WO2008100424A2 - Animals and cells with genomic target sites for transposase-mediated transgenesis - Google Patents

Abstract

Animals and cells with genomic target sites for transposase-mediated transgenesis are provided herein. In some embodiments, a transgenic animal containing in its genome a specific transgene target site is provided. In some embodiments, in a transgenic animal containing in its genome a specific transgene target site, the specific transgene target site can include one or more nucleotide sequence repeats that can include one or more transposon insertion sequences capable of recognition by a transposase enzyme and one or more recognition sequences for a DNA-binding polypeptide. In some embodiments, in a transgenic animal containing in its genome a specific transgene target site, the target site can include one or more nucleotide sequence repeats that include one or more transposon insertion sequences capable of recognition by a transposase enzyme and one or more recognition sequences for a DNA binding polypeptide that can be a chimeric polypeptide. In some embodiments, the recognition sequences for a DNA binding polypeptide can be recognition sequence for a transposase enzyme with one or more DNA binding domains.

Description

ANIMALS AND CELLS WITH GENOMIC TARGET SITES FOR TRANSPOSASE-

MEDIATED TRANSGENESIS

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] The present application claims the benefit of the filing date of U.S. Provisional Patent Application Serial No. 60/900,611 , filed on February 9, 2007, which is hereby incorporated by reference in its entirety.

STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT

[0002] This invention was made in part with Government support under IDeA Network of Biomedical Research Excellence/National Institutes of Health Grant RR016467-06. The Government has certain rights in the invention.

FIELD

[0003] The present invention relates to animals containing specific target sites for transgene insertion in their genomes, and to methods for generating such animals. Particular embodiments relate to animals with genomic target sites for transgene insertion by chimeric integrating enzymes.

BACKGROUND

[0004] The generation of transgenic animals and cells has great value in both basic and applied genetic research and in commercial applications. Transgenesis relies on the integration of exogenous nucleic acid into a host cell. Integration can be achieved passively, where insertion of a transgene is mediated by host cell DNA repair mechanisms. However, passive transgenesis occurs at a very low frequency. Transgenesis can also be performed in an active manner, using viruses and viral-based vectors that encode DNA-integrating components. Such vectors are typically introduced at the single-cell embryo stage, and though they raise the efficiency of transgenesis when comparing the numbers of transgenic animals born to total animals born, they result in high rates of embryo lethality and are limited in the amount of transgenic DNA (9.5 kb) that can be carried, due to the limited physical volume of the viral particles. Specialized containment facilities that are necessary for retroviral production also make it prohibitive for many laboratories to utilize these vectors. The potential for recombination events between viral vector and endogenous retroviruses also raises the risk of generating new, more potent viruses. The most significant obstacle to the use of viral and other transgenesis systems in gene therapy and genetic research, however, is the random nature of gene insertion. This randomness introduces the risk of insertional mutagenesis. Such risks are typified by the activation of oncogenes and inactivation of tumor- repressor genes observed in mice. Thus, wider application of transgenic technology will require the development of active transgenesis methods that provide efficient gene integration at nonrandom sites in the genome.

SUMMARY

[0005] Animals and cells with genomic target sites for transposase- mediated transgenesis are provided herein. In some embodiments, a transgenic animal containing in its genome a specific transgene target site is provided. In some embodiments, in a transgenic animal containing in its genome a specific transgene target site, the specific transgene target site can include one or more nucleotide sequence repeats that can include one or more transposon insertion sequences capable of recognition by a transposase enzyme and one or more recognition sequences for a DNA-binding polypeptide. In some embodiments, in a transgenic animal containing in its genome a specific transgene target site, the target site can include one or more nucleotide sequence repeats that include one or more transposon insertion sequences capable of recognition by a transposase enzyme and one or more recognition sequences for a DNA binding polypeptide that can be a chimeric polypeptide. In some embodiments, the recognition sequences for a DNA binding polypeptide can be recognition sequence for a transposase enzyme with one or more DNA binding domains.

[0006] In some embodiments, in a transgenic animal containing in its genome a specific transgene target site, the specific transgene target site can include one or more nucleotide sequence repeats that can include one or more transposon insertion sequences capable of recognition by a transposase enzyme, including, for example, piggyBac, Sleeping Beauty, Mos1 , Tc1/mariner, Tol2, Tc3,

MuA, Himari transposase, and the like. In preferred embodiments, the transposon insertion sequence in the specific transgene target site can be capable of recognition by a piggyBac transposase.

[0007] In some embodiments, in a transgenic animal containing in its genome a specific transgene target site, the target site can include one or more nucleotide sequence repeats that include one or more transposon insertion sequences capable of recognition by a transposase enzyme and one or more recognition sequences for a DNA binding polypeptide that can be a chimeric polypeptide containing a DNA binding domain, including, for example, a zinc finger, helix-turn-helix, leucine zipper, helix-loop-helix, winged helix-turn-helix, homeodomain, basic domain, ribbon-helix-helix, TATA-binding protein domain, beta barrel dimer, ReI homology domain, and the like. In preferred embodiments, in a transgenic animal containing in its genome a specific transgene target site, the target site can include one or more nucleotide sequence repeats that include one or more transposon insertion sequences capable of recognition by a transposase enzyme and one or more recognition sequences for a DNA binding polypeptide that can be a chimeric polypeptide containing a zinc finger domain. In further preferred embodiments, the recognition sequences can be capable of recognition by a chimeric piggyBac transposase with one or more zinc finger domains. In further embodiments, the recognition sequences can be capable of recognition by a chimeric piggyBac transposase with one zinc finger domain.

[0008] In some embodiments, in a transgenic animal containing in its genome a specific transgene target site, in which the target site can include one or more nucleotide sequence repeats that include one or more transposon insertion sequences capable of recognition by a transposase enzyme and one or more recognition sequences for a DNA binding polypeptide, the recognition sequence for a DNA-binding polypeptide can be an Upstream Activating Sequence. In some embodiments, the recognition sequence for a DNA-binding polypeptide can be an Upstream Activating Sequence capable of being recognized by a Gal4 DNA-binding domain. In preferred embodiments, the recognition sequence for a DNA-binding polypeptide can be an Upstream Activating Sequence capable of being recognized by a polypeptide that contains an S. cerevisiae Gal4 DNA-binding domain, whose sequence is provided in SEQ ID NO.: 1. In preferred embodiments, the recognition sequence for a DNA-binding polypeptide can be an Upstream Activating Sequence capable of being recognized by a piggyBac transposase containing an S. cerevisiae Gal4 DNA-binding domain, whose sequence is provided in SEQ ID NO.: 2.

[0009] In some embodiments, in a transgenic animal containing in its genome a specific transgene target site, in which the target site can include one or more nucleotide sequence repeats that include one or more transposon insertion sequences capable of recognition by a transposase enzyme and one or more recognition sequences for a DNA binding polypeptide, the nucletide sequence repeats can include, for example, DNA-binding polypeptide recognition sequences SEQ ID NO.: 3, SEQ ID NO.: 4, SEQ ID NO.: 5, SEQ ID NO.: 6, SEQ ID NO.: 7, SEQ ID NO.: 8 and the like.

[ooio] In some embodiments, in a transgenic animal containing in its genome a specific transgene target site, the target site can include one or more nucleotide sequence repeats that include one or more transposon insertion sequences capable of recognition by a transposase enzyme and one or more recognition sequences for a DNA binding polypeptide that can be a transposase enzyme that is codon-biased for the species of the animal. In some embodiments, the recognition sequence for a DNA-binding polypeptide can be for a codon-biased piggyBac transposase. In preferred embodiments, the recognition sequence for a DNA-binding polypeptide can be for a codon-biased piggyBac transposase with an S. cerevisiae Gal4 DNA-binding domain, whose sequence is provided in SEQ ID NO.: 9.

[ooii] In some embodiments, in a transgenic animal containing in its genome a specific transgene target site, the target site can include one or more nucleotide sequence repeats that include one or more transposon insertion sequences capable of recognition by a transposase enzyme and one or more recognition sequences for a DNA binding polypeptide that can be engineered for greater binding specificity to the recognition sequence. In some embodiments, the recognition sequences are capable of being recognized by a DNA-binding polypeptide with a Gal4 DNA-binding domain engineered for greater binding specificity to the recognition sequence. [0012] In some embodiments, the transgenic animal containing in its genome a specific transgene target site that can include one or more nucleotide sequence repeats that include one or more transposon insertion sequences capable of recognition by a transposase enzyme and one or more recognition sequences for a DNA binding polypeptide, the animal can be a vertebrate or invertebrate. In some embodiments, the transgenic animal can belong to a classification of animals including, for example, nematodes, arthropods, molluscs, echinoderms, annelid worms, and the like. In some embodiments, the transgenic animal can belong to a classification of animals including, for example, mammals, fish, amphibians, reptiles, birds, and the like. In some embodiments, the transgenic animal can belong to a classification of animals including, for example, rodents, cows, pigs, sheep, goats, horses, and the like.

[0013] In some embodiments, in the transgenic animal containing in its genome a specific transgene target site that can include one or more nucleotide sequence repeats that include one or more transposon insertion sequences capable of recognition by a transposase enzyme and one or more recognition sequences for a DNA binding polypeptide, the recognition sequences for a DNA binding polypeptide can be for a chimeric transposase with one or more DNA binding domains fused to the N-terminus of the transposase. In other embodiments, the recognition sequences for a DNA binding polypeptide can be for a chimeric transposase with one or more DNA binding domains fused to the C-terminus of the transposase. In other embodiments, the recognition sequences for a DNA binding polypeptide can be for a chimeric transposase with one or more DNA binding domains fused to both the N- and C-terminus of the transposase.

[0014] In some embodiments, in the transgenic animal containing in its genome a specific transgene target site that can include one or more nucleotide sequence repeats that include one or more transposon insertion sequences capable of recognition by a transposase enzyme and one or more recognition sequences for a DNA binding polypeptide, the transposon insertion sequences can be positioned upstream, downstream, or both upstream and downstream from the recognition sequences for a DNA-binding polypeptide. [0015] Also provided herein are methods of producing a transgenic animal containing in its genome a specific transgene target site that can include one or more nucleotide sequence repeats that include one or more transposon insertion sequences capable of recognition by a transposase enzyme and one or more recognition sequences for a DNA binding polypeptide. Methods of producing the transgenic animal include the steps of i) obtaining two complementary oligonucleotides that include one or more transposon insertion sequences capable of recognition by a transposase enzyme, one or more recognition sequences for a DNA-binding polypeptide, and at each of their 3-prime ends a unique restriction enzyme cleavage sequence, ii) combining the complementary oligonucleotides to form a mixture in which the oligonucleotides form a double-stranded nucleotide having at each end an overhang that includes the unique restriction enzyme cleavage sequence, iii) contacting the mixture with DNA ligase, thereby generating concatemeric DNA molecules of various lengths that consist of repeats of the oligonucleotide sequence, iv) introducing the concatemeric DNA into an animal embryo or blastomere cell thereof, v) testing for the presence of the concatemeric DNA in the genome of an animal formed from the embryo, vi) mating the animal with a wild-type animal of the opposite sex to generate offspring, vii) testing for the presence of the concatemeric DNA in the genome of the offspring, viii) self-crossing sibling offspring containing the concatemeric DNA in their genomes to generate offspring homozygous for concatemeric DNA in their genomes; and ix) repeating steps (vi) through (viii) with the homozygous offspring to generate animals with single, stable genomic loci that include a transgene target site of unchanging repeat length.

[0016] In some embodiments, an isolated animal cell in culture containing in its genome a specific transgene target site is provided. In an isolated animal cell containing in its genome a specific transgene target site, the specific transgene target site can include one or more nucleotide sequence repeats that can include one or more transposon insertion sequences capable of recognition by a transposase enzyme and one or more recognition sequences for a DNA-binding polypeptide. In some embodiments, in an isolated animal cell containing in its genome a specific transgene target site, the target site can include one or more nucleotide sequence repeats that include one or more transposon insertion sequences capable of recognition by a transposase enzyme and one or more recognition sequences for a DNA binding polypeptide that can be a chimeric polypeptide. In some embodiments, the recognition sequences for a DNA binding polypeptide can be recognition sequences for a transposase enzyme with one or more DNA binding domains.

[0017 ] In some embodiments, in an isolated animal cell, containing in its genome a specific transgene target site, the specific transgene target site can include one or more nucleotide sequence repeats that can include one or more transposon insertion sequences capable of recognition by a transposase enzyme, including, for example, piggyBac, Sleeping Beauty, Mos1 , Tc1/mariner, Tol2, Tc3, MuA, Himari transposase, and the like. In preferred embodiments, the transposon insertion sequence in the specific transgene target site can be capable of recognition by a piggyBac transposase.

[0018] In some embodiments, in an isolated animal cell containing in its genome a specific transgene target site, the target site can include one or more nucleotide sequence repeats that include one or more transposon insertion sequences capable of recognition by a transposase enzyme and one or more recognition sequences for a DNA binding polypeptide that can be a chimeric polypeptide containing a DNA binding domain, including, for example, a zinc finger, helix-turn-helix, leucine zipper, helix-loop-helix, winged helix-turn-helix, homeodomain, basic domain, ribbon-helix-helix, TATA-binding protein domain, beta barrel dimer, ReI homology domain, and the like. In preferred embodiments, in an isolated animal cell containing in its genome a specific transgene target site, the target site can include one or more nucleotide sequence repeats that include one or more transposon insertion sequences capable of recognition by a transposase enzyme and one or more recognition sequences for a DNA binding polypeptide that can be a chimeric polypeptide containing a zinc finger domain. In further preferred embodiments, the recognition sequences can be capable of recognition by a chimeric piggyBac transposase with one or more zinc finger domains. In further embodiments, the recognition sequences can be capable of recognition by a chimeric piggyBac transposase with one zinc finger domain. [0019] In some embodiments, in an isolated animal cell containing in its genome a specific transgene target site, in which the target site can include one or more nucleotide sequence repeats that include one or more transposon insertion sequences capable of recognition by a transposase enzyme and one or more recognition sequences for a DNA binding polypeptide, the recognition sequence for a DNA-binding polypeptide can be an Upstream Activating Sequence. In some embodiments, the recognition sequence for a DNA-binding polypeptide can be an Upstream Activating Sequence capable of being recognized by a Gal4 DNA-binding domain. In preferred embodiments, the recognition sequence for a DNA-binding polypeptide can be an Upstream Activating Sequence capable of being recognized by a polypeptide that contains an S. cerevisiae Gal4 DNA-binding domain, whose sequence is provided in SEQ ID NO.: 1. In preferred embodiments, the recognition sequence for a DNA-binding polypeptide can be an Upstream Activating Sequence capable of being recognized by a piggyBac transposase containing an S. cerevisiae Gal4 DNA-binding domain, whose sequence is provided in SEQ ID NO.: 2.

[0020] In some embodiments, in an isolated animal cell containing in its genome a specific transgene target site, in which the target site can include one or more nucleotide sequence repeats that include one or more transposon insertion sequences capable of recognition by a transposase enzyme and one or more recognition sequences for a DNA binding polypeptide, the nucletide sequence repeats can include, for example, DNA-binding polypeptide recognition sequences SEQ ID NO.: 3, SEQ ID NO.: 4, SEQ ID NO.: 5, SEQ ID NO.: 6, SEQ ID NO.: 7, SEQ ID NO.: 8 and the like.

[0021] In some embodiments, in an isolated animal cell containing in its genome a specific transgene target site, the target site can include one or more nucleotide sequence repeats that include one or more transposon insertion sequences capable of recognition by a transposase enzyme and one or more recognition sequences for a DNA binding polypeptide that can be a transposase enzyme that is codon-biased for the species of the animal cell. In some embodiments, the recognition sequence for a DNA-binding polypeptide can be for a codon-biased piggyBac transposase. In preferred embodiments, the recognition sequence for a DNA-binding polypeptide can be for a codon-biased piggyBac transposase with an S. cerevisiae Gal4 DNA-binding domain, whose sequence is provided in SEQ ID NO.: 9.

[0022] In some embodiments, in an isolated animal cell containing in its genome a specific transgene target site, the target site can include one or more nucleotide sequence repeats that include one or more transposon insertion sequences capable of recognition by a transposase enzyme and one or more recognition sequences for a DNA binding polypeptide that can be engineered for greater binding specificity to the recognition sequence. In some embodiments, the recognition sequences are capable of being recognized by a DNA-binding polypeptide with a Gal4 DNA-binding domain engineered for greater binding specificity to the recognition sequence.

[0023] In some embodiments, the isolated animal cell containing in its genome a specific transgene target site that can include one or more nucleotide sequence repeats that include one or more transposon insertion sequences capable of recognition by a transposase enzyme and one or more recognition sequences for a DNA binding polypeptide, the isolated animal cell can be a vertebrate or invertebrate cell. In some embodiments, the isolated animal cell can be derived from a classification of animals including, for example, nematodes, arthropods, molluscs, echinoderms, annelid worms, and the like. In some embodiments, the isolated animal cell can be derived from a classification of animals including, for example, mammals, fish, amphibians, reptiles, birds, and the like. In some embodiments, the isolated animal cell can be derived from a classification of animals including, for example, rodents, cows, pigs, sheep, goats, horses, and the like.

[0024] In some embodiments, in the isolated animal cell containing in its genome a specific transgene target site that can include one or more nucleotide sequence repeats that include one or more transposon insertion sequences capable of recognition by a transposase enzyme and one or more recognition sequences for a DNA binding polypeptide, the recognition sequences for a DNA binding polypeptide can be for a chimeric transposase with one or more DNA binding domains fused to the N-terminus of the transposase. In other embodiments, the recognition sequences for a DNA binding polypeptide can be for a chimeric transposase with one or more DNA binding domains fused to the C-terminus of the transposase. In other embodiments, the recognition sequences for a DNA binding polypeptide can be for a chimeric transposase with one or more DNA binding domains fused to both the N- and C-terminus of the transposase.

[0025] In some embodiments, in the isolated animal cell containing in its genome a specific transgene target site that can include one or more nucleotide sequence repeats that include one or more transposon insertion sequences capable of recognition by a transposase enzyme and one or more recognition sequences for a DNA binding polypeptide, the transposon insertion sequences can be positioned upstream, downstream, or both upstream and downstream from the recognition sequences for a DNA-binding polypeptide.

[0026] Also provided herein are methods of producing an isolated non- human animal cell in containing in its genome a specific transgene target site that can include one or more nucleotide sequence repeats that include one or more transposon insertion sequences capable of recognition by a transposase enzyme and one or more recognition sequences for a DNA binding polypeptide. Methods of producing the isolated non-human animal cell include the steps of i) obtaining two complementary oligonucleotides that include one or more transposon insertion sequences capable of recognition by a transposase enzyme, one or more recognition sequences for a DNA-binding polypeptide, and at each of their 3-prime ends a unique restriction enzyme cleavage sequence, ii) combining the complementary oligonucleotides to form a mixture in which the oligonucleotides form a double-stranded nucleotide having at each end an overhang that includes the unique restriction enzyme cleavage sequence, iii) contacting the mixture with DNA ligase, thereby generating concatemeric DNA molecules of various lengths that consist of repeats of the oligonucleotide sequence, iv) introducing the concatemeric DNA into an animal embryo or blastomere cell thereof, v) testing for the presence of the concatemeric DNA in the genome of an animal formed from the embryo, vi) mating the animal with a wild-type animal of the opposite sex to generate offspring, vii) testing for the presence of the concatemeric DNA in the genome of the offspring, viii) self-crossing sibling offspring containing the concatemeric DNA in their genomes to generate offspring homozygous for concatemeric DNA in their genomes, ix) repeating steps (vi) through (viii) with the homozygous offspring to generate animals with single, stable genomic loci that include a transgene target site of unchanging repeat length, x) crossing the animal with a sibling of the opposite sex homozygous for the same transgene integration site, xi) obtaining early embryos from the female of the mating pair, xii) isolating embryonic stem cells from the embryos, and xiii) serially cultivating the embryonic stem cells in culture until the emmergence of an immortalized line of cells that contain in their genome the specific transgene target site introduced into the non-human animal generated according to steps (i) through (ix).

[0027] Also provided herein are methods of producing an isolated human or non-human animal cell in containing in its genome a specific transgene target site that can include one or more nucleotide sequence repeats that include one or more transposon insertion sequences capable of recognition by a transposase enzyme and one or more recognition sequences for a DNA binding polypeptide. Methods of producing the isolated human or non-human animal cell include the steps of i) obtaining two complementary oligonucleotides that include one or more transposon insertion sequences capable of recognition by a transposase enzyme, one or more recognition sequences for a DNA-binding polypeptide, and at each of their 3-prime ends a unique restriction enzyme cleavage sequence, ii) combining the complementary oligonucleotides to form a mixture in which the oligonucleotides form a double-stranded nucleotide having at each end an overhang that includes the unique restriction enzyme cleavage sequence, iii) contacting the mixture with DNA ligase, thereby generating concatemeric DNA molecules of various lengths that consist of repeats of the oligonucleotide sequence, iv) introducing the concatemeric DNA in combination with a separate nucleic acid encoding a selectable marker gene into an isolated animal cell in culture, v) serially cultivating the cells under conditions selective for expression of the selectable marker gene, vi) producing a clonal cell line from a surviving cell, vii) testing for the presence of the concatemeric DNA containing the specific transgene target site in the cells of the clonal cell line, and vii) further serially cultivating cells of the clonal cell line to generate cells that contain in their genome a single locus of a transgene target site of unchanging repeat length. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Those of skill in the art will understand that the drawings, described below, are for illustrative purposes only. The drawings are not intended to limit the scope of the present teachings in any way.

[0029] Figure 1 depicts a single polyUAS tandem array containing six UAS recognition sequences for the S. cerevisiae Gal4 DNA-binding domain and a TTAATTAA sequence (Pad restriction enzyme recognition sequence) carrying two TTAA insertion sites for piggyBac transposase (A), oligonucleotides used to create this sequence (B), and the concatemeric repeat sequence generated by ligation of a mixture of these oligonucleotides (C).

[0030] Figure 2 depicts a DNA agarose gel showing polyUAS concatemeric DNA (right lane; left lane shows DNA size markers).

[0031] Figure 3 depicts a DNA agarose gel showing PCR-amplified polyUAS DNA in the genome of a founder F₀ polyUAS female mouse pup.

[0032] Figure 4 depicts a DNA agarose gel showing PCR-amplified polyUAS DNA in the genomes of six Fi offspring of the F₀ founder polyUAS mouse from Figure 3.

[0033] Figure 5 depicts the plasmid designated pMMK-1 containing both the transposase gene and the transposon construct, including between its 5' and 3' terminal repeats (TRs) the gene for EGFP driven by the CAG promoter and the pSV40-hygromycin and CoIEI kanamycin resistance genes. The piggyBac transposase gene is driven by the CAG promoter.

[0034] Figure 6 depicts transgenic mice pups examined for EGFP expression in their skin by epifluorescence.

[0035] Figure 7 shows a schematic of the procedure for transposase- mediated gene insertion in polyUAS fruit flies.

[0036] Figure 8 depicts a diagram of transgenesis using a site-directed chimeric transposase. A single plasmid encoding a transgene and a chimeric, site- selective transposase, both under the control of an enhancer and promoter, is transfected into a cell. The transposase becomes expressed, binds the inverted repeats (IR's) flanking the transgene, and excises and directs insertion of the transgene into a specific site in the cell's genomic DNA. E,P=Enhancer, Promoter

[0037] Figure 9 depicts a schematic diagram of an interplasmid transposition assay used to test the activity of chimeric Mos1 and piggyBac transposases.

[0038] Figure 10 depicts a map of a target plasmid for transgene insertion by a chimeric Gal4-Mos1 transposase.

[0039] Figure 11 depicts a map of a target plasmid for transgene insertion by a chimeric Gal4-piggyBac transposase.

[0040] Figure 12 depicts the transposition activity of chimeric transposases containing N-terminal GAL4 DNA binding domains (A). G/KLΛ-piggyBac retains the activity of its non-chimeric, wild type counterpart, while GAL4-SB77 and GAL4-7O/2 have negligible activity (B).

[0041] Figure 13 shows representations of two-plasmid transposon systems used to directly compare the genomic integration efficiencies of piggyBac and three other transposases. Each transposase was encoded on a helper plasmid (A), each of which was cotransfected into cultured mammalian cells along with a donor plasmid (B). The number of cell clones resistant to the antibiotic hygromycin was then measured to reveal the efficiency of genomic insertion of the pSV40- hygromycin resistance gene on the donor plasmid by each of the transposases.

[0042] Figure 14 shows the high transposition activity of piggyBac transposase relative to three other transposases, Sleeping Beauty (SB11), Mos1, and Tol2, in four different mammalian cell lines, (A) HeLa, (B) H1299, (C) HEK293, and (D) CHO cells, each transfected with the plasmids from Figure 5. (E) An example of hygromycin-resistant HEK293 cells transfected with piggyBac, Tol2, and SB11 transposon systems (from left to right), and their controls, stained for visibility. (F) PCR-based detection of transposon sequences excised from the donor plasmid in vivo by the transposase indicated, showing excision by SB11 (left) and piggyBac (middle), but not by Mos1 (right).

[0043] Figure 15 depicts the transposition activity of SB11 (A), Tol2 (B), and piggyBac (C and D) at various ratios of helper to donor plasmid. The activities of SB11 and piggyBac both peak at certain ratios and then decrease as the amount of helper plasmid increases. Tol2 does not exhibit such overproduction inhibition, and its activity continues to rise as helper plasmid is increased.

DETAILED DESCRIPTION

[0044] Transgenic animals and cells have many uses including genetic research, gene therapy, livestock improvement, and the production of therapeutic and non-therapeutic molecules. Embodiments of the invention encompass transgenic animals and cells containing genomic target sites for site-directed transposase-mediated transgenesis. Embodiments of the invention provide methods for generating transgenic animals and cells containing genomic target sites for site- directed transposase-mediated transgenesis.

[0045] Transposons have many applications in genetic manipulation of a host genome, including transgene delivery and insertional mutagenesis. However, correct gene expression is critical for an animal's proper development and health, as aberrant gene expression can lead to deformations, disorders, and genetic diseases. Aspects of the invention are directed to methods of reducing the risks of genetic disruption associated with many current methods of transgenesis by utilizing genomic target sites for transposon insertion by chimeric transposases.

[0046] The three DNA requirements for genomic integration of a viral and non-viral transposons are (1) the sequence of the transposon DNA, (2) a local genomic host DNA structure, and (3) the associated endogenous DNA-binding proteins (Holmes-Son, M. L., Appa, R. S., and Chow, S. A. [2001] "Molecular genetics and target site specificity of retroviral integration." Adv. Genet. 43:33-69). For integration to occur, a DNA-recombining enzyme is required to mediate the process. This enzyme can be, for example, a transposase, integrase, or a site- specific recombinase. Site-specific recombinases mediate recombination, and some do not require cofactors, which allows them to be active in cells of other species. For example, Cre recombinase, although derived from Escherichia coli phage P1 , efficiently mediates recombination in plant, yeast, and mammalian cells (Sauer, B. [1994] "Site-specific recombination: developments and applications." Cυrr. Opin. Biotechnol. 5:521-527). Site-selective recombinases such as FLP₁ Cre, and β- recombinase perform both integration and excision efficiently with the same target sites; however, the net integration frequency is low (for example, 0.03% for Cre) (Sauer, B. [1994] "Site-specific recombination: developments and applications." Curr. Opin. Biotechnol. 5:521-527; Diaz, V., et al., [1999] "The prokaryotic beta- recombinase catalyzes site-specific recombination in mammalian cells." J. Biol. Chem. 274:6634-6640; O'Gorman, S., Fox, D. T., and Wahl, G. M. [1991] "Recombinase-mediated gene activation and site-specific integration in mammalian cells." Science 251 :1351-1355).

[0047] Limitations of viral vectors such as pathogenicity, expense in production, and systemic instability have proved to be major obstacles to the use of viral based systems. Re-administration of viral based vectors can promote immune responses that can result in life threatening systemic effects and limit gene-transfer efficacy (Kay, M. A., et al., [1997] "Transient immunomodulation with anti-CD40 ligand antibody and CTLA4lg enhances persistence and secondary adenovirus- mediated gene transfer into mouse liver." Proc. Natl. Acad. Sci. U.S.A. 94:4684- 4691 ; Hernandez, Y. J., et al., [1999] "Latent adeno-associated virus infection elicits humoral but not cell-mediated immune responses in a nonhuman primate model." J. Virol. 73:8549-8558). Non-viral vectors (lipid-based, polymer-based, lipid-polymer- based, and polylysine-based) are a synthetic means of encapsulating transgenic DNA for delivery to the cellular target. In contrast to viral vectors, non-viral vectors are safer to prepare. The risk of pathogenic and immunologic complications is diminished. Non-viral vectors have been designed by modifying the surface of the non-viral vector for targeted therapy (Lestina, B. J., et al., [2002] "Surface modification of liposomes for selective cell targeting in cardiovascular drug delivery." J. Control Release 78:235-247; Moreira, J. N., Gaspar, R., and Allen, T, M. [2001] "Targeting stealth liposomes in a murine model of human small cell lung cancer." Biochim. Biophys. Acta. 1515:167-176; Xu, L., et al., [2001] "Systemic p53 gene therapy of cancer with immunolipoplexes targeted by anti-transferrin receptor scFv." MoI. Med. 7:723-734; Sudhan Shaik, M., Kanikkannan, N., and Singh, M. [2001] "Conjugation of anti-My9 antibody to stealth monensin liposomes and the effect of conjugated liposomes on the cytotoxicity of immunotoxin." J. Control Release 76:285-295; Li, X., et al., [2001] "Single-chain antibody-mediated gene delivery into ErbB2-positive human breast cancer cells." Cancer Gene Then 8:555-565; Park, J. W., et al., [2001] "Tumor targeting using anti-her2 immunoliposomes." J. Control Release 74:95-113). Liposomes are typically internalized into endosomes, which are then frequently directed to lysosomes, in which the transposon-carrying plasmid is degraded. Endosomal disruption factors and nuclear localization signals have been employed in these vectors. However, the lipoplexes (plasmid DNA and liposome) are primarily only able to transfect dividing cells unless a nuclear localizing factor is present or interacts with the vector (Kaneda, Y., Iwai, K., and Uchida, T. [1989] "Increased expression of DNA cointroduced with nuclear protein in adult rat liver." Science 243:375-378). Furthermore, efficient host integration does not occur except in transposon-based plasmids (Izsvak, Z., Ivies, Z., and Plasterk, R. H. [2000] "Sleeping Beauty, a wide host-range transposon vector for genetic transformation in vertebrates." J. MoI. Biol. 302:93-102; Sauer, B. [1994] "Site-specific recombination: developments and applications." Curr. Opin. Biotechnol. 5:521-527; Diaz, V., et al., [1999] "The prokaryotic beta-recombinase catalyzes site-specific recombination in mammalian cells." J. Biol. Chem. 274:6634-6640; O'Gorman, S., Fox, D. T., and Wahl, G. M. [1991] "Recombinase-mediated gene activation and site-specific integration in mammalian cells." Science 251 :1351-1355).

[0048] Embodiments of the invention relate to the discovery that the piggyBac transposase of the cabbage looper moth is able to effectively mediate transgenesis in mammalian cells. PiggyBac is the most effective transposase for transforming human cell lines when tested side by side in these cells with other transposases commonly used (Sleeping Beauty [SB11], Tol2 and Mos1) (Wu, S. C- Y., et al., P.N.A.S. [2006] 103[41]:15008-15013). Preferred animals and cells of the current invention contain in their genomes transposon insertion sites that contain 1) recognition sequences capable of recruiting a DNA-binding domain-p/ggrySac transposase chimeric polypeptide, and 2) one or more TTAA insertion sequences, which are the natural integration sites utilized by piggyBac transposase.

[0049] The efficiency of transposon integration can vary substantially among cell lines, suggesting the involvement of host factors. The requirement of host factors for integration of transposon DNA indicates that a host DNA directing factor is necessary for efficient integration by acting to bring the transposon- transposase complex into close proximity to host DNA. The requirement for a host DNA-directing factor has been established in retroviruses and retroviral-like retrotransposons. For example, the yeast retrovirus-like element Ty3 inserts at the transcription start sites of genes transcribed by RNA polymerase III because of its interaction with this complex (Kirchner, J., Connolly, C. M., and Sandmeyer, S. B. Science 267, 1488-1491 [1995]). The integrase protein of the human immunodeficieny virus interacts with the endogenous human protein integrase- interacting 1 to stimulate integration in vitro, suggesting that it may do the same in vivo (Morozov, A., Yung, E., and Kalpana, G. V. [1998] Proc. Natl. Acad. Sci. USA 95: 1120-1125; Kalpana, G. V., et al., [1994] "Binding and stimulation of HIV- 1 integrase by a human homolog of yeast transcription factor snfδ." Science 266:2002- 2006). In fact, Tc1/mariner transposases also have DNA binding domains. However, these DNA binding domains do not appear to be site selective (Yant, S. R., et al., [2000] "Somatic integration and long-term transgene expression in normal and haemophilic mice using a DNA transposon system." Nat. Genet. 25:35-41), possibly lack strong recognition sites in certain host genomes, and may require other host proteins for efficient integration that dock the transposon-transposase complex to the host DNA.

[0050] In many cases, the host does not possess the DNA sequence recognized by the transposase or an endogenous factor that can recruit the transposon-transposase complex to the host DNA. Thus, the efficiency of integration in these hosts will be markedly reduced. Furthermore, even if the transposon- transposase complex is docked to the host DNA, integration may still not occur because the DNA site has to be permissive. Embodiments of the current invention overcome the problems associated with the currently known non-viral vector systems. The transgenic animals and cells of the invention, containing genomic target sites for transposase-mediated transposon insertion, provide means for chimeric transposase enzymes to catalyze site-selective integration of exogenous transposon DNA into the genome of these animals and cells.

[0051] The transgenic animals and isolated cells of the invention contain in their genomes transposon insertion target sites that contain recognition sequences for DNA-binding domains. DNA-binding domains are typically derived from DNA- binding proteins. Such DNA-binding domains are known to function heterologously in combination with other functional protein domains by maintaining the ability to bind the natural DNA recognition sequence (see, e.g., Brent and Ptashne, 1985, Ce//, 43:729-736 incorporated herein by reference in its entirety). For example, hormone receptors are known to have interchangeable DNA-binding domains that function in chimeric proteins (see, e.g., U.S. Pat. No. 4,981 ,784; and Evans, R., 1988, Science, 240:889-895 incorporated by reference herein in its entirety).

[0052] In preferred embodiments of the invention, transgenic animals and cells contain in their genomes transposon insertion target sites that contain recognition sequences for zinc finger DNA-binding domains. The recognition domain of ZFPs is composed of two or more zinc fingers; each finger recognizes and binds to a three base pair sequence of DNA and multiple fingers can be linked together to more precisely recognize longer stretches of DNA. Transposon insertion target sites are inserted into the genome of the animals and cells of the invention for the purpose of recruiting chimeric transposon-integrating transposases containing one or more such zinc finger domains, thus enabling transposon integration at arbitrarily chosen target sites. Potential target sites can be selected by choosing specific animals or cell lines that have been made transgenic for the transposon insertion sites according to the methods disclosed herein, but where the transposon insertion has occurred at a genomic location that does not produce any detectable disruption to the sequence or expression patterns of endogenous genes. Suitable zinc finger DNA-binding proteins provided for use herein include but are not limited to Gal4, PPR1 , Zif268, GLI, XFin, Hapi p, YRM1 , FCR1 , YRR1 , Grt1 , UME6, YaHp, CRG1 , UGA3, ThM , THI2, SirZ, CMR1 , Yrmi p, NirA, CYP1 , Sud , OefC, WaM , PRO1 , RGT1 , Mut3p, Pigi p, Ydr303cp, LAC9, RDS2, AfIR, Trm1 , Snail, REX1 , Glis2, L40E, IKKgamma, INSM1 , RREB1 , MCPIP1 , MCPIP2, MCPIP3, MCPIP4, Zfp191 , ZNF418, KRAB, Ciz1 , Thapi , EGR3, PARP-1 , Trpsi , CaKRI , RanBP2, A20, LIN- 11 , Isl1 , MEC-3, PINCH, Myeloid translocation protein 8, Nervy, DEAF-1 , BS69, KAP-1 , PML, Ing2 (inhibitor of growth protein 2), BPTF, Pygopus (Wnt signalling pathway), WSTF transcription factor, Datfl (Death-associated transcription factor 1 ), CBP acetlytransferase, and the like. These proteins may be found throughout the literature. See for example Klug and Rhodes (1987), Trends Biochem. Sci., 12:464; Jacobs and Michaels (1990), New Biol., 2:583; and Jacobs (1992), EMBO J., 11 :4507-4517 (each of which is incorporated herein by reference in its entirety). Embodiments of the present invention relate to the discovery that the fusion of a zinc finger domain to the N-terminus of the cabbage looper moth piggyBac transposase gene does not interfere with the activity of the protein in HEK293 cells (human embryonic kidney cells), whereas the same zinc finger domain addition to the N- terminus of Sleeping Beauty or Tol2 renders these transposases inactive in these cells (Wu, S.C.-Y., et al., P.N.A.S. [2006] 103[41]:15008-15013). Preferred embodiments of the invention encompass the recruitment of chimeric piggyBac transposases that possess one or more zinc finger DNA binding domains of transcription factors to specific genomic transposon insertion sites. In preferred embodiments, the animals and cells of the invention posess in their genomes transposon insertion sites containing recognition sequences for a chimeric piggyBac transposase containing a S. cerevisiae Gal4 zinc finger domain fused to its N- terminus.

[0053] The animals and cells of the present invention can include in their genomes transposon target sites that contain recognition sequences for a well- known class of proteins that are able to directly bind DNA and perform a variety of functions, such as facilitate initiation of transcription or repression of transcription. These recognition sequences DNA-binding proteins can include, but are not limited to, recognition sequences for transcription control proteins (for example, transcription factors and the like [Conaway and Conaway, 1994, "Transcription Mechanisms and Regulation", Raven Press Series on Molecular and Cellular Biology, Vol. 3, Raven Press, Ltd., New York, N. Y.; incorporated herein by reference in its entirety]); recombination enzymes (for example hin recombinase, and the like); and DNA modifying enzymes (for example, restriction enzymes, and the like).

[0054] The animals and cells of the present invention can include in their genomes transposon target sites that contain recognition sequences for DNA- binding domains of transcription factors. These recognition sequences for transcription factors can include, but are not limited to, recognition sequences for homeobox proteins, zinc finger proteins, hormone receptors, helix-turn-helix proteins, helix-loop-helix proteins, basic-Zip proteins (bZip), beta-ribbon factors, leucine zipper proteins, winged helix-tum-helix proteins, basic domain proteins, ribbon-helix-helix proteins, TATA-binding protein domain proteins, beta barrel dimer proteins, ReI homology domain proteins, and the like. See, for example, Harrison, S., "A Structural Taxonomy of DNA-binding Domains," Nature, 353:715-719.

[0055] The animals and cells of the present invention can include in their genomes transposon target sites that contain recognition sequences for DNA- binding domains of Homeobox DNA-binding proteins. These recognition sequences can include, but are not limited to, recognition sequences for HOX, STF-1 (Leonard et al., 1993, MoI. Endo., 7:1275-1283), Antp, Mat, alpha-2, INV, and the like (see, also, Scott et al. [1989], Biochem. Biophys. Acta, 989:25-48). A 76-amino acid fragment of somatostatin transactivating factor-1 , STF-1 (corresponding to amino acids 140-215, and containing the STF-1 homeodomain), binds DNA as tightly as wild-type STF-1 (Leonard et al., 1993, MoI. Endo., 7:1275-1283). In some transgenic animal and cell embodiments of the invention, the animals or cells contain in their genomes transposon insertion target sites that contain recognition sequences for chimeric integrating enzymes containing STF-1 or the 76-amino acid fragment thereof.

[0056] The animals and cells of the present invention can include in their genomes transposon target sites that contain recognition sequences for DNA- binding domains of hormone receptor DNA-binding proteins. These recognition sequences can include, but are not limited to, recognition sequences for glucocorticoid receptor, thyroid hormone receptor, and estrogen receptor. Use of these hormone receptor DNA-binding proteins is described in U.S. Patent. Nos. 4,981 ,784; 5,171 ,671 ; and 5,071 ,773, each of which is incorporated herein by reference in its entirety.

[0057] The animals and cells of the present invention can include in their genomes transposon target sites that contain recognition sequences for DNA- binding proteins containing helix-turn-helix DNA-binding domains. These recognition sequences can include, but are not limited to, recognition sequences for lambda- repressor, cro-repressor, 434 repressor, and 434-cro. Use of these helix-turn-helix DNA-binding proteins is described in Pabo and Sauer, 1984, Annu. Rev. Biochem., 53:293-321 , incorporated herein by reference in its entirety.

[0058] The animals and cells of the present invention can include in their genomes transposon target sites that contain recognition sequences for DNA- binding proteins containing helix-loop-helix DNA-binding domains. These recognition sequences can include, but are not limited to, recognition sequences for MRF4 (Block et al., 1992, MoI. and Cell Biol., 12(6): 2484-2492), CTF4 (Tsay et al., 1992, NAR, 20(10): 2624), NSCL, PAL2, and USF. (See, for review, Wright [1992], Current Opinion in Genetics and Development, 2(2):243-248; Kadesch, T. [1992], Immun. Today, 13[1]: 31-36; and Garell and Campuzano [1991], Bioessays, 13[1O]: 493-498). Each of the references cited in this paragraph describe helix-loop-helix DNA-binding proteins, and each of these references is incorporated herein by reference in its entirety.

[0059] The animals and cells of the present invention can include in their genomes transposon target sites that contain recognition sequences for DNA- binding proteins containing basic Zip DNA-binding domains. These recognition sequences can include, but are not limited to, recognition sequences for GCN4, fos, and jun (see, for review, Lamb and McKnight, 1991 , Trends Biochem. Sci., 16:417- 422, incorporated herein by reference in its entirety). Exemplary beta-ribbon factors contemplated herein include, but are not limited to, Met-J, ARC, and MNT.

[0060] The animals and cells of the present invention can include in their genomes transposon target sites that contain recognition sequences for DNA- binding domains of restriction enzymes. These recognition sequences can include, but are not limited to, recognition sequences for the hin family of recombinases (for example hin, gin, pin, and cin; see, Feng et al., 1994, Science, 263:348-355, incorporated herein by reference in its entirety), the lambda-integrase family, flp- recombinase, TN916 transposons, and the resolvase family (for example, TN21 resolvase).

[0061] The animals and cells of the present invention can include in their genomes transposon target sites that contain recognition sequences for DNA- binding domains of DNA-modifying enzymes. These recognition sequences can include, but are not limited to, recognition sequences for restriction enzymes, DNA- repair enzymes, and site-specific methylases. Restriction enzymes can be modified using methods well-known in the art to remove the restriction digest function from the protein while maintaining the DNA-binding function (see for example King et al., 1989, J. Biol. Chem., 264 [20]:11807-11815, incorporated herein by reference in its entirety). Generation of animals and cells with transposon insertion sites containing recognition sequences to DNA binding domains of DNA-modifying enzymes can therefore be performed for the purpose of recruiting chimeric transposase enzymes containing one or more DNA-binding domains of a restriction enzyme. Thus, recognition sequences for any restriction enzyme can be present in the transposon insertion site placed into the genome of the animals and cells of the invention. Chimeric transposases containing DNA-binding domains from restriction enzyme recognizing a rare DNA sequence can be used with the animals and cells of the invention. This facilitates the recruitment of the chimeric transposase to relatively few sites in the genome of the animals and cells of the invention when these rare DNA recognition sequences are placed into the genome of the animals or cells using the methods of the invention.

[0062] Some embodiments of the invention relate to animals and cells containing transposon insertion sites with new target recognition sequences that are able to recognize existing DNA-binding domains. Embodiments of the invention also encompass animals and cells containing transposon insertion sites with target recognition sequences that are capable of recruiting chimeric transposases with engineered ZFPs with DNA-interacting amino acid residues that are modified to recognize these sequences. It has been found that in vitro evolution methods can be applied to modify existing DNA-binding domains in a manner that can alter their binding specificity (for teachings on modification of existing DNA-binding domains,. see for example Devlin et al., 1990, Science, 249:404-406; and Scott and Smith, 1990, Science, 249:386-390, each of which is incorporated herein by reference in its entirety).

[0063] Disclosed herein are animals and cells containing transposon insertion sites with recognition sequences for a chimeric transposase integrating enzyme. It is understood and contemplated herein that this chimeric transposase can be selected from at least the group consisting of piggyBac, Sleeping Beauty (SB), Tn7, Tn5, Mos1, Himari , Hermes, Tol2 element, Pokey, Minos, S elements, P- element, ICEStI , Quetzal elements, Tn916, maT, TcMmariner, Tc3, and the like. Additional transposases may be found throughout the art, for example in U.S. Pat. No. 6,225,121 , U.S. Pat. No. 6,218,185 U.S. Pat. No. 5,792,924 U.S. Pat. No. 5,719,055, U.S. Patent Application No. 20020028513, and U.S. Patent Publication No. 20020016975. Because the applicable principal of the invention remains the same, the animals and cells of the invention can include animals and cells with transposon insertion sites with recognition sequences for chimeric transposases constructed from transposases that have not yet been identified.

[0064] Disclosed herein are animals and cells containing transposon insertion sites with recognition sequences for a chimeric transposase integrating enzyme. It is understood and contemplated herein that this chimeric transposase can be selected from at least the group consisting of piggyBac, Sleeping Beauty [SB), Tn7, Tn5, Mos1, Himari , Hermes, Tol2 element, Pokey, Minos, S elements, P- element, ICEStI , Quetzal elements, Tn916, maT, Tel/mariner, Tc3, and the like, each containing the S. cerevisiae Gal4 DNA binding domain (DBD) fused precisely at the N- or C-terminus of the transposase. Examples of known non-chimeric transposases can be found throughout the literature and are incorporated by reference herein from the following: Sleeping Beauty (Izsvak Z, Ivies Z, and Plasterk R H. (2000) Sleeping Beauty, a wide host-range transposon vector for genetic transformation in vertebrates. J. MoI. Biol. 302:93-102), Tn5 (Bhasin A, et al. (2000) Characterization of a Tn5 pre-cleavage synaptic complex. J MoI Biol 302:49-63), Tn7 (Kuduvalli P N₁ Rao J E, Craig N L. (2001) Target DNA structure plays a critical role in Tn7 transposition. EMBO J 20:924932), Tn916 (Marra D, Scott JR. (1999) Regulation of excision of the conjugative transposon Tn916. MoI Microbiol 2:609- 621), Td /mariner (Izsvak Z, Ivies Z, Hackett P B. (1995) Characterization of a Tc-1 like transposable element in zebrafish (Danio rerio). MoI. Gen. Genet. 247:312-322), Minos and S elements (Franz G and Savakis C. (1991) Minos, a new transposable element from Drosophila hydei, is a member of the Tc1-like family of transposons. Nucl. Acids Res. 19:6646; Merriman P J, Grimes C D, Ambroziak J, Hackett D A, Skinner P, and Simmons M J. (1995) S elements: a family of Tc1-like transposons in the genome of Drosophila melanogaster. Genetics 141 :1425-1438), Quetzal elements (Ke Z, Grossman G L, Cornel A J, Collins F H. (1996) Quetzal: a transposon of the Td family in the mosquito Anopheles albimanus. Genetica 98:141-147); Txr elements (Lam W L₁ Seo P₁ Robison K, Virk S₁ and Gilbert W. (1996) Discovery of amphibian Td -like transposon families. J MoI Biol 257:359- 366), Tc1-like transposon subfamilies (Ivies Z₁ Izsvak Z, Minter A₁ Hackett P B. (1996) Identification of functional domains and evolution of Tc1-like transposable elements. Proc. Natl. Acad Sci USA 93: 5008-5013), and Tc3 (Tu Z₁ Shao H. (2002) Intra- and inter-specific diversity of Tc-3 like transposons in nematodes and insects and implications for their evolution and transposition. Gene 282:133-142), P-element (Rubin G M and Spradling A C. (1983) Vectors for P element mediated gene transfer in Drosophila. Nucleic Acids Res. 11 :6341-6351).

[0065] The animals and cells of the present invention can include in their genomes transposon target sites that contain recognition sequences for DNA- binding domains of chimeric transposases. These recognition sequences are contemplated to have the ability to recruit chimeric transposases with one or more DNA-binding domains fused to the N-terminus, C-terminus, or N- and C-terminus of the chimeric transposase.

[0066] By "genomic transposon target site" is meant a sequence in the genome that contains one or more repeats of a sequence containing 1) recognition sequences for DNA-binding domains and 2) consensus transposon insertion sequences specifically utilized by a transposase. The genomic transposon target sites in the animals and cells of the invention can contain one or more recognition sequences for DNA-binding domains of chimeric transposases and one or more consensus transposon insertion sequences that can be utilized by a transposase. Various configurations of these sequences within each transposon target site of the animals and cells is contemplated. The one or more DNA-binding domain recognition sequences can be upstream, downstream, or both upstream and downstream of the one or more transposon insertion sequences. The transposon target site can contain repeats of a sequence composed of, for example, one or more DNA-binding domain recognition sequences, one or more transposon recognition sequences, and one or more DNA-binding domain recognition sequences. The transposon target site can contain repeats of a sequence composed of, for example, two DNA-binding domain recognition sequences, a transposon insertion sequence, and two DNA-binding domain recognition sequencesThe transposon target site can contain repeats of a sequence composed of, for example, three DNA-binding domain recognition sequences, a transposon insertion sequence, and three DNA-binding domain recognition sequences. The transposon target site can contain repeats of a sequence composed of, for example, two DNA-binding domain recognition sequences, two transposon insertion sequences, and two DNA-binding domain recognition sequences. The transposon target site can contain repeats of a sequence composed of, for example, three DNA- binding domain recognition sequences, two transposon insertion sequences, and three DNA-binding domain recognition sequences. The transposon target site can contain repeats of a sequence composed of, for example, four or more DNA-binding domain recognition sequences, one or more transposon insertion sequences, and four or more DNA-binding domain recognition sequences. The DNA-binding domain recognition sequences can be immediately adjacent to the transposon insertion sequence or separated by one or more nucleotides that link the sequences. The DNA-binding domain recognition sequences can be separated from the transposon insertion sequence by any number of nucleotides, provided that recruitment of a chimeric DNA-binding domain-containing transposase directs transposon insertion to the transposon insertion sequence contained in the repeat. The DNA-binding domain recognition sequences are contemplated to have the ability to recruit chimeric DNA-binding domain-containing transposases that insert transposon DNA into transposon insertion sequences in neighboring or proximal repeats of the genomic transposon target site. In a preferred embodiment, the animals and cells of the invention contain genomic transposon target sites containing repeats of a sequence composed of three DNA-binding domain recognition sequences, two transposon insertion sequences, and three DNA-binding domain recognition sequences. In a preferred embodiment, the animals and cells of the invention contain genomic transposon target sites containing repeats of three Upstream Activating Sequences capable of binding an S. cerevisiae Gal4 zinc finger DNA binding domain, two back to back piggyBac transposase transposon insertion sequences, and three Upstream Activating Sequences capable of binding an S. cerevisiae Gal4 zinc finger DNA binding domain.

[0067] The animals and cells of the invention, containing in their genome transposon target sites for site-directed transgenesis by chimeric transposase, can be vertebrate or invertebrate animals or cells. They can be, for example, insect animals and cells. They can be, for example, nematodes, arthropods, molluscs, echinoderms, and annellid worms. In some embodiments, the animals and cells belong to the genus Drosophila. In preferred embodiments, the animals and cells are Drosophila melanogaster. The current invention encompasses methods of generating transformed Drosophila melanogaster animals and cells that contain exogenous DNA in their genome, such as transposon target site DNA. These methods are disclosed herein (see Example 3), and constitute procedures well known to those of ordinary skill in the art

[0068] The animals and cells of the invention, containing in their genome transposon target sites for site-directed transgenesis by chimeric transposases, can be, for example, mammals, fish, amphibians, reptiles, and birds. They can be, for example, rodents, cows, pigs, sheep, goats, and horses. In some embodiments, the animals and cells are rodent animals and cells. In preferred embodiments, the animals and cells are mice and mouse cells. The current invention encompasses methods of generating transformed mice containing in their genome transposon target sites for site-directed transgenesis. These methods are disclosed herein (see In preferred embodiments, the animals and cells of the invention are primate cells. In further preferred embodiments, the cells of the invention are human cells.

[0069] The animals and cells of the present invention are generated for the purpose of site-specific transgenesis by chimeric transposases. Site-specific transgenesis occurs at the genomic transposon target sites placed in the genomes of the animals and cells of the invention. Exemplary sites-specifc transgenesis procedures using animals and cellls of the invention are provided in Examples 2 and 4.

[0070] The insertion of a Gal4 ZFP sequence at the 5'- end of the piggyBac gene does not interfere with the activity of the transposase, and such ZFPs can demostrate target specificity. In addition to providing methods of performing gene therapy in whole animals with specific transgenesis target sites, embodiments of the invention are directed to methods of generating transgenic animals and cells for use in genetic research. Mice that contain genomic transposon target sites can be utilized to generate transgenic offspring carrying a newly introduced transposon encoding a particular transgene. This is transgenesis is performed by coinjecting mouse oocytes from mothers with genomic transposon target sites with isolated sperm (intra-cytoplasmic sperm injection; ICSI) and an exogenous nucleotide vector or vectors that carry the transposon and inverted repeats flanking the transposon that are recognized and utilized by a transposase ezyme and that encode a chimeric transposase that contains a DNA-binding domain specific for the target sequences in the embryo's genomic transposon target site. An exemplary method for utilizing mice according to the invention to perform site-directed transgenesis is provided in Example 4. The short gestation period of twenty-one days in the mouse facilitates interpretable results for the insertion of transgenes by chimeric transposases, which additionally contain a kanamycin resistance gene for plasmid rescue experiments within the transposon to verify the correct location of insertion. This verification can also be performed by PCR or Southern blotting of genomic DNA using procedures familiar to those of skill in the art. The diagram in Figure 8 highlights the main structural components of this approach. Once inside the fertilized oocyte, the construct finds its way into the newly formed zygotic nucleus. The transcriptional machinery within the nucleus transcribes the transpose gene (for example, chimeric piggyBac transposase) with its nuclear localization signal (NLS). The translational machinery of the zygote synthesizes the protein, which by virtue of its NLS makes its way into the nucleus. There, the newly synthesized transposase binds to the terminal repeats (TR) which flank the transposon. The catalytic domain (large circle) of the transposase recognizes the TRs and prepares the DNA between them for insertion. The ZFP DNA binding domain (small circle) guides the insertion complex to the target site in the DNA of the host genome that contains the corresponding recognition sequences, and the transposase protein performs the insertion of the transposon at the consensus insertion site in close proximity. [0071] Plasmids encoding piggyBac transposase chimeric for the ZFPs can be injected into oocytes isolated from mice according to the invention by performing ICSI, recovering genomic DNA from founder animals, and assaying the DNA for gene insertion. This can be achieved by selecting circularized genomic DNA constructs which act like plasmids by virtue of the activity of the kanamycin antibiotic gene present in the rescue plasmid. This allows the selection of bacteria cells that have incorporated the circularized DNA during transformation. Bacteria that survive selection in kanamycin medium have the gene region of interest incorporated into them. This circularized DNA can be recovered like a plasmid and the region of interest containing the transposon amplified by PCR with primers specific to the transposon. Such PCR amplified regions are then sequenced and the site of integration for the transgene recognized.

[0072] Methods of generating a transgenic animal using transposase enzymes has previously been described. See International Application No. PCT/US2007/018922, filed August 28, 2007, entitled METHODS AND COMPOSITIONS FOR TRANSPOSON-MEDIATED TRANSGENESIS; U.S. Provisional Application No. 60/840,780, filed on August 28, 2006, entitled CELL AND ANIMAL TRANSGENESIS WITH SINGLE PLASMID TRANSPOSASE (HELPER) AND TRANSPOSON (DONOR) CONSTRUCTS; U.S. Provisional Application No. 60/840,833, filed August 28, 2006, entitled TRANSGENESIS-READY MICE CONTAINING TRANSPOSASE ENZYME GENES IN THEIR GENOME, DRIVEN BY OOCYTE-SPECIFIC DEVELOPMENTAL PROMOTER; U.S. Provisional Application No. 60/859,652, filed November 17, 2006, entitled RNA AS A SOURCE OF TRANSPOSASE OR THE PROTEIN TRANSPOSASE FOR PIGGYBAC MEDIATED GENE INSERTION AND EXPRESSION; U.S. Application No. 11/127,685, filed May 11 , 2005, entitled TN5 TRANSPOSASE-MEDIATED TRANSGENESIS; and U.S. Application No. 10/521 ,936, filed February 7, 2006, entitled TRANSPOSON-BASED VECTORS AND METHODS OF NUCLEIC ACID INTEGRATION. Each of these applications, including all methods, figures, and compositions, is incorporated herein by reference in its entirety.

[0073] The compositions disclosed herein and the compositions necessary to perform the disclosed methods can be made using any method known to those of skill in the art for that particular reagent or compound unless otherwise specifically noted.

[0074] Nucleic acids used according to the present invention, such as the oligonucleotides to be used as the monomer units for the construction of concatemeric DNA containing repeats of transposon target sites, or PCR primers, can be made using standard chemical synthesis methods or obtained from commercial suppliers.

[0075] Site-directed transgenesis can be performed with the animals and cells of the invention using nucleic acids encoding a chimeric transposase obtained from linking a transposase [for example Td (Reference No. NM. sub. -061407, AI878683, AI878522, AI794017); P-element (Rio et al., Ce// [1986] 44:21-32; among others)] to a DNA directing factor [for example, LexA DBD (Accession No. J01643- V0029-V00300, Hin DNA binding domain (Reference No. J03245), STF-1 DNA binding domain (Reference No. S67435, corresponding to amino acids 140-215 described in Leonard et al. (1993) MoI. Endo. 7:1275-1283), among others]. The sequences of these and other known transposases can be obtained at Entrez Nucleotide Database, or GenBank or other nucleotide or protein search engines. A variety of methods can be used for making these nucleic acids, such as synthetic chemical methods and standard molecular biology methods.

[0076] Site-directed transgenesis can be performed with the animals and cells of the invention using nucleic acids comprising the sequence encoding a transposase [for example Td (Reference No. NM.sub.-061407, AI878683, AI878522, AI794017); P-element (Rio et al., Ce// [1986] 44:21-32; and among others listed herein. The sequences can be obtained at Entrez Nucleotide Database, or GenBank or other nucleotide or protein search engines])] operatively linked to the coding sequence for a DNA directing factor [for example, Gal4 zinc finger domain, LexA DNA-binding domain (Accession No. J01643-V0029-V00300, Hin DNA binding domain (Reference No. J03245), STF-1 DNA binding domain (Reference No. S67435, corresponding to a.a. 140-215 described in Leonard et al. (1993) MoI. Endo. 7:1275-1283), and among others listed herein. The sequences can be obtained at Entrez Nucleotide Database, or GenBank or other nucleotide or protein search engines] and a sequence controlling the expression of the nucleic acid. [0077] Site-directed transgenesis can be performed with the animals and cells of the invention using nucleic acids comprising a sequence having 80% identity to a sequence set forth in a chimeric transposase. This sequence can be obtained from linking a sequence encoding a transposase with 80% identity to a known transposase [for example Td (Reference Nos. NM. sub. -061407, AI878683, AI878522, AI794017); P-element (Rio et al., Cell (1986) 44:21-32; and among others listed herein. The sequences can be obtained at Entrez Nucleotide Database, or GenBank or other nucleotide or protein search engines])] in an operative manner to the coding sequence for a DNA directing factor [for example, Gal4 zinc finger domian, LexA DNA-binding domain (Accession No. J01643-V0029-V00300, Hin DNA binding domain (Reference No. J03245), STF-1 DNA binding domain (Reference No. S67435, corresponding to amino acids 140-215 described in Leonard et al. (1993) MoI. Endo. 7:1275-1283), and among others listed herein. The sequences can be obtained at Entrez Nucleotide Database, or GenBank or other nucleotide or protein search engines], and a sequence controlling the expression of the nucleic acid.

[0078] Site-directed transgenesis can be performed with the animals and cells of the invention using nucleic acids comprising a sequence that hybridizes under stringent hybridization conditions to the coding sequence of a transposase set forth in a chimeric transposase obtained from linking the coding sequence for a transposase [for example Td (Reference Nos. NM.sub.--061407, AI878683, AI878522, AI794017); P-element (Rio et al., Cell (1986) 44:21-32; and among others listed herein. The sequences can be obtained at Entrez Nucleotide Database, or GenBank or other nucleotide or protein search engines])] in an operative manner to the coding sequence for a DNA directing factor [for example, Gal4 zinc finger domain, LexA DNA-binding domain (Accession No. J01643-V0029-V00300, Hin DNA binding domain (Reference No. J03245), STF-1 DNA binding domain (Reference No. S67435, corresponding to a. a. 140-215 described in Leonard et al. (1993) MoI. Endo. 7:1275-1283), and among others listed herein. The sequences can be obtained at Entrez Nucleotide Database, or GenBank or other nucleotide or protein search engines] and a sequence controlling the expression of the nucleic acid. [0079] Site-directed transgenesis can be performed with the animals and cells of the invention using nucleic acids comprising a sequence encoding a chimeric transposases [for example Td (Reference No. NM.sub.~061407, AI878683, AI878522, AI794017); P-element (Rio et al., Cell (1986) 44:21-32; among others)] and the coding sequence for a DNA-binding domain at the end of the transposase sequence corresponding to the N-terminus or C-terminus of the transposase, wherein the nucleic aciis are constructed using fusion PCR (see, for example, Vallette, et al., 1989, NAR, 17:723-733; and Yon and Fried, 1989, NAR, 17:4895). The transposase coding region constructed as described and the DNA binding domain (for example, zif268 or Gal4 coding region) constructed as described are separately amplified by PCR. Primers are designed employing well-known methods to contain a region of overlap that encodes the desired fusion junction. PCR products from the two separate reactions are then purified, mixed, and subjected to a second PCR reaction using primers directed at either side of the overlap region. In the first cycle of the second round, strands from the two reaction products can denature and anneal to allow extension by the polymerase. In the next cycle, the resulting strand can be amplified as in normal PCR.

[0080] Thus two unrelated sequences can be precisely fused: the transposon-based plasmid [coding for the transgene, transposase, and containing a protein binding site (for example, .lamda. operators)] and a second plasmid comprising a fusion polypeptide containing two DNA binding domains [for example, LexA DBD (Accession No. J01643-V0029-V00300) linked to the STF-1 DNA binding domain (Reference No. S67435; corresponding to a. a. 140-215 described in Leonard et al. (1993) MoI. Endo. 7:1275-1283) and among others listed herein which can be combined]. The sequences can be obtained at Entrez Nucleotide Database, or GenBank or other nucleotide or protein search engines.

[0081] The vectors which can be used with the animals and cells of the current invention are produced by standard methods of restriction enzyme cleavage, ligation and molecular cloning. The general protocol for constructing these vectors includes the following steps. First, purified nucleic acid fragments containing desired component nucleotide sequences as well as extraneous sequences are cleaved with restriction endonucleases from initial sources. Fragments containing the desired nucleotide sequences are then separated from unwanted fragments of different size using conventional separation methods, for example, by agarose gel electrophoresis. The desired fragments are excised from the gel and ligated together in the appropriate configuration so that a circular nucleic acid or plasmid containing the desired sequences, for example sequences corresponding to the various elements of the subject vectors, as described above, is produced. Where desired, the circular molecules so constructed are then amplified in a prokaryotic host, for example E. coli. The procedures of cleavage, plasmid construction, cell transformation and plasmid production involved in these steps are well known to one skilled in the art and the enzymes required for restriction and ligation are available commercially. (See, for example, R. Wu, Ed., Methods in Enzymology, Vol. 68, Academic Press, N.Y. (1979); T. Maniatis, E. F. Fritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1982); Catalog 1982-83, New England Biolabs, Inc.; Catalog 1982-83, Bethesda Research Laboratories, Inc.).

[0082] Disclosed are animals and embryos derived therefrom that contain in their genome transposon target sites containing 1) recognition sequences for DNA-binding domains and 2) consensus transposon insertion sequences specifically utilized by a transposase. These animals are produced by the process of transforming the an embryo with the disclosed concatemeric DNA containing repeats of the genomic transposon target site. Disclosed are cells produced by the process of transforming the cultured cells with concatemeric DNA containing repeats of the genomic transposon target site.

[0083] Having described embodiments of the invention in detail, it will be apparent that modifications, variations, and equivalent embodiments are possible without departing the scope of the invention defined in the appended claims. Furthermore, it should be appreciated that all examples in the present disclosure are provided as non-limiting examples.

EXAMPLES

[0084] The following non-limiting examples are provided to further illustrate the present invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples that follow represent approaches the inventors have found function well in the practice of the invention, and thus can be considered to constitute examples of modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments that are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.

EXAMPLE 1: GENERATION OF MICE CONTAINING GENOMIC POLYUAS-TRANSGENE INSERTION SITES.

[0085] Mice that contain in their genome a polyUAS transgene insertion site were generated by introducing into individual mouse embryos exogenous DNA containing repeats of the following "monomeric" UAS array sequence:

cqqattagaagccgccgatacggqcgacagccctccgatacggtccactgtgtgccgttaattaacggcggtctttcgtccgatacggagatatctgcgccgalacggatcactccgaaccg UAS UAS UAS Pad UAS UAS UAS

where the sequences shaded in gray are six different S. cerevisiae UAS sequences, and where the sequence -TTAATTAA-, matching the sequence of a Pad restriction enzyme cleavage site, links the third and fourth UAS sequence. (Sequences in this example are also shown in Figure 1.) This introduces two potential TTAA insertion sites for piggyBac transposase insertion. To generate this DNA, the two DNA oligonucleotides indicated below, 6xUAS-top and 6xUAS-bottom, each containing a cleavage site for the restriction enzyme Pvull at their 3-prime ends, were first obtained from a commercial supplier of custom oligonucleotides:

6xUAS-top

5' cggattagaagccgccgatacgggcgawgix_.ctccgatacggtccactgtgtgccgttaaltaacggcggtcmcgtccgatacggagatatctgcgccgatacggatMctccgaaccgcagctg

(Pad) (Pvull)

3'

6xUAS-bottom

5' cggttcggagtgatccgtajcggcgcagatatctccgMcggaj;gaaaga

(Pad) (Pvull)

3'

[0086] When hybridized, these oligonucleotide sequences give rise to a double-stranded sequence with the "monomeric" array sequence shown above.

These oligonucleotides were mixed, digested with Pvull using standard conditions, and ligated overnight with T4 DNA ligase to form concatemers of various lengths with the following structure:

-i-iP-pvuiι-iDa§-iI)gg-ϋiag-Paci-i! Pvull-ϋ i-Pacl-^-@^-^^-Pvu 1 I-Ig!...

[0087] Figure 2 shows an agarose gel image of the concatemeric DNA of varying "monomeric" repeat length (right lane) after overnight ligation. DNA size markers (100 bp ladder) were run in the left lane.

[0088] This polyUAS concatemeric DNA was diluted to approximately 1 ng/μl_ in 1mM-Tris HCL pH7.4 with 0.1mM EDTA and injected into the pronuclei of fertilized B6D2F1 mouse embryos in M2 medium. Embryos (in single-cell stage) were then transferred into surrogate mothers mated with vasectomized males the night before.

[0089] These mothers were allowed to give birth to their own young, and of 28 newborn pups, only two proved transgenic by PCR for polyUAS in the Fo generation. In the DNA agarose gel shown in Figure 3, polyUAS DNA, with a profile matching that of control polyUAS DNA (the lane immediately to the right of lane 10), is visible in the PCR sample from one pup, female founder F₀ nr 20 (1414; lane 8). PCR samples from this pup's nine siblings do not contain polyUAS DNA (lanes 1-7, 9-10).

[0090] The two polyUAS F₀ founders generated were then each mated with a wild-type B6D2F1 mouse of the opposite sex. Tail samples of Fi offspring were analyzed by PCR to detect the presence of polyUAS repeats. PCR samples from the nine Fi offspring of the nr 20 female are shown in the DNA agarose gel in Figure 4. As seen in this gel, six of the nine F-i offspring are positive for polyUAS DNA (lanes 3-8), indicating that the nr 20 female is germline transgenic for polyUAS DNA.

[0091] The Fi progeny of germline-transgenic mouse nr 20 are bred to homozygosity. The copies of polyUAS concatemeric DNA may lie in different loci of the various chromosomes in these homozygous offspring. Therefore, homozygous polyUAS F₂ offspring are bred with wild-type B6D2F1 mice, and heterozygous offspring are interbred to regenerate homozygous offspring. This process is repeated as many times as necessary for meoitic segregation to separate polyUAS loci and generate individuals homozygous for a single, polyUAS locus.

EXAMPLE 2: GENERATION OF EGFP TRANSGENIC MICE WITH TRANSGENE

INSERTION TARGETED TO A GENOMIC POLYUAS- INSERTION SITE.

[0092] Oocytes are first collected from oviducts of superovulated polyUAS B6D2F1 females after intraperitoneal injection of 5 International Units (IU) equine chorionic gonadotropin (eCG) followed by injection of 5 IU human chorionic gonadotropin (hCG) 48 hours later. Matured oocytes collected 13-15 hours after hCG injection are freed from cumulus cells by treatment with 0.1 % bovine testicular hyaluronidase (359 U/mg solid) in HEPES-CZB medium (CZB medium [81.62 mM NaCI, 4.83 mM KCI, 1.18 mM KH₂PO₄, 1.18 mM MgSO₄, 1.7 mM CaCI₂, 25.12 mM NaHCO₃, 31.3 mM sodium lactate, 0.27 mM sodium pyruvate, 1 mM L-glutamine, 0.11 mM EDTA, 3 mg/ml bovine serum albumin (BSA), 10 μg/ml gentamicin, 10 μg/ml phenol red], pH 7.4, plus 20 mM HEPES-HCI, 5 mM NaHCO₃, and 0.1 mg/ml polyvinyl alcohol instead of BSA). Oocytes are rinsed and kept at 37°C in fresh CZB medium before sperm injection.

[0093] Spermatozoa are collected from the cauda epididymis of B6D2F1 males. A dense sperm mass squeezed out of the epididymis was placed at the bottom of 200 μl Mg²⁺-free HEPES-CZB buffered solution in a microcentrifuge tube. After standing for 10 min at 37°C, the upper 20 μl of the sperm suspension was collected and mixed with an equal volume of HEPES-CZB containing 12% polyvinylpyrrolidone (PVP). Ten microliters of 200 nanogram/microliter plasmid pMMK-1 (Figure 5), containing an EGFP transgene and the gene for a chimeric, Gal4-DNA binding domain-containing piggyBac transposase (Figure 12A), is mixed with 10 microliters of fresh swim-up sperm solution. A single spermatozoon moving slowly in the solution is drawn, tail first, into the injection pipette in such a way that its neck (the junction between the head and tail) is at the opening of the pipette. The head is separated from the tail by applying a few piezo-pulses to the neck region.

[0094] Each sperm head that has its tail removed in the mixed solution is individually microinjected into an isolated oocyte (intra-cytoplasmic sperm injection, ICSI). Two-cell embryos are transferred into the oviducts of pseudopregnant females which are mated with vasectomized males the night before. After gestation, the females are allowed to give birth to their own young and the newborn pups are examined for EGFP expression in their skin by epifluorescence (Figure 6). Insertion of the EGFP transgene at the UAS site is verified by PCR using primers corresponding to the EGFP gene and one of the UAS sequences.

EXAMPLE 3: GENERATION OF DROSOPHILA MELANOGASTER ANIMALS AND CELLS

CONTAINING A GENOMIC POLYUAS-TRANSGENE INSERTION SITE.

[0095] To generate a transgenic line of Drosophila melanogaster containing a chromosomal UAS target array, a P-element transformation vector containing the UAS array is first constructed by ligating the concatemeric polyUAS DNA prepared as described in Example 1 into a version of the P-element transposon plasmid PEG117 (Giniger E, Wells W, Jan L Y, Jan Y N. Roux's Arch Dev Biol. 1993;202: 112-122) engineered to contain a single Pvull restriction enzyme site in the plasmid cloning site.

[0096] Transformations of wild-type syncitial (pre-cellularization stage) Drosophila embryos are performed using standard techniques {for example, Rubin and Spradling, Science. 1986; 218:348-353.) P-element transposase is supplied by co-microinjection of the helper plasmid pUChs (Laski ef a/. Cell. 1986; 44:7-19) with the polyUAS-containing P-element vector. Newly created transgenic flies are recognized by white gene-mediated eye color. These transgenic Gi offspring are then self-crossed to generate homozygous G₂ offspring carrying the polyUAS- containing transposon in their genome.

[0097] Cultured Drosophila cell lines containing this genomic polyUAS transposon are generated by harvesting, trypsinizing, and culturing 20 to 24-hour embryos from polyUAS-homozygous flies, using standard procedures (Schneider, I. [1972] "Cell lines derived from late embryonic stages of Drosophila melanogaster." J. Embryo!. Exp. Morphol. 27: 353-65). EXAMPLE 4: GENERATION OF ΛW EGFP DROSOPHILA MELANOGASTER LINE BYEGFP TRANSGENE INSERTION DIRECTED TO A GENOMIC POLYUAS-INSERTION SITE.

[0098] Preblastoderm syncitial embryos (0-3 hours) are collected from population canisters of polyUAS Drosophila adults (generated as described in Example 3). As schematized in Figure 7, these polyUAS-containing embryos are coinjected with a "donor" plasmid (containing an EGFP marker and a transgene) and a "helper" plasmid similar to Gal4-mos-helper (Figure 9), but containing the gene for a GAL4 DNA-binding domain-containing piggyBac transposase (Figure 12A) instead of a mos transposase. (This helper plasmid encoding Ga\4-piggyBac transposase is generated by replacing the unmodified piggyBac transposase gene of pMMK-1 with a Ga\4-piggyBac transposase gene.)

[0099] Injected embryos are allowed to hatch and grow into adults (G₀ adults). Adults that grow from embryos in which transposon integration occured will express EGFP, as detected by EGFP epifluorescence. Of these EGFP-transgenic flies, those that give rise to EGFP-containing Gi offspring when mated to wild-type flies are germline-transgenic. Half of the Gi offspring of germline-transgenic G₀ adults will carry the EGFP gene, which will be present in the genome of every cell.

[OOioo] EGFP-expressing Gi sibling flies are then self-crossed to generate homozygous offspring carrying matching chromosomal copies of the transposon carrying the EGFP gene and the transgene inserted at the UAS site. To verify the presence of the transposon in homozygous offspring, genomic DNA is isolated from these flies and digested with an enzyme for which no restriction site is present in the EGFP gene. Digested genomic DNA is separated by electrophoresis, transferred to a blotting membrane and Southern blotted with an EGFP cDNA probe. Transgenic flies display single or multiple EGFP-hybridizing bands (due to frequent insertion of concatemers of the transposon carrying EGFP and the transgene). These bands are absent in control flies. The insertion of the EGFP gene and transgene at the UAS site is also verified by inverse PCR using primers corresponding to sequences present in the transposon carrying the genes to determine the genomic DNA sequence flanking the transposon insertion site. EXAMPLE 5: CHIMERIC PIGGYBAC AND MOS1 TRANSPOSASES CONTAINING A GAL4 DNA BINDING DOMAIN PERFORM TRANSGENE INTEGRATION IN A SITE-DIRECTED

MANNER

[ooioi] Transposon insertion into a functional gene can inactivate the gene, and insertion near regulatory sequences can alter transgene or endogenous gene activity. Methods of integrating transposons at predefined sites were designed to facilitate the appropriate expression of the transgene, and thus, avoid side effects. Briefly, the Gal4 DNA binding domain (DBD) was fused to the Mos1 and piggyBac transposases. Fusion of the Gal4 DBD and each transposase was designed to bring the transposase and associated transgene to a specific upstream activating site (UAS) that was engineered into a target plasmid and was recognized by the Gal4 DBD, thereby targeting transgene insertion to this site. Results of plasmid-based transposition assays in Aedes aegypti embryos demonstrated the efficiency of Gal4- Mos1 and Gal4-p/ggySac chimeric transposases.

[00102] A standard transposition assay was performed with two different helper plasmids, plE1-Gal4-Mosf (0.25 μg/ml) or plE1-Gal4-pβ (0.25 μg/ml) (Figure 9, "Gal4-mos hleper" at left) in Aedes aegypti (Liverpool strain) embryos in individual experiments. Embryo injections were given with a mixture of pGDV1-UAS target (0.5 μg/ml), the pBSMOSoriKan or pB[KO alpha] donor plasmid (0.25 μg/ml), along with the respective helper plasmid into preblastoderm embryos within 2 hours of oviposition. The transposition assay was performed as described previously (Coates, CJ. et al., Gene [1999] 226:317-325). Control transposition assays were also performed using the chimeric transposases and an unmodified pGDVI target plasmid that lacked the UAS target.

[00103] Candidate transposition product clones were analyzed by DNA sequencing with the ABI Prism Bigdye terminator cycle sequencing ready reaction kit, following the manufacturer's protocols (Applied Biosystems, Foster City, CA, USA) and previously described primers (Thibault, ST., et al., Insect MoI. Biol. [1999] 8:119-123; and Coates, CJ. , et al., MoI. Gen. Genet. [1997] 253:728-733). Reaction products were resolved on an Applied BioSystems automated DNA sequencer (model # ABI3100) and sequence reads analyzed using the Vector NTI suite software (InforMax, North Bethesda, MD, USA). [00104] Plasmid-based transposition assays were performed in Ae. aegypti embryos (Figure 9). Potential transposition product clones were subjected to SamHI digestion to identify transposition events. The pGDV1-UAS plasmid shown in Figure 9 was 2.727 kb in size and had a unique BamH\ restriction site at nucleotide position 2000. The Mos1 donor element was 4.2 kb, also with a single SamHI site. Thus, the combined molecular weight of any restriction fragments from a transposed element was expected to be 6.9 kb. Putative transposition products with the expected digestion pattern were selected for DNA sequence analysis. The results revealed the duplication of a TA insertion site, the hallmark of Mos1 transposition, which indicates that transposition of the Mos1 element successfully occurred. The transposition frequency for three replicate experiments was calculated by dividing the number of transposition events by the total number of recovered donor plasmids. As a control, a pGDV1 target plasmid lacking a UAS target site was used, such that the GaW-UAS interaction was absent. The transposition assay results revealed a 12.7- fold increase in transpositional activity over the controls where the UAS target site was absent (Table 1). The transposition frequency was almost 20-fold higher when compared with another control where a regular helper plasmid was used. In addition to the enhanced transposition frequency, the Mos1 chimeric transposase showed a high degree of insertion specificity compared with control experiments.

Table 1. Transposition assay data from the use of chimeric transposases and modified target plasmids.

The total number of donor plasmids recovered was estimated by the number of Amp-resistant colonies recovered.

⁶ The transposition frequency was calculated by dividing the number of confirmed transposition products recovered by the total number of donor plasmids recovered. These data were the cumulative data from 3 independent injection and recovery experiments. c Fold increases for the Mos1 experiments were relative to the control Mos helper + pGDV1 experiment except for the number in parentheses, which represents the fold increase in transposition when using pGDV1-UAS target plasmid compared with the standard pGDV1 target plasmid. The fold increase for the piggyBac experiment was based on the increase observed when using the pGDV1- UAS target plasmid compared to the standard pGDV1 target plasmid.

[00105] The pGDV1 target plasmid contains 251 potential TA target sites, of which 60 have been previously identified as insertion sites and 191 are unused sites (Coates, CJ. , et al., MoI. Gen. Genet. [1997] 253:728-733). The Cam resistance gene contains 77 TA sites, thus insertions into these sites were not likely to be recovered due to the disruption of the resistance gene used for colony selection, leaving 114 unused sites. Control experiments utilizing the chimeric transposase and an unmodified pGDVI target plasmid lacking the UAS target revealed that integration of the donor element occurred randomly at multiple TA target sites (Figure 10). However, in the presence of the Mos1 chimeric transposase and the modified pGDV1-UAS target plasmid, transposition primarily occurred at the same TA site, position 1061 of the target plasmid, located 954 bp from the inserted UAS target sequence (Figure 10). Remarkably, the chimeric transposase directed integration to this specific site 96% of the time. Among the Ga\4-Mos1 mediated transposition events at the 1061 site, 98% were in a 5'-3' orientation with respect to the Cam resistance gene. In the control experiments, no integrations occurred at the 1061 TA site of the target plasmid.

[00106] A parallel transposition assay was also performed in Ae. aegypti embryos using the plE1-Gal4-pβ helper. Putative transposition products were selected based on BamHI digestion. The piggyBac donor element was 5.5 kb with a single Bam\λ\ site, and thus the transposition product was expected to be 8.22 kb. Actual transposition products were confirmed using DNA sequence analysis. The sequence results revealed the duplication of a TTAA insertion site; the hallmark of piggyBac transposition, thus confirming that piggyBac mediated transposition had occurred. The transposition frequency was 11.6-fold higher compared to the controls. Moreover, in the presence of the piggyBac chimeric transposase and the modified pGDV1 -UAS target plasmid, 67% of transpositions occurred at position 1103 site of the target plasmid, located 912 bp from the inserted UAS target sequence (Figure 11). In the control experiments, no integrations occurred at position 1103 of the target plasmid.

[00107] The pGDV1 target plasmid contained 29 potential TTAA target sites, of which 8 were in the Cam resistance gene, from which insertions cannot be recovered in this assay (Thibault, ST., et al., Insect MoI. Biol. [1999] 8:119-123; Lobo, N., et al, MoI. Gen.Genet. [1999] 261 :803-810; Li, X., et al., Insect MoI. Biol. [2001] 10: 447-455). Control experiments utilizing the chimeric transposase and an unmodified pGDVI target plasmid lacking the UAS target revealed that integration of the donor element occurred at multiple TTAA target sites (Figure 11). These sites have been previously used by this element for insertion (Thibault, ST., et al., Insect MoI. Biol. [1999] 8:119-123). Among the Ga\4-piggyBac mediated transposition events at the 1103 site, 80% were in a 3'-5' orientation with respect to the Cam resistance gene.

EXAMPLE 6: ACTIVITY OF A GAL4-PIGGYBAC CHIMERIC TRANSPOSASE IS SIMILAR TO THAT OF THE WILD TYPE TRANSPOSASE.

[00108] Directing transgene integration to a unique and safe site on the host chromosome can overcome the hazards of insertional mutagenesis that can result with integrating vectors currently in use. A transposon-based gene delivery system preferably features a custom-engineered transposase with high integration activity and target specificity. Targeting transposon integration to specific DNA sites using chimeric transposases engineered with a DNA binding domain (DBD) has been demonstrated in mosquito embryos containing a plasmid including a unique site recognized by a GAL4 DNA binding domain fused to a transposase (Maragathavally, KJ. et al, FASEB J. [2006] 20:1880). Such modifications can render a transposase inactive, however, as observed for variants of SB11 engineered for target specificity, which have dramatically reduced transposition activity (Wilson, M. H. et al, FEBS Lett [2005] 579: 6205). Therefore, the potential for modifications of SB11, Tol2, and piggyBac transposases was assessed by testing their activity when fused to a GAL4 DNA binding domain. The transposition activities of each of these transposases, upon addition of an N-terminal GAL4 DBD (Figure 12A), was determined using a chromosome integration assay in HEK293 cells. GALΛ-piggyBac transposase demonstrated transposition activity similar to that of wild-type piggyBac, while GAL4- Tol2 and GAL4-SB11 transposases possessed negligible activity (Figure 12B), even though GAL4-S811 protein was detected by Western blot using a monoclonal antibody.

[00109] PiggyBac inserts into the tetranucleotide site TTAA, which is duplicated upon insertion (Ding, S. et al, Ce// [2005] 122: 473; Tosi, L. R. et al, Nucleic Acids Res. [2000] 28: 784). To test whether fusion of GAL4 to the N- terminus of piggyBac transposase alters its preference for TTAA sites, plasmid rescue experiments were performed to retrieve the sequence information of the target sites using genomic DNAs isolated from individual hygromycin-resistant CHO cell clones. Individual clones were isolated and allowed to grow to confluence in a 100mm plate. Genomic DNA was isolated using a DNeasy Tissue kit according to the manufacturer's protocol (Qiagen). Five micrograms of genomic DNA was subjected to Xho\ digestion followed by ligation into a plasmid containing a bacterial origin of replication and an antibiotic resistance gene. The ligation reactions were transformed into E. coli DH 10B cells. Plasmids rescued from transformants were subjected to DNA sequencing to retrieve the genomic sequence flanking the insertion site. Six independent genomic sequences were recovered from four drug- resistant clones. As shown in Table 3, all of these sequences contain genomic DNA with the signature TTAA sequence at the integration site. This experiment demonstrates that the chromosomal integrations observed in cells transfected with GAL4-piggyBac are mediated by a true transposition event with the same insertion preference for TTAA sites. Thus, neither the mechanism of transposon insertion by piggyBac transposase, nor its high level of activity appear, appear to be effected by fusion to a site-selective GAL4 DBD.

Table 2. Analysis of chromosomal insertion site selection by GALA-piggyBac transposase in CHO cells

Independent Donor plasmid Chromosomal

Flanking Chromosomal Sequence Isolated Clones terminal repeat Insertion Site

G8-2 ⁵TGATTATCTTTCTAGGG TTAA GCTCGGGCCGGCCGCGTCGCCGCTTC ³

G25-2 TGATTATCTTTCTAGGG TTAA CAATCAATAAGATAAACATACACAGA

G25-3 TGATTATCTTTCTAGGG TTAA CACCACATTTAACTTGCTCTTTGATA

G28-1 TGATTATCTTTCTAGGG TTAA TAGAGTGCTGAGATTTGGGACATTGC

G29-1 TGATTATCTTTCTAGGG TTAA GGCGTTGGTGGCACACAACTTTAAGT

G34-2 TGATTATCTTTCTAGGG TTAA TAAGACAATGTATGACTTTGTCCCAT

EXAMPLE 7: ENGINEERING OF MODIFIED GAL4-DNA-BINDING ZINC FINGER DOMAIN SPECIFIC FOR A UNIQUE UAS SEQUENCE.

[00110] The Saccharomyces cerevisiae transcriptional activator Gal4 binds to DNA via a zinc finger DNA binding domain. Gal4's zinc finger domain is known as a Ce zinc finger, which shares the consensus sequence Cys-X₂-Cys-X6-Cys-X5-6- Cys-X₂-Cys-X₆-Cys (where X_n indicates a stretch of the indicated number of any amino acids) with other members of this class (Traven, A., et al., EMBO reports [2006] 7: 496-499). Using standard molecular biology subcloning techniques, a portion of this Cβ zinc finger in the DNA-binding domain of a Ga\4-piggyBac transposase is replaced with the analogous sequence from another Cβ zinc finger- containing protein, such as the S. cerevisiae transcriptional regulator PPR1 (Witte, M. M. and Dickson, R.C., MoI. Cell. Biol. [1990] 10: 5128). To generate a binding sequence for this chimeric C₆ zinc finger domain, segments of a Gal4 binding sequence, UAS₀ (CGGAAGACTCTCCTCCG, or any of the six UAS regions highlighted in gray in Example 1) and a PPR1 binding sequence, UASu (TTCGGTAATCTCCGAA) are combined in such a manner that amino acid residues from the respective proteins' zinc finger domains interact with the stretch of nucleotides from the corresponding UAS, as suggested by their appropriate positions in crystal structures of PPR1-DNA (Marmorstein, R., and Harrison, S. C₁ Genes & Dev. [1994] 8: 2504) and GaW-DNA (Marmorstein, R., et al., Nature [1992] 356: 408- 414) Cβ zinc finger complexes.

[00111] The UASG/UASU hybrid sequences are generated using standard molecular biology techniques. The gene for the chimeric Gal4-PPR1 zinc finger domain is subcloned into a bacterial expression vector in frame with the coding sequence for an affinity tag for purification, such as a 6xHis tag. The chimeric domain is expressed and purified using standard techniques for the affinity tag. The purified chimeric domain is tested for the ability to recognize the hybrid UAS binding site using a DNA gel mobility assay (Garner, M. M. and Revzin, A. Nucleic Acids Res. [1981] 9: 3047-3060). In this assay, radiolabeled plasmid DNA containing the hybrid UAS binding site is incubated with or without the purified chimeric Gal4-PPR1 zinc finger domain. These mixtures are then loaded onto native polyacrylamide gels and electrophoresed. Retarded gel mobility of the hybrid UAS-containing plasmid indicates efficient binding by the hybrid zinc finger domain.

[00112] To verify that the hybrid UASG/UASU site can be recognized by the chimeric Gal4-PPR1 zinc finger domain in vivo, transposition assays using chimeric transposases containing the Gal4-PPR1 zinc finger DNA binding domain are performed as described in Example 5. In this case, new versions of the helper plasmids, plE1-Gal4-/Wos7 and plE1-Gal4-pβ (Figure 9, "Gal4-mos hleper" at left) are constructed that encode a Gal4-PPR1 -Mos1 or Gal4-PPR1-pβ transposase instead of Gal4-Mos7 or Gal4-pβ transposase, respectively. The target plasmid pGDV1-UAS is also modified to contain a hybrid UASG/UASU site in place of the original UAS site. Transposition events at this hybrid site are measured relative to a pGDV1 plasmid without a UAS site, as described in Example 5, to determine the efficiency of tranposition by the Gal4-PPR1 zinc finger-containing transposases engineered to specifically recognize the hybrid UASG/UASU sites.

EXAMPLE 8: GENERATION OF TRANSGENIC ANIMAL USING CHIMERIC TRANSPOSASE ENGINEERED FOR OPTIMIZED TARGET SITE RECOGNITION

[00113] Mice that are transgenic for a polyUAS site in which the UAS sequences are hybrid UASQ/UASU sequences (as described in Example 7) are generated using the method described in Example 1. In this instance, however, the oligonucleotides contain the hybrid UASG/UASU sequences, and the transgenic mice produced by this method contain a polyUAS target site specific for the chimeric Gal4- PPR1 zinc finger domain (Example 7).

[00114] As described in Example 2, oocytes are first collected from oviducts of superovulated poly UASQ/UASU B6D2F1 females after intraperitoneal injection of 5 International Units (IU) equine chorionic gonadotropin (eCG) followed by injection of 5 IU human chorionic gonadotropin (hCG) 48 hours later. Matured oocytes collected 13-15 hours after hCG injection are freed from cumulus cells by treatment with 0.1% bovine testicular hyaluronidase (359 U/mg solid) in HEPES-CZB medium (CZB medium [81.62 mM NaCI₁ 4.83 mM KCI₁ 1.18 mM KH₂PO₄, 1.18 mM MgSO₄, 1.7 mM CaCI₂, 25.12 mM NaHCO₃, 31.3 mM sodium lactate, 0.27 mM sodium pyruvate, 1 mM L-glutamine, 0.11 mM EDTA, 3 mg/ml bovine serum albumin (BSA), 10 μg/ml gentamicin, 10 μg/ml phenol red], pH 7.4, plus 20 mM HEPES-HCI, 5 mM NaHCO₃, and 0.1 mg/ml polyvinyl alcohol instead of BSA). Oocytes are rinsed and kept at 37°C in fresh CZB medium before sperm injection.

[00115] Spermatozoa are collected from the cauda epididymis of B6D2F1 males. A dense sperm mass squeezed out of the epididymis was placed at the bottom of 200 μl Mg²⁺-free HEPES-CZB buffered solution in a microcentrifuge tube. After standing for 10 min at 37°C, the upper 20 μl of the sperm suspension was collected and mixed with an equal volume of HEPES-CZB containing 12% polyvinylpyrrolidone (PVP). Ten microliters of 200 nanogram/microliter plasmid pMMK-1 (Figure 5), containing an EGFP transgene and the gene for a chimeric piggyBac transposase carrying a Gal4/PPR1 zinc-finger DNA binding domain at its N-terminus (with the same domain structure shown in Figure 12A), is mixed with 10 microliters of fresh swim-up sperm solution. A single spermatozoon moving slowly in the solution is drawn, tail first, into the injection pipette in such a way that its neck (the junction between the head and tail) is at the opening of the pipette. The head is separated from the tail by applying a few piezo-pulses to the neck region.

[00116] Each sperm head that has its tail removed in the mixed solution is individually microinjected into an isolated oocyte (intra-cytoplasmic sperm injection, ICSI). Two-cell embryos are transferred into the oviducts of pseudopregnant females which are mated with vasectomized males the night before. After gestation, the females are allowed to give birth to their own young and the newborn pups are examined for EGFP expression in their skin by epifluorescence (Figure 6). Insertion of the EGFP transgene at the UAS site is verified by PCR using primers corresponding to the EGFP gene and one of the UASG/UASU sequences.

EXAMPLE 9: GENERATION OF A MOUSE CELL LINE IN CULTURE CONTAINING A POLYUAS TRANSGENE INSERTION SITE BY CULTIVATION OF EMBRYONIC STEM CELLS FROM POLYUAS MICE

[00117] To generate a mouse cell line containing a polyUAS transgene insertion site in its genome, mice that are homozygous for a polyUAS genomic array are generated as described in Example 1. Two mice of the opposite sex among these homozygous mice are isolated and allowed to mate. After mating, embryos are isolated from the mother, and embryonic stem cells are removed from the embryos and cultured using standard techniques (Nagy, A., Gertsenstein, M., Vintersten, K., and Behringer, R. "Isolation and Culture of Blastocyst-Derived Stem Cell Lines," Chapter 8 of Manipulating the Mouse Embryo, 3rd edition. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, USA, 2003; Bryja, V., et al., "An efficient method for the derivation of mouse embryonic stem cells," Experimental Protocols for Embryonic Stem Cell Research, Stem Cells Express, published online December 13, 2005; doi:10.1634/stemcells.2005-0444) The cells are expanded and passaged for several generations to enrich for an immortalized cell population. EXAMPLE 10: GENERATION OF CULTURED HELA CELLS CONTAINING POLYUAS TRANSGENE INSERTION SITES BYDIRECT TRANSFECTION WITH POLYUAS CONCATEMERIC DNA

[00118] To generate a human cell line containing a genomic polyUAS transgene insertion site for use by a chimeric Gal4-DNA binding domain-containing transposase, concatemeric DNA containing repeated polyUAS sequences are prepared in the following manner. The two DNA oligonucleotides described in Example 1 , 6xUAS-top and δxUAS-bottom, each containing a cleavage site for the restriction enzyme Pvull at their 3-prime ends, are first obtained from a commercial supplier of custom oligonucleotides.

[00119] When hybridized, these oligonucleotide sequences give rise to a double-stranded sequence with the "monomeric" array sequence shown above. These oligonucleotides are mixed, digested with Pvull using standard conditions, and ligated overnight with T4 DNA ligase to form concatemers of various lengths with the following structure:

[00120] Figure 2 shows an agarose gel image of the concatemeric DNA of varying "monomeric" repeat length (right lane) after overnight ligation. DNA size markers (100 bp ladder) were run in the left lane.

[00121] This polyUAS concatemeric DNA is diluted to approximately 200- μg/mL in ImM-T ris HCL pH7.4 with 0.1 mM EDTA, mixed with a cotransfection plasmid at the same concentration carrying an antibiotic resistance gene (such as pRC/RSV; Invitrogen) and Cellfectin reagent (Invitrogen), and added to the media of HeLa cells in culture. Transfected cells with stably-integrated cotransfection plasmid (typically indicating successful integration of all exogenous DNA in the transfection mixture) are selected using hygromycin in the growth media until healthy, surviving cells predominate. Genomic DNA from these cells is isolated, digested with a restriction endonuclease, electrophoresed on a polyacrylamide gel, and subjected to Southern blotting using a probe matching the polyUAS "monomer" sequence. The presence of DNA bands specifically detected by this probe in transfected cells but not in untransfected cells indicates genomic integration of the polyUAS transgene insertion site.

EXAMPLE 11: PIGGYBAC EXHIBITS GREATER TRANSPOSITION ACTIVITY IN MAMMALIAN CELLS THAN SB11, TΘL-2, AND MOS1.

[00122] Since different transposon systems have been independently developed and tested in different laboratories, it is difficult to draw conclusions regarding their relative efficiency only on the basis of published literature. A direct comparison of transposition activity of various transposon systems identifies the most promising transposon(s). Mos1, SB11, Tol2, and piggyBac transposon systems can be constructed using a two-component system (Figure 13): a helper plasmid containing the transposase driven by the cytomegalovirus (CMV) promoter (Figure 13A) and a donor plasmid with the terminal repeats bearing a cassette with hygromycin resistance and kanamycin resistance genes to facilitate selection in eukaryotes and prokaryotes, respectively, and a CoIEI replication origin for plasmid propagation in bacteria (Figure 13B). Additionally, the efficiency of chromosomal integration can vary among the transposons depending upon chromatin organization and/or host factors. Therefore, transposition activity of each of the four transposon systems is determined in four mammalian cell lines: HeLa (human cervical carcinoma), HEK293 (human embryonic kidney cell), H1299 (human lung carcinoma), and CHO (Chinese hamster ovarian carcinoma).

[00123] To assess efficiency of transgenesis, cells at 80% confluence are harvested, and 1x10⁵ cells are seeded into individual wells of 24-well plates 18 hours before transfection. A total of 400ng of DNA is used for each transfection reaction with FuGENE 6 (Roche). For each cell line, one-tenth of the transfected cells is transferred to 100 mm plates followed by hygromycin selection for 14 days. The concentration of hygromycin B used in HeLa, HEK293, H1299, and CHO cells is 200, 100, 400, and 400 μg per milliliter, respectively. To count the clones, cells are fixed with PBS containing 4% paraformaldehyde for 10 min and then stained with 0.2% methylene blue for 1 hr. After 14 days of hygromycin selection, cell colonies are counted. Because colonies smaller than 0.5 mm in diameter often fail to be subcloned in the presence of hygromycin, only colonies larger than 0.5 mm in diameter are counted. As shown in Figure 14 (A-E), piggyBac and Tol2 possess activity in all cell lines tested. SB11 displays slight transposition activity in CHO, HeLa, and HEK293 cells, while it is inactive in H1299 cells. No transposition activity is detected with Mos1 in the four cell lines used (Figure 14A-E).

[00124] As indicated in Figure 14A-D, the transposition activity of piggyBac, Tol2, and SB11, varies in different cells. For example, ~1000 hygromycin-resistant colonies are detected with both the control plasmids and SB17 -expressing plasmid in H 1299 cells (Figure 14B), suggesting a lack of transposition activity of SB11 in this cell line. However, in HEK293 cells, ~500 hygromycin-resistant colonies are detected in the presence of SB11 transposase, which represents an 8-fold increase over cells transfected with control plasmid (Figure 14C). Two parameters, relative fold and percentage of transposition, are thus used to assess the transposition activity of the different transposon systems. The relative fold is obtained by dividing the number of hygromycin-resistant colonies detected in cells transfected by donor plus helper by the colony number that results from random integration (as in transfection experiments with control plasmid not encoding a transposase). The percentage of transposition, hereafter referred to as transposition rate, is calculated by subtracting the number of hygromycin-resistant colonies detected in cells transfected with control plasmid from the number of resistant colonies observed in cell transfected with a transposase-encoding plasmid, then dividing by 1x10⁵ (the number of cells originally seeded before transfection), and finally multiplying by 100 to convert to percentage. The transposition rate represented here, however, is not normalized by the transfection efficiency in various cell lines. As summarized in Table 3, the relative fold ranges for the three transposons in different cell lines are as follows: (1) SB11 from 1 [equal to control] in H1299 to 8.1 in HEK293, (2) piggyBac from 5.7 in H1299 to 114 in HEK293, and (3) 7o/2 from 3.3 in CHO to 93.9 in HEK293. The transposition rate ranges are: (1) SB11 from 0% in H1299 to 2.9% in CHO, (2) piggyBac from 0.7% in HeLa to 7.0% in CHO, and (3) Tol2 from 0.08% in HeLa to 1.8% in CHO. Once again, piggyBac displays the highest transposition activity among the three active transposon systems tested, as judged by both the transposition rate and relative fold. The transposition rate of Tol2 is higher than SB11 in H1299 and HEK293 but not in CHO and HeLa cells. Owing to the relatively high integration rate of the SB11 control, the relative fold seen in all four cell lines for Tol2 is higher than that of SB11.

Table 3 Summary of the transposition efficiency of SB11, piggyBac, and Tol2 transposon systems

Relative fold values indicate the relative fold of hygromycin-resistaπt clones as compared with controls (n = 6) Percentage of transposition values indicate the percentage of true transposition from 1 x 105 cells seeded

[00125] The type of DNA transposition described herein involves a two-step action: (1) excision of the transposable element from the donor plasmid, and (2) integration of the excised fragment into its DNA target. Therefore, the numbers of hygromycin-resistant colonies are the result of both excision and integration events. Although no activity is detected in cells transfected with Mos1, it is still possible that successful excision occurs but that integration does not. To exclude this possibility, a plasmid-based excision assay is performed using the polymerase chain reaction (PCR). As a consequence of excision, a short version of the donor plasmid should be produced.

[00126] To perform this assay, 1 x 10⁶ HEK293 cells are seeded onto 60mm² plates 18 hours before transfection. One microgram each of donor and helper plasmid is added to the media to transfect the cells. Plasmids are recovered using the Hirt method 72 hours after transfection (Ziegler, K. et al. J. Virol. Methods [2004] 122: 123). Plasmids isolated are used as templates for nested PCR using primers listed below to detect the presence of donor plasmids that undergo excision: piggyBac first round, 5Bac-1 (TCGCCATTCAGGCTGCGC)/3Bac- I (TGTTCGGGTTGCTGATGC); piggyBac second round, 5Bac- 2(CCTCTTCGCTATTACGCC)/3Bac-2 (TGACCATCCGGAACTGTG); Sleeping Beauty first round, F1-ex (CCAAACTGGAACAACACTCAACCCTATCTC)/ o-lac- R(GTCAGTGAGCGAGGAAGCGGAAGAG); Sleeping Beauty second round, KJC031 (CGATTAAGTTGGGTAACGCCAGGGTTT)/ i-lac- R(AGCTCACTCATTAGGCACCCCAGGC); MOS1 first round, 5mos-1 (TCCATTGCGCATCGTTGC)/ 3mos-1 (AGTACTAGTTCGAACGCG); Mos1 second round, 5mos-2 (ACAGCGTTGTTCCACTGG)/ 3mos-2 (AAGCTGCATCAGCTTCAG).

[00127] No excision-dependent PCR product is detected in cells transfected with donor and helper plasmids for Mos1, whereas excision-dependent PCR products with sizes of 533 bp for SB11 or 316 bp for piggyBac are detected (Figure 14F). SB11 and piggyBac are therefore able to both excise and integrate their respective transposons, while Mos1 is unable to do either.

EXAMPLE 12: PIGGYBAC EXHIBITS GREATER TRANSPOSITION ACTIVITY IN MAMMALIAN CELLS THAN TΘL2 AND SB11 IN CHROMOSOMAL INTEGRATION ASSAY TESTING VARYING AMOUNTS OF HELPER PLASMID.

[00128] To confirm that piggyBac is more efficient than Tol2 and SB11 transposases, a chromosomal integration assay is performed by transfecting HEK293 with a fixed amount of donor plasmid (200 ng) plus varying amounts of helper plasmid encoding either piggyBac, Tol2, and SB11. Plasmid pcDNA3.1Δneo (Figure 13A) is used to normalize the total amount of DNA introduced into the cells. As shown in Figure 14A-C, the lowest number of hygromycin-resistant colonies for piggyBac is approximately 1500, which is significantly higher than the highest number of resistant colonies observed for either Tol2 (490) or SB11 (1180). Furthermore, piggyBac achieves its highest transposition activity (4535) when 200 ng of donor and 100 ng of helper plasmids are introduced into cells. Therefore, piggyBac consistently demonstrates the highest transposition activity of the four transposases tested in mammalian cells in this study.

EXAMPLE 13: PIGGYBAC TRANSPOSITION DECLINES AS HELPER LEVELS INCREASE.

[00129] Transposition efficiency depends on the availability of transposon (donor) and transposase (helper) in cells. It was shown elsewhere that, over a certain threshold, SB11 transposition declines with increasing transposase, a phenomenon known as overproduction inhibition (Lohe, A., et al., MoI. Biol. Evol. [1996] 13: 549). Conversely, Tol2 transposition was directly proportional to the levels of transposase and did not appear to exhibit overproduction inhibition (Kawakami, K., et al., Genetics [2004] 166: 895). Overproduction inhibition for SB11 was also observed, while Tol2 transposition was directly proportional to the amount of transposase DNA (Figure 14A, B) (ibid; Zayed, H. et al., MoI. Ther. [2004] 9: 292). Like SB11, piggyBac also showed peak activity at a ratio of 2 to 1 (donor to helper). However, unlike SB11, which demonstrated a gradual reduction of activity above this ratio, the activity of piggyBac declined rapidly (Figure 15C). These findings suggest that piggyBac exhibits overproduction inhibition.

[00130] To further address this issue, a chromosomal integration assay was performed for piggyBac using 50 ng of donor with increasing amounts of helper ranging from 50 to 300 ng. For each transfection, pcDNA3.1Δneo was again used to normalize the total amound of DNA introduced into the cells. As seen in Figure 15D, increasing the ratio of helper to donor plasmid beyond the 2:1 ratio producing optimum transgenesis resulted in a gradual reduction in transposition. These data further tend to indicate that overproduction inhibition occurs with piggyBac.

Claims

CLAIMSWhat is claimed is:

1. A transgenic animal containing in its genome a specific transgene target site, wherein said specific transgene target site comprises one or more nucleotide sequence repeats, said repeats each comprising one or more transposon insertion sequences capable of recognition by a transposase enzyme and one or more recognition sequences for a DNA-binding polypeptide.

2. The transgenic animal of claim 1 , wherein said DNA binding polypeptide is a chimeric polypeptide comprising a transposase enzyme and one or more DNA binding domains.

3. The transgenic animal of claim 2, wherein said transposase enzyme can be selected from one of the group consisting of piggyBac, Sleeping Beauty, Mos1, Tc1/mariner, Tol2, Tc3, MuA, and Himari transposase.

4. The transgenic animal of claim 2, wherein said transposase enzyme is piggyBac transposase.

5. The transgenic animal of claim 2, wherein said one or more DNA binding domains are selected from the group consisting of a zinc finger, helix-turn- helix, leucine zipper, helix-loop-helix, winged helix-turn-helix, homeodomain, basic domain, ribbon-helix-helix, TATA-binding protein domain, beta barrel dimer, and ReI homology domain.

6. The transgenic animal of claim 2, wherein said one or more DNA binding domains are zinc finger domains.

7. The transgenic animal of claim 2, wherein said chimeric polypeptide comprises one or more zinc finger domains and piggyBac transposase.

8. The transgenic animal of claim 2, wherein said chimeric polypeptide comprises a zinc finger domain and piggyBac transposase.

9. The transgenic animal of claim 1 , wherein said recognition sequence for a DNA-binding polypeptide is an Upstream Activating Sequence.

10. The transgenic animal of claim 1 , wherein said recognition sequence for a DNA-binding polypeptide is an Upstream Activating Sequence capable of being recognized by a Gal4 DNA-binding domain.

11. The transgenic animal of claim 1 , wherein said recognition sequence for a DNA-binding polypeptide is an Upstream Activating Sequence capable of being recognized by a polypeptide comprising SEQ ID NO.: 1.

12. The transgenic animal of claim 1 , wherein said recognition sequence for a DNA-binding polypeptide is an Upstream Activating Sequence capable of being recognized by a polypeptide comprising SEQ ID NO.: 2.

13. The transgenic animal of claim 1 , wherein recognition sequence for a DNA-binding polypeptide can be selected from the group consisting of SEQ ID NO.: 3, SEQ ID NO.: 4, SEQ ID NO.: 5, SEQ ID NO.: 6, SEQ ID NO.: 7, and SEQ ID NO.: 8.

14. The isolated animal of claim 2, wherein said transposase enzyme is codon-biased for the species of said animal.

15. The isolated animal cell of claim 2, wherein said transposase enzyme is codon-biased piggyBac transposase.

16. The isolated animal cell of claim 2, wherein said transposase enzyme comprises SEQ ID NO.: 9.

17. The transgenic animal of claim 1 , wherein said recognition sequence for a DNA-binding polypeptide is capable of being recognized by a DNA-binding polypeptide engineered for greater binding specificity to said recognition sequence.

18. The transgenic animal of claim 17, wherein said DNA-binding polypeptide comprises one or more Gal4 DNA-binding domains engineered for greater binding specificity to said recognition sequence.

19. The transgenic animal of claim 1 , wherein the animal is one of the group consisting of vertebrates and invertebrates.

20. The transgenic animal of claim 1 , wherein the animal is one of the group consisting of nematodes, arthropods, molluscs, echinoderms, annelid worms.

21. The transgenic animal of claim 1 , wherein the animal is one of the group consisting of mammals, fish, amphibians, reptiles, and birds.

22. The transgenic animal of claim 1 , wherein the animal is one of the group consisting of rodents, cows, pigs, sheep, goats, and horses.

23. The transgenic animal of claim 2, wherein the one or more DNA binding domains of the chimeric polypeptide are fused to the N-terminus of the transposase enzyme.

24. The transgenic animal of claim 2, wherein the one or more DNA binding domains of the chimeric polypeptide are fused to the C-terminus of the transposase enzyme.

25. The transgenic animal of claim 2, wherein the one or more DNA binding domains of the chimeric polypeptide are fused to both the N-terminus and C- terminus of the integrating enzyme.

26. The transgenic animal of claim 1 , wherein said one or more transposon insertion sequences are positioned upstream, downstream, or both upstream and downstream from said recognition sequences for a DNA-binding polypeptide.

27. A method of producing a transgenic animal containing in its genome a specific transgene target site, wherein said specific transgene target site comprises one or more nucleotide sequence repeats, said repeats each comprising one or more transposon insertion sequences capable of recognition by a transposase enzyme and one or more recognition sequences for a DNA-binding polypeptide, the method comprising: i) obtaining two complementary oligonucleotides comprising one or more transposon insertion sequences capable of recognition by a transposase enzyme and one or more recognition sequences for a DNA-binding polypeptide, wherein each oligonucleotide contains at its 3-prime end a unique restriction enzyme cleavage sequence; ii) combining said complementary oligonucleotides to form a mixture, wherein said oligonucleotides form a double-stranded nucleotide having at each end an overhang comprising said unique restriction enzyme cleavage sequence; iii) contacting said mixture with DNA ligase, wherein said contacting generates concatemeric DNA of various lengths comprising repeats of said oligonucleotide sequence; iv) introducing said concatemeric DNA into an animal embryo or blastomere cell thereof; v) testing for the presence of said concatemeric DNA in the genome of an animal formed from said embryo; vi) mating said animal with a wild-type animal of the opposite sex to generate offspring; vii) testing for the presence of said concatemeric DNA in the genome of said offspring; viii) self-crossing sibling offspring containing said concatemeric DNA in their genomes to generate offspring homozygous for concatemeric DNA in their genomes; and ix) repeating steps (vi) through (viii) with said homozygous offspring to generate animals with single, stable genomic loci comprising a transgene target site of unchanging repeat length.

28. An isolated animal cell in culture containing in its genome a specific transgene target site, wherein said specific transgene target site comprises one or more nucleotide sequence repeats, said repeats each comprising one or more transposon insertion sequences capable of recognition by a transposase enzyme and one or more recognition sequences for a DNA-binding polypeptide.

29. The isolated animal cell of claim 28, wherein said DNA binding polypeptide is a chimeric polypeptide comprising said transposase enzyme and one or more DNA binding domains.

30. The isolated animal cell of claim 29, wherein said transposase enzyme can be selected from one of the group consisting of piggyBac, Sleeping Beauty, Mos1, Tc1/mariner, Tol2, Tc3, MuA, and Himari transposase.

31. The isolated animal cell of claim 29, wherein said transposase enzyme is piggyBac transposase.

32. The isolated animal cell of claim 29, wherein said one or more DNA binding domains are selected from the group consisting of a zinc finger, helix-turn- helix, leucine zipper, helix-loop-helix, winged helix-turn-helix, homeodomain, basic domain, ribbon-helix-helix, TATA-binding protein domain, beta barrel dimer, ReI homology domain.

33. The isolated animal cell of claim 29, wherein said one or more DNA binding domains are zinc finger domains.

34. The isolated animal cell of claim 29, wherein said chimeric polypeptide comprises one or more zinc finger domains and piggyBac transposase.

35. The isolated animal cell of claim 29, wherein said chimeric polypeptide comprises a zinc finger domain and piggyBac transposase.

36. The isolated animal cell of claim 28, wherein said recognition sequence for a DNA-binding polypeptide is an Upstream Activating Sequence.

37. The isolated animal cell of claim 28, wherein said recognition sequence for a DNA-binding polypeptide is an Upstream Activating Sequence specific for a Gal4 DNA-binding domain.

38. The isolated animal cell of claim 28, wherein said recognition sequence for a DNA-binding polypeptide is an Upstream Activating Sequence specific for a polypeptide comprising SEQ ID NO.: 1.

39. The isolated animal cell of claim 28, wherein said recognition sequence for a DNA-binding polypeptide is an Upstream Activating Sequence specific for a polypeptide comprising SEQ ID NO.: 2.

40. The isolated animal cell of claim 28, wherein said recognition sequence for a DNA-binding polypeptide can be selected from the group consisting of SEQ ID NO.: 3, SEQ ID NO.: 4, SEQ ID NO.: 5, SEQ ID NO.: 6, SEQ ID NO.: 7, and SEQ ID NO.: 8.

41. The isolated animal cell of claim 29, wherein said transposase enzyme is codon-biased for the species of said animal cell.

42. The isolated animal cell of claim 29, wherein said transposase enzyme is codon-biased piggyBac transposase.

43. The isolated animal cell of claim 29, wherein said transposase enzyme comprises SEQ ID NO.: 9.

44. The isolated animal cell of claim 28, wherein said recognition sequence for a DNA-binding polypeptide is capable of being recognized by a DNA-binding polypeptide engineered for greater binding specificity to said recognition sequence.

45. The isolated animal cell of claim 44, wherein said DNA-binding polypeptide is a Gal4 DNA-binding domain engineered for greater binding specificity to said recognition sequence.

46. The isolated animal cell of claim 28, wherein the cell is derived from one of the group consisting of vertebrates and invertebrates.

47. The isolated animal cell of claim 28, wherein the isolated animal cell is derived from one of the group consisting of nematodes, arthropods, molluscs, echinoderms, annelid worms.

48. The isolated animal cell of claim 28, wherein the isolated animal cell is derived from one of the group consisting of mammals, fish, amphibians, reptiles, and birds.

49. The isolated animal cell of claim 28, wherein the isolated animal cell is derived one of the group consisting of rodents, cows, pigs, sheep, goats, horses, and primates.

50. The isolated animal cell of claim 28, wherein the isolated animal cell is derived from humans.

51. The isolated animal cell of claim 29, wherein the one or more DNA binding domains of the chimeric polypeptide are fused to the N-terminus of the integrating enzyme.

52. The isolated animal cell of claim 29, wherein the one or more DNA binding domains of the chimeric polypeptide are fused to the C-terminus of the integrating enzyme.

53. The isolated animal cell of claim 29, wherein the one or more DNA binding domains of the chimeric polypeptide are fused to both the N-terminus and C- terminus of the integrating enzyme.

54. The isolated animal cell of claim 28, wherein said one or more transposon insertion sequences are positioned upstream, downstream, or both upstream and downstream from said recognition sequences for a DNA-binding polypeptide.

55. A method of producing an isolated non-human animal cell in culture containing in its genome a specific transgene target site, wherein said specific transgene target site comprises one or more nucleotide sequence repeats, said repeats each comprising one or more transposon insertion sequences capable of recognition by a transposase enzyme and one or more recognition sequences for a DNA-binding polypeptide, the method comprising: i) generating a non-human animal according to the method of claim 27; ii) crossing said animal with a sibling of the opposite sex homozygous for the same transgene integration site; iii) obtaining early embryos from the female of the mating pair; iv) isolating embryonic stem cells from said embryos; and v) serially cultivating said embryonic stem cells in culture until an immortalized cell line emerges, wherein the cells of said immortalized cell line contain in their genome the specific transgene target site introduced into said non- human animal generated according to the method of claim 27.

56. A method of producing an isolated animal cell in culture containing in its genome a specific transgene target site, wherein said specific transgene target site comprises one or more nucleotide sequence repeats, said repeats each comprising one or more transposon insertion sequences capable of recognition by a transposase enzyme and one or more recognition sequences for a DNA-binding polypeptide, the method comprising: i) obtaining two complementary oligonucleotides comprising a transposon insertion sequence capable of recognition by a transposase enzyme and one or more recognition sequences for a DNA-binding polypeptide, wherein each oligonucleotide contains at its 3-prime end a unique restriction enzyme cleavage sequence; ii) combining said complementary oligonucleotides to form a mixture, wherein said oligonucleotides form a double-stranded nucleotide having at each end an overhang comprising said unique restriction enzyme cleavage sequence; iii) contacting said mixture with DNA ligase, wherein said contacting generates concatemeric DNA of various lengths comprising repeats of said oligonucleotide sequence; iv) introducing said concatemeric DNA in combination with a separate nucleic acid encoding a selectable marker gene into an isolated animal cell in culture; v) serially cultivating the cells under conditions selective for expression of said selectable marker gene; vi) producing a clonal cell line from a surviving cell; vii) testing for the presence of said concatemeric DNA containing said specific transgene target site in the cells of said clonal cell line; and vii) further serially cultivating cells of said clonal cell line to generate cells comprising in their genome single, stable genomic loci comprising a transgene target site of unchanging repeat length.