WO2008122097A1

WO2008122097A1 - Synthesis of standards for detection and quantification of nucleic acids and kit

Info

Publication number: WO2008122097A1
Application number: PCT/BR2008/000091
Authority: WO
Inventors: Eraldo Luiz Batista Jr.; Diógenes Santiago SANTOS; Jocelei Maria Chies; Luiz Augusto Basso
Original assignee: União Brasileira De Educação E Assistência - Mantenedora Da Pucrs; Quatro G Pesquisa & Desenvolvimento
Priority date: 2007-04-05
Filing date: 2008-04-04
Publication date: 2008-10-16
Also published as: BRPI0701529A2

Abstract

The present invention provides effective means by which nucleotide sequences of any organism can be used as standards for detection/quantification of these organisms. The reference standards of this invention are particularly useful to perform absolute quantification of nucleotide sequences and/or microorganisms from DNA found in biological samples, biological fluids, food and cosmetics, with the additional use of the Fluorescence-associated Polymerase Chain Reaction (real-time PCR) technique. The applications of the invention include research involving quantification of nucleic acids (DNA/RNA), as well as DNA/RNA of organisms such as viral and bacterial pathogens. Therefore, this invention is useful in diagnosis of infectious diseases, food industry and cosmetic industry. This invention also provides an improved method for detection/quantification of nucleotide sequences and a kit.

Description

Synthesis of Standards for Detection and Quantification of Nucleic Acids and Kit

Field of the Invention The invention herein presented is related to the synthesis of reference standards containing nucleotide sequences, to its use in the detection and/or quantification of nucleotide sequences of biological samples and to the development of kits containing these sequences. More specifically, the invention enables practical and effective means by which nucleotide sequences of any known organism can be detected and quantified noteworthy when amplification of nucleic acids based on the Polymerase Chain Reaction (PCR), quantitative PCR and fluorescence-based PCR (Real-Time PCR) are used. The applications of the present invention involve detection and quantification of absolute numbers of any nucleotide sequence of any organism, including viruses, bacteria and fungi; this invention is therefore particularly useful in medical diagnosis, when detection and determination of absolute numbers of pathogens or putative pathogens is necessary, in public health services and surveys, and in the food and cosmetic industries. This invention also provides an improved process for detection and quantification of nucleotide sequences that can be presented as a kit.

Related Prior Art

It has been demonstrated that the genomic DNA content of microorganisms is positively related to its number. This is feasible since, for instance, in the case of bacteria, one molecule of double-stranded genomic DNA corresponds to one cell of the microorganism. This DNA contains the sequences of nucleotides that encodes for the proteins needed for proper functioning of the cell. Due to the particularities and differences observed in the distribution of sequences and nucleotides among different species, these very sequences serve as "fingerprints", or genetic ids of these organisms. Thus, the detection of a particular sequence, specific for an organism, in a biological sample, implies the presence of this organism or the contamination of the sample by this organism. Furthermore, considering the aforementioned, the determination of the number of times the id sequence is present will ultimately indicate the number of organisms in that sample (1 molecule of double-stranded DNA =1 id sequence of the organism =1 organism). The PCR technique takes advantage of an enzymatic reaction catalyzed by a thermostable DNA polymerase expressed by bacteria found in the hot springs. DNA polymerase exerts its activity by catalyzing the formation of phosphodiester bonds between nucleotides, enabling the synthesis of a new complementary DNA strand. To this end, the PCR technique uses short oligonucleotide sequences (primers) that act as starting sequences for the elongation of a new strand to be synthesized from a template DNA. Thus, many more molecules of a target DNA sequence can be synthesized from a single molecule of template DNA, in an actual amplification reaction. The PCR technique has been used to detect sequences from a myriad of microorganisms by the design and synthesis of primers that recognize and anneal to target-sequences of that very organism, enabling its amplification and detection. These primers are incubated with the total DNA purified from a biological fluid or other source, along with reagents that will enable the amplification reaction to proceed. The mixture is further subjected to a series of cycles that heat up and cool down the samples. The change in temperature controls the events within the mixture by activating the polymerase and enabling the primers to strategically recognize the exact sites of the template DNA where to anneal. Every cycle of the process will duplicate the number of molecules of DNA that contains the target sequence determined by the flanking primers. Therefore, the primers act as "seekers" of the target- sequence in case the DNA sample contains the target sequence one is willing to detect and/or quantify. In the absence of the target sequence (i.e. a biological fluid that is not contaminated with the microorganism of interest), the primers will not be able to anneal to their complimentary sequences in the template DNA and, as a consequence, there will be no detectable amplification signal. The Real Time PCR (RT-PCR) technology merges the principles of the PCR (briefly described above) with those of Fluorescence Ressonance Energy Transfer (FRET). According to this application, the primers are associated with fluorescent molecules (SybrGreen, Molecular Becons, TaqMan), making it possible to monitor the increase in the number of molecules, since there is also an increase in the fluorescence for every new molecule of DNA synthesized by polymerase during the amplification.

The analysis of the DNA content present in a sample can be based on the exponential increase in the intensity of fluorescence, which directly reflects the DNA content. Thus, samples that contain the same number of DNA molecules will likely present the same, reproducible pattern of increase of fluorescence. The proper analysis of this process enables the determination of the absolute numbers of molecules of the gene chosen to be the "ID" gene of that microorganism. During this process, an exponential amplification of the target DNA is achieved, i.e., for every amplification cycle the target DNA is doubled.

In the case of a biological sample, it is possible to estimate the total numbers of a microorganism DNA based on the amplification pattern of the reaction. The same applies to detect/quantify viruses, bacteria, fungi and any free nucleic acid. The fluorescence generated during amplification is expressed as Relative Units of Fluorescence (RFU). This unit reflects the intensity of fluorescence but does not enable, per se, the determination of the absolute number of DNA molecules since it is an arbitrary value, though reproducible according to a scale. Back to the aforementioned example of a biological sample containing a microorganism, in order to the RFUs to be converted into absolute numbers of DNA molecules and thus microorganisms, it is imperative the use of DNA standards. These standards are DNAs mixtures of known concentration, which must contain the ID sequences of the microorganism to be detected/quantified. The standards must be selectively and specifically recognized by the primers designed for that target microorganism and will serve as references that enable the conversion of RFUs into absolute numbers of DNA. To this end, the standard DNA corresponding to a known number of microorganisms is subjected to a serial dilution, enabling the system to cover a wide range of DNA numbers during the generation of fluorescence.

Previous patents describe methods to quantify microorganisms using PCR as a tool, but none of them employ or even suggest the approach herein presented. The north-American patent US 6,312,930, entitled "Method for detecting bacteria using PCR" (2001) describes the detection of bacteria through the culturing of the sample to be analyzed in non-selective media, followed by the isolation of genomic DNA and detection of the target bacteria with primers and PCR. A control DNA from the target bacteria has to be analyzed in parallel as a positive control. This approach requires genomic DNA of the target bacteria to be available.

The north-American patent US 6,277,560, entitled ""Microorganism quantitation and detection method and kit using an external standard" (2001) reports the quantification of microorganisms using PCR and a series of standards for concentration determination. To this end, samples of human or animal tissues known to be contaminated with the target microorganism , or even microorganisms in culture, are subjected to DNA and or RNA isolation (for viruses). Then, the DNA or RNA of the microorganisms is subjected to spectrophotometry and the number of RNA/DNA molecules is estimated through absorbance. In this approach the DNAs used as standards are obtained either from cell culture or living tissues know to be infected by the target microorganism. A key limitation here is that the DNA/RNA isolated from tissue or blood cells contaminated with the microorganism will also contain host DNA, which will generate optical densities higher that of the target organism alone. Furthermore, bacteria cell and virus culturing facilities require trained personnel and higher costs and risks.

The international patent application WO 03/068918, intitulada "High- Sensitivity Real-Time Polymerase Chain Reaction for Detection of Nucleic Acids", proposes the use of fluorescence-based PCR to detect DNA and RNA of Chlamydia, using primers/oligonucleotides. The process comprises the quantification using DNA or RNA standards directly isolated from eukaryotic cells co-incubated with strains of the microorganisms of interest such as C. psittaci strain B577 (ATCC VR-656) e C. pneumoniae strain DC/CWL- 029 (ATCC VR-1310) for instance, and even contaminated tissues. The French patent FR 2740782, entitled "Detection and quantitation of microorganisms by measuring nucleic acid content" presents a technique and kit for detection and quantification of microorganisms that contains external standards in the analysis of biological fluids. A limitation of this technology lies on the fact that the external DNA standards are obtained directly from the microorganism of interest, i.e., it involves culturing the microorganism.

The Brazilian patent application Pl 0506047-8 yet to be published and of the present inventors, enables a new method for synthesis of nucleotide sequences that overcomes the need for a biological sample as a template. Nevertheless, said patent application does not report the synthesis and use of such sequences in the quantitative analysis of nucleotide sequences leading to absolute numbers of organisms, which are the cornerstone of the invention herein described. The method for synthesis of nucleotide sequences described in Pl 0506047-8 comprises a series of steps: a) anneal at least two nucleotide sequences designed by the user, in which at least parts of the sequences have overlapping regions; (b) enable conditions so that the overlapping regions form double-stranded DNA and a remaining non-overlapping single-stranded region; (c) add monomers and reagents so that DNA polymerase can elongate the single-stranded region into a double stranded complimentary DNA; (d) add at least one new nucleotide sequence designed by the user in which part of it contains a region that overlaps any of the terminal regions of the sequence generated in step (c) and (d) repeat steps (b) and (c) so the complete extended nucleotide sequence is produced. The aforementioned approach is to be used as means by which the reference standards herein described must be obtained.

The present invention overcomes the difficulties of the previous ones, enabling a new and improved process of synthesis of standards used in the detection and absolute quantification based on the detection of DNA/RNA of microorganisms using the PCR technique. The standards of the present invention are used in the PCR reaction during the real-time detection and quantification of any nucleic acid.

Summary of the Invention

The present invention aims at providing standards made of nucleotide sequences as references for the detection and quantification of nucleotide sequences of microorganisms present in biological samples, enabling the determination of its absolute numbers. Therefore, the standards generated by the proposed invention contain no other sequences than that of the target sequence, which increases specificity and sensitivity of the system due to the absence of other similar DNA/RNA sites, something that might happen with other conventional types of standards.

In a similar fashion, thus being another subject of the present invention, the standards generated by the herein described invention can be combined with other applications, for instance, those known as "single nucleotide polymorphisms (SNPs), enabling detection and/or concomitant quantification of different target sequences, including genomic DNA and RNA transcripts.

Another object of the present invention is to enable processes leading to the detection and/or quantification of nucleotide sequences and/or organisms from biological samples with the use of the standards herein described in biochemical reactions.

In a preferred embodiment, the processes for detection and/or quantification of nucleotide sequences and/or microorganisms in biological samples of the present invention are less prone to the production of false- negatives, since the standards enable more sensitivity and efficiency to the reactions.

Another object of the present invention is to produce kits for detection and/or quantification of nucleotide sequences and/or microorganisms from biological samples. The kits could also have the other reagents necessary for the PCR reactions such as dNTPs, DNA polymerase etc. These and other objectives of the present invention will be appreciated by those skilled in the art , and will be described in further detail in the following sections of this document.

Brief Description of the Figures

The following pictures are part of the present invention and have been added in order to better clarify some particularities of its principles.

Figure 1 depicts graphically the 16s ribossomal RNA gene sequence taken from the genomic DNA of a known oral pathogen (Porphyromonas gingivalis), as annotated in the GenBank. Highlighted in gray is the part of the whole sequence to be used as amplicon, i.e., the sequence that will be amplified and that will become the sequence-id of the target pathogen (P.g.). Underlined are the primers' short sequences flanking the amplicon, i.e., the primer forward (tcacgaggaactccgattgc), the reverse primer (actgaagcacgaaggc) and the Taqman probe (cagcttgccatactgcg) tagged with a fluorophore. The region to be synthesized using the Pl 0506047-8 comprises the region flanked by the primers forward and reverse (underlined) plus 50 to 80 bases upstream to the first nucleotide of the forward primer and downstream to the last base of the reverse primer. This strategy creates a longer sequence, bringing it to a total of 190 pairs of bases, which can be divided into 4 blocks of approximately 50 pairs of bases to be synthesized using the herein described invention.

Figure 2 depicts an agarose gel stained with ethidium bromide showing two fragments constructed from the merging of two oligonucleotides each (Fr1 and Fr2). On the right side is depicted two samples of the final id sequence of the Porphyromonas gingivalis 16s ribossomal RNA already merged together (Fr1+Fr2). This fragment has 190 bases and is ready to be gel- purified and cloned before being used as a standard.

Figure 3 depicts an amplification plot generated by the thermalcycler software, containing the sequences synthesized to be used as standards in the quantification of the pathogen Porphyromonas gingivalis. Fluorescence intensity (y axis) increases more rapidly in the mixtures containing higher numbers of the plasmid containing the id-sequence (x axis, Ct).

Figure 4 depicts the linear regression of the serial dilution for the standards created by the technology of synthesis described in the Pl 0506047- 8. The graph depicts a high R² (0.9997) for the serial dilution of standards in the

10⁶, 10⁵, 10⁴ e 10³ recombinant plasmid units. The calculation of the total number of DNA plasmid molecules containing the id-sequence of the pathogen involved the determination of the concentration of the DNA through a spectrophotometer and then according to the method proposed by Yun et al. (Nucleic Ac. Res. 2006) as described below:

1. Calculation of the mass of 1 molecule of plasmid DNA containing the id- sequence to Porphyromonas gingivalis. m=(n). (1.096x10^"21 g/bp) where: N=# of base pairs (3,740bp)

M= mass (g) M=4.09904x10^"18

2. Mass of recombinant plasmid DNA for 10⁶ copies.

10⁶copies X mass (g) of 1 plasmid m=4, 0990x10^"12

3. [ ] for 10⁶ molecules in 5 ul.

V= 4,099x10^"12/5uI v=8,20x10-¹³ g/ul

4. Dilution of pDNA to a concentration of 10⁶ molecules/5 ul (2.96 x 10^~7 g/ul) departing from a stock concentration of 269 ug/ml.

C1.V1 =C2.V2 where: C1 =5.92x10^"10(plasmid DNA stock diluted 500:1) V1=?

C2=8.20x10^"13 (obtained on step 3) V2=1 ml (total volume of pDNA)

V1=1.5 ul de pDNA Then, according to this example it will be necessary 1.5 ul of stock pDNA containing the Porphyromonas gingivalis short sequence of the 16s ribossomal RNA gene in a final volume of 1 ml (998.5 ul of H₂O) for a final mixture containing 10⁶ units of standard DNA per 5 ul of H₂O. Figure 5 depicts the amplification plot of the serial dilutions of plasmids containing the Porphyromonas gingivalis short sequence of the 16s ribossomal RNA gene along with the amplification of a biological sample of an individual who is contaminated with Porphyromonas gingivalis. The process enabled detection and quantification of the pathogen in the sample. Calculation of the quantity is based on the linear regression equation of increasing fluorescence, which is proportional to the increasing number of molecules of plasmid DNA. The regression equation (y=ax+b) allows the calculation of the absolute numbers of molecules.

Figure 6 shows the schematic view of one of the preferred embodiments of the invention, comprising the steps through quantitation. In this case, just by using the information about the target sequence that is available, it is possible to get the de standards, i.e., no manipulation of contaminated biological samples are necessary to complete the process. All that is required is access to the DNA sequence from the Databank and the assembly of the nucleotide sequence of interest described in Pl 0506047-8. Once it has been assembled, before it can be used as a standard, the sequence is cloned into a DNA vector, or plasmid, which, after transformation of E. coli cells is replicated, enabling the purification of high yields of recombinant plasmid DNA containing the target sequence. The plasmid DNA is further quantified by fluorescence or spectrophotometry, quantified and processed according to the aforementioned equations, subjected to a serial dilution and then used as standards.

Figure 7 depicts a schematic view of the detection and analysis of oral pathogens, described in example 1 of the detailed description below. Biological samples are collected from a patient^'s mouth, more specifically from a tooth surface. The biofilm composed by bacteria is lysed and the total DNA isolated; the DNA is then amplified in parallel with the standards of known copy number herein described, which serve as a reference for quantification of the target pathogen present in the biological sample.

Detailed Description of the Invention For the sake of simplicity, it is understood from now on that "biological sample" is any sample, fluid, solid, tissue, food or any other material that could contain a part of an artificial or natural nucleotide sequence.

The present invention enables the production of standards that contain target nucleotide sequences for the detection and quantification of microorganisms from biological samples. The standards produced by this process are devoid of spurious contaminations with cellular structures or toxins since only the information regarding the sequence is necessary, rather than the target organisms themselves.

Once combined with variable sequences, such as SNPs, the same approach enables de detection and concomitant quantification of different target sequences, i.e., genomic DNA and/or RNA transcripts.

The present invention also enables a more sensitive method, less prone to false-negatives, due to its specificity. As a result, kits containing the standards produced by the herein described invention might offer a precise, convenient and cost-effective way over similar products.

The process and the kit herein described enable the detection and/or quantification of nucleotide sequences of organisms or microorganisms, and involve biochemical reactions that end up producing fluorescence, more usually those employed by the Real-Time PCR technology, i.e., SybrGreen™, TaqMan™ and Molecular Beacons™.

Technologies available to date rely on the use of template DNA purified from live pathogens maintained in culture or from DNA isolated from biological samples known to be contaminated with the target pathogen to be analysed. Culture of pathogens may be complex and costly since it requires appropriately designed and built facilities, run by skilled personnel. Safety matters are crucial in this case since culture of some putative targets such as HIV and Mycobacterium tuberculosis pose serious risks to workers. In a preferred embodiment of the invention the standards are obtained by the use of the method described on Pl 0506047-8. The standards are then used for the detection and/or absolute quantification of the nucleotide sequences of the target organisms, ideally using Real-Time PCR or fluorescence-based polymerase chain reaction technology. This technique can be implemented in any molecular biology laboratory that has a fluorescence-based thermalcycler, access to synthesis of nucleotide primers, along with reagents, equipments required for cloning of the sequences and a spectrophotometer/fluorescence reader.

The following steps describe some of the preferred embodiments of the invention, which does not limit its scope, though. For the sake of simplicity, the following steps will describe the method of quantification of a bacterial species, although the invention can be used with virtually any known nucleotide sequence, DNA or RNA and those from cells from whom genome and/or transcriptome have been totally or partially sequenced.

Example 1 - Design and Synthesis of Standards for Porphyromonas gingivalis. Descriptions of the steps involved in the quantification of P. gingivalis using fluorescence-based PCR. Noteworthy, the same method can be applied in the detection/quantification of any other known organism whose DNA/RNA sequence can be found in any Databank (Genbank for instance). The selection of a specific region of the DNA/RNA from any known single-copy gene will serve as the organism id-sequence; this sequence must be specific for this organism without significant overlaps with the sequences of the host cells, other bacteria, viruses etc. Step 1 - Selecting the target id-sequence of the pathogen of interest

First of all, a nucleotide sequence of the organism of interest must be determined, which will become its id-sequence. In the herein described example the 16s ribosomal RNA gene sequence of the Porphyromonas gingivalis has been chosen. Details about the sequence are published at GenBank and are also depicted in figure 1. In this example the BLAST alignment tool was used to verify for possible similarities of the chosen sequence with other pathogens and host (human) genes. It must be emphasized that a different criteria could be used, for instance, the selection of a target sequence that are shared by a group of pathogens. That would enable quantification/detection of groups of pathogens based on their function or a particular feature.

Within the selected whole DNA sequence, a shorter one was chosen to be the amplification target. This sequence must be very specific for the pathogen of interest and might have variable size depending on the chemistry used (TaqMan, SybrGreen etc.). Here we will use the TaqMan chemistry and a 90 bp sequence chosen to be the target of amplification. Once the target sequence has been established, additional analysis using alignment tools are to be carried out to ensure no significant similarities exist with other annotated sequences.

Step 2 - Design and synthesis of the oligonucleotides used in the reproduction of the region to be detected (target region).

The design and synthesis of the oligonucleotides to be used in the build up of the target sequence to be detected were carried out according to Pl 0506047-8, which involve the following components: a)design of two oligonucleotide sequences that partially overlap; b) make it possible through adjustment of reactions and reagents for the two regions to overlap during amplification, forming a partially double-stranded sequence; c) add the components that will make it possible for the reaction to proceed and create ideal conditions for the polymerase to start elongating the remaining single- stranded region, generating a full double-stranded oligonucleotide; d) add another oligonucleotide, which partially overlaps any of the terminal sequences of the DNA produced in step c and, e) repeat steps b and c in order to get a full length nucleotide sequence reproducing the target to be detected. Once the target sequence has been properly determined, one can start designing the oligonucleotides to be used as standards. To that end, the total size' of the sequence to be built involves the original sequence plus 50 to 80 nucleotides up and downstream to the last nucleotides located at the 5' and 3', according to figure 1. To increase the cloning efficiency of the sequence in further steps, the total number of nucleotides, including those of the target plus the extra ones at the 3' and 5' ends, will be 150 to 250 bp. For a total of 190 bp to be synthesized using the Pl 0506047-8 (are within the square in Fig. 1), 4 primers of approximately 50 bp were used:

Primer 1 : 5'-ggcaagctgccttcgcaatcggagttcctcgtgatatctatgcatttcac-3' Primer 2: 5'-ggcaagctgccttcgcaatcggagttcctcgtgatatctatgcatttcac-3' Primer 3: 5'-gcagcttgccatactgcgactgacactgaagcacgaaggcgtgggtatca-3'

Primer 4: 5'-atcgtttactgcgtggactaccagggtatctaatcctgtttgatacccac-3' Figure 2 shows an agarose gel stained with ethidium bromide, depicting two fragments assembled with one pair of oligonucleotides each (FM and Fr2).

On the right two samples of the final fragment (Fr1+Fr2) assembled, with the total size of 190 bp, ready to be gel-purified and cloned before they can be used as standards.

Step 3 - Cloning of the Sequences into plasmid vectors

Once they've been assembled, the nucleotide sequences are cloned into circular DNAs (plasmids), according to figure 6. This approach enables a rapid amplification and production of stocks of plasmids containing the sequence of interest that can be maintained at low temperatures for further propagation.

Once ligated, the plasmids containing the sequences are electroporated into E. coli cells and further spread onto agar plates. After culturing from 12 to 18 hours at 37C, positive colonies are propagated in liquid media and the plasmid DNA containing the sequence is isolated. The purified DNA is ready to be used as a standard for analysis of biological samples.

Step 4 - Processing the cloned chimeric DNA into standards

As mentioned above, each plasmid contains one copy of the id-gene of the pathogen of interest obtained through the synthesis of chimeric sequences. In this way, every single plasmid represents one cell or artificial unit of the microorganism one is willing to quantify. In the Real-Time PCR dynamics, each plasmid molecule will have a specific pattern of fluorescence that will be identical to that generated by one molecule of the pathogen present in the total DNA isolated from the biological sample. Nevertheless, fluorescence per se does not represent an absolute number, rather it is express in relative fluorescence units (RFUs). Thus, before one can go over an absolute quantification analysis, it is necessary to estimate the number of plasmids. To this end the concentration of plasmid DNA is estimated through fluorescence or spectrophotometry at 260 nm. The absorbance at 260 nm or the concentration determined by fluorescence can be converted into number of molecules as previously described. Figure 3 shows an amplification plot of the plasmid serial dilutions containing the sequences assembled for the detection of the preferred embodiment herein described, i.e., the detection of Porphyromonas gingivalis. The intensity of fluorescence (y axis) increases more rapidly in the mixture that contains more units of the plasmid (x axis, Ct). Once the absolute numbers of plasmid DNA molecules have been determined they can be use as a standard. To this end, a volume containing a determined number of molecules of plasmids carrying the chimeric DNA is subjected to a serial dilution. For example, starting with 10⁶ (1 million) units of plasmids in solution, 3 additional dilutions are prepared, 10⁵ (hundred thousand), 10⁴ (ten thousands) e 10³ (a thousand) units, respectively. Each mixture containing the known number of plasmids will be subjected to amplification through PCR in a real-time thermalcycler. During amplification each dilution will generate a different intensity of fluorescence, which, in this case will have 10 orders of magnitude difference among different concentrations (dilution factor=10). The increase in fluorescence will be directly proportional to the number of molecules present in the mixture, i.e., for every cycle of amplification the fluorescence produced by the most concentrated sample will be higher than the more diluted one and so on according to figure 4. The intensity of the fluorescence of the standards whose concentrations are known enables the estimation of the number of microorganisms of interest in any biological sample. To this end, fluorescence and their respective quantities are subjected to a linear regression analysis, which will allow the determination of the quantity of the microorganisms in the unknown sample. Figure 4 depicts the linear regression relative to the serial dilution of the standards used in the detection of Porphyromonas gingivalis and generated by the chimeric nucleotide sequences technology. The graph show a high R² (0.9997) for the serial dilution obtained with the standards (from 10⁶ to 10³ units of plasmid). In other words, the system sensitivity has detected DNA concentrations in the range of 1 million to one-hundred units of Porphyromonas gingivalis DNA.

Example 2 - Process for detection/quantification of Porphyromonas gingivalis collected from a periodontal inflamed site.

The standards obtained according to example 1 were used in a PCR reaction run in real-time for the detection and quantification of Porphyromonas gingivalis obtained from a periodontal site of a patient presenting gingival inflammation. Figure 7 depicts how the procedure was carried out and in figure 5 the results are presented; 27,660 units of Porphyromonas gingivalis DNA were detected in the sample.

The aforementioned results described in example 1 can be applied to other nucleotide sequences, either DNA or RNA. It is to say that the invention does not present technical limitations when it comes to the type of sample to be analyzed. Furthermore, the combination of different criteria of specificity of different nucleotide sequences to be detected/quantified in a single sample offer clear advantages. For instance, one can detect and quantify different strains of Porphyromonas gingivalis form a single sample and express their distribution as a ratio of different populations of the bacterium based on its pathogenicity. Likewise, the combination of different specificity criteria applied to different target nucleotide sequences in a single sample when the focus of analysis is RNA enables the simultaneous use of more than one standard in a single procedure of detection/quantification. In this case one can characterize the levels of transcription of a group of homologous genes, the expression of mutated versus wild-type genes, viral RNA copy numbers, quantification of different populations of miRNAs, siRNAs and other nucleotide sequences found to be important in diagnosis, prognosis, research and quality control.

Those skilled in the art will readily appreciate the invention and promptly understand that the description herein presented enables the synthesis of standards containing nucleotide sequences, which provides an improved method to detect and quantify nucleotide sequences that can be used to develop a kit containing all the necessary reagents. Subtle modifications on the preferred embodiments herein presented are to be understood as within the spirit of the invention and of the scope of the appended claims.

Claims

ClaimsSynthesis of Standards for Detection and Quantification of Nucleic Acids and Kit

1. Reference standards for the detection and quantification of nucleotide sequences, comprising a single nucleotide sequence without other non-target sequences as well as contaminating cell debris.

2. Reference standards, according to claim 1 , involving at least another nucleotide sequence that may contain deliberate variations of the target sequence.

3. Reference standards, according to claim 2, characterized by the fact that the aforementioned variation might include insertions, deletions, inversions, substitutions and their combinations.

4. Reference standards, according to claims 1-3, characterized by the fact that it is obtained by a process comprising the following steps: a) merge at least two synthetic nucleotide sequences designed by the user, in which at least part of such sequences contain overlapping regions; b) create appropriate conditions for these two overlapping regions to anneal to each other, leaving part of the remaining sequence single- stranded (non-overlapping); c) add to the mixture all the reagents necessary for DNA polymerase to elongate the single-stranded, non-overlapped region, into a complete double stranded form; d) add another synthetic nucleotide sequence designed by the user, in which part of this additional sequence contains a region that overlaps any of the terminal ends of the sequence obtained in "c", and repeat steps (B) and (C) in order to get a extended nucleotide sequence.

5. Reference standards, according to claim 4, characterized by the fact that the extended sequence obtained in step (d) is cloned into a plasmid e then introduced into a host cell that will replicate abundantly;

6. Process for detection and/or quantification of nucleotide sequences, characterized by the fact that it involves the contact of at least two nucleotide sequences that overlap at different locations of the target nucleotide-sequence, ' being the latter: (a) the sample that supposedly contains de target nucleotide sequence to be detected/quantified;

(b) at least one reference standard that contains a nucleotide sequence devoid of other non-target, spurious sequences, cell debris, being the standard able to be amplified by the primers thus creating conditions where the overlapping regions cam anneal to each other, generating a double-stranded form, in a way that a polymerase will elongate the remaining single- stranded DNA generating a double-stranded form; create conditions for the double stranded created in the latter step will denature; repeat the extension and denaturation steps as many times as necessary to amplify the copy numbers of the target nucleotide sequence and quantify the target nucleotide sequence supposedly present in the biological sample, having the standards of know concentration as a reference that will associate increase in fluorescence with absolute copy number of DNA molecules.

7. A process, according to claim 6, characterized by the fact that at least two reference standards, in such a way that the standards will serve as a positive control and/or reference standards of different concentrations of nucleotide sequences supposedly present in the biological sample to be analyzed.

8. A process, according to claims 6-7, characterized by the fact that simultaneous or individual detection and quantification of different target sequences, including genomic DNA and/or RNAs.

9. A kit developed for detection and quantification of nucleotide sequences, that includes: (a) at least two nucleotide sequences/primers, where at least part of the sequences contains regions that overlap the target nucleotide sequence supposedly present in the biological sample to be analyzed; the correspondent monomers and polymerase that will extend the overlapping region.

(b) at least one reference standards that contains a sequence devoid of non-target spurious sequences and contamination with cell debris, being the standard able to be amplified by the primers. (c) ways by which the target nucleotide sequence can be directly or indirectly quantified in a biological sample, by direct comparison with the reference standards of varying known concentrations.