KR101541974B1 - Composition and method for enhancing differentiation of neuronal stem cells comprising miR29b - Google Patents

Abstract

The present invention discloses a composition for inhibiting the proliferation or promoting differentiation of neural stem cells comprising miR-29b. The composition according to the present invention or the neuron differentiated thereby can be usefully used for the treatment or prevention of various diseases due to damage of nerve cells.

Description

[0001] The present invention relates to a composition and method for promoting the differentiation of a neural stem cell comprising miR29b into a neuron, and a method and a composition for enhancing differentiation of a neuron stem cell comprising miR29b

It is a technical field related to stem cell proliferation and differentiation.

Neurodegenerative diseases such as Alzheimer's disease is a disease in which neuronal cells degenerate and die, and most neurodegenerative diseases are not a fundamental therapeutic so far.

The fundamental treatment of neurodegenerative diseases is to remove the cause of the disease and to restore the patient's function to normal, or to diagnose and treat it early, to inhibit further progression. Another method is to restore some of the functions of damaged nerve cells. In the absence of a fundamental therapeutic agent, cell therapy using neural stem cells can offer an alternative to various neurodegenerative diseases.

U.S. Patent No. 6,686,198 relates to a method for inducing and maintaining neural cells, and discloses a method for inducing differentiation by activating cells having an actin receptor with actin.

U.S. Patent No. 7,368,115 relates to a method for enhancing neural stem cell proliferation, differentiation and survival, and discloses a method for promoting the proliferation and differentiation of neural stem cells using an adenylate cyclase-activating polypeptide.

It is necessary to develop a neuronal differentiation promotion technique based on a new mechanism.

U.S. Patent No. 6686198 U.S. Patent No. 7,368,115

And to provide a composition and a method for promoting differentiation of neurons based on a molecular biological mechanism.

In one embodiment, the present invention relates to a composition for promoting differentiation of a neural stem cell comprising miR-29b, or a precursor cell of neural stem cells, neurons, astrocytes, and oligodendrocytes. In one embodiment, it promotes differentiation into neurons such as neurons.

MiR-29b according to the present invention is a 7 to 25 mer nucleic acid molecule comprising a 5'-AGCACCA-3 'sequence, wherein in one embodiment miR-29b according to the present invention has the sequence 5'-UAGCACCAUUUGAAAUCAGUGUU-3' .

Promoting neuronal differentiation by the miR-29b contained in the composition according to the present invention is not limited to this, but may be achieved by inhibiting the expression of miR-29b by an inhibitor of β-catenin and T cell factor (ICAT) , And suppression of such expression reduces the complex formation of ICAT and beta-catenin. In another embodiment, the expression inhibition is by binding miR-29b to the 3 'UTR (untranslated region) region of the ICAT mRNA. In one embodiment, the binding of miR-29b to the 3 'UTR is by binding to the target sequence 5'-TGGTGCT-3'.

In other embodiments, compositions according to the present disclosure may be used for the prevention or treatment of neurodegenerative diseases. Such a composition may be delivered to the brain using a delivery method that includes nerve cell damaged areas, such as intracerebroventricular ICV injection or intranasal administration, and the like. In other embodiments, it may be formulated as a nasal administration, intravenous administration, subcutaneous injection, intracerebral intramuscular injection, oral administration or inhalation, or a formulation suitable for such administration.

In another aspect, the invention provides a method of differentiating neural stem cells into neural cells, comprising treating miR-29b to neural stem cells. The method of the present invention can be performed in Invitro in one embodiment, and can be used in an X-ray method in which patient-derived neural stem cells are treated in Invitro and then introduced into the patient. In this regard, the subject also provides cells differentiated by the method.

Promotion of differentiation of neural stem cells into neurons by miR-29b proposed by the present invention can be usefully used as a therapeutic agent for neurodegenerative diseases.

FIG. 1A shows quantitative RT-PCR of total RNAs after treatment of cells with proliferation supplement (PRO) or differentiation supplement (DIFF) after collecting NSCs (nerve cell lines) and quantifying miR29 a, b and c subtypes This is a result.
FIG. 1B shows the result of quantitative reverse transcription PCR on total RNA by collecting NSC and quantifying ICAT and its binding partner, beta-catenin. pro and Diff are as described above.
Fig. 1c shows that NSCs from mouse fetal cells transferred with miR-29b or anti-miR-29b were stained with BrdU and positive cells with nuclei stained together with DAPI and BrdU.
FIG. 1d shows the measurement of the positive cells of FIG. 1c, where 1000 cells per section were measured, and BrdU incorporation quantification was expressed by Student 's t- test . DAPI + refers to the total number of cells and BrdU + DAPI + refers to cells that proliferate in the cell. The BrdU + cells (%) on the Y axis of the graph are BrdU + DAPI / DAPI + x 100.
FIGS. 2A and 2B show that ICAT stimulates 3D cultured NSC proliferation and Native proliferation. As a result of observation of 3D-cultured NSC by fluorescence microscopy, a-catenin and ICAT in TUJ-1- Which is rich in. The scale bar represents 15 μm (AE), the microscope is a Zeiss LSM 700 (Carl Zeiss, Germany) cone-color laser scanning microscope or Olympus FV1000-MPE and the 3D construction is Imaris (custom software developed by Bitplane scientific software) Respectively.
FIG. 2b shows the result of quantitative reverse transcription-PCR analysis of ICSC-deficient fetal NSC using miR-29b or siICAT # 2, indicating that NSC lacking ICAT exhibited a> 90% decrease in Nestin and GFAP expression, Bar represents the SEM of triplicate experiments.
Figure 3 shows HEK293T cells as a luciferase vector containing wild-type or multiple mutations (TGCT to GTAG mutation) 3'-UTR as a result of miR-29 as targeting the ICAT ctnnbip1 gene, 3'-UTR Transfer. Transfection with miR-29b reduced luciferase activity of wild-type 3'-UTR, but not mutant variants. MicroRNA-29b was shown to bind directly to the 3'-UTR. Firefly reporter luciferase activity is normalized to Renilla activity, cis sequence is indicated in red, and mutagenized bases are indicated in blue.
FIG. 4 shows abnormal brain formation due to abnormal cell migration due to quantitative increase of immature differentiated neurons in the case of miR29b deficiency due to miR-29b inhibitor treatment using intra-uterine electrical perforation. In E16.5 cortical plates, TBR-1 positive early pyramidal neurons appear red and RELN expressing cells appear yellow. Injection of anti-miR-29 by intra-uterine electroporation resulted in a numerical reduction of TBR1-expressing neurons located in the cortical plate. The abbreviations are: MZ, Marginal zone; CP, Cortical plate; SC, Subplate cells; IZ, Intermediate zone, SVZ, Subventricular zone; VZ, Ventricular zone
Fig. 4B is a graphical representation of Wnt / [beta] -catenin mediated neuron production, indicating that microRNA-29 promotes the inhibition and differentiation of neural stem cells by targeting ICAT.

The present invention is based on the finding that miR-29b can modulate neuronal differentiation and / or proliferation by inhibiting the expression of ICAT that is involved in the Wnt / beta-catenin signaling pathway.

In one embodiment, the present invention relates to a composition for inhibiting proliferation or promoting differentiation into neurons of neural stem cells comprising miR-29b.

As used herein, the term " miR "or" microRNA "refers to 21 to 23 noncoding RNAs that regulate gene expression after transcription by promoting degradation of target RNA or inhibiting their translation. The maturation sequences of the miRNAs used herein can be obtained from the miRNA database (http://www.mirbase.org). As of August 2012, 25,141 mature miRNAs from 193 species are registered according to the miRNA database (19th edition, miRBase). In general, microRNAs are transcribed into precursors of about 70-80 nt (nucleotide) long with a hairpin structure called pre-miRNA and then matured by cleavage by the RNAse III enzyme Dicer. MicroRNAs form a ribonucleotide complex called miRNP, which cleaves the target gene by complementary binding to the target site, or inhibits translation. Over 30% of human miRNAs are present in clusters, which are transcribed into a single precursor and then cleaved to form the final mature miRNA.

The miR-29 microRNAs herein are members of the family to which miR-29a, b, and c belong. One embodiment is miR-29b from human. MiR-29 herein includes miR-29, pri-miR-29, pre-miR-29, and mature miR-29. Also, miR-29 of the present application includes mutants and fragments thereof, and the mutants and fragments thereof substantially exhibit the biological effect of miR-29 according to the present invention.

MiR-29b, an agonist thereof, or a mimic thereof may be used as used herein. These may be mature miR-29, or a polynucleotide comprising the primary miR-29, and the polynucleotide may be a hybrid of RNA, DNA, or RNA and DNA. The polynucleotides may also be single or double stranded. The sequence of miR-29 is known and is known, for example, as MI0000087, MI000105, MI0000107 and MI0000735.

In one embodiment, miR-29b herein is a nucleic acid molecule of 7 to 25 mer comprising a 5'-AGCACCA-3 'sequence. Nucleic acid molecules include, for example, RNA, DNA, antigomir, 2'-O-modified oligonucleotides, phosphorothioate-backbone deoxyribonucleotides, phosphorothioate-backbone ribonucleotides, decoy oligonucleotides, ) Oligonucleotides or LNA (locked nucleic acid) oligonucleotides. In one embodiment, miR-29b has 5'-UAGCACCAUUUGAAAUCAGUGUU-3 '.

In one embodiment, the miR-29 variants herein also include those modified to prevent degradation in the subject or cell. (2'-O-methyl, 2'-O-methoxyethyl), 2'-fluoro, and 4'- A chemical modification such as a thio modification, a modification of the skeleton such as a phosphorothioate, a morpholino or a phosphonocarboxylate linkage.

As used herein, the term " neural stem cell " (NSC) is an undifferentiated cell that is capable of self-sustaining ability to divide continuously. Progenitor cells are progenitor cells of stem cells. They are undifferentiated, but have limited proliferative capacity, unlike stem cells, and are cells that undergo a specific pathway differentiation under certain conditions. Neural progenitor cells are differentiated into neurons, and glial precursor cells are differentiated into astrocytes or oligodendrocytes. The composition according to the present invention promotes the differentiation of neural stem cells into progeny cells, for example, neural progenitor cells, neurons, glial precursor cells, astrocytes and oligodendrocytes. In one embodiment according to the present disclosure, the differentiation into neural progenitor cells and / or neurons is facilitated.

The neural stem cells used in the compositions according to the present invention may be obtained from embryonic, pediatric or adult mammalian neural tissue (for example, rodents such as mice, human and primate neural tissue), and also those described in US Patent 6,294,346 .

MiR-29b according to the present invention inhibits the expression of ICAT that is involved in the Wnt / beta-catenin signaling pathway. In the Wnt / beta-catenin signaling pathway, beta-catenin migrates to the nucleus and binds to the transcription factor of lymphoid enhancer binding factor (TEF) / T-cell transcription factor (TCF) (Behrens et al., 1996 Nature 382: 638-642; Tetsu and McCormick, 1999 Beta-catenin regulates expression of cyclin D1 in colon carcinoma cells. Nature 398: 422-426). Inhibitors of β-catenin and T cell factor (ICAT) inhibit the binding of beta-catenin to TCF through its binding to beta-catenin, thus inhibiting the Wnt / beta-catenin signaling pathway Daniels and Weis, 2002 Molecular cell 10: 573-584). ICAT - / - necrotic mice were found to have anterior cerebral anomalies, and the embryos were found to be smaller in size (Satoh et al., 2004; National Academy of Sciences 101: 8017-8021). .

In this study, the quantitative reduction of ICAT by miR-29b in the Wnt / beta-catenin signaling pathway resulted in the inability to complex with beta-catenin and the introduction of beta-catenin into the nucleus, resulting in gene expression associated with NSC proliferation inhibition and differentiation induction Induced

MiR-29b of the present invention inhibits the expression of ICAT, which interacts with beta-catenin in the Wnt / beta-catenin signaling pathway, and can be useful for differentiation or proliferation into neural cells. In particular, miR-29b according to the present invention inhibits translation of the 3 'UTR region of ICAT mRNA into its target protein by binding to the target sequence 5' TGGTGCT 3 '.

Accordingly, the composition according to the present invention can be usefully used for the treatment or prevention of neurodegenerative diseases due to deficiency of neuronal cells.

The term " neurodegenerative disease or condition or symptom " as used herein refers to a medical condition associated with a loss or dysfunction of a neuron. For example, these diseases include brain damage due to nerve damage caused by surgery, stroke or trauma; Central nervous system (CNS) dysfunction such as depression, epilepsy, neurosis or psychosis; Alzheimer's; Multiple sclerosis; Huntington disease; Amyotrophic lateral sclerosis; Parkinson's disease.

As used herein, the term " treatment ", "palliative" or "improvement" refers to any act that improves or alleviates the symptoms of a related disease upon administration of the composition. Those skilled in the art will be able to ascertain the precise criteria of the disease by referring to the data provided by the Korean Medical Association, and to judge the degree of improvement, improvement, and treatment of the disease.

As used herein, the term "prophylactic" means any act that inhibits or delays the onset of a related disorder. It will be apparent to those skilled in the art that the compositions herein may prevent early onset symptoms, or related disorders when administered prior to appearance.

MiR-29b according to the present invention may be used in the composition as such or in the form of a pharmaceutically acceptable salt. A pharmaceutically acceptable salt means that the undesirable toxicity is minimized while maintaining the biological activity of the polynucleotide according to the present invention. Such salts include salts formed with metal cation such as, for example, zinc, calcium, bismuth, barium, magnesium, aluminum, copper, cobalt, nickel, cadmium, sodium, But are not limited to, salts formed with cations derived from N-dibenzylethylene-diamine, D-glucosamine, tetraethylammonium, or ethylenediamine. .

In one embodiment according to the present application, the active ingredients herein are negatively charged due to the nature of the nucleotides. Due to the lipophilic nature of the cell membrane, the absorption of the polynucleotide into the cell membrane can be reduced. Absorption inhibition due to this polarity can be overcome through the prodrug approach described below (Crooke, RM (1998) in Crooke, ST Antisense research and Application, Springer-Verlag, Berlin, Germany, vol. 103-140).

The composition according to the present invention may also facilitate the differentiation and / or proliferation of neural progenitor cells and / or neurons, glial precursor cells, astrocytes or oligodendrocytes of neural stem cells in vitro, and in one embodiment, The cell culture may be implanted in a subject and used for the treatment of the above-mentioned diseases. Neural progenitor cells can be differentiated into cells such as neurons at the transplanted site when they are transplanted. Methods of transplantation are known and can be found, for example, in U.S. Patent 6,294,346. In other embodiments, the cell culture may be used as an assay kit or a research tool. In this respect, the present invention relates to a method of differentiating neural stem cells into neural cells, comprising the step of treating miR-29b to neural stem cells.

MiR-29b according to the present invention may be constructed as an oligonucleotide using a nucleic acid synthesizer or as part of an expression plasmid or vector containing a polynucleotide encoding miR-29b under the promoter, so that it can be transcribed in Invivo or Invitro. Can be used. In the latter case, the expression plasmid itself containing the polynucleotide encoding miR-29b under the promoter may be used, or the miR-29b transcribed therefrom may be used separately.

The expression vector includes all of the vectors contained in the chromosome or the cytoplasm, and includes vectors derived from viruses such as bacteria, bacteriophages, yeasts, adenoviruses or retroviruses.

MiR-29b or a vector or plasmid expressing miR-29b according to the present invention may be used in combination with a calcium phosphate method, a DEAE-dextran method, a cationic lipid-mediated liposome transfer method, an infection or transduction using a virus, an electroporation, Or microinjected into a desired cell, tissue or organ.

The composition of the present invention may be provided as a pharmaceutical composition and may contain one or more active ingredients exhibiting the same or similar functions in relation to the treatment of diseases other than the miR-29b of the present invention or a compound which maintains / increases the solubility and / May be further contained. Also optionally, it may further comprise a chemotherapeutic agent, an anti-inflammatory agent, an antiviral agent and / or an immunomodulator.

The composition of the present invention may further comprise one or more pharmaceutically acceptable diluents, carriers and / or adjuvants in addition to the above-mentioned active ingredients. The pharmaceutically acceptable carrier may be a mixture of saline, sterilized water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol, liposome and one or more of these components. , A buffer solution, a bacteriostatic agent, and the like may be added. In addition, it can be formulated into injection formulations, pills, capsules, granules or tablets such as aqueous solutions, suspensions, emulsions and the like by additionally adding diluents, dispersants, surfactants, binders and lubricants, Specific antibody or other ligand can be used in combination with the carrier. Can further be suitably formulated according to the respective disease or ingredient according to the appropriate method in the art or using the methods disclosed in Remington's Pharmaceutical Science (recent edition), Mack Publishing Company, Easton PA have. For example, as solutions, emulsions and liposomes, and the like. For example, the active ingredient may be formulated into tablets, capsules, gels, syrups or suppositories by mixing with pharmaceutically acceptable liquid and / or solid carriers or excipients of fine powder. The composition according to the invention may also be prepared as a suspension in an aqueous, non-aqueous or mixed medium. The aqueous suspension may further comprise a material that increases the viscosity of the suspension, such as sodium carboxymethylcellulose, sorbitol and / or dextran.

The method of administering the composition according to the present invention is not particularly limited, and a known method of administering the inhibitor can be applied. Depending on the intended method, parenteral administration (for example, intranasal, intravenous, subcutaneous, Or may be administered orally. In order to obtain a rapid therapeutic effect, it can be administered by intranasal administration or cerebrovascular injection. The compositions herein may also be delivered in a variety of routes including, for example, infusion or bolus injection, epidermal or mucosal (oral mucosa, anal mucosa, intestinal mucosa, etc.). The compositions herein may also be administered systemically or topically.

The composition according to the present application is administered in a pharmaceutically effective amount. In the present invention, "pharmaceutically or therapeutically effective amount" means an amount sufficient to treat a disease at a reasonable benefit / risk ratio applicable to medical treatment, and the effective dose level will depend on the type, severity, The activity of the drug, the sensitivity to the drug, the time of administration, the route of administration and the rate of release, the duration of the treatment, factors including co-administered drugs, and other factors well known in the medical arts. The composition of the present invention can be administered as an individual therapeutic agent or in combination with other therapeutic agents, and can be administered sequentially or simultaneously with conventional therapeutic agents, and can be administered singly or in multiple doses. It is important to take into account all of the above factors and to administer the amount in which the maximum effect can be obtained in a minimal amount without side effects, which can be easily determined by those skilled in the art.

The dosage ranges vary widely depending on the patient's body weight, age, sex, health condition, diet, time of administration, administration method, excretion rate and severity of the disease, and a proper dosage is, for example, And / or the degree of specific activity of the polynucleotide used. It may be calculated on the basis of the EC ₅₀ generally measured as effective in the in vivo animal model and in vitro, for example from 0.01 μg to 1 g per kg of body weight, and may be calculated on a daily, weekly, monthly or yearly basis , May be administered once or several times per unit period, or may be continuously administered for a long period using an infusion pump. The number of repeated administrations is determined in consideration of the duration of the drug in the body, the drug concentration in the body, and the like. The composition may be administered for recurrence, even after treatment according to the course of the disease treatment.

The composition according to the present invention can inhibit proliferation while promoting differentiation as described above. Accordingly, in another embodiment, the present invention can be used for inhibiting proliferation of proliferating cancer stem cells. For example, a miR or composition according to the present invention may treat a glioblastoma multiforme (GBM), a representative brain tumor.

Hereinafter, embodiments are provided to facilitate understanding of the present invention. However, the following examples are provided only for the purpose of easier understanding of the present invention, and the present invention is not limited to the following examples.

Example

Experimental Method

Embryo From mouse brain  Primary Nerve sphere  detach

Timed pregnant mice (CD1 albino, ICR) were purchased from Harlan Inc (USA). Mice were randomly assigned to SNU-130531-1 by the Institutional Animal Care and Use Committee (IACUC) of the IRB and Seoul National University College of Medicine. The embryonic day 13.5 days (E13.5), the brain cortex was harvested, isolated and resuspended using the methods described previously (Rietze and Reynolds, 2006).

cDNA  Synthesis and quantification Reverse transcription PCR  ( qRT - PCR )

Expression patterns of mature miR-29 families a, b and c were analyzed by qRT-PCR. 100 ng total RNA containing 18 nt RNA was isolated and cDNA was synthesized using the miScript strater kit (Qiagen) according to the manufacturer's instructions. The RT primer, 5'-UAGCACCAUUUGAAAUCAGUGUU-3 ', QIAGEN, or U6 RNA specific to miR-29b contained in the kit was used.

Amplification of the synthesized cDNA was performed using the ABI StepOne system according to the manufacturer's instructions. In summary, the relative quantification (RQ) was used for the ΔΔCT method and the interassay variation was corrected for the U6 RNA concentration.

To identify mRNA regulated by miR-29b, 0.5 mg of total RNA was synthesized using miScript strater kit (Qiagen) according to the manufacturer's instructions and corrected for GAPDH concentration.

Micro device array manufacturing

A microarray consisting of 8 units of polydimethylsiloxane (Sylgard 184; Dow Chemical, MI) made by general soft lithography was used in the experiment. Sterilized micropatterned PDMS and glass cover slip substrates were treated with oxygen plasma (Femto Science, Seoul, Korea) and then stuck together to form a closed microchannel (140-160 mm) system. The single unit consists of one central channel and two side channels for 3D NSC culture and growth medium replenishment.

3D using micro devices NSC  culture

Collagen type I (BD Bioscience) was used as ECM material for 3D NSC culture. The collagen type I solution was dissolved in 10x PBS solution and distilled water at a concentration of 2 mg / ml and adjusted to pH 7.4 with 0.5N NaOH. E13.5 neural spheres were suspended to 5 x 10 ⁶ cells / ml cell density with the ice-cold collagen solution. NSCs cultured in collagen solution were injected into a central channel and cultured at 37 ° C for 30 minutes to gel. Lipofectamine RNAiMAX (Invitrogen) was prepared using 100 nM siRNAs (Sigma, MISSION® siRNA (Mouse, NM_023465), siICAT # 1, SASI_Mm01_00054131; siICAT # 2, SASI_Mm01_00054132) or 50 nM miRNAs (QIAGEN) targeting ctnnbip1, ) Using the manufacturer's method.

After gelation, a complete growth medium containing solids was added to the microdevice through both channels and incubated overnight. Subsequently, the badge was changed every day. NSC-specific gene expression was quantified by qRT-PCR 3 days after culture.

Immunocytochemical analysis

NSCs cultured in microdevice arrays were fixed with 4% (w / v) paraformaldehyde in PBS for 15 minutes at room temperature and then washed with PBS. Fixed cells were treated with 0.1% triton x-100 for 5 min to make them permeable and then blocked with 4% (w / v) bovine serum albumin in PBS for 1 h. The cells were then treated with either monoclonal anti-TJJ1 (Millipore, 1: 100), mouse monoclonal anti-O4 (Millipore, 1: 100), rabbit polyclonal anti-GGF (Abcam, 1: 100), rabbit polyclonal anti- FL-81) (Santa Cruz, 1: 100), and mouse anti-active β-catenin (clone 8E7) (Millipore, 1: 100) for 2 hours at room temperature. Nuclei were stained with DAPI (Sigma).

miRNA  3 ' UTR  Target Luciferase  Reporter Analysis

Full-length encoding (2191 bp) 3'-UTR of mouse ctnnbip1 fragment based on pEZX-MT01 framework was purchased and used (GeneCopoeia, Inc. USA). The mutant construct contains a base mismatch (GTAG in TGCT) in the seed sequence of the 3'UTR of ctnnbip1 , the direct miR-29-target binding site. HEK293T cells were seeded 24 hours prior to co-transfer. 0.5 μg of the reporter construct (WT or MUT-see FIG. 3b) was co-transfected with control siRNA or 50 nM mouse miR-29b-3p miRNA duplex (QIAGEN, USA). After 24 hours, the activity of luciferase was measured using a dual-luciferase reporter assay system (Promega, USA) according to the manufacturer's procedure and normalized to the activity of lenalla luciferase.

BrdU  Incorporation and immunodiffusion analysis

The NSC E13.5 in 24-well plates (Promega) coated with laminin per well were seeded with 1x10 ⁵ cell cells. The cells were then pulsed with 10 mM BrdU (BD Biosciences, USA) for 1 hour. BrdU pulsed cells were fixed, treated with acid and immunostained with anti-BrdU (Abcam, 1: 100).

Uterine perforation

The uterine horns were exposed to open surgery after anesthesia (induction 4%, surgery 2.5%) with a mouse (Timed-pregnant C57BL / 6N; E13.5 days) in which the pregnancy cycle was known. 1 μl of expression vector (37.5 pmol of control siRNA or miRNA-29b antisense RNA (5'-GCUGGUUUCAUAUGGUGGUUUA-3 ') and 0.625 μg of pCAGIG reporter plasmid in PBS containing 0.05% fast green (Sigma) (Sun et al., 2011 Nature communications 2: 529). Electroporation was performed using Tweezertrodes (diameter, 5 mm; BTX) under the following conditions: Five times in 50 milliseconds at 45 V with 950 millisecond intervals using a square pulse generator (ECM 830; BTX). The uterine horn is then returned to the abdominal cavity, and the wall and skin are sutured to allow the embryo to develop normally Respectively.

Statistical processing

Quantitative data were analyzed using SEM; n > 3. Significant differences were obtained using the unpaired Student 's t- test for the two treatment groups: * p <0.05; ** p &lt;0.01; And *** p &lt; 0.001.

Example  1 &lt; / RTI &gt; expressed in 3D-cultured neural stem cells WNT  Detection of signal transfer components

Quantitative real-time PCR was performed on miRNA-29a, b and c subtypes to characterize the role of the miRNA-29 family in neural epidermal cells. The primary neurons isolated from the mice were treated with proliferation supplement (PRO) or differentiation supplement (DIFF) (Stem cell technologies', USA) as described in the experimental method, PCR was performed.

The results are shown in FIG. As a result, miR-29b was remarkably increased when inducing neural stem cell differentiation using the supplement or 1% FBS.

Expression of ICAT (Inhibitor of β-catenin and T cell factor) and beta-catenin was investigated to identify potential target molecules of the miR-29 family. The ICAT mRNA expression pattern was found to be in an inverse relationship with miR-20b (see Fig. 1). Fig. 1 shows that ICAT is quantitatively increased when differentiation is induced when PRO and DIFF are compared, not when microRNA-29b is treated.

miR-29b binds to the 3'-UTR region of the mRNA of ICAT and induces translation inhibition. qRT-PCR analysis showed no change in mRNA level. ICAT protein concentration was significantly reduced in the presence of endogenous miR29b, whereas mRNA was not. Beta-catenin expression levels were not associated with reduced ICAT concentrations.

As the differentiation progresses progressively, miR-29b increases quantitatively, while ICAT decreases, and the correlation between the two molecules can be deduced. It is considered that ICAT, a potential target molecule of miR-29b, directly binds miR-29b and induces a decrease in ICAT expression.

Example  2 miR By -29b NSC  Reduction of proliferation

To determine the effect of miR-29 on NSCs, E13.5 cortical cells were grown in neural spheres and cultured in media supplemented with EGF and FGF2. Bromodeoxyuridine (BrdU) incorporation experiments showed that the NSC treated with miR-29b exhibited a proliferation rate of about 30%, resulting in a decrease in proliferating cells. On the other hand, when treated with miR-29b antisense, the cell proliferation rate was about 33% higher. The results are shown in FIG.

The BrdU pulse confirmed that miR-29b induced a decrease in the number of fetal NSCs and an increase in the number of anti-sense cells of miR-29b. This indicates that miR-29b expression decreases the proliferation rate of neural stem cells.

Example  3 miR By -29b NSC  Acceleration of differentiation

There are NSCs that respond to EGF- and FGF2- in the embryonic telecephalic germinal region of the early E13.5 embryo (Reynolds and Rietze, 2005; Rietze and Reynolds, 2006). The progenitor optic nerve cells are predominantly bulbous markers that express the intermediate filament protein type VI, Nestin, and early neurons express class III β-tubulin (TUJ-1). Nestin (neural progenitor cell marker), glial fibrillary acidic protein (GFAP) (astrocytemarker), and glutamyltransferase (NSAID) were transfected into NSCs transfected with miR-29b to investigate the differentiated cell types produced in expanded stem cells in neurons. Quantitative reverse transcription-PCR was performed on the markers specific to each cell type such as TUJ-1 (neuronal cell marker) and O4 (oligodendrocyte marker).

Expression of neural precursor markers Nestin and GFAP (Frederiksen and McKay, 1988; Doetsch, 2003; Kriegstein and Alvarez-Buylla, 2009) in the presence of siRNA against miR-29b and ICAT (siICAT # 2) (Fig. 2B). The neuronal marker, class III β-tubulin (TUJ-1), showed similar results in the transfused group. O4, a marker of oligodendrocytes, was shown to be induced by siRNA-targeting ICAT (siICAT # 2). As shown in FIG. 4A, TBR-1 expressing cells were observed from anomalous formation and outgrowth by miR-29b to a neuron by neuron or GFAP with a tendency of 90% Indicating that differentiation into cells is promoted.

Beta-catenin migrates to the nucleus and binds to the LEF / TCF family to induce expression of the target gene (Behrens et al., 1996 Nature 382: 638-642). Beta -catenin in the nucleus was essential for the differentiation of 3D cultured NSC (Figure 2b)

Example  4 miR -29 Target Identification: WNT  Signal pathway ICAT 3 ' UTR

miR-29b binds to the 3 &apos; -UTR of ICAT mRNA and inhibits its expression at the protein level, which is reported by TargetScan (http://www.targetscan.org) (Lewis et al., 2003 Cell 115: 787- 798), microRNA.org (http://www.microrna.org) (Betel et al., 2008 Nucleic acids research 36: D149-153) algorithms. (See FIG. 3B).

miR-29 family members miR-29a, b, and c contain TGGTGCT, which is the targeted seed sequence of the 3'-UTR of ICAT.

To confirm this, a luciferase construct comprising mouse ICAT 3'-UTR (2173 bp) containing the miR-29b target seed sequence was prepared. Cells containing the construct, wild type (WT) miTarget miRNA 3'-UTR target clone (GeneCopoeia, MD, USA) or mutant (MUT-see figure 3b) were transfected into a mature miR-29b RNA duplex. Luciferase activity decreased 20-30% of luciferase activity when the WT reporter gene was transferred with miR-29b (see Figure 3a). To confirm whether the miR-29b target site of the ICAT 3'-UTR is important for inhibition of ICAT expression, a mutation was introduced in the ICAT 3 'UTR region. As a result of mutagenesis, miR-29b failed to bind to the target site (see FIG. 3B). These results indicate that miR-29b suppresses its expression into its protein through the TGGTGCT target site of ICAT 3'-UTR.

Example  5 In brain development miR -29b On antisense  Proliferative defects due to

To identify the role of miR-29b in neuronal differentiation and migration in vivo, 2'-O-methyl modified anti-miR-29b inhibitor was microinjected into the left ventricle of E13.5 embryos. This resulted in severe outgrowth due to premature outward migration in the mice (see FIG. 4A).

In addition, the above experiment showed that proliferative defects and immature outward migration of the mouse brain were observed (see FIG. 4A). The cells were radially transferred to the cortical marginal zone transferred to the control siRNA (negative control silencing small RNA sequence, AllStars negative control siRNA, QIAGEN) and showed reelin expression distribution. However, when treated with anti-miR-29b, the Cajal-Retzius neurons were decreased in the marginal zone. miR-29b antisense inhibits T-brain-1 (TBR1), a member of the brachyury (T-box) transcription factor. TBR1 is the initial pyramidal neuron marker for the final positioning of the smooth surface and cortical plate (CP) (Hevner et al., 2001 Neuron 29: 353-366).

Inhibition of ICAT expression by treating miR-29b inhibitor as described above indicates that miR-29b function is important in normal corticogenesis during brain development from abnormal anomalies such as outgrowth and migration.

While the present invention has been described in connection with what is presently considered to be the preferred embodiments, it is to be understood that the invention is not limited to the disclosed embodiments, but, on the contrary, .

All technical terms used in the present invention are used in the sense that they are generally understood by those of ordinary skill in the relevant field of the present invention unless otherwise defined. The contents of all publications referred to herein are incorporated herein by reference.

Claims (11)

Inhibiting the proliferation of neural stem cells comprising 7-25 mer miR-29b nucleic acid molecules comprising the 5 'AGCACCA 3' sequence, or inhibiting the proliferation of neural stem cells comprising neural stem cell precursors, neurons, astrocytes or oligodendrocytes Composition for promoting differentiation.
delete 2. The composition of claim 1, wherein the sequence of miR-29b is designated 5'UAGCACCAUUUGAAAUCAGUGUUU 3 '.
The composition according to claim 1, wherein the stimulation of neuronal differentiation by miR-29b is due to the inhibition of expression of an inhibitor of β-catenin and T cell factor (mRNA) mRNA by miR-29b.
5. The composition of claim 4, wherein the inhibition of expression inhibits complex formation of the ICAT and beta-catenin.
5. The composition of claim 4, wherein the expression inhibition is by binding miR-29b to the 3 'UTR (Untranslated Region) region of the ICAT mRNA.
7. The composition of claim 6, wherein said binding is by binding to the 5 'TGGTGCT 3' target sequence of said 3 'UTR.
8. The composition according to any one of claims 1 to 7, wherein the composition is used for the prevention or treatment of brain cancer or neurodegenerative diseases.
8. The composition according to any one of claims 1 to 7, wherein the composition is administered by administration to a site where the neuron is damaged or by injection of a cerebral blood vessel.
10. The composition of claim 9, wherein the composition is for intranasal administration, intravenous administration, subcutaneous injection, oral administration, intracerebroventricular injection, or inhalation administration.
A method of differentiating neurons into neural cells of an in vitro neural stem cell, comprising the step of treating miR-29b with neural stem cells.

Images