WO2008100145A2 - Procédé de sélection d'un mammifère non humain produisant du lait à composition en acides gras améliorée - Google Patents

Procédé de sélection d'un mammifère non humain produisant du lait à composition en acides gras améliorée Download PDF

Info

Publication number
WO2008100145A2
WO2008100145A2 PCT/NL2008/050085 NL2008050085W WO2008100145A2 WO 2008100145 A2 WO2008100145 A2 WO 2008100145A2 NL 2008050085 W NL2008050085 W NL 2008050085W WO 2008100145 A2 WO2008100145 A2 WO 2008100145A2
Authority
WO
WIPO (PCT)
Prior art keywords
milk
fatty acids
dgatl
allele
cis
Prior art date
Application number
PCT/NL2008/050085
Other languages
English (en)
Other versions
WO2008100145A3 (fr
Inventor
Johannes Antonius Maria Van Arendonk
Jeroen Margot Leon Heck
Anke Schennink
Maria Helena Petronella Wilhelmina Visker
Original Assignee
Wageningen Universiteit
Holland Genetics B.V.
Vereniging De Nederlandse Zuivel Organisatie
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Wageningen Universiteit, Holland Genetics B.V., Vereniging De Nederlandse Zuivel Organisatie filed Critical Wageningen Universiteit
Priority to EP08712611A priority Critical patent/EP2121976A2/fr
Publication of WO2008100145A2 publication Critical patent/WO2008100145A2/fr
Publication of WO2008100145A3 publication Critical patent/WO2008100145A3/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23C—DAIRY PRODUCTS, e.g. MILK, BUTTER OR CHEESE; MILK OR CHEESE SUBSTITUTES; MAKING THEREOF
    • A23C9/00—Milk preparations; Milk powder or milk powder preparations
    • A23C9/20—Dietetic milk products not covered by groups A23C9/12 - A23C9/18
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027—New or modified breeds of vertebrates
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/115—Fatty acids or derivatives thereof; Fats or oils
    • A23L33/12—Fatty acids or derivatives thereof
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00—Animals characterised by species
    • A01K2227/10—Mammal
    • A01K2227/101—Bovine
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23C—DAIRY PRODUCTS, e.g. MILK, BUTTER OR CHEESE; MILK OR CHEESE SUBSTITUTES; MAKING THEREOF
    • A23C2230/00—Aspects relating to animal feed or genotype
    • A23C2230/10—Animal milk with modified composition due to a specific feed
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00—Food compositions, function of food ingredients or processes for food or foodstuffs
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like

Definitions

  • the invention relates to the use of means that detect the presence of a SCD 878V and/or of additional means that detect the presence of a DGATl 232A allele in a method for identifying a non-human mammal which produces milk with an improved fatty acid composition.
  • milk and milk-derived foods including cheese and butter
  • milk and milk-derived foods were the main source of dietary saturated fatty acids across Europe, ranging between 27% and 58%.
  • the contribution from milk and milk-derived foods to dietary trans fatty acids was between 17% and 72%.
  • Milk- fat is relatively high in saturated fatty acids, especially C14:0 and C16:0, and low in polyunsaturated fatty acids.
  • Milk-fat composition can be altered through the nutrition of dairy cows (12), and possibly by selective breeding, although prospects for the latter have not been studied extensively.
  • the major prerequisite for selective breeding is existence of genetic variation in milk-fat composition among cows.
  • For milk-fat percentage around half the observed variation is estimated to be due to genetic variation (13-16). Phenotypic variation in milk-fat composition has been reported as well, both between and within breeds, although the number of reports on genetic variation is limited and recent publications are lacking (17-21).
  • DGATl acyl CoA:diacylglycerol acyltransferase 1
  • WO02/36824 discloses that bovine carrying the DGATl 232A allele produce more milk, said milk containing more milk-protein and less milk-fat than milk from cows that do not carry the DGATl 232A allele. The effect of the DGATl 232A allele on milk fatty acid composition is not known.
  • the present invention establishes that the DGATl 232 A allele is further associated with at least one of: a reduced content of saturated C 16 fatty acids, and an increased content of unsaturated Cl 8 fatty acids in the milk- fat composition.
  • SNP single nucleotide polymorphism
  • This gene codes for the Stearoyl-Coenzyme A desaturase (SCD).
  • SCD Stearoyl-Coenzyme A desaturase
  • the mutation A878V in the SCD enzyme was found particularly attractive for conferring healthier fatty acid composition to the milk.
  • the inventors established that the presence of both a SCD 878 V and a DGATl 232 A allele is associated with a milk having an even more healthy fatty acid composition.
  • a SCD 878 V allele detects the presence of a SCD 878 V allele and/or of additional means that detect the presence of a DGATl 232A allele in a method for identifying a non-human mammal, preferably a bovine which produces milk having a different milk-fat composition than the one from a milk produced by a non-human mammal not having a SCD 878 V and/or DGATl 232 A allele.
  • milk or milk- fat could be replaced by milk or milk- fat composition.
  • a milk or milk-fat composition is preferably defined by a fatty acid composition.
  • "different” preferably means that using any of the means as described herein the milk-fat composition of a milk produced by a non-human mammal having a SCD 878V and/or a DGATl 232 A allele is analyzed as being different (i.e. distinct) from the milk-fat composition of a milk produced by a non- human mammal not having a SCD 878 V and/or DGATl 232 A allele.
  • a "different" milk-fat composition more preferably means a healthier milk-fat composition.
  • a "healthy" milk-fat composition is further herein defined by reference to its fatty acid composition.
  • a SCD 878 V allele in a method for identifying a non-human mammal, preferably a bovine which produces milk having a different milk-fat composition than the one from a milk produced by a non- human mammal not having a SCD 575FaIIeIe. More preferably, in this embodiment, the milk has a milk-fat with an increased desaturation index for at least one of C16, C17,C18 and CLA fatty acids.
  • unsaturated Cl 8 fatty acids are preferably selected from the following group: C18:l cis 9 (oleic acid), C18:l cis 11, C18:2 cis 9,12 (linoleic acid), CLA (conjugated linoleic acid) and C18:3 cis 9,12,15 (linolenic acid). All these unsaturated C18 cis-isomers C18: 1 cis 9 (oleic acid), C18:l cis 11, C18:2 cis 9,12 (linoleic acid), CLA and C18:3 cis 9,12,15 (linolenic acid) are known to have a positive effect on human health.
  • the CLA is selected from the following isomers consisting of: C 18:2 cis 9, trans 11 and C18:2 translO, cis 12. Even more preferably, the CLA is the C18:2 cis9, transl l isomer.
  • a desaturation index is defined as being the ratio between the product and the substrate plus the product, said ratio being expressed as a percentage.
  • Substrate and product mean substrate and product for a SCD enzyme.
  • a SCD enzyme specifically introduces a cis double bond at the 9 position of a fatty acid.
  • the substrate and product are expressed as content of substrate and product as later defined herein.
  • the C16 index is: (C16:lcis9 / (C16:0 + C16:lcis9))xl00.
  • the C17 index is: (C17:lcis9 / (C17:0 + C17:lcis9))xl00.
  • the C18 index is: ((C18:lcis9 + C18:ltransl2) / (C18:0 + C18:lcis9 + C18:ltransl2))xl00.
  • the Cl 8 index is the index of C18: lcis9.
  • the index of C18:lcis9 is as follows: (C18:lcis9 / (C18:0 + C18:lcis9))xl00.
  • the index of CLA is as follows: (CLA/ (C 18: 1 transl l + CLA))xlOO, which is (C 18:2cis9transl 1/(C 18:1 transl l + C18:2cis9transl l))xl00. Therefore, the C18 index does not include the CLA index.
  • the CLA index is calculated as an index which is separate from the Cl 8 index.
  • the invention relates to a use of means, that detect the presence of a SCD 878V allele in a method for identifying a non-human mammal, preferably a bovine which produces milk having a milk-fat composition with at least one of an increased content of C16:lcis9, C17:lcis9 and CLA and a decreased content of C17:0 and C18:0 fatty acids.
  • This sentence is equivalent with an increased content of at least one of C16:lcis9, C17:lcis9 and CLA and/or a decreased content of at least one of C17:0 and C18:0 fatty acids.
  • the same meaning is given to the use of the expression "at least one" in combination with a group of features.
  • a SCD 878V allele is associated with milk having a healthy milk- fat composition: a healthy fatty acid composition wherein a decreased content of saturated C17 and C18 fatty acids and an increased content of unsaturated C 16, C 17, and Cl 8 fatty acids is seen.
  • An unsaturated Cl 8 fatty acid is preferably CLA.
  • an increased desaturation index for C 16, C 17, Cl 8 or CLA means a desaturation index which is higher than the corresponding desaturation index for C 16, C 17, C18 or CLA in the milk-fat of the milk of a non- human mammal, preferably a bovine not having a SCD 878V allele.
  • the increase is approximately of 2% or more. More preferably, the increase is approximately of 5% or more, or approximately of 7% or more, or approximately of 10% or more, or approximately of 15 % or more, or approximately of 20% or more, or approximately of 25% or more.
  • a decreased content of C17:0 or C18:0 fatty acids means a content of C17:0 or C18:0 fatty acids which is lower than the content of C 17:0 or C 18:0 fatty acids present in the milk-fat of the milk of a non-human mammal, preferably a bovine not having a SCD 878V allele.
  • the decrease is approximately of 4% or more, or approximately of 5% or more. More preferably, the decrease is approximately of 7% or more, or approximately of 10% or even more.
  • an increased content of C16:lcis9, C17:lcis9 or CLA fatty acids means a content of C16:lcis9, C17:lcis9 or CLA fatty acids which is higher than the content of C16:lcis9, C17:lcis9 or CLA fatty acids present in the milk- fat of the milk of a non- human mammal, preferably a bovine not having a SCD 878V allele.
  • the increase is approximately of 5% or more. More preferably, the increase is approximately of 7% or more, or approximately of 10% or more, or approximately of 15% or more, or approximately of 20% or more, or approximately of 25% or more.
  • a DGATl 232 A allele in a method for identifying a non-human mammal, preferably a bovine which produces milk having a different milk-fat composition than the one from a milk produced by a non- human mammal not having a DGATl 232 A allele.
  • the presence of a DGATl 232 A allele is associated with a milk having at least one of a reduced content of saturated C16 fatty acids and an increased content of unsaturated Cl 8 fatty acids.
  • the invention relates to the use of means that detect the presence of the DGATl 232A allele in a method for identifying a non- human mammal, preferably a bovine which produces milk having a milk-fat composition with at least one of a reduced content of saturated C 16 fatty acids and an increased content of at least one of C18 cis-isomers such as: C18:l cis 9 (oleic acid), C18:l cis 11, C18:2 cis 9,12 (linoleic acid), conjugated linoleic acid (CLA) and C18:3 cis 9,12,15 (linolenic acid).
  • the Cl 8 cis-isomers are selected from the group consisting of: C18:l cis 9 (oleic acid), C18:l cis 11, C18:2 cis 9,12 (linoleic acid), CLA and C18:3 cis 9,12,15 (linolenic acid).
  • the C18 cis-isomers are selected from the group consisting of oleic acid, linoleic acid, CLA and linolenic acid.
  • the CLA is preferably selected from the following isomers consisting of: C18:2 cis 9, trans 11 and C18:2 translO, cis ⁇ 2.
  • the invention relates to the use of means that detect the presence of the DGATl 232A allele in a method for identifying a non-human mammal, preferably a bovine which produces milk having a milk-fat composition with at least one of a reduced content of saturated C16 fatty acids and an increased content of at least one of Cl 8 cis-isomers such as: C 18:1 cis 9 (oleic acid), C18:l cis 11, C18:2 cis 9,12 (linoleic acid), and C18:3 cis 9,12,15 (linolenic acid).
  • the C18 cis-isomers are selected from the group consisting of: C18:l cis 9 (oleic acid), C18:l cis 11, C18:2 cis 9,12 (linoleic acid) and C18:3 cis 9,12,15 (linolenic acid).
  • the Cl 8 cis-isomers are selected from the group consisting of oleic acid, linoleic acid, and linolenic acid.
  • the DGATl 232A allele is associated with milk having a healthy milk- fat composition: a healthy fatty acid composition wherein a reduced content of saturated C16 fatty acids and an increased content of unsaturated Cl 8 fatty acids is seen. Furthermore, the DGATl 232A allele has unexpectedly been found to be associated with a relative small increase in saturated C 14 fatty acid. The total effect on fatty acid composition is positive for the human health because the effect of the DGATl 232A allele is much more pronounced on saturated C16 fatty acids, unsaturated C18 fatty acids than on saturated C14 fatty acids (see table 5).
  • the invention relates to the use of means that detect the presence of the DGATl 232A allele in a method for identifying a non-human mammal, preferably a bovine which produces milk having a milk- fat composition with at least one of a reduced content of saturated C16 fatty acids, an increased content of unsaturated C 18 fatty acids, and an increased content in saturated C 14 fatty acids. Furthermore, if one looks at the overall effect on fatty acid composition, it has been observed (table 6) that the DGATl K232A mutation has a statistically significant effect (reduction) on C5, C6, C7, C8, C9, CI l, C13, C15, C16 and C17 saturated fatty acids.
  • the DGATl K232A mutation also has a statistically significant effect (increase) on C18 (C 18:1 cis9 (oleic acid), C 18:1 cisl l, C 18:2 cis 9,12 (linoleic acid), CLA, and C18:3 cis 9,12,15 (linolenic acid)) unsaturated fatty acids (table 7).
  • the invention relates to the use of means that detect the presence of the DGATl 232A allele in a method for identifying a non-human mammal, preferably a bovine which produces milk having a milk- fat composition with at least one of a reduced content of saturated C5, C6, C7, C8, C9, CI l, C13, C15, C16 and C17 fatty acids and an increased content of unsaturated on Cl 8 (Cl 8:1 cis9 (oleic acid), C 18:1 cisl l, C 18:2 cis 9,12 (linoleic acid), CLA, and C18:3 cis 9,12,15 (linoleic acid)) fatty acids.
  • a reduced content of saturated C16 fatty acids means a content of saturated C16 fatty acids which is lower than the content of saturated C 16 fatty acids present in the milk-fat composition of the milk of a non-human mammal, preferably a bovine not having a DGATl 232 A allele.
  • the reduction is approximately of 5% or more. More preferably, the reduction is approximately of 7% or more or approximately of 10% or even more.
  • an increased content of unsaturated C 18 fatty acids means a content of unsaturated Cl 8 fatty acids which is higher than the content of unsaturated C18 fatty acids present in the milk-fat composition of the milk of a non- human mammal, preferably a bovine not having a DGATl 232 A allele.
  • the increase is approximately of 5% or more. More preferably, the increase is approximately of 7% or more, or approximately of 10% or more.
  • an increased content of saturated C 14 fatty acid means a content of saturated C 14 fatty acid which is higher than the content of saturated C 14 fatty acids present in the milk- fat composition of the milk of a non-human mammal, preferably a bovine not having a DGATl 232 A allele.
  • the increase is approximately of 2% or more. More preferably, the increase is approximately of 5% or more or approximately of 7% or even more.
  • a SCD 878V allele detects the presence of a SCD 878V allele and of additional means that detect the presence of a DGATl 232 A allele in a method for identifying a non- human mammal, preferably a bovine which produces milk having a different (more preferably healthier) milk-fat composition than the one from a milk produced by a non-human mammal not having a SCD 878V and/or DGATl 232 A allele.
  • the invention relates to a use of means that detect the presence of a SCD 878V allele in a method for identifying a non-human mammal, preferably a bovine which produces milk having a milk-fat with an increased desaturation index for at least one of C 16, C 17, C18 and CLA fatty acids, wherein additional means are used to detect the presence of a DGATl 232 A allele.
  • a SCD 575F aIIeIe and a DGATl 232 A allele explain a distinct part of the variation seen for the desaturation index of at least one of C 16, C18 and CLA fatty acids.
  • the effect of the SCD A878V polymorphism and of the DGATl K232A polymorphism are mostly additive and in the same direction. Consequently, the combined homozygous genotypes have progressively decreasing effects on the ClO, C12 and C14 indexes, and progressively increasing effects on the Cl 8 and CLA indexes.
  • the effect of the SCD A878V polymorphism and of the DGATl K232A polymorphism are mostly additive, but in opposite directions.
  • the effect of the SCD A 878 V polymorphism is larger than the effect of the DGATl K232A polymorphism.
  • the combination of homozygous SCD 878 A and homozygous DGATl 232 A has the most decreasing effect on the C16 index
  • the combination of homozygous SCD 575 F and homozygous DGATl 232K has the most increasing effect on the C16 index.
  • the combination of homozygous SCD 575 F and homozygous DGATl 232 A has an increasing effect on the C16 index also.
  • the effect of the DGATl K232A polymorphism is not significant, therefore, does not add to the effect of the SCD A 878 V polymorphism.
  • DGATl 232 A allele has unexpectedly been found to be associated with a relative small increase in saturated C 14 fatty acids.
  • the total effect on fatty acid composition is positive for the human health because the effect of a DGATl 232 A allele is much more pronounced on saturated C16 fatty acids and unsaturated Cl 8 fatty acids than on saturated C 14 fatty acids.
  • the invention relates to the use of means that detect the presence of a DGATl 232 A allele in a method for identifying a non-human mammal, preferably a bovine which produces milk having a milk- fat composition with at least one of a reduced content of saturated C16 fatty acids, an increased content of unsaturated Cl 8 fatty acids, and an increased content in saturated C 14 fatty acids. Furthermore, if one looks at the overall effect on fatty acid composition, it has been observed that a DGATl K232A mutation has a statistically significant effect (decrease) on C5, C6, C7, C8, C9, CI l, C13, C15, C16 and C17 saturated fatty acids.
  • DGATl K232A mutation also has a statistically significant effect (increase) on Cl 8 (C 18:1 cis9 (oleic acid), C 18:1 cisl l, C18:2 cis 9,12 (linoleic acid), CLA, and C18:3 cis 9,12,15 (linolenic acid)) unsaturated fatty acids.
  • the invention relates to the use of means that detect the presence of a DGATl 232 A allele in a method for identifying a non-human mammal, preferably a bovine which produces milk having a milk- fat composition with at least one of a reduced content of saturated C5, C6, C7, C8, C9, CI l, C13, C15, C16 and C17 fatty acids and an increased content of unsaturated C 18 (C 18 : 1 cis9 (oleic acid), C 18 : 1 cis 11 , C 18 :2 cis 9, 12 (linoleic acid), CLA, and C18:3 cis 9,12,15 (linoleic acid)) fatty acids.
  • the milk has a milk-fat with an increased desaturation index for at least one of C 16, C 17, C18 and CLA fatty acids.
  • the increased desaturation index is the CLA index.
  • C 16, C 17, C18 or CLA means a desaturation index which is higher than the corresponding desaturation index for C 16, C 17, Cl 8 or CLA in the milk- fat of the milk of a non-human mammal, preferably a bovine not having a SCD 878V and a DGATl
  • the increase is approximately of 5% or more. More preferably, the increase is approximately of 7% or more, or approximately of 10% or more, or approximately of 15% or more.
  • the milk has a milk-fat composition with at least one of a decreased content of saturated C 16, C 17 and C 18 fatty acids and an increased content of unsaturated C 16, C17 and Cl 8 fatty acids.
  • a decreased content of saturated C16, C17 or C18 fatty acids means a content of C16:0, C17:0 or C18:0 fatty acids which is lower than the content of C16:0, C17:0 or C18:0 fatty acids present in the milk-fat of the milk of a non- human mammal, preferably a bovine not having a SCD 878 V and a DGATl 232 A allele.
  • the decrease is approximately of 4% or more, or approximately of 5% or more. More preferably, the decrease is approximately of 7% or more, or approximately of 10% or even more.
  • an increased content of unsaturated C 16, C17 or C18 fatty acids means a content of C16:lcis9, C17:lcis9, C18:lcis9 or CLA fatty acids which is higher than the content of C16:lcis9, C17:lcis9, C18:lcis9 or CLA fatty acids present in the milk-fat of the milk of a non-human mammal, preferably a bovine not having a SCD 878V and a DGATl 232 A allele.
  • the increase is approximately of 1% or more, or approximately of 5% or more. More preferably, the increase is approximately of 7% or more, or approximately of 10% or more, or approximately of 15% or more, or approximately of 20% or more.
  • fatty acid content preferably means the amount of fatty acid in gram per 100 gram fatty acids in the milk-fat (w/w). This content is therefore preferably expressed by means of weight percentages.
  • the milk-fat is preferably extracted from the milk as defined later herein.
  • Fatty acid methyl esters are preferably prepared from fat fractions and analyzed as defined later herein.
  • decrease and/or increase of fatty acid contents are preferably estimated by comparison with the corresponding control or average contents in the milk-fat of a control non-human mammal, preferably a bovine which is milked in the morning during winter (february-march) in its first lactation (between Day 63 and Day 282 in lactation).
  • the bovine is preferably a Dutch Holstein Friesian cow that is milked twice a day, in which population the frequency of the SCD 878V allele is 0.27 and the frequency of the DGATl 232 A allele is 0.60.
  • To have a representative average content at least 1000 cows are preferably used.
  • the invention may be applied to any non-human mammal for obtaining milk having an improved milk-fat composition or an improved fatty acid composition.
  • the non-human mammal is an ungulate and/or a ruminant.
  • Preferred ungulates include a cow (or bovine), a horse, a sheep, a camel, a donkey, or a goat. More preferably, the non-human mammal is a bovine.
  • Milk -fat is preferably extracted from the milk samples as follows. Milk -fat is extracted from the milk samples by adding 5 ml HCL (4M) to 100 ml of milk which is kept at 28°C and is shaken during 45 min. When butterfat is clearly visible, the water phase is poured off and the fat is rinsed with 200 ml cold water twice. Subsequently, the fat is melted at 70 0 C during 60 min, then transferred into a centrifuge tube and stored at -20 0 C until further processing. After defrosting, the tube is warmed to 40 0 C and centrifuged for 15 min at 1300g and 40 0 C.
  • the fat phase is cleared at 40 0 C and used for the preparation of fatty acid methyl esters.
  • Fatty acid methyl esters are prepared from fat fractions as described in ISO Standard 15884 (29). Fatty acid methyl esters are analyzed according to ISO Standard 15885 (3 0) on a Trace GC Ultra chromatograph (Thermo Electron Corporation, Waltham, MA, USA), using a Varian Fame Select column (100m x 0.25mm ID, Varian Inc. , Palo Alto, CA, USA). The initial temperature is held at 7O 0 C for 1 min, raised to 225 0 C at 3°C/min, and held at 225 0 C for 5 min. A volume of 1 ⁇ l is injected. Each peak is identified and quantified using pure methyl ester samples (Sigma-Aldrich, Zwijndrecht, the Netherlands; Larodan, Malmo, Sweden).
  • a SCD 878V ox both a SCD 878V and a DGATl 232A allele are determined with respect to DNA, mRNA, and/or protein obtained from the non-human mammal by direct or indirect methods.
  • the method used for detecting a SCD 878V or both a SCD 878V and a DGATl 232 A allele is not critical for the invention. Several methods were identified in WO 02/36824 using DNA, mRNA, and/or protein obtained from the bovine by direct or indirect methods.
  • the presence of a SCD 878 V or both a SCD 878 V and a DGATl 232 A allele is directly assessed in the milk of the non-human mammal, preferably a bovine.
  • somatic cells are first isolated from the milk. More preferably, in this preferred method, the Taqman assay or the SNaPshot assay is used as defined below.
  • the type of means used in the method of the invention is also not critical for the invention as long as these means are able to identify a SCD 878V or both a SCD 878V and a DGATl 232 A allele.
  • Preferred means include primers, nucleic acid probes or antibodies.
  • a bovine coding nucleic acid sequence of the SCD 575FaIIeIe is given in SEQ ID NO:1.
  • An amino acid sequence of the bovine SCD protein with the 878V allele encoded by SEQ ID NO:1 is SEQ ID NO:2.
  • a bovine coding nucleic acid sequence of the SCD 878 A allele is given in SEQ ID NO:3.
  • An amino acid sequence of the bovine SCD protein with the 878A allele encoded by SEQ ID NO:3 is SEQ ID NO:4.
  • the nucleic acid coding sequence and amino acid sequence of the allele A are also available at GenBank data library under accession number AY241932.
  • a bovine coding nucleic acid sequence of the DGATl 232 A allele is given in SEQ ID NO:5.
  • An amino acid sequence encoded by SEQ ID NO:5 is SEQ ID NO:6.
  • a bovine coding nucleic acid sequence of the DGATl 232K allele is given in SEQ ID NO:7.
  • An amino acid sequence encoded by SEQ ID NO:7 is SEQ ID NO:8.
  • PCR Polymerase Chain Reaction
  • Taqman assay the SNaPshot single-base extension assay: PCR followed by allele-specific single-base extension as means, - detection of protein variants of SCD or DGATl using antibodies directed against these variants as means, hybridisation with probes that are complementary either for the SCD 878V allele or the DGATl 232 A allele (without amplification) as means and PCR with three primers as means, one specific for the locus of SCD or DGATl, one specific for the desired allele (SCD 878V or DGATl 232A) and one for the undesired allele (SCD 878A or DGATl 232K).
  • the method used is the TaqMan assay: PCR using two primers and two probes as means.
  • This preferred method is extensively presented below taken DGATl as example.
  • This method includes a step in which ascertaining whether the K232A polymorphism is present in the sequence of DGATl DNA, includes amplifying the DNA in the presence of primers based on the nucleotide sequence of the DGATl gene and flanking sequence in the presence of allele-specific probes complementary to either the DGATl 232 A allele or the DGATl 232K allele.
  • a primer of the present invention used in PCR for example, is a nucleic acid molecule sufficiently complementary to the sequence on which it is based and of sufficient length to selectively hybridise to the corresponding portion of a nucleic acid molecule intended to be amplified and to prime synthesis thereof under in vitro conditions commonly used in PCR.
  • a probe of the present invention is a molecule, for example a nucleic acid molecule of sufficient length and sufficiently complementary to the nucleic acid molecule of interest, which selectively binds under high or low stringency conditions with the nucleic acid sequence of interest for detection thereof in the presence of nucleic acid molecules having differing sequences.
  • Preferred primers for the detection of a DGATl 232A allele are the following: forward primer 5'- CGCTTGCTCGTAGCTTTGG -3' and reverse primer: 5'- CGCGGTAGGTCAGGTTGTC -3' (SEQ ID NO:9 and 10 respectively).
  • Preferred probes for the detection of a DGATl allele 232A are the following: VIC MGB-probe: 5'- CGTTGGCC TTCTTAC -3' (detects K allele) and FAM MGB -probe: 5'-TTGGCCGCCTTAC-S' (detects A allele) (SEQ ID NO:11 and 12 respectively).
  • FAM and VIC are fluoresent reporter dyes.
  • the exication wavelength for FAM is 495 nm and the fluorescence has its emission peak at 520 nm
  • the exication wavelength for VIC is 540 nm
  • the fluorescence has its emmision peak at 555 nm.
  • the use of fluorogenic probes in the 5 'nuclease assay combines PCR amplification and detection into a single step.
  • an oligonucleotide probe is included in the PCR amplification reaction along with the forward and reverse primers. If the target sequence of the probe is amplified in the reaction, then the probe will hybridize to this target sequence during the annealing/extension step of PCR.
  • the fluorogenic probe consists of an oligonucleotide labelled with both a fluorescent reporter dye and a quencher dye. In the intact probe, proximity of the quencher reduces the fluorescence signal observed from the reporter dye.
  • Fluorogenic probes and the 5 'nuclease assay can be used for allelic discrimination.
  • probes specific for each allele are included in the PCR assay.
  • the probes can be distinguished because they are labelled with different fluorescent reporter dyes (e.g. FAM and VIC).
  • FAM and VIC fluorescent reporter dyes
  • a mismatch between probe and target greatly reduces the efficiency of probe hybridization and cleavage.
  • substantial increase in FAM or VIC fluorescent signal indicates homozygosity for the FAM- or VIC-specific allele.
  • An increase in both signals indicates heterozygosity (26).
  • Genotyping with fluorogenic probes requires that fluorescence measurements be made after PCR is completed. This is conveniently done in a multicolour real-time PCR system.
  • a multicolour real-time PCR system exicates fluorescent reporter dyes at their respective wavelength (e.g. 495nm for FAM and 540 nm for VIC) and subsequently measures the emitted fluorescence at the respective peak wavelengths (e.g. 520 nm for FAM and 555 nm for VIC).
  • the power of discrimination between alleles is determined by the difference in melting temperature ( ⁇ T m ) between match and mismatch probe.
  • the ⁇ T m is primarily dependent on the type of mutation, together with the length of the probe.
  • oligonucleotides are designed that can anneal to their target at elevated (PCR) temperatures. This may result in a small ⁇ T m discrimination window and difficult allelic discrimination, especially when G to A or G to T mutations are present (27).
  • Oligonucleotide probes conjugated with a minor groove binder (MGB) ligand have been developed.
  • the MGB has a high affinity for the minor groove of double-stranded DNA and stabilizes the oligoprobe with the complementary single-strand DNA target.
  • These MGB probes have a higher melting temperature (T m ) for a given length.
  • T m melting temperature
  • a 12-mer probe with MGB group had an identical T m as a 27-mer DNA probe without MGB group.
  • Single base mismatches between target DNA and such short MGB probes significantly decrease the T m of the duplex resulting in a large ⁇ T m discrimination window. This means that shorter fluorogenic TaqMan probes can be used thus improving specificity and sensitivity.
  • NFQ non- fluorescent quencher
  • the method used is the SNaPshot single-base extension assay: PCR followed by allele-specific single-base extension as means.
  • This preferred method is extensively presented below taken SCD as example. This method includes a step in which ascertaining whether the A878 V polymorphism is present in the sequence of SCD DNA, includes amplifying the DNA in the presence of primers based on the nucleotide sequence of the SCD gene and flanking sequence, followed by allele-specific single-base extension of either the SCD 878A allele or the SCD 878V allele.
  • a primer of the present invention used in PCR for example, is a nucleic acid molecule sufficiently complementary to the sequence on which it is based and of sufficient length to selectively hybridise to the corresponding portion of a nucleic acid molecule intended to be amplified and to prime synthesis thereof under in vitro conditions commonly used in PCR.
  • Preferred primers for the detection of a SCD 575F aIIeIe are the following: forward primer 5'- TCATTTAACCCCTCATTACCTCA -3' and reverse primer: 5'- TGTAAAATACTAGGCTTTCTGG -3' ( SEQ ID NO: 13 and 14 respectively).
  • Preferred single-base extension primer for the detection of a SCD 878 V allele is the following: 5'- TGGTTTCCCTGGGAGCTG - 3' (SEQ ID NO: 15).
  • the SNaPshot assay investigates SNP markers by employing PCR amplification followed by dideoxy single-base extension of an unlabeled primer.
  • This unlabeled, single-base extension primer is designed to anneal to the sequence adjacent to the SNP site. Once the primer anneals, the single-base extension occurs by the addition of the complementary dye-labelled ddNTP (dye terminator) to the annealed primer.
  • ddNTP dye terminator
  • Each of the four ddNTPs is fluorescently labelled with a different colour dye. The result is marker fragments for the different SNP alleles that are all the same length, but vary by colour.
  • Electrophoresis and multicolour fluorescence detection are preferably carried out with a DNA sequencer ( 48-capillary 3730 DNA analyser, Applied Biosystems), and GeneMapper software (Applied Biosystems) is preferably used to size and genotype the data.
  • the SNaPshot multiplex assay can investigate up to ten SNP markers simultaneously by using single-base extension primers of different lengths for the different markers. It may be necessary to add a non-annealing tail to a primer to make its length sufficiently different from other primers. This prevents different SNP markers from overlapping.
  • the invention relates to a method for selecting a non-human mammal, preferably a bovine which produces milk with an increased desaturation index for at least one of C 16, C 17, C 18, and CLA fatty acids and/or with a milk-fat composition with at least one of a reduced content of saturated C 16 fatty acids and an increased content of unsaturated Cl 8 fatty acids.
  • the invention relates to a method for selecting a non- human mammal, preferably a bovine which produces milk with an increased desaturation index for at least one of C 16, C 17, C 18, and CLA fatty acids.
  • the index is preferably the CLA index.
  • the milk has a milk-fat composition with at least one of an increased content of C16:lcis9, C17:lcis9 and CLA and a decreased content of C17:0 and C18:0 fatty acids.
  • the non-human mammal, preferably a bovine is obtained by applying the method of the invention wherein one screens for the presence of a SCD 878V allele. Therefore, the non- human mammal preferably possesses one allele SCD 878V, more preferably two.
  • the invention relates to a method for selecting a non -human mammal, preferably a bovine which produces milk having a milk-fat composition with at least one of a reduced content of saturated C16 fatty acids and an increased content of unsaturated Cl 8 fatty acids.
  • the milk- fat composition has a reduced content of saturated C16 fatty acids, an increased content of at least one of C18 cis-isomers such as C18:l cis 9 (oleic acid), C18:l cis 11, C18:2 cis 9, ⁇ 2 (linoleic acid), CLA and C18:3 cis 9,12,15 (linolenic acid).
  • the C18 cis- isomers are selected from the group consisting of: C 18:1 cis 9 (oleic acid), C 18:1 cis 11, C18:2 cis 9,12 (linoleic acid), CLA and C18:3 cis 9,12,15 (linolenic acid).
  • the Cl 8 cis-isomers are selected from the group consisting of oleic acid, linolenic acid, CLA and linoleic acid.
  • this non-human mammal preferably a bovine is obtained by applying the method of the invention wherein one screens for the presence of a DGATl 232 A allele. Therefore, the non- human mammal preferably possesses one allele DGATl 232 A, more preferably two.
  • the invention relates to a further preferred embodiment, wherein the milk produced has an increased desaturation index for at least one of C 16, C 17, C18 and CLA fatty acids.
  • the index is the CLA index.
  • the milk produced has at least one of a decreased content of saturated C16, C17 and C18 fatty acids and an increased content of unsaturated C16, C17 and Cl 8 fatty acids.
  • the non-human mammal preferably a bovine is obtained by applying the method of the invention wherein one screens for the presence of a SCD 878V allele in combination with a DGATl 232 A allele .
  • the non- human mammal preferably possesses one allele SCD 878V and one allele DGATl 232 A, more preferably two alleles SCD 878 V and one allele DGATl 232 A, or one allele SCD 878V and two alleles DGATl 232 A and most preferably two alleles SCD 878V and two alleles DGATl 232 A.
  • the method not only enables to identify a non-human mammal, preferably a bovine, producing milk with an improved (preferably healthier) fatty-acid composition.
  • the invention provides a further third preferred embodiment wherein the method also enables to select a non- human mammal, preferably a bovine, as a parent of offspring producing milk with an improved fatty acid composition. Mating of such selected parents will result in an increase of the frequency of the alleles that are favorable for an improved fatty acid composition (such as SCD 878V and/or DGATl 232A) in the offspring, thus, result in offspring producing milk with an improved fatty acid composition compared to offspring of parents that were not selected with this method.
  • an improved fatty acid composition such as SCD 878V and/or DGATl 232A
  • the invention provides a further fourth preferred embodiment for the method of the invention wherein the non- human mammal, preferably a bovine producing such milk is obtained by further selecting and/or feeding a specific diet (12).
  • This selection preferably includes the identification and selection of additional favorable alleles and/or further identification and selection of specific breeds.
  • Identification and selection may encompass any method for ensuring that the non-human mammal produces milk with a further improved fatty acid composition (increased unsaturated fatty acid content and decreased saturated fatty acid content by comparison to a non-selected non-human mammal, preferably an increased desaturation index for at least one of C 16, C 17, Cl 8 and CLA fatty acids).
  • a further improved fatty acid composition increased unsaturated fatty acid content and decreased saturated fatty acid content by comparison to a non-selected non-human mammal, preferably an increased desaturation index for at least one of C 16, C 17, Cl 8 and CLA fatty acids.
  • a further improved fatty acid composition increased unsaturated fatty acid content and decreased saturated fatty acid content by comparison to a non-selected non-human mammal, preferably an increased desaturation index for at least one of C 16, C 17, Cl 8 and CLA fatty acids.
  • the method combines second, third and/or fourth preferred embodiments for selecting a non-human mammal, preferably a bovine which produces milk having a milk-fat composition with a reduced content of saturated C16 fatty acids, an increased content of unsaturated C18 fatty acids and a control content of saturated C 14 fatty acid.
  • a non-human mammal preferably a bovine which produces milk having a milk-fat composition with a reduced content of saturated C16 fatty acids, an increased content of unsaturated C18 fatty acids and a control content of saturated C 14 fatty acid.
  • the method combines former first, second, third and/or fourth preferred embodiments for selecting a non-human mammal, preferably a bovine which produces milk having a milk-fat with an increased desaturation index for at least one of C 16, C 17, Cl 8 and CLA fatty acids.
  • the invention relates to milk or milk-fat composition obtainable from the non- human mammal, preferably a bovine obtained by the method of the invention or by the use of the invention both as defined earlier herein.
  • the milk of the invention is therefore much more healthy than the milk of control non-human mammal, preferably control bovine milk.
  • the milk has an increased desaturation index for at least one of C 16, C 17,Cl 8 and CLA fatty acids.
  • the index is preferably the CLA index.
  • the milk has a milk-fat composition with at least one of an increased content of C16:lcis9, C17:lcis9 and CLA and a decreased content of C 17:0 and C 18:0 fatty acids.
  • the milk has a milk- fat composition with at least one of a reduced content of saturated C16 fatty acids and an increased content of unsaturated C18 fatty acids.
  • the milk obtained has a milk-fat composition with a reduced content of saturated C16 fatty acids, an increased content of at least one of Cl 8 cis-isomers such as C 18:1 cis 9 (oleic acid), C18:l cis 11, C18:2 cis 9,12 (linoleic acid) and/or C18:3 cis 9,12,15 (linolenic acid) and/or an increased content of CLA.
  • the C18 cis-isomers are selected from the group consisting of oleic acid, linolenic acid, CLA and linoleic acid.
  • the milk has a milk-fat composition with at least one of a reduced content of saturated C 16 fatty acids, an increased content of unsaturated Cl 8 fatty acids and a control content of saturated C 14 fatty acid.
  • the milk produced has further an increased desaturation index for at least one of C 16, C 17,Cl 8 and CLA fatty acids.
  • the index is the CLA index.
  • the milk produced has at least one of a decreased content of saturated C 16, C17 and Cl 8 fatty acids and an increased content of unsaturated C 16, C17 and Cl 8 fatty acids.
  • Such products include all milk- based and/or milk-derived products such as yoghurt, butter or cheese.
  • Such products further include food products that comprise a milk and/or milk-fat composition containing ingredient such as bakery products, chocolate or ice cream.
  • the invention relates to a food product comprising a milk-fat composition derived from the milk of the invention.
  • Figure 1 shows the relationship between available substrate (substrate yield) in one morning milk sample and desaturation index for C 14.
  • the substrate yield is the amount of substrate that was available before desaturation took place. This is the amount of C14:0 plus the amount of C14:lcis9 that was measured in the morning milk sample (mean 13.47 kg milk per sample).
  • Figure 1 shows that there is no effect of substrate yield on the desaturation index for C 14, thus, the desaturation index is not affected by the amount of substrate that is available. This holds also true for the desaturation indexes of ClO, C12, C16, C17, C18 and CLA.
  • Figure 2 shows the relationship between the C 14 desaturation index and the C 16 desaturation index.
  • Three groups can be discriminated.
  • the phenotypes that were used to calculate the desaturation indexes were corrected for fixed effects, such as herd, days in milk, age at calving and season of calving. Therefore, the three groups might well demonstrate a genetic effect.
  • the three groups overlap for 94% with the genotypes of the SCD A878V polymorphism. This indicates that the SCD A878V polymorphism underlies the three groups that can be discriminated in Figure 2.
  • the fat composition of winter milk samples was measured in 1918 Dutch Holstein Friesian cows in their first lactation.
  • the average milk-fat percentage is 4.36 (Table 1).
  • the most abundant fatty acid is C 16:0, which accounts for about 33% of total fat (Table 2).
  • Trans fatty acids contribute 1.54%.
  • the ratio of saturated to unsaturated fatty acids (SFA/UFA) averages 2.80, meaning that saturated fatty acids account for about 70% of total fat.
  • the coefficient of variation (CV) is highest (28%) for conjugated linoleic acid (CLA) and trans fatty acids, and lowest (about 9%) for C14:0, C16:0, and C4:0-C12:0.
  • heritabilities to estimate what proportion of total phenotypic variation is additive genetic variation, i.e. heritable.
  • Heritability for fat percentage is high (0.51), meaning that about half of the total variation is additive.
  • Short- and medium-chain fatty acids (C4-C16) also have high heritabilities, ranging from 0.43 to 0.59.
  • Saturated and unsaturated Cl 8 show lower heritabilities (around 0.25), as does the trans fatty acids (0.20).
  • C 16:0 which is the most abundant and most unfavorable fatty acid from a nutritionist's point of view, shows a high negative genetic correlation with C14:0 (-0.84), CLA (-0.59), and unsaturared C18 (-0.53).
  • the DGATl K232A mutation explains large proportions of the genetic variance: 50% for fat percentage, 53% for unsaturated C 18, 40% for C 16:0, and 36% for SF A/UFA. Effects of DGATl on fat composition are in line with expectations based on the effect of DGATl on fat percentage and the genetic correlations between fat percentage and fat composition (Table3).
  • the effect of the DGATl K232A mutation on all saturated and respectively unsaturated fatty acid composition is given in Tables 6 and 7 respectively. It can be observed from table 6 that the DGATl K232A mutation has a statistically significant effect (reduction) on C5, C6, C7, C8, C9, CI l, C13, C15, C16 and C17 saturated fatty acids.
  • the C18 fatty acids and, to a lesser extent, C 16:0 arise from the cow's plasma lipids and have a dietary origin (12); they are, therefore, likely to be under less genetic control.
  • Heritability for trans fatty acids was also low (0.20). This low heritability may be because trans fatty acids are produced by microbial biohydrogenation in the rumen of the cow (33), which may be under less genetic control as well.
  • Heritabilities for milk, protein and fat yield and protein and fat percentage are generally in line with previous studies (13-15, 34, 35). Genetic parameters for fat composition were reported only previously by Karijord et al. (20), who estimated lower heritabilities.
  • the effect of the DGATl K232A mutation on fat composition may have different causes: a higher activity of DGATl and alteration of specificity of DGATl.
  • the DGATl K allele has been shown to have a higher Vmax than the A allele in producing triglycerides, which is consistent with the in vivo effect of the K232A mutation (38).
  • DGATl seems to have a preference for short-chain and unsaturated fatty acids, since the sn-3 position of the glycerol backbone is occupied predominantly by these fatty acids (39).
  • Specificity has been shown for other acyltransferases (40, 41 ).
  • the K232A mutation could alter the specificity of the DGATl enzyme, which may result in a change in fat composition.
  • Genetic correlations show that an increase in fat percentage implies an increase in the fraction of C 16:0, while decreasing the fractions of unsaturated C 18, CLA, and C 14:0. It is likely that selection in the past decades in the Dutch dairy has resulted not only in increased fat percentage and fat yield, but also in a more saturated fat composition, with more C16:0, less unsaturated C18, less CLA, and less C14:0.
  • Our results show that it is possible to change fat composition of milk-fat by selective breeding, and that efficiency of selective breeding can be improved using the K232A polymorphism in DGATl. From a public health point of view, increasing the frequency of the DGATl A allele is desirable because of its association with more unsaturated milk-fat, less C16:0, and more unsaturated C18.
  • a 0.5 liter milk sample was collected from each cow at one morning milking between February and March 2005.
  • Milk- fat composition was measured at the laboratory of COKZ (Leusden, the Netherlands).
  • Milk-fat was extracted from the milk samples, and fatty acid methyl esters were prepared from fat fractions, as described in ISO Standard 15884 (29).
  • Methyl esters were analyzed according to ISO Standard 15885 (30) on a Trace GC Ultra chromatograph (Thermo Electron Corporation, Waltham, MA, USA), using a Varian Fame Select column (100m x 0.25mm ID, Varian Inc. , Palo Alto, CA, USA).
  • the initial temperature was held at 7O 0 C for 1 min, raised to 225 0 C at 3°C/min, and held at 225 0 C for 5 min.
  • a volume of 1 ⁇ l was injected.
  • Each peak was identified and quantified using pure methyl ester samples (Sigma-Aldrich, Zwijndrecht, the Netherlands; Larodan, Malmo, Sweden).
  • the fatty acids included in this study were grouped according to their relevance to human nutrition and health. Fat and protein percentage were determined by infra red spectroscopy, using a MilkoScan FT6000 (Foss Electric, Hillerod, Denmark) at the Milk Control Station (Zutphen, the Netherlands). Fat and protein yields were calculated by multiplying each percentage by milk yield. Yield data were missing for 135 cows. Genotypes
  • Genotyping of the DGATl K232A dinucleotide polymorphism was performed using a Taqman allelic discrimination method in an Applied Biosystems 7500 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA).
  • the primers and labeled oligonucleotide probes for this reaction were: forward, 5'- CGCTTGCTCGTAGCTTTGG -3'; reverse, 5'- CGCGGTAGGTCAGGTTGTC -3'; VIC probe (detects ⁇ allele ), 5'- CGTTGGCCTTCTTAC -3'; FAM probe (detects A allele), 5'-TTGGCCGCCTTAC-S' (SEQ ID NO: 5, 6, 7 and 8 respectively).
  • yykinm ⁇ + bi *dim 1 + b 2 *e ⁇ ° 05*dim +b 3 *afc, + b 4 *afc, 2 + season k + scodei + herd m + U n +
  • Syklmn where y is the dependent variable, ⁇ is the general mean, dim is the covariate describing the effect of days in milk modelled with a Wilmink curve (32), afc is the covariate describing the effect of age at first calving, season is the fixed effect of the class of calving season (June -August 2004, September-November 2004, or December 2004-February 2005), scode is the fixed effect of the differences in genetic level between groups of proven bull daughters and young bull daughters, herd is the random effect of groups of animals sampled in the same herd, U n is the random additive genetic effect of animal n, and e is the random residual effect.
  • Example 2 SCD 878V and optionally DGAT 232A Material and methods
  • Phenotypes A 0.5 liter milk sample was collected from each cow at one morning milking between February and March 2005. Milk- fat composition was measured at the COKZ laboratory (Netherlands Controlling Authority for Milk and Milk Products, Leusden, the
  • Fat and protein percentages were measured by infra red spectroscopy, using a MilkoScan FT6000 (Foss Electric, Hillerod, Denmark) at the Milk Control Station (Zutphen, the Netherlands). Fat and protein yields were calculated by multiplying each percentage by the milk yield. Yield data were missing for 145 cows.
  • Genotypes for the SCD A 878 V polymorphism were assayed by SNaP shot single base primer extension method (Applied Biosystems, Foster City, CA, USA).
  • the primer designs were based on the Genbank sequence (AY241932): forward, 5'- TCATTTAACCCCTCATTACCTCA -3'; reverse, 5'-
  • 12 ⁇ l reactions were set up containing 20 ng of genomic DNA, 0.2 ⁇ M of each primer and 2X AccuPrime Supermix II (Invitrogen, Carlsbad, CA, USA). PCR cycling conditions were 94°C for 5 min, 36 cycles of 94°C for 30 s, 55°C for 45 s, 68°C for 90 s, followed by an extension cycle of 68°C for 10 min.
  • PCR products were purified by incubation with shrimp alkaline phosphatase (SAP) (USB, Cleveland, OH, USA) and Exo I (USB) at 37°C for 1 h and 72°C for 15 min.
  • Extension reactions using 3 ⁇ l of purified PCR product and 5 pmol of genotyping primer and SNaPshot multiplex Ready reaction mix (Applied Biosystems), were performed using 40 cycles of 96°C for 10 s, 50 0 C for 5 s, and 60 0 C for 30 s.
  • the extension products were incubated with SAP at 37°C for 1 h and 72°C for 15 min.
  • Genotyping of the DGATl K232A dinucleotide polymorphism was performed using a Taqman allelic discrimination method in an Applied Biosystems 7500 Real-Time PCR System (Applied Biosystems).
  • the primers and labeled oligonucleotide probes for this reaction were designed based on the DGATl sequence (Genbank accession no. AY065621): forward, 5'- CGCTTGCTCGTAGCTTTGG -3'; reverse, 5'- CGCGGTAGGTCAGGTTGTC -3'; VIC probe (detects K allele), 5'- CGTTGGCCTTCTTAC -3'; FAM probe (detects A allele), 5'-TTGGCCGCCTTAC-S'.
  • PCR cycling conditions were 94°C for 5 min, 40 cycles of 92°C for 15 s and 60 0 C for 1 min. In total, 1779 animals were genotyped for the DGATl K232A polymorphism.
  • Analyses were performed first using SAS 9.1 (2002) procedures to determine fixed effects.
  • yi j ki ⁇ m ⁇ + bi *dim 1 + b 2 *e ⁇ ° 05*dim +b 3 *afc, + b 4 *afc, 2 + season k + scodei + herd m + U n +
  • y was the dependent variable
  • ⁇ was the general mean
  • dim was the covariate describing the effect of days in milk modelled with a Wilmink curve (32)
  • afc was the covariate describing the effect of age at first calving
  • season was the fixed effect of the class of calving season (June -August 2004, September-November 2004, or December 2004-February 2005)
  • scode was the fixed effect of the differences in genetic level between groups of proven bull daughters and young bull daughters
  • herd was the random effect of groups of animals sampled in the same herd
  • U n was the random additive genetic effect of animal n
  • e was the random residual effect.
  • Effects of the SCD A 878 V or the DGATl K232A mutation were estimated using the same model, but extended with effect g: the fixed effect of the SCD genotype (AA, AV, W) or the fixed effect of the DGATl genotype (KK, KA, AA). Ungenotyped individuals were included as a separate group, and appeared to be random.
  • Var(U) A ⁇ u 2 , where A was a matrix of additive genetic relationships between individuals and ⁇ u 2 was the additive genetic variance.
  • Heritabilities were estimated using univariate analyses, and phenotypic and genetic correlations were estimated using bivariate analyses. Summary:
  • Figure 2 shows the C 14 and the C16 indexes (corrected phenotypes).
  • SCD stearoyl- Co enzyme A desaturase
  • This SNP is known to affect mono -unsaturated fatty acids (MUFA) percentage and melting point in intramuscular fat of Japanese black cattle (Taniguchi et al 2004, Mamm. Genome 15: 142-148).
  • MUFA mono -unsaturated fatty acids
  • melting point in intramuscular fat of Japanese black cattle
  • V allele is associated with a lower index for ClO, C 12 and C 14, but is associated with a higher index for C 16, C 17, Cl 8 and CLA.
  • the polymorphism in the gene DGATl known to have a clear influence on milk- fat composition, is also associated with desaturation indexes (Table 13). This indicates that not only the conversion of saturated to unsaturated fatty acids by SCD is determinative for saturation of milk- fat, but also the esterification of specific fatty acids to glycerol by DGATl.
  • the percentages of the genetic variance explained by the SCD A 878 V and DGATl K232A polymorphisms are in Table 14. Correction for the SCD genotype doesn't notably change the effect (size) of the DGATl genotype, meaning that the two genes explain a different part of the variation.
  • Table 15 provides the combined effects of the SCD A 878 V polymorphism and the DGATl K232A polymorphism on fatty acid composition and desaturation indexes.
  • the effect of the SCD A 878 V polymorphism and of the DGATl K232A polymorphism are mostly additive and in the same direction. Consequently, the combined homozygous genotypes have progressively decreasing effects on the ClO, C 12 and C 14 indexes, and progressively increasing effects on the Cl 8 and CLA indexes.
  • C16 the effect of the SCD A 878 V polymorphism and of the DGATl K232A polymorphism are mostly additive, but in opposite directions.
  • the effect of the SCD A878V polymorphism is larger than the effect of the DGA Tl K232A polymorphism.
  • the combination of homozygous SCD 878 A and homozygous DGATl 232 A has the most decreasing effect on the C16 index
  • the combination of homozygous SCD 878 V and homozygous DGATl 232K has the most increasing effect on the C16 index.
  • the combination of homozygous SCD 878 V and homozygous DGATl 232 A has an increasing effect on the C16 index also.
  • the effect of the DGATl K232A polymorphism is not significant, therefore, does not add to the effect of the SCD A 878 V polymorphism.
  • C4:0-C12:0 includes saturated fatty acids C4:0, C6:0, C8:0, C10:0 and C12:0.
  • C18u includes unsaturated Cl 8 fatty acids: Cl 8:1 trans 6, Cl 8:1 trans 9, Cl 8:1 trans 11, Cl 8:1 cis 9, C18:l cis 11, C18:2 cis 9,12, C18:3 CM 9,12,15.
  • trans includes C16:l trans 9, C18:l trans 4-8, C18:l trans 9, C18:l trans 10, C18:l trans 11, C18:l trans 12.
  • SFA saturated fatty acids
  • UFA unsaturated fatty acids
  • Standard errors of phenotypic correlations were between 0.02 and 0.03.
  • Standard errors of genetic correlations were between 0.08 and 0.23.
  • KA contrast of KA -KK genotypes.
  • AA contrast of AA -KK genotypes.
  • P value statistical significance of the DGATl K232A effect.
  • r 2 genetlc % percentage of the genetic variance explained by the DGATl K232A mutation.
  • KA contrast of KA -KK genotypes.
  • AA contrast of AA -KK genotypes.
  • P value statistical significance of the DGATl K232A effect.
  • KA contrast of KA -KK genotypes.
  • AA contrast of AA -KK genotypes.
  • P value statistical significance of the DGATl K232A effect.
  • contrast of KA-KK genotypes " contrast of AA-KK genotypes.
  • ISO-IDF 2002a Milkfat - Preparation of fatty acid methyl esters. ISO 15884-IDF 182; International Dairy Federation, Brussels, Belgium.
  • ISO-IDF 2002b Milkfat - Determination of the fatty acid composition by gas- liquid chromatography.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Nutrition Science (AREA)
  • Environmental Sciences (AREA)
  • Food Science & Technology (AREA)
  • Polymers & Plastics (AREA)
  • Analytical Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Immunology (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Mycology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Animal Behavior & Ethology (AREA)
  • Animal Husbandry (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Investigating Or Analysing Biological Materials (AREA)

Abstract

Cette invention concerne l'utilisation d'un moyen qui détecte la présence d'un allèle SC D 878V et/ou d'un allèle DGAT 1 232A dans un procédé identifiant un mammifère non humain, de préférence un bovin qui produit du lait dont la composition en acides gras est meilleure.
PCT/NL2008/050085 2007-02-15 2008-02-15 Procédé de sélection d'un mammifère non humain produisant du lait à composition en acides gras améliorée WO2008100145A2 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
EP08712611A EP2121976A2 (fr) 2007-02-15 2008-02-15 Procédé de sélection d'un mammifère non humain produisant du lait à composition en acides gras améliorée

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
EP07102480 2007-02-15
EP07102480.6 2007-02-15
EP07113639 2007-08-01
EP07113639.4 2007-08-01

Publications (2)

Publication Number Publication Date
WO2008100145A2 true WO2008100145A2 (fr) 2008-08-21
WO2008100145A3 WO2008100145A3 (fr) 2008-10-09

Family

ID=39323612

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/NL2008/050085 WO2008100145A2 (fr) 2007-02-15 2008-02-15 Procédé de sélection d'un mammifère non humain produisant du lait à composition en acides gras améliorée

Country Status (2)

Country Link
EP (1) EP2121976A2 (fr)
WO (1) WO2008100145A2 (fr)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010087725A3 (fr) * 2008-12-24 2010-10-14 Fonterra Co-Operative Group Limited Sélection d'animaux en fonction du profil laitier et/ou tissulaire recherché
NL2005543C2 (en) * 2010-10-18 2012-04-19 Friesland Brands Bv Method to produce milk with increased unsaturated fatty acids content.
NL2006696C2 (en) * 2011-04-29 2012-10-30 Friesland Brands Bv Milk composition comprising vitamins and minerals.

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1598430A1 (fr) * 2003-02-20 2005-11-23 The New Industry Research Organization Procede destine a evaluer le gout, la texture, etc. au moyen d'un genotype de desaturase stearoyl-coa

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE01992795T1 (de) * 2000-10-31 2004-12-16 Michel Alphonse Julien Georges Marker-unterstützte auswahl von rindvieh für verbesserte milchproduktion unter verwendung des diacylglycerin-acyltransferase-gens dgat1
CA2453001C (fr) * 2001-07-06 2011-05-24 Arbeitsgemeinschaft Deutscher Rinderzuchter E.V. Methode de tests sur un mammifere portant sur sa predisposition a presenter une teneur en matiere grasse de lait et/ou sa predisposition au persillage de la viande
DE60225196T2 (de) * 2002-06-05 2009-02-12 Paulette Berzi Marker-unterstützte rinderauswahl für verbesserte milchzusammensetzung
NZ538004A (en) * 2002-07-03 2011-01-28 A2 Corp Ltd Method for altering fatty acid composition of milk

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1598430A1 (fr) * 2003-02-20 2005-11-23 The New Industry Research Organization Procede destine a evaluer le gout, la texture, etc. au moyen d'un genotype de desaturase stearoyl-coa

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
MOIOLI B ET AL: "Short communication: Effect of stearoyl-coenzyme A desaturase polymorphism on fatty acid composition of milk" JOURNAL OF DAIRY SCIENCE, AMERICAN DAIRY SCIENCE ASSOCIATION, SAVOY, IL, US, vol. 90, no. 7, 1 July 2007 (2007-07-01), pages 3553-3558, XP002462906 ISSN: 0022-0302 *
See also references of EP2121976A2 *
TANIGUCHI M ET AL: "Genotype of stearoyl-CoA desaturase is associated with fatty acid composition in Japanese Black cattle" MAMMALIAN GENOME, NEW YORK, NY, US, vol. 14, 1 February 2004 (2004-02-01), pages 142-148, XP002980913 ISSN: 0938-8990 cited in the application *

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010087725A3 (fr) * 2008-12-24 2010-10-14 Fonterra Co-Operative Group Limited Sélection d'animaux en fonction du profil laitier et/ou tissulaire recherché
NL2005543C2 (en) * 2010-10-18 2012-04-19 Friesland Brands Bv Method to produce milk with increased unsaturated fatty acids content.
WO2012053893A1 (fr) * 2010-10-18 2012-04-26 Friesland Brands B.V. Procédé de production de lait ayant une teneur accrue en acides gras insaturés
CN103237442A (zh) * 2010-10-18 2013-08-07 菲仕兰品牌有限公司 生产不饱和脂肪酸含量提高之乳的方法
NL2006696C2 (en) * 2011-04-29 2012-10-30 Friesland Brands Bv Milk composition comprising vitamins and minerals.
WO2012148276A1 (fr) * 2011-04-29 2012-11-01 Friesland Brands B.V. Composition de lait comprenant des vitamines et des minéraux

Also Published As

Publication number Publication date
WO2008100145A3 (fr) 2008-10-09
EP2121976A2 (fr) 2009-11-25

Similar Documents

Publication Publication Date Title
Schennink et al. DGAT1 underlies large genetic variation in milk‐fat composition of dairy cows
Schennink et al. Milk fatty acid unsaturation: genetic parameters and effects of stearoyl-CoA desaturase (SCD1) and acyl CoA: diacylglycerol acyltransferase 1 (DGAT1)
Bouwman et al. Genome-wide association of milk fatty acids in Dutch dairy cattle
Martin et al. A genome scan for milk production traits in dairy goats reveals two new mutations in Dgat1 reducing milk fat content
Bovenhuis et al. Effects of the diacylglycerol o-acyltransferase 1 (DGAT1) K232A polymorphism on fatty acid, protein, and mineral composition of dairy cattle milk
Conte et al. Diacylglycerol acyltransferase 1, stearoyl-CoA desaturase 1, and sterol regulatory element binding protein 1 gene polymorphisms and milk fatty acid composition in Italian Brown cattle
Gill et al. Association of selected SNP with carcass and taste panel assessed meat quality traits in a commercial population of Aberdeen Angus-sired beef cattle
Tăbăran et al. Influence of DGAT1 K232A polymorphism on milk fat percentage and fatty acid profiles in Romanian Holstein cattle
Zidi et al. Association between the polymorphism of the goat stearoyl-CoA desaturase 1 (SCD1) gene and milk fatty acid composition in Murciano-Granadina goats
Lehnert et al. Phenotypic population screen identifies a new mutation in bovine DGAT1 responsible for unsaturated milk fat
Muñoz et al. QTL detection on porcine chromosome 12 for fatty‐acid composition and association analyses of the fatty acid synthase, gastric inhibitory polypeptide and acetyl‐coenzyme a carboxylase alpha genes
Carvajal et al. Milk fatty acid profile is modulated by DGAT1 and SCD1 genotypes in dairy cattle on pasture and strategic supplementation
US20110321182A1 (en) Selection of animals for desired milk and/or tissue profile
WO2008100145A2 (fr) Procédé de sélection d'un mammifère non humain produisant du lait à composition en acides gras améliorée
Dervishi et al. Structural characterisation of the acyl CoA: diacylglycerol acyltransferase 1 (DGAT1) gene and association studies with milk traits in Assaf sheep breed
WO2022233345A2 (fr) Marqueur moléculaire d'un pnu affectant le gène elovl3 associé à la composition des acides gras du canard, et son procédé de détection et son utilisation
JP6078871B2 (ja) 鶏の鑑定方法
US7910308B1 (en) Genetic markers in fatty acid synthase for identification of meat product fatty acid content in cattle
Uemoto et al. The effects of single and epistatic quantitative trait loci for fatty acid composition in a Meishan× Duroc crossbred population
Soares et al. Polymorphism of alpha s1-casein gene in a dairy goat herd in the southeastern region of Brazil
JP2008061567A (ja) 脂肪酸合成酵素の遺伝子型に基づき牛筋肉内脂肪における脂肪酸含有量の多寡を判定する方法及び該結果に基づき牛肉の食味の良さを判定する方法
Patel et al. Evaluation of DGAT1-exon 8 K232A substitution in Gir and Kankrej (Bos indicus), Indian origin cattle and its association with milk production traits
EP3478854A2 (fr) Loci de caractères quantitatifs affectant la composition en acides gras du lait
Schennink et al. Genome-wide scan for bovine milk fat composition II. QTL for long chain fatty acids
Behailu et al. Effect of DGAT1 K232A mutation and breed on milk traits in Cattle Populations of Ethiopia

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 08712611

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2008712611

Country of ref document: EP