WO2008109724A2 - Treatment of cocaine-induced fetal brain injury - Google Patents

Abstract

A Disclosed is a method of therapeutically or prophylactically treating a pregnant mother for cocaine-induced fetal brain injury comprising administering a therapeutically or prophylactically effective amount of a cytochrome P450 inhibitor or prodrug thereof to the mother. Also disclosed is a method of screening for inhibitors of cocaine-induced fetal brain injury. Uses of compounds and compositions to manufacture a medicament for treating a pregnant mother for cocaine-induced fetal brain injury are further provided.

Description

TREATMENT OF COCAINE-INDUCED FETAL BRAIN INJURY

CROSS-REFERENCE TO A RELATED APPLICATION

[0001] This patent application claims the benefit of U.S. Provisional Patent Application No. 60/893,218, filed March 6, 2007, which is incorporated by reference.

BACKGROUND OF THE INVENTION

[0002] Maternal abuse of cocaine during pregnancy has exposed several hundred thousand fetuses per year to cocaine in the United States alone, which can result in cocaine- induced fetal brain injury. Prenatal exposure to cocaine has been associated with a variety of disorders of central nervous system (CNS) development such as intrauterine growth retardation, interference with neuronal migration and differentiation, and neurobehavioral deficits. Accordingly, there is a desire for therapies to prevent, minimize, and treat cocaine- induced fetal brain injury.

BRIEF SUMMARY OF THE INVENTION

[0003] The invention provides a method of therapeutically or prophylactically treating a pregnant mother for cocaine-induced fetal brain injury, the method comprising administering a therapeutically or prophylactically effective amount of a cytochrome P450 inhibitor or prodrug thereof to the mother.

[0004] The invention further provides a method of screening for inhibitors of cocaine- induced fetal brain injury. A test compound is contacted with a first central nervous system (CNS) cell. Cocaine and/or a P450 metabolite thereof is contacted with the first CNS cell and a second CNS cell. A cocaine-induced effect on the first and second CNS cells is measured. The cocaine-induced effect on the first and second CNS cells is compared, wherein a decrease in the cocaine-induced effect on the first CNS cell relative to the second CNS cell identifies the test compound as an inhibitor of cocaine-induced fetal brain injury. [0005] Uses of compounds and compositions to manufacture a medicament for treating a pregnant mother for cocaine-induced fetal brain injury are provided by the invention. In some embodiments, the use employs an inhibitor of cocaine-induced fetal brain injury. In some embodiments, the use employs a cytochrome P450 inhibitor, metabolite, or prodrug thereof. DETAILED DESCRIPTION OF THE INVENTION

[0006] The invention provides a method of therapeutically or prophylactically treating a pregnant mother for cocaine-induced fetal brain injury, the method comprising administering a therapeutically or prophylactically effective amount of a cytochrome P450 inhibitor or prodrug thereof to the mother. In some embodiments, the cytochrome P450 inhibitor or prodrug thereof inhibits cocaine-induced generation of reactive oxygen species (ROS) in a neural progenitor cell of a fetus of the mother. In some embodiments, the cytochrome P450 inhibitor or prodrug thereof inhibits cocaine-induced generation of ROS in an oligodendrocyte progenitor cell of a fetus of the mother. In some embodiments, the cytochrome P450 inhibitor or prodrug thereof inhibits cocaine-induced proliferation inhibition of a neural progenitor cell of a fetus of the mother. In some embodiments, the cytochrome P450 inhibitor or prodrug thereof inhibits cocaine-induced proliferation inhibition of an oligodendrocyte progenitor cell of a fetus of the mother. [0007] Any suitable cytochrome P450 inhibitor, metabolite thereof, or prodrug thereof can be employed in the therapeutic and/or prophylactic method of treatment of the invention. In some embodiments, the cytochrome P450 inhibitor or prodrug thereof comprises an imidazole group. Examples of imidazole comprising inhibitors include cimetidine, ketoconazole, a prodrug thereof and any combination thereof. In some embodiments, the cytochrome P450 inhibitor or prodrug thereof comprises a macrolide antibiotic, metabolite thereof, or a prodrug thereof. Examples of macrolide antibiotics, metabolites thereof, and prodrugs thereof include erythromycin, troleandomycin, clarithromycin, azithromycin, a metabolite thereof and a combination thereof. In some embodiments, the cytochrome P450 inhibitor or prodrug thereof is 2-diethylaminoethyl 2,2-diphenylpentanoate (SKF-525A, proadifen), a prodrug, or metabolite thereof. In some embodiments, the cytochrome P450 inhibitor or prodrug thereof is chloramphenicol, a prodrug, or metabolite thereof. Suitable cytochrome P450 inhibitors also include compounds related to those described herein with similar inhibitory activity.

[0008] The cytochrome P450 inhibitor, metabolite thereof, or prodrug thereof employed in the therapeutic and/or prophylactic method of treatment of the invention can inhibit one or more cytochrome P450 isoforms that metabolize cocaine or a metabolite thereof. In some embodiments, the cytochrome P450 inhibitor inhibits a P450 isoform of the CYP3 family. The CYP3 family isoform inhibited can be CYP3A4. The inhibitor can be an inhibitor of cocaine N-oxidative metabolism or other relevant metabolic pathway. The method of treatment can comprise the administration of one or more inhibitor. When multiple inhibitors are employed, their administration can be simultaneous, sequential, or in combination. The combined effect on treating cocaine-induced fetal brain injury can be less than additive, additive, or more than additive compared to administration with a single inhibitor. In some embodiments, the administration of multiple inhibitors has a synergistic effect on treating cocaine-induced fetal brain injury.

[0009] The cytochrome P450 inhibitor can be administered at any appropriate time before, during, and/or after the term of pregnancy, but is administered at least during pregnancy. The inhibitor can be administered during a period critical to the neural development of the fetus, hi humans, the critical period is generally within the first and/or second trimesters. In some embodiments, the cytochrome P450 inhibitor or prodrug thereof is administered during the first and/or second trimester of the pregnancy. The inhibitor can be administered during cortical neurogenesis of the fetus, which in humans spans and includes approximately the sixth through the twenty-sixth week of gestation. The cytochrome P450 inhibitor can be administered during an early period of cortical neurogenesis. In humans, the early period spans and includes approximately the sixth through the tenth week of gestation. The cytochrome P450 inhibitor can be administered during a middle period of cortical neurogenesis. In humans, the middle period spans and includes approximately the tenth through the twenty-sixth week of gestation. Cocaine can potentially cause other types of adverse effects via the same biochemical mechanisms described herein during these or other periods. Accordingly, an inhibitor of cocaine-induced injury can be administered during other time periods of the gestation. [0010] Cocaine use by the mother need not occur at the same time as the cytochrome P450 inhibitor is administered. Cocaine use by the mother can be intermittent or continuous. The cytochrome P450 inhibitor can be administered based on a current pattern of abuse, past abuse, and/or a perceived likelihood of abuse. The administration of the cytochrome inhibitor can be intermittent or continuous. The administration can be varied in the context of other drugs, legal or illegal, used by the mother, wherein the variation is used to minimize side effects and maximize the effectiveness of the method of treatment of the invention. A blood test and/or other tests, such as tests on the amniotic fluid, can be used to monitor the effects of the treatment along with adjustment of the dosage as appropriate to maximize the efficacy of the treatment and/or minimize liver toxicity and any other potential side effects or negative drug interactions. The blood and/or other fluid tested can be that of the mother and/or the fetus. The cytochrome P450 inhibitor can be administered to the pregnant mother as a means of administration to the fetus. Li the context of the invention, when treatment of the mother for cocaine-induced fetal brain injury is referred to, treatment of the fetus is encompassed by virtue of the fetus being in systemic communication with the mother. In some embodiments, the cytochrome P450 inhibitor is administered via the umbilical cord and/or placenta.

[0011] The method of treatment of the invention is not limited by the type of cocaine abuse by the mother. The cocaine abused can be of any form. That form can be a salt such as a hydrochloride or sulfate salt of cocaine. The cocaine can be a free base. The method of treatment is also not limited by the route of administration of the cocaine. Routes of administration include inhalation, oral, parenteral, and non-parenteral administration. The form and/or route of administration can remain constant or vary. The cocaine abused can be taken in a pure form or part of a composition. The cocaine abused can be a molecular variant of cocaine such that the variant retains the ability to cause fetal brain injury. The cocaine abused can be a prodrug or metabolite of cocaine.

[0012] The invention further provides a method of screening for inhibitors of cocaine- induced fetal brain injury. A test compound is contacted with a first central nervous system (CNS) cell. Cocaine or a P450 metabolite thereof is contacted with the first CNS cell(s) and a second CNS cell(s). A cocaine-induced effect on the first and second CNS cells is measured. The cocaine-induced effect on the first and second CNS cells is compared, wherein a decrease in the cocaine-induced effect on the first CNS cell relative to the second CNS cell identifies the test compound as an inhibitor of cocaine-induced fetal brain injury. In some embodiments, cocaine is contacted with the first and second CNS cells. The first and second CNS cells can comprise neural progenitor cells. In such embodiments, one or more other type of CNS cell can be present but need not be. An example of a type of CNS cells are AF5 cells. In some embodiments, oligodendrocyte progenitor cells are used in addition to or in the alternative to neural progenitor cells. The neural and/or oligodendrocyte progenitor cells can be human cells. In some embodiments, the cells are primary human fetal CNS cells. In some embodiments, the cells are ventricular zone (VZ) cells or derived therefrom. The test compound can be contacted with the first and second CNS cells before, concurrent with, or after the cocaine is contacted with the cells. [0013] In some embodiments, the cocaine-induced effect is an amount of reactive oxidative species (ROS) and the ROS in the first and second CNS cells is measured. The amount of ROS in the first and second CNS cells is compared, wherein a decrease in the amount of ROS in the first CNS cell relative to the second CNS cell identifies the test compound as an inhibitor of cocaine-induced fetal brain injury. The ROS measured can comprise P450-dependent ROS. The amount of reactive oxidative species can be measured by any suitable method. In some embodiments, the amount of reactive oxidative species is measured by fluorescence resulting from a 2',7'-dichlorofluorescein diacetate (DCFH-DA) assay in which cells are incubated with DCFH-DA. Other probes for detection of reactive oxygen species that can be employed include 5-(and 6-) chloromethyl-2'-7'- dichlorodihdrofluorescein diacetate, acetyl ester (CM-H2DCFDA), 3'-(p-aminophenyl) fluorescein (APF), dihydrocalcein AM, and/or by one or more measurement of protein oxidation available to those of skill in the art. In some embodiments, there is a substantially equal amount of reactive oxidative species (ROS) in the first and second neural progenitor cells prior to the contact with cocaine or a P450 metabolite thereof. [0014] Other ways of identifying an inhibitor and measuring ROS directly or indirectly include the ability of a test compound to diminish to any degree the effect of cocaine on progenitor cells. For example a compound can be identified as one that diminishes cocaine- induced cell cycle arrest such as cocaine-induced increase of cells in the Gl phase and decrease of cells in the S and/or M phases. A compound can be identified as one that diminishes one or more of cocaine-induced cell proliferation inhibition, down-regulation of cyclin A and/or c-myc, and induction of ATF4 signaling and/or increased phosphorylation of eIF2α. Accordingly, in some embodiments, the cocaine-induced effect measured is a decrease in cell proliferation, wherein a diminished decrease in cell proliferation of the first CNS cell relative to the second CNS cell identifies the test compound as an inhibitor of cocaine-induced fetal brain injury. Cell proliferation can be measured using any suitable method. Examples of such methods include bromo-2'-deoxyuridine (BrdU) incorporation and fluorescence-assisted cell sorting (FACS). In some embodiments, the cocaine-induced effect measured is a decrease in cyclin A, wherein a diminished decrease in cyclin A in the first CNS cell relative to the second CNS cell identifies the test compound as an inhibitor of cocaine-induced fetal brain injury. In some embodiments, the cocaine-induced effect measured is a decrease in c-myc, wherein a diminished decrease in c-myc in the first CNS cell relative to the second CNS cell identifies the test compound as an inhibitor of cocaine- induced fetal brain injury. In some embodiments, the cocaine-induced effect measured is an increase in ATF4 signaling, wherein a diminished increase in ATF4 signaling in the first CNS cell relative to the second CNS cell identifies the test compound as an inhibitor of cocaine-induced fetal brain injury. In some embodiments, the cocaine-induced effect measured is an increase in eIF2α phosphorylation, wherein a diminished increase in eIF2α phosphorylation in the first CNS cell relative to the second CNS cell identifies the test compound as an inhibitor of cocaine-induced fetal brain injury.

[0015] The method of screening inhibitors can comprise contacting cells with one or more test compound. When multiple test compounds are employed, the contact of the test compounds with the cell(s) can be simultaneous, sequential, or in combination. The combined effect on decreasing the cocaine-induced effect on the cell can be less than additive, additive, or more than additive compared to contact with a single compound. In some embodiments, the contacting of multiple compounds with the cell(s) has a synergistic effect in decreasing the cocaine-induced effect. Measurements and calculations of synergism can be performed using any suitable method such as described in Teicher, "Assays for In Vitro and In Vivo Synergy," in Methods in Molecular Medicine, vol. 85: Novel Anticancer Drug Protocols, pp. 297-321 (2003). An inhibitor identified in the screen can be used in the method of treatment of the invention as described herein and/or in other contexts such as uses to manufacture a medicament.

[0016] The invention also provides a method of screening a test compound to determine if the test compound damages the developing fetal brain using an AF5 cell, which is a model for developing fetal brain. Damage can be measured by assessing the amount of ROS in a first AF5 cell that is contacted with the test compound and comparing the amount of ROS in the first cell with the amount of ROS in a second (control) AF5 cell that is not contacted with the test compound. An increase in the amount of ROS in the first CNS cell relative to the second CNS cell identifies the test compound as a drug that causes damage to the developing fetal brain.

[0017] Uses of compounds and compositions to manufacture a medicament for treating a pregnant mother for cocaine-induced fetal brain injury are provided by the invention. Any inhibitor can be employed as part of the use. In some embodiments, the use employs an inhibitor of cocaine-induced fetal brain injury identified from a screen for such inhibitors. In some embodiments, the use employs an inhibitor of cocaine-induced generation of ROS in a neural progenitor cell of a fetus of the mother. In some embodiments, the use employs an inhibitor of cocaine-induced generation of ROS in an oligodendrocyte progenitor cell of a fetus of the mother. In some embodiments, the use employs an inhibitor of cocaine-induced proliferation inhibition of a neural progenitor cell of a fetus of the mother. In some embodiments, the use employs an inhibitor of cocaine-induced proliferation inhibition of an oligodendrocyte progenitor cell of a fetus of the mother. In some embodiments, the use employs a cytochrome P450 inhibitor, metabolite, or prodrug thereof. Examples of suitable cytochrome P450 inhibitors, metabolites or prodrugs thereof include cimetidine, ketoconazole, erythromycin, troleandomycin, clarithromycin, azithromycin, 2- diethylaminoethyl 2,2-diphenylpentanoate (SKF-525A, proadifen), chloramphenicol, a prodrug, a metabolite, and any combination thereof.

[0018] An inhibitor employed in the method of treatment and an inhibitor identified in the screening method of the invention are not limited by the species or mechanism of inhibition. In some embodiments, the inhibitor administered is itself the inhibitory species. In some embodiments, the inhibitor administered is a prodrug of the inhibitory species. The mechanism of inhibition can be competitive, non-competitive, reversible, irreversible, suicidal, full, and/or partial.

[0019] A therapeutic agent, e.g., a cytochrome P450 inhibitor, which can be a compound and/or a composition, used in accordance with the method of the invention can comprise a small molecule, a nucleic acid, a protein, an antibody, or any other agent with one or more therapeutic property. Examples of cytochrome P450 inhibitors include cimetidine, 2- diethylaminoethyl 2,2-diphenylpentanoate (SKF-525A, proadifen), a prodrug, a metabolite and any combination thereof. The therapeutic agent can be formulated in any pharmaceutically acceptable manner. The therapeutic agent that is used in the invention can be formed as a composition, such as a pharmaceutical composition comprising a carrier and a therapeutic compound. Pharmaceutical compositions containing the therapeutic agent can comprise more than one therapeutic compound. The carrier can be any suitable carrier. Preferably, the carrier is a pharmaceutically acceptable carrier. With respect to pharmaceutical compositions, the carrier can be any of those conventionally used and is limited only by chemico-physical considerations, such as solubility and lack of reactivity with the active compound(s), and by the route of administration.

[0020] The pharmaceutically acceptable carriers described herein, for example, vehicles, adjuvants, excipients, and diluents, are well-known to those skilled in the art and are readily available to the public. The pharmaceutically acceptable carrier can be chemically inert to the active agent(s) and one which has low or no detrimental side effects or toxicity under the conditions of use. The choice of carrier can be determined in part by the particular therapeutic agent, as well as by the particular method used to administer the therapeutic agent. There are a variety of suitable formulations of the pharmaceutical composition of the invention. The following formulations for oral, aerosol, parenteral, subcutaneous, transdermal, transmucosal, intestinal, intramedullary injections, direct intraventricular, intravenous, intranasal, intraocular, intramuscular, intraarterial, intrathecal, intraperitoneal, rectal, and vaginal administration are exemplary and are in no way limiting. More than one route can be used to administer the therapeutic agent, and in some instances, a particular route can provide a more immediate and more effective response than another route. Therapeutic agents can be formulated and administered systemically or locally. Techniques for formulation and administration may be found in Remington's Pharmaceutical Sciences, 18th ed., Mack Publishing Co., Easton, Pa. (1990).

[0021] Formulations suitable for oral administration can include (a) liquid solutions, such as an effective amount of the therapeutic agent dissolved in diluents, such as water, saline, or fruit juice such as orange juice; (b) capsules, sachets, tablets, lozenges, dragees, and troches, each containing a predetermined amount of the active ingredient, as solids or granules; (c) powders; (d) suspensions in an appropriate liquid, gel, syrup, or slurry; and (e) suitable emulsions. Liquid formulations may include diluents, such as water and alcohols, for example, ethanol, benzyl alcohol, and the polyethylene alcohols, either with or without the addition of a pharmaceutically acceptable surfactant. Capsule forms can be of the ordinary hard or soft shelled gelatin type containing, for example, surfactants, lubricants, and inert fillers, such as lactose, sucrose, calcium phosphate, and corn starch. Tablet forms can include one or more of lactose, sucrose, mannitol, corn starch, potato starch, alginic acid, microcrystalline cellulose, acacia, gelatin, guar gum, colloidal silicon dioxide, croscarmellose sodium, talc, magnesium stearate, calcium stearate, zinc stearate, stearic acid, and other excipients, colorants, diluents, buffering agents, disintegrating agents, moistening agents, preservatives, flavoring agents, and other pharmacologically compatible excipients. Lozenge forms can comprise the inhibitor in a flavor, usually sucrose and acacia or tragacanth, as well as pastilles comprising the inhibitor in an inert base, such as gelatin and glycerin, or sucrose and acacia, emulsions, gels, and the like containing, in addition to, such excipients as are known in the art. [0022] Pharmaceutical preparations that can be used orally include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol. The push-fit capsules can contain the active ingredients in admixture with filler such as lactose, binders such as starches, and/or lubricants such as talc or magnesium stearate and, optionally, stabilizers. In soft capsules, the active compounds may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols. In addition, stabilizers may be added.

[0023] The therapeutic agent, alone or in combination with other suitable components, can be made into aerosol formulations to be administered via inhalation. These aerosol formulations can be placed into pressurized acceptable propellants, such as dichlorodifluoromethane, propane, nitrogen, and the like. They also can be formulated as pharmaceuticals for non-pressured preparations, such as in a nebulizer or an atomizer. Such spray formulations also may be used to spray mucosa. Topical formulations can be employed.

[0024] Injectable formulations are in accordance with the invention. The parameters for effective pharmaceutical carriers for injectable compositions are well-known to those of ordinary skill in the art [see, e.g., Pharmaceutics and Pharmacy Practice, J.B. Lippincott Company, Philadelphia, PA, Banker and Chalmers, eds., pages 238 250 (1982), and ASHP Handbook on Injectable Drugs, Toissel, 4th ed., pages 622 630 (1986)]. For injection, the therapeutic agent can be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer. For such transmucosal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art. [0025] In some embodiments, the therapeutic agent is prepared in a depot form to allow for release to be controlled with respect to time and location within the body (see, for example, U.S. Patent No. 4,450,150). Depot forms of therapeutic agents can be, for example, an implantable composition comprising the therapeutic agent and a porous or non-porous material, such as a polymer, wherein the therapeutic agent is encapsulated by or diffused throughout the material and/or degradation of the non-porous material. The depot is then implanted into the desired location within the body and the therapeutic agent is released from the implant at a predetermined rate.

[0026] Formulations suitable for parenteral administration include aqueous and nonaqueous, isotonic sterile injection solutions, which can contain anti oxidants, buffers, bacteriostats, and solutes that render the formulation isotonic with the blood of the intended recipient, and aqueous and non aqueous sterile suspensions that can include suspending agents, solubilizers, thickening agents, stabilizers, and/or preservatives. The therapeutic agent can be administered in a physiologically acceptable diluent in a pharmaceutically acceptable carrier, such as a sterile liquid or mixture of liquids, including water, saline, aqueous dextrose and related sugar solutions, an alcohol, such as ethanol or hexadecyl alcohol, a glycol, such as propylene glycol or polyethylene glycol, poly(ethyleneglycol) 400, glycerol, dimethylsulfoxide, ketals such as 2,2-dimethyl-l,3-dioxolane-4-methanol, ethers, oils, fatty acids, fatty acid esters or glycerides, or acetylated fatty acid glycerides with or without the addition of a pharmaceutically acceptable surfactant, such as a soap or a detergent, suspending agent, such as pectin, carbomers, methylcellulose, hydroxypropylmethylcellulose, or carboxymethylcellulose, or emulsifying agents and other pharmaceutical adjuvants.

[0027] Oils, which can be used in parenteral formulations include petroleum, animal, vegetable, or synthetic oils. Specific examples of oils include peanut, soybean, sesame, cottonseed, corn, olive, petrolatum, and mineral. Suitable fatty acids for use in parenteral formulations include oleic acid, stearic acid, and isostearic acid. Ethyl oleate and isopropyl myristate are examples of suitable fatty acid esters.

[0028] Suitable soaps for use in parenteral formulations include fatty alkali metal, ammonium, and triethanolamine salts, and suitable detergents include (a) cationic detergents such as, for example, dimethyl dialkyl ammonium halides, and alkyl pyridinium halides, (b) anionic detergents such as, for example, alkyl, aryl, and olefin sulfonates, alkyl, olefin, ether, and monoglyceride sulfates, and sulfosuccinates, (c) nonionic detergents such as, for example, fatty amine oxides, fatty acid alkanolamides, and polyoxyethylenepolypropylene copolymers, (d) amphoteric detergents such as, for example, alkyl-β-aminopropionates, and 2-alkyl-imidazoline quaternary ammonium salts, and (e) mixtures thereof. [0029] The parenteral formulations will typically contain from about 0.5% to about 25% by weight of the drug in solution. Preservatives and buffers may be used. In order to minimize or eliminate irritation at the site of injection, such compositions may contain one or more nonionic surfactants having a hydrophile-lipophile balance (HLB) of from about 12 to about 17. The quantity of surfactant in such formulations will typically range from about 5% to about 15% by weight. Suitable surfactants include polyethylene glycol sorbitan fatty acid esters, such as sorbitan monooleate and the high molecular weight adducts of ethylene oxide with a hydrophobic base, formed by the condensation of propylene oxide with propylene glycol. The parenteral formulations can be presented in unit-dose or multi-dose sealed containers, such as ampoules and vials, and can be stored in a freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid excipient, for example, water, for injections, immediately prior to use. Extemporaneous injection solutions and suspensions can be prepared from sterile powders, granules, and tablets of the kind previously described. [0030] The therapeutic agent can be made into suppositories by mixing with a variety of bases, such as emulsifying bases or water-soluble bases. Formulations suitable for vaginal administration can be presented as pessaries, tampons, creams, gels, pastes, foams, or spray formulas containing, in addition to the active ingredient, such carriers as are known in the art to be appropriate.

[0031] The exact formulation, route of administration and/or dosage can be chosen by the individual physician in view of the patient's condition. [See, e.g., Fingl et. al., in The Pharmacological Basis of Therapeutics, 1975, Ch. 1 p. I]. The attending physician can determine when to terminate, interrupt, or adjust administration due to toxicity, or to organ dysfunctions. Conversely, the attending physician can also adjust treatment to higher levels if the clinical response were not adequate, precluding toxicity. The magnitude of an administrated dose can vary with the severity of the cocaine abuse and the route of administration. The severity of the disorder can, for example, be evaluated, in part, by standard prognostic evaluation methods. The dose and perhaps dose frequency, can vary according to the age, body weight, and response of the individual patient. [0032] Therapeutic agents intended to be administered intracellularly can be administered using techniques well known to those of ordinary skill in the art. For example, such therapeutic agents can be encapsulated into liposomes, then administered as described above. Liposomes are spherical lipid bilayers with aqueous interiors. Molecules present in an aqueous solution at the time of liposome formation are incorporated into the aqueous interior. The liposomal contents are both protected from the external microenvironment and, because liposomes fuse with cell membranes, are efficiently delivered into the cell cytoplasm. In addition to or in the alternative to liposomes, other inclusion complexes, such as cyclodextrin inclusion complexes can be employed.

[0033] The strength of the active ingredient of the therapeutic agent in a particular dosage form can be any appropriate strength. Single or multiple dosages can be taken to achieve the proper dosage. For example when the dosage form is a tablet, caplet, or capsule, the strength of the active ingredient, in a particular tablet, caplet, or capsule can be 1 mg or more, 2 mg or more, 5 mg or more, 10 mg or more, 20 mg or more, 50 mg or more, 100 mg or more, 150 mg or more, 200 mg or more, 250 mg or more, 300 mg or more, 350 mg or more, 400 mg or more, 450 mg or more, 500 mg or more, 600 mg or more, 700 mg or more, 750 mg or more, and Ig or more. In some embodiments, the therapeutic agent employed is a commercially available cytochrome P450 inhibitor formulation. In some embodiments, the therapeutic agent is a cytochrome P450 inhibitor formulation analogous to a commercially available formulation but with a greater or lesser amount of cytochrome P450 inhibitor. [0034] Accordingly, the invention provides a cytochrome P450 inhibitor or prodrug for treating a pregnant mother for cocaine-induced fetal brain injury and a medicinal formulation comprising a cytochrome P450 inhibitor or a prodrug thereof for treating a pregnant mother for cocaine-induced fetal brain injury.

[0035] The inhibitors used for treatment and screened for according to the invention can be tested in any appropriate animal model. The animal model can be a vertebrate animal. The vertebrate can be a fish. The vertebrate can be a bird such as a chicken. The vertebrate can be a mammal. Mammals include, but are not limited to, the order Rodentia, such as mice and rats, the order Logomorpha, such as rabbits, the order Carnivora, including Felines (cats) and Canines (dogs), the order Artiodactyla, including Bovines (cows) and Swines (pigs), the order Perssodactyla, including Equines (horses), and, most preferably, the order Primates, Ceboids, or Simoids (monkeys) or the order Anthropoids (humans and apes). A preferred Anthropoid is the human. Cocaine abuse is a disorder principally associated with humans. However, the method of the invention is applicable to other animals as models. [0036] The following examples further illustrate the invention but, of course, should not be construed as in any way limiting its scope.

EXAMPLE 1

[0037] This example demonstrates that cocaine's ability to cause fetal brain injury varies during gestation including the period of neocortical neurogenesis. Neocortical neurogenesis in rats starts at El 2 and ends at El 9. Pregnant Sprague-Dawley rats (Charles River Laboratories, Wilmington, MA) receive cocaine at early (El 3 and E14), middle (El 5 and E 16), or late periods (E 17 and E 18) of neocortical neurogenesis. Rats receive 20 mg/kg cocaine intraperitoneally (IP) twice at an interval of 12 hours followed by IP 50 mg/kg bromo-2'-deoxyuridine (BrdU) (Sigma- Aldrich) 24 hours after the last injection of cocaine. Rats are euthanized by CO₂ inhalation 2 hours after BrdU. Control animals receive physiological saline. All animal procedures are performed according to the "Guide for the Care and Use of Laboratory Animals," according to an animal protocol approved by the institutional animal care and use committee of the NIDA intramural Research Program. Cocaine hydrochloride is provided by the National Institute on Drug Abuse (Baltimore, MD). Cocaine induces reductions in cortical size when administered during either the early or middle period of neurogenesis, but not when administered during the late period of neurogenesis. The cocaine reduces cortical size by 23% when injected during the early (E13- E14) period of cortical neurogenesis, and by 15% when injected during the middle (E15-E16) period, but there is no effect of cocaine when injected during the late period. Coronal brain sections stained with cresyl violet illustrate cortical regions that can be used for cortical area measurements between the superior sagittal sinus (SSS) and the caudal pole of the internal capsule. Regions used for BrdU labeling measurements can include one third or two thirds of the cerebral cortex from the SSS to the caudal pole of the internal capsule. In this example and the following examples, values can be expressed as means ± S.E.M. Mean values can be compared using the Student's t test or analysis of variance (ANOVA). The criterion for statistical significance can be p<0.001, p< 0.01, p < 0.05 or other appropriate measurement.

EXAMPLE 2

[0038] This example demonstrates the effect of cocaine on cell cycle progression and mitotic rate of neural progenitor cells in the developing neocortical ventricular zone. Both the ventricular zone (VZ) and subventricular zone (SVZ) can be examined. Cell cycle progression is monitored by incorporation of BrdU for 2 hours, while total progenitor cells are identified by Ki67 immunostaining. Cocaine decreases the number of BrdU-labeled progenitor cells in ventricular zone VZ during both the early and middle neurogenesis periods. Images of BrdU incorporation in peri-ventricular region of cocaine-exposed fetuses show immunoreactivity of Ki67+ and BrdU in subcortical areas of El 5 fetal brains. Cell cycle progression of VZ progenitor cells is inhibited by cocaine. BrdU incorporation in the developing neocortical VZ of cocaine-exposed fetuses at E17 or E19 can also be examined. Cocaine decreases the percentage of proliferating progenitor cells (BrdU/Ki67+) and mitotic BrdU-labeled progenitor cells at E17 in the VZ.

[0039] Progenitor cells in the VZ proliferate in an interkinetic nuclear migration manner, in which mitosis occurs at the surface of the lateral ventricle. The length of the G2/M phase for the progenitor cells is fairly constant at about 2 hours. Taking advantage of this spatiotemporal regulation, BrdU-labeled mitotic progenitors lining the lateral ventricles are detected when BrdU is injected 2 hours before examination. Cocaine significantly decreases the number of BrdU-labeled mitotic progenitor cells lining the lateral ventricles during both the early and middle periods of neurogenesis. Such results indicate that cocaine interferes with the entry of VZ progenitor cells into S phase; therefore, a smaller number of progenitors are available for continued progression to the M phase.

EXAMPLE 3

[0040] This example demonstrates that cocaine promotes proliferation inhibition but not cell death. The AF5 neural progenitor cell line is maintained as previously described in Truckenmiller et al., Exp. Neurol. 175, 318-337 (2002). 5xlO³ cells/well are plated in 96- well plates for cell proliferation and cytotoxicity assays and 4xlO⁴ cells/well in 12-well plates for immunostaining and ROS measurement 24 hours prior to use. AF5 cells are treated with cocaine at various concentrations in either serum-containing or serum-free medium for 24 hours. Cell proliferation is measured using an MTT assay (ATCC, Manassas, VA). Cocaine-induced cytotoxicity is evaluated by lactate dehydrogenase (LDH) release from the cytosol into the medium after exposure of AF5 cells to various concentrations of cocaine in serum-containing medium for 24 hours, according to the manufacturer's protocol (Roche Applied Science, Indianapolis, IN). For single-stranded DNA immunostaining, cells are fixed with methanol/PBS (6:1) for 24 hours at -20⁰C followed by incubation in formamide at 70⁰C for 5 min. Fixed cells are immunostained with mouse anti-single-stranded DNA monoclonal antibodies (1:10, Chemicon, Temecula, CA) and fluorescein-conjugated anti- mouse IgM (1:200, Jackson Immunoresearch, West Grove, PA). Data can be represented as: (number of single-stranded DNA-positive nuclei/number of DAPI-positive total nuclei) times 100%. Exposure of the AF5 neural progenitor cell line to 100 μM cocaine for 24 hours produces a 32% decrease in MTT oxidation as compared to controls. This effect, however, is observed only in serum-containing medium, which fosters cell proliferation. In serum-free medium, where AF5 cells proliferate slowly, cocaine produces no effect. These data indicate that cocaine inhibits proliferation, rather than causing cell death. Data can be shown as percentages of control cultures incubated without cocaine (means + SEM of triplicate observations from at least four separate experiments). [0041] Cell proliferation is also measured using the CyQUANT™ cell proliferation assay (Invitrogen, Carlsbad, CA). AF5 cells are treated with cocaine in concentrations ranging from 1 μM to 100 μM. After 24 hours the numbers of nuclei are measured by using the CyQUANT cell proliferation assay. The CyQUANT assay, which is based on fluorescent labeling of nuclei, yields a doubling time of AF5 cells in control medium of about 24 hours. Cell growth rates are significantly lowered by cocaine in a dose-dependent manner. To exclude the involvement of cell death in this action of cocaine, LDH leakage measurements and single-stranded DNA immunostaining are performed. The dose-dependent inhibition of cell proliferation by cocaine at 24 hours can be demonstrated. Data are presented as percentage of control cultures incubated without cocaine at 0 hours (means + SEM of four replicates from four separate experiments). Cytotoxicity can be expressed as a percentage of the maximum LDH activity (LDH released from 2 % Triton X-100-treated cells). Data are representative of six separate experiments (means + SEM of triplicate observations). For examining the effect of cocaine on apoptosis, AF5 cultures can be labeled for single-stranded DNA (ssDNA) immunostaining and DAPI. Data can be presented as percentage of single- stranded DNA positive cells from fifteen fields of three wells in each group (> 450 cells/group). Cocaine (1-100 μM for 24 hours) does not change either extracellular LDH activity or apoptotic nuclei positive for single-strand DNA. No morphological changes indicative of necrosis or apoptosis in cocaine-treated AF5 cells are observed. Therefore, cell death does not account for the reduction in cell number produced by cocaine in serum- containing medium.

EXAMPLE 4

[0042] This example demonstrates that cocaine causes cell cycle arrest in the Gl/S phase. Cell cycle distribution of cocaine-treated cells is examined using fluorescence-assisted cell sorting (FACS). Cultures are synchronized by maintaining them in serum-free medium for 24 hours, followed by exposure to 0, 10, or 100 μM cocaine in serum-containing medium for 24 hours. AF5 cells are analyzed by flow cytometry on a FACS Calibur flow cytometer (Becton Dickinson, San Jose, CA). Proportions of cells in the Gl, S, and G2/M phases of the cell cycle are determined using ModFit LT software (Verity Software House, Topsham, ME). AF5 cells are stained with propidium iodide. Quantitative results of FACS analysis can be shown as percentages of cells in Gl, S, and G2/M phases, representing means + SEM from 6 independent experiments. Cocaine results in a dose-dependent increase in cells in Gl phase and a reduction of cells in S phase, indicating that cocaine inhibits the Gl-to-S phase transition.

[0043] The effect of cocaine on Gl/S cell cycle arrest can also be demonstrated using bromo-2'-deoxyuridine (BrdU). BrdU incorporation over 24 hours is measured to monitor the number of cells going through S phase. AF5 cultures are treated with 20 μM BrdU (BD Pharmingen, San Diego, CA) and cocaine together for 24 hours, fixed with 95 % ethanol and permeabilized with 2N HCl . Non-specific staining is blocked with 5% normal goat serum with 0.1 % Nonidet P-40 for 20 min at RT. Cells are double-labeled with monoclonal mouse anti-BrdU (1:100, BD Pharmingen) and polyclonal rabbit anti-phospho-histone H3 (1 :200, Upstate Biotechnology, Lake Placid, NY) overnight at 4 ⁰C. After washing, secondary antibodies Alexa Fluor 594 goat anti-mouse and Alexa Fluor 488 goat anti-rabbit (1:500, Invitrogen) are applied, and nuclei are labeled with DAPI. Numbers of immunoreactive nuclei are counted and data are obtained by dividing numbers of nuclei positive for BrdU or phospho-histone H3 by total numbers of nuclei. Both 10 μM and 100 μM cocaine significantly decrease the percentage of BrdU-positive cells. The percentage of mitotic cells is low (< 3%), as measured by phosphorylated H3 immunocytochemistry, and does not show a significant effect of cocaine. For quantification, sixteen fields from four wells are counted in each group (> 1000 cells/group).

EXAMPLE 5

[0044] This example demonstrates genes whose transcription is affected by cocaine and have the potential to mediate cocaine-induced Gl/S transition arrest. cDNA microarrays that include ninety-three significant cell cycle-related genes are probed. Of the ninety-three cell cycle-related genes, sixteen are Gl/S phase transition controllers (cyclin A2, C, Dl, D2, D3, El, E2, Gl, CDK2, pl2CDK2-APl, CDK4, p27Kipl, p57Kip2, pl8INK4c, PITSLRE/CDKl Ip58, and p53). Total RNA is extracted from AF5 cultures using RNA STAT-60 (TEL-TEST, Friendswood, TX). cDNA microarray analysis is performed using a mouse developmental cDNA microarray containing 15,000 clones derived from early Kargul libraries using procedures for processing as described in Tanaka et al., Proc. Natl. Acad. Sci. USA 97, 9127-9132 (2000) and Z-score based analysis is performed as described by Cheadle et al., J. MoI. Diagn. 5, 73-81 (2003). Associations of gene ontology terms with the microarray-identified transcripts are obtained with the FatiGO web tool as described in Al- Shahrour et al., Bioinformatics 20, 578-580 (2004). Genes that show both |Z-ratio| >1.2 and p<0.05 are considered as being changed significantly. Cocaine (100 μM, 24 hours) significantly changes 823 transcripts, accounting for 5.5 % of the total 15,000 genes in the array. Eighteen of the positive transcripts are involved in cell cycle regulation. This category is the eighth most highly-represented category among a total of 121 gene categories. Table 1 lists cell cycle-related genes that showed significant up- or down-regulation by cocaine. Of these, only cyclin A2 and the downstream transcript c-myc are involved in the Gl/S transition. Indeed, of the sixteen Gl/S phase transition controllers included in the microarray, cocaine (10 μM and 100 μM, 24 hours) significantly down-regulates only cyclin Al (see Table 2). Expression of other Gl/S phase transition controllers, such as cyclin Dl, D2, D3, El and E2 are not changed by cocaine. These results support that down-regulation of cyclin A2 causes cocaine-induced inhibition of cell proliferation. Decreased expression of cyclin A2 by cocaine in AF5 cells is verified by quantitative real-time RT-PCR. Reverse transcription is performed as described by Sanchez et al., Cell Tissue Res. 324,1-8 (2006). To quantify the cyclin A2 transcript, quantitative real time RT-PCR using the DNA Engine Opticon Fluorescence Detection System (MJ Research, Waltham, MA) is performed using SYBR green according to the manufacturer's protocol. The primer sequences and sizes of the PCR products for rat cyclin A2 are ATATGAAGAGGCAGCCAGACA (sense) (SEQ ID NO: 1), AGGCAGCTCCAGCAATAAGCG (antisense) (SEQ ID NO: 2); 483 bp, and for human cyclin A2 are GCAAACAGTAAAC AGCCTGCG (sense) (SEQ ID NO: 3), TCAACTAACCAGTCCACGAGG (antisense) (SEQ ID NO: 4); 386 bp. The results are analyzed using Opticon software. Relative expression is determined by normalizing to 18S ribosomal RNA (Ambion, Austin, TX) using 1.0 for the control. Data can be expressed as fold changes in relationship to the control condition.

TABLE 1

TABLE 2

* statistically significant [0045] The effects of cocaine on cyclin A2 mRNA expression in primary human fetal CNS cells obtained from second trimester fetal brains are measured. Primary human fetal CNS cells (ScienCell Research Laboratories, San Diego, CA) are from about 20-week human fetal cerebral cortexes, obtained in accordance with principles embodied in the Declaration of Helsinki (Code of Ethics of the World Medical Association) and are cultured at 37°C, 5% CO₂ using the recommended human cell media obtained from ScienCell Research Laboratories. Five different types of human primary cells (8-21 days in vitro) are treated with 100 μM cocaine for 24 hours and cyclin A2 is measured by quantitative real-time RT-PCR analysis. As measured by quantitative real-time RT-PCR, 100 μM cocaine significantly decreases cyclin A2 mRNA levels in human neural progenitor cells and oligodendrocyte progenitor cells, whereas cyclin A2 mRNA is not altered in neurons and microglia. In contrast, the cyclin A2 transcript is increased by cocaine in human astrocytes. These data indicate that cocaine specifically down-regulates cyclin A2 in progenitor cells. [0046] Western blotting is used to confirm a reduction of cyclin A2 protein by cocaine and demonstrate that signaling molecules downstream of cyclin A2 are also downregulated. Western blot analysis of cell cycle-regulating proteins in cocaine-treated AF5 cells. AF5 cells are treated with vehicle or 100 μM cocaine for 24 hours. Total cell lysates are subjected to immunoblotting. Western blotting is performed as described by Sanchez et al., Cell Tissue Res., 324:1-8 (2006) using monoclonal antibodies to CDK2 (BD Transduction Laboratory, San Diego, CA), pRb (BD Pharmingen), ATFl (Santa Cruz Biotechnology, Santa Cruz, CA), JunB (Santa Cruz Biotechnology), phospho-eIF2α (Ser-51) (Cell Signaling, Beverly, MA), α-tubulin (Sigma-Aldrich), and polyclonal antibodies to eIF2α (Cell Signaling), cyclin A, phospho-CDK2 (Thr-160), c-Myc, ATF2, ATF3, ATF4, phospho-CREB (Ser-133), CREB, JunD, c-Jun, c-Fos, p21, and p27 (Santa Cruz Biotechnology). Immunoreactive bands are densitometrically quantitated using Kodak Image Station 440 CF (Rochester, NY). Signals of cyclin A and c-Myc are normalized to α-tubulin to compensate for loading variation. Phosphorylation status of CDK2 and pRb are determined by normalizing phosphorylated forms to total CDK2 proteins and unphosphorylated forms of pRb, respectively. Data can represent means of three to five independent experiments. Western blotting reveals that cocaine significantly decreases the active forms of CDK2 and pRb (phosphorylated form) as well as c-Myc expression. Cyclin A induces a conformational change in CDK2 that leads to phosphorylation. CDK2 activates pRb that in turn promotes the expression of c-Myc. Accordingly, the Western blotting shows a reduction of cyclin A2 protein by cocaine and demonstrate that signaling molecules downstream of cyclin A2 are also downregulated.

[0047] To characterize the time course of cocaine-induced down-regulation of cyclin A, AF5 cells are treated with 100 μM cocaine for 6 days. Cyclin A protein level, as measured by Western blotting, starts to decrease by day 1, continues to decrease at day 3, and is undetectable at day 6. This data suggests that cocaine-induced inhibition of AF5 cell proliferation is correlated with down-regulation of cyclin A.

EXAMPLE 6

[0048] This example demonstrates regulation of cocaine-induced proliferation inhibition by cyclin A. To show that cyclin A is responsible for cocaine-induced inhibition of proliferation, a rescue of cocaine-induced down-regulation of cyclin A by transfecting AF5 cells with a vector encoding cyclin A (pRc/CMV-CycA) is performed. First, to identify the appropriate timing of transfection, the time course of changes in cyclin A expression after either cocaine treatment or vector transfection is examined. AF5 cells are transfected with a plasmid encoding cyclin A (pRc/CMV-CycA; Hinds et al., Cell 70, 993-1006 (1992)) or a control plasmid (pcDNA3.1; Invitrogen, Carlsbad, CA). One million AF5 cells in suspension (100 μl) are mixed with 2 μg of either of the plasmids and electroporation is performed using nucleofection protocol T-20 (Amaxa Biosystems, Bethesda, MD). Immediately after nucleofection, cells are plated in 96-well plates for the CyQUANT cell proliferation assay. Quantitative real-time RT-PCR show that cyclin A2 mRNA decreases as early as 6 hours after 100 μM cocaine treatment, and then gradually returns towards control levels. The expression of cyclin A2 can be expressed as ratios to the control values. Cyclin A proteins are significantly decreased 12 hours after 100 μM cocaine treatment, with a nearly maximum effect (48%) at 24 hours. For that time course of cyclin A protein levels in AF5 cells treated with 100 μM cocaine, the expression of cyclin A is normalized to α-tubulin and expressed as ratios to the control values. pRc/CMV-CycA transfection causes an increase in cyclin A protein levels 12 hours after transfection, and maximum effect is seen at 24 hours. For that time course of cyclin A protein levels in AF5 cells after nucleofection with the pRc/CMV- CycA vector, the expression of cyclin A is normalized to α-tubulin and expressed as a percentage of the control values for cells transfected with the plasmids lacking an insert. Based on those results, cells are exposed to cocaine immediately after electroporation of the CMV-Cyc A vector, and cyclin A protein and cell proliferation are measured 24 hours after transfection. Western blot analysis of cyclin A expression confirms that cyclin A transfection abolishes the cocaine-induced down-regulation of cyclin A as well as the inhibition of proliferation caused by cocaine. Data can be presented as percentages of control cell numbers at 0 hours (means + SEM). Accordingly, the data indicate that cocaine inhibits AF5 cell proliferation by down-regulating cyclin A.

EXAMPLE 7

[0049] This example demonstrates that cocaine-induced down-regulation of cyclin A is mediated by ATF4 and similarly that cocaine mediates cyclin A down-regulation through ATF4 signaling. Western blot analysis shows that cocaine (100 μM, 3 hours) significantly up-regulates only ATF4 among a total of nine candidate transcription factors, including ATFl, ATF2, ATF3, ATF4, CREB, JunB, JunD, c-Jun, and c-Fos. AF5 cells are exposed to cocaine for 3 hours, and total cell lysates are subjected to immunoblotting. Signals are normalized to α-tubulin and expressed as ratios to the control values. Phosphorylated CREB is normalized to total CREB proteins. In addition, p21 and p27, repressors of the cyclin A2 promoter, are not changed by cocaine. These data indicate that ATF4 mediates cocaine- induced down-regulation of cyclin A. Western blot analysis shows that an increase in ATF4 protein occurs as early as 1 hour after 100 μM cocaine exposure, is maximal at 3 hours, and then declines, returning to control levels by 24 hours. For dose response experiments, AF5 cells are also exposed to cocaine for 3 hours. The expression of ATF4 is normalized to α- tubulin and expressed as percentage of the control values. The effect of cocaine is dose- dependent, and cocaine at concentrations higher than 1 μM results in significant induction of ATF4. Phosphorylation of eIF2α in AF5 cells treated with 10 μM cocaine is measured. The phosphorylation status of eIF2α is determined by normalizing phosphorylated forms to total eIF2α proteins and expressed as percentage of the control values. 10 μM cocaine significantly increases the phosphorylated form of eIF2α 0.5 hours after exposure to cocaine. Accordingly, eIF2α phosphorylation precedes the increase in ATF4.

EXAMPLE 8

[0050] This example demonstrates the utility of cytochrome P450 inhibitors in diminishing the negative effects of cocaine on progenitor cells. This example further demonstrates the role of cocaine-induced oxidative ER stress in activation of ATF4 in progenitor cells. Cocaine-induced generation of ROS is shown to mediate increases in ATF4 expression, cyclin A down-regulation, and inhibition of cell proliferation. The cytochrome P450 inhibitors SKF-525A and cimetidine are shown to block cocaine-induced endogenous ROS generation, translational activation of ATF4, down-regulation of cyclin A, and proliferation inhibition.

[0051] Effects of cytochrome P450 inhibitors on ROS formation, expression of ATF4 and cyclin A, and proliferation of AF 5 cells are examined. To determine whether N-oxidative metabolism is responsible for cocaine-induced proliferation inhibition, the effects of cytochrome P450 inhibitors on proliferation inhibition caused by cocaine are examined. SKF-525A and cimetidine are obtained from Sigma-Aldrich (St. Louis, MO). SKF-525A (100 μM), or cimetidine (100 μM) are applied to AF5 cells 30 minutes before application of 10 or 100 μM cocaine. ROS and ATF4 protein levels are measured 30 minutes and 3 hours after cocaine, respectively, whereas cyclin A protein levels and cell proliferation are measured 24 hours after cocaine. Endogenous ROS are measured by incubating AF5 cells with 100 μM 2',7'-dichlorofluorescein diacetate (DCFH-DA) during the last 20 minutes of the treatments. The treated AF5 cells are washed, dissolved with 1% Triton X-IOO in PBS and fluorescence is measured at an excitation wavelength of 485 run, and an emission wavelength of 530 nm using a fluorescence microplate reader. 10 μM cocaine causes a significant increase in ROS 30 minutes after treatment. Cocaine at 100 μM causes ROS generation even earlier, with a significant increase 15 minutes after exposure. For the ROS measurement and cell proliferation assay, data can be shown as percentages of control cultures incubated without cocaine. For Western blot analysis, the expression of ATF4 and cyclin A can be shown as a percentage of α-tubulin.

[0052] Pretreatment with the cytochrome P450 inhibitors SKF-525 A and cimetidine, potent blockers of N-oxidative metabolism of cocaine, significantly reverses cocaine-induced ROS formation, indicating that cocaine produces ROS via N-oxidative metabolism. Further, both SKF-525A and cimetidine completely inhibited cocaine-induced ATF4 up-regulation and cyclin A down-regulation. Both SKF-525 A and cimetidine significantly diminish cocaine-induced proliferation inhibition (100 μM for 24 hours). In contrast, lipophilic free radical scavengers, α-tocopherol and 3(2)-tert-butyl-4-hydroxyanisole (BHA), and the iron chelator deferoxamine (DFO) are shown not to block cocaine-induced inhibition of proliferation, indicating that lipid peroxidation and iron-mediated ROS production (Fenton reaction) in mitochondria are not primarily involved in cocaine-induced ROS production. These results indicate that cytochrome P450-dependent ROS formation is responsible for cocaine-induced proliferation inhibition caused by cyclin A down-regulation. Accordingly, cocaine biotransformation by microsomal cytochrome P450 is a source of cocaine-induced ROS generation and cell cycle arrest caused by cyclin A down-regulation. Moreover, cytochrome P450 inhibitors can be used to inhibit ROS generation and prevent cell cycle arrest. Furthermore, measurement of ROS generation can be used as a means of identifying and verifying inhibitors of cocaine-induced injury.

EXAMPLE 9

[0053] This example demonstrates the effect of cocaine on cyclin A expression in the developing cerebral cortex. For cyclin A expression studies, tissues (prefrontal cortex and peri-ventricular region) are dissected. Tissues from three fetuses are pooled for each individual assay to obtain sufficient material. RNA and proteins are extracted using RNA STAT-60 (TEL-TEST) and lysis buffer, respectively. Pregnant animals, rats as described in Example 1, receive cocaine according to the injection schedule described above in Example 1 and the frontal cortex of developing fetuses is dissected. Down-regulation of cyclin A2 mRNA is seen in prefrontal cortex of the developing fetuses when cocaine is injected at either E13-14 or E15-16. These time periods represent early and middle periods of neocortical neurogenesis, respectively. Cyclin A2 mRNA is not, however, changed by injections during the late period (E 17-18) of neurogenesis. For cyclin A mRNA expression in cocaine-treated fetal brains, data can be expressed as fold changes in relationship to the control condition. Cyclin A protein is also significantly decreased by cocaine in both early and middle neurogenesis periods, but not during the late period of neurogenesis. For Quantification of Western blots, expression can be shown as a percentage of α-tubulin. This result indicates that cocaine down-regulates cyclin A expression only during earlier periods of neocortical neurogenesis, when the VZ is still the dominant structure in the germinal zone. Moreover, the time period during which cocaine decreases cyclin A expression (E13-E17) corresponds exactly to the time period during which cocaine inhibits mitosis in the VZ as described in Example 2 above.

EXAMPLE 10

[0054] This example demonstrates that P450 inhibitors block the inhibitory effect of cocaine on neural progenitor cell proliferation and cyclin A expression in the developing cerebral cortex. [0055] Pregnant rats at the early period of neurogenesis (E 13 -E 15) are administered cocaine followed by BrdU as described in Example 1. The rats are pretreated with 100 mg/kg cimetidine (administered intraperitoneally) one hour before each cocaine administration. Cimetidine is able to cross the placenta and does not affect neural progenitor cell survival, density, proliferation, or fetal mortality. Pretreatment of pregnant rats with cimetidine results in recovery of the cocaine-induced decrease in BrdU/Ki67-positive progenitor cells in the VZ described in Example 2.

[0056] In particular, about 35% of VZ cells are BrdU/Ki67-positive in rats pretreated with cimetidine before cocaine, which is similar to the results observed in control rats (not administered cimetidine or cocaine), wherein about 36% of VZ cells are BrdU/Ki67-positive, and rats that are administered cimetidine only, wherein about 35% of VZ cells are BrdU/Ki67-positive. In contrast, only about 28% of VZ cells are BrdU/Ki67-positive in rats administered cocaine alone. This experiment demonstrates that cimetidine blocks cocaine- induced proliferation inhibition in neural progenitor cells in the developing neocortex. [0057] To determine whether the protection afforded by cimetidine is due to the recovery of cocaine-induced down-regulation of cyclin A and mediation by ER stress, the effects of cimetidine on the expression of ATF4 and cyclin A are measured in the prefrontal cortex of cocaine-treated fetuses. Pretreatment of pregnant rats with cimetidine inhibits the cocaine- induced up-regulation of ATF4 and the down-regulation of cyclin A as determined by Western blot analysis.

[0058] In control rats (not administered cimetidine or cocaine), the ATF4 expression level and the cyclin A expression level are each assigned a value of 100. Rats administered cocaine alone have a relative ATF4 expression of about 190 and a relative cyclin A expression of about 58. In contrast, rats pretreated with cimetidine before cocaine have a relative ATF4 expression of about 120 and a relative cyclin A expression of about 94. Rats administered cimetidine alone have a relative ATF4 expression of about 95 and a relative cyclin A level of about 102. These results indicate that blockade of cocaine N-oxidative metabolism by P450 inhibitors reverses cocaine-induced proliferation inhibition of neural progenitor cells in the VZ by normalizing cocaine-induced oxidative ER stress and consequent cyclin A down-regulation.

[0059] The results in this in vivo rat model demonstrate that a P450 inhibitor (e.g., cimetidine) could be administered to pregnant women at risk for cocaine abuse and developmental brain damage to prevent the adverse effects of cocaine. [0060] All references, including publications, patent applications, and patents, cited herein are hereby incorporated by reference to the same extent as if each reference were individually and specifically indicated to be incorporated by reference and were set forth in its entirety herein.

[0061] The use of the terms "a" and "an" and "the" and similar referents in the context of describing the invention (especially in the context of the following claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. The terms "comprising," "having," "including," and "containing" are to be construed as open-ended terms (i.e., meaning "including, but not limited to,") unless otherwise noted. Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., "such as") provided herein, is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention.

[0062] Preferred embodiments of this invention are described herein, including the best mode known to the inventors for carrying out the invention. Variations of those preferred embodiments may become apparent to those of ordinary skill in the art upon reading the foregoing description. The inventors expect skilled artisans to employ such variations as appropriate, and the inventors intend for the invention to be practiced otherwise than as specifically described herein. Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context.

Claims

CLAM(S):

1. A method of therapeutically or prophylactically treating a pregnant mother for cocaine-induced fetal brain injury, the method comprising administering a therapeutically or prophylactically effective amount of a cytochrome P450 inhibitor or prodrug thereof to the mother.

2. The method of claim 1 , wherein the cytochrome P450 inhibitor or prodrug thereof inhibits cocaine-induced generation of reactive oxygen species (ROS) in a neural progenitor cell of a fetus of the mother.

3. The method of claim 1 , wherein the cytochrome P450 inhibitor or prodrug thereof inhibits cocaine-induced generation of reactive oxygen species (ROS) in an oligodendrocyte progenitor cell of a fetus of the mother.

4. The method of claim 1 or 2, wherein the cytochrome P450 inhibitor or prodrug thereof inhibits cocaine-induced proliferation inhibition of a neural progenitor cell of a fetus of the mother.

5. The method of claim 1 or 3, wherein the cytochrome P450 inhibitor or prodrug thereof inhibits cocaine-induced proliferation inhibition of an oligodendrocyte progenitor cell of a fetus of the mother.

6. The method of any one of claims 1-5, wherein the cytochrome P450 inhibitor or prodrug thereof comprises an imidazole group.

7. The method of claim 6, wherein the cytochrome P450 inhibitor or prodrug thereof is selected from the group consisting of cimetidine, ketoconazole, a prodrug thereof and any combination thereof.

8. The method of any one of claims 1-5, wherein the cytochrome P450 inhibitor or prodrug thereof is a macrolide antibiotic, metabolite thereof, or a prodrug thereof.

9. The method of claim 8, wherein the macrolide antibiotic, metabolite thereof, or prodrug thereof comprises erythromycin, troleandomycin, clarithromycin, azithromycin, a metabolite thereof and a combination thereof.

10. The method of any one of claims 1-5, wherein the cytochrome P450 inhibitor is 2-diethylaminoethyl 2,2-diphenylpentanoate (SKF-525A, proadifen), a prodrug, or a metabolite thereof.

11. The method of any one of claims 1 -5, wherein the cytochrome P450 inhibitor is chloramphenicol, a prodrug thereof, or a metabolite thereof.

12. The method of any one of claims 1 -5, wherein the cytochrome P450 inhibitor inhibits one or more cytochrome P450 isoforms that metabolize cocaine or a metabolite thereof.

13. The method of any one of claims 1 -5, wherein the cytochrome P450 inhibitor or prodrug thereof inhibits a P450 isoform of the CYP3 family.

14. The method of claim 13, wherein the CYP3 family isoform is CYP3A4.

15. The method of any one of claims 1-14, wherein the cytochrome P450 inhibitor or prodrug thereof is administered during at least one of a first and second trimester of a gestation of the fetus.

16. Use of a cytochrome P450 inhibitor or prodrug thereof in the manufacture of a medicament for treating a pregnant mother for cocaine-induced fetal brain injury.

17. The use of claim 16, wherein the cytochrome P450 inhibitor or prodrug thereof is selected from the group consisting of cimetidine, ketoconazole, erythromycin, troleandomycin, clarithromycin, azithromycin, 2-diethylaminoethyl 2,2-diphenylpentanoate (SKF-525A, proadifen), chloramphenicol, a prodrug, a metabolite and any combination thereof.

18. A method of screening for inhibitors of cocaine-induced fetal brain injury, the method comprising:

(a) contacting a test compound with a first central nervous system (CNS) cell;

(b) contacting cocaine or a P450 metabolite thereof with the first CNS cell and a second CNS cell; (c) measuring a cocaine-induced effect on the first and second CNS cells; and

(d) identifying the test compound as an inhibitor of cocaine-induced fetal brain injury if there is a decrease in the cocaine-induced effect on the first CNS cell relative to the second CNS cell.

19. The method of claim 18, wherein cocaine is contacted with the first and second CNS cells.

20. The method of claim 18 or 19, wherein the first and second CNS cells are neural progenitor cells.

21. The method of any one of claims 18-20, wherein the first and second CNS cells are AF5 cells.

22. The method of claim 18 or 19, wherein the first and second CNS cells are oligodendrocyte progenitor cells.

23. The method of any of claims 18-22, wherein the test compound is administered to the first and second CNS cells before the cocaine is administered.

24. The method of any one of claims 18-23, wherein the cocaine-induced effect measured is an amount of reactive oxidative species (ROS), wherein a decrease in the amount of ROS in the first CNS cell relative to the second CNS cell identifies the test compound as an inhibitor of cocaine-induced fetal brain injury.

25. The method of claim 24, wherein the ROS are P450-dependent ROS.

26. The method of claim 24 or 25, wherein there is a substantially equal amount of reactive oxidative species (ROS) in the first and second neural progenitor cells prior to the contact with cocaine or a P450 metabolite thereof.

27. The method of any one of claims 24-26, wherein the amount of reactive oxidative species is measured by fluorescence resulting from a 2',7'-dichlorofluorescein diacetate (DCFH-DA) assay.

28. The method of any one of claims 18-23, wherein the cocaine-induced effect measured is a decrease in cell proliferation, wherein a diminished decrease in cell proliferation of the first CNS cell relative to the second CNS cell identifies the test compound as an inhibitor of cocaine-induced fetal brain injury.

29. The method of any one of claims 18-23, wherein the cocaine-induced effect measured is a decrease in cyclin A, wherein a diminished decrease in cyclin A in the first CNS cell relative to the second CNS cell identifies the test compound as an inhibitor of cocaine-induced fetal brain injury.

30. The method of any one of claims 18-23, wherein the cocaine-induced effect measured is a decrease in c-myc, wherein a diminished decrease in c-myc in the first CNS cell relative to the second CNS cell identifies the test compound as an inhibitor of cocaine- induced fetal brain injury.

31. The method of any one of claims 18-23, wherein the cocaine-induced effect measured is an increase in ATF4 signaling, wherein a diminished increase in ATF4 signaling in the first CNS cell relative to the second CNS cell identifies the test compound as an inhibitor of cocaine-induced fetal brain injury.

32. The method of any one of claims 18-23, wherein the cocaine-induced effect measured is an increase in eIF2α phosphorylation, wherein a diminished increase in eIF2α phosphorylation in the first CNS cell relative to the second CNS cell identifies the test compound as an inhibitor of cocaine-induced fetal brain injury.

33. A cytochrome P450 inhibitor or prodrug thereof for treating a pregnant mother for cocaine-induced fetal brain injury.

34. A medicinal formulation comprising a cytochrome P450 inhibitor or a prodrug thereof for treating a pregnant mother for cocaine-induced fetal brain injury.

35. A method of screening a test compound to determine if the test compound damages developing fetal brain, comprising

(a) contacting the test compound with a first AF5 cell; (b) assessing the amount of reactive oxygen species (ROS) in the first AF5 cell and a second AF5 cell that has not been contacted with the test compound;

(c) comparing the amount of ROS in the first and second AF5 cells;

(d) identifying the test compound as a compound that damages developing fetal brain if there is an increase in ROS in the first CNS cell relative to the second CNS cell.