WO2008099190A2

WO2008099190A2 - Osteogenic compounds

Info

Publication number: WO2008099190A2
Application number: PCT/GB2008/000529
Authority: WO
Inventors: Bikramjit Chopra; Grahame Mckenzie; Bryn Hardwick
Original assignee: Inion Limited
Priority date: 2007-02-16
Filing date: 2008-02-15
Publication date: 2008-08-21
Also published as: WO2008099190A3; GB0703062D0; GB2446653A

Abstract

The invention relates to N,N-dimethylacetamide and its pharmaceutically acceptable salts and prodrugs, compositions comprising same and the use of these compounds and compositions as a medicament and in the manufacture of compositions for promoting bone regrowth and repair, and to methods of treating damaged or broken bones.

Description

OSTEOGENIC COMPOUNDS

Technical field

The present invention relates to compounds having osteogenic properties, uses of said compounds, compositions comprising those compounds, methods of manufacturing compositions and methods useful in bone repair.

Background of the Invention

Most people will have broken or will break a bone in their body during their lifetime. With an ever ageing population the incidence of broken bones is only likely to increase.

The traditional method for fixing broken bones includes repositioning the broken bone in the correct position and applying plaster of Paris or fibreglass to the outside of the limb concerned in order to form a ' cast ' . Once the bone has set the cast may be removed.

More recently developed methods include the fitting of bone plates with screws and the like to keep the broken bone in position while healing occurs. One such method is described in US 7,122,037. Another method involves the positioning of a resorbable polymer composition around the broken bone which composition holds the bone in position while healing occurs and then slowly dissolves and is absorbed by the body of the patient as taught in US 6,607,548.

The process of bone healing is relatively poorly understood. The present knowledge is that osteoinduction occurs via growth factors, in particular bone morphogenic protein (BMP) which induces undifferentiated mesenchymal cells to congregate at the point of the break and differentiate into osteoblasts which effect repair of the break.

What is also known, however, is that several rather diverse methods are available to enhance bone growth, such as mechanical stimulation, electromagnetic fields, low- intensity ultrasound, osteoconductive materials, for instance hydroxyapatite, tricalcium phosphate, bioactive glass etc., and osteoinductive materials, such as growth factors .

US 6,926,903 teaches the use of resorbable polymer compositions comprising a compound which infers osteogenic properties to the composition. This type of composition gives the advantage that whilst holding the broken bone in place for healing, the oestogenic compound may slowly release from the composition causing bone growth rate to increase at the site of the break. Such compositions can result in significantly faster bone healing.

It would be useful if other osteogenic compounds were available that showed a similar or improved effect.

It is an object of the invention to provide alternative osteogenic compounds for use in bone repair or at least to provide the public and/or medical community with a useful alternative .

Various compounds and uses for compounds according to the invention are detailed in the accompanying specification. These compounds and their uses are to be considered exemplification only and are not to be construed as limiting the scope of the invention as defined by the appended claims .

Summary of the Invention

The present invention relates to compounds, compositions and the use of these compounds and compositions for promoting bone regrowth and repair, to methods for manufacturing such compositions and to methods of treating patients with broken bones .

Accordingly, there is provided, in a first aspect of the invention N,N-dimethylacetamide and its pharmaceutically acceptable salts and prodrugs for use as a medicament.

Pharmaceutically acceptable salts and prodrugs may be of any type so long as when administered to a patient an appreciable portion of the free drug becomes available. In some embodiments salts may be those of inorganic acids such as sulphates and chlorides .

In preferred embodiments the compound is N, N- dimethylacetamide .

In a second aspect the invention provides a resorbable polymer composition comprising a polymer matrix and N, N- dimethylacetamide, its pharmaceutically acceptable salts or prodrugs .

The polymer matrix may be selected from the group consisting of polyglycolide, polylactides, polycaprolactones, polytriraethylenecarbonates , polyhydroxybutyrates , polyhydroxyvalerates, polydioxanon.es, polyorthoesters, polycarbonates, polytyrosinecarbonates, polyorthocarbonates polyalkylene oxalates, polyalkylene succinates, poly (malic acid), poly(maleic anhydride), polypeptides, polydepsipeptides, polyvinylalcohol, polyesteramides, polyamides, polyanhydrides, polyurethanes, polyphosphazenes, polycyanoacrylates, polyfumarates, poly(amino acids), modified polysaccharides, modified proteins and their copolymers, terpolymers or combinations or mixtures or polymer blends thereof .

In preferred embodiments the polymer matrix is selected from the group consisting of polyglycolide, poly (L-lactide-co- glycolide) , poly (DjL-lactide-co-glycolide) , poly (L-lactide) , poly (D,L-lactide) , poly (L-lactide-co-D, L-lactide) , polycaprolactone, poly (L-lactide-co-caprolactone) , poly(D,L- lactide-co-caprolactone) polytrimethylenecarbonate , poly (L- lactide-co-trimethylenecarbonate) poly (D, L-lactide-co- trimethylenecarbonate) , polydioxanone and their copolymers, terpolymers or combinations or mixtures or polymer blends thereof .

In particularly preferred embodiments the polymer matrix comprises Polylactide/Polyglycolide/Trimethylene carbonate copolymer (PLA/PGA/TMC) with a composition of 80/10/10, Poly D, L-lactide/Poly L-lactide/Trimethylene carbonate copolymer (PLDLA/PLA/TMC) with a composition of 55/40/5, or a matrix comprising 80 wt-% P(L/DL)LA (70/30) and 20 wt-% PLLA/TMC (70/30) . The resorbable polymer composition may contain anywhere between the minimal amount of N,N-dimethylacetamide, its pharmaceutically acceptable salts or prodrugs, required for a pharmaceutical effect up to about 50% by weight of the composition.

Preferably the resorbable polymer composition is in the form of an implant.

Preferably N,N-dimethylacetamide, its pharmaceutically acceptable salts or prodrugs, make up between 0.05 and 50% by weight of the composition. More preferably the N, N- dimethylacetamide, its pharmaceutically acceptable salts or prodrugs, is present in an amount of between 0.1 and 10% by weight.

Preferably N,N-dimethylacetamide, its pharmaceutically acceptable salts or prodrugs, are spread throughout the resorbable polymer matrix evenly but in some embodiments may be positioned only in that portion of the device intended to lie against the bone. In other embodiments N, N- dimethylacetamide, its pharmaceutically acceptable salts or prodrugs, may have any distribution profile within the resorbable polymer composition.

In a third aspect the invention also provides the use N₇N- dimethylacetamide, its pharmaceutically acceptable salts or prodrugs, in the manufacture of a medicament for promoting osteogenesis, particularly for assisting in the healing of, or treating, a fractured bone. The medicament may be in any form such as tablet, capsule, slow release composition, powder for inhalation, syrup and any other form known in the art .

The medicaments may be in the form of a mixture with any pharmaceutically acceptable carrier. The term "pharmaceutically acceptable carrier" includes a material which is not biologically or otherwise undesirable. Such a material may be administered to an individual along with the selected active agent without causing any undesirable biological effects or interacting in a deleterious manner with any of the other components of the pharmaceutical composition in which it is contained.

The medicaments according to the invention may be manufactured using any methods known in the art. For example, the compositions may be dry milled and mixed prior to tableting and the composition may therefore necessarily contain other pharmaceutically expectable excipients such as a lubricant selected from the group consisting of calcium stearate, magnesium stearate, zinc stearate, stearic acid, talc and combinations thereof, a binding agent selected from the group consisting of hydroxypropylmethyl cellulose, hydroxyethyl cellulose, hydroxypropyl cellulose, methyl cellulose and a polyvinyl pyrrolidone (PVP) .

Medicaments according to the invention may contain any pharmaceutically acceptable excipients such as binders, fillers, pigments, disintegrating agents, lubricants, wetting agents, buffers and other excipients conventionally used in the pharmaceutical and chemical fields. Some examples of excipients for use in the medicaments of the present invention are microcrystalline cellulose, lactose, starch, colloidal silica, talc, glycerol esters, sodium stearyl fumarate, and titanium dioxide.

For oral administration compositions or medicaments of the invention may be administered with any inert diluent or with an edible carrier. They may be incorporated directly into food or beverages making up part of the patient's diet. The compositions or medicaments of the invention may be formulated with excipients and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspension syrups, wafers, and the like.

The tablets, troches, pills, capsules and the like may contain those excipients already mentioned and in some cases may also contain sweetening agents, such as sucrose, glucose, aspartame or saccharin, flavouring agents such as essential oils of mint, peppermint, spearmint or any other suitable flavouring. When the dosage unit is a capsule it may additionally contain a liquid carrier such as an oil or buffered aqueous solution.

Medicaments and compositions of the invention may also be formulated with phospholipids or fatty acids or other synthetic nanoparticles as carriers .

Medicaments and compositions of the invention may take the form of formulations for parenteral administration and may include sterile aqueous solutions or dispersions, and sterile powders for the preparation of sterile, injectable solutions or dispersions. The solutions or dispersions may also contain buffers, diluents, and other suitable additives that may be designed to promote the cellular uptake of the active agents in the composition, for example, liposomes.

Pharmaceutical formulations for topical administration may be especially useful for localized treatment. Formulations for topical treatment included ointments, sprays, gels, suspensions, lotions, creams, and the like. Formulations for topical administration may include known carrier materials such as isopropanol, glycerol, paraffin, stearyl alcohol, polyethylene glycol, and the like. The pharmaceutically acceptable carrier may also include a known chemical absorption promoter. Absorption promoters include, for example, trichloroethanol, trifluoroethanol, and certain alcohols and mixtures thereof according to GB 1,001,949 to Meyer and GB 1,464,975 to AstraLakemedel) .

Medicaments and compositions of the invention suitable for rectal or vaginal administration may be presented as a suppository, which may include one or more suitable nonirritating excipients or carriers comprising, for example, cocoa butter, polyethylene glycol, a suppository wax or a salicylate, which is solid at room temperature, but liquid at body temperature and, therefore, will melt in the rectum or vaginal cavity and release the active compound.

Formulations of the present invention which are suitable for vaginal administration also include pessaries, tampons, creams, gels, pastes, foams or spray formulations containing such carriers as are known in the art to be appropriate .

The medicaments of the invention preferably comprise a resorbable polymer matrix, such as those exemplified herein. In this embodiment the polymer matrix acts as a slow release composition in preferred embodiments, allowing N, N- dimethylacetamide, its pharmaceutically acceptable salts or prodrugs, to leach out of the resorbable composition over time and enhance bone repair.

In a fourth aspect the present invention provides a method for manufacturing an implant having osteogenic properties comprising the steps of; a) selecting polymer (s) or copolymer (s) ; b) adding N,N-dimethylacetamide, its pharmaceutically acceptable salts or prodrugs, in an amount of between 0.05 and 50% by weight; c) processing the polymer (s) or copolymer (s) to form a polymer matrix; and d) forming the implant from said polymer matrix.

In a further aspect the present invention provides another method for manufacturing an implant having osteogenic properties comprising the steps of; a) selecting polymer (s) or copolymer (s) ; b) processing the polymer (s) or copolymer (s) to form a polymer matrix; c) forming the implant from said polymer matrix; and d) adding the implant to a solution of N,N- dimethylacetamide, its pharmaceutically acceptable salts or prodrugs, so that an amount of between 0.05 and 50% by weight is adsorbed by the implant.

The step of processing the polymer (s) or copolymer (s) to form a polymer matrix may be carried out by any means known to one of skill in the art . In preferred embodiments the processing step involves melt processing.

In one embodiment the method may involve incorporation of N,N-dimethylacetamide, its pharmaceutically acceptable salts or prodrugs, into the polymer both prior to blending and after the implant is made .

The implant forms include, but are not limited to, membranes, films, plates, mesh plates, screws, taps or other formed pieces .

Without wishing to be bound by theory, the applicant believes that the osteogenic agents act in synergy with BMP and those other endogenous factors present that assist in bone repair, for example, BMP-2, BMP-4, BMP-7 and GDF-5. Some aspects of the invention involve the inclusion of one or more of these endogenous factors within the formulation or polymer matrix so as to augment the naturally occurring factors which will be present at the site of a break. The invention therefore also encompasses those formulations, uses and methods where an endogenous factor and the osteogenic agent are present and/or administered in synergistic amounts . In one particularly preferred embodiment the osteogenic agent may be co-administered with one or more of recombinant human BMP-2, BMP-4, BMP-7 and GDF-5.

In a further aspect the present invention provides a method of treating a person in need of bone repair comprising administering N,N-dimethylacetamide, its pharmaceutically acceptable salts or prodrugs, or a pharmaceutical composition according to the invention.

In preferred embodiments the method involves surgically implanting a resorbable polymer composition according to the invention.

In another preferred embodiment the medicament takes the form of a paste that may be applied between fractured portions of bone so as to provide N,N-dimethylacetamide, its pharmaceutically acceptable salts or prodrugs, directly at the site of the break, thereby enhancing bone repair.

Certain aspects of the invention will now be exemplified. The experiments detailed below are given by way of example only and are in no way intended to limit the scope of the invention as defined in the appended claims.

Methods

Before the examples are introduced and discussed, the marker compounds monitored in the testing methods confirming the activity of N,N-dimethylacetamide are briefly outlined.

Alkaline phosphatase is a commonly assessed biomarker associated with an osteogenic phenotype. Active osteoblasts robustly produce alkaline phosphatase, a chemical that has an essential role in making phosphate available for calcification of bone. Osterix is a zinc finger-containing transcription factor that is essential for osteoblast differentiation and bone formation.

Examples

Example I - Cell culture and induction of differentiation

Determination of alkaline phosphatase phenotype

The murine muscle myoblast cell line, C2C12 (Lot05/K/031) was obtained from European Collection of Cell Cultures (Salisbury, U.K.) . The cells were maintained in DMEM containing foetal bovine serum (10%) , 1-glutamine (2mM) , penicillin G (lOOμg/mL) and streptomycin (100U/mL) , in a humidified atmosphere containing 5% CO₂ at 37⁰C.

To assess their differentiation into an osteogenic phenotype, C2C12 cells were seeded at a density of

0.5xl0⁴cells/mL into polystyrene 96 well plates (Appleton Woods, Birmingham, U.K.) and maintained for 24 hours, after which they were treated with N,N-dimethylacetamide over a range of concentrations (ImM to lμM) in the presence of subthreshold concentration of BMP-2 (lOOng/mL; obtained from Prof. Franz Weber, University of Zurich); appropriate vehicle controls were used.

A combination of BMP-2 (lOOng/mL) with NMP (5mM) - a compound found to have osteogenic properties - was used as a standard reference. Cells were maintained in culture for 7 days prior to assessment of alkaline phosphatase activity. Results of the tests are shown below.

Assessment of Alkaline Phosphatase activity

Following 7 days in treatment, cell culture experiments were terminated by in situ lysis in Buffer A (containing 2-amino- 2-methylpropan-l-ol (0.56M; SigmaAldrich, Poole, U.K.) and sodium dodecyl sulphate (0.1% w/v; SigmaAldrich, Poole, U.K.) in H₂O, adjusted to pH 10 with 5N HCl); following two washes in PBS. Thereafter, 4-nitrophenyl phosphate (2OmM in Buffer A containing MgCl₂ (4mM) ) was added to each well. Plates were incubated at 37⁰C in an atmosphere containing 5 % CO₂ for 30 minutes.

Following this period, the reactions were terminated with the addition of NaCl (IM) to each well. Absorbance of each well was then measured on a plate reader at 405nm (FluoStar Optima, BMG Labtech, Aylesbury, U.K.) .

N,N-dimethylacetamide in the presence of BMP-2 (lOOng/mL) was shown to induce alkaline phosphatase in murine C2C12 cells. Induction was observable at 5mM and the level of alkaline phosphatase induction was over 2.6 times greater than BMP-2 (lOOng/mL) alone.

Assessment of mineralization in MC3T3-E1 cells

Following 14 days in treatment, cell culture experiments were washed twice in PBS and cells fixed using 2% paraformaldehyde at room temperature for 15 minutes.

Thereafter, cells were washed using deionized H₂O five times. Alizarin red (4OmM, pH4.2) was added to each well for 15 minutes with gentle rocking; thereafter the stain was carefully removed and cell layers washed 5 times with deionized H₂O. Following these washing steps, excess H₂O was carefully removed from the plates and alizarin red staining quantitatively assessed following extraction using cetylpyridinium chloride (10% in sodium phosphate solution (1OmM); pH7.0). Absorbance of each well was then measured on a plate reader at 560nm (FluoStar Optima, BMG Labtech, Aylesbury, U.K.).

N,N-dimethylacetamide in the presence of BMP-2 (lOOng/mL) was shown to induce mineralisation in murine MC3T3-E1 cells. Induction was observable at 500μM and the level of mineralisation was around two times greater than BMP-2 (lOOng/mL) alone.

Osterix (Osx) qPCR

C2C12 cells were seeded into 6 well plates at 30,000 cells/well in DMEM medium supplemented with foetal bovine serum (10%) , 1-glutamine (2OmM) , penicillin G (lOOμg/mL) and streptomycin (lOOU/mL) . The following day the cells were treated with BMP-2 (lOOng/mL) and N,N-dimethylacetamide

(5mM) and incubated for 48 hours in a humidified atmosphere containing 5% CO₂ at 37°C. Therafter, cells were harvested and total RNA isolated using the RNeasy mini-kit (Qiagen #74104) .

As osterix has only a single exon, to reduce contaminating effects of gDNA, on-column gDNA digestion was carried out. First-strand cDNA was synthesised from 500ng of RNA using random hexamers and Superscript II Reverse Transcriptase (Invitrogen #18064-022) . Transcript expression of Osx was determined by real-time quantitative PCR (qPCR) analysis performed in a Chromo4 Real-Time PCR detector (BioRad Laboratories) using iQ SYBR Green Supermix (BioRad #170- 8882) and the primers to detect a 124bp sequence; Primers for Osterix qPCR; 5' GTCAAGAGTCTTAGCCAAACTC 3'; Fwd 5' AAATGATGTGAGGCCAGATGG 3' Rev. Osx expression was normalised against 18S ribosomal RNA expression.

N,N-dimethylacetamide (5mM) enhanced osterix gene expression in C2C12 cells by a factor of over 1.7 compared to BMP-2 (lOOng/mL) alone.

Example 2 - Resorbable polymer manufacturing

According to one embodiment of the method of the present invention, N,N-dimethylacetamide is added to the polymer matrix that has been already fashioned into the form of a medical implant .

Polymer compositions are prepared by dry-mixing commercially available granular-form base materials with commercially available copolymer additives. The material composition was 80% w/w P(L/DL)LA (70/30) and 20% w/w PLLA/TMC (70/30). The components are weighed according to a desired weight ratio into a container which is then rotated in a Turbula T2F shaker mixer for 30 minutes until a homogenous dry mixture is obtained. The resulting mixture is then dried in vacuum at 60⁰C for 8 to 12 hours and subsequently melt-blended and injection-moulded into pieces of the desired shape. The processes and tooling required to carry out injection moulding are well known to one skilled in the art of die making or plastics engineering.

Before use the plates are usually sterilized by gamma irradiation with a nominal dose of 25 kGy. After sterilisation, the plates are submerged in N, N- dimethylacetamide for 30 seconds followed by resting at room temperature for half an hour.

Example 3 - Membrane for periodontal use

The implant may also be fashioned into a barrier membrane for use in Guided Tissue Regeneration (GTR) to treat a periodontal defect.

The membrane comprises PLA/PGA-matrix polymers. The membrane is positioned in a slot of a package, such as a plastic blister. The preparation of the membrane is conducted as one stage of surgical operation as follows:

1. After opening the package, an amount of N₇N- dimethylacetamide or a solution thereof is poured into the membrane slot. The membrane is fully immersed in the N,N-dimethylacetamide or solution thereof for an period of between 30 seconds and 3 minutes, preferably for 30 seconds.

2. The membrane is removed from the slot. 3. The N,N-diraethylacetamide is allowed to diffuse into the polymer matrix of the membrane for 15 to 20 minutes .

4. The membrane is ready for use as a barrier between the gingival soft tissue and the healing bone tissue and/or periodontal tissues in order to prevent the gingival soft tissue filling the defect side.

In the conditions of a normal operating theatre temperature and humidity, the membrane stays malleable for several hours .

Implants of the invention can be used for example in guided bone regeneration applications, where the effect of an osteogenic compound loaded barrier membrane is required to avoid soft tissue ingrowth in the area where new bone formation is required, and to enhance bone regeneration.

Therapeutic applications

When N,N-dimethylacetamide is incorporated into compositions for use in securing broken bones, it results in a more rapid healing of bones . The compound acts in a synergistic manner with BMP and other endogenous factors already present at the break site to enhance their effect on the healing process .

The compositions may be applied as a solid 'cast' around the portion of bone to be repaired or may be applied between two or more fractured portions as a fluid, preferably viscous, so that the active compounds are present between the fractured pieces facilitating their reattachment to one another .

Compositions of the invention may be used for rebuilding bone, cosmetic surgery, trauma surgery, rebuilding fractures, and in the treatment of osteoporosis and osteosarcoma .

Claims

CLAIMS :

1. A compound selected from N,N-dimethylacetamide, its pharmaceutically acceptable salts and prodrugs for use as a medicament .

2. A compound according to claim 1 which is N, N- dimethylacetamide .

3. A resorbable polymer composition comprising a polymer matrix and a compound according to claim 1 claim 2.

4. The resorbable polymer composition of claim 3 wherein the polymer matrix is selected from the group consisting of polyglycolide, polylactides, polycaprolactones, polytrimethylenecarbonates, polyhydroxybutyrates, polyhydroxyvalerates , polydioxanones, polyorthoesters, polycarbonates, polytyrosinecarbonates, polyorthocarbonates polyalkylene oxalates, polyalkylene succinates, poly (malic acid), poly(maleic anhydride), polypeptides, polydepsipeptides, polyvinylalcohol , polyesteramides, polyamides, polyanhydrides, polyurethanes, polyphosphazenes, polycyanoacrylates , polyfumarates , poly (amino acids), modified polysaccharides, modified proteins and their copolymers, terpolymers or combinations or mixtures or polymer blends thereof .

5. The resorbable polymer composition of claim 3 or claim 4 wherein the polymer matrix is selected from the group consisting of polyglycolide, poly (L-lactide-co-glycolide) , poly(D,L-lactide-co-glycolide) , poly (L-lactide) , poly(D,L- lactide) , poly (L-lactide-co-D, L-lactide) , polycaprolactone, poly (L-lactide-co-caprolactone) , poly (D,L-lactide-co- caprolactone) polytrimethylenecarbonate, poly (L-lactide-co- trimethylenecarbonate) poly (D, L-lactide-co- trimethylenecarbonate) , polydioxanone and their copolymers, terpolymers or combinations or mixtures or polymer blends thereof .

6. The resorbable polymer composition of any one of claims 3 , 4 and 5 wherein the polymer matrix comprises Polylactide/Polyglycolide/Trimethylene carbonate copolymer (PLA/PGA/TMC) with a composition of 80/10/10, Poly D, L- lactide/Poly L-lactide/Trimethylene carbonate copolymer (PLDLA/PLA/TMC) with a composition of 55/40/5, or a matrix comprising 80 wt-% P (L/DL) LA (70/30) and 20 wt-% PLLA/TMC (70/30) .

7. The resorbable polymer composition of any one of claims 3 to 6 wherein the compound is present in an amount of from 0.05 to 50% by weight of the composition.

8. The resorbable polymer composition of claim 7 wherein the compound is present in an amount of between 0.1 and 10% by weight .

9. The use of an osteogenic compound according to claims 1 claim 2 in the manufacture of a medicament for promoting osteogenesis .

10. The use of claim 9 wherein the promotion of osteogenesis is for treating a broken bone.

11. The use of claim 9 or claim 10 wherein the medicament is in the form of a resorbable polymer composition according to any one of claims 3 to 8.

12. A method for manufacturing an implant having osteogenic properties comprising the steps of; a) selecting polymer(s) or copolymer (s) ; b) adding a compound according to claims 1 or claim 2 in an amount of between 0.05 and 50% by weight; c) processing the polymer (s) or copolymer (s) to form a polymer matrix; and d) forming the implant from said polymer matrix.

13 A method for manufacturing an implant having osteogenic properties comprising the steps of; a) selecting polymer (s) or copolymer (s) ; b) processing the polymer (s) or copolymer (s) to form a polymer matrix; c) forming the implant from said polymer matrix; and d) adding the implant to a solution of a compound according to claims 1 or claim 2, so that an amount of between 0.05 and 50% by weight is adsorbed by the implant.

14. The method of claim 12 or claim 13 wherein the step of processing the polymer (s) or copolymer (s) to form a polymer matrix comprises melt processing.

15. The method of any one of claims 12 to 14 comprising incorporation of the compound into the polymer prior to blending and after the implant is made.

16. The method of any one of claims 12 to 15 wherein the polymer (s) or copolymer (s) are selected so as to provide a polymer matrix selected from the group consisting of polyglycolide, polylactides, polycaprolactones, polytrimethylenecarbonates, polyhydroxybutyrates, polyhydroxyvalerates, polydioxanones, polyorthoesters, polycarbonates, polytyrosinecarbonates, polyorthocarbonates polyalkylene oxalates, polyalkylene succinates, poly (malic acid) , poly(maleic anhydride) , polypeptides, polydepsipeptides, polyvinylalcohol, polyesteramides, polyamides, polyanhydrides, polyurethanes, polyphosphazenes, polycyanoacrylates, polyfumarates, poly(amino acids), modified polysaccharides, modified proteins and their copolymers, terpolymers or combinations or mixtures or polymer blends thereof.

17. The method of any one of claims 12 to 16 wherein the polymer (s) or copolymer (s) are selected so as to provide a polymer matrix selected from the group consisting of polyglycolide, poly (L-lactide-co-glycolide) , poly(D,L- lactide-co-glycolide) , poly (L-lactide) , poly (D, L-lactide) , poly (L-lactide-co-D, L-lactide) , polycaprolactone, poly(L- lactide-co-caprolactone) , poly (D,L-lactide-co-caprolactone) polytrimethylenecarbonate, poly (L-lactide-co- trimethylenecarbonate) poly (D,L-lactide-co- trimethylenecarbonate) , polydioxanone and their copolymers, terpolymers or combinations or mixtures or polymer blends thereof .

18. The method of any one of claims 12 to 15 wherein the polymer (s) or copolymer (s) are selected so as to provide a polymer matrix that comprises Polylactide/Polyglycolide/Trimethylene carbonate copolymer. (PLA/PGA/TMC) with a composition of 80/10/10, Poly D, L- lactide/Poly L-lactide/Trimethylene carbonate copolymer (PLDLA/PLA/TMC) with a composition of 55/40/5, or a matrix comprising 80 wt-% P(L/DL)LA (70/30) and 20 wt-% PLLA/TMC (70/30) .

19. The method of any one of claims 12 to 18 wherein the compound is present in an amount of between 0.1 and 10% by weight.

20. A method of treating a person in need thereof comprising administering a compound according to claim 1 or claim 2.

21. A composition comprising a compound according to claim 1 or claim 2 and one or more of recombinant human BMP-2, BMP-4, BMP-7 and GDF-5 in synergistically effective amounts

22. The resorbable polymer composition of any one of claims 3 to 8 additionally comprising one or more of recombinant human BMP-2, BMP-4, BMP-7 and GDF-5.

23. The use according to any one of claims 9 to 11 wherein the medicament additionally comprises one or more of recombinant human BMP-2, BMP-4, BMP-7 and GDF-5.

24. The method of any one of claims 12 to 19 additionally comprising the step of adding one or more of recombinant human BMP-2, BMP-4, BMP-7 and GDF-5.

25. A method of treating a person in need thereof comprising surgically implanting a resorbable polymer composition to the any one of claims 3 to 8 or claim 22.

26. The use of claim 9, claim 10 or claim 23 wherein the medicament is in the form of a paste .