WO2008107509A1 - Method for modifying the inflorescence architecture of plants - Google Patents

Abstract

The invention relates to a method for modifying the inflorescence architecture of plants, comprising: the transformation of plant material with a gene construction containing a cytotoxic gene under the control of the PsEND1 pea anther-specific gene promoter; the regeneration of the plants; and the selection of the transgenic plants that exhibit a modified inflorescence architecture compared to that of the corresponding wild plant. The resulting transgenic plant exhibits a more complex branching pattern with a greater number of branches and higher order branches, all of which are flowering. The invention is suitable for use in agriculture, particularly in the production of ornamental plants

Description

 PROCEDURE TO MODIFY THE ARCHITECTURE OF THE INFLORESCENCE OF PLANTS

FIELD OF THE INVENTION The invention relates, in general, to a method for modifying the architecture of the inflorescence of plants, and, in particular, to a method for obtaining transgenic plants that have an architecture of their inflorescence modified with respect to Ia of the corresponding wild plants, based on the use of a construct comprising a cytotoxic gene under the control of a specific anther promoter. The transgenic plants show an architecture of their inflorescence more complex and with greater number of branches than the corresponding wild plants. These branches initiate and develop a greater number of floral meristems than the wild ones.

BACKGROUND OF THE INVENTION

Plant architecture, this is its three-dimensional organization, is a characteristic under strict genetic control by what is specific to each plant species (Reinhardt, D. & Kuhlemeier, C. (2002). Plant architecture. EMBO reports 3: 846-851). However, some modification of the basic structural pattern can occur due to environmental conditions such as light, temperature, humidity or nutritional status of plants.

The architecture of the aerial part of the plants is defined by the pattern of distribution of the leaves along the stem or phyloxis, the determination of the apical meristems of the stem, and by the branching patterns of the vegetative parts and the parts reproductive, this last factor also called architecture of the inflorescence. Plants produce lateral branches from the meristems that begin in the armpits of the leaves. The branching pattern is conditioned by the filotactic pattern of the plant stem. In many plants, the initiation of axillary meristems is initially suppressed by the apical meristem, a phenomenon called apical dominance. In the case of corn, it is known that the apical dominance is mediated mainly by the TEOSINTE BRANCHED1 gene (Doebley et al., (1997). The evolution of apical dominance in maize. Nature 386: 485-488). In fact, in the tb1 mutant, all axillary meristems develop, giving rise to highly branched plants that show a new vegetative architecture. However, the structure of the inflorescence in each one of the branches that develop in the mutant does not show floral proliferations, which suggests that the archiyecure of the vegetative parle and the architecture of the inflorescence of the plants are regulated differently.

At the genetic level, mutations are also described, such as lateral suppressor in tomato, which give rise to the suppression of axillary meristems and which is evidenced by the production of tomato plants without lateral branches (Schumacher et al., (1999) The Lateral suppressor (Ls) gene of tomato encodes a new member of the VHIID protein family. Proc. Nati. Acad.Sci.USA 96: 290-295).

The floral transition affects the architecture of the plant in several ways since there are usually changes in the phyloxis in addition to those that affect the destination and the identity of the meristems. Many plants have an apical meristem of the stem that is undetermined, that is, it remains active throughout the life of the plant by first differentiating leaves and then flowers. This growth pattern is called monopodial and is characteristic of Arabidopsis or Antirrhinum. The pattern of monopodial growth in Arabidopsis is established in different stages: first, type 1 vegetative metamers are formed, formed by very short internodes, a leaf and a yolk, which are organized in the form of a rosette; and in the second place, and after a floral transition, the main stem of the inflorescence is composed at the beginning of type 2 metamers, which have elongated internodes, a caulinar leaf and a bud, and then by type 3 metamers that contain intermediate length internodes. and a floral bud. The axillary meristems are detected in the stem, first in the axillae of the caulinary leaves and later in those of the rosettes, once the floral transition has occurred. Such axillary meristems form inflorescent lateral stems with a monopodial development pattern (Alvarez et al., (1992). Terminal flower: a gene affecting inflorescence development in Arabidopsis thaliana. Plant Journal 2: 103-116). Thus, the number of axillary meristems has a great impact and conditions the architecture of the plant. The formation of axillary meristems in Arabidopsis is controlled, in part, by three R2R3 genes of the Myb family called RAX genes {REGULATORS OF AXILAR MERISTEMES) that are homologs of the Blind gene of Solanum licopersicon (Müller et al. (2006). homologous R2R3 Myb genes control the pattern of lateral meristem initiation in Arabidopsis. Plant Ce // 18: 586-597).

Other plants such as those belonging to the Solanaceae family, in the case of tomato, have a specific or symposium development, this is the apical meristem ends up forming a flower and the development continues from the lateral meristems (Schmitz, G. & Theres , K. (1999) Genetic control of branching in Arabidopsis and tomato Curr. Opin. Plant Biol, 2: 51-559 In the Solanaceae, the architecture of the inflorescences shows a lot of diversity among the species. In general, the meristem apical forms a terminal flower when the floral transition occurs, from here, tobacco, for example, initiates several symposia branches that they consist of a leaf or bract, a new sypodial meristem and a terminal flower, while in tomato only two sypodial meristems of which the lower form three leaves before blooming are started while the upper one divides successively forming a terminal flower each time and a new symposium meristem. On the other hand, in Petunia only one sympodial branch is initiated, which forms two leaves and a new sympodial meristem (Huber, KA (1980). ). Dissertationes Botanicae 55: 1-252).

The genetic and molecular analysis of the control of the morphology of the inflorescences has revealed some keys that determine its architecture. In Arabidopsis the genes REV, KNAT1 and ERECTA have been characterized that are essential to determine the architecture of the inflorescence (Otsuga et al., (2001). REVOLUTA regulates meristem initiation at lateral positions. Plant Journal 25: 223-236; Douglas et al., (2002). KNAT1 and ERECTA regulate inflorescence architecture in Arabidopsis. Plant CeII 14: 547-558; Venglat et al., (2002). The homeobox gene BREVIPEDICELLUS is a key regulator of inflorescence architecture in Arabidopsis. Proc. Nati Acad. Sci. USA 131: 1491-1591). Also orthologous genes of CLAVATA1 from Arabidopsis have been characterized in rice and corn that contribute to the establishment of the architecture of the inflorescence in said species as well as various genes that affect the vegetative and reproductive branching patterns in Arabidopsis {LAS), tomato {LS and BL), rice {MOC1) or corn {BIF2) (Wang, Y. & Li, J. (2006). Genes controlling plant architecture. Current Opinion in Biotechnology 17: 1-7).

Recently, several genes that control the architecture of the inflorescence in corn have been isolated (Vollbrecht et al., (2005). Architecture of floral branch systems in maize and related grasses. Nature 436: 1119-1126). In crop plants, the architecture of the inflorescence can condition the production of seeds and the adequacy of the harvesting strategy. In corn, the branching pattern of the inflorescence seems to be controlled by the RAMOSA genes (Bortiri et al., (2006). Ramosa2 Encodes to LATERAL ORGAN BOUNDARY domain proteinthat determines the fate of stem cells in branch meristems of maize. Plant CeI1 18 : 574-585). Recently, the RAMOSA 3 gene that codes for the trehalose-6-phosphate phosphatase enzyme and which is expressed in discrete domains near axillary meristems has been characterized. The RAMOSA 3 gene could control the branching pattern of corn inflorescences by modifying a sugar signal that would reach axillary meristems (Satoh-Nagasawa et al., (2006). A trehalose metabolic enzyme controls inflorescence architecture in maize. Nature 441 : 227-230). These hypotheses could constitute scientific bases of future biotechnological applications.

In conclusion, it is known that the three-dimensional structure of plants is regulated at different levels through processes such as phyloxis, apical dominance, determination of meristems and differential growth of stems and lateral organs. Through genetic analysis, regulatory proteins have been identified that control the identity and determination of meristems (Wang & Li, 2006, cited at supra). The involvement of plant hormones in the control of plant architecture has also been described (Kuhlemeier, C. & Reinhardt, D. (2001). Auxin and phyllotaxis. Trends Plant Sci. 6: 187-189; Schmitz & Theres , 1999, cited at supra; Booker et al., (2005). MAX1 encodes a cytochrome P450 family member that acts downstream of MAX3 / 4 to produce a carotenoid-derived branch-inhibiting hormone. Dev. Cell 8: 443-449; Ashikari et al., (2005). Cytokinin oxidase regulates rice grain production. Science 309: 741-745; Ueguchi-Tanaka et al., (2005). GIBBERELLIN INSENSITIVE DWARF1 encodes a soluble receptor for Gibberellin Nature 437: 693-698). However, it is still pending to establish how regulatory proteins and hormones interact to approach the understanding of how growth control at the cellular level leads to the establishment of the architecture of the genetically determined plant (Woodward et al., (2005). Interaction of auxin and ERECTA in elaborating Arabidopsis inflorescence architecture revealed by the activation tagging of a new member of the YUCCA family putative flavin monooxygenases. Plant Physiol. 139: 192-203). Further away is the possibility of using this knowledge to alter the architecture of the inflorescences so that harvest or ornamental plants with improved characteristics can be designed (Wang & Li, 2006, cited at supra).

On the other hand, the availability of genotypes of andro-sterile plants is crucial for obtaining hybrid seeds and opens up the possibility of plant management in a more environmentally friendly way. In some crops, the use of andro-sterile plants would prevent pollen contamination or horizontal gene transfer between compatible species. In previous work, biotechnological tools have been developed for the production of andro-sterile plants of agronomic interest through the use of the promoter region of the pea PsENDI gene (Pisum sativum L.) to direct the expression of cytotoxic agents specifically to the structural tissues of the anthers (WO 01/73088).

The ablation of anthers produced by genetic transformation with cytotoxic genes that are expressed only in the anthers, using specific promoters of some staminal tissue (such as the promoter region of the PsENDI gene mentioned above) has allowed to obtain andro-sterile transgenic plants and transgenic plants with restored androfertility in species of agronomic importance such as Corn, rapeseed or wheat. The genetic ablation is based on the induction of cell death by means of the expression of any enzyme that is capable of destroying the cellular integrity such as proteases, lipases and RNases. The same results can be obtained by expressing substances toxic to cells, for example, peptides that inactivate ribosomes such as the A chain of the toxin (DT-A) of Corynebacterium diphtheria. It is also possible the ablation of complete flowers in transgenic plants in which the gene encoding DT-A is expressed under the control of the promoter of the LEAFY gene (Nilsson, O., et al. (1998). Genetic ablation of flowers in transgenic Arabidopsis Plant J. VoI. 15 (6): 799-804). Methods have been developed that do not destroy tissue directly, but instead give rise to cells susceptible to specific ablative agents. An example of this strategy is the use of "antisense" RNA from a gene that confers tolerance to a herbicide. The effect of the "antisense" RNA is to eliminate the chemical resistance specifically in pollen, so that the application of the herbicide produces its destruction. This method converts a herbicide into a gametocide.

The first ablation strategy designed to produce androsterility was proposed by Mariani in 1990 (Mariani, C, et al. (1990). Induction of male sterility by a chimaeric ribonuclease gene. Nature. VoI. 347: 737-741).

The promoter of the TA29 tobacco gene, specific to tapetum, was used to direct the expression of two RNases (Aspergillus oryzae T1 RNAse and Bacillus amyloliquefaciens barnase) in tobacco and Brassica napus. The obtained andro-sterile transgenic anthers lacked tapetum and their pollen sacs did not produce microspores or pollen grains.

On the other hand, the floriculture industry strives to achieve new and different varieties of ornamental plants with improved characteristics ranging from resistance to pathogens. diseases to the modification of the architecture of the plant, including the floral architecture (altered inflorescences) or modifications in the color and in the number of flowers. The classic improvement techniques are aimed at crossing plants with desirable characteristics to obtain hybrids that incorporate these characteristics, or the use of hormones to alter the phenotype of the plant. However, recombinant DNA technology has become the alternative strategy to classical improvement to develop plants with an altered phenotype and have certain improved characteristics. In patent application WO 02/45486, genetic sequences capable of altering the phenotype of plants are used when said sequences are incorporated into the genome; in US Patent 6,025,544, plants are genetically modified with nucleic acid sequences that code for proteins capable of altering floral behavior; and it is even possible to alter the color of the flowers by introducing DNA sequences that interfere in the route of the floral pigments, as described in the patent application WO 94/28140, or alter the floral architecture of the crop plants to generate more productive transgenic plants (WO 02/079463). All these efforts are directed to the production of transgenic plants that exhibit desirable physical characteristics and appreciated in the floriculture industry that increases the market value of the plants in the ornamental plant industry.

Given the complexity of genetic factors involved in the determination of the three-dimensional structure of the inflorescences, the inventors set out to study the possible effect of blocking normal floral development through the biotechnological ablation of the anthers of the flowers on the branching pattern of the same. SUMMARY OF THE INVENTION

The present invention is aimed at solving the need of the ornamental plants sector to have plants with complex inflorescent architectures that add value due to their attractiveness or the improvement of production costs.

The use of recombinant DNA techniques to obtain transgenic plants with improved desirable characteristics is a resource commonly used in the state of the art and known to the person skilled in the art.

Previous tests carried out by the inventors using gene constructs based on the expression of a cytotoxic gene under the control of a specific anther promoter, such as the promoter of the pea PsENDI gene, or a functional fragment thereof, to obtain andro-sterile plants, They showed that the plants that possessed androsterility had a greater complexity in the three-dimensional structure of the inflorescences. The modification of the architecture of the inflorescences in the transgenic plants seemed to lead to an increase in the production in the number of flowers. To verify that this phenomenon was not a product of chance, we proceeded to transform plants of scientific / agronomic interest, such as Arabidopsis thaliana and Nicotiana tabacum, with a gene construct that contained a cytotoxic gene that produces androsterility. The results obtained with A. thaliana and N. tabacum demonstrated that the gene construction used can be used in obtaining plants with an architecture of their modified inflorescence, so that there is an increase in the complexity of the pattern of branching of plants which in turn leads to an increase in the number of branches. Thus, as shown in the Example that accompanies this description, while the wild plants of A. thaliana cv. Columbia used in the experiments show a branching pattern in which from the main stem branches of the first order are derived and from these branches of the second order are derived both in the armpits of the rosette leaves and in those of the caulinary leaves, In transgenic plants, first, second, third and fourth order ramifications occur, both from the armpits of the rosette leaves and from those of the caulinary leaves, as can be seen schematically in the diagrams of Figures 7A and 7B.

Therefore, in one aspect, the invention relates to a process for the production of transgenic plants with an architecture of its modified inflorescence with respect to that presented by the corresponding wild plant which, among other stages, comprises transforming a susceptible plant cell or tissue if transformed with a gene construct comprising a cytotoxic gene under the control of the promoter of the PsENDI gene, or a fragment thereof capable of specifically regulating the gene expression of said cytotoxic gene in anthers.

In addition to obtaining more colorful plants and with a reduction in the production costs of cut flowers, the transgenic plants obtained by the process of the present invention, being andro-sterile, have the additional advantage that they do not produce horizontal dispersion of genes by not generating neither pollen nor seeds, so that its authorization of use at field level would not be a difficulty.

Therefore, in another aspect, the invention relates to a transgenic plant obtainable by the method described in the present invention that has an architecture of its modified inflorescence compared to that of the corresponding wild plant. In a particular embodiment, said transgenic plant has a complex, different architecture, with greater number of branches and branches of greater order, all of them capable of producing flowers, than the wild plant.

In addition, in another aspect of the invention, a process for producing flowers is described which comprises cultivating a transgenic plant obtained according to the procedure described above under conditions that allow flowering and flower development.

BRIEF DESCRIPTION OF THE FIGURES

Figure 1 shows the schematic representation of the construction pBI-END1 :: barnasa-barstar and the starting construction pBI101-F3. Plasmid PB1101 consists of the constitutive promoter of nopaline synthetase (nos-pro) fused to the nptll gene that confers resistance to kanamycin, the uidA gene that encodes the enzyme D-glucuronidase (GUS) and the polyadenylation signal of the nopaline synthetase gene (nos-ter) at the 3 'ends of both genes. In the construction pBI101-END1 :: barnasa-barstar the uidA gene has been replaced by the fragment that contains the barnasa-barstar genes. The combined use of both genes is done to avoid the cytotoxic action of the barnase gene in the microorganisms used as vectors (Agrobacterium) since in said organisms the expression of the barstar gene (barnase inhibitor) is carried out without difficulty. However, said gene is not expressed in the plant.

Figure 2 shows photographs of wild Arabidopsis thaliana plants (Figure 2A) and transgenic A. thaliana plants obtained according to the procedure described in the present invention (Figure 2B). On the other hand, in the upper right corner of Figure 2C the flowers present in the wild Arabidopsis plants (left flower) and the flowers shown in the transgenic Arabidopsis plants (right flower). In the rest of Figure 2C, two Arabidopsis plants are shown: one transgenic obtained by the method of the invention (right) and another wild (left). The transgenic plants show a greater development than the wild ones, a greater number of branches and a greater number of flowers when compared with the wild ones. The flowers of the wild plants fertilize and produce fruits (silicuas) stopping their growth, while the transgenic ones do not produce fruits and continue to produce flowers. Figures 2D and 2E show the longitudinal dissection of a wildflower and a transgenic flower, respectively. In the wild flower the presence of normal anthers is observed while in the transgenic anthers are undeveloped.

Figure 3 shows transgenic Nicotiana tabacum plants obtained according to the method of the invention and wild N. tabacum plants. Figure 3A shows a wild plant (left) against two transgenic plants according to the method of the invention

(center and right). Figure 3B shows a detail of the branches of a transgenic plant of N. tabacum and Figure 3C shows the corresponding wild plant. The transgenic plants show a greater development than the wild ones, a greater number of branches and a greater number of flowers when compared with the wild ones. In Ia

Figure 3D can be seen how the flowers of wild plants fertilize and produce fruits (capsules) stopping their growth (left), while the transgenic ones do not produce fruits and continue to produce flowers that are senescent on the branches without fertilizing.

Figures 4A and 4B show an anther of a complete N. tabacum wild plant and a cross section of one of its pollen sacs respectively observed by scanning electron microscopy (SEM). You can see how it contains pollen grains in its inside. In Figures 4C and 4D a transgenic anther of N. tabacum is shown showing its collapsed pollen sacs and a cross section of one of them showing that there are no pollen grains inside respectively.

Figure 5 shows the nucleotide sequence of the 5 'region of the PsENDL pea gene. The possible regulatory elements within the sequence are represented in different colors depending on the type of regulatory element.

Figures 6A and 6B show the number of branches produced in wild plants against transgenic plants (A) and the number of flowers produced in wild plants against transgenic plants (B). In both graphs the number 1 corresponds to wild plants and the number 2 to transgenic plants.

Figures 7A and 7B show a representative diagram of the number of branches produced in wild plants (A) and in transgenic plants (B) of A. thaliana.

Figures 8A and 8B show a representative diagram of the number of flowers produced in wild plants (A) and in transgenic plants (B) of A. thaliana.

DETAILED DESCRIPTION OF THE INVENTION

In one aspect, the invention relates to a method for obtaining a transgenic plant with an architecture of its modified inflorescence with respect to that presented by the wild plant (wt), which comprises: (a) transforming a plant cell or tissue capable of being transformed with a gene construct comprising:

(i) a first nucleic acid sequence comprising the nucleotide sequence of the promoter of the PsENDI gene, or a fragment thereof capable of specifically regulating the gene expression of a second nucleic acid sequence in anthers, and

(ii) a second nucleic acid sequence comprising the nucleotide sequence of a cytotoxic gene, or a functional fragment thereof, under the control of said first nucleic acid sequence, to produce a transformed plant cell or tissue,

(b) regenerate said transformed cell or plant tissue in stage (a) to produce a transgenic plant, and (c) select the transgenic plants of stage (b) that exhibit an architecture of its modified inflorescence compared to that presented The corresponding wild plant.

As used in this description, a "transgenic plant with an architecture of its modified inflorescence" with respect to that presented by the wild plant refers to a transgenic plant capable of developing a more complex branching pattern, which produces a greater number of branches and branches of greater order, all of them capable of producing flowers, than the corresponding wild plant (wt) thanks to the incorporation into its genome of the gene construction described in the present invention; in general, said transgenic plant with an architecture of its modified inflorescence has a more complex branching pattern and is the producer of a greater number of branches and Branches of greater order, all of them producing flowers, than the corresponding wild plant. Likewise, said transgenic plant is not only capable of producing a greater number of branches than the corresponding wild plant, but said transgenic plants have an increase in the number of flowers produced and in their half-life with respect to wild plants. While wild plants senesce at three months, transgenic plants have been running for six months. In general, said transgenic plant has a three-dimensional structure that provides a more colorful appearance. In this invention, a plant of interest is genetically manipulated to contain and stably and consistently express a phenotype that is not normally present in wild plants. Said phenotype consists of a greater number of branches and branches of greater order, all of them capable of producing flowers, and of flowers than the wild plant.

Although practically any plant of interest can be genetically manipulated according to the invention to obtain transgenic plants with an architecture of its modified inflorescence with respect to that presented by the wild plant; In a particular embodiment, said plant is an ornamental plant. Illustrative, non-limiting examples of said plants of interest susceptible to being genetically manipulated according to the invention to obtain transgenic plants with an architecture of their inflorescence modified with respect to that presented by the wild plant, include plants belonging to the Aeschynantus genera; Canna; Column; Anemone; Azalea; Begonia; Calceolaria; Camellia; Dianthus; Freessia; Gerbera; Hibiscus; Hypoestes; Kalanchoe; Nicotiana; Pelargonium; Petunia; Príkmula; Rannunculus; Rhipsalidopsis; Pink; Saintpaulia; Sinningia-gloxinia; Streptocarpus; Tigridia; Verbena; and Zinnia. The method of the invention comprises the preparation of a gene construct comprising (i) a first nucleic acid sequence comprising the nucleotide sequence of the promoter of the PsENDI gene, or a fragment thereof capable of specifically regulating the gene expression of a gene. second nucleic acid sequence in anthers, and (ii) a second nucleic acid sequence comprising the nucleotide sequence of a cytotoxic gene, or a functional fragment thereof, under the control of said first nucleic acid sequence.

The promoter of the pea PsENDI gene (Pisum sativum L), hereinafter pEND1, is a promoter capable of directing the specific expression in anther in early stages of plant development as described and evidenced in the WO patent application 07/013088. Indeed, the in situ hybridization assays described in said patent application confirmed the specificity of the expression of the PsENDI gene in the tissues of the pea anther, in particular, in the tissues that make up the pollen sacs of the anthers, during the different stages of its development. Its expression began in very early stages of development (differentiation of common primordia in petals and stamens) and continued until the dehiscence of the anther, expressing itself exclusively in the epidermis, connective tissue, intermediate layer and endothelium. No expression of the gene was detected in the nutritive tissue {tapetum) or in the germinal (pollen). Likewise, the tests carried out with other floral organs, other parts of the plant (stem, leaves, roots, etc.) or with seeds (cotyledons) were negative. Therefore, the use of said promoter allows to produce transgenic plants that specifically express in the anther any gene that is under its control. The complete nucleotide sequence of pEND1 (5 'region of the PsENDI gene) is shown in said patent application WO 01/073088 (SEQ ID NO: 1), as well as in Figure 5 that accompanies this description.

In a particular embodiment, the pEND1 present in the gene construct comprises the nucleotide sequence shown from nucleotide -2,736 to nucleotide -6 of the nucleotide sequence shown in Figure 5, which constitutes the complete sequence of said promoter.

In another particular embodiment, the gene construct used to transform plant cells or tissues comprises a fragment of pEND1 comprising, at least, the nucleotide sequence comprised from nucleotide -366 to nucleotide -6 of the nucleotide sequence shown in Figure. 5. The previously defined pEND1 fragment maintains the regulatory capacity of the specific expression in anther and is capable of directing the specific expression of anther in early stages of plant development.

The pEND1 can be obtained by conventional methods from a pea plant (Pisum sativum L.) or from a host organism transformed with a DNA sequence comprising said promoter, as mentioned in WO 01/073088. Likewise, the fragments of pEND1 that maintain the regulatory capacity of the specific expression in anther can be obtained, based on the information provided, by conventional methods, for example, from the pEND1, making the appropriate deletions. To test if a fragment of pEND1 maintains the regulatory capacity of the specific expression in the anther, the tests described in Example 1 of WO 01/073088 can be performed. The gene construct used to transform plant cells or tissues comprises, in addition to pEND1 or a functional fragment thereof, that is, capable of regulating the specific expression in anther, a cytotoxic gene, operably linked to said promoter or functional fragment thereof.

As used in this description, the term "cytotoxic gene" includes any gene that encodes a protein or enzymatic activity that causes cell death in the tissue where it is expressed, for example, a gene that encodes a protein or enzymatic activity that causes the ablation of the anther.

Various plants that produce cell death have been used in plants, for example, Ia diphtheria toxin A (DTA) produced naturally by Corynebacterium diphteriae, Pseudomonas aeruginosa exotoxin A, Aspergillus oryzae ribonuclease T, Bacillus amyloliquefaciens barnase, etc. The genes encoding said proteins can be used as cytotoxic genes in the gene construction described herein for the implementation of the present invention.

However, in a particular embodiment, said cytotoxic gene that is expressed in anther because it is under the control of pEND1 is the barnase gene, a Bacillus amyloliquefaciens ribonuclease [Mariani et al., (1990), cited at supra ] that causes the complete ablation of the anther, from very early stages of its development, preventing the formation of pollen therein, thus giving rise to an andro-sterile plant. Additional examples of cytotoxic genes are cited in European patent application EP 412006 as well as in patent application WO 01/073088, the contents of which are incorporated by reference to the present description. The gene construct used to transform plant cells or tissues by the process of the invention can be obtained by conventional methods using widely known techniques [Sambrook, J., et al, 2001. Molecular cloning:.. A Laboratory Manual, ^3rd ed, Coid Spring Harbor Laboratory Press, NY, VoI. 1-3]. Said gene construct may also contain, operatively linked, regulatory elements of the expression, for example, sequences of termination of transcription, enhancer sequences of transcription and / or translation, etc.

The gene construct used to transform plant cells or tissues according to the method of the invention can be inserted into the genome of a plant cell or tissue by any appropriate method to obtain transformed plant cells and tissues. Such methods may involve, for example, the use of liposomes, electroporation, diffusion, particle bombardment, microinjection, gene bullets ("gene gun"), chemical compounds that increase free DNA uptake, for example, coprecipitation with calcium phosphate, viral vectors, etc. Appropriate vectors for plant transformation include those derived from the Ti plasmid of Agrobacteríum tumefaciens, such as those described in EP 120516. In addition, from the transformation vectors derived from the Ti or Ri plasmids of Agrobacteríum, alternative methods can be used to insert Ia gene construction in plant cells and tissues. In a particular embodiment, said gene construct is introduced, by means of the vacuum infiltration protocol.

The gene construction described herein can be used to transform any cell or plant tissue that can be transformed. In a particular embodiment, said cell or plant tissue belongs to an ornamental type plant. As used herein, the term "ornamental plant" includes any plant grown for its generally aesthetic value. Between such aesthetic values include visually appealing characters such as colorful, colorful or scented flowers or inflorescences. Illustrative, non-limiting examples of such ornamental plants include plants belonging to the Aeschynantus genera; Canna; Column; Anemone; Azalea; Begonia; Calceolaria; Camellia; Dianthus; Freessia; Gerbera; Hibiscus; Hypoestes; Kalanchoe; Nicotiana; Pelargonium; Petunia; Príkmula; Rannunculus; Rhipsalidopsis; Pink; Saintpaulia; Sinningia-gloxinia; Streptocarpus; Tigridia; Verbena; and Zinnia. In accordance with the present invention it is possible to obtain transgenic plants with improved ornamental value, which have a greater number of branches and branches of greater order, all those branches having the ability to produce flowers, regardless of their number.

The gene construct can be incorporated into a vector that includes a prokaryotic replicon, that is, a DNA sequence capable of directing the autonomous replication and maintaining the extrachromosomally recombinant DNA molecule when introduced into a prokaryotic host cell, such as a bacterium. Said replicons are known in the art. In a preferred embodiment, said prokaryotic replicon also includes a gene whose expression confers a selective advantage, such as resistance to a drug (drug), to the transformed host cell. Illustrative examples of bacterial genes that confer resistance to drugs include those that confer resistance to ampicillin, tetracycline, etc. The neomycin phosphotransferase gene has the advantage that it is expressed in both eukaryotic and prokaryotic cells. The vectors that include a prokaryotic replicon also include, in general, restriction sites for the insertion of the gene construct used for the implementation of the process of the invention. These vectors are known (US 6,268,552). Among the expression vectors capable of expressing a recombinant DNA sequence in plant cells and capable of directing the stable integration into the genome of the host plant cell are vectors derived from the Ti plasmid of A. tumefaciens and several other known expression systems operating in plants (see, for example, WO 87/00551).

The method of the invention to obtain transgenic plants with an architecture of its modified inflorescence with respect to that presented by the corresponding wild plant comprises the introduction, in a cell or in a tissue of a plant, of the gene construction previously defined to produce a cell or a transformed plant tissue and generating a transgenic plant with an architecture of its modified inflorescence compared to that presented by the wild plant by regeneration of said cell or transformed plant tissue, wherein said transgenic plant with a modified inflorescence architecture with respect to The one that presents the wild plant produces a greater number of branches and branches of greater order, all of them producing flowers, than the corresponding wild plant as well as a greater number of flowers than the wild plant when grown under conditions that allow flowering and development. from the flowers. The transgenic plant with an architecture of its modified inflorescence thus obtained has a more complex branching pattern and is not only capable of producing greater number of branches than the corresponding wild plant, but also that these branches are capable of producing flowers and the plant It has a half-life superior to that of wild plants.

The introduction of said gene construction to transform plant material and generate a transgenic plant can be carried out, as previously mentioned, by any means known in the state of the art, including, but not limited to, the transfer of DNA. mediated by A. tumefaciens, preferably with an unarmed T-DNA vector, electroporation, direct DNA transfer, particle bombardment, etc.

The techniques to cultivate the transformed plant cells and tissues and regenerate the transgenic plants with an architecture of their modified inflorescence with respect to that presented by the wild plant are well known in the state of the art as well as the conditions of cultivation and growth of said transgenic plants in order to produce a greater number of flowers.

Also, the systems and agents for introducing and selecting markers to check the presence of heterologous DNA in cells and / or plant tissues are well known. Among the genetic markers that allow the selection of heterologous DNA in plant cells are genes that confer antibiotic resistance, for example, kanamycin, hygromycin, gentamicin, etc. The marker allows the selection of successfully transformed plants that grow in a medium containing the corresponding antibiotic because they carry the appropriate resistance gene.

Many of the techniques useful for carrying out the invention are conventional and known to plant biotechnology technicians. By way of illustration, such conventional techniques are collected in Sambrook et al. (2001) [cited at supra] and Maniatis, T., et al., (1982). Molecular cloning: a laboratory manual. CoId Spring Harbor Laboratory Press, CoId Spring Harbor, NY.

The present invention allows flowers to be obtained without having to apply hormones (gibberellins, auxins, cytokinins, etc.) or agrochemicals. On the other hand, an added advantage of the procedure of Ia The invention is that it allows to obtain not only more showy plants but also to increase the production of cut flowers, with which a reduction in production costs is achieved. Likewise, the transgenic plants thus obtained have a longer half-life of several months compared to wild plants.

The process provided by this invention supposes the additional possibility that the plants thus obtained have dominant androsterility. One of the advantages of the process provided by this invention is that it offers the possibility of having andro-sterile flower-producing plants, with a greater number of branches and branches of greater order, all capable of producing flowers, than the wild plant, with the that the unwanted horizontal transfer of genes is avoided by not producing pollen or seeds, which is especially relevant in their authorization of use at the field level, since the horizontal transfer of genes is one of the major concerns of environmental groups and part of the citizens that today oppose the cultivation of transgenic plants. On the other hand, the availability of andro-sterile plant genotypes may be relevant to avoid pollen contamination in urban areas or decrease the production of pollen allergens.

EXAMPLE

Obtaining plants of A. thaliana v N. tabacum with an architecture of its modified inflorescence with respect to the wild species by means of the specific ablation of anthers with the barnase gene controlled by the promoter of the pea PsENDI gene I. MATERIALS AND METHODS

1. Cultivation of plants in a chamber and greenhouse

The plant species used in the example of the present invention are shown in Table 1.

Table 1. Plants used in this invention and their use

Plant Variety / ecotype Use

Arabidopsis thaliana Columbia (Col)

Expression of the Nicotiana tabacum cv. Petite Havana SR1 END1 :: barnasa

Samples of the plant tissues used in the present invention for the extraction of nucleic acids were collected directly from the plant, frozen in liquid nitrogen and stored at -8O ⁰ C until later use. Samples destined for microscopy studies were fixed for further processing.

1.1 Cultivation of A. thaliana

1.1.1 Cultivation in alveoli and pots

Arabidopsis plants were grown in phytotrons under controlled photoperiod and temperature growth conditions. The temperature was 21 ⁰ C and the illumination came from cold white fluorescent tubes with an intensity of 150 μE m ^"2 s ^{" 2} (Sylvania Standard F58W / 133-T8). The plants were grown under conditions of inductive photoperiod, which were 16 hours of light and 8 hours of darkness (long day, DL) and non-inductive photoperiod that were 8 hours of light and 16 hours of darkness (short day, DC).

The seeds were sown in alveoli or in pots depending on the subsequent use of the plants generated. The seeds were sown in 6.5 * 6.5 * 5 cm plastic cells for long-day or short-day crops in a mixture of peat: perlite: vermiculite (1: 1: 1). They were placed in trays inside culture chambers and irrigated with immersion with Hoagland solution number 1 supplemented with trace elements. After planting, the trays were covered with plastic to maintain moisture and avoid contamination with other seeds from nearby plants. They were kept in darkness at 4 ⁰ C for 3 days in order to synchronize the germination and after those days they were transferred to cabins.

When the first pair of sheets appeared approximately or see condensation in the plastic that covered them, it was drilled in different points of the tray that were increasing until the plastic was completely removed after three days.

Planting in pots was carried out in plastic pots of 11 cm in diameter, for DL or DC cultures and the same process was performed as for planting in alveoli.

For the evaluation of the number of flowers produced in relation to those produced by an unprocessed plant A total of 78 Arabidopsis thaliana seeds were sown; 18 of which belonged to the wild Columbia ecotype and the remaining 60 were seeds resulting from the crossing of independent END1 r.barnasa lines with wild genotype plants.

The seeds were sown in 6.5 x 6.5 x 5 cm plastic cells in a mixture of peat: perlite: vermiculite (1: 1: 1). They were placed in trays in culture chambers and irrigated by immersion in a Hoagland solution number 1 supplemented with trace elements (Hewitt,

YM 1966. Sand and water culture methods used in the study of plant nutrition. Farnham Royal, Bucks. Commonwealth Agricultural Bureaux.). After planting, the trays were covered with plastic to maintain moisture. They were kept in darkness at 4 ⁰ C for 72 hours in order to synchronize the germination and after those days they were transferred to cabins. When the first pair of sheets appeared, the plastic covering the trays was bored and ended up being completely removed after three days. Arabidopsis plants were grown in phytotrons under controlled photoperiod and temperature growth conditions. The temperature was 21 ⁰ C and the illumination came from cold white light fluorescent tubes with an intensity of 150 μE m ^"2 s ^{" 2} . The plants were grown under inductive photoperiod conditions, which were 16 hours of light and 8 hours of darkness (long day, DL).

1.1.2 Petri dish cultivation

The in vitro cultivation of Arabidopsis in Petri dishes, was conducted in cabins with a constant temperature of 25 ⁰ C under long day (LD). The light was supplied by Grolux 36 W (Sylvania) fluorescent tubes with an intensity of 90 μE m ^"2 s ^{" 2} .

The seeds were sterilized by immersion for 3 minutes in a 70% (v / v) ethanol solution and 0.005% Triton X-100. During this time, the seeds were mixed with the previous solution by moving the tube containing them. Subsequently, the solution was removed and 96% ethanol was added with stirring for 1 minute. Immediately afterwards the seeds with the ethanol were placed on sterile filter paper until they dried. For the selection of primary transformants, the sterilized seeds (approximately 30 mg of seeds) were uniformly distributed in 15 cm diameter Petri dishes containing selection medium with kanamycin [2.2 g / l of MS salts (Murashige culture medium) and Skoog) (Duchefa), 20 g / l sucrose, 0.1 g / l MONTH (morpholinoethane sulfonic acid) pH 5.9, 0.6% agar (Pronadisa), 50 mg / l kanamycin, 300 mg / l timentin ]. The boxes with the seeds were stored for three days at 4 ⁰ C in the dark after which they were moved to an in vitro culture cabin. After 7-10 days of planting the transformants that were distinguished by their green and elongated root, they were transplanted with the help of tweezers to plastic cells.

1.2 Cultivation of N. tabacum 1.2.1 Cultivation in pots

Tobacco plants from in vitro culture were individually grown in 13 cm diameter plastic pots containing a previously sterilized peat mix: vermiculite (1: 1), in a greenhouse cabin under controlled conditions and with a temperature of 24 ⁰ C during the day and 18 ⁰ C during the night. Natural light is supplemented with artificial light using 400 W mercury vapor lamps [Phillips HDK / 400 HPI ®, N], to maintain a long day photoperiod. Irrigation consisted of Hoagland solution number 1 provided by an automated drip irrigation system for 2 minutes, 4 times a day

1.2.2 Petri dish cultivation

The in vitro culture of snuff was performed in booths with constant temperature of 25 ⁰ C under photoperiod conditions long (16 hours light and 8 hours dark) day, with a light intensity of 90 μE m ^{"2 s" 2} supplied by fluorescent tubes of light type Grolux 36W (Sylvania).

Kanamycin-resistant plants (primary transformants, T1) whose cultivation had begun in Petri dishes, were subsequently transplanted into plastic alveoli of 6.5 x 6.5 x 5 cm with a mixture of peat: vermiculite (1: 1) . These crops remained covered with a transparent plastic, in which holes were gradually made in order to avoid excessive water condensation for 9 days. After the acclimatization period, the seedlings were transplanted into individual pots, where they were grown in greenhouse cabins under controlled temperature and photoperiod conditions. 2. Cultivation of microorganisms

The microorganisms used in the example of the present invention are shown in Table 2.

Table 2. Bacterial strains used in the present invention

Strain Reference / origin Use

DH5α (E.coli) Hanahan (1983) Transformation of bacteria

C58 pMP90 (A. Koncz and Schell (1986) Transformation of tumefaciens plants) LBA4404 (A. Hoekema et a / (1983). Transformation of tumefaciens plants)

- Hananhan, D. (1983). Studies of transformation of Escherichia coli. J. Mol. Biol. VoI. 166: 557-560. - Koncz, C, Schell, J. (1986). The promoter of TL-DNA gene 5 controls tissue-specific expression of chimeric genes carried by a novel type of Agrobacterium binary vector. Mol. Gen. Genet. VoI 204: 383-396.

- Hoekema, A., et al., (1993). A binary plant vector strategy based on separation of vir and T region I heard Agrobacterium tumefaciens Ti-plasmid. Nature VoI 303: 179-180.

2.1 Cultivation conditions of microorganisms

Liquid cultures of bacteria E. coli and A. tumefaciens incubated place overnight at 37 ⁰ C and 28 ⁰ C respectively with stirring of 200 rpm. Cultures of E. coli and A. tumefaciens in boxes with solid medium were incubated place overnight in an oven at 37 ⁰ C and three days at 28 ⁰ C respectively.

2.2 Microorganism culture medium

The medium used for the growth of microorganisms was: - LB medium (Luria-Bertani medium): 1% tryptone, 0.5% yeast extract, 1% NaCI, pH 7.0. When the solid medium was used, it was solidified by the addition of 1.5% agar (Pronadisa).

3. Nucleic acid manipulation 3.1 Cloning

Cloning was done in different plasmids depending on the origin of the DNA fragments and the required purposes.

1. The PCR products (polymerase chain reaction) were cloned into the plasmid pGEM-T Easy (Promega), which contains a specific cloning site for PCR products with a free adenine at the 3 'ends.

2. Plasmid pBI101 [Vancanneyt, G., et al., (1990). Construction of an intron-containing marker gene: splicing of the intron in transgenic plants and its use in monitoring early events in Agrobacterium-mediated plant transformation. Mol. Gen. Genet. VoI 220 (2): 245-50] was used to obtain transgenic Arabidopsis and tobacco plants through the transformation with Agrobacteríum tumefaciens. This plasmid contains the nptll gene that offers resistance to kanamycin and the β-glucuronidase gene that allowed to perform histochemical analysis of the transformed plants. Plasmid pBI101 was used to carry out the expression of the END1 :: barnase transgene in the two plants mentioned. 4. Enzymatic reactions

4.1 Ligation reactions

Ligation reactions were performed maintaining a molar ratio between vector and insert of 1: 2 in the case of plasmid pGEM-T Easy (Promega) and 1: 5 in the case of vector pBI101. The final volume of the reactions was 10 or 20 μl. This volume included the vector / insert volume, 1 unit of phage T4 ligase DNA (Roche Molecular

Biochemicals) and ligation buffer (5 mM MgC ^ 1 mM DTT, 1 mM ATP, 66 mM Tris-HCI pH 7.5). The ligation reactions were carried out at 4 ⁰ C overnight in the case of using the plasmid pGEM-T Easy and at 16 ⁰ C overnight in the case of using pBI101.

4.2 Digestion with restriction enzymes

The buffer and the conditions recommended by the different commercial houses were used for each restriction enzyme. Digestions were carried out in 1.5 ml tubes with 5-10 u / μg DNA, for at least 3 hours at the optimum temperature for each enzyme.

4.3 Dephosphorylation of cohesive ends (5 'protuberant) Dephosphorylation reactions were performed with alkaline phosphatase from calf intestine (CIP, Boehringer Mannheim). The reactions were carried out by mixing 5 μg of linearized plasmid vector, 10 μl of 10x buffer (0.5 M Tris-HCI, 1 mM EDTA, pH 8.5), CIP 0.5 u / μg DNA and H2O until complete a volume of 100 μl. The mixture was incubated 30 minutes at 37 ⁰ C, adding again 0.5 u / ug DNA CIP after that time and incubating again for 30 minutes at 37 ⁰ C. The reaction was stopped with 2 ul of 0.5M EDTA per 100 μl total reaction volume, heating 20 min at 7O ⁰ C. The solution was extracted twice with phenol / chloroform, precipitated with 1/10 v sodium acetate (NaOAc) 3 M pH 5.2, 2.5 v absolute ethanol (EtOH) and 1 μl of glycogen (Boehringer Mannheim) and the DNA precipitate was resuspended in a suitable volume (about 15 μl) and quantified by agarose gel electrophoresis.

4.4 DNA amplification by polymerase chain reaction (PCR)

The polymerase chain reaction (PCR) was used to amplify DNA fragments that will later be linked to the plasmid vectors.

Plasmid DNA amplification reactions were carried out in a total volume of 50 μl, from 10-50 ng of template DNA, 1 μM of specific primers of the fragment to be amplified or of the plasmid where it was cloned, dN ₄ TPs 200 μM, 50 mM KCI, MgCb

1.5 mM, 10 mM Tris-HCI pH 8.3 and 2.5 units of Thermus aquaticus polymerase (Taq polymerase, Roche Molecular Biochemicals).

For the amplification of the fragment containing the barnase and barstar genes inserted in the genome of transgenic plants, the PCR reaction was carried out using the Ribo 1 and Inhi 2 primers (Table 3). These reactions were carried out in a total volume of 20 μl, from 50-100 ng of genomic DNA, 0.6 μM of specific primers, dN ₄ TPs 200 μM, 50 mM KCI, 1.5 mM MgCl ₂ , 10 mM Tris-HCI pH 8.3, 2.5 units of Thermus aquaticus polymerase (Taq polymerase, Roche Molecular Biochemicals). The reactions were run in a Perkin Elmer 2400 at the following conditions: 1 cycle at 94 ⁰ C 2 minutes; 30 cycles of 94 ⁰ C 30 s; banding temperature (T) in degrees Celsius for 30 s; 72 ⁰ CT _ex t minutes, and 1 final cycle at 72 ⁰ C for 10 minutes. In each reaction, the banding temperature was estimated as a function of the temperature Tm (estimated melting temperature) of the primers used (Table 3); the extension time used It depended on the length of the fragment to be amplified; In general, 1 minute was used for each kb of expected product.

Table 3. Primers used in PCR amplifications and sequencing reactions carried out in this work.

Primer Sequence (5 '-> 3') [SEQ ID NO] Template DNA Position

Ribo 1 TA GGA TCCCGACC ATGGC AC AGGTT ATC [21 Bamasa fragment - barstar - \ 2 → 15

Inhi 2 GCGΛGCrcTTAAGAAAGTTGATGGTGATG [3] Barnase fragment - barstar 876 → 847

T7 GTAATACGACTCACTATAGGGC [4] pGEM- T Easy (Promega) 3016 → 2099

SP6 GATTTAGGTGACACTATAGAATAC [S] pGEM- T Easy (Promega) 158 → 136

The italicized sequences correspond to the nucleotides that are not part of the template DNA, and of them, the underlined ones, correspond to the restriction targets introduced to subclone the cDNAs in the corresponding plasmids.

4.5 Purification of DNA fragments from agarose gels

After separating the DNA samples by electrophoresis in agarose / TBE gels (Tris-Borate: 0.045 M tris-borate; EDTA (disodium salt of ethylene diamine tetraacetic acid) 1 mM) the bands of interest were cut from the gel with a knife and The DNA contained therein was purified using the QIAquick GeI Extraction Kit (Qiagen) system, following the manufacturer's recommendations. The extraction and purification of the DNA fragments by this method is based on the solubilization of the agarose and the selective adsorption of the nucleic acids on a silica gel membrane, in the presence of a high salt concentration. DNA elution was carried out in 10 mM Tris-HCI pH 8. 4.6 Sequencing

The sequencing of cloned DNA fragments was carried out according to the enzyme sequencing protocol developed by Sanger et al., (Sanger, F., Nicklen, S., Coulso, AR 1977. DNA sequencing with chain termination inhibitors. PNAS. USA 74, 5463-5467) automatically in a sequencer "ABI PRISM 377" (Perkin Elmer). For this, the DNA extracted according to the protocol of isolation and purification of plasmid DNA from the QIAGEN-tiplOO system described in section 5.1 was brought to a concentration of 0.2 μg / μl, and amplified with Ampli Taq DNA polymerase in the presence of ddNTPs, each marked with a different fluorophore (Perkin Elmer). The primers of the plasmid vector pGEM-T Easy, T7 and SP6 were used.

5. Isolation and purification of nucleic acids

5.1 Isolation of plasmid DNA in Escherichia coli

For the small-scale plasmid DNA preparations, the alkaline lysis method was used as described in Sambrook, J., et al., (1989) [cited at supra], starting from a 3 ml culture grown during a night in liquid medium LB supplemented with the corresponding antibiotic. Medium or large-scale plasmid DNA preparations were made from cultures, grown overnight in 100 ml or 500 ml of liquid medium LB supplemented with antibiotic, according to the method of extraction and purification of plasmid DNA from the systems of Qiagen Plasmid Midi Kit (Qiagen tip-100 columns) and Qiagen Plasmid Maxi Kit (Qiagen tip-500 columns), respectively, following the manufacturer's instructions.

5.2 Isolation of Agrobacterium tumefaciens plasmid DNA For the small-scale preparations of Agrobacterium plasmid DNA, the alkaline lysis method described by Sambrook, J., et al., (1989) [cited at supra] with slight modifications. It was based on a 3 ml culture, grown overnight in LB liquid medium supplemented with 50 μg / μl kanamycin. After centrifuging the culture, the cell pellet was resuspended in 100 μl of solution I (50 mM glucose; 50 mM Tris-HCI (pH 8.0); 10 mM EDTA) after which 200 Dl of Il solution (NaOH) was added 0.2 N, 1% SDS) and mixed by quickly inverting the tube. Subsequently, solution III (60 ml of 5 M KAc; 11.5 ml of glacial acetic acid; 28.5 ml of water) was added and mixed using the vortex. After 5 minutes on ice, the sample was centrifuged at 12,000 rpm for 5 minutes at 4 ⁰ C. To the supernatant resulting from the centrifugation 900 Dl of absolute ethanol was added and incubated 30 minutes at -8O ⁰ C. After centrifuging at 12,000 rpm, 5 minutes at room temperature, the precipitate was washed with 70% ethanol, dried and resuspended in 25 μl of TE (10 mM Tris-HCI pH 8, 1 mM EDTA).

The purity of the DNA preparation obtained by this procedure was not high enough to perform a restriction analysis of the plasmid. To solve this problem, a 1 μl aliquot of this DNA preparation was used to transform E. coli. From one of the transforming clones of E. coli thus obtained, a new plasmid DNA preparation was made which was used in the relevant analyzes.

6. Transformation of bacteria The strains that were used in the transformations were the DH5α of Escherichia coli and the Agrobacterium tumefaciens C58 pMP90 (Koncz and Schell, 1986) and LBA4404 (Hoekma et al., 1983) [both cited at supra] strains. 6.1 Preparation of competent cells and transformation by electroporation

The preparation of competent cells for transformation by electroporation was carried out according to the protocols described in the Pulse controller, Accessory for bacterial and fungal electro-transformation (BioRad) catalog, in the case of E. coli, and according to Wen-jun, S ., and Forde, BG, (1989). Efficient transformation of Agrobacterium spp. By high voltage electroporation. Nucleic Acid Res. VoI. 17: 4415, in the case of A. tumefaciens.

After thawing an aliquot of 40 μl of competent cells prepared by successive glycerol washes on ice, 1 μl of transformant vector was added. The mixture was placed in a 0.1 cm electrode separation cuvette (BioRad), previously cooled in ice, and subjected to an electric pulse with a Gene Pulser ™ apparatus (BioRad). The electroporation conditions were 200 Ω, 25 μF and 1, 8 kV, for E. coli, and 400 Ω, 25 μF and 1, 8 kV, for A. tumefaciens. After the electric pulse was added 1 ml of LB and incubated 1 hour at 37 ⁰ C and 200 rpm for E. coli, and 3 hours at 28 ⁰ C and 200 rpm for A. tumefaciens.

6.2 Selection of bacterial recombinants

The selection of bacterial recombinants was carried out by sowing the bacterial cells transformed into plates with LB medium supplemented with the antibiotic to which the plasmid under study conferred resistance, and in the event that the plasmid allowed the selection by color, added 40 μl (25 mg / ml) of IPTG and 25 μl (20 mg / ml) of X-GaI to the solid culture medium.

The antibiotics used for the selection of bacterial recombinants and the concentration at which they were used appear in Table 4. Table 4. Antibiotics used and their concentrations

Antibiotic Concentration

Ampicillin 100 μg / μl for E. coli.

Kanamycin 25 μg / μl for E. coli.

50 μg / μl for A. tumefaciens.

7. Design of the construction pBI-END1 :: barnasa-barstar

To test whether the expression of the cytotoxic barnase gene in those tissues of the anther where END1 is active, was capable of producing androsterility in transgenic Arabidopsis and tobacco plants, the construction pBI-END1 :: barnasa-barstar was performed.

For this, the pBI101-F3 construction [described in patent application WO 01/73088] (Figure 1) was started. This construction contained 2,731 bp of the promoter region of the PsENDI gene isolated from the screening of a genomic pea library. The region comprised from fragment -2,736 to nucleotide -6 of the 5 'region, the first nucleotide of the previously isolated cDNA (clone 162) from a pea flower cDNA library [Gómez, MD, et. al., (2004). The pea END1 promoter drives anther-specific gene expression in different plant species. VoI plant. 219: 967-981]. The -2,736A6 fragment of the promoter region of the PsENDI gene was fused to the uidA gene encoding the enzyme β-glucuronidase (GUS), (Gómez et al., 2004) [cited at supra]. This gene was released with the restriction enzymes BamHI and Sacl and the fragment corresponding to plasmid pBI101 plus the promoter of the PsENDI gene was extracted from the agarose gel.

The barnasa-barstar fragment previously cloned into the BamHI site of plasmid pBluescript KS (+) (Stratagene), was amplified using the primers Ribo 1 and Inhi 2 [Table 3]. With the first one, the cutting site for the BamHI enzyme of the original clone at the ATG level of barnase is maintained, and with the latter a cutting site for Sacl is created at the level of the stop codon of the barstar gene. The fragment product of the PCR reaction was ligated to the pGEM-T Easy vector (Promega), and subsequently released with the enzymes BamHI and Sacl. This insert was cloned into the site created by these same enzymes in the pBI-END1 construct, thus creating the pBI-END1 :: barnasa-barstar construct (Figure 1).

8. Transformation and analysis of transgenic plants

8.1 Transformation of Arabidopsis thaliana and analysis of transgenic plants

For the transformation of transgenic plants of Arabidopsis thaliana, the wild plant of the ecotype Columbia (Col) has been used. The transformation was performed following the vacuum infiltration protocol described by Bechtold (Bechtold, N., et al., (1993). In Agrobacterium-mediated gene transfer by infiltration of adult Arabidopsis thaliana plants. CR Acad. Sci. Paris, Life Sci. VoI. 316: 1194-1199). Approximately 60 Arabidopsis seeds were grown in 11 cm diameter pots. After about 2 weeks from planting, some plants were removed in order to facilitate the homogeneous and adequate growth of the population. Once the plants had produced the floral escape, when the last caulinar leaf had separated about 2-3 cm from the apex of the main inflorescence (plant height 9 to 11 cm), it was decapitated to eliminate the apical dominance and thus induce the proliferation of lateral inflorescences. The approximate time that elapsed from planting to decapitation was approximately one month and 5-6 days. Once decapitated, the plants were grown about 4 more days before infiltration. Three days before the infiltration (day -3), a tube was inoculated with 10 ml of LB medium, containing 100 μg / ml of rifampicin and 50 μg / ml of kanamycin, from a glycerinated with strain C58 pMP90 of A tumefaciens (Koncz and Schell, 1986) [cited at supra] carrier of the constructions of interest. This was incubated place overnight in the dark at 28 ⁰ C with agitation of 200 rpm. After this time (day -2), a flask was inoculated with 600 ml of LB medium with kanamycin (50 μg / ml) with 10 ml of the previous preculture and incubated under the same conditions for 48 hours. On the day of the infiltration (day 0) the culture was collected by centrifugation and the sediment with the bacteria was resuspended in 200 ml of infiltration medium (2.2 g / l MS salts (Duchefa), 5% sucrose, 1 mg / l 6-BAP (cytokine 6 benzyl amino purine), 100 mg / l MONTH, pH 5.9). Before infiltration, all fertilized silicones were removed from the plants as well as the open flowers. For vacuum infiltration, the pots were inverted and placed in a lunch box containing 200 ml of the Agrobacterium suspension in the middle of infiltration, so that not only the floral apexes but also the rosette leaves were submerged in the liquid . The assembly was placed in a vacuum hood connected to a pump (EDWARDS RV3 pump, 110-120 / 220-240V, 50-60 Hz, single phase A652-01-903) and subjected to vacuum for 30 minutes in the high position vacuum and flow under "position I" (final total pressure: 3 x 10 ^{~ 2} mbar, 3 Pa). The time began to count when the suspension of Agrobacteríum began to bubble. After the infiltration time, the plants were removed from the hood and dried slightly, draining them on a piece of absorbent paper. The plants treated in this way were covered with plastic bags and returned to the cultivation booths where they were allowed to continue growing under the conditions described in section 1.1. During the 2-3 days following the infiltration holes were made in the bags, in order to acclimatize the plants to the usual humidity conditions, until these were definitively eliminated. The plants were grown to obtain mature seeds.

Alternatively to the transformation of Arabidopsis thaliana plants with the method of Bechtold et al., (1993) [cited at supra], on some occasions a modified version of this method was used based on the use of Silwet L.77 detergent (LEHLE SEEDS). At the time of the infiltration, the plants are kept submerged for 8 s in the Agrobacterium suspension in the middle of infiltration to which said detergent had been added to a final concentration of 0.05%; immediately after, they were subjected to a 1 minute vacuum pulse using the same conditions as the previous procedure. The treatment of the plants before and after the infiltration, as well as the preparation of the Agrobacterium cultures, were the same as the treatment described in the previous procedure.

When the siliques of transformed plants were mature seeds were collected, stored in cellophane bags and incubated in an oven at 37 ⁰ C for at least a week. For the selection of the primary transformants (Ti), the seeds from individual Ti plants were sterilized, planted in 15 cm diameter Petri dishes with kanamycin selection medium and grown in in vitro culture cabins. After 7-10 days from planting, the transformants were clearly identifiable by their green color and their developed roots; at that time they were transplanted into alveoli (6.5 X 6.5 x 5 cm) with a peat mixture: vermiculite: perlite (1: 1: 1) and transferred to a phytotron for cultivation under the conditions described in the section 1.1.

The phenotype of the population corresponding to the first (Ti) and second generation (T ₂ ) of plants transformed with the construction was analyzed pBI-END1 :: barnasa-barstar. The plants were photographed with a Nikon F-601 M camera, coupled to an MZ8 (Leica) magnifying glass. The anthers of the END1 :: barnasa plants were fixed and observed by SEM (scanning electron microscopy) and optical microscopy. For the phenotypic analysis of said END1 :: barnasa plants of the T ₂ generation, a segregation analysis of the andro-sterile phenotype was performed to determine the index of the transgene segregation for 4 independent transgenic lines based on the proportion of sterile plants versus fertile plants obtained. For this, the seeds coming from the crossing of independent Ti lines with wild plants were sown in individual alveoli for each one. The phenotype of the resulting plants was observed in terms of morphology of the anthers and fruit formation to quantify the percentage of sterility of the germinated plants.

8.2. Nicotiana tabacum transformation and phenotypic analysis of transformed plants

The transformation of Nicotiana tabacum plants was carried out following the method described by Horsh, R. B., et al., (1984). Inheritance of functional foreign genes in plants. Science VoI 223: 496-498, with the modifications proposed by Fisher and Guiltinan (1995) [Fisher, D. K., Guiltinan, J., (1995). Rapid, efficient production of homocygous transgenic tobaceous plants with Agrobacterium tumefaciens: a seed to seed protocol. Plant Mol. Biol. Rep. VoI. 13: 278-289].

A tube was inoculated with 5 ml of LB medium, 10 mM MgSO ₄ , 100 μg / ml rifampin and 50 μg / ml kanamycin from a glycerinated with the strain LBA4404 of A. tumefaciens carrying the construction of interest. This place overnight incubated in the dark at 28 ⁰ C with agitation of 200 rpm. After this time, 500 μl aliquots of that culture were used to inoculate two 250 ml flasks with 50 ml of LB medium, 10 mM MgSO ₄ and 50 μg / ml kanamycin that were incubated under the same conditions until that the DOβoo reached a value between 0.5-0.6. The resulting culture was collected by centrifugation and the sediment with the bacteria was resuspended in half the volume of liquid MSS medium [4.4 g / l MS salts (Duchefa), 2% sucrose, 100 mg / l MONTH, pH 5, 9].

Leaf sections of Nicotiana tabacum cv. Petite Havana SR1 of 1 cm ² , from young plants (approximately 4 weeks) propagated in solid MSS medium from internodes, were immersed in the Agrobacterium suspension, arranged in a 9 cm diameter Petri dish for 10 minutes. Then leaf discs were removed from the suspension of Agrobacterium, drained, placed abaxial side up on solid medium MSS (3.5g / l phytagel) and cocultured for three days at 25 ⁰ C in darkness for Facilitate Agrobacterium infection. After coculturing the infected leaf disks were transferred to boxes with MSSABCK regeneration and selection medium [MSS medium with 0.2 mg / l IAA (indole acetic acid), 2.2 mg / l 6-BAP, 400 mg / l carbenicillin (to inhibit the growth of Agrobacterium) and 130 mg / l kanamycin (to select the growth of cells that would have incorporated T-DNA)].

The plates with the explants were incubated in booths in vitro culture at 25 ⁰ C, under conditions of long - day photoperiod (I see 1.2.2.), And every 7-10 days were changed to new boxes with the same medium. The regenerated shoots (one of each explant, to ensure that independent transformation events were selected) that were appearing were cut avoiding the callus and transferred to bottles 6 cm in diameter by 9.5 cm high with rooting medium MSSACK ( solid MSS medium with 0.2 mg / l of IAA, 200 mg / l of carbenicillin and 130 mg / l of kanamycin). From each rooted outbreak, two internodes were isolated, each with a leaf, which was transferred to MSSABCK medium bottles, from which two were regenerated whole plants. One of them was used to maintain a replica in vitro culture, while the other, once rooted, was transferred to land. To do this, the rooted shoots were removed from the jars, the remains of the roots were removed from the roots, transplanted into pots of 13 cm in diameter with a mixture of peat: vermiculite (1: 1) and moved to the greenhouse, where they were grown under the conditions described in section 1.2.1. The phenotypic analysis of the first generation (Ti) of END1 :: barnasa plants was carried out by analyzing the morphology of the anthers of these plants by means of photographs taken with a Nikon F-601 M camera, coupled to a magnifying glass MZ8 (Leica) and by observing the anthers through SEM and optical microscopy.

9. Preparation of plant samples for scanning electron microscopy (SEM)

9.1 Fixation

Vegetable samples were introduced in 4% p-formaldehyde (w / v) in 1XPBS pH 7.0 immediately after collection. Subsequently, they were subjected to two or three vacuum pulses of 3 minutes each, the fixative solution was changed to a fresh one and they were kept overnight at 4 ⁰ C. After the tissue fixation process they were washed with 1XPBS and dehydrated to absolute ethanol by a series of successive 30-minute washes at 4 ⁰ C in increasing ethanol solutions (15%, 30%, 50%, 70%, 85%, 96%, 100%). From this point on, the samples underwent a different process depending on whether they were included in paraffin (Paraplast Plus, Sigma), resin (Historesin, Leica) or used to be analyzed by scanning electron microscopy. 9.2 Critical point and sample analysis

The samples stored in 100% ethanol, were dried with liquid CO2 in a Polaron E300 critical point dryer, mounted on metal slides with activated carbon adhesive tape on which they were oriented and dissected conveniently. After assembly, the samples were coated with 200 nm gold-palladium particle shading, under an ionized argon atmosphere in a Sputter Coater SCD005 (BALTEC).

The images were obtained by means of the Autobeam program of the ISIS platform (Oxford Instruments), with a scanning speed of 200 s per image, in a JEOL JSM-5410 scanning electron microscope operating under the conditions of 10 kV microanalysis and distance of 25 mm work.

II. RESULTS

The most important characteristic of the andro-sterile plants of Arabidopsis thaliana and Nicotiana tabacum obtained using the technology described above, is the increase in the complexity of the branching pattern of their inflorescences that in addition to the change in the sight of the plants entails the continuous production of Flowers compared to a wild control plant, as well as lengthening its half-life. In fact, as described above, the patterns of development of the inflorescences of plants are genetically determined although subject to the action of environmental factors. In Arabidopsis this pattern is defined as monopodial, both in its main stem and in the lateral branches. The biotechnological ablation of the anthers in Arabidopsis strongly interferes with the complex system of genetic control of the inflorescence architecture, which is evident because, although the pattern of development of the main stem is monopodial, the depletion of the production of floral meristems is delayed in time and the development pattern of the lateral branches of the inflorescence acquires symposial characteristics, since inflorescent branches of up to fourth order are produced both in the branches adjacent to the leaves of rosette as adjacent to the caulinarian leaves. A possible explanation for this phenomenon would be the fact that while the wild plants produce a certain number of branches and flowers that after their fertilization produce the corresponding fruits, in the andro-sterile plants when fruits are not produced, no substance is produced that should interfere with the genetic and signaling system that controls the proliferation of axillary meristems. The transgenic plants would continue to produce flowers incessantly, since the sucrose or other signaling molecules circulating in them continue to reach the inflorescent meristems as their use is not diverted towards the development of the fruits produced. In this way, the inflorescences of the andro-sterile plants would continue with an undetermined growth as there was no inhibition of this phenomenon by some type of signaling from the developing fruits (Hensel, LL, et al., (1994). The fate of inflorescence meristems is controlled by developing fruits in Arabidopsis. Plant Physiol. VoI. 106: 863-876).

1. Andro-sterile plants of Arabidopsis thaliana

The generated transgenic plants showed from the floral transition a series of characteristics that differentiated them from the control plants:

While in the control plants (Figure 2A) the flowers fertilized and produced normal fruits (silicones), in the transgenic ones when fertilization was not produced by the ablation of the anthers, the flowers entered into senescence and in the pedicels of the flowers they only remained the unfertilized carpels (Figure 2B). - The flowers present in the control plants (WT) have normal anthers with pollen inside (Figure 2C, left flower) and the filament of the yarn has its normal length (Figure 2D). The transgenic flowers do not show anthers (Figure 2C, right flower) and if we remove sepals and petals we can observe hook-shaped structures instead of the pollen sacs of the anther and a very short filament compared to that of the control stamens ( Figure 2E).

Transgenic plants continue to develop and produce branches and flowers (Figure 2C right) while control plants enter senescence and their fruits open to release the seeds inside (Figure 2C left). The half-life of these plants increased three months compared to the control.

2. Andro-sterile plants of Nicotiana tabacum

The transgenic plants generated showed, as in the previous case, the same characteristics in terms of development and flowering:

- While in the control plants (Figure 3A left) the flowers fertilized and produced normal fruits (capsules), in the transgenic ones when fertilization was not produced by the ablation of the anthers, the flowers entered senescence and in the pedicels of the flowers the flowers remained unfertilized (Figure 3A center and right). Many times senescent flowers remain on stems that continuously lengthen when flowers are produced in their inflorescent meristems. In Figure 3D one of these floral branches can be observed in comparison with one of a control plant that has produced a certain number of flowers, capsules with seeds have been fertilized and produced inside. - Transgenic plants continue to develop and produce branches and flowers (Figure 3B) while control plants enter senescence and their fruits (capsules) open to release the seeds inside (Figure 3C). Some plants were producing branches and flowers for more than a year.

The flowers present in the control plants (WT) have normal anthers with pollen inside (Figure 4A and 4B) and the filament of the yarn has its normal length. The transgenic flowers show deformed and necrotic anthers with abundant trichomes covering their collapsed pollen sacs, which do not show pollen inside (Figure 4C and 4D).

3. Evaluation of the total number of branches produced by andro-sterile Arabidops / s thaliana plants in relation to a normal plant.

Table 5 shows that the percentage of germination shown for the six lines studied (Bi, B ₂ , B ₃ , B ₈ , Bi ₄ , B ₂ o) ranges between 30-100%, while the germination percentage of Wild seeds is 88.88%.

Subsequently, plants that showed an andro-sterile phenotype were selected from the germinated seeds, eliminating the plants with wild phenotype. In the last column of Table 5, the number of plants with an andro-sterile phenotype that were evaluated for each of the crosses used is indicated. Table 5. Analysis of the germination of Arabidopsis END1 plants :: barnase and number of plants with andro-sterile phenotype

The number of branches was calculated and their order and the number of total flowers were determined as well as the average values of both parameters, both for wild plants and for all andro-sterile plants of each of the independent crosses END1 :: barnasa. For the latter, the average value of both parameters has been calculated by averaging the means obtained for each of the crossings evaluated. Said results are reflected in Table 6 (A and B), Table 7 and Figures 6A and 6B.

Table 6A Number and complexity of wild plant branches evaluated

Table 6B Number and complexity of the branches of the transgenic plants evaluated

In Tables 6A and 6B it can be seen that the wild plants of the Columbia cultivar used in this study produce a total of 36 branches and that these branches correspond to first and second order branches produced in the armpits of the rosette leaves and in those of the caulinares. However, the transgenic plants show a drastic modification of their architecture since they produce first, second, third and fourth order branches both in the armpits of the rosette leaves and in those of the caulinares. There is a dramatic increase in the number of branches, 288 in the transgenic versus 36 in the wild. This increase occurs in the number of branches of all orders. In Tables 7A and 7B it can be observed that the drastic modification of the number and order of the branches that characterize the new architecture of the inflorescence of the transgenic plants implies that said branches are capable of developing a greater number of flowers. Thus, while the number of total flowers of the wild plants of the Columbia cultivar is 659, that of the corresponding transgenic plants was 3,001. In addition, it is observed that there are increases in the ability to develop flowers in the branches of all orders

Table 7A Number of flowers of wild plant branches evaluated

Table 7B Number of flowers of the branches of the transgenic plants evaluated

Table 8A Total values, average values and standard deviations of the number of branches and number of flowers for the andro-sterile plants of the transgenic lines. Wt: wild plants, TR: transgenic plants

Total 246 2938

Table 8 B. Total values, average values and standard deviations of the number of branches and number of flowers for the wild plants studied

Summing up the previous:

The number of branches produced by plants with an andro-sterile phenotype is approximately 8 times higher than in wild plants, since, while in these the average value of branches obtained is 36 branches, in transgenic plants, the average value of branches obtained is 288. In the andro-sterile plants, a greater number of branch orders is observed (tertiary and quaternary branches are obtained) while in the wild plants only primary and secondary branches are observed (Figures 7A and 7B). Regarding the number of flowers (Tables 8A and 8B), in andro-sterile plants it is observed that the number of flowers is approximately 4.5 times higher than in wild plants (Figures 8A and 8B). Although you do not want to be linked to any theory, this fact could be explained by the following aspects:

1. When no fruits are produced in andro-sterile plants, no substance is produced that should interfere with the genetic and signaling system that controls the proliferation of axillary meristems.

2. In transgenic plants, lateral meristems remain active for longer than in wild plants; thus, while wild plants are able to live for three months, transgenic plants remain alive in the greenhouse for twice as long (six months).

3. A possible partial explanation for this phenomenon could be based on the hypothesis that in the transgenic plants there is no consumption of sucrose (energy) destined in a wild plant for fruit development after fertilization. Said energy is used by the transgenic plant to withstand more ramifications and inflorescences, thereby increasing its development and the total number of flowers produced.

Claims

1. A procedure for obtaining a transgenic plant with an architecture of its modified inflorescence with respect to that presented by the wild plant (wt) and comprising:

(a) transforming a plant cell or tissue capable of being transformed with a gene construct comprising:

(i) a first nucleic acid sequence comprising the nucleotide sequence of the promoter of the PsENDI gene, or a fragment thereof capable of specifically regulating the gene expression of a second nucleic acid sequence in anthers, and

(ü) a second nucleic acid sequence comprising the nucleotide sequence of a cytotoxic gene, or a functional fragment thereof, under the control of said first nucleic acid sequence, to produce a transformed plant cell or tissue,

(b) regenerate said transformed cell or plant tissue in stage (a) to produce a transgenic plant, and (c) select the transgenic plants of stage (b) that exhibit an architecture of its modified inflorescence compared to that presented The corresponding wild plant.

2. Method according to claim 1, wherein said first nucleic acid sequence comprises the promoter of the pea PsENDI gene (Pisum sativum L).

3. Method according to claim 1, wherein said first nucleic acid sequence comprises the nucleotide sequence comprised from nucleotide -2,736 to nucleotide -6 of the nucleotide sequence shown in Figure 5.

4. Method according to claim 1, wherein said first nucleic acid sequence comprises the nucleotide sequence comprised from nucleotide -366 to nucleotide -6 of the nucleotide sequence shown in Figure 5.

5. Method according to claim 1, wherein said second nucleic acid sequence comprises a cytotoxic gene that causes androsterility in plants or a fragment thereof capable of causing androsterility when expressed in anthers.

6. Method according to claim 1 or 5, wherein the cytotoxic gene is a gene that encodes a ribonuclease activity or a gene that encodes a protein that causes cell death in the tissue where it is expressed.

7. Method according to claim 6, wherein the cytotoxic gene is selected from the barnase gene, the gene encoding the toxin A of diphtheria (DTA) produced naturally by Corynebacterium diphteriae, the gene that codes for the exotoxin A of Pseudomonas aeruginosa, the gene that encodes the ribonuclease T of Aspergillus oryzae and the gene that encodes the barnase of Bacillus amyloliquefaciens.

8. A transgenic plant obtainable according to the procedure of any of claims 1 to 7, which has a complex, different architecture, with a greater number of branches and of greater order, all of them capable of producing flowers, than that of the wild plant (wt).

9. A process for producing flowers comprising cultivating a transgenic plant obtained according to the method of any one of claims 1 to 7, or a transgenic plant according to claim 8, under conditions that allow flowering and flower development.