WO2008104194A1 - Lipoprotéines de basse densité oxyde et leurs anticorps pour le traitement de plaques d'athérosclérose - Google Patents

Lipoprotéines de basse densité oxyde et leurs anticorps pour le traitement de plaques d'athérosclérose Download PDF

Info

Publication number
WO2008104194A1
WO2008104194A1 PCT/EP2007/001723 EP2007001723W WO2008104194A1 WO 2008104194 A1 WO2008104194 A1 WO 2008104194A1 EP 2007001723 W EP2007001723 W EP 2007001723W WO 2008104194 A1 WO2008104194 A1 WO 2008104194A1
Authority
WO
WIPO (PCT)
Prior art keywords
antibody
oxidised
ldl
epitope
regression
Prior art date
Application number
PCT/EP2007/001723
Other languages
English (en)
Inventor
Jan Nilsson
Roland Carlsson
Original Assignee
Bioinvent International Ab
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Bioinvent International Ab filed Critical Bioinvent International Ab
Priority to PCT/EP2007/001723 priority Critical patent/WO2008104194A1/fr
Publication of WO2008104194A1 publication Critical patent/WO2008104194A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/0005—Vertebrate antigens
    • A61K39/0012—Lipids; Lipoproteins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/775—Apolipopeptides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/565—Complementarity determining region [CDR]
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/60—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C07K2317/62—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
    • C07K2317/622—Single chain antibody (scFv)

Definitions

  • the present invention relates to immunotherapeutic methods for treatment of cardiovascular disease.
  • Atherosclerosis is a multifactorial disease developing preferentially in subjects presenting biochemical risk factors including smoking, hypertension, diabetes mellitus, hypercholesterolemia, elevated plasma low-density lipoprotein (LDL) and triglycerides, hyperfibrinogenemia and hyperglycemia, among others.
  • Atherosclerosis is a chronic disease that causes a thickening of the innermost layer (the intima) of large and medium-sized arteries. It decreases blood flow and might cause ischemia and tissue destruction in organs supplied by the affected vessel. Atherosclerotic lesions develop over a number of decades in humans, leading to complications such as coronary and cerebral ischemic and thromboembolic diseases and myocardial and cerebral infarction.
  • Atherosclerosis is the major cause of cardiovascular disease including myocardial infarction, stroke and peripheral artery disease. Cardiovascular disease is the leading cause of morbidity and mortality in industrialised countries and progresses steadily in emerging countries, with coronary atherosclerosis being the main underlying pathology. Current therapy of atherosclerosis is not completely effective at preventing disease development and complication.
  • LDL lipoproteins
  • Oxidised LDL is toxic and causes vascular injury. Atherosclerosis represents, in many respects, a response to this injury including inflammation and fibrosis.
  • High plasma levels of cholesterol, and in particular high levels of LDL are generally recognised as driving forces for development of atherosclerosis whereas high levels of high-density lipoprotein (HDL) counteract development of atherosclerosis.
  • HDL has consequently been called the good cholesterol while LDL has been called the bad cholesterol.
  • Simplified, LDL transports cholesterol to tissue while HDL absorbs cholesterol from tissue and transports it to the liver where it becomes degraded.
  • Therapeutic strategies to reduce LDL and increase HDL are under development for treatment of atherosclerosis.
  • Antibodies against oxidised LDL were found to be present in patients with cardiovascular disease as well as in healthy controls. This led researchers to investigate whether autoimmune reactions against oxidised LDL in the vascular wall played a role in the development of atherosclerosis by immunising animals against their own oxidised LDL. The idea behind this approach was that if autoimmune reactions against oxidised LDL are reinforced using classical immunisation techniques this would result in increased vascular inflammation and progression of atherosclerosis. To test this hypothesis rabbits were immunised with homologous oxidised LDL and then induced atherosclerosis by feeding the animals a high-cholesterol diet for 16 weeks (Ameli et al, 1996; Freigang et al, 1998).
  • WO 02/080954 reports that vaccination of animals prone- to develop atherosclerosis with oxidised forms of certain peptides derived from apolipoprotein B-100 (ApoB-100) protects them from development of atherosclerosis.
  • ApoB-100 apolipoprotein B-100
  • Previous experiments have demonstrated that antibodies that bind to oxidised epitopes present in LDL particles (Schipou et al, 2004) protect from development of atherosclerotic plaques in animal models.
  • radiolabeled forms of antibodies that bind to oxidised LDL can also be used for radioimmunodetection of atherosclerotic lesions in experimental animals
  • the present invention thus relates to the use of immunotherapy against oxidised LDL to induce regression of pre-existing atherosclerotic plaques in an individual.
  • the immunotherapy can be either active immunisation by administration of oxidised epitopes of LDL, or passive immunisation by administration of antibodies raised against oxidised epitopes of LDL.
  • regression of atherosclerotic plaques we include the meaning of reducing the size and/or amount and/or extent of atherosclerotic plaques. Typically, regression of atherosclerotic plaques leads to a reduction in the area of the interior arterial surface covered by plaques.
  • regression of atherosclerotic plaques we include reducing the overall plaque burden in the individual, as well as reducing the size of some, or all, of the individual atherosclerotic plaques. Regression of atherosclerotic plaques also leads to an increase in the vascular lumen contributing to increased blood flow.
  • Methods for measuring the size and/or amount and/or extent of atherosclerotic plaques in an individual are well known to the person of skill in the art and include angiography, vascular ultrasound, computer tomography and magnetic resonance imaging.
  • reducing the size and/or amount and/or extent we include a reduction of about 1-25%, such as a reduction of about 1 or 2 or 3 or 4 or 5%, or a larger reduction of about 6 or 7 or 8 or 9 or 10%, or a reduction of 10-25%. More preferred is a larger reduction of 25-50%, or 50-75%, or more.
  • reducing the area of the interior arterial surface covered by atherosclerotic plaques we include a reduction of about 1-25%, such as a reduction of about 1 or 2 or 3 or 4 or 5%, or a larger reduction of about 6 or 7 or 8 or 9 or 10%, or a reduction of 10-25%. More preferred is a larger reduction of 25-50%, or 50-75%, or more.
  • an increase in the effective cross-section of the arterial vessel we include the meaning of an increase of 1 -25%, such as an increase of about 1 or 2 or 3 or 4 or 5%, or a larger increase of about 6 or 7 or 8 or 9 or 10%, or an increase of 10- 25%. More preferred is a larger increase of 25-50%, or 50-75%, or 75-100%. Most preferably, the effective cross-section of the arterial vessel is increased 2- or 3- or 4- or 5- or 10-fold, or more. Clearly, the extent of increase of cross-section of the arterial vessel is dependent upon the level of arterial blockage caused by atherosclerotic lesions prior to treatment.
  • the atherosclerotic plaques to be regressed are typically those in the aorta of the individual, but may also be found in other arterial sites in the patient like the femoral, carotid and coronary arteries.
  • the immunotherapy is directed against epitopes present on oxidised LDL but not on native LDL.
  • epitopes can be determined using methods well known to a person of skill in the art and described in WO 02/080954.
  • the immunotherapy is directed against oxidised epitopes present on ApoB-100 in oxidised LDL.
  • Oxidised LDL contains several different epitopes that can be recognised by antibodies. LDL may undergo oxidative and degrading changes through a wide variety of different chemical reactions. These include reactions caused by different types of modifications caused by the activity of oxygen, enzymes (e.g. myeloperoxidase), metal ions (e.g. Fe 2+ and Cu 2+ ), free radicals and other types of chemical stress.
  • enzymes e.g. myeloperoxidase
  • metal ions e.g. Fe 2+ and Cu 2+
  • free radicals e.g. Fe 2+ and Cu 2+
  • oxidised epitopes are found on the protein part of LDL (Yang et al,. 2001) but others are modifications of lipids present in the LDL particle. Many oxidatively modified and biologically active phospholipids can be formed (Heery et al, 1995; Friedman et al, 2002; Watson et al, 1999). Polyunsarured fatty acids are converted to fatty acid hydroperoxides, which rapidly form highly reactive products such as malondialdehyde and 4-hydroxynonenal (Smiley et al, 1991). These type of intermediate products can go on to form covalent Schiff base and Michael-type products with the lysine in ApoB-100 protein of LDL.
  • Reactive aldehydes can also be found in fatty acids attached via the ester bonds in the phosphatidylcholine moiety (Witztum & Ralph, 1998). Frequently found is phospholipid l-palmitoyl-2-arachidonoyLs ⁇ «-glycero-3-phosphorylcholine (PAPC), a near terminal oxidation product that yields an aldehyde at a carbon of the sn-2 oxidized arachidonic acid, resulting in POVPC (l-palmitoyl-2-(5-oxo)valeroyl- ⁇ n- glycero-3-phosphoryl choline).
  • PAPC phospholipid l-palmitoyl-2-arachidonoyLs ⁇ «-glycero-3-phosphorylcholine
  • POVPC can react with lysine and also with amine- containing phospholipids such as phosphatidylethanolamine and phosphatidylserine.
  • the end result is a variety of oxidised lipid-protein and oxidised lipid-lipid adducts. Some of these oxidations are driven by enzymes such as secretory phospholipase (Leitinger et al, 1999). Other enzyme-formed changes such as nitration and addition of HOCL are performed by myeloperoxidase (Carr et al, 2000). AU neoepitopes are to be considered as immunogenic and biologically active (Mclntyre et al, 1999; Esterbauer et al, 1991).
  • cryptic epitopes that are a result of an oxidised modification of the LDL particle but are not oxidised themselves, like phosphorylcholine and fragments of proteins, are hallmarks of oxidised LDL particles and such epitopes are targetable by immunotherapy.
  • the peptides could be grouped into six categories with common characteristics:
  • the peptide fragments of ApoB-100 may be made using protein chemistry techniques for example using partial proteolysis (either exolytically or endolytically), or by de novo synthesis.
  • the variants may be made by recombinant DNA technology. Suitable techniques for cloning, manipulation, modification and expression of nucleic acids, and purification of expressed proteins, are well known in the art and are described for example in Sambrook et al (2001) "Molecular Cloning, a Laboratory Manual", 3 rd edition, Sambrook et al (eds), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, USA, incorporated herein by reference.
  • peptide we include not only molecules in which amino acid residues are joined by peptide (-CO-NH-) linkages but also molecules in which the peptide bond is reversed.
  • retro-inverso peptidomimetics may be made using methods known in the art, for example such as those described in Meziere et al, 1997. This approach involves making pseudopeptides containing changes involving the backbone, and not the orientation of side chains. At least for MHC class II and T helper cell responses, these pseudopeptides were shown to be useful.
  • Retro-inverse peptides which contain NH-CO bonds instead of CO-NH peptide bonds, are much more resistant to proteolysis.
  • the peptide bond may be dispensed with altogether provided that an appropriate linker moiety which retains the spacing between the CI atoms of the amino acid residues is used; it is particularly preferred if the linker moiety has substantially the same charge distribution and substantially the same planarity of a peptide bond. It is also appreciated that the peptide may conveniently be blocked at its N- or C-terminus so as to help reduce susceptibility to exoproteolytic digestion.
  • the invention thus includes the use of the oxidised peptide epitopes of ApoB-100 listed in Table 1, or an active fragment of one or more of these peptides, for immunotherapy against oxidised LDL to induce regression of pre-existing atherosclerotic plaques, whether by active immunisation or by passive immunisation i.e. administration of antibodies raised against these oxidised epitopes.
  • ApoB-100 peptides can be administered in either oxidised or unoxidised form. This is because they seem to become oxidised when administered in vivo.
  • administering an oxidised epitope of LDL we include administering an unoxidised epitope that becomes oxidised in vivo.
  • the antibodies for passive immunisation all bind to oxidised LDL.
  • a fragment of a peptide epitope of ApoB-100 listed in Table 1 we mean at least six consecutive amino acids of the given sequence.
  • a fragment may include 6 or 7 or 8 or 9 or 10 or 11 or 12 or 13 or 14 or 15 or 16 or 17 or 18 or 19 consecutive amino acids of the given sequence.
  • An “active” fragment is one which, when oxidised, can be used to raise antibodies that induce regression of atherosclerotic plaques in an individual by either active or passive immunotherapy. Methods for determining whether any particular fragment of the peptide epitopes listed in Table 1 are active fragments as defined are provided in the Examples.
  • the immunotherapy comprises administering to the individual at least one antibody that selectively binds to an oxidised epitope of LDL.
  • the invention thus includes a method of inducing regression of atherosclerotic plaques in an individual in need thereof, the method comprising administering to the individual at least one antibody that selectively binds to an oxidised epitope of LDL.
  • the invention also includes the use of at least one antibody that selectively binds to an oxidised epitope of LDL in the preparation of a medicament that induces regression of atherosclerotic plaques in an individual.
  • administration of an antibody that selectively binds to an oxidised epitope of LDL comprises administering to the individual a polynucleotide encoding said antibody molecule.
  • Methods of delivering polynucleotides to a patient are well known to a person of skill in the art and include the use of immunoliposomes, viral vectors (including vaccinia, modified vaccinia, and adenovirus), and by direct delivery of DNA, eg using a gene-gun and electroporation.
  • immunoliposomes including vaccinia, modified vaccinia, and adenovirus
  • viral vectors including vaccinia, modified vaccinia, and adenovirus
  • DNA eg using a gene-gun and electroporation.
  • Svensson et al 1999, describes the delivery of recombinant genes to cardiomyocytes by intramyo cardial injection or intracoronary infusion of cardiotropic vectors, such as recombinant adeno-associated virus vectors, resulting in transgene expression in murine cardiomyocytes in vivo.
  • MeIo et al review gene and cell-based therapies for heart disease.
  • Stents represent an attractive alternative for localized gene delivery, as they provide a platform for prolonged gene elution and efficient transduction of opposed arterial walls. This gene delivery strategy has the potential to decrease the systemic spread of the viral vectors and hence a reduced host immune response. Both synthetic and naturally occurring stent coatings have shown potential to allow prolonged gene elution with no significant adverse reaction. (Sharif ef ⁇ /, 2004).
  • the polynucleotide encoding the antibody molecule is operatively linked to targeting and/or regulatory sequences that direct expression of the antibody to the arteries, and preferably the arterial walls.
  • targeting and regulatory sequences are known to the skilled person. It may be desirable to be able to temporally regulate expression of the polynucleotide in the cell.
  • expression of the polynucleotide is directly or indirectly (see below) under the control of a promoter that may be regulated, for example by the concentration of a small molecule that may be administered to the patient when it is desired to activate or, more likely, repress (depending upon whether the small molecule effects activation or repression of the said promoter) expression of the antibody from the polynucleotide.
  • a promoter that may be regulated, for example by the concentration of a small molecule that may be administered to the patient when it is desired to activate or, more likely, repress (depending upon whether the small molecule effects activation or repression of the said promoter) expression of the antibody from the polynucleotide.
  • the expression construct is stable, ie. capable of expressing the antibody (in the presence of any necessary regulatory molecules), in the cell for a period of at least one week, one, two, three, four, five, six, eight months or one or more years.
  • the polynucleotide may be operatively linked to a regulatable promoter.
  • regulatable promoters include those referred to in the following papers: Rivera et al (1999) Proc Natl Acad Sd USA 96(15), 8657-62 (control by rapamycin, an orally bioavailable drug, using two separate adenovirus or adeno-associated virus (AAV) vectors, one encoding an inducible human growth hormone (hGH) target gene, and the other a bipartite rapamycin-regulated transcription factor); Magari et al (1997) J Clin Invest 100(11), 2865-72 (control by rapamycin); Bueler (1999) Biol Chem 380(6), 613-22 (review of adeno-associated viral vectors); Bohl et al (1998) Blood 92(5), 1512-7 (control by doxycycline in adeno-associated vector); Abruzzese et al (1996) JMo/ Med 74
  • the antibody molecule is an antibody raised against an oxidised epitope of LDL, such as those listed in Table 1 and described in WO 02/080954.
  • peptides may be oxidised by exposure to a variety of agents such as iron, oxygen, copper, myeloperoxidase, phospholipase, hypochlorous acid, or by malone dealdehyde (MDA) modification, to mimic the different modifications of the amino acids that may occur during oxidation of LDL.
  • MDA malone dealdehyde
  • other methods known in the art may be employed to oxidise the epitopes of LDL.
  • human, or human-like antibodies can also be generated using other technologies well known in the art, including immunisation of mice transgenic in the human immunoglobulin locus, or by humanisation of e.g. murine antibodies with the desired specificity.
  • an antibody that "selectively binds to an oxidised epitope of LDL” we mean that the antibody molecule binds the oxidised epitope of LDL with a greater affinity than for unoxidised LDL.
  • the antibody binds the oxidised epitope of LDL with at least 1.5, or at least 2, or at least 5, or at least 10 or at least 50 times greater affinity than for unoxidised LDL. More preferably, the antibody molecule binds the oxidised epitope of LDL with at least 100, or at least 1,000, or at least 10,000 times greater affinity than for unoxidised LDL. Such binding may be determined by methods well known in the art, such as one of the Biacore ® systems.
  • the antibody molecule selectively binds an oxidised epitope of LDL and does not bind unoxidised LDL.
  • the antibodies have an affinity for their target epitope of at least 10 " M, although antibodies with higher affinities may be even more preferred.
  • Antibodies initiate then- biological activity by binding to antigens. Antibody binding to antigens is generally specific for one antigen and the binding is usually of high affinity. Antibodies are produced by B-lymphocytes. Blood contains many different antibodies, each derived from a clone of B-cells and each having a distinct structure and specificity for antigen. Antibodies are present on the surface of B- lymphocytes, in the plasma, in interstitial fluid of the tissues and in secretory fluids such as saliva and mucous on mucosal surfaces.
  • All naturally-occurring antibodies are similar in their overall structure, accounting for certain similarities in physico-chemical features such as charge and solubility. All antibodies have a common core structure of two identical light chains, each about 24 kilo Daltons, and two identical heavy chains of about 55-70 kilo Daltons each. One light chain is attached to each heavy chain, and the two heavy chains are attached to each other. Both the light and heavy chains contain a series of repeating homologous units, each of about 110 amino acid residues in length which fold independently in a common globular motif, called an immunoglobulin (Ig) domain. The region of an antibody formed by the association of the two heavy chains is hydrophobic.
  • Ig immunoglobulin
  • Antibodies and especially monoclonal antibodies, are known to cleave at the site where the light chain attaches to the heavy chain when they are subjected to adverse physical or chemical conditions. Because antibodies contain numerous cysteine residues, they have many cysteine-cysteine disulfide bonds. All Ig domains contain two layers of beta-pleated sheets with three or four strands of anti-parallel polypeptide chains.
  • antibody molecules can be divided into a small number of distinct classes and subclasses based on physicochemical characteristics such as size, charge and solubility, and on their behaviour in binding to antigens.
  • the classes of antibody molecules are: IgA, IgD, IgE, IgG and IgM, and members of each class are said to be of the same isotype.
  • IgA and IgG isotypes are further subdivided into subtypes called IgAl, IgA2 and IgGl, IgG2, IgG3 and IgG4.
  • the heavy chains of all antibodies in an isotype share extensive regions of amino acid sequence identity, but differ from antibodies belonging to other isotypes or subtypes.
  • IgG, IgE and IgD circulate as monomers, whereas secreted forms of IgA and IgM are dimers or pentamers, respectively, stabilised by the J chain.
  • Some IgA molecules exist as monomers or trimers.
  • antibody or “antibody molecule” we include not only whole immunoglobulin molecules as described above but also fragments thereof such as Fab, F(ab') 2 , Fv and other fragments thereof that retain the antigen-binding site.
  • antibody includes genetically engineered derivatives of antibodies such as single chain Fv molecules (scFv) and domain antibodies (dAbs).
  • scFv single chain Fv molecules
  • dAbs domain antibodies
  • the term also includes antibody-like molecules which may be produced using phage-display techniques or other random selection techniques for molecules which bind to oxidised LDL or to specified regions of it.
  • the term antibody includes all molecules which contain a structure, preferably a peptide structure, which is part of the recognition site (ie the part of the antibody that binds or combines with the epitope or antigen) of a natural antibody.
  • variable heavy (VH) and variable light (V L ) domains of the antibody are involved in antigen recognition, a fact first recognised by early protease digestion experiments. Further confirmation was found by "humanisation" of rodent antibodies. Variable domains of rodent origin may be fused to constant domains of human origin such that the resultant antibody retains the antigenic specificity of the rodent parented antibody (Morrison et al. (1984) Proc. Natl. Acad. Sci. USA 81, 6851-6855). That antigenic specificity is conferred by variable domains and is independent of the constant domains is known from experiments involving the bacterial expression of antibody fragments, all containing one or more variable domains.
  • Fab-like molecules (Better et al (1988) Science 240, 1041); Fv molecules (Skerra et al (1988) Science 240, 1038); single-chain Fv (ScFv) molecules where the V H and VL partner domains are linked via a flexible oligopeptide (Bird et al (1988) Science 242, 423; Huston et al (1988) Proc. Natl. Acad. Sci USA 85, 5879) and single domain antibodies (dAbs) comprising isolated V domains (Ward et al (1989) Nature 341 , 544).
  • dAbs single domain antibodies
  • ScFv molecules we mean molecules wherein the V H and V L partner domains are linked via a flexible oligopeptide.
  • Engineered antibodies such as ScFv antibodies, can be made using the techniques and approaches described in J. Huston et al, (1988) "Protein engineering of antibody binding sites: recovery of specific activity in an anti-digoxin single chain Fv analogue produced in E. coW ⁇ Proc. Natl. Acad. Sci. USA, 85, pp.5879-5883, and in A. Pluckthun, (1991) "Antibody engineering; Advances from use of E. coli expression systems", Bio/technology 9(6): 545-51 , incorporated herein by reference.
  • antibody fragments rather than whole antibodies
  • the smaller size of the fragments may lead to improved pharmacological properties, such as better penetration to the target site. Effector functions of whole antibodies, such as complement binding, are removed.
  • Fab, Fv, ScFv and dAb antibody fragments can all be expressed in and secreted from E. coli, thus allowing the facile production of large amounts of the fragments.
  • the antibody is a monoclonal antibody. In some circumstance, particularly if the antibody is going to be administered repeatedly to a human patient, it is preferred if the monoclonal antibody is a human monoclonal antibody or a humanised monoclonal antibody.
  • Suitable monoclonal antibodies which are reactive as described herein may be prepared by known techniques, for example those disclosed in “Monoclonal Antibodies; A manual of techniques ", H Zola (CRC Press, 1988) and in “Monoclonal Hybridoma Antibodies: Techniques and Application “, SGR Hurrell (CRC Press, 1982).
  • the antibodies may be given desired properties concerning e.g. specificity and cross-reactivity, isotype, affinity and plasma half-life.
  • desired properties e.g. specificity and cross-reactivity, isotype, affinity and plasma half-life.
  • the possibility to develop antibodies with predetermined properties became apparent already with the advent of the monoclonal antibody technology (Milstein and K ⁇ hler, 1975 Nature, 256: 495-7).
  • This technology used murine hybridoma cells producing large amounts of identical, but murine, antibodies.
  • a large number of preclinical, and also clinical trials were started using murine monoclonal antibodies for treatment of e.g. cancers.
  • the antibodies were of non-human origin the immune system of the patients recognised them as foreign and developed antibodies to them.
  • the efficacy and plasma half- lives of the murine antibodies were decreased, and often side effects from allergic reactions, caused by the foreign antibody, prevented successful treatment.
  • the first approach comprised technology to make so called chimeric antibodies where the murine variable domains of the antibody were transferred to human constant regions resulting in an antibody that was mainly human (Neuberger et al, 1985, Nature 314: 268-70; Neuberger et al, 1998, 8 th International Biotechnology Symposium Part 2, 792-799).
  • the antibody is a humanised antibody.
  • Suitably prepared non- human antibodies can be "humanised” in known ways, for example by inserting the CDR regions of mouse antibodies into the framework of human antibodies. Humanised antibodies can be made using the techniques and approaches described in Verhoeyen et al (1988) Science, 239, 1534-1536, and in Kettleborough et al, (1991) Protein Engineering, 14(7), 773-783.
  • Completely human antibodies may be produced using recombinant technologies. Typically large libraries comprising billions of different antibodies are used. In contrast to the previous technologies employing chimerisation or humanisation of e.g. murine antibodies this technology does not rely on immunisation of animals to generate the specific antibody. Instead the recombinant libraries comprise a huge number of pre-made antibody variants wherein it is likely that the library will have at least one antibody specific for any antigen. Thus, using such libraries, an existing antibody having the desired binding characteristics can be identified. In order to find the good binder in a library in an efficient manner, various systems where phenotype i.e. the antibody or antibody fragment is linked to its genotype i.e. the encoding gene have been devised.
  • phage display system where antibody fragments are expressed, displayed, as fusions with phage coat proteins on the surface of filamentous phage particles, while simultaneously carrying the genetic information encoding the displayed molecule.
  • Phage displaying antibody fragments specific for a particular antigen may be selected through binding to the antigen in question. Isolated phage may then be amplified and the gene encoding the selected antibody variable domains may optionally be transferred to other antibody formats, such as e.g. full length immunoglobulin, and expressed in high amounts using appropriate vectors and host cells well known in the art.
  • the format of displayed antibody specificities on phage particles may differ.
  • the most commonly used formats are Fab (Griffiths et al, 1994. EMBO J. 13: 3245- 3260) and single chain (scFv) (Hoogenboom et al, 1992, J MoI Biol. 227: 381- 388) both comprising the variable antigen binding domains of antibodies.
  • the single chain format is composed of a variable heavy domain (V H ) linked to a variable light domain (V L ) via a flexible linker (US 4,946,778).
  • V H variable heavy domain
  • V L variable light domain
  • US 4,946,778 flexible linker
  • the antibody Before use as a therapeutic agent, the antibody may be transferred to a soluble format e.g. Fab or scFv and analysed as such. In later steps the antibody fragment identified to have desirable characteristics may be transferred into yet other formats such as full length antibodies.
  • Antibody fragments derived from this library all have the same framework regions and only differ in their CDRs. Since the framework regions are of germline sequence the immunogenicity of antibodies derived from the library, or similar libraries produced using the same technology, are expected to be particularly low (Soderlind et al, 2000). This property is of great value for therapeutic antibodies, reducing the risk that the patient forms antibodies to the administered antibody, thereby reducing risks for allergic reactions, the occurrence of blocking antibodies, and allowing a long plasma half-life of the antibody.
  • peptides identified in WO 02/080954 and listed in Table 1 may be used as antigens for generation of fully human antibodies with predetermined properties, which may be particularly relevant as therapeutic antibodies for inducing regression of atherosclerotic plaques.
  • the resulting fully human antibodies are not expected to generate any undesired immunological reaction when administered into patients.
  • Certain preferred antibodies include those that bind to ApoB-100 epitopes P45 (amino acid residues 661-680) and/or P143 (amino acid residues 2131-2150).
  • Antibodies having this binding specificity include IEI-I3 (Schiopu et al 2004) and 2D03 (described in Example 2).
  • Antibody IEI-E3 has previously been shown to significantly inhibit development of plaque in an animal model (Schiopu et al, 2004). We have now shown (see Examples) that it can induce regression of atherosclerotic plaques. We have also demonstrated that other anti-oxidised LDL antibodies with a different specificity i.e. 2D03, LDO-D4 and KTT-B8, but not the control antibody FITC-8, could all significantly reduce the level of plaque in aorta compared to the plaque area seen in the animals before the start of treatment. The CDR sequences of the antibodies are listed in Table 2.
  • V H and V L sequences of antibodies IEI-E3, 2D03 and KTT-B8 are given in Figure 3 of WO 2004/030607, and are incorporated herein by reference. Table 2. Amino acid sequences of CDRs found in anti-oxLDL antibodies
  • the immunotherapy comprises administering to the individual at least one oxidised epitope of LDL.
  • the at least one oxidised epitope of LDL acts to induce an immune response against the oxidised epitope so as to induce regression of atherosclerotic plaques in an individual.
  • the at least one oxidised epitope of LDL acts as a vaccine to raise an immune response that induces regression of atherosclerotic plaques in the vaccinated individual.
  • the invention thus includes a method of inducing regression of atherosclerotic plaques in an individual in need thereof, the method comprising administering to the individual at least one oxidised epitope of LDL.
  • the invention also includes the use of at least one oxidised epitope of LDL in the preparation of a medicament for inducing regression of atherosclerotic plaques in an individual.
  • the individual is a mammal, such as a horse, cow, sheep, pig, camel, dog or cat. More preferably, the individual is a human individual.
  • the human individual is typically a patient who has, or is at risk of having, a cardiovascular disease associated with atherosclerosis.
  • cardiovascular disease associated with atherosclerosis includes references to diseases that are medically linked to atherosclerosis in that they are a consequence of atherosclerotic lesions. Cardiovascular diseases associated with atherosclerosis that may be mentioned include coronary artery disease, myocardial infarction and strokes.
  • Whether or not a particular patient is one who is expected to benefit from treatment may be determined by the physician.
  • the invention includes reducing the risk of a cardiovascular disease associated with atherosclerosis in a patient who is at risk of developing said cardiovascular diseases due to the presence of the atherosclerotic plaques.
  • the patient who is at risk of a cardiovascular disease associated with atherosclerosis may be one who has blood cholesterol levels that are likely to cause or exacerbate cardiovascular disease or dysfunction.
  • the patient may be one who is at risk of developing coronary heart disease because of multiple risk factors (including obesity, smoking, hypertension, diabetes mellitus and a family history of premature coronary heart disease); one with a familial condition characterised by very high plasma concentrations of cholesterol and/or triglycerides; one with hyperlipidemia not secondary to underlying diseases (such as hypothyroidism, nephrotic syndrome, hepatic disease or alcoholism); one with elevated LDL-cholesterol; or one under dietary hypolipidemic intervention (complementary treatment).
  • risk factors including obesity, smoking, hypertension, diabetes mellitus and a family history of premature coronary heart disease
  • a familial condition characterised by very high plasma concentrations of cholesterol and/or triglycerides
  • hyperlipidemia not secondary to underlying diseases such as hypothyroidism, nephrotic syndrome, hepatic disease or alcoholism
  • LDL-cholesterol low-cholesterol
  • dietary hypolipidemic intervention complementary treatment
  • the invention is particularly useful for treating patients with advanced or severe atherosclerosis, and advanced or severe forms of the cardiovascular disease associated with atherosclerosis.
  • the invention may comprise the prior step of determining the size and/or amount and/or extent of atherosclerotic plaques in the individual. This may be done to assess whether the individual is in need of treatment to reduce his atherosclerotic plaque burden, or to provide a baseline measurement to assess the efficacy of such treatment, or for both purposes.
  • the invention may be considered to include a method of identifying a patient with an atherosclerotic plaque burden in need of reduction, and subsequently administering to the individual at least one antibody that selectively binds to an oxidised epitope of LDL, or at least one oxidised epitope of LDL.
  • an atherosclerotic plaque burden in need of reduction may be due to the size and/or extent of the overall plaque burden. Additionally or alternatively, this could be due to the nature of the plaques, for example, how unstable they are.
  • the invention may also be considered to include the use of at least one antibody that selectively binds to an oxidised epitope of LDL, or at least one oxidised epitope of LDL, in the preparation of a medicament for inducing regression of atherosclerotic plaques in an individual who has been assessed as being in need of such treatment by measuring the size and/or amount and/or extent of atherosclerotic plaques in the individual.
  • the invention may also comprise the subsequent step of determining the size and/or amount and/or extent of atherosclerotic plaques in the patient after the administration of the at least one antibody that selectively binds to an oxidised epitope of LDL, or the at least one oxidised epitope of LDL, so as to assess the efficacy of the treatment in comparison with a baseline measurement taken prior to treatment.
  • the dose of the at least one antibody that selectively binds to an oxidised epitope of LDL administered to the patient will typically be determined by the physician based on considerations such the atherosclerotic condition of the patient to be treated, other treatment agents to be administered, the age, sex and size of the patient, and so on. Typically, however, the dose of the at least one oxidised epitope of LDL administered to the patient will be determined by the physician based on the body- weight of the patient to be treated.
  • Statins inhibitors of 3-hydroxy-3-methylglutaryl-coenzyme A (HMG-CoA) reductase
  • HMG-CoA 3-hydroxy-3-methylglutaryl-coenzyme A reductase
  • Administration of a statin in conjunction with the immunotherapy described above may be a useful means of treatment to supplement the regression of atherosclerotic plaques.
  • the two dosage regimes are chosen to have a synergistic effect.
  • a further aspect of the invention provides a method of combating a cardiovascular disease associated with atherosclerosis in an individual in need thereof, the method comprising: inducing the regression of atherosclerotic plaques in an individual by administering to the individual: (a) at least one antibody molecule that selectively binds to an oxidised epitope of LDL, or (b) at least one oxidised epitope of LDL; and administering a statin to the individual.
  • a further aspect of the invention provides the use of: (a) at least one antibody molecule that selectively binds to an oxidised epitope of LDL, or (b) at least one oxidised epitope of LDL; in the preparation of a medicament for combating a cardiovascular disease associated with atherosclerosis by inducing the regression of atherosclerotic plaques, wherein the individual is one to whom a statin is administered.
  • a related aspect of the invention provides the use of a statin in the preparation of a medicament for combating a cardiovascular disease associated with atherosclerosis, wherein the individual is one to whom: (a) at least one antibody molecule that selectively binds to an oxidised epitope of LDL, or (b) at least one oxidised epitope of LDL is administered to induce the regression of atherosclerotic plaques.
  • a still further related aspect of the invention provides the use of: (a) at least one antibody molecule that selectively binds to an oxidised epitope of LDL, or (b) at least one oxidised epitope of LDL, and a statin, in the preparation of a medicament for combating a cardiovascular disease associated with atherosclerosis by inducing the regression of atherosclerotic plaques.
  • a pharmaceutical formulation comprising: (a) at least one antibody molecule that selectively binds to an oxidised epitope of LDL, or (b) at least one oxidised epitope of LDL, and a statin, in admixture with a pharmaceutically-acceptable adjuvant, diluent or carrier.
  • a kit of parts comprising components:
  • in conjunction we include the meaning that the components may be suitable for simultaneous or combined administration to the patient. However, since the components may need be administered by different routes or at different rates, by “in conjunction” we also include the meaning of consecutive administration or separate administration within the same treatment regime.
  • Suitable statins include atorvastatin, cerivastatin, fluvastatin, lovastatin, mevastatin, pravastatin, rosuvastatin and simvastatin.
  • the antibody may be coupled to an antiinflammatory agent.
  • Suitable anti-inflammatory agents include steroidal compounds such as dexamethasone, betamethasone, prednisone, prednisolone, triamcinolone, hydrocortisone, alclometasone, amcinonide, diflorasone, etc. as well as non-steroidal antiinflammatories. Methods for coupling compounds, such as the anti-inflammatory agents listed above, to antibodies are well known in the art.
  • a further aspect of the invention provides a method of identifying an antibody that induces regression of atherosclerotic plaques in an individual, the method comprising: providing an antibody that selectively binds to an oxidise epitope of LDL, and testing it in an assay for atherosclerotic plaque regression, wherein regression of atherosclerotic plaques in the assay indicates that the antibody is one that induces regression of atherosclerotic plaques.
  • the atherosclerotic plaque regression assay may be an in vivo assay such as the animal models described in Example 2 or 4.
  • the tested antibody has been isolated from a human antibody fragment library as described above.
  • the tested antibody selectively binds to an oxidised, in particular MDA-modified, peptide derived from ApoB-100.
  • Identified antibody fragments with desired characteristics of atherosclerotic plaque regression may then be rebuilt into other antibody configurations, e.g. full length human immunoglobulin, to be used for therapeutic purposes.
  • a still further aspect of the invention provides a method of identifying an agent that induces regression of atherosclerotic plaques in an individual, the method comprising: providing an agent comprising an oxidised epitope of LDL, administering the agent to an individual who has atherosclerotic plaques, and determining whether said agent induces regression of the atherosclerotic plaques, wherein regression of the atherosclerotic plaques indicates that the agent is one that induces regression of atherosclerotic plaques.
  • the individual may be an animal model of atherosclerosis, such as described in Example 2 or 4.
  • the method may be employed in the context of a clinical trial of the agent, in which case the individual may be a human individual who has atherosclerotic plaques.
  • a final aspect of the invention provides an antibody comprising: at least one complementarity determining region (CDR) that has the amino acid sequence of the corresponding CDR of antibody 2D03 as shown in Table 2 More preferably, the antibody has two or three or four or five CDRs that have the sequence of the corresponding CDRs of antibody 2D03.
  • CDR complementarity determining region
  • the antibody comprises a heavy chain CDR3 (H3) having the amino acid sequence ARIRVGPSGGAFDY (SEQ ID No: 41). Additionally, the antibody may have another one or two or three or four CDRs that have the sequence of the corresponding CDRs of antibody 2D03.
  • the antibody does not comprise a heavy chain CDR3 (H3) having the amino acid sequence ARIRVGP SGGARDY (SEQ ID No: 63).
  • the antibody has three or four CDRs that have the sequence of the corresponding CDRs of antibody 2D03, it is preferred if the antibody has all three heavy chain or all three light chain CDRs that have the sequence of the corresponding CDRs of antibody 2D03.
  • this aspect of the invention includes an antibody comprising: three light chain CDRs that have the sequence of the corresponding three light chain CDRs of antibody 2D03, or three heavy chain CDRs that have the sequence of the corresponding three heavy chain CDRs of antibody 2D03.
  • the antibody does not comprise a heavy chain encoded by the nucleotide sequence: GAGGTGCAGCTGTTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGG TCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAACGCCT GGATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTC TCAAGTATTAGTGTTGGTGGACATAGGACATATTATGCAGATTCCGTG AAGGGCCGGTCCACCATCTCCAGAGACAATTCCAAGAACACGCTGTAT CTGCAAATGAACAGCCTGAGAGCCGAGGACACTGCCGTGTATTACTGT GCACGGATACGGGTGGGTCCGTCCGGCGGGGCCTTTGACTACTGGGGC CAGGGTACACTGGTCACCGTGAGC TCA (SEQ ID NO: 64). Yet more preferably, the antibody comprises three light chain CDRs and three heavy chain CDRs that have the sequence of the corresponding CDRs of antibody 2D03.
  • the antibody does not comprise all six CDRs that have the sequence of the corresponding CDRs of antibody 2D03 as shown in Table 2, it is preferred if some or all of the 1, 2, 3, 4 or 5 "non-identical" CDRs comprise a variant of the sequence of the corresponding CDRs of antibody 2D03. It is particularly preferred if the Hl and/or H2 and/or Ll and/or L2 and/or L3 CDRs comprise a variant of the sequence of the corresponding CDRs of antibody 2D03 as shown in Table 2.
  • a variant we include the meaning that the variant has at least 50% sequence identity with the sequence of the corresponding CDR, more preferably at least 70%, yet more preferably at least 80% or at least 90% or at least 95%.
  • the variant has 96% or 97% or 98% or 99% sequence identity with the sequence of the corresponding CDR of antibody 2D03.
  • the "variant" CDR sequence has 5 or 4 or 3 or 2 or only 1 amino acid residue difference from the sequence of the corresponding CDR of antibody 2D03.
  • Antibody 2D03 itself has the fixed framework regions of the n-CoDeR ® antibody system (WO 98/32845; Soderlind et al (2000); WO 02/080954; and WO 2004/ 030607).
  • the CDRs of antibody 2D03 as shown in Table 2 may also be particularly useful in conjunction with another framework region.
  • the antibody having at least one CDR that has the amino acid sequence of the corresponding CDR of antibody 2D03 as described above may have an alternative framework region. Suitable framework regions are well known in the art and are described for example in M. Lefranc & G. Lefranc (2001) "The Immunoglobulin FactsBook", Academic Press, incorporated herein by reference.
  • the invention also includes an antibody that selectively binds to the oxidised-LDL epitope that is selectively bound by antibody 2D03. Methods for determining whether any given antibody selectively binds to the oxidised-LDL epitope that is selectively bound by antibody 2D03 are well known to the person of skill in the art.
  • the invention also includes a pharmaceutical composition comprising an antibody according to this aspect of the invention and a pharmaceutically acceptable carrier; an antibody according to this aspect of the invention for use in medicine; and the use of an antibody according to this aspect of the invention in the preparation of a medicament for inducing regression of atherosclerotic plaques.
  • FIG. 1 Luminescence ELISA demonstrating binding of 2D03 and IEI-E3 antibodies to oxidised and native forms of LDL and ApoB-100.
  • MDA MDA-modif ⁇ ed forms of LDL and ApoB-100 whereas Na represents the native forms of these entities.
  • FIG. 1 ELISA based analysis of binding of 2D03 and IEI-E3 antibodies to MDA-modified human ApoB-100. Control corresponds to binding of FITC-8 antibody to the same antigen. Affinities were determined by Biacore analysis.
  • FIG. 3 Binding of single chain fragment (scFv) of IEI-E3 and 2D03 to a number of different MDA modified antigens.
  • P2 amino acids [aa] 16-31); P45 (aa 661-680); P129 (aa 1921-1940); P143 (aa 2131-2150); P210 (aa 3136-3155); and P301 (aa 4502-4521) are peptides corresponding to the specified regions of human Apo B-100 sequence.
  • the control peptide was a non-relevant lysine- containing peptide (MDA-modified, black). Data are plotted as signal/10 5 . Abbreviations are as defined in text.
  • FIG. 4 Immunohistochemical staining of human plaques with 2D03, IEI-E3 and a control FITC-8 antibody. Bound antibody was detected with a horseradish peroxidase conjugated anti antibody and diamino benzidine staining.
  • FIG. 5 Plaque area in the descending aorta of atherosclerotic ApoBec mice treated with 2D03 and IEI-E3, LDO-D4 and KTT B8 antibodies which are specific for oxidised LDL.
  • the isotype matched FITC-8 antibody was used as a control. Plaque area was assessed by Oil Red O staining. The values are expressed as percentage of total plaque area per total area of the descending aorta.
  • FIG. 1 Treatment of human monocyte derived macrophages with anti-oxidised ApoB-100 IgG blocks MCP-I release. Human monocyte derived macrophages, pre-cultured for 10 days in the presence of human serum, were treated with
  • FIG. 7 The MCP-I blocking effect of anti-oxidised ApoB-100 IgG on atheroma-like macrophages is rapid and stable over time.
  • Human monocytes or human monocyte derived macrophages were obtained from two donors (circles or squares, respectively). The cells were treated with 60 ⁇ g/ml of the 2D03 antibody (closed symbols) or the control antibody (open symbols) either immediately (left set of graphs) or after pre-culture of the monocytes for 14 days in the presence of human serum (right set of graphs). Supernatants were isolated and analysed for MCP-I CC chemokine content using a commercially available ELISA. Data are means of triplicate values with SEM.
  • Example 1 Generation of human antibodies with high affinity and specificity for epitopes present on oxidised LDL
  • Human antibody fragments binding with specificity for oxidised LDL were selected from the n-CoDeR library essentially as described (Schiopu et al, 2004). Briefly; the library was expressed with phage display and selected for binding to a mixture of biotinylated oxidized peptides derived from ApoB-100. Binding phages were selected with avidin coated magnetic beads in 2-3 rounds of selection (Soderlind et al, (2000) Nature BioTechnol. 18: 852-856) and finally screened for binding to MDA- and Cu-oxidised forms of LDL and ApoB-100. The antibodies bound to MDA and Cu oxidised forms of LDL and ApoB-100 but not to their native, non-oxidised forms ( Figure 1).
  • the antibodies also bound with specificity to human atherosclerotic plaques but not to normal tissue as assessed by immunohistochemistry.
  • Example 2 Regression of atherosclerotic plaques in animal model using immunotherapy based on passive immunisation Methods
  • mice Male LDLR " ⁇ ApoBec mice on C57BL/6 background from Jackson Laboratories (Bar Harbor, ME, USA) were used in the present study. From 4 weeks of age the mice were fed a high cholesterol diet (0.15% cholesterol, 21% fat, Lactamin AB, Kimstad, Sweden) provided ad libitum. One week before the first immunisation the diet was changed to normal chow. At 25 weeks of age one group of mice was sacrificed to serve as a control for the level of plaque formation at the initiation of the experiment and three groups of the remaining mice were injected intraperitoneally with 1 mg/dose (0.5 mL) of the human IgGl antibodies directed to MDA modified ApoB-100 peptides or the control antibody respectively. Nonspecific human IgGl antibodies directed to fluorescein isothiocyanate (FITC-8) were used as control. The injections were repeated 2 times at 1-week intervals.
  • FITC-8 fluorescein isothiocyanate
  • mice were humanely killed at 29 weeks of age by exsanguination through cardiac puncture under anesthesia with 300 ⁇ L of distilled water, fentanyl/fluanisone and midazolam (2:1 :1, vol/vol/vol), administered intraperitoneally.
  • PBS phosphate buffered saline
  • Histochoice Amresco, Solon, Ohio
  • the descending aorta was dissected free of external fat and connective tissue, cut longitudinally, and mounted en-face lumen side-up on ovalbumin- (Sigma, St. Louis, Missouri) coated slides (termed flat preparation) (Branen et al, 2001).
  • the local Animal Care and Use Committee approved the experimental protocol used in this study.
  • mice received 3 intraperitoneal injections of 1 mg antibody per dose at 25, 26 and 27 weeks of age and were sacrificed 2 weeks after the last injection, at 29 weeks of age.
  • the general health status of the mice was not influenced by the antibody treatment. There were no significant differences among the test and control groups regarding weight and the plasma levels of cholesterol and triacyl glycerol (data not shown).
  • One group of animals were sacrificed at the onset of the experiment and served the purpose to determine a baseline level of plaque burden.
  • the extent of atherosclerosis was measured in Oil Red O stained en-face preparations of the thoracic and abdominal aorta.
  • All test antibodies induced a significant regression of plaque burden in the treated animals as compared to the control antibody and to the baseline value obtained from mice at 25 weeks of age.
  • the other antibodies also reduced plaque burden significantly (p ⁇ 0.01) compared to either the FITC-8 group or the baseline value.
  • Antibodies found in plasma from human individuals and directed against oxidised LDL have been associated with disease extent, progression and degree of activity in many studies (Tsimikas et al, 2001, Salonen et al, 1992, Maggi et al, 1993). Levels of such antibodies may in the future become useful as markers for detecting the presence of vulnerable plaques in cardiovascular patients (Nilsson and Fredriksson, 2004, Nilsson and Kovanen, 2004).
  • HMG-CoA inhibitors HMG-CoA inhibitors
  • HMG-CoA inhibitors are efficient in preventing acute cardiovascular events by reducing plasma cholesterol content and by additional mechanisms, yet to be clarified.
  • Continuous efforts are made to develop new means of treatment, which, rather than replacing statins, would add to their efficacy by using different, complementary mechanisms.
  • a direct, immediately effective antibody therapy could therefore be the answer for the vulnerable patients on the verge of a life-threatening cerebrovascular or cardiac episode.
  • the antibody treatment may be even more effective in humans than in mice.
  • the antibodies that we used were human IgGl antibodies generated against human oxLDL ApoB-100.
  • the homology between human and mouse ApoB-100 is not perfect, impairing to a certain extent human antibody binding to mouse oxLDL.
  • the immune system of the mice reacts to the foreign human protein generating mouse anti -human IgGl antibodies that correlate negatively with the amount of injected antibodies still present in plasma at the time of euthanisation, as we have previously shown (Schipou et al, 2004). These antibodies might reduce the effectiveness of the human IgGl treatment in mice by blocking their binding sites or by inducing their clearance from the circulation.
  • Example 3 Modulation of macrophage inflammatory activity with antibodies against oxidised epitopes on LDL
  • the MCP-I blocking effect of anti-oxApoB-100 IgG was not due to a general cytotoxic effect. Macrophages harvested following treatment with anti-oxApoB- 100 IgG were fully viable as determined by trypan blue staining and subsequent analysis in a light microscope.
  • MCP-I is pivotal for monocyte and macrophage recruitment and migration in health and disease. Specifically, deletion of the monocyte/ macrophage tropic CC chemokine MCP-I (Gu et al, 1998) or its corresponding receptor CCR2 (Boring et al, 1998) protects mice from atherosclerosis in vivo. In vitro stimulation of monocytes with MCP-I was shown to promote monocyte transendothelial migration and in the presence of oxLDL was shown to promote macrophage to foam cell transformation (Tangirala et al, 1997).
  • treatment with anti-oxApoB-100 antibodies may provide a selective inhibition of MCP-I release thus minimizing potential side effects of inhibiting monocyte migration to inflammatory sites unrelated to the atherosclerotic plaque.
  • Example 4 Induction of regression of atherosclerotic plaques in animal model using immunotherapy based on active immunisation
  • LDLR-/- ApoBec mice are fed a high fat diet for 21 weeks starting at week 4.
  • one group of animals is sacrificed and the extent of atherosclerosis in their descending aortas is determined.
  • This group serves as a baseline group, to which the extent of atherosclerosis in other groups can be compared.
  • Test animals, vaccinated with peptide or PBS only, are taken off the high fat diet and given injections for several weeks, after which the animals are sacrificed and the level of atherosclerosis is determined.
  • Example 2 we have demonstrated that the extent of plaque burden is stable over a 4 week period from week 25 to week 29 when the animals are taken off the high fat diet.
  • the analysis revealed that baseline animals had 10% of their descending aorta area covered by plaque at the age of 25 weeks.
  • Vaccinated animals are shown to have a reduced plaque burden compared to the control group and the baseline group. This demonstrates that immunisation against epitopes found on oxidised forms of LDL can lead to a reduction in the burden of preexisting plaques and suggests that vaccination may be an efficient mode for decreasing plaque burden in patients.
  • Oxidatively modified LDL contains phospholipids with platelet-activating factor-like activity and stimulates the growth of smooth muscle cells. J Clin Invest. 1995 Nov;96(5):2322-30

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biochemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Genetics & Genomics (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Vascular Medicine (AREA)
  • Microbiology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Cardiology (AREA)
  • Urology & Nephrology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Mycology (AREA)
  • Epidemiology (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Peptides Or Proteins (AREA)

Abstract

Utilisation d'une immunothérapie contre les lipoprotéines de basse densité (LDL) visant à induire une régression de lésions athérosclérotiques pré-existantes chez un individu. L'immunothérapie en question peut être passive, avec emploi d'anticorps qui se lient aux épitopes présents sur des LDL oxydées, ou bien active via une composition de vaccin induisant une réponse immunitaire contre les épitopes présents sur les LDL oxydées.
PCT/EP2007/001723 2007-02-28 2007-02-28 Lipoprotéines de basse densité oxyde et leurs anticorps pour le traitement de plaques d'athérosclérose WO2008104194A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
PCT/EP2007/001723 WO2008104194A1 (fr) 2007-02-28 2007-02-28 Lipoprotéines de basse densité oxyde et leurs anticorps pour le traitement de plaques d'athérosclérose

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/EP2007/001723 WO2008104194A1 (fr) 2007-02-28 2007-02-28 Lipoprotéines de basse densité oxyde et leurs anticorps pour le traitement de plaques d'athérosclérose

Publications (1)

Publication Number Publication Date
WO2008104194A1 true WO2008104194A1 (fr) 2008-09-04

Family

ID=38294216

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2007/001723 WO2008104194A1 (fr) 2007-02-28 2007-02-28 Lipoprotéines de basse densité oxyde et leurs anticorps pour le traitement de plaques d'athérosclérose

Country Status (1)

Country Link
WO (1) WO2008104194A1 (fr)

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011025978A2 (fr) * 2009-08-28 2011-03-03 Stuart Bunting Méthodes de traitement faisant appel à des anticorps anti-ldl oxydées
EP2310417A1 (fr) * 2008-07-11 2011-04-20 Forskarpatent i Syd AB Protéines conjuguées ou fusionnées à un anticorps spécifique des protéines ldl oxydées
WO2019215300A1 (fr) 2018-05-09 2019-11-14 Medirista Biotechnologies Ab Anticorps destinés à être utilisés en polythérapie
WO2019232081A1 (fr) * 2018-05-29 2019-12-05 Abcentra, Llc Compositions et procédés pour le traitement de la polyarthrite rhumatoïde et de l'athérosclérose accélérée
WO2019232070A1 (fr) * 2018-05-29 2019-12-05 Abcentra, Llc Compositions et procédés de traitement du psoriasis
US10858422B2 (en) 2016-05-31 2020-12-08 Abcentra, Llc Methods for treating systemic lupus erythematosus with an anti-apolipoprotein B antibody
CN118011012A (zh) * 2024-02-19 2024-05-10 中国科学院昆明动物研究所 LL-37-ApoB-100生物标志物及其应用

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002080954A1 (fr) * 2001-04-05 2002-10-17 Forskarpatent I Syd Therapie d'immunisation a base de peptides destinee au traitement d'atherosclerose et developpement d'un dosage a base de peptides permettant de determiner des reponses immunitaires contre la lipoproteine faible densite oxydee
WO2004030607A2 (fr) * 2002-10-04 2004-04-15 Forskarpatent I Syd Ab Therapie d'immunisation passive a base peptidique pour le traitement de l'atherosclerose
WO2007025781A2 (fr) * 2005-09-02 2007-03-08 Bioinvent International Ab Traitement immunotherapeutique

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002080954A1 (fr) * 2001-04-05 2002-10-17 Forskarpatent I Syd Therapie d'immunisation a base de peptides destinee au traitement d'atherosclerose et developpement d'un dosage a base de peptides permettant de determiner des reponses immunitaires contre la lipoproteine faible densite oxydee
WO2004030607A2 (fr) * 2002-10-04 2004-04-15 Forskarpatent I Syd Ab Therapie d'immunisation passive a base peptidique pour le traitement de l'atherosclerose
WO2007025781A2 (fr) * 2005-09-02 2007-03-08 Bioinvent International Ab Traitement immunotherapeutique

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
BINDER C J ET AL: "Pneumococcal vaccination decreases atherosclerotic lesion formation: molecular mimicry between Streptococcus pneumoniae and oxidized LDL", NATURE MEDICINE, NATURE PUBLISHING GROUP, NEW YORK, NY, US, vol. 9, no. 6, June 2003 (2003-06-01), pages 736 - 743, XP002355525, ISSN: 1078-8956 *
FREDRIKSON GUNILLA NORDIN ET AL: "Inhibition of atherosclerosis in apoE-null mice by immunization with apoB-100 peptide sequences", ARTERIOSCLEROSIS, THROMBOSIS, AND VASCULAR BIOLOGY, HIGHWIRE PRESS, PHILADELPHIA, PA, US, vol. 23, no. 5, 1 May 2003 (2003-05-01), pages 879 - 884, XP002420073, ISSN: 1524-4636 *
LIMA JOAO A C ET AL: "Statin-induced cholesterol lowering and plaque regression after 6 months of magnetic resonance imaging-monitored therapy", CIRCULATION, AMERICAN HEART ASSOCIATION, DALLAS, TX, US, vol. 110, no. 16, 19 October 2004 (2004-10-19), pages 2336 - 2341, XP002420074, ISSN: 0009-7322 *
LITTLE M ET AL: "Of mice and men: hybridoma and recombinant antibodies", IMMUNOLOGY TODAY, ELSEVIER PUBLICATIONS, CAMBRIDGE, GB, vol. 21, no. 8, 1 August 2000 (2000-08-01), pages 364 - 370, XP004215163, ISSN: 0167-5699 *
NILSSON J ET AL: "Immunomodulation of atherosclerosis - Implications for vaccine development", ARTERIOSCLEROSIS, THROMBOSIS, AND VASCULAR BIOLOGY, XX, XX, vol. 25, no. 1, January 2005 (2005-01-01), pages 18 - 28, XP002420072, ISSN: 1079-5642 *
NILSSON JAN ET AL: "Oxidized LDL antibodies in treatment and risk assessment of atherosclerosis and associated cardiovascular disease.", CURRENT PHARMACEUTICAL DESIGN 2007, vol. 13, no. 10, 2007, pages 1021 - 1030, XP009087793, ISSN: 1873-4286 *
SCHIOPU A ET AL: "RECOMBINANT HUMAN ANTIBODIES AGAINST ALDEHYDE-MODIFIED APOLIPOPROTEIN B-100 PEPTIDE SEQUENCES INHIBIT ATHEROSCLEROSIS", CIRCULATION, AMERICAN HEART ASSOCIATION, DALLAS, TX, US, vol. 110, no. 14, 5 October 2004 (2004-10-05), pages 2047 - 2052, XP009048754, ISSN: 0009-7322 *
SCHIOPU ALEXANDRU ET AL: "Plaque regression induced by human recombinant antibodies against oxLDL Epitopes in LDLR-/- Apobec mice", CIRCULATION, vol. 112, no. 17, Suppl. S, October 2005 (2005-10-01), & 78TH ANNUAL SCIENTIFIC SESSION OF THE AMERICAN-HEART-ASSOCIATION; DALLAS, TX, USA; NOVEMBER 13 -16, 2005, pages U73, XP009087806, ISSN: 0009-7322 *

Cited By (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2310417A1 (fr) * 2008-07-11 2011-04-20 Forskarpatent i Syd AB Protéines conjuguées ou fusionnées à un anticorps spécifique des protéines ldl oxydées
EP2310417A4 (fr) * 2008-07-11 2012-01-11 Forskarpatent I Syd Ab Protéines conjuguées ou fusionnées à un anticorps spécifique des protéines ldl oxydées
WO2011025978A2 (fr) * 2009-08-28 2011-03-03 Stuart Bunting Méthodes de traitement faisant appel à des anticorps anti-ldl oxydées
WO2011025978A3 (fr) * 2009-08-28 2011-04-21 Stuart Bunting Méthodes de traitement faisant appel à des anticorps anti-ldl oxydées
US10858422B2 (en) 2016-05-31 2020-12-08 Abcentra, Llc Methods for treating systemic lupus erythematosus with an anti-apolipoprotein B antibody
WO2019215300A1 (fr) 2018-05-09 2019-11-14 Medirista Biotechnologies Ab Anticorps destinés à être utilisés en polythérapie
WO2019232081A1 (fr) * 2018-05-29 2019-12-05 Abcentra, Llc Compositions et procédés pour le traitement de la polyarthrite rhumatoïde et de l'athérosclérose accélérée
WO2019232070A1 (fr) * 2018-05-29 2019-12-05 Abcentra, Llc Compositions et procédés de traitement du psoriasis
CN112689512A (zh) * 2018-05-29 2021-04-20 艾比中心有限责任公司 用于治疗银屑病的组合物和方法
US11690912B2 (en) 2018-05-29 2023-07-04 Abcentra, Llc Methods for treatment of rheumatoid arthritis and accelerated atherosclerosis with an anti-Apo B100 antibody
US12016921B2 (en) 2018-05-29 2024-06-25 Abcentra, Llc Methods for treatment of psoriasis with an anti-Apo B100 antibody
CN118011012A (zh) * 2024-02-19 2024-05-10 中国科学院昆明动物研究所 LL-37-ApoB-100生物标志物及其应用

Similar Documents

Publication Publication Date Title
EP1928913B1 (fr) Therapie immunotherapeutique pour l'induction de la regression des plaques atherosclérotiques
ES2896107T3 (es) Métodos para tratar la hiperlipidemia con un inhibidor de ANGPTL8 y un inhibidor de ANGPTL3
US7601353B2 (en) Peptide-based passive immunization therapy for treatment of atherosclerosis
WO2008104194A1 (fr) Lipoprotéines de basse densité oxyde et leurs anticorps pour le traitement de plaques d'athérosclérose
JP2024059787A (ja) Ａｎｇｐｔｌ３阻害剤と組み合わせてｐｃｓｋ９阻害剤を投与することにより高脂血症を有する患者を処置するための方法
JP2006506450A5 (fr)
US20110182851A1 (en) Oxidized ldl specific antibody-fusion and conjugated proteins
AU2003267905B2 (en) Peptide-based passive immunization therapy for treatment of atherosclerosis
RU2789047C2 (ru) Способы лечения аллергии и повышения эффективности аллерген- специфической иммунотерапии путем введения ингибитора ил-4р
EA040479B1 (ru) Способы лечения гиперлипидемии ингибитором angptl8 и ингибитором angptl3

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 07722976

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 07722976

Country of ref document: EP

Kind code of ref document: A1