WO2008116223A1 - Preq1 riboswitches and methods and compositions for use of and with preq1 riboswitches - Google Patents

Preq1 riboswitches and methods and compositions for use of and with preq1 riboswitches Download PDF

Info

Publication number
WO2008116223A1
WO2008116223A1 PCT/US2008/058050 US2008058050W WO2008116223A1 WO 2008116223 A1 WO2008116223 A1 WO 2008116223A1 US 2008058050 W US2008058050 W US 2008058050W WO 2008116223 A1 WO2008116223 A1 WO 2008116223A1
Authority
WO
WIPO (PCT)
Prior art keywords
riboswitch
preqi
compound
cell
rna
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2008/058050
Other languages
English (en)
French (fr)
Inventor
Ronald R Breaker
Jeffrey E. Barrick
Adam Roth
Wade Winkler
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Yale University
Original Assignee
Yale University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Yale University filed Critical Yale University
Priority to US12/532,538 priority Critical patent/US20100152212A1/en
Priority to JP2009554792A priority patent/JP2010521978A/ja
Priority to EP08799599A priority patent/EP2139909A4/en
Publication of WO2008116223A1 publication Critical patent/WO2008116223A1/en
Anticipated expiration legal-status Critical
Priority to US13/617,993 priority patent/US20130012527A1/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04Antibacterial agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00

Definitions

  • the disclosed invention is generally in the field of gene expression and specifically in the area of regulation of gene expression.
  • Precision genetic control is an essential feature of living systems, as cells must respond to a multitude of biochemical signals and environmental cues by varying genetic expression patterns. Most known mechanisms of genetic control involve the use of protein factors that sense chemical or physical stimuli and then modulate gene expression by selectively interacting with the relevant DNA or messenger RNA sequence. Proteins can adopt complex shapes and carry out a variety of functions that permit living systems to sense accurately their chemical and physical environments. Protein factors that respond to metabolites typically act by binding DNA to modulate transcription initiation (e.g. the lac repressor protein; Matthews, K.S., and Nichols, J. C, 1998, Prog. Nucleic Acids Res. MoI. Biol. 55, 127-164) or by binding RNA to control either transcription termination
  • transcription initiation e.g. the lac repressor protein; Matthews, K.S., and Nichols, J. C, 1998, Prog. Nucleic Acids Res. MoI. Biol. 55, 127-164
  • Protein factors respond to environmental stimuli by various mechanisms such as allosteric modulation or post-translational modification, and are adept at exploiting these mechanisms to serve as highly responsive genetic switches (e.g. see Ptashne, M., and Gann, A. (2002). Genes and Signals. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY).
  • RNA can take an active role in genetic regulation. Recent studies have begun to reveal the substantial role that small non-coding RNAs play in selectively targeting niRNAs for destruction, which results in down-regulation of gene expression (e.g. see Hannon, GJ. 2002, Nature 418, 244-251 and references therein). This process of RNA interference takes advantage of the ability of short RNAs to recognize the intended niRNA target selectively via Watson-Crick base complementation, after which the bound mRNAs are destroyed by the action of proteins. RNAs are ideal agents for molecular recognition in this system because it is far easier to generate new target-specific RNA factors through evolutionary processes than it would be to generate protein factors with novel but highly specific RNA binding sites.
  • RNA Although proteins fulfill most requirements that biology has for enzyme, receptor and structural functions, RNA also can serve in these capacities. For example, RNA has sufficient structural plasticity to form numerous ribozyme domains (Cech & Golden, Building a catalytic active site using only RNA. In: The RNA World R. F. Gesteland, T. R. Cech, J. F. Atkins, eds., pp.321-350 (1998); Breaker, In vitro selection of catalytic polynucleotides. Chem. Rev. 97, 371-390 (1997)) and receptor domains (Osborne & Ellington, Nucleic acid selection and the challenge of combinatorial chemistry. Chem. Rev.
  • Bacterial riboswitch RNAs are genetic control elements that are located primarily within the 5 '-untranslated region (5'-UTR) of the main coding region of a particular mRNA. Structural probing studies (discussed further below) reveal that riboswitch elements are generally composed of two domains: a natural aptamer (T. Hermann, D. J. Patel, Science 2000, 287, 820; L. Gold, et al., Annual Review of Biochemistry 1995, 64, 763) that serves as the ligand-binding domain, and an 'expression platform' that interfaces with RNA elements that are involved in gene expression (e.g. Shine-Dalgarno
  • a regulatable gene expression construct comprising a nucleic acid molecule encoding an RNA comprising a preQr responsive riboswitch operably linked to a coding region, wherein the riboswitch regulates expression of the RNA, wherein the riboswitch and coding region are heterologous.
  • the riboswitch can comprise an aptamer domain and an expression platform domain, wherein the aptamer domain and the expression platform domain are heterologous.
  • the riboswitch can also comprise two or more aptamer domains and an expression platform domain, wherein at least one of the aptamer domains and the expression platform domain are heterologous. At least two of the aptamer domains can exhibit cooperative binding.
  • a riboswitch wherein the riboswitch is a non-natural derivative of a naturally-occurring preQi -responsive riboswitch.
  • the riboswitch can comprise an aptamer domain and an expression platform domain, wherein the aptamer domain and the expression platform domain are heterologous.
  • the riboswitch can further comprise one or more additional aptamer domains. At least two of the aptamer domains can exhibit cooperative binding.
  • the riboswitch can be activated by a trigger molecule, wherein the riboswitch produces a signal when activated by the trigger molecule.
  • a method of detecting a compound of interest comprising: bringing into contact a sample and a riboswitch, wherein the riboswitch is activated by the compound of interest, wherein the riboswitch produces a signal when activated by the compound of interest, wherein the riboswitch produces a signal when the sample contains the compound of interest, wherein the riboswitch comprises a preQi- responsive riboswitch or a derivative of a preQi -responsive riboswitch.
  • the riboswitch can change conformation when activated by the compound of interest, wherein the change in conformation produces a signal via a conformation dependent label.
  • the riboswitch can also change conformation when activated by the compound of interest, wherein the change in conformation causes a change in expression of an RNA linked to the riboswitch, wherein the change in expression produces a signal.
  • the signal can be produced by a reporter protein expressed from the RNA linked to the riboswitch.
  • Also disclosed is a method comprising: (a) testing a compound for inhibition of gene expression of a gene encoding an RNA comprising a riboswitch, wherein the inhibition is via the riboswitch, wherein the riboswitch comprises a preQi -responsive riboswitch or a derivative of a preQi -responsive riboswitch, (b) inhibiting gene expression by bringing into contact a cell and a compound that inhibited gene expression in step (a), wherein the cell comprises a gene encoding an RNA comprising a riboswitch, wherein the compound inhibits expression of the gene by binding to the riboswitch.
  • a method of identifying preQi -responsive riboswitches comprising assessing in-line spontaneous cleavage of an RNA molecule in the presence and absence of preQi, wherein the RNA molecule is encoded by a gene regulated by preQi, wherein a change in the pattern of in-line spontaneous cleavage of the RNA molecule indicates a preQi -responsive riboswitch.
  • the compound can have the structure of Formula II:
  • the compound can have the structure of Formula II:
  • the compound can have the structure of Formula II:
  • the compound can have the structure of Formula II:
  • R 5 is NH 2 + , NH 3 + , CO 2 H, B(OH) 2 , CH(NH 2 ) 2 , C(NH 2 ) 2 + , CNH 2 NH 3 + , C(NH 3 + ) 3 , hydroxymethyl, 1-hydroxyethyl, 2-hydroxyethyl, 1,2- dihydroxyethyl, 2-hydroxy-l-methylethyl,l-hydroxypropyl, 2-hydroxypropyl, 3- hydroxypropyl, 1,3-dihydroxypropyl, 2,3-dihydroxypropyl, 1-hydroxybutyl, 2- hydroxybutyl, 3-hydroxybutyl, 4-hydroxybutyl, 1, 4 dihydroxybutyl, 2,4-dihydroxybutyl, l-hydroxy-2-methylpropyl, 2-hydroxy-2-methylpropyl, 3-hydroxy-2-methylpropyl, 1- hydroxymethyl-1-methylethyl, trishydroxymethylmethyl, thiolmethyl, 1-thiole
  • R 5 is NH 2 + , NH 3 + , CO 2 H, B(OH) 2 , CH(NH 2 ) 2 , C(NH 2 ) 2 + , CNH 2 NH 3 + , C(NH 3 + ) 3 , hydroxymethyl, 1-hydroxyethyl, 2-hydroxyethyl, 1,2- dihydroxyethyl, 2-hydroxy-l-methylethyl,l-hydroxypropyl, 2-hydroxypropyl, 3- hydroxypropyl, 1,3-dihydroxypropyl, 2,3-dihydroxypropyl, 1-hydroxybutyl, 2- hydroxybutyl, 3-hydroxybutyl, 4-hydroxybutyl, 1, 4 dihydroxybutyl, 2,4-dihydroxybutyl, l-hydroxy-2-methylpropyl, 2-hydroxy-2-methylpropyl, 3-hydroxy-2-methylpropyl, 1- hydroxymethyl-1-methylethyl, trishydroxymethylmethyl, thiolmethyl, 1-thiole
  • the compound can have the structure of Formula II:
  • the compound can have the structure of Formula II:
  • R 5 is NH 2 + , NH 3 + , CO 2 H, B(OH) 2 , CH(NH 2 ) 2 , C(NH 2 ) 2 + , CNH 2 NH 3 + , C(NH 3 + ) 3 , hydroxymethyl, 1-hydroxyethyl, 2-hydroxyethyl, 1,2- dihydroxyethyl, 2 -hydroxy- 1 -methyl ethyl, 1-hydroxypropyl, 2-hydroxypropyl, 3- hydroxypropyl, 1,3-dihydroxypropyl, 2,3-dihydroxypropyl, 1-hydroxybutyl, 2- hydroxybutyl, 3-hydroxybutyl, 4-hydroxybutyl, 1, 4 dihydroxybutyl, 2,4-dihydroxybutyl, l-hydroxy-2-methylpropyl, 2-hydroxy-2-methylpropyl, 3-hydroxy-2-methylpropyl, 1- hydroxym ethyl- 1 -methyl ethyl, trishydroxymethylmethylmethylmethyl
  • the cell can be identified as being in need of inhibited gene expression.
  • the cell can be a bacterial cell.
  • the compound can kill or inhibit the growth of the bacterial cell.
  • the compound and the cell can be brought into contact by administering the compound to a subject.
  • the cell can be a bacterial cell in the subject, wherein the compound kills or inhibits the growth of the bacterial cell.
  • the subject can have a bacterial infection.
  • the cell can contain a preQi -responsive riboswitch.
  • the compound can be administered in combination with another antimicrobial compound. The compound can inhibit bacterial growth in a biofilm.
  • a method of producing preQi comprising: cultivating a mutant bacterial cell capable of producing preQi , wherein the mutant bacterial cell comprises a mutation in the preQi riboswitch, which mutation increases preQi production by the mutant bacterial cell in comparison to a cell not having the mutation; and isolating preQi from the cell culture, thereby producing preQi.
  • This method can yield at least a 10% increase in preQi production compared to cultivating a bacterial cell that does not comprise the mutation in the preQi riboswitch.
  • This method can yield at least a 10% increase in preQi production compared to cultivating a bacterial cell that does not comprise the mutation in the preQi riboswitch.
  • This method can yield at least a 25% increase in preQi production compared to cultivating a bacterial cell that does not comprise the mutation in the preQi riboswitch.
  • the preQi riboswitch can comprise a knockout mutation.
  • a bacterial cell comprising a mutation in a preQi riboswitch, which mutation measurably increases preQi production by the cell when compared to a cell that does not have the mutation.
  • Also disclosed is a method of inhibiting bacterial cell growth comprising: bringing into contact a cell and a compound that binds a preQi -responsive riboswitch, wherein the cell comprises a gene encoding an RNA comprising a preQj- responsive riboswitch, wherein the compound inhibits bacterial cell growth by binding to the preQi -responsive riboswitch, thereby limiting preQi production.
  • This method can yield at least a 10% decrease in bacterial cell growth compared to a cell that is not in contact with the compound.
  • the compound and the cell can be brought into contact by administering the compound to a subject.
  • the cell can be a bacterial cell in the subject, wherein the compound kills or inhibits the growth of the bacterial cell.
  • the subject can have a bacterial infection.
  • the compound can be administered in combination with another antimicrobial compound.
  • a method of detecting preQi in a sample comprising: bringing a preQi -responsive riboswitch in contact with the sample; and detecting interaction between preQj and the preQj -responsive riboswitch, wherein interaction between preQi and the preQi -responsive riboswitch indicates the presence of preQi.
  • the preQi- responsive riboswitch can be labeled.
  • Also disclosed is a method comprising inhibiting gene expression of a gene encoding an RNA comprising a riboswitch by bringing into contact a cell and a compound that was identified as a compound that inhibits gene expression of the gene by testing the compound for inhibition of gene expression of the gene, wherein the inhibition was via the riboswitch, wherein the riboswitch comprises a preQi -responsive riboswitch or a derivative of a preQi -responsive riboswitch.
  • Figure 2 shows queuosine biosynthesis in eubacteria. Enzymes known to participate in Q production are indicated, together with required cofactors (in parentheses), at the respective steps. Transformations for which specific corresponding enzymes remain to be identified are indicated by question marks.
  • Figure 3 The 5' UTR of the B. subtilis queCDEFmRNA undergoes structural modulation in response to preQi.
  • (a) Primary and secondary structure consensus models corresponding to each type of the conserved domain associated with preQi biosynthetic genes (SEQ ID NOS: 43, 44, and 45). Nucleotides in gray and black are more than 95% and 80% conserved, respectively, among the sequence representatives shown in Figure 1. Less conserved regions, which may vary slightly in the number of nucleotides, are represented by circles or heavy lines. Locations of less conserved, putative stem elements are indicated in gray. R denotes A or G; Y denotes C or U. (b) Sequence and secondary structure model of 106 queC, a part of the B.
  • subtilis queC 5' UTR that contains predicted aptamer and terminator structures (SEQ ID NO: 45).
  • Sites of spontaneous RNA cleavage that are responsive to or independent of the presence of preQi are superimposed on the model and derived from structure probing analysis in c.
  • the 5 ' terminal guanosyl residue is non-native and was introduced to facilitate transcription in vitro using T7 RNA polymerase.
  • Constant scission was found for nucleotides 16-27, 31-38, 57, 58, 67, 77-81, 83 and 93-95 of SEQ ID NO:45. Reduced scission was found for nucleotides 50-53, 59, 60, 70, 71 and 74-76 of SEQ ID NO:45. Increased scission was found for nucleotides 55 and 56 of SEQ ID NO:45. (c) In-line probing analysis of 106 gweC RNA reveals sites of increased and decreased strand scission (arrowheads) that are induced in the presence of preQi.
  • a value approaching 1.0 is expected if retention of H-guanine occurs in the RNA chamber, as would result from equilibrium dialysis in the absence of unlabeled competitor or in the presence of unlabeled purines that do not function as competitors under the assay conditions (100 nM 3 H-guanine, 20 ⁇ M RNA, 60 ⁇ M unlabeled analog).
  • G guanine; preQi, 7-aminomethyl- 7-deazaguanine;
  • A adenine; 7dG, 7-deazaguanine.
  • Figure 5 shows determination of the minimal aptamer sequence required for binding of preQi.
  • (b) In-line probing analysis reveals that conserved sequences near the 3' end of 36 queC are required for preQj -induced structural modulation. Constructs were incubated in the absence (-) or presence (+) of 10 ⁇ M preQi. Other details and notations are as described in the legend to Fig. 3c.
  • Figure 7 shows effects of variant preQi riboswitches on genetic control in vivo
  • Figure 8 shows preQi riboswitch locations and associated genes.
  • GenBank record accession numbers and nucleotide positions are provided for each riboswitch element in the sequence alignment (Fig. 1).
  • Predicted genes or operons downstream of each riboswitch element are designated by gene locus tags and accompanied by COG database assignments of general protein functions.
  • the precise molecular functions corresponding to most genes in the preQi regulon are currently unknown.
  • Genes of the queCDEF operon have been implicated in Q biosynthesis, however (Reader 2004; Gaur 2005; Van Lanen 2005), and the specific chemical step catalyzed by QueF has been experimentally determined (Van Lanen 2005).
  • RNAs are typically thought of as passive carriers of genetic information that are acted upon by protein- or small RNA-regulatory factors and by ribosomes during the process of translation. It was discovered that certain mRNAs carry natural aptamer domains and that binding of specific metabolites directly to these RNA domains leads to modulation of gene expression. Natural riboswitches exhibit two surprising functions that are not typically associated with natural RNAs. First, the mRNA element can adopt distinct structural states wherein one structure serves as a precise binding pocket for its target metabolite. Second, the metabolite-induced allosteric interconversion between structural states causes a change in the level of gene expression by one of several distinct mechanisms.
  • Riboswitches typically can be dissected into two separate domains: one that selectively binds the target (aptamer domain) and another that influences genetic control (expression platform). It is the dynamic interplay between these two domains that results in metabolite-dependent allosteric control of gene expression.
  • riboswitches Distinct classes of riboswitches have been identified and are shown to selectively recognize activating compounds (referred to herein as trigger molecules). For example, coenzyme B] 2 , glycine, thiamine pyrophosphate (TPP), and flavin mononucleotide (FMN) activate riboswitches present in genes encoding key enzymes in metabolic or transport pathways of these compounds.
  • the aptamer domain of each riboswitch class conforms to a highly conserved consensus sequence and structure. Thus, sequence homology searches can be used to identify related riboswitch domains. Riboswitch domains have been discovered in various organisms from bacteria, archaea, and eukarya.
  • riboswitch RNAs are genetic control elements that are located primarily within the 5 '-untranslated region (5'-UTR) of the main coding region of a particular mRNA. Structural probing studies (discussed further below) reveal that riboswitch elements are generally composed of two domains: a natural aptamer (T. Hermann, D. J. Patel, Science 2000, 287, 820; L. Gold, et al., Annual Review of Biochemistry 1995, 64, 763) that serves as the ligand-binding domain, and an 'expression platform' that interfaces with RNA elements that are involved in gene expression ⁇ e.g.
  • the ligand-bound or unbound status of the aptamer domain is interpreted through the expression platform, which is responsible for exerting an influence upon gene expression.
  • the view of a riboswitch as a modular element is further supported by the fact that aptamer domains are highly conserved amongst various organisms (and even between kingdoms as is observed for the TPP riboswitch), (N. Sudarsan, et al., RNA 2003, 9, 644) whereas the expression platform varies in sequence, structure, and in the mechanism by which expression of the appended open reading frame is controlled.
  • ligand binding to the TPP riboswitch of the tenA mRNA of B. subtilis causes transcription termination (A. S.
  • TPP riboswitch RNAs typically range from -70 to 170 nt in length ( Figure 11 of U.S. Application Publication No. 2005-0053951).
  • RNA receptors that function with high affinity and selectivity.
  • Apparent AT D values for the ligand-riboswitch complexes range from low nanomolar to low micromolar. It is also worth noting that some aptamer domains, when isolated from the appended expression platform, exhibit improved affinity for the target ligand over that of the intact riboswitch. (-10 to 100-fold) (see Example 2 of U.S. Application Publication No. 2005-0053951).
  • RNA is part of a riboswitch selective for 7-aminomethyl-7-deazaguanine (preQi), an intermediate in Q biosynthesis.
  • preQi 7-aminomethyl-7-deazaguanine
  • the preQi aptamer appears to have a simple structure, consisting of a single stem-loop and a short tail sequence that together are formed from as few as 34 nucleotides.
  • this aptamer is highly selective for its cognate ligand in vitro, and displays an affinity for preQi in the low nanomolar range. Relatively compact RNA structures can therefore serve effectively as metabolite receptors to regulate gene expression.
  • preQi is then transferred to the appropriate tRNAs by a tRNA-guanine transglycosylase (TGT) (Okada 1979), where it is further modified in situ to yield Q (Reuter 1991) or an aminoacylated derivative (Salazar 2004; Blaise 2004).
  • TGT tRNA-guanine transglycosylase
  • Q Reuter 1991
  • Salazar 2004 an aminoacylated derivative
  • queC ykvJ
  • the ligand- binding domain of the queC riboswitch exhibits a dissociation constant (K d ) for preQi in the nanomolar range.
  • K d dissociation constant
  • numerous additional examples of the queC motif were found, which define a widespread regulon whose expression can be modulated in response to intracellular concentrations of this important modified nucleobase.
  • RNA elements are composed of a GC -rich stem-loop followed by a stretch of 6-9 uridyl residues.
  • Intrinsic terminators are widespread throughout bacterial genomes (F. Lillo, et al., 2002, 18, 971), and are typically located at the 3 '-termini of genes or operons. Interestingly, an increasing number of examples are being observed for intrinsic terminators located within 5 '-UTRs.
  • RNA polymerase responds to a termination signal within the 5 '-UTR in a regulated fashion
  • T. M. Henkin Current Opinion in Microbiology 2000, 3, 149
  • the RNA polymerase complex is directed by external signals either to perceive or to ignore the termination signal.
  • transcription initiation might occur without regulation, control over mRNA synthesis (and of gene expression) is ultimately dictated by regulation of the intrinsic terminator.
  • one of at least two mutually exclusive mRNA conformations results in the formation or disruption of the RNA structure that signals transcription termination.
  • a trans-acting factor which in some instances is a RNA (F. J.
  • Riboswitches offer a direct link between RNA structure modulation and the metabolite signals that are interpreted by the genetic control machinery.
  • riboswitches Most clinical antibacterial compounds target one of only four cellular processes (Wolfson 2006). Since bacteria have well developed resistance mechanisms to protect these processes (D'Costa 2006), it is useful to discover new targets that are vulnerable to drug intervention.
  • One type of vulnerable process is the regulation of gene expression by riboswitches (Winkler 2005). Typically found in the 5'-UTRs of certain bacterial mRNAs, members of each known riboswitch class form a structured receptor (or "aptamer") (Mandal 2004) that has evolved to bind a specific fundamental metabolite. In most cases, ligand binding regulates the expression of a gene or group of genes involved in the synthesis or transport of the bound metabolite. Because the biochemical pathways regulated by riboswitches are often essential for bacterial survival, repression of these pathways through riboswitch targeting can be lethal.
  • antibacterial metabolite analogs function by targeting riboswitches (Sudarsan 2003; Sudarsan 2005; Woolley 1943).
  • the antibacterial thiamine analog pyrithiamine (Woolley 1943) most likely functions by targeting a thiamine pyrophosphate-binding riboswitch (Sudarsan 2005).
  • the antibacterial lysine analog L-aminoethylcysteine (Shiota 1958) (AEC, Fig. Ib) binds to the lysC riboswitch from B. subtilis and represses the expression of a /ysC-regulated reporter gene (Sudarsan 2006).
  • the lysC riboswitch is mutated in B. subtilis (Lu 1991) and Escherichia coli (Patte 1998) strains resistant to AEC.
  • riboswitch or aptamer domain For example, if a riboswitch or aptamer domain is disclosed and discussed and a number of modifications that can be made to a number of molecules including the riboswitch or aptamer domain are discussed, each and every combination and permutation of riboswitch or aptamer domain and the modifications that are possible are specifically contemplated unless specifically indicated to the contrary.
  • A, B, and C are disclosed as well as a class of molecules D, E, and F and an example of a combination molecule, A-D is disclosed, then even if each is not individually recited, each is individually and collectively contemplated.
  • each of the combinations A-E, A-F, B-D, B-E, B-F, C-D, C-E, and C-F are specifically contemplated and should be considered disclosed from disclosure of A, B, and C; D, E, and F; and the example combination A-D.
  • any subset or combination of these is also specifically contemplated and disclosed.
  • the sub-group of A-E, B-F, and C-E are specifically contemplated and should be considered disclosed from disclosure of A, B, and C; D, E, and F; and the example combination A-D.
  • Riboswitches are expression control elements that are part of an RNA molecule to be expressed and that change state when bound by a trigger molecule. Riboswitches typically can be dissected into two separate domains: one that selectively binds the target (aptamer domain) and another that influences genetic control (expression platform domain). It is the dynamic interplay between these two domains that results in metabolite-dependent allosteric control of gene expression.
  • riboswitches Disclosed are isolated and recombinant riboswitches, recombinant constructs containing such riboswitches, heterologous sequences operably linked to such riboswitches, and cells and transgenic organisms harboring such riboswitches, riboswitch recombinant constructs, and riboswitches operably linked to heterologous sequences.
  • the heterologous sequences can be, for example, sequences encoding proteins or peptides of interest, including reporter proteins or peptides.
  • Preferred riboswitches are, or are derived from, naturally occurring riboswitches, such as naturally occurring preQi riboswitches.
  • the riboswitch can include or, optionlly, exclude, artificial aptamers.
  • artificial apatmers include apatamers that are designed or selected via in vitro evolution and/or in vitro selection.
  • the riboswtiches can comprise the consensus sequence of naturally occurring riboswitches, such a consensus sequence of preCh riboswitches. Consensus sequences of preQi riboswitches are shown in Figure 1 and Figure 3a. Disclosed is a riboswitch, wherein the riboswitch is a non-natural derivative of a naturally-occurring preCh -responsive riboswitch.
  • the disclosed riboswitches generally can be from any source, including naturally occurring riboswitches and riboswitches designed de novo. Any such riboswitches can be used in or with the disclosed methods. However, different types of riboswitches can be defined and some such sub-types can be useful in or with particular methods (generally as described elsewhere herein). Types of riboswitches include, for example, naturally occurring riboswitches, derivatives and modified forms of naturally occurring riboswitches, chimeric riboswitches, and recombinant riboswitches.
  • a naturally occurring riboswitch is a riboswitch having the sequence of a riboswitch as found in nature.
  • Such a naturally occurring riboswitch can be an isolated or recombinant form of the naturally occurring riboswitch as it occurs in nature. That is, the riboswitch has the same primary structure but has been isolated or engineered in a new genetic or nucleic acid context.
  • Chimeric riboswitches can be made up of, for example, part of a riboswitch of any or of a particular class or type of riboswitch and part of a different riboswitch of the same or of any different class or type of riboswitch; part of a riboswitch of any or of a particular class or type of riboswitch and any non-riboswitch sequence or component.
  • Recombinant riboswitches are riboswitches that have been isolated or engineered in a new genetic or nucleic acid context. Riboswitches can have single or multiple aptamer domains.
  • Aptamer domains in riboswitches having multiple aptamer domains can exhibit cooperative binding of trigger molecules or can not exhibit cooperative binding of trigger molecules (that is, the aptamers need not exhibit cooperative binding). In the latter case, the aptamer domains can be said to be independent binders.
  • Riboswitches having multiple aptamers can have one or multiple expression platform domains. For example, a riboswitch having two aptamer domains that exhibit cooperative binding of their trigger molecules can be linked to a single expression platform domain that is regulated by both aptamer domains. Riboswitches having multiple aptamers can have one or more of the aptamers joined via a linker. Where such aptamers exhibit cooperative binding of trigger molecules, the linker can be a cooperative linker.
  • Aptamer domains can be said to exhibit cooperative binding if they have a Hill coefficient n between x and x-1, where x is the number of aptamer domains (or the number of binding sites on the aptamer domains) that are being analyzed for cooperative binding.
  • a riboswitch having two aptamer domains can be said to exhibit cooperative binding if the riboswitch has Hill coefficient between 2 and 1. It should be understood that the value of x used depends on the number of aptamer domains being analyzed for cooperative binding, not necessarily the number of aptamer domains present in the riboswitch. This makes sense because a riboswitch can have multiple aptamer domains where only some exhibit cooperative binding.
  • chimeric riboswitches containing heterologous aptamer domains and expression platform domains. That is, chimeric riboswitches are made up an aptamer domain from one source and an expression platform domain from another source.
  • the heterologous sources can be from, for example, different specific riboswitches, different types of riboswitches, or different classes of riboswitches.
  • the heterologous aptamers can also come from non-riboswitch aptamers.
  • the heterologous expression platform domains can also come from non-riboswitch sources. Modified or derivative riboswitches can be produced using in vitro selection and evolution techniques.
  • in vitro evolution techniques as applied to riboswitches involve producing a set of variant riboswitches where part(s) of the riboswitch sequence is varied while other parts of the riboswitch are held constant. Activation, deactivation or blocking (or other functional or structural criteria) of the set of variant riboswitches can then be assessed and those variant riboswitches meeting the criteria of interest are selected for use or further rounds of evolution.
  • Useful base riboswitches for generation of variants are the specific and consensus riboswitches disclosed herein. Consensus riboswitches can be used to inform which part(s) of a riboswitch to vary for in vitro selection and evolution.
  • modified riboswitches with altered regulation.
  • the regulation of a riboswitch can be altered by operably linking an aptamer domain to the expression platform domain of the riboswitch (which is a chimeric riboswitch).
  • the aptamer domain can then mediate regulation of the riboswitch through the action of, for example, a trigger molecule for the aptamer domain.
  • Aptamer domains can be operably linked to expression platform domains of riboswitches in any suitable manner, including, for example, by replacing the normal or natural aptamer domain of the riboswitch with the new aptamer domain.
  • any compound or condition that can activate, deactivate or block the riboswitch from which the aptamer domain is derived can be used to activate, deactivate or block the chimeric riboswitch.
  • Riboswitches can be inactivated by covalently altering the riboswitch (by, for example, crosslinking parts of the riboswitch or coupling a compound to the riboswitch). Inactivation of a riboswitch in this manner can result from, for example, an alteration that prevents the trigger molecule for the riboswitch from binding, that prevents the change in state of the riboswitch upon binding of the trigger molecule, or that prevents the expression platform domain of the riboswitch from affecting expression upon binding of the trigger molecule. Also disclosed are biosensor riboswitches.
  • Biosensor riboswitches are engineered riboswitches that produce a detectable signal in the presence of their cognate trigger molecule. Useful biosensor riboswitches can be triggered at or above threshold levels of the trigger molecules. Biosensor riboswitches can be designed for use in vivo or in vitro. For example, biosensor riboswitches operably linked to a reporter RNA that encodes a protein that serves as or is involved in producing a signal can be used in vivo by engineering a cell or organism to harbor a nucleic acid construct encoding the riboswitch/reporter RNA.
  • biosensor riboswitch for use in vitro is a riboswitch that includes a conformation dependent label, the signal from which changes depending on the activation state of the riboswitch.
  • a biosensor riboswitch preferably uses an aptamer domain from or derived from a naturally occurring riboswitch.
  • Biosensor riboswitches can be used in various situations and platforms. For example, biosensor riboswitches can be used with solid supports, such as plates, chips, strips and wells.
  • New riboswitches and/or new aptamers that recognize new trigger molecules can be selected for, designed or derived from known riboswitches. This can be accomplished by, for example, producing a set of aptamer variants in a riboswitch, assessing the activation of the variant riboswitches in the presence of a compound of interest, selecting variant riboswitches that were activated (or, for example, the riboswitches that were the most highly or the most selectively activated), and repeating these steps until a variant riboswitch of a desired activity, specificity, combination of activity and specificity, or other combination of properties results.
  • any aptamer domain can be adapted for use with any expression platform domain by designing or adapting a regulated strand in the expression platform domain to be complementary to the control strand of the aptamer domain.
  • the sequence of the aptamer and control strands of an aptamer domain can be adapted so that the control strand is complementary to a functionally significant sequence in an expression platform.
  • the control strand can be adapted to be complementary to the Shine-Dalgarno sequence of an RNA such that, upon formation of a stem structure between the control strand and the SD sequence, the SD sequence becomes inaccessible to ribosomes, thus reducing or preventing translation initiation.
  • the aptamer strand would have corresponding changes in sequence to allow formation of a Pl stem in the aptamer domain.
  • one the Pl stem of the activating aptamer (the aptamer that interacts with the expression platform domain) need be designed to form a stem structure with the SD sequence.
  • a transcription terminator can be added to an RNA molecule
  • the speed of transcription and spacing of the riboswitch and expression platform elements can be important for proper control. Transcription speed can be adjusted by, for example, including polymerase pausing elements (e.g., a series of uridine residues) to pause transcription and allow the riboswitch to form and sense trigger molecules.
  • polymerase pausing elements e.g., a series of uridine residues
  • regulatable gene expression constructs comprising a nucleic acid molecule encoding an RNA comprising a preQi -responsive riboswitch operably linked to a coding region, wherein the riboswitch regulates expression of the RNA, wherein the riboswitch and coding region are heterologous.
  • the riboswitch can comprise an aptamer domain and an expression platform domain, wherein the aptamer domain and the expression platform domain are heterologous.
  • the riboswitch can comprise two or more aptamer domains and an expression platform domain, wherein at least one of the aptamer domains and the expression platform domain are heterologous. At least two of the aptamer domains can exhibit cooperative binding.
  • RNA molecules comprising heterologous riboswitch and coding region. That is, such RNA molecules are made up of a riboswitch from one source and a coding region from another source.
  • the heterologous sources can be from, for example, different RNA molecules, different transcripts, RNA or transcripts from different genes, RNA or transcripts from different cells, RNA or transcripts from different organisms, RNA or transcripts from different species, natural sequences and artificial or engineered sequences, specific riboswitches, different types of riboswitches, or different classes of riboswitches.
  • coding region refers to any region of a nucleic acid that codes for amino acids. This can include both a nucleic acid strand that contains the codons or the template for codons and the complement of such a nucleic acid strand in the case of double stranded nuclec acid molecules. Regions of nucleic acids that are not coding regions can be referred to as noncoding regions. Messenger RNA molecules as transcribed typically include noncoding regions at both the 5' and 3' ends. Eucaryotic niRNA molecules can also include internal noncoding regions such as introns. Some types of RNA molecules do not include functional coding regions, such as tRNA and rRNA molecules.
  • RNA molecules that do not include functional coding regions can also be regulated or affected by the disclosed riboswitches.
  • the disclosed riboswitches can be operably linked to a noncoding RNA molecule in any manner as disclosed herein for operable linkage of a riboswitch to a coding region.
  • the riboswitch can regulate expression of such RNA as disclosed herein for regulation of RNA comprising a riboswitch operably linked to a coding region.
  • the function of any nucleic acid molecule can also regulated or affected by the disclosed riboswitches.
  • RNA examples include, but are not limited to, RNA, DNA, and artificial nucleic acids, including peptide nucleic acid (PNA), morpholino and locked nucleic acid (LNA), as well as glycol nucleic acid (GNA) and threose nucleic acid (TNA).
  • PNA peptide nucleic acid
  • LNA morpholino and locked nucleic acid
  • NAA glycol nucleic acid
  • TAA threose nucleic acid
  • the riboswitch can regulate expression of the coding region, expression of the encoded protein, expression of the noncoding RNA molecule, transcription of the RNA or of the coding regin, or translation of the encoded protein, for example.
  • Aptamers are nucleic acid segments and structures that can bind selectively to particular compounds and classes of compounds.
  • Riboswitches have aptamer domains that, upon binding of a trigger molecule result in a change in the state or structure of the riboswitch. In functional riboswitches, the state or structure of the expression platform domain linked to the aptamer domain changes when the trigger molecule binds to the aptamer domain.
  • Aptamer domains of riboswitches can be derived from any source, including, for example, natural aptamer domains of riboswitches, artificial aptamers, engineered, selected, evolved or derived aptamers or aptamer domains.
  • Aptamers in riboswitches generally have at least one portion that can interact, such as by forming a stem structure, with a portion of the linked expression platform domain. This stem structure will either form or be disrupted upon binding of the trigger molecule.
  • aptamer domains can be used in riboswitches.
  • the consensus sequences and structures indicate variations in sequence and structure. Aptamer domains that are within the indicated variations are referred to herein as direct variants.
  • These aptamer domains can be modified to produce modified or variant aptamer domains. Conservative modifications include any change in base paired nucleotides such that the nucleotides in the pair remain complementary. Moderate modifications include changes in the length of stems or of loops (for which a length or length range is indicated) of less than or equal to 20% of the length range indicated. Loop and stem lengths are considered to be "indicated" where the consensus structure shows a stem or loop of a particular length or where a range of lengths is listed or depicted.
  • Moderate modifications include changes in the length of stems or of loops (for which a length or length range is not indicated) of less than or equal to 40% of the length range indicated. Moderate modifications also include and functional variants of unspecified portions of the aptamer domain. Aptamer domains of the disclosed riboswitches can also be used for any other purpose, and in any other context, as aptamers. For example, aptamers can be used to control ribozymes, other molecular switches, and any RNA molecule where a change in structure can affect function of the RNA. 2. Expression Platform Domains
  • Expression platform domains are a part of riboswitches that affect expression of the RNA molecule that contains the riboswitch.
  • Expression platform domains generally have at least one portion that can interact, such as by forming a stem structure, with a portion of the linked aptamer domain. This stem structure will either form or be disrupted upon binding of the trigger molecule.
  • the stem structure generally either is, or prevents formation of, an expression regulatory structure.
  • An expression regulatory structure is a structure that allows, prevents, enhances or inhibits expression of an RNA molecule containing the structure. Examples include Shine-Dalgarno sequences, initiation codons, transcription terminators, stability signals, and processing signals, such as RNA splicing junctions and control elements.
  • Trigger molecules are molecules and compounds that can activate a riboswitch. This includes the natural or normal trigger molecule for the riboswitch and other compounds that can activate the riboswitch. Natural or normal trigger molecules are the trigger molecule for a given riboswitch in nature or, in the case of some non-natural riboswitches, the trigger molecule for which the riboswitch was designed or with which the riboswitch was selected (as in, for example, in vitro selection or in vitro evolution techniques).
  • Riboswitches function to control gene expression through the binding or removal of a trigger molecule.
  • Compounds can be used to activate, deactivate or block a riboswitch.
  • the trigger molecule for a riboswitch (as well as other activating compounds) can be used to activate a riboswitch.
  • Compounds other than the trigger molecule generally can be used to deactivate or block a riboswitch.
  • Riboswitches can also be deactivated by, for example, removing trigger molecules from the presence of the riboswitch.
  • a riboswitch can be blocked by, for example, binding of an analog of the trigger molecule that does not activate the riboswitch. Also disclosed are compounds for altering expression of an RNA molecule, or of a gene encoding an RNA molecule, where the RNA molecule includes a riboswitch. This can be accomplished by bringing a compound into contact with the RNA molecule.
  • Riboswitches function to control gene expression through the binding or removal of a trigger molecule.
  • subjecting an RNA molecule of interest that includes a riboswitch to conditions that activate, deactivate or block the riboswitch can be used to alter expression of the RNA.
  • Expression can be altered as a result of, for example, termination of transcription or blocking of ribosome binding to the RNA.
  • Binding of a trigger molecule can, depending on the nature of the riboswitch, reduce or prevent expression of the RNA molecule or promote or increase expression of the RNA molecule.
  • the gene encodes a desired expression product, activating or deactivating the riboswitch can be used to induce expression of the gene and thus result in production of the expression product.
  • the gene encodes an inducer or repressor of gene expression or of another cellular process, activation, deactivation or blocking of the riboswitch can result in induction, repression, or de-repression of other, regulated genes or cellular processes.
  • Many such secondary regulatory effects are known and can be adapted for use with riboswitches.
  • An advantage of riboswitches as the primary control for such regulation is that riboswitch trigger molecules can be small, non-antigenic molecules.
  • compounds that activate a riboswitch can be identified by bringing into contact a test compound and a riboswitch and assessing activation of the riboswitch. If the riboswitch is activated, the test compound is identified as a compound that activates the riboswitch. Activation of a riboswitch can be assessed in any suitable manner.
  • the riboswitch can be linked to a reporter RNA and expression, expression level, or change in expression level of the reporter RNA can be measured in the presence and absence of the test compound.
  • the riboswitch can include a conformation dependent label, the signal from which changes depending on the activation state of the riboswitch.
  • a riboswitch preferably uses an aptamer domain from or derived from a naturally occurring riboswitch.
  • assessment of activation of a riboswitch can be performed with the use of a control assay or measurement or without the use of a control assay or measurement.
  • Methods for identifying compounds that deactivate a riboswitch can be performed in analogous ways. Identification of compounds that block a riboswitch can be accomplished in any suitable manner.
  • an assay can be performed for assessing activation or deactivation of a riboswitch in the presence of a compound known to activate or deactivate the riboswitch and in the presence of a test compound. If activation or deactivation is not observed as would be observed in the absence of the test compound, then the test compound is identified as a compound that blocks activation or deactivation of the riboswitch.
  • analogs that interact with the preQi riboswitch can have improved binding to the preQi riboswitch by making new contacts to other functional groups in the RNA structure. Furthermore, modulation of bioavailability, toxicity, and synthetic ease (among other characteristics) can be tunable by making modifications in these two regions of the scaffold, as the structural model for the riboswitch shows many modifications are possible at these sites.
  • High-throughput screening can also be used to reveal entirely new chemical scaffolds that also bind to riboswitch RNAs either with standard or non- standard modes of molecular recognition. Since riboswitches are the first major form of natural metabolite-binding RNAs to be discovered, there has been little effort made previously to create binding assays that can be adapted for high-throughput screening. Multiple different approaches can be used to detect metabolite binding RNAs, including allosteric ribozyme assays using gel-based and chip-based detection methods, and in-line probing assays. Also disclosed are compounds made by identifying a compound that activates, deactivates or blocks a riboswitch and manufacturing the identified compound.
  • compounds can be made by bringing into contact a test compound and a riboswitch, assessing activation of the riboswitch, and, if the riboswitch is activated by the test compound, manufacturing the test compound that activates the riboswitch as the compound.
  • compounds made by checking activation, deactivation or blocking of a riboswitch by a compound and manufacturing the checked compound This can be accomplished by, for example, combining compound activation, deactivation or blocking assessment methods as disclosed elsewhere herein with methods for manufacturing the checked compounds.
  • compounds can be made by bringing into contact a test compound and a riboswitch, assessing activation of the riboswitch, and, if the riboswitch is activated by the test compound, manufacturing the test compound that activates the riboswitch as the compound.
  • Checking compounds for their ability to activate, deactivate or block a riboswitch refers to both identification of compounds previously unknown to activate, deactivate or block a riboswitch and to assessing the ability of a compound to activate, deactivate or block a riboswitch where the compound was already known to activate, deactivate or block the riboswitch.
  • the term "substituted" is contemplated to include all permissible substituents of organic compounds.
  • the permissible substituents include acyclic and cyclic, branched and unbranched, carbocyclic and heterocyclic, and aromatic and nonaromatic substituents of organic compounds.
  • Illustrative substituents include, for example, those described below.
  • the permissible substituents can be one or more and the same or different for appropriate organic compounds.
  • the heteroatoms, such as nitrogen can have hydrogen substituents and/or any permissible substituents of organic compounds described herein which satisfy the valences of the heteroatoms.
  • substitution or “substituted with” include the implicit proviso that such substitution is in accordance with permitted valence of the substituted atom and the substituent, and that the substitution results in a stable compound, e.g. , a compound that does not spontaneously undergo transformation such as by rearrangement, cyclization, elimination, etc.
  • a 1 ,” “A 2 ,” “A 3 ,” and “A 4 " are used herein as generic symbols to represent various specific substituents. These symbols can be any substituent, not limited to those disclosed herein, and when they are defined to be certain substituents in one instance, they can, in another instance, be defined as some other substituents.
  • alkyl as used herein is a branched or unbranched saturated hydrocarbon group of 1 to 24 carbon atoms, such as methyl, ethyl, n-propyl, isopropyl, n- butyl, isobutyl, t-butyl, pentyl, hexyl, heptyl, octyl, nonyl, decyl, dodecyl, tetradecyl, hexadecyl, eicosyl, tetracosyl, and the like.
  • the alkyl group can also be substituted or unsubstituted.
  • the alkyl group can be substituted with one or more groups including, but not limited to, alkyl, halogenated alkyl, alkoxy, alkenyl, alkynyl, aryl, heteroaryl, aldehyde, amino, carboxylic acid, ester, ether, halide, hydroxy, ketone, sulfo-oxo, sulfonyl, sulfone, sulfoxide, or thiol, as described below.
  • groups including, but not limited to, alkyl, halogenated alkyl, alkoxy, alkenyl, alkynyl, aryl, heteroaryl, aldehyde, amino, carboxylic acid, ester, ether, halide, hydroxy, ketone, sulfo-oxo, sulfonyl, sulfone, sulfoxide, or thiol, as described below.
  • lower alkyl is an alkyl group with 6 or fewer carbon atoms, e.g., methyl, ethyl, propyl, isopropyl, butyl, sec-butyl, iso-butyl, tert-butyl, pentyl, hexyl, and the like.
  • alkyl is generally used to refer to both unsubstituted alkyl groups and substituted alkyl groups; however, substituted alkyl groups are also specifically referred to herein by identifying the specific substituent(s) on the alkyl group.
  • halogenated alkyl specifically refers to an alkyl group that is substituted with one or more halide, e.g., fluorine, chlorine, bromine, or iodine.
  • alkoxyalkyl specifically refers to an alkyl group that is substituted with one or more alkoxy groups, as described below.
  • alkylamino specifically refers to an alkyl group that is substituted with one or more amino groups, as described below, and the like.
  • alkyl is used in one instance and a specific term such as “halogenated alkyl” is used in another, it is not meant to imply that the term “alkyl” does not also refer to specific terms such as “halogenated alkyl” and the like.
  • cycloalkyl refers to both unsubstituted and substituted cycloalkyl moieties
  • the substituted moieties can, in addition, be specifically identified herein; for example, a particular substituted cycloalkyl can be referred to as, e.g., an "alkylcycloalkyl.”
  • a substituted alkoxy can be specifically referred to as, e.g. , a "halogenated alkoxy”
  • a particular substituted alkenyl can be, e.g., an "alkenylalcohol,” and the like.
  • alkoxy as used herein is an alkyl group bonded through a single, terminal ether linkage; that is, an “alkoxy” group can be defined as — OA 1 where A 2 is alkyl as defined above.
  • alkenyl as used herein is a hydrocarbon group of from 2 to 24 carbon atoms with a structural formula containing at least one carbon-carbon double bond.
  • the alkenyl group can be substituted with one or more groups including, but not limited to, alkyl, halogenated alkyl, alkoxy, alkenyl, alkynyl, aryl, heteroaryl, aldehyde, amino, carboxylic acid, ester, ether, halide, hydroxy, ketone, sulfo-oxo, sulfonyl, sulfone, sulfoxide, or thiol, as described below.
  • alkynyl as used herein is a hydrocarbon group of 2 to 24 carbon atoms with a structural formula containing at least one carbon-carbon triple bond.
  • the alkynyl group can be substituted with one or more groups including, but not limited to, alkyl, halogenated alkyl, alkoxy, alkenyl, alkynyl, aryl, heteroaryl, aldehyde, amino, carboxylic acid, ester, ether, halide, hydroxy, ketone, sulfo-oxo, sulfonyl, sulfone, sulfoxide, or thiol, as described below.
  • aryl as used herein is a group that contains any carbon-based aromatic group including, but not limited to, benzene, naphthalene, phenyl, biphenyl, phenoxybenzene, and the like.
  • aryl also includes "heteroaryl,” which is defined as a group that contains an aromatic group that has at least one heteroatom incorporated within the ring of the aromatic group. Examples of heteroatoms include, but are not limited to, nitrogen, oxygen, sulfur, and phosphorus.
  • non- heteroaryl which is also included in the term “aryl,” defines a group that contains an aromatic group that does not contain a heteroatom. The aryl group can be substituted or unsubstituted.
  • the aryl group can be substituted with one or more groups including, but not limited to, alkyl, halogenated alkyl, alkoxy, alkenyl, alkynyl, aryl, heteroaryl, aldehyde, amino, carboxylic acid, ester, ether, halide, hydroxy, ketone, sulfo-oxo, sulfonyl, sulfone, sulfoxide, or thiol as described herein.
  • the term "biaryl” is a specific type of aryl group and is included in the definition of aryl. Biaryl refers to two aryl groups that are bound together via a fused ring structure, as in naphthalene, or are attached via one or more carbon-carbon bonds, as in biphenyl.
  • cycloalkyl as used herein is a non-aromatic carbon-based ring composed of at least three carbon atoms.
  • examples of cycloalkyl groups include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, etc.
  • heterocycloalkyl is a cycloalkyl group as defined above where at least one of the carbon atoms of the ring is substituted with a heteroatom such as, but not limited to, nitrogen, oxygen, sulfur, or phosphorus.
  • the cycloalkyl group and heterocycloalkyl group can be substituted or unsubstituted.
  • the cycloalkyl group and heterocycloalkyl group can be substituted with one or more groups including, but not limited to, alkyl, alkoxy, alkenyl, alkynyl, aryl, heteroaryl, aldehyde, amino, carboxylic acid, ester, ether, halide, hydroxy, ketone, sulfo-oxo, sulfonyl, sulfone, sulfoxide, or thiol as described herein.
  • cycloalkenyl groups include, but are not limited to, cyclopropenyl, cyclobutenyl, cyclopentenyl, cyclopentadienyl, cyclohexenyl, cyclohexadienyl, and the like.
  • heterocycloalkenyl is a type of cycloalkenyl group as defined above, and is included within the meaning of the term “cycloalkenyl,” where at least one of the carbon atoms of the ring is substituted with a heteroatom such as, but not limited to, nitrogen, oxygen, sulfur, or phosphorus.
  • the cycloalkenyl group and heterocycloalkenyl group can be substituted or unsubstituted.
  • the cycloalkenyl group and heterocycloalkenyl group can be substituted with one or more groups including, but not limited to, alkyl, alkoxy, alkenyl, alkynyl, aryl, heteroaryl, aldehyde, amino, carboxylic acid, ester, ether, halide, hydroxy, ketone, sulfo-oxo, sulfonyl, sulfone, sulfoxide, or thiol as described herein.
  • cyclic group is used herein to refer to either aryl groups, non-aryl groups (i.e., cycloalkyl, heterocycloalkyl, cycloalkenyl, and heterocycloalkenyl groups), or both. Cyclic groups have one or more ring systems that can be substituted or unsubstituted. A cyclic group can contain one or more aryl groups, one or more non-aryl groups, or one or more aryl groups and one or more non-aryl groups.
  • amine or “amino” as used herein are represented by the formula
  • NA 1 A 2 A 3 where A 1 , A 2 , and A 3 can be, independently, hydrogen, an alkyl, halogenated alkyl, alkenyl, alkynyl, aryl, heteroaryl, cycloalkyl, cycloalkenyl, heterocycloalkyl, or heterocycloalkenyl group described above.
  • esters as used herein is represented by the formula — OC(O)A 1 or — C(O)OA 1 , where A 1 can be an alkyl, halogenated alkyl, alkenyl, alkynyl, aryl, heteroaryl, cycloalkyl, cycloalkenyl, heterocycloalkyl, or heterocycloalkenyl group described above.
  • ether as used herein is represented by the formula A 1 OA 2 , where A 1 and A 2 can be, independently, an alkyl, halogenated alkyl, alkenyl, alkynyl, aryl, heteroaryl, cycloalkyl, cycloalkenyl, heterocycloalkyl, or heterocycloalkenyl group described above.
  • ketone as used herein is represented by the formula A 1 C(O)A 2 , where A 1 and A 2 can be, independently, an alkyl, halogenated alkyl, alkenyl, alkynyl, aryl, heteroaryl, cycloalkyl, cycloalkenyl, heterocycloalkyl, or heterocycloalkenyl group described above.
  • halide refers to the halogens fluorine, chlorine, bromine, and iodine.
  • hydroxyl as used herein is represented by the formula — OH.
  • sulfo-oxo as used herein is represented by the formulas — S(O)A 1
  • -OS(O) 2 A 1 or -OS(O) 2 OA 1
  • Ai and A 2 can be hydrogen, an alkyl, halogenated alkyl, alkenyl, alkynyl, aryl, heteroaryl, cycloalkyl, cycloalkenyl, heterocycloalkyl, or heterocycloalkenyl group described above.
  • sulfonylamino or "sulfonamide” as used herein is represented by the formula -S(O) 2 NH-.
  • thiol as used herein is represented by the formula — SH.
  • R n where n is some integer can independently possess one or more of the groups listed above.
  • a first group can be incorporated within second group or, alternatively, the first group can be pendant (i.e., attached) to the second group.
  • an alkyl group comprising an amino group the amino group can be incorporated within the backbone of the alkyl group.
  • the amino group can be attached to the backbone of the alkyl group. The nature of the group(s) that is (are) selected will determine if the first group is embedded or attached to the second group.
  • Certain materials, compounds, compositions, and components disclosed herein can be obtained commercially or readily synthesized using techniques generally known to those of skill in the art.
  • the starting materials and reagents used in preparing the disclosed compounds and compositions are either available from commercial suppliers such as Aldrich Chemical Co., (Milwaukee, Wis.), Acros Organics (Morris Plains, N.J.), Fisher Scientific (Pittsburgh, Pa.), or Sigma (St.
  • the compound can have the structure of Formula II:
  • the compound can have the structure of Formula II:
  • R 5 is NH 2 + , NH 3 + , CO 2 H, B(OH) 2 , CH(NH 2 ) 2 , C(NH 2 ) 2 + , CNH 2 NH 3 + , C(NH 3 + ) 3 , hydroxymethyl, 1-hydroxyethyl, 2-hydroxyethyl, 1,2- dihydroxyethyl, 2-hydroxy-l-methylethyl,l-hydroxypropyl, 2-hydroxypropyl, 3- hydroxypropyl, 1,3-dihydroxypropyl, 2,3-dihydroxypropyl, 1-hydroxybutyl, 2- hydroxybutyl, 3-hydroxybutyl, 4-hydroxybutyl, 1, 4 dihydroxybutyl, 2,4-dihydroxybutyl, l-hydroxy-2-methylpropyl, 2-hydroxy-2-methylpropyl, 3-hydroxy-2-methylpropyl, 1- hydroxymethyl-1 -methyl ethyl, trishydroxymethylmethyl, thiolmethyl, 1-thiolmethyl, 1-thiolmethyl, 1-thi
  • R 5 is NH 2 + , NH 3 + , CO 2 H, B(OH) 2 , CH(NH 2 ) 2 , C(NH 2 ) 2 + , CNH 2 NH 3 + , C(NH 3 + ) 3 , hydroxymethyl, 1-hydroxyethyl, 2-hydroxyethyl, 1,2- dihydroxyethyl, 2 -hydroxy- 1 -methylethyl, 1 -hydroxypropyl, 2-hydroxypropyl, 3- hydroxypropyl, 1,3-dihydroxypropyl, 2,3-dihydroxypropyl, 1-hydroxybutyl, 2- hydroxybutyl, 3-hydroxybutyl, 4-hydroxybutyl, 1, 4 dihydroxybutyl, 2,4-dihydroxybutyl, l-hydroxy-2-methylpropyl, 2-hydroxy-2-methylpropyl, 3-hydroxy-2-methylpropyl, 1- hydroxymethyl-1 -methylethyl, trishydroxymethylmethyl, thiolmethyl
  • R 5 is NH 2 + , NH 3 + , CO 2 H, B(OH) 2 , CH(NH 2 ) 2 , C(NH 2 ) 2 + , CNH 2 NH 3 + , C(NH 3 + ) 3 , hydroxymethyl, 1-hydroxyethyl, 2-hydroxyethyl, 1,2- dihydroxyethyl, 2-hydroxy-l-methylethyl,l-hydroxypropyl, 2-hydroxypropyl, 3- hydroxypropyl, 1,3-dihydroxypropyl, 2,3-dihydroxypropyl, 1-hydroxybutyl, 2- hydroxybutyl, 3-hydroxybutyl, 4-hydroxybutyl, 1, 4 dihydroxybutyl, 2,4-dihydroxybutyl, l-hydroxy-2-methylpropyl, 2-hydroxy-2-methylpropyl, 3-hydroxy-2-methylpropyl, 1- hydroxymethyl-1 -methyl ethyl, trishydroxymethylmethyl, thiolmethyl, 1-thiolmethyl, 1-thiolmethyl, 1-thi
  • the compound can have the structure of Formula II:
  • R 5 is NH 2 + , NH 3 + , CO 2 H, B(OH) 2 , CH(NH 2 ) 2 , C(NH 2 ) 2 + , CNH 2 NH 3 + , C(NH 3 + )-,, hydroxymethyl, 1-hydroxyethyl, 2-hydroxyethyl, 1,2- dihydroxyethyl, 2 -hydroxy- 1 -methylethyl, 1-hydroxypropyl, 2-hydroxypropyl, 3- hydroxypropyl, 1,3-dihydroxypropyl, 2,3-dihydroxypropyl, 1 -hydroxybutyl, 2- hydroxybutyl, 3-hydroxybutyl, 4-hydroxybutyl, 1, 4 dihydroxybutyl, 2,4-dihydroxybutyl, l-hydroxy-2-methylpropyl, 2-hydroxy-2-methylpropyl, 3-hydroxy-2-methylpropyl, 1- hydroxymethyl-1 -methylethyl, trishydroxymethylmethyl, thiolmethyl
  • -OH can be a hydrogen bond donor by donating the hydrogen atom
  • -OH can also be a hydrogen bond acceptor through one or more of the nonbonded electron pairs on the oxygen atom.
  • moieties can be a hydrogen bond donor and acceptor and can be referred to as such.
  • Every compound within the above definition is intended to be and should be considered to be specifically disclosed herein. Further, every subgroup that can be identified within the above definition is intended to be and should be considered to be specifically disclosed herein. As a result, it is specifically contemplated that any compound, or subgroup of compounds can be either specifically included for or excluded from use or included in or excluded from a list of compounds. As an example, a group of compounds is contemplated where each compound is as defined above and is able to activate a preQrresponsive riboswitch.
  • contacts and interactions (such as hydrogen bond donation or acceptance) described herein for compounds interacting with riboswitches are preferred but are not essential for interaction of a compound with a riboswitch.
  • compounds can interact with riboswitches with less affinity and/or specificity than compounds having the disclosed contacts and interactions.
  • different or additional functional groups on the compounds can introduce new, different and/or compensating contacts with the riboswitches.
  • large functional groups can be used.
  • Such functional groups can have, and can be designed to have, contacts and interactions with other part of the riboswitch. Such contacts and interactions can compensate for contacts and interactions of the trigger molecules and core structure.
  • the disclosed preQi riboswitches can be used with any suitable expression system.
  • Recombinant expression is usefully accomplished using a vector, such as a plasmid.
  • the vector can include a promoter operably linked to riboswitch-encoding sequence and RNA to be expression (e.g., RNA encoding a protein).
  • the vector can also include other elements required for transcription and translation.
  • vector refers to any carrier containing exogenous DNA.
  • vectors are agents that transport the exogenous nucleic acid into a cell without degradation and include a promoter yielding expression of the nucleic acid in the cells into which it is delivered.
  • Vectors include but are not limited to plasmids, viral nucleic acids, viruses, phage nucleic acids, phages, cosmids, and artificial chromosomes.
  • a variety of prokaryotic and eukaryotic expression vectors suitable for carrying riboswitch-regulated constructs can be produced.
  • Such expression vectors include, for example, pET, pET3d, pCR2.1, pBAD, pUC, and yeast vectors.
  • the vectors can be used, for example, in a variety of in vivo and in vitro situation.
  • Viral vectors include adenovirus, adeno-associated virus, herpes virus, vaccinia virus, polio virus, AIDS virus, neuronal trophic virus, Sindbis and other RNA viruses, including these viruses with the HIV backbone. Also useful are any viral families which share the properties of these viruses which make them suitable for use as vectors.
  • Retroviral vectors which are described in Verma (1985), include Murine Maloney Leukemia virus, MMLV, and retroviruses that express the desirable properties of MMLV as a vector.
  • viral vectors contain, nonstructural early genes, structural late genes, an RNA polymerase III transcript, inverted terminal repeats necessary for replication and encapsidation, and promoters to control the transcription and replication of the viral genome.
  • viruses When engineered as vectors, viruses typically have one or more of the early genes removed and a gene or gene/promoter cassette is inserted into the viral genome in place of the removed viral DNA.
  • a “promoter” is generally a sequence or sequences of DNA that function when in a relatively fixed location in regard to the transcription start site.
  • a “promoter” contains core elements required for basic interaction of RNA polymerase and transcription factors and can contain upstream elements and response elements.
  • Enhancer generally refers to a sequence of DNA that functions at no fixed distance from the transcription start site and can be either 5' (Laimins, 1981) or 3' (Lusky et al., 1983) to the transcription unit. Furthermore, enhancers can be within an intron (Banerji et al., 1983) as well as within the coding sequence itself (Osborne et al., 1984). They are usually between 10 and 300 bp in length, and they function in cis. Enhancers function to increase transcription from nearby promoters. Enhancers, like promoters, also often contain response elements that mediate the regulation of transcription. Enhancers often determine the regulation of expression.
  • Expression vectors used in eukaryotic host cells can also contain sequences necessary for the termination of transcription which can affect mRNA expression. These regions are transcribed as polyadenylated segments in the untranslated portion of the mRNA encoding tissue factor protein. The 3' untranslated regions also include transcription termination sites. It is preferred that the transcription unit also contain a polyadenylation region. One benefit of this region is that it increases the likelihood that the transcribed unit will be processed and transported like mRNA.
  • the identification and use of polyadenylation signals in expression constructs is well established. It is preferred that homologous polyadenylation signals be used in the transgene constructs.
  • the vector can include nucleic acid sequence encoding a marker product.
  • This marker product is used to determine if the gene has been delivered to the cell and once delivered is being expressed.
  • Preferred marker genes are the E. CoIi lacZ gene which encodes /3-galactosidase and green fluorescent protein.
  • the marker can be a selectable marker. When such selectable markers are successfully transferred into a host cell, the transformed host cell can survive if placed under selective pressure. There are two widely used distinct categories of selective regimes. The first category is based on a cell's metabolism and the use of a mutant cell line which lacks the ability to grow independent of a supplemented media.
  • the second category is dominant selection which refers to a selection scheme used in any cell type and does not require the use of a mutant cell line. These schemes typically use a drug to arrest growth of a host cell. Those cells which have a novel gene would express a protein conveying drug resistance and would survive the selection. Examples of such dominant selection use the drugs neomycin, (Southern and Berg, 1982), mycophenolic acid, (Mulligan and Berg, 1980) or hygromycin (Sugden et al., 1985).
  • Gene transfer can be obtained using direct transfer of genetic material, in but not limited to, plasmids, viral vectors, viral nucleic acids, phage nucleic acids, phages, cosmids, and artificial chromosomes, or via transfer of genetic material in cells or carriers such as cationic liposomes.
  • Transfer vectors can be any nucleotide construction used to deliver genes into cells (e.g., a plasmid), or as part of a general strategy to deliver genes, e.g., as part of recombinant retrovirus or adenovirus (Ram et al. Cancer Res. 53:83-88, (1993)).
  • Preferred viral vectors are Adenovirus, Adeno-associated virus, Herpes virus, Vaccinia virus, Polio virus, AIDS virus, neuronal trophic virus, Sindbis and other RNA viruses, including these viruses with the HIV backbone. Also preferred are any viral families which share the properties of these viruses which make them suitable for use as vectors.
  • Preferred retroviruses include Murine Maloney Leukemia virus, MMLV, and retroviruses that express the desirable properties of MMLV as a vector. Retroviral vectors are able to carry a larger genetic payload, i.e., a transgene or marker gene, than other viral vectors, and for this reason are a commonly used vector. However, they are not useful in non-proliferating cells.
  • Adenovirus vectors are relatively stable and easy to work with, have high titers, and can be delivered in aerosol formulation, and can transfect non-dividing cells.
  • Pox viral vectors are large and have several sites for inserting genes, they are thermostable and can be stored at room temperature.
  • a preferred embodiment is a viral vector which has been engineered so as to suppress the immune response of the host organism, elicited by the viral antigens.
  • Preferred vectors of this type will carry coding regions for Interleukin 8 or 10.
  • Viral vectors have higher transaction (ability to introduce genes) abilities than do most chemical or physical methods to introduce genes into cells.
  • viral vectors contain, nonstructural early genes, structural late genes, an RNA polymerase III transcript, inverted terminal repeats necessary for replication and encapsidation, and promoters to control the transcription and replication of the viral genome.
  • viruses When engineered as vectors, viruses typically have one or more of the early genes removed and a gene or gene/promoter cassette is inserted into the viral genome in place of the removed viral DNA. Constructs of this type can carry up to about 8 kb of foreign genetic material.
  • the necessary functions of the removed early genes are typically supplied by cell lines which have been engineered to express the gene products of the early genes in trans. i. Retroviral Vectors
  • a retrovirus is an animal virus belonging to the virus family of Retro viridae, including any types, subfamilies, genus, or tropisms.
  • Retroviral vectors in general, are described by Verma, LM. , Retroviral vectors for gene transfer. In Microbiology-1985, American Society for Microbiology, pp. 229-232, Washington, (1985), which is incorporated by reference herein. Examples of methods for using retroviral vectors for gene therapy are described in U.S. Patent Nos. 4,868,116 and 4,980,286; PCT applications WO 90/02806 and WO 89/07136; and Mulligan, (Science 260:926-932 (1993)); the teachings of which are incorporated herein by reference.
  • a retrovirus is essentially a package which has packed into it nucleic acid cargo.
  • the nucleic acid cargo carries with it a packaging signal, which ensures that the replicated daughter molecules will be efficiently packaged within the package coat.
  • a packaging signal In addition to the package signal, there are a number of molecules which are needed in cis, for the replication, and packaging of the replicated virus.
  • a retroviral genome contains the gag, pol, and env genes which are involved in the making of the protein coat. It is the gag, pol, and env genes which are typically replaced by the foreign DNA that it is to be transferred to the target cell.
  • Retrovirus vectors typically contain a packaging signal for incorporation into the package coat, a sequence which signals the start of the gag transcription unit, elements necessary for reverse transcription, including a primer binding site to bind the tRNA primer of reverse transcription, terminal repeat sequences that guide the switch of RNA strands during DNA synthesis, a purine rich sequence 5' to the 3' LTR that serve as the priming site for the synthesis of the second strand of DNA synthesis, and specific sequences near the ends of the LTRs that enable the insertion of the DNA state of the retrovirus to insert into the host genome.
  • a packaging signal for incorporation into the package coat a sequence which signals the start of the gag transcription unit, elements necessary for reverse transcription, including a primer binding site to bind the tRNA primer of reverse transcription, terminal repeat sequences that guide the switch of RNA strands during DNA synthesis, a purine rich sequence 5' to the 3' LTR that serve as the priming site for the synthesis of the second strand of DNA synthesis, and specific sequences near the ends of the
  • gag, pol, and env genes allow for about 8 kb of foreign sequence to be inserted into the viral genome, become reverse transcribed , and upon replication be packaged into a new retroviral particle.
  • This amount of nucleic acid is sufficient for the delivery of a one to many genes depending on the size of each transcript. It is preferable to include either positive or negative selectable markers along with other genes in the insert.
  • a packaging cell line is a cell line which has been transfected or transformed with a retrovirus that contains the replication and packaging machinery, but lacks any packaging signal.
  • the vector carrying the DNA of choice is transfected into these cell lines, the vector containing the gene of interest is replicated and packaged into new retroviral particles, by the machinery provided in cis by the helper cell. The genomes for the machinery are not packaged because they lack the necessary signals.
  • viruses as vectors are limited in the extent to which they can spread to other cell types, since they can replicate within an initial infected cell, but are unable to form new infectious viral particles.
  • Recombinant adenoviruses have been shown to achieve high efficiency gene transfer after direct, in vivo delivery to airway epithelium, hepatocytes, vascular endothelium, CNS parenchyma and a number of other tissue sites (Morsy, J. Clin. Invest. 92:1580-1586
  • Recombinant adenoviruses achieve gene transduction by binding to specific cell surface receptors, after which the virus is internalized by receptor-mediated endocytosis, in the same manner as wild type or replication-defective adenovirus (Chardonnet and Dales, Virology 40:462-477 (1970); Brown and Burlingham, J. Virology 12:386-396 (1973); Svensson and Persson, J.
  • a preferred viral vector is one based on an adenovirus which has had the El gene removed and these virons are generated in a cell line such as the human 293 cell line.
  • both the El and E3 genes are removed from the adenovirus genome.
  • AAV adeno-associated virus
  • This defective parvovirus is a preferred vector because it can infect many cell types and is nonpathogenic to humans.
  • AAV type vectors can transport about 4 to 5 kb and wild type AAV is known to stably insert into chromosome 19. Vectors which contain this site specific integration property are preferred.
  • An especially preferred embodiment of this type of vector is the P4.1 C vector produced by Avigen, San Francisco, CA, which can contain the herpes simplex virus thymidine kinase gene, HSV-tk, and/or a marker gene, such as the gene encoding the green fluorescent protein, GFP.
  • the inserted genes in viral and retroviral usually contain promoters, and/or enhancers to help control the expression of the desired gene product.
  • a promoter is generally a sequence or sequences of DNA that function when in a relatively fixed location in regard to the transcription start site.
  • a promoter contains core elements required for basic interaction of RNA polymerase and transcription factors, and can contain upstream elements and response elements.
  • Preferred promoters controlling transcription from vectors in mammalian host cells can be obtained from various sources, for example, the genomes of viruses such as: polyoma, Simian Virus 40 (SV40), adenovirus, retroviruses, hepatitis-B virus and most preferably cytomegalovirus, or from heterologous mammalian promoters, e.g. beta actin promoter.
  • the early and late promoters of the SV40 virus are conveniently obtained as an SV40 restriction fragment which also contains the SV40 viral origin of replication (Fiers et al., Nature, 273: 113 (1978)).
  • the immediate early promoter of the human cytomegalovirus is conveniently obtained as a HindIII E restriction fragment (Greenway, PJ. et al., Gene 18: 355-360 (1982)).
  • promoters from the host cell or related species also are useful herein.
  • Enhancer generally refers to a sequence of DNA that functions at no fixed distance from the transcription start site and can be either 5' (Laimins, L. et al., Proc. Natl. Acad. Sci. 78: 993 (1981)) or 3 1 (Lusky, M.L., et al., MoI. Cell Bio. 3: 1108 (1983)) to the transcription unit. Furthermore, enhancers can be within an intron (Banerji, J. L. et al., Cell 33: 729 (1983)) as well as within the coding sequence itself (Osborne, T.F., et al., MoI. Cell Bio. 4: 1293 (1984)).
  • Enhancers function to increase transcription from nearby promoters. Enhancers also often contain response elements that mediate the regulation of transcription. Promoters can also contain response elements that mediate the regulation of transcription. Enhancers often determine the regulation of expression of a gene. While many enhancer sequences are now known from mammalian genes (globin, elastase, albumin, ⁇ -fetoprotein and insulin), typically one will use an enhancer from a eukaryotic cell virus.
  • Preferred examples are the SV40 enhancer on the late side of the replication origin (bp 100-270), the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.
  • the promoter and/or enhancer can be specifically activated either by light or specific chemical events which trigger their function.
  • Systems can be regulated by reagents such as tetracycline and dexamethasone.
  • reagents such as tetracycline and dexamethasone.
  • a preferred promoter of this type is the CMV promoter (650 bases).
  • Other preferred promoters are SV40 promoters, cytomegalovirus (full length promoter), and retroviral vector LTF.
  • GFAP glial fibrillary acetic protein
  • Expression vectors used in eukaryotic host cells can also contain sequences necessary for the termination of transcription which can affect mRNA expression. These regions are transcribed as polyadenylated segments in the untranslated portion of the mRNA encoding tissue factor protein. The 3' untranslated regions also include transcription termination sites. It is preferred that the transcription unit also contain a polyadenylation region. One benefit of this region is that it increases the likelihood that the transcribed unit will be processed and transported like mRNA.
  • the identification and use of polyadenylation signals in expression constructs is well established. It is preferred that homologous polyadenylation signals be used in the transgene constructs.
  • the polyadenylation region is derived from the SV40 early polyadenylation signal and consists of about 400 bases. It is also preferred that the transcribed units contain other standard sequences alone or in combination with the above sequences improve expression from, or stability of, the construct. 3. Markers
  • the vectors can include nucleic acid sequence encoding a marker product. This marker product is used to determine if the gene has been delivered to the cell and once delivered is being expressed.
  • Preferred marker genes are the E. CoIi lacZ gene which encodes ⁇ -galactosidase and green fluorescent protein.
  • the marker can be a selectable marker.
  • suitable selectable markers for mammalian cells are dihydro folate reductase (DHFR), thymidine kinase, neomycin, neomycin analog G418, hydromycin, and puromycin.
  • DHFR dihydro folate reductase
  • thymidine kinase thymidine kinase
  • neomycin neomycin analog G418, hydromycin
  • puromycin puromycin.
  • the transformed mammalian host cell can survive if placed under selective pressure.
  • selective regimes There are two widely used distinct categories of selective regimes. The first category is based on a cell's metabolism and the use of a mutant cell line which lacks the ability to grow independent of a supplemented media. Two examples are: CHO DHFR" cells and mouse LTK" cells. These cells lack the ability to grow without the addition of such nutrients as thymidine or hypoxanthine. Because these cells lack certain genes necessary for a complete nucleotide synthesis pathway, they cannot survive unless the missing nucleotides are provided in a supplemented media.
  • An alternative to supplementing the media is to introduce an intact DHFR or TK gene into cells lacking the respective genes, thus altering their growth requirements. Individual cells which were not transformed with the DHFR or TK gene will not be capable of survival in non-supplemented media.
  • the second category is dominant selection which refers to a selection scheme used in any cell type and does not require the use of a mutant cell line. These schemes typically use a drug to arrest growth of a host cell. Those cells which would express a protein conveying drug resistance and would survive the selection. Examples of such dominant selection use the drugs neomycin, (Southern P. and Berg, P., J. Molec. Appl. Genet. 1: 327 (1982)), mycophenolic acid, (Mulligan, R.C. and Berg, P. Science 209: 1422 (1980)) or hygromycin, (Sugden, B. et al, MoI. Cell. Biol. 5: 410-413 (1985)).
  • Biosensor riboswitches are engineered riboswitches that produce a detectable signal in the presence of their cognate trigger molecule. Useful biosensor riboswitches can be triggered at or above threshold levels of the trigger molecules. Biosensor riboswitches can be designed for use in vivo or in vitro.
  • preQi biosensor riboswitches operably linked to a reporter RNA that encodes a protein that serves as or is involved in producing a signal can be used in vivo by engineering a cell or organism to harbor a nucleic acid construct encoding the preQi riboswitch/reporter RNA.
  • biosensor riboswitch for use in vitro is a riboswitch that includes a conformation dependent label, the signal from which changes depending on the activation state of the riboswitch.
  • a biosensor riboswitch preferably uses an aptamer domain from or derived from a naturally occurring riboswitch, such as preQi.
  • a reporter protein or peptide can be used for assessing activation of a riboswitch, or for biosensor riboswitches.
  • the reporter protein or peptide can be encoded by the RNA the expression of which is regulated by the riboswitch.
  • the examples describe the use of some specific reporter proteins.
  • the use of reporter proteins and peptides is well known and can be adapted easily for use with riboswitches.
  • the reporter proteins can be any protein or peptide that can be detected or that produces a detectable signal.
  • the presence of the protein or peptide can be detected using standard techniques (e.g., radioimmunoassay, radio-labeling, immunoassay, assay for enzymatic activity, absorbance, fluorescence, luminescence, and Western blot). More preferably, the level of the reporter protein is easily quantifiable using standard techniques even at low levels.
  • reporter proteins include luciferases, green fluorescent proteins and their derivatives, such as firefly luciferase (FL) from Photinus pyralis, and Renilla luciferase (RL) from Renilla reniformis.
  • Conformation dependent labels refer to all labels that produce a change in fluorescence intensity or wavelength based on a change in the form or conformation of the molecule or compound (such as a riboswitch) with which the label is associated.
  • Examples of conformation dependent labels used in the context of probes and primers include molecular beacons, Amplifluors, FRET probes, cleavable FRET probes, TaqMan probes, scorpion primers, fluorescent triplex oligos including but not limited to triplex molecular beacons or triplex FRET probes, fluorescent water-soluble conjugated polymers, PNA probes and QPNA probes.
  • Such labels and, in particular, the principles of their function, can be adapted for use with riboswitches.
  • Several types of conformation dependent labels are reviewed in Schweitzer and Kingsmore, Curr. Opin. Biotech. 12:21- 27 (2001).
  • Stem quenched labels are fluorescent labels positioned on a nucleic acid such that when a stem structure forms a quenching moiety is brought into proximity such that fluorescence from the label is quenched.
  • the stem is disrupted (such as when a riboswitch containing the label is activated)
  • the quenching moiety is no longer in proximity to the fluorescent label and fluorescence increases. Examples of this effect can be found in molecular beacons, fluorescent triplex oligos, triplex molecular beacons, triplex FRET probes, and QPNA probes, the operational principles of which can be adapted for use with riboswitches.
  • Stem activated labels are labels or pairs of labels where fluorescence is increased or altered by formation of a stem structure.
  • Stem activated labels can include an acceptor fluorescent label and a donor moiety such that, when the acceptor and donor are in proximity (when the nucleic acid strands containing the labels form a stem structure), fluorescence resonance energy transfer from the donor to the acceptor causes the acceptor to fluoresce.
  • Stem activated labels are typically pairs of labels positioned on nucleic acid molecules (such as riboswitches) such that the acceptor and donor are brought into proximity when a stem structure is formed in the nucleic acid molecule.
  • the donor moiety of a stem activated label is itself a fluorescent label, it can release energy as fluorescence (typically at a different wavelength than the fluorescence of the acceptor) when not in proximity to an acceptor (that is, when a stem structure is not formed). When the stem structure forms, the overall effect would then be a reduction of donor fluorescence and an increase in acceptor fluorescence.
  • FRET probes are an example of the use of stem activated labels, the operational principles of which can be adapted for use with riboswitches. H.
  • detection labels can be incorporated into detection probes or detection molecules or directly incorporated into expressed nucleic acids or proteins.
  • a detection label is any molecule that can be associated with nucleic acid or protein, directly or indirectly, and which results in a measurable, detectable signal, either directly or indirectly. Many such labels are known to those of skill in the art. Examples of detection labels suitable for use in the disclosed method are radioactive isotopes, fluorescent molecules, phosphorescent molecules, enzymes, antibodies, and ligands.
  • fluorescent labels include fluorescein isothiocyanate (FITC), 5,6-carboxymethyl fluorescein, Texas red, nitrobenz-2-oxa-l,3-diazol-4-yl (NBD), coumarin, dansyl chloride, rhodamine, amino-methyl coumarin (AMCA), Eosin, Erythrosin, BODIPY ® , Cascade Blue ® , Oregon Green ® , pyrene, lissamine, xanthenes, acridines, oxazines, phycoerythrin, macrocyclic chelates of lanthanide ions such as quantum dyeTM, fluorescent energy transfer dyes, such as thiazole orange-ethidium heterodimer, and the cyanine dyes Cy3, Cy3.5, Cy5, Cy5.5 and Cy7.
  • FITC fluorescein isothiocyanate
  • NBD nitrobenz-2-oxa-l,3-diazol-4-
  • Examples of other specific fluorescent labels include 3-Hydroxypyrene 5,8,10-Tri Sulfonic acid, 5-Hydroxy Tryptamine (5-HT), Acid Fuchsin, Alizarin Complexon, Alizarin Red, Allophycocyanin, Aminocoumarin, Anthroyl Stearate, Astrazon Brilliant Red 4G, Astrazon Orange R, Astrazon Red 6B, Astrazon Yellow 7 GLL, Atabrine, Auramine, Aurophosphine, Aurophosphine G, BAO 9 (Bisaminophenyloxadiazole), BCECF, Berberine Sulphate, Bisbenzamide, Blancophor FFG Solution, Blancophor SV, Bodipy Fl, Brilliant Sulphoflavin FF, Calcien Blue, Calcium Green, Calcofluor RW Solution, Calcofluor White, Calcophor White ABT Solution, Calcophor White Standard Solution, Carbostyryl, Cascade Yellow, Catecholamine, Chinacrine, Coriphosphine O, Coumarin
  • Isothiosulphonic acid Stilbene, Snarf 1, sulpho Rhodamine B Can C, Sulpho Rhodamine G Extra, Tetracycline, Thiazine Red R, Thioflavin S, Thioflavin TCN, Thioflavin 5, Thiolyte, Thiozol Orange, Tinopol CBS, True Blue, Ultralite, Uranine B, Uvitex SFC, Xylene Orange, and XRITC.
  • Useful fluorescent labels are fluorescein (5-carboxyfluorescein-N- hydroxysuccinimide ester), rhodamine (5,6-tetramethyl rhodamine), and the cyanine dyes Cy3, Cy3.5, Cy5, Cy5.5 and Cy7.
  • the absorption and emission maxima, respectively, for these fluors are: FITC (490 nm; 520 nm), Cy3 (554 nm; 568 nm), Cy3.5 (581 nm; 588 nm), Cy5 (652 nm: 672 nm), Cy5.5 (682 nm; 703 nm) and Cy7 (755 nm; 778 nm), thus allowing their simultaneous detection.
  • fluorescein dyes include 6- carboxyfluorescein (6-FAM), 2',4',1,4,-tetrachlorofluorescein (TET), 2',4',5',7',1,4- hexachloro fluorescein (HEX), 2',7'-dimethoxy-4', S'-dichloro- ⁇ -carboxyrhodamine (JOE), 2'-chloro-5'-fluoro-7',8'-fused phenyl-l,4-dichloro-6-carboxyfluorescein (NED), and T- chloro-7'-phenyl-l,4-dichloro-6-carboxyfluorescein (VIC).
  • Fluorescent labels can be obtained from a variety of commercial sources, including Amersham Pharmacia Biotech, Piscataway, NJ; Molecular Probes, Eugene, OR; and Research Organics, Cleveland, Ohio.
  • Additional labels of interest include those that provide for signal only when the probe with which they are associated is specifically bound to a target molecule, where such labels include: "molecular beacons” as described in Tyagi & Kramer, Nature Biotechnology (1996) 14:303 and EP 0 070 685 Bl.
  • Other labels of interest include those described in U.S. Pat. No. 5,563,037; WO 97/17471 and WO 97/17076.
  • Labeled nucleotides are a useful form of detection label for direct incorporation into expressed nucleic acids during synthesis.
  • detection labels that can be incorporated into nucleic acids include nucleotide analogs such as BrdUrd (5- bromodeoxyuridine, Hoy and Schimke, Mutation Research 290:217-230 (1993)), aminoallyldeoxyuridine (Henegariu et al., Nature Biotechnology 18:345-348 (2000)), 5- methylcytosine (Sano et al., Biochim. Biophys. Acta 951 :157-165 (1988)), bromouridine (Wansick et al, J.
  • Suitable fluorescence-labeled nucleotides are Fluorescein-isothiocyanate-dUTP, Cyanine-3-dUTP and Cyanine-5-dUTP (Yu et al., Nucleic Acids Res., 22:3226-3232 (1994)).
  • a preferred nucleotide analog detection label for DNA is BrdUrd (bromodeoxyuridine, BrdUrd,
  • AA-dUTP aminoallyl-deoxyuridine triphosphate
  • 5-methyl-dCTP 5-methyl-dCTP
  • a useful nucleotide analog for incorporation of detection label into RNA is biotin-16-UTP (biotin- 16-uridine- 5'-triphosphate, Roche Molecular Biochemicals). Fluorescein, Cy3, and Cy5 can be linked to dUTP for direct labeling. Cy3.5 and Cy7 are available as avidin or anti- digoxygenin conjugates for secondary detection of biotin- or digoxygenin-labeled probes.
  • Biotin can be detected using streptavidin-alkaline phosphatase conjugate (Tropix, Inc.), which is bound to the biotin and subsequently detected by chemiluminescence of suitable substrates (for example, chemiluminescent substrate CSPD: disodium, 3-(4- methoxyspiro-[l,2,-dioxetane-3-2'-(5'-chloro)tricyclo [3.3.1.1 3>7 ]decane]-4-yl) phenyl phosphate; Tropix, Inc.).
  • suitable substrates for example, chemiluminescent substrate CSPD: disodium, 3-(4- methoxyspiro-[l,2,-dioxetane-3-2'-(5'-chloro)tricyclo [3.3.1.1 3>7 ]decane]-4-yl
  • Labels can also be enzymes, such as alkaline phosphatase, soybean peroxidase, horseradish peroxidase and polymerases, that can be detected, for example, with chemical signal amplification or by using a substrate to the enzyme which produces light (for example, a chemiluminescent 1 ,2-dioxetane substrate) or fluorescent signal.
  • enzymes such as alkaline phosphatase, soybean peroxidase, horseradish peroxidase and polymerases
  • a substrate to the enzyme which produces light for example, a chemiluminescent 1 ,2-dioxetane substrate
  • fluorescent signal for example, a chemiluminescent 1 ,2-dioxetane substrate
  • Detection labels that combine two or more of these detection labels are also considered detection labels. Any of the known detection labels can be used with the disclosed probes, tags, molecules and methods to label and detect activated or deactivated riboswitches or nucleic acid or protein produced in the disclosed methods. Methods for detecting and measuring signals generated by detection labels are also known to those of skill in the art.
  • radioactive isotopes can be detected by scintillation counting or direct visualization; fluorescent molecules can be detected with fluorescent spectrophotometers; phosphorescent molecules can be detected with a spectrophotometer or directly visualized with a camera; enzymes can be detected by detection or visualization of the product of a reaction catalyzed by the enzyme; antibodies can be detected by detecting a secondary detection label coupled to the antibody.
  • detection molecules are molecules which interact with a compound or composition to be detected and to which one or more detection labels are coupled.
  • homology and identity mean the same thing as similarity.
  • word homology is used between two sequences (non-natural sequences, for example) it is understood that this is not necessarily indicating an evolutionary relationship between these two sequences, but rather is looking at the similarity or relatedness between their nucleic acid sequences.
  • Many of the methods for determining homology between two evolutionarily related molecules are routinely applied to any two or more nucleic acids or proteins for the purpose of measuring sequence similarity regardless of whether they are evolutionarily related or not.
  • Optimal alignment of sequences for comparison can be conducted by the local homology algorithm of Smith and Waterman Adv. Appl. Math. 2: 482 (1981), by the homology alignment algorithm of Needleman and Wunsch, J. MoL Biol. 48: 443 (1970), by the search for similarity method of Pearson and Lipman, Proc. Natl. Acad. Sci. U.S.A. 85: 2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WI), or by inspection.
  • nucleic acids can be obtained by for example the algorithms disclosed in Zuker, M. Science 244:48-52, 1989, Jaeger et al. Proc. Natl. Acad. Sci. USA 86:7706-7710, 1989, Jaeger et al. Methods Enzymol. 183:281-306, 1989 which are herein incorporated by reference for at least material related to nucleic acid alignment. It is understood that any of the methods typically can be used and that in certain instances the results of these various methods can differ, but the skilled artisan understands if identity is found with at least one of these methods, the sequences would be said to have the stated identity.
  • a sequence recited as having a particular percent homology to another sequence refers to sequences that have the recited homology as calculated by any one or more of the calculation methods described above.
  • a first sequence has 80 percent homology, as defined herein, to a second sequence if the first sequence is calculated to have 80 percent homology to the second sequence using the Zuker calculation method even if the first sequence does not have 80 percent homology to the second sequence as calculated by any of the other calculation methods.
  • a first sequence has 80 percent homology, as defined herein, to a second sequence if the first sequence is calculated to have 80 percent homology to the second sequence using both the Zuker calculation method and the Pearson and Lipman calculation method even if the first sequence does not have 80 percent homology to the second sequence as calculated by the Smith and Waterman calculation method, the Needleman and Wunsch calculation method, the Jaeger calculation methods, or any of the other calculation methods.
  • a first sequence has 80 percent homology, as defined herein, to a second sequence if the first sequence is calculated to have 80 percent homology to the second sequence using each of calculation methods (although, in practice, the different calculation methods will often result in different calculated homology percentages).
  • hybridization typically means a sequence driven interaction between at least two nucleic acid molecules, such as a primer or a probe and a riboswitch or a gene.
  • Sequence driven interaction means an interaction that occurs between two nucleotides or nucleotide analogs or nucleotide derivatives in a nucleotide specific manner. For example, G interacting with C or A interacting with T are sequence driven interactions. Typically sequence driven interactions occur on the Watson-Crick face or Hoogsteen face of the nucleotide.
  • the hybridization of two nucleic acids is affected by a number of conditions and parameters known to those of skill in the art. For example, the salt concentrations, pH, and temperature of the reaction all affect whether two nucleic acid molecules will hybridize.
  • selective hybridization conditions can be defined as stringent hybridization conditions.
  • stringency of hybridization is controlled by both temperature and salt concentration of either or both of the hybridization and washing steps.
  • the conditions of hybridization to achieve selective hybridization can involve hybridization in high ionic strength solution (6X SSC or 6X SSPE) at a temperature that is about 12-25°C below the Tm (the melting temperature at which half of the molecules dissociate from their hybridization partners) followed by washing at a combination of temperature and salt concentration chosen so that the washing temperature is about 5°C to 20 0 C below the Tm.
  • the temperature and salt conditions are readily determined empirically in preliminary experiments in which samples of reference DNA immobilized on filters are hybridized to a labeled nucleic acid of interest and then washed under conditions of different stringencies. Hybridization temperatures are typically higher for DNA-RNA and RNA-RNA hybridizations.
  • the conditions can be used as described above to achieve stringency, or as is known in the art (Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1989; Kunkel et al. Methods Enzymol. 1987:154:367, 1987 which is herein incorporated by reference for material at least related to hybridization of nucleic acids).
  • a preferable stringent hybridization condition for a DNA:DNA hybridization can be at about 68 0 C (in aqueous solution) in 6X SSC or 6X SSPE followed by washing at 68 0 C.
  • Stringency of hybridization and washing if desired, can be reduced accordingly as the degree of complementarity desired is decreased, and further, depending upon the G-C or A-T richness of any area wherein variability is searched for.
  • stringency of hybridization and washing if desired, can be increased accordingly as homology desired is increased, and further, depending upon the G-C or A-T richness of any area wherein high homology is desired, all as known in the art.
  • selective hybridization is by looking at the amount (percentage) of one of the nucleic acids bound to the other nucleic acid.
  • selective hybridization conditions would be when at least about, 60, 65, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 percent of the limiting nucleic acid is bound to the non- limiting nucleic acid.
  • the non-limiting nucleic acid is in for example, 10 or 100 or 1000 fold excess.
  • This type of assay can be performed at under conditions where both the limiting and non- limiting nucleic acids are for example, 10 fold or 100 fold or 1000 fold below their ka, or where only one of the nucleic acid molecules is 10 fold or 100 fold or 1000 fold or where one or both nucleic acid molecules are above their kd.
  • selective hybridization conditions would be when at least about, 60, 65, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 percent of the nucleic acid is enzymatically manipulated under conditions which promote the enzymatic manipulation, for example if the enzymatic manipulation is DNA extension, then selective hybridization conditions would be when at least about 60, 65, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88
  • Preferred conditions also include those suggested by the manufacturer or indicated in the art as being appropriate for the enzyme performing the manipulation.
  • homology it is understood that there are a variety of methods herein disclosed for determining the level of hybridization between two nucleic acid molecules. It is understood that these methods and conditions can provide different percentages of hybridization between two nucleic acid molecules, but unless otherwise indicated meeting the parameters of any of the methods would be sufficient. For example if 80% hybridization was required and as long as hybridization occurs within the required parameters in any one of these methods it is considered disclosed herein.
  • nucleic acid based including, for example, riboswitches, aptamers, and nucleic acids that encode riboswitches and aptamers.
  • the disclosed nucleic acids can be made up of for example, nucleotides, nucleotide analogs, or nucleotide substitutes. Non-limiting examples of these and other molecules are discussed herein. It is understood that for example, when a vector is expressed in a cell, that the expressed mRNA will typically be made up of A, C, G, and U.
  • nucleic acid molecule is introduced into a cell or cell environment through for example exogenous delivery, it is advantageous that the nucleic acid molecule be made up of nucleotide analogs that reduce the degradation of the nucleic acid molecule in the cellular environment.
  • riboswitches, aptamers, expression platforms and any other oligonucleotides and nucleic acids can be made up of or include modified nucleotides (nucleotide analogs). Many modified nucleotides are known and can be used in oligonucleotides and nucleic acids.
  • a nucleotide analog is a nucleotide which contains some type of modification to either the base, sugar, or phosphate moieties.
  • Modifications to the base moiety would include natural and synthetic modifications of A, C, G, and TAJ as well as different purine or pyrimidine bases, such as uracil-5-yl, hypoxanthin-9-yl (I), and 2-aminoadenin-9-yl.
  • a modified base includes but is not limited to 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines
  • Universal bases include 3-nitropyrrole and 5-nitroindole. Universal bases substitute for the normal bases but have no bias in base pairing. That is, universal bases can base pair with any other base. Base modifications often can be combined with for example a sugar modification, such as 2'-O-methoxyethyl, to achieve unique properties such as increased duplex stability.
  • a sugar modification such as 2'-O-methoxyethyl
  • Modifications to the sugar moiety would include natural modifications of the ribose and deoxyribose as well as synthetic modifications.
  • Sugar modifications include but are not limited to the following modifications at the 2' position: OH; F; 0-, S-, or N-alkyl; 0-, S-, or N-alkenyl; 0-, S- or N-alkynyl; or O-alkyl-0-alkyl, wherein the alkyl, alkenyl and alkynyl can be substituted or unsubstituted Cl to ClO, alkyl or C2 to ClO alkenyl and alkynyl.
  • 2' sugar modifications also include but are not limited to -O[(CH 2 )n O]m CH 3 , - O(CH 2 )n OCH 3 , -0(CH 2 )n NH 2 , -0(CH 2 )n CH 3 , -0(CH 2 )n -ONH 2 , and - O(CH 2 )nON[(CH 2 )n CH 3 )J 2 , where n and m are from 1 to about 10.
  • modifications at the 2' position include but are not limited to: Cl to ClO lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH 3 , OCN, Cl, Br, CN, CF 3 , OCF 3 , SOCH 3 , SO 2 CH 3 , ONO 2 , NO 2 , N 3 , NH 2 , heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an oligonucleotide, or a group for improving the pharmacodynamic properties of an oligonucleotide, and other substituents having similar properties.
  • Similar modifications can also be made at other positions on the sugar, particularly the 3' position of the sugar on the 3' terminal nucleotide or in 2'-5' linked oligonucleotides and the 5' position of 5' terminal nucleotide.
  • Modified sugars would also include those that contain modifications at the bridging ring oxygen, such as CH 2 and S.
  • Nucleotide sugar analogs can also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar.
  • modified sugar structures such as 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; and 5,700,920, each of which is herein incorporated by reference in its entirety, and specifically for their description of modified sugar structures, their synthesis, their use, and their incorporation into nucleotides, oligonucleotides and nucleic acids.
  • Nucleotide analogs can also be modified at the phosphate moiety.
  • Modified phosphate moieties include but are not limited to those that can be modified so that the linkage between two nucleotides contains a phosphorothioate, chiral phosphorothioate, phosphorodithioate, phosphotriester, aminoalkylphosphotriester, methyl and other alkyl phosphonates including 3'-alkylene phosphonate and chiral phosphonates, phosphinates, phosphoramidates including 3'-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates.
  • these phosphate or modified phosphate linkages between two nucleotides can be through a 3 '-5' linkage or a 2'-5' linkage, and the linkage can contain inverted polarity such as 3'-5' to 5'-3' or 2'-5' to 5'-2'.
  • Various salts, mixed salts and free acid forms are also included.
  • nucleotides containing modified phosphates include but are not limited to, 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306; 5,550,111; 5,563,253; 5,571,799; 5,587,361; and 5,625,050, each of which is herein incorporated by reference its entirety, and specifically for their description of modified phosphates, their synthesis, their use, and their incorporation into nucleotides, oligonucleotides and nucleic acids. It is understood that nucleotide analogs need only contain a single modification
  • Nucleotide substitutes are molecules having similar functional properties to nucleotides, but which do not contain a phosphate moiety, such as peptide nucleic acid (PNA). Nucleotide substitutes are molecules that will recognize and hybridize to (base pair to) complementary nucleic acids in a Watson-Crick or Hoogsteen manner, but which are linked together through a moiety other than a phosphate moiety. Nucleotide substitutes are able to conform to a double helix type structure when interacting with the appropriate target nucleic acid. Nucleotide substitutes are nucleotides or nucleotide analogs that have had the phosphate moiety and/or sugar moieties replaced.
  • PNA peptide nucleic acid
  • Nucleotide substitutes do not contain a standard phosphorus atom.
  • Substitutes for the phosphate can be for example, short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages.
  • morpholino linkages formed in part from the sugar portion of a nucleoside
  • siloxane backbones sulfide, sulfoxide and sulfone backbones
  • formacetyl and thioformacetyl backbones methylene formacetyl and thioformacetyl backbones
  • alkene containing backbones sulfamate backbones
  • sulfonate and sulfonamide backbones amide backbones; and others having mixed N, O, S and CH2 component parts.
  • phosphate replacements include but are not limited to 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; and 5,677,439, each of which is herein incorporated by reference its entirety, and specifically for their description of phosphate replacements, their synthesis, their use, and their incorporation into nucleotides, oligonucleotides and nucleic acids.
  • PNA aminoethylglycine
  • Oligonucleotides and nucleic acids can be comprised of nucleotides and can be made up of different types of nucleotides or the same type of nucleotides.
  • one or more of the nucleotides in an oligonucleotide can be ribonucleotides, 2'-O-methyl ribonucleotides, or a mixture of ribonucleotides and 2'-O-methyl ribonucleotides; about 10% to about 50% of the nucleotides can be ribonucleotides, 2'-O-methyl ribonucleotides, or a mixture of ribonucleotides and 2'-O-methyl ribonucleotides; about 50% or more of the nucleotides can be ribonucleotides, 2'-O-methyl ribonucleotides, or a mixture of ribonucleotides and 2'-O-methyl ribonucleo
  • Solid supports are solid-state substrates or supports with which molecules (such as trigger molecules) and riboswitches (or other components used in, or produced by, the disclosed methods) can be associated.
  • Riboswitches and other molecules can be associated with solid supports directly or indirectly.
  • analytes e.g., trigger molecules, test compounds
  • capture agents e.g., compounds or molecules that bind an analyte
  • riboswitches can be bound to the surface of a solid support or associated with probes immobilized on solid supports.
  • An array is a solid support to which multiple riboswitches, probes or other molecules have been associated in an array, grid, or other organized pattern.
  • Solid-state substrates for use in solid supports can include any solid material with which components can be associated, directly or indirectly. This includes materials such as acrylamide, agarose, cellulose, nitrocellulose, glass, gold, polystyrene, polyethylene vinyl acetate, polypropylene, polymethacrylate, polyethylene, polyethylene oxide, polysilicates, polycarbonates, teflon, fluorocarbons, nylon, silicon rubber, polyanhydrides, polyglycolic acid, polylactic acid, polyorthoesters, functionalized silane, polypropylfumerate, collagen, glycosaminoglycans, and polyamino acids.
  • materials such as acrylamide, agarose, cellulose, nitrocellulose, glass, gold, polystyrene, polyethylene vinyl acetate, polypropylene, polymethacrylate, polyethylene, polyethylene oxide, polysilicates, polycarbonates, teflon, fluorocarbons, nylon, silicon rubber, polyanhydrides
  • Solid-state substrates can have any useful form including thin film, membrane, bottles, dishes, fibers, woven fibers, shaped polymers, particles, beads, microparticles, or a combination.
  • Solid- state substrates and solid supports can be porous or non-porous.
  • a chip is a rectangular or square small piece of material.
  • Preferred forms for solid-state substrates are thin films, beads, or chips.
  • a useful form for a solid-state substrate is a microtiter dish, hi some embodiments, a multiwell glass slide can be employed.
  • An array can include a plurality of riboswitches, trigger molecules, other molecules, compounds or probes immobilized at identified or predefined locations on the solid support.
  • Each predefined location on the solid support generally has one type of component (that is, all the components at that location are the same). Alternatively, multiple types of components can be immobilized in the same predefined location on a solid support. Each location will have multiple copies of the given components.
  • the spatial separation of different components on the solid support allows separate detection and identification. Although useful, it is not required that the solid support be a single unit or structure.
  • a set of riboswitches, trigger molecules, other molecules, compounds and/or probes can be distributed over any number of solid supports. For example, at one extreme, each component can be immobilized in a separate reaction tube or container, or on separate beads or microparticles.
  • Oligonucleotides can be coupled to substrates using established coupling methods. For example, suitable attachment methods are described by Pease et al, Proc. Natl. Acad. ScL USA 91(11):5022-5026 (1994), and Khrapko et al, MoI Biol (Mosk) (USSR) 25:718-730 (1991).
  • a method for immobilization of 3'-amine oligonucleotides on casein-coated slides is described by Stimpson et al, Proc. Natl. Acad. Sci. USA 92:6379-6383 (1995).
  • Each of the components for example, riboswitches, trigger molecules, or other molecules
  • immobilized on the solid support can be located in a different predefined region of the solid support.
  • the different locations can be different reaction chambers.
  • Each of the different predefined regions can be physically separated from each other of the different regions.
  • the distance between the different predefined regions of the solid support can be either fixed or variable.
  • each of the components can be arranged at fixed distances from each other, while components associated with beads will not be in a fixed spatial relationship.
  • the use of multiple solid support units for example, multiple beads) will result in variable distances.
  • Components can be associated or immobilized on a solid support at any density. Components can be immobilized to the solid support at a density exceeding 400 different components per cubic centimeter. Arrays of components can have any number of components. For example, an array can have at least 1 ,000 different components immobilized on the solid support, at least 10,000 different components immobilized on the solid support, at least 100,000 different components immobilized on the solid support, or at least 1,000,000 different components immobilized on the solid support. M. Kits
  • kits for detecting compounds the kit comprising one or more biosensor riboswitches.
  • the kits also can contain reagents and labels for detecting activation of the riboswitches.
  • mixtures formed by performing or preparing to perform the disclosed method For example, disclosed are mixtures comprising riboswitches and trigger molecules.
  • the method involves mixing or bringing into contact compositions or components or reagents
  • performing the method creates a number of different mixtures. For example, if the method includes 3 mixing steps, after each one of these steps a unique mixture is formed if the steps are performed separately. In addition, a mixture is formed at the completion of all of the steps regardless of how the steps were performed.
  • the present disclosure contemplates these mixtures, obtained by the performance of the disclosed methods as well as mixtures containing any disclosed reagent, composition, or component, for example, disclosed herein.
  • Systems useful for performing, or aiding in the performance of, the disclosed method.
  • Systems generally comprise combinations of articles of manufacture such as structures, machines, devices, and the like, and compositions, compounds, materials, and the like. Such combinations that are disclosed or that are apparent from the disclosure are contemplated.
  • systems comprising biosensor riboswitches, a solid support and a signal-reading device.
  • P. Data Structures and Computer Control Disclosed are data structures used in, generated by, or generated from, the disclosed method.
  • Data structures generally are any form of data, information, and/or objects collected, organized, stored, and/or embodied in a composition or medium.
  • Riboswitch structures and activation measurements stored in electronic form, such as in RAM or on a storage disk is a type of data structure.
  • the disclosed method, or any part thereof or preparation therefor can be controlled, managed, or otherwise assisted by computer control.
  • Such computer control can be accomplished by a computer controlled process or method, can use and/or generate data structures, and can use a computer program.
  • Such computer control, computer controlled processes, data structures, and computer programs are contemplated and should be understood to be disclosed herein.
  • riboswitch a compound or trigger molecule that can activate, deactivate or block the riboswitch.
  • Riboswitches function to control gene expression through the binding or removal of a trigger molecule.
  • Compounds can be used to activate, deactivate or block a riboswitch.
  • the trigger molecule for a riboswitch (as well as other activating compounds) can be used to activate a riboswitch.
  • Compounds other than the trigger molecule generally can be used to deactivate or block a riboswitch.
  • Riboswitches can also be deactivated by, for example, removing trigger molecules from the presence of the riboswitch.
  • the disclosed method of deactivating a riboswitch can involve, for example, removing a trigger molecule (or other activating compound) from the presence or contact with the riboswitch.
  • a riboswitch can be blocked by, for example, binding of an analog of the trigger molecule that does not activate the riboswitch.
  • RNA molecules or of a gene encoding an RNA molecule, where the RNA molecule includes a riboswitch
  • Riboswitches function to control gene expression through the binding or removal of a trigger molecule.
  • subjecting an RNA molecule of interest that includes a riboswitch to conditions that activate, deactivate or block the riboswitch can be used to alter expression of the RNA.
  • Expression can be altered as a result of, for example, termination of transcription or blocking of ribosome binding to the RNA. Binding of a trigger molecule can, depending on the nature of the riboswitch, reduce or prevent expression of the RNA molecule or promote or increase expression of the RNA molecule.
  • Activation of a riboswitch refers to the change in state of the riboswitch upon binding of a trigger molecule.
  • a riboswitch can be activated by compounds other than the trigger molecule and in ways other than binding of a trigger molecule.
  • the term trigger molecule is used herein to refer to molecules and compounds that can activate a riboswitch. This includes the natural or normal trigger molecule for the riboswitch and other compounds that can activate the riboswitch.
  • Natural or normal trigger molecules are the trigger molecule for a given riboswitch in nature or, in the case of some non-natural riboswitches, the trigger molecule for which the riboswitch was designed or with which the riboswitch was selected (as in, for example, in vitro selection or in vitro evolution techniques).
  • Non-natural trigger molecules can be referred to as non-natural trigger molecules.
  • compounds that activate a riboswitch can be identified by bringing into contact a test compound and a riboswitch and assessing activation of the riboswitch. If the riboswitch is activated, the test compound is identified as a compound that activates the riboswitch. Activation of a riboswitch can be assessed in any suitable manner.
  • the riboswitch can be linked to a reporter RNA and expression, expression level, or change in expression level of the reporter RNA can be measured in the presence and absence of the test compound.
  • the riboswitch can include a conformation dependent label, the signal from which changes depending on the activation state of the riboswitch.
  • a riboswitch preferably uses an aptamer domain from or derived from a naturally occurring riboswitch.
  • assessment of activation of a riboswitch can be performed with the use of a control assay or measurement or without the use of a control assay or measurement.
  • Methods for identifying compounds that deactivate a riboswitch can be performed in analogous ways. In addition to the methods disclosed elsewhere herein, identification of compounds that block a riboswitch can be accomplished in any suitable manner.
  • an assay can be performed for assessing activation or deactivation of a riboswitch in the presence of a compound known to activate or deactivate the riboswitch and in the presence of a test compound. If activation or deactivation is not observed as would be observed in the absence of the test compound, then the test compound is identified as a compound that blocks activation or deactivation of the riboswitch.
  • Biosensor riboswitches are engineered riboswitches that produce a detectable signal in the presence of their cognate trigger molecule. Useful biosensor riboswitches can be triggered at or above threshold levels of the trigger molecules. Biosensor riboswitches can be designed for use in vivo or in vitro.
  • preQi biosensor riboswitches operably linked to a reporter RNA that encodes a protein that serves as or is involved in producing a signal can be used in vivo by engineering a cell or organism to harbor a nucleic acid construct encoding the riboswitch/reporter RNA.
  • An example of a biosensor riboswitch for use in vitro is a preQi riboswitch that includes a conformation dependent label, the signal from which changes depending on the activation state of the riboswitch.
  • Such a biosensor riboswitch preferably uses an aptamer domain from or derived from a naturally occurring preQi riboswitch.
  • compounds can be made by bringing into contact a test compound and a riboswitch, assessing activation of the riboswitch, and, if the riboswitch is activated by the test compound, manufacturing the test compound that activates the riboswitch as the compound.
  • Checking compounds for their ability to activate, deactivate or block a riboswitch refers to both identification of compounds previously unknown to activate, deactivate or block a riboswitch and to assessing the ability of a compound to activate, deactivate or block a riboswitch where the compound was already known to activate, deactivate or block the riboswitch.
  • a method of detecting a compound of interest comprising: bringing into contact a sample and a riboswitch, wherein the riboswitch is activated by the compound of interest, wherein the riboswitch produces a signal when activated by the compound of interest, wherein the riboswitch produces a signal when the sample contains the compound of interest, wherein the riboswitch comprises a preQi- responsive riboswitch or a derivative of a preQi -responsive riboswitch.
  • the riboswitch can change conformation when activated by the compound of interest, wherein the change in conformation produces a signal via a conformation dependent label.
  • the riboswitch can also change conformation when activated by the compound of interest, wherein the change in conformation causes a change in expression of an RNA linked to the riboswitch, wherein the change in expression produces a signal.
  • the signal can be produced by a reporter protein expressed from the RNA linked to the riboswitch.
  • a method of detecting preQi in a sample comprising: bringing a preQi -responsive riboswitch in contact with the sample; and detecting interaction between preQi and the preQi -responsive riboswitch, wherein interaction between preQi and the preQi -responsive riboswitch indicates the presence of preQi .
  • the preQi -responsive riboswitch can be labeled.
  • a method comprising: (a) testing a compound for inhibition of gene expression of a gene encoding an RNA comprising a riboswitch, wherein the inhibition is via the riboswitch, wherein the riboswitch comprises a preQi -responsive riboswitch or a derivative of a preQi -responsive riboswitch, (b) inhibiting gene expression by bringing into contact a cell and a compound that inhibited gene expression in step (a), wherein the cell comprises a gene encoding an RNA comprising a riboswitch, wherein the compound inhibits expression of the gene by binding to the riboswitch.
  • Also disclosed is a method comprising inhibiting gene expression of a gene encoding an RNA comprising a riboswitch by bringing into contact a cell and a compound that was identified as a compound that inhibits gene expression of the gene by testing the compound for inhibition of gene expression of the gene, wherein the inhibition was via the riboswitch, wherein the riboswitch comprises a preQi -responsive riboswitch or a derivative of a preQi -responsive riboswitch.
  • Riboswitches are a new class of structured RNAs that have evolved for the purpose of binding small organic molecules.
  • the natural binding pocket of riboswitches can be targeted with metabolite analogs or by compounds that mimic the shape-space of the natural metabolite.
  • the small molecule ligands of riboswitches provide useful sites for derivitization to produce drug candidates. Distribution of some riboswitches is shown in Table 1 of U.S. Application Publication No. 2005-0053951. Once a class of riboswitch has been identified and its potential as a drug target assessed, such as the preQi riboswitch, candidate molecules can be identified.
  • Anti-riboswitch drugs represent a mode of anti -bacterial action that is of considerable interest for the following reasons. Riboswitches control the expression of genes that are critical for fundamental metabolic processes. Therefore manipulation of these gene control elements with drugs yields new antibiotics. These antimicrobial agents can be considered to be bacteriostatic, or bacteriocidal. Riboswitches also carry RNA structures that have evolved to selectively bind metabolites, and therefore these RNA receptors make good drug targets as do protein enzymes and receptors. Furthermore, it has been shown that two antimicrobial compounds (discussed above) kill bacteria by deactivating the antibiotics resistance to emerge through mutation of the RNA target.
  • a compound can be identified as activating a riboswitch or can be determined to have riboswitch activating activity if the signal in a riboswitch assay is increased in the presence of the compound by at least 1 fold, 2 fold, 3 fold, 4 fold, 5 fold, 50%, 75%,
  • the riboswitch assay can be performed using any suitable riboswitch construct. Riboswitch constructs that are particularly useful for riboswitch activation assays are described elsewhere herein.
  • the identification of a compound as activating a riboswitch or as having a riboswitch activation activity can be made in terms of one or more particular riboswitches, riboswitch constructs or classes of riboswitches.
  • compounds identified as activating a preQi riboswitch or having riboswitch activating activity for a preQi riboswitch can be so identified for particular preQi riboswitches, such as the preQi riboswitches found in Bacillus anthracis or B. subtilis.
  • Antimicrobial is meant inhibiting or preventing bacterial growth, killing bacteria, or reducing the number of bacteria.
  • a method of inhibiting or preventing bacterial growth comprising contacting a bacterium with an effective amount of one or more compounds disclosed herein. Additional structures for the disclosed compounds are provided herein.
  • a method of inhibiting bacterial cell growth comprising: bringing into contact a cell and a compound that binds a preQi -responsive riboswitch, wherein the cell comprises a gene encoding an RNA comprising a preQi -responsive riboswitch, wherein the compound inhibits bacterial cell growth by binding to the preQi- responsive riboswitch, thereby limiting preQi production.
  • This method can yield at least a 10% decrease in bacterial cell growth compared to a cell that is not in contact with the compound.
  • the compound and the cell can be brought into contact by administering the compound to a subject.
  • the cell can be a bacterial cell in the subject, wherein the compound kills or inhibits the growth of the bacterial cell.
  • the subject can have a bacterial infection.
  • the compound can be administered in combination with another antimicrobial compound.
  • the bacteria can be any bacteria, such as bacteria from the genus Bacillus, Acinetobacter, Actinobacillus, Clostridium, Desulfitobacterium, Enter ococcus, Erwinia, Escherichia, Exiguobacterium, Fusobacterium, Geobacillus, Haemophilus, Klebsiella, Idiomarina, Lactobacillus, Lactococcus, Leuconostoc, Listeria, Moorella,
  • Mycobacterium Oceanobacillus, Oenococcus, Pasteurella, Pediococcus, Pseudomonas, Shewanella, Shigella, Solibacter, Staphylococcus, Streptococcus, Thermoanaerobacter,
  • Thermotoga and Vibrio, for example.
  • the bacteria can be, for example, Actinobacillus pleuropneumoniae, Bacillus anthracis, Bacillus cereus, Bacillus clausii, Bacillus halodurans, Bacillus licheniformis, Bacillus subtilis, Bacillus thuringiensis, Clostridium acetobutylicum, Clostridium perfringens, Clostridium tetani, Clostridium thermocellum, Desulfitobacterium hafniense, Enter ococcus faecalis, Erwinia carotovora, Escherichia coli, Exiguobacterium sp., Fusobacterium nucleatum,
  • Geobacillus kaustophilus Haemophilus ducreyi, Haemophilus influenzae, Haemophilus somnus, Idiomarina loihiensis, Lactobacillus acidophilus, Lactobacillus casei, Lactobacillus delbrueckii, Lactobacillus gasseri, Lactobacillus johnsonii, Lactobacillus plantarum, Lactococcus lactis, Leuconostoc mesenteroides, Listeria innocua, Listeria monocytogenes, Moorella thermoacetica, Oceanobacillus iheyensis, Oenococcus oeni, Pasteurella multocida, Pediococcus pentosaceus, Shewanella oneidensis, Shigella flexneri, Solibacter usitatus, Staphylococcus aureus, Staphylococcus epidermidis, Thermoanaerobacter tengcongensis
  • Bacterial growth can also be inhibited in any context in which bacteria are found.
  • bacteria for example, bacterial growth in fluids, biof ⁇ lms, and on surfaces can be inhibited.
  • the compounds disclosed herein can be administered or used in combination with any other compound or composition.
  • the disclosed compounds can be administered or used in combination with another antimicrobial compound.
  • "Inhibiting bacterial growth” is defined as reducing the ability of a single bacterium to divide into daughter cells, or reducing the ability of a population of bacteria to form daughter cells. The ability of the bacteria to reproduce can be reduced by about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or 100% or more.
  • a method of inhibiting the growth of and/or killing a bacterium or population of bacteria comprising contacting the bacterium with one or more of the compounds disclosed and described herein.
  • “Killing a bacterium” is defined as causing the death of a single bacterium, or reducing the number of a plurality of bacteria, such as those in a colony.
  • the "killing of bacteria” is defined as cell death of a given population of bacteria at the rate of 10% of the population, 20% of the population, 30% of the population, 40% of the population, 50% of the population, 60% of the population, 70% of the population, 80% of the population, 90% of the population, or less than or equal to 100% of the population.
  • the compounds and compositions disclosed herein have anti-bacterial activity in vitro or in vivo, and can be used in conjunction with other compounds or compositions, which can be bactericidal as well.
  • a therapeutically effective amount of a compound as provided herein is meant a nontoxic but sufficient amount of the compound to provide the desired reduction in one or more symptoms.
  • the exact amount of the compound required will vary from subject to subject, depending on the species, age, and general condition of the subject, the severity of the disease that is being treated, the particular compound used, its mode of administration, and the like. Thus, it is not possible to specify an exact “effective amount.” However, an appropriate effective amount may be determined by one of ordinary skill in the art using only routine experimentation.
  • the compositions and compounds disclosed herein can be administered in vivo in a pharmaceutically acceptable carrier.
  • pharmaceutically acceptable a material that is not biologically or otherwise undesirable, i.e., the material may be administered to a subject without causing any undesirable biological effects or interacting in a deleterious manner with any of the other components of the pharmaceutical composition in which it is contained.
  • the carrier would naturally be selected to minimize any degradation of the active ingredient and to minimize any adverse side effects in the subject, as would be well known to one of skill in the art.
  • compositions or compounds disclosed herein can be administered orally, parenterally (e.g., intravenously), by intramuscular injection, by intraperitoneal injection, transdermally, extracorporeally, topically or the like, including topical intranasal administration or administration by inhalant.
  • topical intranasal administration means delivery of the compositions into the nose and nasal passages through one or both of the nares and can comprise delivery by a spraying mechanism or droplet mechanism, or through aerosolization of the nucleic acid or vector.
  • Administration of the compositions by inhalant can be through the nose or mouth via delivery by a spraying or droplet mechanism. Delivery can also be directly to any area of the respiratory system (e.g., lungs) via intubation.
  • compositions required will vary from subject to subject, depending on the species, age, weight and general condition of the subject, the severity of the allergic disorder being treated, the particular nucleic acid or vector used, its mode of administration and the like. Thus, it is not possible to specify an exact amount for every composition. However, an appropriate amount can be determined by one of ordinary skill in the art using only routine experimentation given the teachings herein.
  • Parenteral administration of the composition or compounds, if used, is generally characterized by injection.
  • Injectables can be prepared in conventional forms, either as liquid solutions or suspensions, solid forms suitable for solution of suspension in liquid prior to injection, or as emulsions.
  • a more recently revised approach for parenteral administration involves use of a slow release or sustained release system such that a constant dosage is maintained. See, e.g., U.S. Patent No. 3,610,795, which is incorporated by reference herein.
  • compositions and compounds disclosed herein can be used therapeutically in combination with a pharmaceutically acceptable carrier.
  • Suitable carriers and their formulations are described in Remington: The Science and Practice of Pharmacy (19th ed.) ed. A.R. Gennaro, Mack Publishing Company, Easton, PA 1995.
  • an appropriate amount of a pharmaceutically-acceptable salt is used in the formulation to render the formulation isotonic.
  • the pharmaceutically-acceptable carrier include, but are not limited to, saline, Ringer's solution and dextrose solution.
  • the pH of the solution is preferably from about 5 to about 8, and more preferably from about 7 to about 7.5.
  • Further carriers include sustained release preparations such as semipermeable matrices of solid hydrophobic polymers containing the antibody, which matrices are in the form of shaped articles, e.g., films, liposomes or microparticles. It will be apparent to those persons skilled in the art that certain carriers may be more preferable depending upon, for instance, the route of administration and concentration of composition being administered.
  • compositions are known to those skilled in the art. These most typically would be standard carriers for administration of drugs to humans, including solutions such as sterile water, saline, and buffered solutions at physiological pH.
  • the compositions can be administered intramuscularly or subcutaneously. Other compounds will be administered according to standard procedures used by those skilled in the art.
  • Pharmaceutical compositions may include carriers, thickeners, diluents, buffers, preservatives, surface active agents and the like in addition to the molecule of choice. Pharmaceutical compositions may also include one or more active ingredients such as antimicrobial agents, antiinflammatory agents, anesthetics, and the like.
  • the pharmaceutical composition may be administered in a number of ways depending on whether local or systemic treatment is desired, and on the area to be treated.
  • Administration may be topically (including ophthalmically, vaginally, rectally, intranasally), orally, by inhalation, or parenterally, for example by intravenous drip, subcutaneous, intraperitoneal or intramuscular injection.
  • the disclosed antibodies can be administered intravenously, intraperitoneally, intramuscularly, subcutaneously, intracavity, or transdermally.
  • Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions.
  • non- aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate.
  • Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media.
  • Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's, or fixed oils.
  • Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer's dextrose), and the like. Preservatives and other additives may also be present such as, for example, antimicrobials, anti-oxidants, chelating agents, and inert gases and the like.
  • Formulations for topical administration may include ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders.
  • Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable.
  • Compositions for oral administration include powders or granules, suspensions or solutions in water or non-aqueous media, capsules, sachets, or tablets. Thickeners, flavorings, diluents, emulsif ⁇ ers, dispersing aids or binders may be desirable.
  • compositions may potentially be administered as a pharmaceutically acceptable acid- or base- addition salt, formed by reaction with inorganic acids such as hydrochloric acid, hydrobromic acid, perchloric acid, nitric acid, thiocyanic acid, sulfuric acid, and phosphoric acid, and organic acids such as formic acid, acetic acid, propionic acid, glycolic acid, lactic acid, pyruvic acid, oxalic acid, malonic acid, succinic acid, maleic acid, and fumaric acid, or by reaction with an inorganic base such as sodium hydroxide, ammonium hydroxide, potassium hydroxide, and organic bases such as mono- , di-, trialkyl and aryl amines and substituted ethanolamines.
  • inorganic acids such as hydrochloric acid, hydrobromic acid, perchloric acid, nitric acid, thiocyanic acid, sulfuric acid, and phosphoric acid
  • organic acids such as formic acid, acetic acid, propionic acid,
  • compositions as disclosed herein may also be delivered by the use of monoclonal antibodies as individual carriers to which the compound molecules are coupled.
  • the therapeutic compositions of the present disclosure may also be coupled with soluble polymers as targetable drug carriers.
  • Such polymers can include, but are not limited to, polyvinyl-pyrrolidone, pyran copolymer, polyhydroxypropylmethacryl- amidephenol, polyhydroxyethylaspartamidephenol, or polyethyl-eneoxidepolylysine substituted with palmitoyl residues.
  • compositions of the present disclosure may be coupled to a class of biodegradable polymers useful in achieving controlled release of a drug, for example, polylactic acid, polyepsilon caprolactone, polyhydroxy butyric acid, polyorthoesters, polyacetals, polydihydro-pyrans, polycyanoacrylates and cross-linked or amphipathic block copolymers of hydrogels.
  • biodegradable polymers useful in achieving controlled release of a drug, for example, polylactic acid, polyepsilon caprolactone, polyhydroxy butyric acid, polyorthoesters, polyacetals, polydihydro-pyrans, polycyanoacrylates and cross-linked or amphipathic block copolymers of hydrogels.
  • At least about 3%, more preferably about 10%, more preferably about 20%, more preferably about 30%, more preferably about 50%, more preferably 75% and even more preferably about 100% of the bacterial infection is reduced due to the administration of the compound.
  • a reduction in the infection is determined by such parameters as reduced white blood cell count, reduced fever, reduced inflammation, reduced number of bacteria, or reduction in other indicators of bacterial infection.
  • the dosage can increase to the most effective level that remains non- toxic to the subject.
  • subject refers to an individual.
  • the subject is a mammal such as a non-human mammal or a primate, and, more preferably, a human.
  • Subjects can include domesticated animals (such as cats, dogs, etc.), livestock (e.g., cattle, horses, pigs, sheep, goats, etc.), laboratory animals (e.g., mouse, rabbit, rat, guinea pig, etc.) and fish.
  • a "bacterial infection” is defined as the presence of bacteria in a subject or sample. Such bacteria can be an outgrowth of naturally occurring bacteria in or on the subject or sample, or can be due to the invasion of a foreign organism.
  • the compounds disclosed herein can be used in the same manner as antibiotics.
  • antibiotics are well established in the art.
  • One example of their use includes treatment of animals.
  • the disclosed compounds can be administered to the animal via injection or through feed or water, usually with the professional guidance of a veterinarian or nutritionist. They are delivered to animals either individually or in groups, depending on the circumstances such as disease severity and animal species. Treatment and care of the entire herd or flock may be necessary if all animals are of similar immune status and all are exposed to the same disease-causing microorganism.
  • Another example of a use for the compounds includes reducing a microbial infection of an aquatic animal, comprising the steps of selecting an aquatic animal having a microbial infection, providing an antimicrobial solution comprising a compound as disclosed, chelating agents such as EDTA, TRIENE, adding a pH buffering agent to the solution and adjusting the pH thereof to a value of between about 7.0 and about 9.0, immersing the aquatic animal in the solution and leaving the aquatic animal therein for a period that is effective to reduce the microbial burden of the animal, removing the aquatic animal from the solution and returning the animal to water not containing the solution.
  • the immersion of the aquatic animal in the solution containing the EDTA, a compound as disclosed, and TRIENE and pH buffering agent may be repeated until the microbial burden of the animal is eliminated.
  • a method of producing preQj comprising: cultivating a mutant bacterial cell capable of producing preQj, wherein the mutant bacterial cell comprises a mutation in the preQj riboswitch, which mutation increases PrCQ 1 production by the mutant bacterial cell in comparison to a cell not having the mutation; and isolating preQi from the cell culture, thereby producing preQj.
  • the mutant bacterial cell can be a knockout mutant, wherein the cell cannot produce the preQi riboswitch.
  • the cell can have the region coding for the preQj riboswitch removed completely.
  • Production of preQi can be increased by 10, 20, 30, 40, 50, 60, 70, 80, 90% or more. This can be measured by the overall amount of preQi compared to that produced by a cell that has an intact preQi riboswitch.
  • a bacterial cell comprising a mutation in a preQi riboswitch, which mutation measurably increases preQi production by the cell when compared to a cell that does not have the mutation.
  • “measurably increases” is meant a 10, 20, 30, 40, 50, 60, 70, 80, 90% or more increase in production of preQi.
  • Example 1 A riboswitch selective for the queuosine precursor preQi contains an unusually small aptamer domain
  • queC motif The initially reported examples of the queC motif were restricted to only a few bacterial species of the orders Bacillales and Clostridia. The majority of the sequence conservation among these examples occurred within a span of fewer than 40 nt. The apparent limited distribution of this motif and its relatively small size are distinct from known riboswitches, which tend to be phylogenetically more widespread and contain conserved sequence elements and structural features that require more nucleotides.
  • the queC motif is associated with Q biosynthetic genes Representatives comprising the expanded set o ⁇ queC motifs were striking in their sequence and structural conservation, and because they were found to be consistently associated with homologous genes from a diverse collection of bacteria (Figure 8). These attributes strongly implied a regulatory role for this RNA motif, although further analysis was hampered by the lack of characterization of the genes in the apparent regulon. This problem was resolved when it was reported that the gene families usually affiliated with the RNA ( Figure 8) are involved in Q biosynthesis (Reader 2004), and the search for a possible riboswitch ligand was focused on the metabolic products of this biosynthetic pathway.
  • Q and its derivatives are hypermodified versions of guanosine that are found widely among eukaryotes and eubacteria, where Q has been implicated in a broad range of physiological processes (Iwata-Reuyl 2003).
  • the Q modification is required for phenomena such as virulence in the pathogen Shigella flexneri (Durand 1994) and viability during stationary phase in Escherichia coli (Noguchi 1982; Frey 1989).
  • guanosine triphosphate GTP serving as the starting material (Kuchino .
  • the first known intermediate in the biosynthetic pathway is 7-cyano-7-deazaguanine (preQo) (Okada 1978), which subsequently is converted to preQi in an NADPH-dependent reduction catalyzed by QueF (Van Lanen 1972).
  • preQi is inserted at the appropriate position in the anticodons of the relevant tRNAs (Okada 1979; Reuter 1991).
  • Representatives of the queC element can be sorted into one of two types based on distinct signature sequences within the conserved loop (Figs. 1 and 3a).
  • a 106 nt RNA containing the queC motif from B. subtilis (termed 106 queC; Fig. 3b) were examined, whose nucleotide sequence conforms to the type II consensus.
  • This RNA construct included the conserved sequence and structural elements of the queC motif as well as a stem-loop with characteristics of an intrinsic transcription terminator (Gusarov 1999; Yarnell 1999) (Fig. 3b).
  • preQi is the primary target of the queC RNA element, and it seems reasonable from a gene-control perspective that the final Q biosynthetic intermediate that exists as a free nucleobase would serve as the regulator. Based only on the slight differential in affinity, however, a structurally related precursor like preQ 0 cannot be excluded as a physiologically relevant candidate ligand for this RNA motif. The possibility that members of the two motif types (Figs. 1 and 3a) might be selective for distinct yet related metabolites was examined. Having established that the type II queC element from B. subtilis preferentially binds preQj (Fig. 4b), w the target selectivity of type I representatives was next examined.
  • the weaker binding interaction relative to preQi can result either from steric interference or from the absence of hydrogen bonding potential.
  • the diminished binding affinity observed with 7-methylguanine, which lacks the carbon atom substitution, is even more pronounced, but this can result partly from the loss of a hydrogen bond donor at the N9 position.
  • the apparent K & for the amide analog of preQi, 7-carboxamide-7-deazaguanine is similar to that of preQi, indicating a degree of steric tolerance at the pertinent methylene group.
  • the carboxamide derivative since the carboxamide derivative is not likely to be biologically relevant, no selective pressure exists for molecular discrimination against this compound.
  • guanine alone is expected to accumulate under physiological conditions.
  • the affinity of 52 queC for preQi is only about 25-fold greater than for guanine, raising the question of whether this difference in ligand affinity is sufficient to account for the selective binding that presumably occurs in vivo.
  • One factor that could contribute to higher selectivity toward preQi in vivo is a limitation in the maximum cellular concentration of guanine.
  • queC RNA serves as a highly selective aptamer for this modified base.
  • e. Assessing preQi recognition by equilibrium dialysis To provide additional support for a specific physical interaction between preQi and the queC RNA motif, competitive binding experiments were done using an equilibrium dialysis apparatus containing two chambers separated by a permeable membrane with a molecular weight cut-off of 5000 Daltons (Fig. 4d). Because guanine is recognized by the queC motif with nanomolar affinity (Fig. 4c), we first added 3 H-guanine and a molar excess of 106 queC RNA individually to the respective chambers.
  • the K d for preQi was determined by subjecting 36 queC to in-line probing analysis in the presence of increasing preQi concentrations (Fig. 5c). Quantitative analysis of structure modulation at two selected sites reveals a K d of approximately 50 nM (Fig. 5d). A construct that contains PO exhibits a slightly lower K & value (20 nM; Fig. 4b), which suggests that this stem-loop makes only a small contribution to ligand binding. There is also the possibility that the presence of PO could have an impact on kinetic aspects of riboswitch function.
  • This single point mutation permits a canonical base-pairing interaction with the adenine ligand without perturbing intermolecular contacts elsewhere. Because the structurally similar metabolites guanine and preQi have the same capacity for canonical base-pair formation with cytidine, a search for a similar ligand-cytidine pairing interaction with preQi aptamers was carried out. By analogy with the guanine riboswitch, it was reasoned that any cytidyl residue o ⁇ queC RNA serving this hypothetical role would be absolutely conserved, and that a mutation to uridine at this position would be sufficient to switch ligand specificity to favor compounds more closely related to adenine.
  • the mutant version of 80 queC (Ml) in which cytidine 34 is replaced with uridine (Ml) displays a selectivity profile that differs markedly from that of the wild-type construct (Fig. 6b).
  • key changes are observed in Ml upon incubation with 2,6-diaminopurine.
  • these structural changes are similar to ones that are elicited by preQi in the wild-type construct, with the increased levels of strand cleavage at internucleotide linkages immediately 3 ' to C29 reflecting the most obvious among these (Fig. 6b).
  • none of the test compounds induces structural modulation in M2, a construct in which the other absolutely conserved cytidine (C35) is replaced by uridine.
  • guanine lacks the 7-deaza-7-aminomethyl modification, thereby permitting a direct comparison of the effects stemming only from the Watson-Crick edges of the ligand and the discriminator base. Possible reasons for this disparity include adverse effects on global aptamer structure that are likely to result from substitutions of key functional groups.
  • the primary chemical difference resulting from the C34U mutation is the effective replacement of the exocyclic amine at the 4 position with a keto group (Fig. 6c).
  • the preQ ⁇ riboswitch is a gene control element
  • preCh as the target metabolite of the queC element can help to shed light on the roles of other genes in this new-found regulon that remain uncharacterized.
  • the recurrent juxtaposition of a preQi riboswitch with a gene encoding a predicted membrane protein (COG4708; Figure 8) implies a role for this protein in the transport of Q or a related metabolite.
  • preQi riboswitches are associated in several instances with homologous operons containing two genes of unknown functions ( Figure 8). Based on COG database assignments (Tatusov 2001), one of these genes is predicted to encode a protein with similarity to inosine-uridine nucleoside N-ribohydrolase.
  • the preQi motif appears nonetheless to be capable of serving as an effective agent of gene control in a variety of eubacteria.
  • motifs similar in size to that of the preQi aptamer can comprise a substantial fraction of metabolite-binding domains yet to be discovered.
  • the capacity of a natural, miniature RNA for sophisticated function was presaged by the abundance of diminutive aptamer domains that have been isolated using in vitro selection.
  • the size of the preQi aptamer is unexceptional when measured against those that have been evolved in the laboratory.
  • the preQi -binding motif is distinctive, however, in terms of the affinity and selectivity of its interaction with the cognate ligand.
  • Artificially generated aptamers whose lengths are constrained by the pools from which they are derived, are generally observed to bind their targets with poorer affinities and selectivities than naturally occurring motifs (Breaker 2006).
  • aptamers selected in vitro can be attributed to a combination of factors, including less stringent selection pressure and obstructed access to the ligand resulting from immobilization methods. It is apparent, however, that small size alone does not preclude RNA from specific, high affinity recognition of small molecule targets.
  • iii METHODS Oligonucleotides and Chemicals. Synthetic DNA oligonucleotides were prepared using standard solid-phase methods by the HHMI Biopolymer/Keck Foundation Biotechnology Resource Laboratory.
  • oligonucleotides were eluted from gel fragments in 10 mM Tris-HCl (pH 7.5 at 23 0 C), 200 rnM NaCl and 1 mM EDTA, and subsequently concentrated by precipitation with ethanol. 7-deazahypoxanthine and 7- deazaadenine were obtained from Berry & Associates. Other purine compounds were purchased from Sigma- Aldrich.
  • PreQi was synthesized as described (Akimoto 1988) and purified by reverse-phase HPLC (Luna C18, 250 x 10 mm, 5 ⁇ m, (Phenomenex)) with a flow rate of 5 mL min "1 using an isocratic mobile phase of 20 mM ammonium acetate (pH 6.0). PreQi eluted at 17 min. Fractions containing preQi were collected, frozen and lyophilized to yield the product as a white powder. 1 H-NMR (D 2 O) ⁇ 6.88 (s, IH, C-H), 4.13 (s, 2H, CH 2 ), 1.95 (s,
  • 7-aminomethyl-7-deazaadenine was prepared using a modified version of a previously reported protocol Akimoto 1986).
  • the intermediate, 7-(N,N'- dimethylaminomethyl)-7-deazaadenine was synthesized following previously published procedures (GB Patent No. 981458 (1965)).
  • Bioinformatics PreQi aptamer sequence alignments were manually adapted to the secondary structure model presented in this report from a previously published alignment of the_y&vJRNA motif (Barrick 2004). Covariance models (Eddy 1994) trained on this initial alignment were used to search microbial genomes and environmental sequences for additional matches with the RAVENNA extension (Weinberg 2006) (which accelerates covariance model searches with sequence-based heuristic filters) to the INFERNAL software package (Eddy 2003). PreQi riboswitch candidates were verified by examining their genomic contexts, which involved using the COG database (Tatusov 2003) to predict the functions of genes in putative operons. Sequences in the final alignment were weighted with the GSC algorithm (Gerstein 1994) to mitigate biases from similar sequences before calculating the reported consensus sequence.
  • RNA construct preparation A portion of the intergenic region upstream of queC was amplified using PCR from B. subtilis genomic DNA (strain 1 A40) using the primers 5 '-GAGCCTGGAATTCATAGGCGCTTTGC (SEQ ID NO: 1) and 5 '-
  • TTTTCTGGATCCATGATTCCTC-TCC (SEQ ID NO: 2).
  • the amplification product was cloned into pDG1661 (ref. 57) and the integrity of the resulting plasmid was confirmed by sequencing.
  • This plasmid served as the template for PCR amplification of the DNA fragment encoding the 106 queC construct.
  • DNA templates corresponding to the remaining RNA constructs were prepared by extending appropriate partially complementary synthetic oligonucleotides using Superscript II reverse transcriptase (Invitrogen) according to the manufacturer's instructions.
  • the primer in the sense orientation contained the T7 promoter sequence.
  • RNA molecules were prepared by transcription in vitro using T7 RNA polymerase and gel- purified as previously described (Roth 2006).
  • RNA molecules were dephosphorylated with alkaline phosphatase (Roche Diagnostics) and radiolabeled with ⁇ - 32 P [ATP] and T4 polynucleotide kinase (New England Biolabs) according to the manufacturers' instructions. Spontaneous transesterification reactions using gel-purified, 5' end-labeled RNAs were assembled essentially as previously described (Mandal 2003).
  • RNA fragments resulting from spontaneous transesterification were resolved by denaturing 10% PAGE, and the imaging and quantitation of these data were performed with a Molecular Dynamics Phosphorlmager and ImageQuaNT software. K ⁇ values were determined as described previously (Mandal 2003).
  • preQi riboswitch function in vivo The function in vivo of the preQi riboswitch was assessed by fusing sequences containing this element with a lacZ reporter gene using methods similar to those described previously 60 .
  • a portion of the intergenic region upstream o ⁇ queC was amplified using PCR from B. subtilis genomic DNA (strain 1A40) using the primers 5 '-CGAGAATTCATAATGAAACGAACCGTCACTATAG (SEQ ID NO: 3) and 5'- GTACTTTTTTCTTTTTCGTTAACAGCCTAGGTGC (SEQ ID NO: 4).
  • sequence variants M3-M9 site-directed mutagenesis of the wild-type construct was performed using a QuikChange kit (Stratagene) together with primers that carried the desired mutations. Constructs were integrated at the amyE locus in strain 1 A40 and confirmed as described (Mandal 2003). Following growth in 2XYT broth with shaking at 37°C to an A 600 of 0.6, these strains were used in ⁇ - galactosidase assays.

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Plant Pathology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biochemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Public Health (AREA)
  • Biophysics (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Microbiology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Nitrogen Condensed Heterocyclic Rings (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
PCT/US2008/058050 2007-03-22 2008-03-24 Preq1 riboswitches and methods and compositions for use of and with preq1 riboswitches Ceased WO2008116223A1 (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
US12/532,538 US20100152212A1 (en) 2007-03-22 2008-03-24 Preq1 riboswitches and methods and compositions for use of and with preq1 riboswitches
JP2009554792A JP2010521978A (ja) 2007-03-22 2008-03-24 Preq1リボスイッチならびにpreq1リボスイッチの使用のための、およびpreq1リボスイッチを用いる使用のための方法および組成物
EP08799599A EP2139909A4 (en) 2007-03-22 2008-03-24 PREQ1-RIBOSWITCHES AND METHOD AND COMPOSITIONS FOR USE BY AND WITH PREQ1-RIBOSWITCHES
US13/617,993 US20130012527A1 (en) 2007-03-22 2012-09-14 Preq1 riboswitches and methods and compositions for use of and with preq1 riboswitches

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US91941007P 2007-03-22 2007-03-22
US60/919,410 2007-03-22

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US13/617,993 Continuation US20130012527A1 (en) 2007-03-22 2012-09-14 Preq1 riboswitches and methods and compositions for use of and with preq1 riboswitches

Publications (1)

Publication Number Publication Date
WO2008116223A1 true WO2008116223A1 (en) 2008-09-25

Family

ID=39766517

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2008/058050 Ceased WO2008116223A1 (en) 2007-03-22 2008-03-24 Preq1 riboswitches and methods and compositions for use of and with preq1 riboswitches

Country Status (4)

Country Link
US (2) US20100152212A1 (enExample)
EP (1) EP2139909A4 (enExample)
JP (1) JP2010521978A (enExample)
WO (1) WO2008116223A1 (enExample)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010142027A1 (en) * 2009-06-12 2010-12-16 Socpra - Sciences Et Genie S. E. C. Guanine riboswitch binding compounds and their use as antibiotics
WO2012153142A3 (en) * 2011-05-10 2013-01-03 The University Of Manchester Riboswitches

Families Citing this family (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10093967B2 (en) * 2014-08-12 2018-10-09 The Regents Of The University Of Michigan Detection of nucleic acids
US11267842B2 (en) 2015-03-03 2022-03-08 The Regents Of The University Of California Enzymatic modification of nucleic acids
US20180073026A1 (en) * 2015-04-01 2018-03-15 Universität Wien Novel expression regulating rna-molecules and uses thereof
CA3055565A1 (en) 2017-03-08 2018-09-13 The Regents Of The University Of Michigan Analyte detection
CN110650624A (zh) 2017-03-10 2020-01-03 威斯康星州医药大学股份有限公司 用于视网膜疾病的核糖开关调节的基因治疗
WO2018226666A1 (en) * 2017-06-05 2018-12-13 Maumita Mandal Methods, compositions, and devices involving pseudoknot formation
GB202011812D0 (en) * 2020-07-29 2020-09-09 Provost Fellows Found Scholars And The Other Members Of Board Of The College Of The Holy And Undivid Compounds
CA3193099A1 (en) * 2020-09-24 2022-03-31 David R. Liu Prime editing guide rnas, compositions thereof, and methods of using the same

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2003288906C1 (en) * 2002-09-20 2010-12-09 Yale University Riboswitches, methods for their use, and compositions for use with riboswitches.

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
BARRICK J.E. ET AL.: "The distributions, mechanisms, and structures of metabolite-binding riboswitches", GENOME BIOLOGY, vol. 8, no. 11, November 2007 (2007-11-01), pages R239.1 - R239.19, XP021041505 *
MEYER ET AL.: "Confirmation of a second natural preQ1 aptamer class in Streptococcaceae bacteria", RNA, vol. 14, 2008, pages 685 - 695, XP007911582 *
See also references of EP2139909A4 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010142027A1 (en) * 2009-06-12 2010-12-16 Socpra - Sciences Et Genie S. E. C. Guanine riboswitch binding compounds and their use as antibiotics
US9993491B2 (en) 2009-06-12 2018-06-12 Socpra—Sciences Et Génie S.E.C. Guanine riboswitch binding compounds and their use as antibiotics
WO2012153142A3 (en) * 2011-05-10 2013-01-03 The University Of Manchester Riboswitches
US20140213779A1 (en) * 2011-05-10 2014-07-31 The University Of Manchester Riboswitches

Also Published As

Publication number Publication date
JP2010521978A (ja) 2010-07-01
US20100152212A1 (en) 2010-06-17
EP2139909A1 (en) 2010-01-06
EP2139909A4 (en) 2010-04-07
US20130012527A1 (en) 2013-01-10

Similar Documents

Publication Publication Date Title
US20130012527A1 (en) Preq1 riboswitches and methods and compositions for use of and with preq1 riboswitches
EP1828953B1 (en) Crystalline xpt guanine riboswitch from Bacillus subtilis and structure-based compound identification employing said riboswitch
US8440810B2 (en) Riboswitches, methods for their use, and compositions for use with riboswitches
EP2426218A1 (en) Riboswitches and methods and compositions for use of and with riboswitches
US20130143955A1 (en) Cyclic di-GMP-II Riboswitches, Motifs, and Compounds, and Methods for Their Use
EP2471925A1 (en) Methods and compositions related to riboswitches that control alternative splicing
US20130029342A1 (en) Glycine riboswitches, methods for their use, and compositions for use with glycine riboswitches
US20100137440A1 (en) Lysine riboswitches, structure-based compound design with lysine riboswitches, and methods and compositions for use of and with lysine riboswitches
US20100324123A1 (en) Glms riboswitches, structure-based compound design with glms riboswitches, and methods and compositions for use of and with glms riboswitches
HK1154867A (en) Riboswitches, methods for their use, and compositions for use with riboswitches

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 08799599

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 2009554792

Country of ref document: JP

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2008799599

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 12532538

Country of ref document: US