, sputum, mucus, bone marrow, lymph, and tears.
"Sample" is used herein in its broadest sense. A sample comprising polynucleotides, polypeptides, peptides, antibodies and the like may comprise a bodily fluid; a soluble fraction of a cell preparation, or media in which cells were grown; a chromosome, an organelle, or membrane isolated or extracted from a cell; genomic DNA, RNA, or cDNA, polypeptides, or peptides in solution or bound to a substrate; a cell; a tissue; a tissue print; a fingerprint, skin or hair; and the like. In another preferred embodiment, a method of diagnosing fragile X syndrome and fragile
X tremor ataxia syndrome comprises detecting GC-rich region of the FMR4 gene in normals, carriers and afflicted individuals. These can be detected by PCR methods, e.g. real-time PCR, cloning etc.
In another preferred embodiment, the patient or individual is a mammal. This includes humans of any age. For example, an embryo, neonate, infant, child, teenager or adult.
In another preferred embodiment, an FMR4 peptide or nucleic acid is identified by an antibody or aptamer. In another preferred embodiment, a kit comprises primers of SEQ ID NOS: 1-8 and 10- 12; thermostable polymerase, and A, G, C, T nucleotides.
In another preferred embodiment, a kit comprises SEQ ID NO: 9, peptides thereof, or antibodies specific for SEQ ID NO: 9 or peptide thereof. In some instances, such as when unusually small amounts of RNA are recovered and only small amounts of cDNA are generated therefrom, it is desirable or necessary to perform a PCR reaction on the first PCR reaction product. That is, if difficult to detect quantities of amplified DNA are produced by the first reaction, a second PCR can be performed to make multiple copies of DNA sequences of the first amplified DNA. A nested set of primers are used in the second PCR reaction. The nested set of primers hybridize to sequences downstream of the 5' primer and upstream of the 3' primer used in the first reaction. The present invention includes oligonucleotide which are useful as primers for performing PCR methods to amplify mRNA or cDNA that encodes FMR4 protein, for example, SEQ ID NOS: 1-8 and 10-12. According to the invention, diagnostic kits can be assembled which is useful to practice methods of detecting the presence of mRNA or cDNA that encodes FMR4 in tissue samples. Such diagnostic kits comprise oligonucleotides which are useful as primers for performing PCR methods. It is preferred that diagnostic kits according to the present invention comprise a container comprising a size marker to be run as a standard on a gel used to detect the presence of amplified DNA. The size marker is the same size as the DNA generated by the primers in the presence of the mRNA or cDNA encoding FMR4.
In another preferred embodiment, a kit comprises reagents for identifying and measuring the levels of FMR4 in FXS and FXTAS using real-time PCR (RT-PCR). The kit can include one or more of SEQ ID NOS: 1-12. Another method of determining whether a sample contains cells expressing FMR4 is by
Northern blot analysis of mRNA extracted from a tissue sample. The techniques for performing Northern blot analyses are well known by those having ordinary skill in the art and are described in Sambrook, J. et al., Molecular Cloning: A Laboratory Manual, (1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y. mRNA extraction, electrophoretic separation of the mRNA, blotting, probe preparation and hybridization are all well known techniques that can be routinely performed using readily available starting material. One having ordinary skill in the art, performing routine techniques, could design probes to identify mRNA encoding FMR4 using the information in SEQ ID NO: 9. The mRNA is extracted using poly dT columns and the material is separated by electrophoresis and, for example, transferred to nitrocellulose paper. Labeled probes made from an isolated specific fragment or fragments can be used to visualize the presence of a complementary fragment fixed to the paper.
According to the invention, diagnostic kits can be assembled which is useful to practice methods of detecting the presence of mRNA that encodes FMR4 in tissue samples by Northern blot analysis. Such diagnostic kits comprise oligonucleotides which are useful as probes for hybridizing to the mRNA. The probes may be radiolabeled. It is preferred that diagnostic kits according to the present invention comprise a container comprising a size marker to be run as a standard on a gel. It is preferred that diagnostic kits according to the present invention comprise a container comprising a positive control which will hybridize to the probe. Another method of detecting the presence of mRNA encoding FMR4 protein is by oligonucleotide hybridization technology. Oligonucleotide hybridization technology is well known to those having ordinary skill in the art. Briefly, detectable probes which contain a specific nucleotide sequence that will hybridize to nucleotide sequence of mRNA encoding FMR4 protein. RNA or cDNA made from RNA from a sample is fixed, usually to filter paper or the like. The probes are added and maintained under conditions that permit hybridization only if the probes fully complement the fixed genetic material. The conditions are sufficiently stringent to wash off probes in which only a portion of the probe hybridizes to the fixed material. Detection of the probe on the washed filter indicates complementary sequences. One having ordinary skill in the art, using the sequence information disclosed in SEQ ID NO: 9 can design probes which are fully complementary to mRNA sequences but not genomic DNA sequences. Hybridization conditions can be routinely optimized to minimize background signal by non-fully complementary hybridization.
The present invention includes labeled oligonucleotides which are useful as probes for performing oligonucleotide hybridization. That is, they are fully complementary with mRNA sequences but not genomic sequences. For example, the mRNA sequence includes portions encoded by different exons. The labeled probes of the present invention are labeled with radiolabeled nucleotides or are otherwise detectable by readily available nonradioactive detection systems. According to the invention, diagnostic kits can be assembled which is useful to practice oligonucleotide hybridization methods of the invention. Such diagnostic kits comprise a labeled oligonucleotide which encodes portions of FMRl encoded by different exons. It is preferred that labeled probes of the oligonucleotide diagnostic kits according to the present invention are labeled with a radionucleotide. The oligonucleotide hybridization-based diagnostic kits according to the invention preferably comprise DNA samples that represent positive and negative controls. A positive control DNA sample is one that comprises a nucleic acid molecule which has a nucleotide sequence that is fully complementary to the probes of the kit such that the probes will hybridize to the molecule under assay conditions. A negative control DNA sample is one that comprises at least one nucleic acid molecule, the nucleotide sequence of which is partially complementary to the sequences of the probe of the kit. Under assay conditions, the probe will not hybridize to the negative control DNA sample.
Another aspect of the invention relates to methods of analyzing tissue samples which are fixed sections routinely prepared by surgical pathologists to characterize and evaluate cells. In some embodiments, the cells are from brain tissue or testicular tissue and are analyzed to determine and evaluate the extent OΪFMR4 expression.
The present invention relates to in vitro kits for evaluating tissues samples to determine the level of FMR4 expression and to reagents and compositions useful to practice the same. The tissue is analyzed to identify the presence or absence of the FMR4 protein. Techniques such as FMR4/anti-FMR4 binding assays and immunohistochemistry assays may be performed to determine whether FMR4 is absent in cells in the tissue sample which are indicative of fragile X syndrome and fragile X tremor ataxia syndrome or upregulated which is indicative and diagnostic of premutation carriers. Thus, absence of FMRl would not give a definitive diagnosis of premutation carriers, whereas, FMR4 allows for diagnosis of fragile X syndrome and fragile X tremor ataxia syndrome and premutation carriers; allows for differentiation between fragile X and premutation carriers; and differentially diagnoses and predicts between different fragile X phenotypes. Alternatively, in some embodiments of the invention, tissue samples are analyzed to identify whether FMRl and FMR4 protein is being expressed in cells in the tissue sample which indicate a lack of fragile X syndrome and fragile X tremor ataxia syndrome. The presence of mRNA that encodes the FMR4 protein or cDNA generated therefrom can be determined using techniques such as in situ hybridization, immunohistochemistry. In situ hybridization technology is well known by those having ordinary skill in the art. Briefly, cells are fixed and detectable probes which contain a specific nucleotide sequence are added to the fixed cells. If the cells contain complementary nucleotide sequences, the probes, which can be detected, will hybridize to them. One having ordinary skill in the art, using the sequence information in SEQ ID NO: 9 can design probes useful in in situ hybridization technology to identify cells that express FMR4.
For in situ hybridization according to the invention, it is preferred that the probes are detectable by fluorescence. A common procedure is to label probe with biotin-modified nucleotide and then detect with fluorescently-tagged avidin. Hence, the probe does not itself have to be labeled with florescent but can be subsequently detected with florescent marker.
Cells are fixed and the probes are added to the genetic material. Probes will hybridize to the complementary nucleic acid sequences present in the sample. Using a fluorescent microscope, the probes can be visualized by their fluorescent markers.
According to the invention, diagnostic kits can be assembled which is useful to practice in situ hybridization methods of the invention are fully complementary with mRN A sequences but not genomic sequences. For example, the mRNA sequence includes portions encoded by different exons. It is preferred that labeled probes of the in situ diagnostic kits according to the present invention are labeled with a fluorescent marker. \
Immunohistochemistry techniques may be used to identify and essentially stain cells with FMR4. Anti-FMR4 antibodies are contacted with fixed cells and the FMR4 present in the cells reacts with the antibodies. The antibodies are detectably labeled or detected using labeled second antibody or protein A to stain the cells.
According to some embodiments, diagnostic reagents and kits are provided for performing immunoassays to determine the presence or absence of FMR4 protein in a sample from an individual. Kits may additionally include one or more of the following: means for detecting antibodies bound to FMR4 present in a sample, instructions for performing the method, and diagrams or photographs that are representative of how positive and/or negative results appear. In addition, kits may comprise optional positive controls such as FMR4 protein. Further, optional negative controls may be provided. Immunoassay methods may be used to identify individuals with fragile X syndrome and fragile X tremor ataxia syndrome by detecting the absence or deficiency of FMR4 in sample of tissue or body fluid using antibodies which bind to FMR4. The antibodies are preferably monoclonal antibodies. The antibodies are preferably raised against FMR4 made in human cells. Immunoassays are well known and there design may be routinely undertaken by those having ordinary skill in the art. The techniques for producing monoclonal antibodies are outlined in Harlow, E. and D. Lane (1988) Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, N. Y., which is incorporated herein by reference, provide detailed guidance for the production of hybridomas and monoclonal antibodies which specifically bind to FMR4.
According to some embodiments, immunoassays comprise allowing proteins in the sample to bind a solid phase support such as a plastic surface. Detectable antibodies are then added which selectively binding to FMR4. Detection of the detectable antibody indicates the presence of FMR4. The detectable antibody may be a labeled or an unlabelled antibody.
Unlabelled antibody may be detected using a second, labeled antibody that specifically binds to the first antibody or a second, unlabelled antibody which can be detected using labeled protein A, a protein that complexes with antibodies. Various immunoassay procedures are described in Immunoassays for the 80's, Voller, et al., Ed., University Park, 1981, which is incorporated herein by reference.
Simple immunoassays may be performed in which a solid phase support is contacted with the test sample. Any proteins present in the test sample bind the solid phase support and can be detected by a specific, detectable antibody preparation. Such a technique is the essence of the dot blot, Western blot and other such similar assays. Other immunoassays may be more complicated but actually provide excellent results.
Typical and preferred immunometric assays include "forward" assays for the detection of a protein in which a first anti-protein antibody bound to a solid phase support is contacted with the test sample. After a suitable incubation period, the solid phase support is washed to remove unbound protein. A second, distinct anti-protein antibody is then added which is specific for a portion of the specific protein not recognized by the first antibody. The second antibody is preferably detectable. After a second incubation period to permit the detectable antibody to complex with the specific protein bound to the solid phase support through the first antibody, the solid phase support is washed a second time to remove the unbound detectable antibody. Alternatively, the second antibody may not be detectable. In this case, a third detectable antibody, which binds the second antibody is added to the system. This type of "forward sandwich" assay may be a simple yes/no assay to determine whether binding has occurred or may be made quantitative by comparing the amount of detectable antibody with that obtained in a control. Such "two-site" or "sandwich" assays are described by Wide, Radioimmune Assay Method, (1970) Kirkham, Ed., E. & S. Livingstone, Edinburgh, pp. 199- 206, which is incorporated herein by reference.
Other types of immunometric assays are the so-called "simultaneous" and "reverse" assays. A simultaneous assay involves a single incubation step wherein the first antibody bound to the solid phase support, the second, detectable antibody and the test sample are added at the same time. After the incubation is completed, the solid phase support is washed to remove unbound proteins. The presence of detectable antibody associated with the solid support is then determined as it would be in a conventional "forward sandwich" assay. The simultaneous assay may also be adapted in a similar manner for the detection of antibodies in a test sample.
The "reverse" assay comprises the stepwise addition of a solution of detectable antibody to the test sample followed by an incubation period and the addition of antibody bound to a solid phase support after an additional incubation period. The solid phase support is washed in conventional fashion to remove unbound protein/antibody complexes and unreacted detectable antibody. The determination of detectable antibody associated with the solid phase support is then determined as in the "simultaneous" and "forward" assays. The reverse assay may also be adapted in a similar manner for the detection of antibodies in a test sample.
The first component of the immunometric assay may be added to nitrocellulose or other solid phase support which is capable of immobilizing proteins. The first component for determining the presence of FMR4 in a test sample is anti-FMR4 antibody. By "solid phase support" or "support" is intended any material capable of binding proteins. Well-known solid phase supports include glass, polystyrene, polypropylene, polyethylene, dextran, nylon, amylases, natural and modified celluloses, polyacrylamides, agaroses, and magnetite. The nature of the support can be either soluble to some extent or insoluble for the purposes of the present invention. The support configuration may be spherical, as in a bead, or cylindrical, as in the inside surface of a test tube or the external surface of a rod. Alternatively, the surface may be flat such as a sheet, test strip, etc. Those skilled in the art will know many other suitable "solid phase supports" for binding proteins or will be able to ascertain the same by use of routine experimentation. A preferred solid phase support is a 96- well microtiter plate. To detect the presence of FMR4, detectable anti-FMR4 antibodies are used. Several methods are well known for the detection of antibodies.
One method in which the antibodies can be detectably labeled is by linking the antibodies to an enzyme and subsequently using the antibodies in an enzyme immunoassay (EIA) or enzyme-linked immunosorbent assay (ELISA), such as a capture ELISA. The enzyme, when subsequently exposed to its substrate, reacts with the substrate and generates a chemical moiety which can be detected, for example, by spectrophotometric, fluorometric or visual means. Enzymes which can be used to detectably label antibodies include, but are not limited to malate dehydrogenase, staphylococcal nuclease, delta-5-steroid isomerase, yeast alcohol dehydrogenase, alpha-glycerophosphate dehydrogenase, triose phosphate isomerase, horseradish peroxidase, alkaline phosphatase, asparaginase, glucose oxidase, beta- galactosidase, ribonuclease, urease, catalase, glucose-6-phosphate dehydrogenase, glucoamylase and acetylcholinesterase. One skilled in the art would readily recognize other enzymes which may also be used.
Another method in which antibodies can be detectably labeled is through radioactive isotopes and subsequent use in a radioimmunoassay (RIA) (see, for example, Work, et al., Laboratory Techniques and Biochemistry in Molecular Biology, North Holland Publishing Company, N. Y., 1978, which is incorporated herein by reference). The radioactive isotope can be detected by such means as the use of a gamma counter or a scintillation counter or by autoradiography. Isotopes which are particularly useful for the purpose of the present invention are 3H, 125I, 1311, 35S, and 14C. One skilled in the art would readily recognize other radioisotopes which may also be used.
It is also possible to label the antibody with a fluorescent compound. When the fluorescent-labeled antibody is exposed to light of the proper wavelength, its presence can be detected due to its fluorescence. Among the most commonly used fluorescent labeling compounds are fluorescein isothiocyanate, rhodamine, phycoerythrin, phycocyanin, allophycocyanin, o-phthaldehyde and fluorescamine. One skilled in the art would readily recognize other fluorescent compounds which may also be used. Antibodies can also be detectably labeled using fluorescence-emitting metals such as
152Eu, or others of the lanthanide series. These metals can be attached to the protein-specific antibody using such metal chelating groups as diethylenetriaminepentaacetic acid (DTPA) or ethylenediamine-tetraacetic acid (EDTA). One skilled in the art would readily recognize other fluorescence-emitting metals as well as other metal chelating groups which may also be used.
Antibodies can also be detectably labeled by coupling to a chemiluminescent compound. The presence of the chemiluminescent-labeled antibody is determined by detecting the presence of luminescence that arises during the course of a chemical reaction. Examples of particularly useful chemoluminescent labeling compounds are luminol, isoluminol, theromatic acridinium ester, imidazole, acridinium salt and oxalate ester. One skilled in the art would readily recognize other chemiluminescent compounds which may also be used.
Likewise, a bioluminescent compound may be used to label antibodies. Bioluminescence is a type of chemiluminescence found in biological systems in which a catalytic protein increases the efficiency of the chemiluminescent reaction. The presence of a bioluminescent protein is determined by detecting the presence of luminescence. Important bioluminescent compounds for purposes of labeling are luciferin, luciferase and aequorin. One skilled in the art would readily recognize other bioluminescent compounds which may also be used. Detection of the protein-specific antibody, fragment or derivative may be accomplished by a scintillation counter if, for example, the detectable label is a radioactive gamma emitter. Alternatively, detection may be accomplished by a fluorometer if, for example, the label is a fluorescent material. In the case of an enzyme label, the detection can be accomplished by colorometric methods which employ a substrate for the enzyme. Detection may also be accomplished by visual comparison of the extent of enzymatic reaction of a substrate in comparison with similarly prepared standards. One skilled in the art would readily recognize other appropriate methods of detection which may also be used.
The binding activity of a given lot of antibodies may be determined according to well known methods. Those skilled in the art will be able to determine operative and optimal assay conditions for each determination by employing routine experimentation.
In a preferred embodiment, the kits include antibodies for detection of FMR4 and identifying variants thereof, using Western blot analysis.
Positive and negative controls may be performed in which known amounts of FMR4 and no FMR4, respectively, are added to assays being performed in parallel with the test assay. One skilled in the art would have the necessary knowledge to perform the appropriate controls.
An "antibody composition" refers to the antibody or antibodies required for the detection of the protein. For example, the antibody composition used for the detection of FMR4 in a test sample comprises a first antibody which binds FMR4, as well as a second or third detectable antibody that binds the first or second antibody, respectively.
To examine a test sample for the presence or absence of FMR4, a standard immunometric assay such as the one described herein may be performed. A first anti-FMR4 antibody, which recognizes, for example, a specific portion of FMR4 is added to a 96-well microtiter plate in a volume of buffer. The plate is incubated for a period of time sufficient for binding to occur and subsequently washed with PBS to remove unbound antibody. The plate is then blocked with a PBS/BSA solution to prevent sample proteins from non-specifically binding the microtiter plate. Test sample are subsequently added to the wells and the plate is incubated for a period of time sufficient for binding to occur. The wells are washed with PBS to remove unbound protein. Labeled anti-FMR4 antibodies, which recognize portions of FMR4 not recognized by the first antibody, are added to the wells. The plate is incubated for a period of time sufficient for binding to occur and subsequently washed with PBS to remove unbound, labeled anti-FMR4 antibody. The amount of labeled and bound anti-FMRl antibody is subsequently determined by standard techniques.
Kits which are useful for the detection of FMR4 in a test sample comprise a container comprising anti-FMR4 antibodies and a container or containers comprising controls. Controls include one control sample which does not contain FMR4 and/or another control sample which contained FMR4. The anti-FMR4 antibodies used in the kit are detectable such as being detectably labeled. If the detectable anti-FMR4 antibody is not labeled, it may be detected by second antibodies or protein A, for example, which may also be provided in some kits in separate containers. Additional components in some kits include solid support, buffer, and instructions for carrying out the assay. The immunoassay is useful for detecting FMR4 in homogenized tissue samples and body fluid samples including the plasma portion or cells in the fluid sample.
In all of the above embodiments, the detection can also include other antibodies such as those detecting FMRl, FMR2, FMR3, etc, nucleic acids, peptides, for example, as a control, as part of the detection and the like.
Western blots may be used in methods of identifying individuals suffering from fragile X syndrome and fragile X tremor ataxia syndrome by detecting presence of FMR4 in samples of tissue, such as for example, brain and testes. Western blots use detectable anti-FMR4 antibodies to bind to any FMR4 present in a sample and thus indicate the presence of the protein in the sample.
Western blot techniques, which are described in Sambrook, J. et al., (1989) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., which is incorporated herein by reference, are similar to immunoassays with the essential difference being that prior to exposing the sample to the antibodies, the proteins in the samples are separated by gel electrophoresis and the separated proteins are then probed with antibodies. In some preferred embodiments, the matrix is an SDS-PAGE gel matrix and the separated proteins in the matrix are transferred to a carrier such as filter paper prior to probing with antibodies. Anti-FMR4 antibodies described above are useful in Western blot methods. Generally, samples are homogenized and cells are lysed using detergent such as Triton-X.
The material is then separated by the standard techniques in Sambrook, J. et al., (1989) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
Kits which are useful for the detection of FMR4 in a test sample by Western blot comprise a container comprising FMR4 antibodies and a container or containers comprising controls. Controls include one control sample which does not contain FMR4 and/or another control sample which contained FMR4. The anti-FMR4 antibodies used in the kit are detectable such as being detectably labeled. If the detectable anti-FMR4 is not labeled, it may be detected by second antibodies or protein A for example which may also be provided in some kits in separate containers. Additional components in some kits include instructions for carrying out the assay. The means to detect anti-FMR4 antibodies that are bound to FMR4 include the immunoassays described above.
Aspects of the present invention also include various methods of determining whether a sample contains cells that express FMR4 by sequence-based molecular analysis. Several different methods are available for doing so including those using Polymerase Chain
Reaction (PCR) technology, using Northern blot technology, oligonucleotide hybridization technology, and in situ hybridization technology. According to the invention, samples are screened to determine the presence or absence of mRNA that encodes FMR4.
The invention relates to oligonucleotide probes and primers used in the methods of identifying mRNA that encodes FMR4 and to diagnostic kits which comprise such components.
The mRNA sequence-based methods for determining whether a sample mRNA encoding FMR4 include but are not limited to PCR technology, Northern and Southern blot technology, in situ hybridization technology and oligonucleotide hybridization technology. [0101] Embodiments of inventive compositions and methods are illustrated in the following examples. These examples are provided for illustrative purposes and are not considered limitations on the scope of inventive compositions and methods. EXAMPLES
MATERIALS AND METHODS Rapid Amplification ofcDNA ends (RACE)
The genomic sequence for FMRl locus was obtained from the UCSC (genome.ucsc.edu) website. RACE-ready cDNA (0.5 ng/μl) from SH-S Y5 Y cells for 5' and 3' RACE was custom made by Ambion, Inc. RACE primers were designed using Primer3 software (frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi) and the name and sequence of the RACE primers for FMR4 is listed below in Table 1 :
Table 1
Figure imgf000042_0001
Two rounds of PCR were carried out using the outer and inner primers respectively. First PCR was carried out using 10 μl of RACE-ready cDNA and the second PCR was carried out using 2 μl of the first PCR product. PCR conditions were as follow: 94°C for 5 minutes, (94°C for 30 seconds, 59°C for 30 seconds, 72°C for 3 minutes) for 35 cycles, 72°C for 10 minutes. Both first and second PCR products were ran on a 2% agarose gel and bands of interest were cut, purified, cloned into pGEM T-easy vector (Promega) before sending for sequencing.
RNA Extraction and cDNA synthesis Total RNA was extracted using Quiagen RNeasy mini kit (catalogue # 74106). RNA concentrations were measured using The NanoDrop® ND- 1000 UV-Vis Spectrophotometer. Equal amounts of RNA were reversed transcribed using TaqMan reverse transcription reagents (part # N808-0234) according to the manufacturer's protocol.
Real-Time PCR Real-Time PCR (RT-PCR) was carried out with the GeneAmp 7900 (Applied Biosystems, Foster City, CA). The PCR reactions contained 20-40 ng cDNA, Universal Mastermix (Applied Biosystems, Foster City, CA), 300 nM of forward and reverse primers, and 200 nM of probe in a final reaction volume of 15 μl. The primers and probe were designed using File-Builder software (Applied Biosystem, Foster City, CA). The PCR conditions were as follows: 50°C for 2 mm then 95°C for 10 mm then 40 cycles of 950C for 15 s and 600C for 1 mm. The results are based on cycle threshold (Ct) values. Differences between the Ct values for experimental and reference genes (18srRNA) were calculated as ΔΔCt. PCR FMRl forward primer C ACCTC AAAGCGAGC AC ATA (SEQ ID NO: 5) and reverse primer C AATAGC AGTGACCCC AGGT (SEQ ID NO: 6). FMR4 forward primer AACTAGGAACAGTGGCAACCA (SEQ ID NO: 7) and reverse primer TGAGTTGAGGAAAGGCGAGT (SEQ ID NO: 8). PCR conditions are as follows: 94°C for 5 minutes, (94°C for 30 seconds, 59°C for 30 seconds, 72°C for one minute) x 35 cycles, 720C for 10 minutes.
FMR4 forward primer: ACACCCTGTGCCCTTTAAGG (SEQ ID NO: 10), FMR4 reverse primer: TCAAAGCTGGGTCTGAGGAAAG (SEQ ID NO: 11), Reporter (probe): TCGGGATCTCAAAATGT (SEQ ID NO: 12).
In vitro transcription and translation
1 μg of pcDNA3.1 containing the FMR4 sequence (or without the sequence as a control) was utilized for in vitro transcription using a MAXIscript kit (Cat # AM 1200, Ambion, Austin, TX) according to manufacturer's instructions. Subsequently, in vitro translation was carried out using the Retic Lysate IVT kit (Ambion, Austin, TX) according to manufacturer's instructions, except that Fluorotect Green-Lys (Promega, Madison, WI) was included in the translation mixture according to manufacturer's suggestions. Fluorotect Green-Lys, is a BIODPY labeled lysine that allows the addition of a fluorescent amino acid to any newly synthesized peptide (unlabeled lysine is also included in the reaction mixture) allowing for fluorescent detection of such peptides.
Northern blot analysis
A human ready-to-hybridize northern blot membrane was purchased from Ambion (cat# 3141) which has 2 μg of poly(A) RNA per lane isolated from human brain, liver, placenta, small intestine, colon, pancreas, spleen, prostate, testes, and ovary. The membrane was initially incubated with 15 ml of prewarmed hybridization solution (Ambion, cat#8670) for 1 hour at 650C. Northern blot probes (32P) were generated using Amersham rediprime II random prime labeling system (RPN 1633) according to the manufacturer's protocol. 14 μl of the probe was added per 5 ml of hybridization buffer (42 μl total) to the membrane for overnight incubation at 42°C. Two low stringency and two high stringency washes were performed for 15 minutes each prior to exposing the membrane for phosphor imager.
Cell culture, siRNA transfection and RNA isolation HEK-293 cells were cultured in MEM plus 10% FBS. Cells in logarithmic growth were transfected with 20 nM of siRNA using 0.2% Lipofectamine 2000 according to manufacturer's instructions (Invitrogen, Carlsbad, CA). Cells were incubated for 72 h or transfected a second time for an additional 72 hours prior to RNA isolation. RNA was isolated using QIAGEN RNeasy mini-kit (#74 106). All samples were treated with RNAse- free DNase (QIAGEN #79254) for 20 minutes as described in the manufacturer's protocol. The sequences of FMRl and FMR4 siRNAs are listed in Table 2.
FMR4 over-expression
The entire cDNA sequence of FMR4 was cloned into pcDNA3.1 vector. The vector was sequenced to verify the insertion of the FMR4 sequence. The vector was transfected into several human and mouse cell lines using standard procedures.
Stability and a-aminatin treatment
HEK-293T cells were cultured in 6 well plates. Twenty-four hours later, cells were treated with 50 μg/ml of α-amanitin. Cells were harvested for RNA isolation and RT-PCR at 0, 6, 12, and 24 hours post treatment. Three independent samples were taken for each data point and all samples had untreated and untransfected matching samples for RNA purification and data analysis.
Cell proliferation assay
Using Multidrop 384Titan, 50 ng of PGL3 vector (luciferase vector with SV40 promoter), 2OnM of siRNA and transfection reagents (Lipofectamine 2000 0.2% and OptiMEM, Invitrogen, CA) were plated in 96 well plates. Equal number of cells (20,000 per well) were added to each well and incubated at 37°C for 72 hours. Bright-Glo luciferase reagent (Promega, Madison, WI) was added to each well and incubated at room temperature for 5 minutes. Luciferase activity, as a marker of cell proliferation, was measured by Analyst GT Multimode Reader (Molecular Devices, Sunnyvale, CA) and plotted against control siRNA.
Cell cycle analysis
FMR4 was knocked down using two different siRNAs (4 repeats each), and we used a control negative siRNA (4 repeats also) to examine the effects of FMR4 on the cell cycle. At 72 hours post transfection, the cells were prepared for flow cytometry as follows: cells were washed with PBS, trypsynized and centrifuged at 1,000 rpm for 10 minutes. Then the cells were washed again with PBS before being fixed with 70% ethanol at -20°C overnight. The next day the cells were centrifuged, washed with PBS and re-suspended in 38mM sodium citrate, 69 μM propidium iodide and 19 μg/ml RNAse A for flow cytometry analysis. Results were analyzed using FlowJo analysis software.
TUNEL assay
HEK-293T cells were plated on cover slips prior to treatment with a control siRNA or siRNAs against FMR4. At 72 hours post transfection, the cells were fixed with 4% paraformaldehyde (pH 7.4) for 15 min at room temperature, followed by permeabilization with 0.1% triton-X in PBS. TdT- mediated dUTP nick end labeling (TUNEL) reaction mixture was added to the cells and incubated at 370C for 1 hour (Roche, Indianapolis, IN). The cells were then stained with DAPI and images were captured using a confocal microscope.
Example 1: Identification of the FMR4 gene
Real time PCR (RT-PCR) and PCR primers were designed at various regions of the FMRl genomic sequence including upstream and downstream sequences surrounding FMRl to search for other transcripts. A new transcript was detected that we termed FMR4 upstream of FMRl transcription start site in several cell lines that were examined including lymphoblasts, HEK-293, and SH-SY5Y cells. Using rapid amplification of cDNA ends (RACE), the 5' and 3' ends of FMR4 were cloned and sequenced.
FMR4 sequence:
GGGAACCGGCCGGGGTGCCGGGTCGAAAGACAGACGCGCGGGCCGGGCGTGCGCGGGCTTGGTG GAGGGCGGGAAGGCTGAAGGGCGGTGACAGGTCGCACTGCCTCGCGAGGGCCAGAACGCCCATTT CTGCAGAGGTGCACTCAGTGGCGTGGGAAATCAAATGCATCCGGTTATCCCAGTTCGGCCTCTCTG GGATTCCGCGGGAGGGGGTGTCTGGTCTGGTTTGGTTTGGTTTGGTTTGGTTTGGTTTGGTCCGGTT CAAAGTAGCGCAGTCTGACTGAGCGGGAGGTGGAGTGGAAGGCGAGAATAGGGGTGAAGGATTA GACAGAAGAAGACTTTGAACTAGGAACAGTGGCAACCAGGGTGACCCAGGCTTTTGTGACCCGTA GAGGCAGAAGGTGAGGCGTCTACGCCCTCTCTCACCAGATTTTGGGCGGCCCTGTGGAGACACCCT GTGCCCTTTAAGGGACATGGATTGAGTCGGGATCTCAAAATGTGAGCCTTTCCTCAGACCCAGCTT TGACCCACGTACTCGCCTTTCCTCAACTCATTTTCATACTTTCACTTGACTATATATTTTTTAAAAAT TGTGTTAAGCACTTGAGGTTCATTTCTGCCCCTACTGTATGTGCACCCTGTGCCAGAGGGTGGGGT GAACACGTGTGTAGCAGTCATGCGTCCTGTCCACAGGGGCCGATGCACCTCCTTGCAACCCTTTAC ATTCCACTGTGAAACAAACCTCAACTTTTTCTTATTCCTGTTTTTACACCGTGCTTATAGCTGCCTTA ATCCATGTTCCCTTCGGGATGCTGGTATCCAACTGAGAAGTTGACGGAGCATCTATCGTGTGCCAG ACACTGTGCTAAGTGCTAACGAGAAATCGGTGAGCAAAACAGAAAAGAAAAAAAAAGAAGAAAC GACTGCCAGCATTGAACTTAGTACCTAGCAAAGTAGGTGGACATAAATCAAATTGTCAGACAAGT AAATGAGTAGTTGCAGCTGTGATAAGGGGTATGAAGAATAGGCGCTTCCATGATGGCGGAACATG ACCTAGTCTGGGGTGGAGAAGGGGAGATGATTCCAGCTGGAATATGGCAGGTGAGAGTTAACTAA TAGCACTGAGTTGGCAGAGGCAGGATGACCTGCCCCAGGCAGGTGCCCCAGAATGAGAGGATGTT GCTGCTGGTGGAACTCCAGCTTTAAAGCGGTGGATCTAGGGCCACATTCCTCAAGGCCATAGCAA ACAGGAAAGACCTTTTGGACTAGGGTCTTTGGAGTAGTCACATGAGGCCAAGAACCCAATAGGGC TGAAAGAGAATCTCATCATAGGCTGAATGGGAGCAGAGCATTAGCTGCAACTCCAATGTATTATA GTAAAAGGGGACACATTGATTAGAATGATTATACCCCTCCAAGTGTAAGCTGTTGTTCAATTTACC CAGGGCTTAAAAATATGTCAACTCTTCACAACCATTTTTACTACAAGCCACACTCAACCTGTGTTG TTCCCTGAACCTGTGATGCACTTTCATCCGTTCATGTCTCTACACATCCTTCCTGGGCCCCATAGAG GCCCTGCACCTTAAGGTTTTCAGCTGGATTCCTATTAGCTAGTTATTTTATCTCAGGTACAGAGAGT TAACTTTGCTCCTCAATTTTCAGCACATTGTCATATCAGTCCCTACAGGGTCCTTGTTTACATTATTT TATAGTGTTTATATTATTTTTTCCTCATCTTTCTCGATCCCCACTCTCATTCTTCTAGACACAAGCTG CAATATGTTCGATAGAGATCCTTGATAATTTAACACAGATAATGTTTTGTTTATGCCTCTTGCATTT ACAGAGATGGTATTGGACTGTAAATCTCTATTTCCCACTGTTTTACTCAACAGTCTGTTTTTGAGCT ATACCCACATTGCTGTGTGTACACCTAGTTTGCTACCGAGTATGCCAGAAATTTTATTCATACATAT CCCTACTGATCGGGCATCTAGGTTACTGCCAACTCCCTGAAGTCATACTGTGGTGAAAACCCTTGT GAATGTCTTTACAAACCTTTGCCAGAACTTATTTTGTGCTCTTGTAGAACTTTGTGCATACCCTCTG CTTCCTCATTACACTGCTTGGCATATAGCAGAGACTCAACAAATGTTGAATACCTCTACTATGATG GTTAGTGTACTAGAATAATTCTCCCTGAAGTCATACTGTGGTGAAAACCCTTGTGAATGTCTTTAC AAACCTTTGCCAGAACTTATTTTGTGCTCTTGTAGAACTTTGTGCATACCCTCTGCTTCCTCATTAC ACTGCTTGGCATATAGCAGAGACTCAACAAATGTTGAATACCTCTACTATGATGGTTAGTGTACTA GAATAATT (SEQ ID NO: 9)
Bioinformatic analysis shows that the genomic sequence encompassing FMR4 is only present in primates. Northern blot analysis shows that this transcript is expressed in several human tissues including brain, liver, placenta, small intestine, colon and spleen but not in the pancreas, testes, ovaries or prostate (Figure 1). This is in contrast to FMRl which shows high levels of expression in the testes, ovaries and prostate (Figure 1).
FMR4 is unregulated in premutation carriers and shut down in full mutation patients:
Next, the relative expression of FMR] and FMR4 was investigated in two control, four premutation and four full mutation patients by RT-PCR in white blood cells. Both FMRl and
FMR4 are upregulated in permutation patients, and shut down in full mutation patients
(Figures 2 and 3A-3B).
Knockdown of FMRl by siRNA does not affect FMR4: Three different siRNA against
FMRl and a control negative siRNA were used to transfect HEK-293T cells. One set of HEK-293T cells were transfected for 72 hours, and another set of cells were transfected for
72 hours then transfected again for an additional 72 hours (144 hours total). Two out of the three siRNA caused significant decrease in the FMRl message at 72 and 144 hours but did not affect the transcription of FMR4 (Figure 4A).
FMR4 may code for a small peptide: Next, ESTScan 2 (embnet.org/software/ESTScan2.html) was used to determine if FMR4 had an open reading frame. According to this software, FMR4 has a small open reading frame that codes for a 25 amino acid peptide. Using several protein homology search websites including NCBI, the new peptide does not seem to have any homology with any known proteins.
FMRl and FMR4 mRNA have similar half-lives'. HEK-293 cells were treated with 50 μM of α-amanitin (which inhibits RNA pol II) and the RNA was isolated at 0, 6, 12 and 24 hours post treatment. Actin was used as a positive control and 18S was used as a negative control
(product of RNA pol I). By RT-PCR the levels of Actin, 18S, FMRl, and FMR4 were measured. 18S mRNA was not affected since it is not a product of RNA pol II. It was found that FMRl and FMR4 have very similar half-lives (Figure 5). Summary: The discovery of a new gene {FMR4) is reported herein. The new gene is transcribed upstream of the FMRl gene. FMR4 shows a similar pattern of expression to
FMRl in normal, premutation and full mutation patients with fragile X syndrome and fragile
X tremor ataxia syndrome suggesting it could play a role in the etiology of this syndrome.
Patients with fragile X syndrome show a high variability in their phenotype, also, some fragile X syndrome patients continue to produce FMRl mRNA in some cases comparable to normal individuals. It is possible that these variations in fragile X syndrome patients could be due to FMR4. Several mouse models for fragile X syndrome have been developed but none of them produced an accurate recapitulation of the human phenotype. Since FMR4 is a primate- specific transcript it is possible that FMR4 is responsible for some of the phenotypes found in human but not in these mice. Future experiments involving the knockdown of this transcript in primates (e.g., monkeys) could help elucidate the specific role of this transcript in fragile X syndrome. Also, transgenic mice that overexpress FMR4 could provide insights into this new gene.
Example 2: Identification and expression analysis ofFMR4 Previous work by us and others has shown that bidirectional promoters are relatively common in the mammalian genome. Using genomic approaches, including rapid amplification of cDNA ends (RACE), regular and real time PCR (RT-PCR), transcripts upstream of FMRl that could also be affected by the CGG repeat expansion were searched. Identification of a novel 2.4 kb long noncoding RNA, which we named FMR4, was shown to reside upstream and may share a bidirectional promoter with FMRl (Figures 6A, 6B).
Bioinformatic analysis indicated that FMR4 did not have a conventional open reading frame.
To confirm that FMR4 was indeed a noncoding RNA in vitro transcription/translation was carried out followed by mass spectrometry analysis; however, no protein was detected indicating that FMR4 is most likely a noncoding RNA. Northern blot analysis showed that FMRl was expressed in the majority of the human tissues examined consistent with previous reports. FMR4 was expressed in several adult human tissues including brain, liver, placenta, small intestine, colon and spleen but not in the pancreas, testes, ovaries or prostate. Two bands corresponding to FMR4 were observed in several human adult tissues, one possibility is that there is alternative transcription start sites for FMR4, however, when RACE analysis was performed, RACE ready cDNA was used from SH-SY5Y cells and obtained only the longer 2.4kb transcript.
FMR4 is ubiquitously expressed during human development: Since FMR4 is expressed in several human adult tissues, its expression levels were examined in human fetal tissues. Using RT-PCR RNA expression levels of FMR4 were measured in seven different human fetal tissues (12 weeks); the RNA from each tissue was pooled from at least three different embryos (GBiosciences). It was found that FMR4 was expressed in all the tissues examined including the brain. Notably, FMR4 was highly expressed in the kidney and heart at that stage of human development (Figure 7A). FMR4 is expressed in human and monkey brain: To determine whether FMR4 shows differential expression within different regions of the human brain, the RNA concentrations of both FMRl and FMR4 were examined by Real-Time PCR (RT-PCR) using tissue from six postmortem human brains (from four males and two females aged 61-91 years) and studied three different regions (cerebellum, frontal cortex, and hippocampus). By this quantitative method, RT-PCR, both FMRl and FMR4 were shown to display robust expression levels in all three brain regions tested (Figure 7B). To determine if FMR4 was also expressed in other primates, the expression of FMR4 was examined in Rhesus monkey brain regions using RT- PCR. Total RNA from each brain region was isolated from two monkeys and DNAse treated prior to cDNA synthesis. FMR4 was found to be expressed in all the monkey brain regions tested with high expression in the cerebellum and interior parietal cortex (Figure 7C) confirming that FMR4 was expressed in other primates in addition to humans.
The CGG expansion affects transcription in both directions of a bidirectional promoter: To determine if the expression of FMR4 was affected by the CGG expansion in the 5' UTR of FMRl that occurs in FXS and/or FXTAS, the relative expression 0ΪFMR4 and FMRl was investigated by RT-PCR in untransformed leukocytes from four control, four premutation and four FXS patients. FMR4 expression, similar to FMRl, was found to be significantly up- regulated in premutation carriers, and shut down in full mutation (FXS) patients (P < 0.0001) (Figure 3A). All the samples tested had a matching control without the reverse transcriptase to account for possible DNA contamination. Regular PCR (35 cycles), gel electrophoresis and ethidium bromide staining were utilized to examine the expression of FMR4 and FMRl from the same samples. FMR4 was detectable in both the normal and premutation carriers but not in the full mutation fragile X patients. FMRl was detectable in the normal, premutation carriers and one out of the four fragile X patients (Figure 3B). FMR4 is a product of RNA polymerase II and has a similar half-life to FMRl: To measure the relative half-lives of FMRl and FMR4, HEK-293T cells were treated with 50μM of α-amanitin (an inhibitor of RNA polymerase II) and RNA was isolated at 0, 6, 12 and 24 hours post treatment (six repeats each). All treated samples had a matching control which did not receive α-amanitin (untreated samples). Actin was used as a positive control and 18S rRNA was used as a negative control (a product of RNA polymerase I). The levels of Actin, 18S, FMRl, and FMR4 were measured by RT-PCR. 18S rRNA levels did not change at any of the time points tested since α-amanitin does not affect RNA polymerase I. By contrast Actin, FMRl and FMR4 were all affected since they are all products of RNA polymerase II. The data indicates that FMR4 has a similar half-life to FMRl (Figure 5).
No evidence of direct cross-regulation between FMRl and FMR4: To determine whether FMRl and FMR4 are functionally linked, three different siRNAs against FMRl were tested and three different newly designed siRNAs against FMR4 were identified. It is important to utilize multiple efficacious siRNAs to any given target in order to avoid the possibility of off- target phenomena. Also, since FMR4 was highly expressed in human embryonic kidney (Figure 2A), HEK-293T cells were used as an in vitro system to study FMR4 regulation and function. First, three siRNAs against FMRl were tested by transfecting HEK-293T cells with 20 nM (final concentration) of FMRl siRNAs (six repeats each). Two out of the three siRNAs tested were effective in knocking down FMRl by 80% as early as 48 hours post transfection (siRNA B and C, Table 2). This level of knockdown was also observed at 72 hours post transfection and in repeated transfection experiments (144 hours total, two transfections at 0 hour and 72 hours post first transfection). However, in all cases the concentrations of FMR4 were not affected by FMRl siRNAs (Figure 4A). Nine different siRNAs for FMR4 were designed and tested, three siRNAs (C, G, and H, see methods for sequences) caused a significant decrease in FMR4 at 48 and 72 hours post transfection, but did not affect the levels of FMRl (Figure 4B). FMR4 siRNA C was used, which caused the highest level of FMR4 knockdown among the siRNAs tested for a time course experiment. HEK-293T cells were transfected with FMR4 siRNA C and RNA was collected at 24, 48, 72 and 144 hours post transfection. This siRNA caused a significant knockdown of FMR4 but did not affect FMRl levels at any of the time points tested (Figure 4C). Next, FMR4 was cloned into a pcDNA3.1 vector with a CMV promoter and overexpressed FMR4 in HEK- 293T cells, a pcDNA3.1 vector without the FMR4 insert was used as a control. At 72 hours post transfection, RNA was isolated, reversed transcribed and used for RT-PCR analysis.
FMR4 overexpression led to a substantial increase in FMR4 RNA levels, but did not have any effect on FMRl RNA (Figure 4D). Collectively, these experiments suggest that the non- overlapping transcripts FMRl and FMR4 do not regulate each other.
FMR4 affects cell proliferation in human cells: To uncover a possible function for FMR4, the effects of three distinct and efficacious siRNAs against FMR4 on cell proliferation were examined using a luciferase reporter system (see methods). HEK-293T cells were transfected with either siRNAs targeting FMR4 (C, G, and H), FMRl, or a control siRNA. All cells were simultaneously co-transfected with a pGL3 (luciferase) vector. At 72 hours post transfection, luciferase activity, which is a marker of cell proliferation, was measured using an Analyst GT Multimode Reader (Molecular Devices) and all data points were plotted as a percentage of control siRNA treated cells. All three siRNAs against FMR4, but not the siRNA against FMRl, resulted in significant decreases in cell proliferation in comparison to the control siRNA treated cells (Figure 8A). To determine if the effect of FMR4 on cell proliferation is reproducible in other human cell lines a similar experiment was carried out using HeLa cells and found that all three siRNAs against FMR4 also resulted in highly significant decreases in cell proliferation in comparison to control siRNA (P<0.0001) (Figure 8B). In contrast to HEK-293T cells, FMRl siRNA resulted in a marginally significant decrease in cell proliferation in HeLa cells (Figure 8B). A similar experiment was carried out using mouse N2A neuroblastoma cells as a negative control experiment. siRNAs against FMR4 had no effect on cell proliferation in mouse N2A cells (Figure 9A). To determine if the overexpression of FMR4 have an opposite effect compared to FMR4 siRNAs knockdown on cell proliferation, HEK-293T and HeLa cells were transfected with FMR4 overexpression vector. It was found that the overexpression of FMR4 in both cell lines resulted in an increase in cell proliferation compared to the control vector treated cells (P<0.0001) (Figures 8C-8D). The overexpression of FMR4 in mouse N2A cells had no effect on cell proliferation (Figure 9B).
FMR4 has antiapoptotic properties: To further characterize the manner in which FMR4 affects cell proliferation, FMR4 was knocked down using two different siRNAs (four repeats each), and a control negative siRNA was used (four repeats also) to examine the effects of FMR4 on the cell cycle in HEK-293T cells. At 72 hours post transfection, propidium iodide FACS analysis was performed (see methods) and it was found that the siRNAs knockdown of FMR4 resulted in an increase in the number of cells in the Sub-Gl phase and a modest but significant decrease in the number of cells in S phase of the cell cycle (Figure 10A). This indicated that FMR4 may have an antiapoptotic function in human cells; a fluorescent TUNEL assay was next performed and a significant increase in apoptosis was found in cells treated with FMR4 siRNA (72 hours post transfection) compared to cells treated with a control siRNA, further indicating that FMR4 has an antiapoptotic function in human cells (Figures 1 OB-I OC).
A possible Role for FMR4 in Autism: It has now been estimated that two thirds of fragile X patients display autistic-like behavior. However, the exact mechanism or the link between fragile X syndrome and autism is yet to be determined. Here data is presented which suggest that FMR4 may play a role in autism. We have sequenced the genomic DNA which encompass FMR4 in normal control, autistic patients and Schizophrenia patients and found several mutations/SNPs in some autistic patients but not in normal control or Schizophrenia patients (Table 2). These results suggest that FMR4 may also play a role in autism.
K)
Figure imgf000053_0001
aPosition: Nucleotide position on the FMR4 sequence bS2D ID : our internal variant ID cVariant status: Once we detect a variant we redo the PCR and re-sequence the proband in order to eliminate false positive dInheritance mode: Once we detect a variant we analyse the parents to determinate the inheritance mode (de novo vs. transmitted). Frequent variant are not tested for inheritance mode. Only rare variant (frequency <1%)
Legend: na = not available fp = false positive
Al = allele 1 (WT)
A2 = allele 2 (Variant)

Claims

CLAIMS What is claimed:
1. A nucleic acid comprising the sequence of SEQ ID NO: 9, mutants, variants, alleles, complementary sequences, ribonucleotide sequences, and fragments thereof.
2. The nucleic acid of claim 1 , wherein the nucleic acid comprises a strand that hybridizes under conditions of high stringency to the entirety of a nucleotide sequence comprising SEQ ID NO: 9 or the complement thereof.
3. The nucleic acid of claim 1 , wherein SEQ ID NO: 9, mutants, variants, alleles, complementary sequences, ribonucleotide sequences and fragments thereof, comprise one or more modified nucleotides.
4. The nucleic acid of claim 1 , wherein a polynucleotide sequence comprises at least 50% sequence identity to SEQ ID NO: 9.
5. The nucleic acid of claim 1 , wherein a pharmaceutical composition comprises SEQ ID NO: 9, mutants, variants, alleles, complementary sequences and fragments thereof.
6. The nucleic acid of claim 1 , wherein allelic variations comprise nucleic acid changes at one or more positions of SEQ ID NO: 9 comprising positions: 223-227, 223-232, 257, 320, 504, 600, 689, 912-914, 991 , 1675, or 1793.
7. A polynucleotide comprising a vector expressing SEQ ID NO: 9, mutants, variants, alleles, complementary sequence, ribonucleotide sequences, and fragments thereof.
8. The polynucleotide of claim 7, wherein the expression vector comprises a promoter wherein the promoter is an inducible promoter, constitutive promoter, tissue specific promoter or bi-directional promoter.
9. An isolated peptide encoded by a nucleic acid comprising the sequence of SEQ ID NO: 9, mutants, variants, alleles, ribonucleotide sequences, complementary sequences, and fragments thereof.
10. An antibody or aptamer specific for a peptide encoded by a nucleic acid comprising the sequence of SEQ ID NO: 9, mutants, variants, alleles, ribonucleotide sequences, complementary sequences, and fragments thereof.
1 1. An isolated cell comprising any one or more of nucleic acids comprising SEQ ID NOS: 1-12, mutants, variants, alleles, ribonucleotide sequences, complementary sequences, and fragments thereof.
12. The isolated cell of claim 1 1 , wherein the nucleic acid comprises SEQ ID NO: 9, mutants, variants, alleles, ribonucleotide sequences, complementary sequences, and fragments thereof.
13. A biomarker diagnostic of Fragile X syndrome, Fragile X tremor ataxia syndrome, autism or schizophrenia, wherein the biomarker is (a) a peptide encoded by a nucleic acid comprising the sequence any one or more of SEQ ID NOS: 1 -12, mutants, variants, alleles, complementary sequence and fragments thereof; and/or (b) the biomarker is a nucleic acid comprising the sequence any one or more of SEQ ID NOS: 1-12, mutants, variants, alleles, complementary sequence and fragments thereof.
14. The biomarker of claim 13, wherein the biomarker is a peptide encoded by a nucleic acid comprising the sequence of SEQ ID NO: 9, mutants, variants, alleles, complementary sequence and fragments thereof.
15. The biomarker of claim 13, wherein the biomarker is a nucleic acid comprising the sequence of SEQ ID NO: 9, mutants, variants, alleles, complementary sequence and fragments thereof.
16. An isolated primer comprising any one or more of nucleic acids SEQ ID NOS: 1 -8 and 10-12, mutants, variants, alleles, ribonucleotide sequences, complementary sequences, and fragments thereof.
17. The isolated primer of claim 16, wherein one or more of nucleic acids SEQ ID NOS: 1 -8 and 10-12, mutants, variants, alleles, ribonucleotide sequences, complementary sequences, and fragments thereof, comprise one or more modified nucleotides.
18. An isolated set of primers comprising SEQ ID NOS: 1 and 3; SEQ ID NOS: 2 and 4; SEQ ID NOS: 7 and 8; SEQ ID NOS: 10-12, or combinations thereof.
19. A method of diagnosing Fragile X syndrome, Fragile X tremor ataxia syndrome, autism or schizophrenia comprising: obtaining a biological sample from a patient; identifying SEQ ID NO: 9, mutants, variants, alleles, complementary sequence, fragments or a portion thereof; detecting the presence, absence or variation in concentration of a peptide encoded by SEQ ID NO: 9, mutants, variants, alleles, complementary sequence and fragments thereof; comparing the concentrations of the peptide between a normal individual, a permutation carrier and the patient; and, diagnosing Fragile X syndrome, Fragile X tremor ataxia syndrome, autism or schizophrenia.
20. The method of claim 19, wherein the patient is an embryo, neonate, infant, child, teenager or adult.
21. The method of claim 19, wherein the peptide or nucleic acid is identified by an antibody or aptamer.
22. A method of treating and/or preventing a patient afflicted with Fragile X syndrome, Fragile X tremor ataxia syndrome, autism or schizophrenia comprising: administering to a patient a composition comprising a vector expressing SEQ ID NO: 9, complementary sequences, mutants, variants, alleles, and fragments thereof; and, treating and/or preventing a patient afflicted with Fragile X syndrome, Fragile X tremor ataxia syndrome, autism or schizophrenia.
23. The method of claim 22, wherein the vector comprises a promoter wherein the promoter is an inducible promoter, constitutive promoter, tissue specific promoter or bi-directional promoter.
24. A method of treating and/or preventing a patient afflicted with Fragile X syndrome, Fragile X tremor ataxia syndrome, autism or schizophrenia comprising: administering to a patient a composition comprising a therapeutically effective amount of a protein or peptide encoded by SEQ ID NO: 9, mutants, variants, alleles, and fragments thereof; and, treating and/or preventing a patient afflicted with Fragile X syndrome, Fragile X tremor ataxia syndrome, autism or schizophrenia.
25. A method of treating and/or preventing a patient afflicted with Fragile X syndrome, Fragile X tremor ataxia syndrome, autism or schizophrenia comprising: administering to a patient a composition comprising an antibody that specifically binds to a peptide encoded by SEQ ID NO: 9, complementary sequences, mutants, variants, alleles, and fragments thereof; and, treating and/or preventing a patient afflicted with Fragile X syndrome, Fragile X tremor ataxia syndrome, autism or schizophrenia.
26. A method of treating and/or preventing a patient afflicted with Fragile X syndrome, Fragile X tremor ataxia syndrome, autism or schizophrenia comprising: administering to a patient a composition comprising an siRNA that specifically binds SEQ ID NO: 9, complementary sequences, mutants, variants, alleles, and fragments thereof; and, treating and/or preventing a patient afflicted with Fragile X syndrome, Fragile X tremor ataxia syndrome, autism or schizophrenia.
27. A method of treating and/or preventing a patient afflicted with Fragile X syndrome, Fragile X tremor ataxia syndrome, autism or schizophrenia comprising: administering to a patient a composition comprising a nucleic acid SEQ ID NO: 9, complementary sequences, mutants, variants, alleles, and fragments thereof; and, treating and/or preventing a patient afflicted with fragile X syndrome and fragile X tremor ataxia syndrome.
28. A method of modulating FMR4 expression in a cell or subject comprising: administering to a cell or subject a composition comprising a peptide encoded by SEQ ID
NO: 9, complementary sequences, mutants, variants, alleles, and fragments thereof; and/or, administering to a cell or subject a composition comprising an antibody that specifically binds to a peptide encoded by SEQ ID NO: 9, complementary sequences, mutants, variants, alleles, and fragments thereof; and/or, administering to a cell or subject a composition comprising an siRNA that specifically binds SEQ ID NO: 9, complementary sequences, mutants, variants, alleles, and fragments thereof; and/or, administering to a cell or subject a composition comprising a nucleic acid SEQ ID NO: 9, complementary sequences, mutants, variants, alleles, and fragments thereof; and/or, administering to a cell or subject a composition comprising a vector expressing SEQ ID NO: 9, complementary sequences, mutants, variants, alleles, and fragments thereof; and, modulating the expression of FMR4 in a cell or subject.
29. The method of claim 28, wherein FMR4 modulation comprises stabilizing, increasing or decreasing the concentration of FMR4 nucleic acid and/or proteins, peptides or fragments thereof as compared to FMR4 concentration in a normal cell or subject.
30. A kit comprising primers of SEQ ID NOS: 1-8 and 10-12; thermostable polymerase, and A, G, C, T nucleotides.
1. A kit comprising SEQ ID NO: 9, peptides thereof, or antibodies specific for SEQ ID NO: or peptide.
PCT/US2008/060112 2007-04-13 2008-04-11 A novel gene associated with fragile x syndrome and fragile x tremor ataxia syndrome Ceased WO2008128103A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US91168507P 2007-04-13 2007-04-13
US60/911,685 2007-04-13

Publications (1)

Publication Number Publication Date
WO2008128103A1 true WO2008128103A1 (en) 2008-10-23

Family

ID=39864347

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2008/060112 Ceased WO2008128103A1 (en) 2007-04-13 2008-04-11 A novel gene associated with fragile x syndrome and fragile x tremor ataxia syndrome

Country Status (1)

Country Link
WO (1) WO2008128103A1 (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1992020925A1 (en) * 1991-05-14 1992-11-26 Siemens Aktiengesellschaft Multiple flow, liquid ring pump

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1992020925A1 (en) * 1991-05-14 1992-11-26 Siemens Aktiengesellschaft Multiple flow, liquid ring pump

Similar Documents

Publication Publication Date Title
KR101914309B1 (en) Treatment of sodium channel voltage-gated, alpha subunit (scna) related diseases by inhibition of natural abtisense transcript to scna
JP6285472B2 (en) Identification of tumor-related markers for diagnosis and treatment
KR101682735B1 (en) Treatment of brain derived neurotrophic factor (bdnf) related diseases by inhibition of natural antisense transcript to bdnf
TWI816712B (en) Screening reagent for active ingredient of cancer promoting factor expression inhibitor and screening method thereof, screening reagent for active ingredient of cancer preventive or therapeutic agent and screening method thereof, cancer promoting factor expression inhibitor, and cancer preventive or therapeutic agent
US9347085B2 (en) Methods and compositions for reducing amyloid beta levels
Sun et al. Heterogeneous nuclear ribonucleoprotein L negatively regulates foot-and-mouth disease Virus replication through inhibition of viral RNA synthesis by interacting with the internal ribosome Entry site in the 5′ untranslated region
US20110224133A1 (en) Highly Potent Peptides To Control Cancer And Neurodegenerative Diseases
JP2023531935A (en) Treatment of obesity with G protein-coupled receptor 75 (GPR75) inhibitors
JP7177439B2 (en) Pro-inflammatory factor expression inhibitor, screening method for active ingredient thereof, expression cassette useful for said method, diagnostic agent, and diagnostic method
US20130316958A1 (en) Highly potent peptides to control cancer and neurodegenerative diseases
WO2016152352A1 (en) Melanoma-specific biomarker and use thereof
US20170355997A1 (en) Methods and compositions for treating or preventing pruritis
JP6852926B2 (en) Disease activity determination / prognosis evaluation of preventive / therapeutic agents for diseases related to cell migration regulation and diseases of lung interstitium
JP2019525903A (en) Methods for diagnosis and treatment of metastatic cancer
WO2009084668A1 (en) Method of inhibiting cancer cell proliferation, proliferation inhibitor and screening method
US7648827B2 (en) Use of eukaryotic genes affecting cell cycle control or cell cycle progression for diagnosis and treatment of proliferative diseases
JP5263730B2 (en) Preventive and therapeutic agent for feline infectious peritonitis virus (FIPV)
EP4512403A1 (en) Neuropeptide b and w-receptor as a target for treating mood disorders and/or chronic stress
US20260102465A1 (en) Compositions and methods utilizing a novel human foxo3 isoform
JP2018164442A (en) Method for determining, preventing or treating cutaneous squamous cell carcinoma
AU2003225750C1 (en) Novel compositions and methods in cancer associated with altered expression of KCNJ9
EP1474175A2 (en) Agents that regulate apoptosis
WO2006093494A1 (en) Astrocyte elevated gene-1 and its promoter in treatments for neurotoxicity and malignancy
US20040110698A1 (en) Oligonucleotides and methods using same for treating cox-ll associated diseases
WO2001070982A2 (en) Brca-1 regulators and methods of use

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 08745672

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 08745672

Country of ref document: EP

Kind code of ref document: A1