WO2008087442A1

WO2008087442A1 - Biological materials and uses thereof

Info

Publication number: WO2008087442A1
Application number: PCT/GB2008/000188
Authority: WO
Inventors: Andrew Johnson; Ramiro Alberio
Original assignee: Evocell Limited
Priority date: 2007-01-19
Filing date: 2008-01-18
Publication date: 2008-07-24
Also published as: GB0701062D0

Abstract

An isolated animal cell or cell extract thereof comprising an exogenous nucleic acid molecule expressible therein encoding a nanog protein or functionally equivalent fragment thereof. There are also provided isolated nanog proteins and encoding nucleic acids and methods of using the cells and cell extracts.

Description

BIOLOGICAL MATERIALS AND USES THEREOF

The present invention relates to methods of and compositions suitable for inducing the reprogramming of a differentiated cell or cell nucleus and uses thereof of the reprogrammed cell and/or cell nucleus, in particular, the invention describes methods of reprogramming a differentiated cell to produce an embryonic stem cell-like cell.

Embryonic stem cells are pluripotent stem cells which are capable of generating any other cell type in the organism from which they are derived.

Pluripotent cells have the ability to develop into all three embryonic tissue layers which in turn form all the cells of every body organ and is used to describe stem cells that can form any and all cells and tissues in the body.

This differs subtly from totipotent cells which have the capacity to specialize into extraembryonic membranes and tissues, the embryo, and all postembryonic tissues and organs.

Differentiated cells are cells which make up the somatic tissues within an organism and are, under normal in vivo circumstances, generally considered to be restricted in their developmental potential. Differentiated cells may be either terminally differentiated, that is, they are developmentally arrested as a particular cell type (for example, neurons, myocytes and osteocytes), or they may retain the potential to give rise to a limited number of other cell types within a specific lineage (for example, a myeloid progenitor cell which can produce a variety of immune cells including basophils, eosinophils, and neutrophils).

Mammalian, and in particular human, embryonic stem cells offer the potential for the treatment and/or prevention of many human diseases or conditions. In particular, embryonic stem cells offer a means to generate a large range of human cell types, such cells being of great therapeutic value. However, currently in most developed countries there are ethical and practical issues surrounding the obtaining and use of mammalian, and in particular human, embryonic stem cells. Embryonic stem cells are normally derived from a pluripotent population of cells in an embryo known as the inner cell mass (ICM) which is the population of cells from which an entire organism is derived. The ICM arises early in development, typically three to five days after fertilisation depending on the species in question. Using cloning procedures it is possible to produce embryos from any individual of a given species. Typically, in current cloning procedures the nucleus of a mammalian differentiated cell is transferred into an enucleated mammalian oocyte, usually from the same species in a process known as nuclear transfer (Campbell et at., 2005, Reprod Dom Anim 40:256-268).

Nuclear transfer is known to be difficult to perform and to have a low frequency of success (Campbell et a/., 2005, Reprod Dom Anim 40:256- 268). When successful, the transferred nuclear DNA is reprogrammed by the recipient oocyte and the oocyte can then be stimulated, by mimicking the effect of fertilisation, to form an embryo.

Usually the oocyte is stimulated into mitosis and either at the morula or blastocyst stage is implanted into the uterus of a 'foster' mother. This procedure has a very low success rate and produces very few viable embryos. In those cases where an embryo forms, the ICM may be isolated to provide embryonic stem cells which can be used in other applications.

When this process is applied to human, or mammalian, embryos it is referred to as therapeutic cloning, which has both practical and ethical considerations. In practical terms, obtaining embryonic stem cells requires the donation of eggs from a female, which is limited in practice as mammalian eggs are expensive to recover and very few eggs can be obtained from one female. In ethical terms and particularly in relation to humans, there are widespread objections to the generation of an embryo as an intermediate in another process, for example in therapeutic cloning where the embryo produced serves only as a donor of embryonic stem cells. Hence, there is a need to develop pluripotent, embryonic stem cell-like cells which can be used in therapeutic procedures but that can be obtained without the cloning procedure, and in particular without using mammalian oocytes to produce embryos simply to provide embryonic stem cells.

The nuclei of differentiated cells have previously been successfully reprogrammed towards a pluripotent state by the production of viable fertile animals from cloning experiments with differentiated cells (Wilmut et al (1997) Nature 385:810-813; Polejaeva et al (2000) Nature 407:86-90). These procedures have very low efficiencies and success rates. In these procedures the differentiated nucleus was reprogrammed to pluripotency by nuclear transfer into an enucleated mammalian oocyte and exposure to factors within the mammalian oocyte which reactivated genes in the cell nucleus that conferred pluripotency to the cell via the creation of an embryo. In these cases all the manipulations were performed using material from the same species as the cell of interest.

Pluripotency in a cell may be identified by looking for the expression of a number of marker genes. In a human these genes include POU5F1 (encoding the transcription factor Oct-4), NANOG, Rex-1 , Sox-2 and Tert (Ginis et al., 2004 Dev Bio! 269:Pageε 360-380). The skilled man will understand from the context in which POU5 (Oct-4) and NANOG, or any other genes or proteins are referred to whether it is the gene or the gene product which is being discussed.

Oct-4 is a transcription factor normally found and expressed in pluripotent cells, including embryonic stem cells, but it is not expressed in normal differentiated cells. The activation of Oct-4 is consistent with the cells being reprogrammed towards a state resembling pluripotency. Experimental elimination of Oct-4 results in the complete absence of an ICM in embryos, and the loss of an undifferentiated phenotype in embryonic stem cells which go on to differentiate into primitive ectoderm (Nichols et al (1998) Cell. 95:379-391 ). Nanog is another transcription factor also found in pluripotent cells. In the absence of nanog expression embryonic stem cells lose their pluripotency (Chambers (2004) Cloning Stem Cells 6:386-391 ).

For a cell to be considered to be pluripotent the transcription of the well characterized "pluripotency network" (PN) that includes the transcription factors nanog, Oct-4, and Sox-2 is required. It had been shown by Gurdon and colleagues that the Oct-4 gene could be activated when permeabilized mammalian cells are injected into the nucleus (called germinal vesicle, or GV) of oocytes from Xenopus, a frog (Byrne, J. A., et al., 2003 Curr. Biol. 13, 1206-1213). Also, Hansis and Niehrs reported activation of Oct-4 in cells incubated at 37 degrees for 30 minutes in extracts from Xenopus eggs (eggs are ovulated oocytes, and are physiologically different (Hansis C, et al., 2004 Current Biology 14 1475-1480). Oct-4 transcription was activated two weeks after treatment with extract, as shown by PCR. However, neither of these groups reported activation of nanog, so the resulting cells that express Oct-4 are not pluripotent.

It has been previously shown (co-pending international application PCT/GB2006/002754) that reprogramming of differentiated cells to a pluripotent embryonic-stem cell like form can be achieved using a cell or cell extracts derived from a class of cold blooded vertebrates that are different to Xenopus (frogs). Examples of this group of cold blooded vertebrates include Axolotl (Salamanders) and Sturgeon. A phylogenetic tree showing other members of this group is shown in Figure 8. The differences are both developmental/embryologica! (different vertebrate body plans) and in the gene expression patterns of key pluirpotency genes such as nanog.

The genome of Xenopus laevis, a commonly used laboratory frog has been sequenced to completion and can be found in Canon, S., et al. (2006) Dev. Dyn. 235, 2889-2894 and [http://genome.jgi- psf.org/Xentr4/Xentr4.home.html]. From the fully sequenced genome it can be found that Xenopus does not contain a Nanog gene based on sequence comparisons using the Nanog sequence known for other species such as Humans, Mice, Chick, Cow, Rat and Dog.

There is a need for methods of producing embryonic stem cells or cells that resemble embryonic stem cells (so-called embryonic-stem cell like cells) without the creation of whole embryos in order to overcome both the practical and ethical considerations of the stem cell field. Hence, the present invention provides alternative compositions for and methods of redirecting the developmental potential of differentiated cells and/or their nuclei e.g. differentiated cells from mammals, to a more pluripotent state resembling that of an embryonic stem cell in a process known as reprogramming.

In a first aspect of the invention there is provided an isolated cell or cell extract thereof comprising an exogenous nucleic acid molecule expressible therein encoding a nanog protein or functionally equivalent fragment thereof.

By "animal" we mean any animal including humans.

By "exogenous" we mean a molecule that has been introduced into the cell or cell extract of the invention from outside of the cell. The exogenous molecule may be derived from a different cell type and/or from a different species to that of the cell into which the exogenous molecule is introduced. The exogenous molecule may be derived from an identical cell type and/or from an identical species to that of the cell into which the exogenous molecule is introduced. The exogenous molecule may also be an artificially synthesised or recombinant^ produced molecule.

Polypeptides of the invention include both full-length and fragments. Such polypeptides may be prepared by any conventional means.

Functionally equivalent proteins or protein fragments refer to proteins and/or fragments having at least 69% sequence identity and retaining the same function as Oct-4 and/or nanog. Such function can be tested by any of the methods described herein.

"Nucleic acid molecules" according to the invention include single and double stranded DNA, RNA, cDNA. Derivatives of nucleotide sequences capable of encoding functionally-equivalent polypeptides may be obtained using any conventional method well known in the art.

Functionally equivalent fragments of nanog can be identified using methods well known in the art for testing the function of proteins, in particular the methods described in the examples can be used to test the function of the fragments.

Therefore, there is provided an isolated cell or cell extract thereof wherein the nucleic acid molecule encoding nanog protein is identical to an endogenous nucleic acid molecule of the cell that encodes nanog protein.

Alternatively there is provided an isolated cell or cell extract thereof wherein the nucleic acid molecule encoding nanog protein is not identical to an endogenous nucleic acid molecule of the cell that encodes nanog protein.

By "endogenous" we mean a molecule that is not introduced into the cell or cell extract of the invention. In other words the endogenous molecule is found naturally within the cell or cell extract thereof.

In an alternative embodiment of the first aspect of the invention there is also provided an isolated animal cell or cell extract thereof comprising an exogenous nanog protein or functionally equivalent thereof.

There is provided an isolated cell or cell extract thereof wherein the exogenous nanog protein is identical to an endogenous nanog protein of the cell. Alternatively, there is provided an isolated cell or cell extract thereof wherein the exogenous nanog protein is not identical to an endogenous nanog protein of the cell.

Preferably the cell or cell extract thereof did not contain nanog protein before introduction of the exogenous nucleic acid molecule encoding nanog protein or the exogenous nanog protein. The cell not containing nanog may be a cell type that has or has been capable of naturally expressing nanog at a particular developmental stage but is not expressing and therefore does not contain nanog at the time of introduction of the exogenous molecule.

Conveniently, the cell does not contain an endogenous nucleic acid molecule encoding nanog protein.

Preferred the cell types are one selected from the following: early embryo, ovary, oocyte and egg cells.

Conveniently the isolated cell or cell extract is derived from a cold blooded vertebrate that does not naturally express nanog including frogs such as Xenopus, reptiles and teleosts,. Alternatively the cell or cell extract is derived from an egg laying species such as birds..

Alternatively the isolated cell or ceil extract thereof is derived from a cold blooded vertebrate, wherein the cold blooded vertebrate has one or more of the following properties:

(i) a primitive vertebrate body plan including laterally projecting ribs and/or spinal projections and/or pelvic appendages in fish extending from a posteriorly located pelvic bone;

(ii) germ cells which do not contain germ plasm; and/or (iii) the oocyte, egg, ovary or early embryo cell or cell from which the cell extract is derived, expresses Oct-4 in a highly conserved form and/or nanog in a highly conserved form.

An isolated cell or cell extract thereof as claimed in any previous claim wherein the exogenous nucleic acid molecule and/or exogenous nanog protein have the nucleic acid or amino acid sequence of nanog derived from a cold blooded vertebrate, wherein the cold blooded vertebrate has one or more of the following properties:

(ii) germ cells which do not contain germ plasm; and/or

(iii) the oocyte, egg, ovary or early embryo cell or cell from which the cell extract is derived, expresses Oct-4 in a highly conserved form and/or nanog in a highly conserved form.

Primitive Body Plan

Whether an organism has a primitive vertebrate body plan can be determined by considering one or both of two specific criteria pertaining to their skeletal structures. The first criterion relates to the rib structure and the second criterion relates to the pelvic bone. Primitive fish and primitive amphibians have similar skeletal structures, which is in marked contrast to the skeletal structure of organisms with so called "derived" skeletons (anuran (frog) skeletons; teleost skeletons).

An organism with a primitive vertebrate body plan, such as a lungfish or a salamander, has ribs which radiate laterally from a backbone. This is the primitive condition of the vertebrate skeleton which gave rise to the rib cage in mammais. By way of contrast in an organism, such as a teleost fish, which has a derived body plan, the ribs radiate dorso-ventrally, not laterally. This difference allows fish with a primitive vertebrate body plan to be distinguished from those without.

As an alternative to considering the ribs, an organism with a primitive vertebrate body plan can also be identified by considering the pelvic bone. In primitive fish pelvic appendages extend from the pelvic bone in the posterior region of the skeleton. In the skeletons of teleosts the pelvic bone is found in a much anteriorised position near or adjacent to or even fusing with the pectoral girdle, positioning the pelvic fins at about the halfway point of the fish's body or even anterior of that point, near the head. The primitive amphibian skeleton exemplified by the salamander (axolotl) retains a pelvic bone attached to the posterior region of the skeleton. Frogs in contrast have a highly derived and expanded pelvic girdle. In addition frogs have a much reduced number of vertebrae anterior to the pelvic girdle.

Figure 7 illustrates the retention of the primitive vertebrate body plan in fish and amphibians. The similarity in the skeletal structure between the primitive fish and primitive amphibian can be clearly seen, as can the difference in structure compared to that of the derived skeletons. The figure compares the skeleton of a lungfish, representing the primitive vertebrate body plan with that of a typical teleost skeleton, representing a derived vertebrate body plan. It also compares the skeleton of a salamander (axolotl) with a frog (Xenopus laevis).

The lungfish skeleton is shown from a dorsal view (from the back). Importantly, the teleost shows a side view, illustrating that the spinal projections/ribs radiate dorso-ventrally, not laterally. The amphibians are both dorsal views. In the fish the small arrows point to bones/ribs which project laterally from the backbone in the lungfish. This is the primitive condition of the vertebrate skeleton which gave rise to the rib cage. Note that the teleost ribs project ventrally, not laterally. This is a teleost innovation. The dorsal and ventral spinal projections which support the fins are also a teleost innovation. Primitive fish retain four limbs, which evolved into the four limbs of tetrapods, four-limbed land dwelling animals. Importantly, the large arrow points to the pelvic bone in the primitive fish and primitive amphibian. This is a feature that defines primitive fish, as it is lost in teleosts. The primitive vertebrate body plan is discussed in more detail in Johnson ef a/(2003) Evolution and Development 5:4, 414-431.

Sturgeon, turtle, lungfish, and mammals all share a similar embryology, as defined by gastrulation movements. Johnson et a/(2003) Evolution and Development 5:4, 414-431.

Roelants et al.(2007) have recently identified global patterns of diversification of amphibians based on fossil records and shown phylogenetie relationships for the above-described species.

Therefore, the primitive vertebrate body plan can be identified, for example on x-rays, by the lateral and no dorsoventral projection of ribs and/or spinal projections. An alternative skeletal identification is the pelvic bone in fish.

Germ cells without germplasm

In females a germ cell refers to an oocyte or a precursor cell to an oocyte.

An oocyte defines the female germ ceil when in the ovary, and an egg defines the female germ cell after ovulation.

Germ plasm is a region of cytoplasm found in the egg, oocyte or embryo of some organisms which contains determinants that will direct specification of cells to the germ cell lineage. In animals without a germ plasm these same molecules are distributed throughout the egg cytoplasm, and possibly the GV (germinal vesicle) as well. These molecules, such as the products of the nanos, vasa and dazl genes, are typically RNA binding proteins, or the messenger RNAs that encode these, that are likely to be involved in the pluripotency reprogramming process since they are found in embryonic stem cells. It is considered that in organisms with a germ plasm these molecules are localized, and therefore probably in low abundance and relatively unavailable in oocytes, eggs, ovaries or early embryos, or extracts thereof, thus making organisms with a germ plasm unsuitable for reprogramming differentiated cells.

Preferably, in relation to the invention, a cold blooded vertebrate with a primitive vertebrate body plan also has oocytes/eggs (germ cells) which do not contain germ plasm. The presence or absence of germ plasm may explain how certain organisms developed. Indeed by looking at the body plan of an organism it is possible to predict whether the oocytes/eggs in that organism will have a germ plasm. The hind limbs in particular, which define the posterior extreme of the body trunk, are crucial. In the absence of germ plasm the germ cells are derived from posterior-lateral mesoderm, at about the vertebral position defined by the pelvic bone and they are formed in response to extracellular signals exclusive to this posterior region of the embryo. These cells later develop into oocytes. In the presence of germ plasm the germ cells develop in a more anterior position and the resulting organism has a relatively anterior adult morphology. The oocytes, eggs, ovaries and early embryos of organisms with a germ plasm are less efficient at cell and nucleus reprogramming when compared to those without a germ plasm.

Organisms which display a primitive vertebrate body plan are understood not to have germ plasm in their germ cells. The retention of the primitive vertebrate body plan is believed to be a consequence of the absence of a germ plasm. . Johnson et a/(2003) Evolution and Development 5:4, 414- 431.

For the purposes of identifying animals whose oocytes/eggs contain germ plasm, the hindlimbs, defining the posterior extreme of the body trunk are crucial. In the absence of germ plasm germ cells are derived from posterior-lateral mesoderm, at about the vertebral position defined by the pelvic bone. Animals whose eggs contain germ plasm do not require the extracellular posterior signals required to produce germ cells as the cells are specified by material supplied by the egg, not from extracellular signals. Therefore, in most animals with germ plasm, such as frogs and teleost fish, the animals have a relatively anterior adult morphology. The oocytes and eggs of these animals are not as useful for reprogramming.

It has been shown that the absence of germ plasm in mammals, once considered to be a mammalian innovation, has been conserved through a specific lineage of species that retain primitive embryological characteristics, which as a consequence result in the retention of a primitive vertebrate body plan in this lineage of animals. In the embryos of mammals and cold-blooded vertebrate species whose embryos retain primitive characteristics, and retain a primitive adult vertebrate morphology the stem cells that give rise to the germ line (sperm and eggs), known as PGCs₁ are derived from pluripotent precursors that arise early in development. Whereas in most experimental, non-mammalian, organisms such as Xenopus or zebrafish (a teleost) the PGCs are formed by an entirely different mechanism than in mammals, and pluripotent precursors equivalent to those of mammals are never formed. In Xenopus and zebrafish the germ cells are segregated very early from somatic cells by the unequal distribution of germ plasm, containing germ cell determinants. The cells that inherit the germ plasm then become the PGCs, and do not give rise to somatic cells.

Figure 11 illustrates the distribution of germ plasm in oocytes from a number of different organisms. The RNAs coding for Xdazl and Xcat2 in Xenopus oocytes are shown, and the RNA coding for vasa is shown in lungfish oocytes. RNA coding for dazl and vasa are shown for sturgeon oocytes. Sections from oocytes were reacted with probes specific to these molecules and the probe was detected using alkaline phosphatase conjugated antibodies and colour detection by standard methods. Xdazl and Xcaf.2 RNAs are localized within the cytoplasm, indicative of germ plasm. Vasa RNA in lungfish oocytes and vasa and dazl RNA in sturgeon oocytes, are uniformly distributed, indicative of the absence of germ plasm.

It is now believed that the mechanism to produce PGCs in mammals is present in some lower animals, but only in those species that meet specific criteria. These species can be identified on the basis of their body plan. Species that meet the criteria, such as axolotl, have PGC development similar to that in mammals, and a similar complement of genes that govern germ cell development, such as the genes encoding Oct-4, and nanog and are therefore able to reprogram differentiated cells, and in particular mammalian differentiated cells. It is therefore possible to accurately predict that the oocytes of certain species which meet the aforementioned criteria will have reprogramming potential equivalent to that of axolotls. Species that do not meet these criteria will not have the same complement of conserved pluripotency genes and thus will not have equivalent reprogramming capability. The species meeting the criteria have a primitive vertebrate body plan which is believed to be a consequence of the absence of a germ plasm. Importantly, since Oct-4 and nanog are required to produce PGCs in the absence of germ plasm, the retention of Oct-4 and nanog is believed to be a consequence of having no germ plasm.

Adults are a product of their embryology. Therefore, the adult body plan is conserved because the embryology is conserved. What constrains the embryology, preventing the major changes seen in frogs and teleosts, is the mechanism for producing germ cells. In animals without germ plasm the PGCs have a more tenuous existence. Because they are derived from pluripotent cells they can be directed to develop into a somatic cell type if the signals required for their production are altered, as would happen with a major change in embryological cell movements. In animals without germ plasm the PGCs have a more tenuous existence, they can be wiped out if the signals required for their production are altered, as would happen with a major change in embryological cell movements. If germ plasm is present, the PGCs are refractory to these changes in signals, because they form no matter what. Thus, constraints on the embryology are lifted, the cell movements of embryology change, and this is why animals with germ plasm are capable of having an altered morphology from the primitive body plan. Without germ plasm this couldn't happen. Sturgeon, turtle, lungfish, and mammals all share a similar embryology, as defined by gastrulation movements.

Expression of Oct-4 and/or nanog

Preferably a cold blooded vertebrate retaining a primitive vertebrate body plan also has oocyte, egg, ovary or early embryo cells which express Oct-4 and/or nanog.

Oct-4 and/or Nanog expression may be determined by assaying for mRNA encoding the protein or for the protein product itself. Examples of methods of assays to do this include RT-PCR method to assay mRNA described in Makin et a/, technique 2 p295-301 (1990) or antibody assays for the protein product.

In order for Oct-4 and/or nanog in the oocyte, egg, ovary or early embryo cells to be considered highly conserved it must share at least 69% amino acid identity with the DNA binding domains (DBD) of the human transcription factor Oct-4 or the human nanog protein, respectively. In the case of the axolotl Oct-4 protein, AxOct-4, 73% of the amino acids are identical to the mouse Oct-4 DBD, and 75% are identical to the human Oct-4 DBD. The closest proteins from zebrafish and Xenopus, encoded by the genes ZPOU-2 and XLPOU91 , and which do not confer the ability to reprogram differentiated cells respectively, are 63% identical, less than the required 69% identity. The identity and activity of the functionally equivalent Oct-4 genes can be tested using standard methods known to the skilled man such as those described in the examples.

Preferably the amino acid identity referred to between the human Oct-4

DBD and that of a cold blooded vertebrate allows for conservative changes in the amino acids which do not alter the polarity or charge of the amino acid residue. Examples of conservative changes are well known to those skilled in the art, and include, for example, substitution of one hydrophobic residue such as isoieucine, valine, leucine or methionine for another, or the substitution of one polar residue for another, such as arginine for lysine. Preferably, when determining the amino acid identity between two protein sequences conservative amino acid changes are considered to be identical amino acids. Therefore, a conservative amino acid change in amino acid sequence will not affect the percentage amino acid identity and function between to two sequences but would change the percent identity in a phylogenetic analysis).

To further support the understanding discussed above, the gene encoding Oct-4 in various species was compared, and those sharing the identified morphological features were shown to have more closely related Oct-4 encoding genes than species lacking the morphological features. In these experiments the Oct-4 encoding genes were isolated from newt (Notopthalmus viridens), the gulf sturgeon (Asciperser oxyrhynchus), the African lungfish (Protopterus annectans) and the Red Eared Slider (a turtle, T.scήpta) all of which fulfil the criteria described for primitive morphology. In Figure 8 the DNA sequences of Oct-4 encoding related genes isolated from these species are compared with the most closely related gene sequences isolated from other species that are part of the public database and a pseudo phylogenetic tree is illustrated designed to track the evolutionary history of the Oct-4 encoding gene. Under normal circumstances a gene sequence evolution tracks the evolutionary relatedness of the animals (i.e. the species phylogeny). Therefore any sequence of a related gene would be expected to be more similar between salamanders (axolotl and newt) and frogs (Xenopus, Bufo, rana) because of their more recent divergence from a common amphibian ancestor, than they would be to the equivalent gene from another species, such as, fish, reptiles or mammals, from which they are evolutionarily more distant. The same logic holds for all fish compared to higher order species such as mammals and amphibians. However, in contrast to conventional phylogenetic predictions the analysis in Figure 8 shows that salamanders (i.e. axolotl), newts, sturgeon, lungfish and turtles each contain a gene highly related to the Oct-4 gene of the mouse and human Oct-4 genes, the equivalent gene is not found in their most closely related sister groups i.e. frogs, zebrafish etc.

The Oct-4 gene (Axoct-4) in the axolotl (the salamander species Ambystoma mexicanum) is more highly related to the mammalian Oct-4 gene than any other gene in the database, including several genes from Xenopus that are related to Oct-4, and can rescue ES cells, in some cases, such as XLPOU91 , better than the axolotl Oct-4 gene (Morrison and Brickman, 2006). (Figure 9 shows comparison of axolotl and mouse sequences). This result suggests that the Axoct-4 gene is a true ortholog (i.e. a gene related by ancestry and function) of the mammalian Oct-4 gene. This is also supported by the expression pattern (Bachvarova et al (2004) Developmental Dynamics 231 :871-880). The greater number of Xenopus genes result from duplications of an ancestral Oct-4 sequence, more similar to Axoct-4, and subsequent subfunctionalization of mechanism (Prince and Pickett, 2002; Nat Rev. Genet.: 3; 827-37). This result suggests that the axolotl oocytes are biochemically more similar to the oocytes of mammals than are the oocytes of Xenopus which do not contain a true Oct-4 ortholog.

In mammals, Oct-4 is required to produce PGCs. This is not the case in Xenopus, meaning that any Oct-4 equivalent genes are not a true orthologs of the mammal Oct-4. The expression pattern and homology of mechanism of Oct-4 in axolotl now suggest Oct-4 is required to produce PGCs. This observation may contribute to why axolotl oocytes have a greater capacity to reprogram mammalian differentiated cells to pluripotency than Xenopus cells, the axolotl oocytes behaving more like mammalian oocytes in reprogramming capacity. Also, since the absence of germ plasm also makes these oocyte/eggs more similar to mammals, this is likely to also be involved in the superior reprogramming capacity of axolotls compared to Xenopus. The absence of a germ plasm may allow other factors such as Nanos, vasa and dazl which are al! RNA binding proteins associated with germ plasm to be more accessible for reprogramming. Having demonstrated that axolotls, which have an Oct-4 gene more closely related to mammalian Oct-4 genes than the Oct-4 gene of frogs , it is understood that other organisms with an Oct-4 gene more closely related to the mammalian Oct-4 gene will also be able to reprogram mammalian differentiated cells. Also, the expression pattern of Axoct-4 is equivalent to that of early mammalian embryos. Thus sturgeon and lungfish, other salamanders, and the "primitive fish" will all have a reprogramming capacity equivalent to axolotl, and far greater than that of Xenopus, other frogs, or teleosts.

The group of organisms predicted on the basis of body plan to lack a conserved Oct-4 gene, including all frogs, all teleost fish, all birds and the majority of reptiles is far larger than the group that retain a primitive body plan and that retain a conserved Oct-4 gene (including urodele amphibians) and a gene encoding an ortholog of nanog. Therefore only the oocytes, ovaries, eggs and early embryos, or extracts thereof, of a very small number of species are suitable for use in the present invention.. The following lineages retain a conserved vertebrate body plan:

Salamanders (axolotl or notopthalamus)

Turtles

Lizards

Crocodilians

Hyperotreti (hagfish); Hyperoartia (lamprey);

Chondrichthyes (sharks, rays, skates, chimeras);

Chondrostei (bichirs, sturgeons, paddlefish);

Semionotiformes (gars);

Amiiformes (bowfins) Dipnoi (iungfish); and

Coelacanthimorpha (coelacanths).

Hence it is preferred that the cold blooded vertebrate is selected from the group comprising amphibians, reptiles and fish. Preferably the cold blooded vertebrate is selected from the group comprising salamanders, turtles, lizards, crocodilians, Hyperotreti (hagfish); Hyperoartia (lamprey); Chondrichthyes (sharks, rays, skates, chimeras); Chondrostei (bichirs, sturgeons, paddlefish etc); Semionotiformes (gars); Amiiformes (bowfins); Dipnoi (lungfish); and Coelacanthimorpha (coelacanths).

Most preferably the cold blooded vertebrate is selected from the group comprising salamanders, turtles, lungfish and sturgeon.

Conveniently the cold blooded vertebrate is a salamander, including axolotl and notopthalmus.

Alternatively to salamanders the cold blooded vertebrate is a sturgeon (Scientific genus: Acipenser).

In a second aspect of the invention there is provided a pharmaceutical composition comprising an isolated cell or cell extract as defined in the first aspect of the invention and a pharmaceutically acceptable carrier, excipient or diluent.

In a third aspect of the invention there is provided an isolated nucleic acid molecule encoding a nanog protein having the nucleic acid sequence of nanog derived from a cold blooded vertebrate, wherein the cold blooded vertebrate has one or more of the following properties:

(ii) germ cells which do not contain germ plasm; and/or

(iii) the oocyte, egg, ovary or early embryo cell or cell from which the cell extract is derived, expresses Oct-4 in a highly conserved form and/or nanog in a highly conserved form. .

In an alternative embodiment of the third aspect of the invention there is provided an isolated nanog protein having the amino acid sequence of nanog derived from a cold blooded vertebrate, wherein the cold blooded vertebrate has one or more of the following properties:

(ii) germ cells which do not contain germ plasm; and/or

Hence it is preferred that the cold blooded vertebrate is selected from the group comprising amphibians, reptiles and fish.

Preferably the cold blooded vertebrate is selected from the group comprising salamanders, turtles, lizards, crocodilians, Hyperotreti

(hagfish); Hyperoartia (lamprey); Chondrichthyes (sharks, rays, skates, chimeras); Chondrostei (bichirs, sturgeons, paddlefish etc);

Semionotiformes (gars); Amiiformes (bowfins); Dipnoi (lungfish); and

Coelacanthimorpha (coelacanths).

Conveniently the cold blooded vertebrate is a salamander, including axolotl and notopthalmus. Alternatively to salamanders the cold blooded vertebrate is a sturgeon (Scientific genus: Acipenser).

In one embodiment of the third aspect of the invention, the salamander is not an axolotl.

In a fourth aspect of the invention there is provided a pharmaceutical composition comprising an isolated nucleic acid or protein molecule as defined in the third aspect of the invention and a pharmaceutically acceptable carrier, excipient or diluent.

In a fifth aspect of the invention there is provided a method of producing a reprogrammed cell or reprogrammed cell nucleus comprising exposing a differentiated cell, or the nucleus of a differentiated cell to a cell or cell extract as defined in the first aspect of the invention.

In an alternative embodiment of the fifth aspect of the invention there is provided a method of producing a reprogrammed eel! or reprogrammed cell nucleus comprising exposing a differentiated cell, or the nucleus of a differentiated cell to either (a) an isolated nucleic acid molecule encoding a nanog protein having the nucleic acid sequence of nanog derived from a cold blooded vertebrate or (b) an isolated nanog protein having the amino acid sequence of nanog derived from a cold blooded vertebrate,

wherein the cold blooded vertebrate has one or more of the following properties:

A reprogrammed cell is a cell which has had its normal differentiated function removed or altered. A reprogrammed cell nucleus is a nucleus whose normal differentiated function has been removed or altered.

A differentiated cell is a cell which has developed into a particular cell type with a specified function e.g. a nerve cell, or muscle cell. These cells under normal circumstances cannot generally develop to other cell types. In the context of this invention a re-differentiated cell is a cell which has been of one particular cell type and has been manipulated using the methods of the invention to form a pluripotent eel! and subsequently converted into a differentiated cell again. The re-differentiated cell may be of the same type or a different type of cell as in its original differentiation.

Preferably the cold blooded vertebrate is selected from the group comprising salamanders, turtles, lizards, crocodilians, Hyperotreti (hagfish); Hyperoartia (lamprey); Chondrichthyes (sharks, rays, skates, chimeras); Chondrostei (bichirs, sturgeons, paddlefish etc); Semionotiformes (gars); Amiiformes (bowfins); Dipnoi (iungfish); and Coelacanthimorpha (coelacanths).

Most preferably the cold blooded vertebrate is selected from the group comprising salamanders, turtles, Iungfish and sturgeon.

Conveniently the cold blooded vertebrate is a salamander, including axolotl and notopthalmus. Alternatively to salamanders the cold blooded vertebrate is a sturgeon Scientific genus: Acipenser).

Preferably, the reprogrammed cell is an embryonic stem cell-like cell.

The term "embryonic stem cell-like cell" is used herein to refer to a differentiated cell that has been reprogrammed to exhibit a property of an embryonic stem cell, or a cell containing a reprogrammed differentiated nucleus which exhibits a property of an embryonic stem cell. An embryonic stem cell-like cell may include one or more of, but not limited to, the following properties: proliferation without transformation; continuous proliferation; self renewal and capacity to generate a wide range of tissues; the ability to differentiate into either the same or a different cell type than the original differentiated cell (pluripotency); when compared with these same parameters in the cell prior to being de-differentiated or reprogrammed.

Preferably, the reprogrammed cell, and/or the reprogrammed cell nucleus, expresses Oct-4. Alternatively the reprogrammed cell, or the reprogrammed cell nucleus, expresses only nanog. The reprogrammed cell, or the reprogrammed cell nucleus may also be pluripotent.

Conveniently the reprogrammed cell, and/or the reprogrammed cell nucleus produced according to any method of the invention may express both Oct-4 and nanog and/or other markers of pluripotency. Other markers of pluripotency include Sox-2, Rex-1 , and TERT.

Whether a cell is pluripotent can be identified by the presence of pluripotent properties, that is that the cell can be stimulated to differentiate into almost any cell type in the organism from which it is derived. Differentiation of pluripotent cells can be induced by exposure of the pluripotent cell to a progenitor medium and/or certain growth factors Lanza, 2004. Handbook of Stem Cells: Embryonic/Adult and Foetal Stem Cells. Preferably the Oct-4 and/or the nanog in the cold-blooded vertebrate oocyte, egg, ovary or early embryo cell or cell extract discussed above are highly conserved in comparison to the human form, by this we mean the Oct-4 in the cold-blooded vertebrate has at least 69% amino acid identity in the DNA binding domain with the human transcription factor Oct-4. Preferably with the nanog gene this would be at least 69% and most preferably 75% identity with the homeo domain shared with the human nanog protein,

Advantageously the Oct-4 and/or the nanog in the cold blooded vertebrate oocyte, egg, ovary or early embryo cells has at least 69% amino acid identity with the DNA binding domains (DBD) of the human transcription factor Oct-4 or the human nanog protein, respectively.

Amino acid identity can be measured using CiustalW (Thompson et al. (1994) Nucl. Acids. Res., 22 p4673-4680, or any alternative amino acid sequence comparison tool. The clustalW method can be used with the following parameters: Pairwise alignment parameters - methodiaccurate Matrix: PAM, Gap open penalty 10.00, Gap extension penalty: 0.10;

Multiple alignment parameters - Matrix: PAM, Gap open penalty: 10.00, % identity for delay: 30; Penalize end gaps: on. Gap separation distance 0, Negative matrix: no, Gap extension penalty: 0.20, Residue -specific gap penalties: on, Hydrophilic gap penalties: on, Hydrophilic residues: GPSNDQEKR. Sequence identity at a particular residue is intended to include identical residues which have simply been derivatized.

Alternative parameters may also be suitable.

Nucleotide sequence identity can also be measured using ClustalW (Thompson et al (1994)) using the following parameters:

Pairwise alignment parameters - Method: accurate, Matrix: IUB, Gap open penalty: 15.00, Gap extension penalty: 6.66; Multiple alignment parameters - Matrix: IUB, Gap open penalty: 15.00, % identity for delay: 30, Negative matrix: no, Gap extension penalty: 6.66, DNA transitions weighting: 0.5.

Alternative parameters may also be suitable.

Preferably, any nucleotide sequence encoding a conserved Oct-4 and/or nanog has more than 69% e.g. 75%, 80%, 90% or 95% identity to the human Oct-4 and/or nanog sequences (according to the test described above) or a sequence which hybridizes to human Oct-4 and/or nanog sequences under wash conditions of 0.1 x SSC, 65°C (wherein SCC = 0.15 M NaCI, 0.015M sodium citrate, pH 7.2) which encodes a functionally equivalent protein to human Oct-4 and/or nanog.

Preferably the cell or cell extract thereof comprises material from the nucleus or germinal vesicle (GV) of the oocyte, egg, or early embryo cell.

The nucleus and GV contain specific transcription factors Oct-4 and Nanog.

The RNA encoding germ cell specific RNA binding proteins that are located in the germ plasm in frogs and teleosts Dazl, VASA, and Nanos are distributed uniformly in the cytoplasm (Johnson et al., 2001 , 243:402- 415; Dev,. Biol.; Bachvarova et al., Dev. Dyn. 231 , 871 -880) and are capable of maintaining piuripotency or germ cell specification in germ cells with germ plasm but are not capable of reprogramming cells.

Exposure of the differentiated cell with the cell or cell extract of the first aspect of the invention, may be achieved by injecting a permeabilised differentiated cell into the cell, or incubating a permeabilised differentiated cell with an extract thereof.

Preferably the permeabilised differentiated cell allows factors in the cell or cell extract thereof, to pass into the cell and reprogram it, preferably mitochondria or the nucleus from the oocyte, egg, ovary cell or embryo cell cannot pass into the permeabilised cell and thus there is no exchange of genetic material. Permeabilisation of the differentiated cell can be achieved by any method well known in the art such as treating the cell with Triton-X-100, digitonin, saponin or streptolysin O.

Preferably, after contact with the cell or cell extract thereof, of a cold blooded vertebrate according to the invention the reprogrammed cells are recovered by centrifugation onto a microscope slide or culture dish, using techniques well known in the art.

Preferably, in any method of the invention for reprogramming a differentiated cell nucleus, a differentiated cell nucleus may be contacted with an cell, by using well known nuclear transfer techniques which will be readily apparent to the skilled man (see refs discussed above). Such techniques include injection of the differentiated nucleus into an enucleated cell of the invention; or fusion of a differentiated cell with an enucleated cell of the invention.

Cell based work has the advantage that the reprogrammed cell is entirely contained within the cell of the first aspect of the invention.

Alternatively, the differentiated cell nucleus may be incubated with an extract of the cell of the first aspect of the invention.

Use of an extract has the advantage that it avoids the manipulation necessary to inject a differentiated cell or nuclei into an intact cell in order for factors in the cell to act on the differentiated eel! or nuclei and cause its reprogramming. Using extracts also makes it easy to retrieve the material and allows thousands to millions of cells or nuclei to be reprogrammed at once.

Preferably an extract of whole ovary is used. By using whole ovary extract there is no need to separate the cell components. Alternatively, the raw material for the extract may be oocytes liberated from ovarian stroma by conventional techniques, for example 0.2% collagenase digestion. A differentiated cell refers to a cell that has achieved a mature state of differentiation. Typically a differentiated cell is characterised by the expression of genes that encode differentiation-associated proteins in a given cell. For example, the expression of myelin proteins and the formation of myelin sheath in glial cells is a typical example of terminally differentiated glial cells. Differentiated cells are either unable to differentiate further or can only differentiate into specific cells in a particular cell lineage.

Preferably, the differentiated cell used in any method of the invention is a eukaryotic cell. Preferably the differentiated cell is obtained from a mammal. Most preferably the cell is human.

Preferably the differentiated cell to be reprogrammed is a healthy cell.

Alternatively the differentiated cell to be reprogrammed is derived from an individual with a genetic disease. Preferably the genetic disease is an inherited genetic disease, an epigenetic disease, a degenerative disease or metabolic disease.

Preferably, in any method of the invention, the differentiated cell or nuclei thereof is exposed to the cell or cell extract thereof of the first aspect of the invention, at a temperature between about 5°C and about 30⁰C, more preferably between about 5°C and about 21°C. More preferably the differentiated cells or nuclei are contacted with the cell or cell extract thereof of the invention, at a temperature consistent with the body temperature of the organism from which the cell or cell extract thereof, is derived. As the skilled person will appreciate, if the cell is derived from a cold blooded animal, these species don't have a body temperature of their own per se, their bodies are instead at the temperature of their environment. More preferably the contact temperature is about 18°C, or that of the environment in which the cold blooded vertebrate normally resides. Preferably, a reprogrammed cell nucleus according to the invention expresses genes which are markers of pluripotency. Preferably the pluripotency marker genes include the gene encoding Oct-4 and nanog. The Oct-4 gene may be used as a marker if demethylation of the Oct-4 promoter occurs.

In a sixth aspect of the invention there is a reprogrammed cell produced according to the method of the fifth aspect of the invention.

Preferably the reprogrammed cell is an embryonic stem cell-like cell.

In a seventh aspect of the invention there is provided a reprogrammed cell nucleus produced according to the method of the fifth aspect of invention.

Preferably, the reprogrammed ceil nucleus may be subsequently used in standard known somatic cell nuclear transfer (SCNT) techniques. The efficiency of the SCNT techniques are enhanced by first reprogramming the differentiated cell nucleus according to the invention.

In an eighth aspect of the invention there is provided a method of producing a re-differentiated cell comprising:

(a) producing a reprogrammed cell as described in the fifth aspect of the invention; and

(b) re-differentiating the reprogrammed cell into a differentiated cell of the same type, or a different type, to the differentiated cell from which it is derived.

Preferably, the re-differentiation is effected using a progenitor medium. Once generated, the reprogrammed differentiated cell can be cultured in the presence of particular growth factors and other signalling molecules (progenitor medium) that induce their differentiation into particular cells types. Different progenitor media are required to produce different cell types. The method of the invention allows pluripotent reprogrammed cells to be obtained from differentiated cells of an individual, these reprogrammed cells can then be differentiated into a cell type required to treat that patient.

In a ninth aspect of the invention there is provided a re-differentiated cell produced according to the method of the eighth aspect of the invention.

In a tenth aspect of the invention there is provided a pharmaceutical composition comprising a reprogrammed cell as defined in the sixth aspect of the invention and/or a reprogrammed cell nucleus as defined in the seventh aspect of the invention or a re-differentiated cell as defined in the ninth aspect of the invention, and a pharmaceutically acceptable carrier, excipient or diluent.

In an eleventh aspect of the invention there is provided a method of treating a disease requiring the replacement or renewal of cells comprising administering to an animal an effective amount of isolated cell or cell extract as defined in the first aspect of the invention and/or an isolated nucleic acid or protein molecule as defined in the third aspect of the invention and/or an effective amount of reprogrammed cells as defined in the sixth aspect of the invention and/or a reprogrammed cell nucleus as defined in the seventh aspect of the invention and/or an effective amount of re-differentiated cells produced by the method of the ninth aspect of the invention.

In a twelfth aspect of the invention there is provided an isolated cell or cell extract as defined in the first aspect of the invention and/or an isolated nucleic acid or protein molecule as defined in the third aspect of the invention and/or the reprogrammed cells as defined in the sixth aspect of the invention and/or a reprogrammed cell nucleus as defined in the seventh aspect of the invention or a re-differentiated cell as defined in the ninth aspect of the invention for use as a medicament. In a thirteenth aspect of the invention there is provided a use of the isolated cell or cell extract as defined in the first aspect of the invention and/or an isolated nucleic acid or protein molecule as defined in the third aspect of the invention and/or the reprogrammed cells as defined in the sixth aspect of the invention and/or a reprogrammed cell nucleus as defined in the seventh aspect of the invention or a re-differentiated cell as defined in the ninth aspect of the invention in the manufacture of a medicament for the treatment of a disease requiring the replacement or the renewal of cells.

Different cell/tissue types are needed for subsequent use in different medical conditions.

For example, haematopoietic stem cells could be used to treat individuals suffering from leukaemia. Neural progenitor cells could be used to treat individuals suffering from neurodegenerative disorders, such as Alzheimer's or Parkinson's disease. Skin cells could be used for grafts in cases where an individual has suffered severe bums or scarring.

The use of stem cells for the generation of organs and tissues for transplantation provides a promising alternative therapy for bone marrow transplantation (e.g. following cancer therapies or in leukaemia), diabetes (pancreatic beta and alpha cells), liver disease (liver cells), heart disease (cardiac muscle cells), bone/joint replacements (bone and joint cartilage osteocytes and chondrocytes), tooth regeneration (tooth progenitor cells), macular degeneration and retinal detachment (retinal cells) and autoimmune disorders to name just a few. The main problems associated with transplantation are the lack of donors and the potential incompatibility of the transplanted tissue with the immune system of the recipient.

That is, the immunorejection of the transplanted tissue as the recipient views the transplant as foreign. Using the method of the invention embryonic stem cell-like cells can be derived from a patient in need of a transplant and then used to a produce tissue or an organ for transplantation into the same patient. This removes any problems of tissue incompatibility and immunorejection. Thus there is great therapeutic potential in being able to generate pluripotent embryonic stem cell-like cells, in particular where they are genetically identical to those of the patient.

Preferably the disease of the eleventh twelfth and thirteenth is selected from the group comprising neurological disease (Parkinson's disease, Alzheimer's disease, spinal cord injury, stroke), skin alternation, burns, heart disease, diabetes, osteoarthritis, diseases requiring organ and tissue transplantation, infertility and rheumatoid arthritis.

Conveniently the disease is a neurological disease.

Advantageously the neurological disease is selected from the group comprising Parkinson's disease, Alzheimer's disease, spinal cord injury, stroke.

In a fourteenth aspect of the invention there is provided a kit for reprogramming a differentiated cell, or for reprogramming the nucleus of a differentiated cell, comprising an isolated cell or cell extract as defined in the first aspect of the invention and/or an isolated nucleic acid or protein molecule as defined in the third aspect of the invention;

and instructions to use the ceil or cell extract thereof.

Preferably the kit further comprises one or more differentiated cells to be reprogrammed.

Advantageously the kit also comprises a progenitor medium to effect the further step of re-differentiation of the reprogrammed cell.

In a fifteenth aspect of the invention there is provided a use of the isolated cell or cell extract as defined in the first aspect of the invention and/or an isolated nucleic acid or protein molecule as defined in the third aspect of the invention and/or the reprogrammed cells as defined in the sixth aspect of the invention and/or a reprogrammed eel! nucleus as defined in the seventh aspect of the invention or a re-differentiated cell as defined in the ninth aspect of the invention in the identification of agents effective in treating and/or preventing and/or diagnosing disease.

Preferably the disease is a genetic disease. Advantageously the disease is an inherited genetic disease.

Examples of diseases include neurological disease (Parkinson's disease, Alzheimer's disease, spinal cord injury, stroke), skin alternation, burns, heart disease, diabetes, osteoarthritis, rheumatoid arthritis, infertility, cystic fibrosis and huntingtons disease.

In a sixtennth aspect of the invention, all of the previous aspects of the invention, can also be conducted whereby Oct-4 proteins and/or encoding nucleic acid molecules are directly substituted for the Nanog proteins and/or encoding nucleic acid molecules described above. The Examples have demonstrated that supplementing cells or cell extracts with Oct-4 also demonstrate improved pluripotency induction over that of the cell or cell extract without Oct-4 supplementation

Preferred Embodiments

Examples embodying certain preferred aspects of the invention will now be described with reference to the following figures in which: -

Figure 1. Schematic diagram showing procedure used to test axolotl molecules in Xenopus laevis oocytes.

Figure 2. Western blot showing HA tagged Ax-Oct-4 and Ax-Nanog after injection into Xenopus laevis oocytes. Xenopus nuclei were run on 12% SDS-PAGE and probed with anti HA antibody. Coomasie stained gel is shown as loading control. Figure 3. Nanog reactivation in mouse embryonic fibroblasts injected into Xenopus laevis oocytes containing Ax-Nanog and Ax-O ct-4.

Figure 4. Reactivation of nanog in MEFs injected into Xenopus iaevis oocytes is dose dependent. Xenopus laevis oocytes were injected with increasing amounts of Ax-Nanog RNA prior to the injection of MEFs.

Figure 5. Reactivation of other pluripotency genes in MEFs injected into Xenopus laevis oocytes supplemented with Ax-Nanog and Ax-Oct-4. Sox-2 and Rex-1 were reactivated in oocytes injected with Oct-4 and Nanog.

Figure 6. Purified Axnanog Protein Potentiates Nanog Expression in Reprogramming Extracts. Top panel (A) Varying amounts of purified Axnanog protein was added directly to 3T3 cells under normal reprogramming conditions. PCR was performed on extracted RNA. Maximal expression of Nanog was observed at 50ug/ml of protein. Oct-4 was not expressed under these conditions. Nanog is not expressed in the absence of added Axnanog protein. Bottom panel (B). Lane 1. Permeabilized Cells in media; Lane 2, Media plus 50ug/ml axnanog; Lane 3, axolotl oocyte extract alone; Lane 4, axolotl oocyte extract plus 50ug/ml Axnanog; Lane 5 RNa from Mouse ES cells; Lane 6, Negative control for PCR.

Figure 7. depicts a comparison of skeletons representing evolutionarily conserved primitive and derived adult body plans in fish and amphibians. A. Lungfish skeleton shown from dorsal view. B. Teleost fish shown from a side view. C. Salamander (axolotl) skeleton showed from dorsal view. D. Frog (Xenopus) skeleton showed from dorsal view. Small arrows show ribs. Large arrows point to pelvic bones;

Figure 8 shows a phylogenetic analysis of class V POU domain transcription factors (Oct-4 like genes). Genes were isolated from the ovaries of the species and compared by parsimony to determine the most closely related sequences. Groups within the same cluster are the most closely related; and Figure 9. Amino acid aiignment of mouse and axolotl Oct-4 using Ciustal- W.

Figure 10. Amino acid alignment of nanog from mouse, rat, human, cow, dog, opossum, chick and axolot! using Clustal-W.

Figure 11. shows examples of the distribution of germ cell specific RNAs in the cytoplasm of cold blooded vertebrates as indictors of the presence or absence of germ plasm.

Example 1 - Addition of nanog mRNA to non-nanog containing Xenopuε oocytes

Experimental Design.

Xenopus laevis (hereinafter Xenopus) oocytes were manually defolliculated using watchmakers forceps. Oocytes were cultured in standard amphibian saline containing 10ug/ml of Kanamycin, and 0.001 % Fungizone (Invitrogen). Synthetic mRNAs were produced using Message Machine (Ambion).

Oocytes were microinjected with 2ng of synthetic RNA encoding Axnanog- HA, or 2ng of synthetic RNA encoding Axoct-4-HA, or 1 ng of both synthetic RNAs. Oocytes were cultured overnight at 17-18 ⁰C to allow translation of the injected mRNA.

The next day clusters of permeabilized test cells for reprogramming (see below for details of cells and permeabilisation procedure) were injected into the germinal vesicle (GV) of the oocytes.

Oocytes were cultured either overnight, or for two days, at which time the GV was dissected from the oocytes and examined further using Western blotting and PCR based gene expression analysis (See below). Figure 1 shows a schematic diagram of the procedure

Test Cells and permeabiiization procedure

The test cells for reprogramming by the modified Xenopus oocytes were mouse embryonic fibroblasts prepared from 13.5 dpi SW2 outbred mice ( obtained e.g. from Charles River labs).

Internal organs, limbs and genital ridges were carefully removed prior to mincing and gentle trypsin digestion (0.25% trypsin/EDTA) for 5 min. at 37°C to provide test cells. The test cells were expanded for 2-3 passages before use in the experiments. Freshney, 2000. Culture of Mammalian cells: A manual of basic technique. Ed: Wiley-Liss.

Human BJ fibroblasts (human foreskin derived) were obtained from ATCC (CRL-2522) and expanded as indicated by the supplier.

Mouse and Human cells were permeabilized with 20 ug/ml digitonin in permeabiiization buffer (PB) (170 mM Potassium Gluconate, 5 mM KCI, 2 mM MgCI₂, 1 mM KH₂PO₄, 1 mM EGTA, 20 mM Hepes, supplemented with leupeptin 3 μg/ml, aprotinin 1 μg/ml and pepεtatin A 1 μg/ml freshly prior to use) for 2 min. on ice before injection into the oocytes.

Permeabiiization rate was assessed using a propidium iodide and 70 kD FlTC dextran as described in Alberio et al., 2005 Exp. Cell Res. 307, 131 - 141 (2005). .

Permeabilized cells were resuspended in PB supplemented with 0.1 % BSA and maintained on ice during injections.

Western Blotting

10 GV/group were lysed in Laemmli lysis buffer (62.5 mM Tris-HCI, pH 6.8, 2% SDS, 25% glycerol, 0.01 % bromophenol blue) and separated on a 10% sodium dodecyl sulphate-10% polyacrylamide gel. One GV equivalent (1/10 of the lysate obtained) was loaded per lane.

Proteins were transferred onto a PVDF membrane and probed with a rat polyclonal anti-HA (hemaglutinin) antibody (1 :1000 dilution) and incubated overnight at 4°C.

A peroxidase conjugated anti-rat secondary antibody (1 :10000 dilution) was incubated for 1 h at room temperature. ECL plus kit (Amersham Biosciences) was used to detect chemiluminescence. Figure 2 shows the presence of Ax-Oct-4-HA and/or AxNanog-HA in the cells in which they were microinjected. Neither Ax-Oct-4 or AxNanog were found in cells that they were no injected into.

Gene expression analysis

isolated GVs were collected and processed for RNA extraction using Qiagen RNAeasy mini kit with DNAse treatment. Qiagen Sensi- or Omniscript reverse transcriptase kits were used for cDNA synthesis. cDNA made in 20 ul was diluted 2.5 times before using for PCR.

PCR reactions were carried out in the linear range as determined by serial dilutions. Amplicon fragments were compared with ES cells cDNA for size reference in each PCR. Nanog and Oct-4 ampϋcons were sequenced for confirmation.

Mouse Primers used:

Oct-4 forward: 5'-gtttgccaagctgctgaagc, reverse: 5'-caccagggtctccgatttgc,

Nanog: forward: 5'-atgaagtgcaagcggcagaaa, reverse: 5'-cctggtggagtcacagagtagttc; β-actin: forward: δ'-ttctttgcagctccttcgtt, reverse: 5^!-cttttcacggttggccttag;

SOX-2: forward: 5^!-gtggaaacttttgtccgagac, reverse: 5'-tggagtgggaggaagaggtaac; REX-1 : forward: 5'- ggccagtccagaataccaga;

Reverse: 5'-gaactcgcttccagaacctg.

Figure 3 shows the expression of mouse Nanog, mouse Oct-4 and Mouse actin in germinal vesicles isolated from test cells. Neither mouse Nanog nor Oct-4 are expressed in control cells. Mouse nanog (but not Oct-4) is expressed after exposure to oocytes microinjected with axolotl nanog, therefore showing xenopus cells supplemented with axolotl nanog reactivate the mouse nanog gene expresion. Axolotl Oct-4 has no effect on mouse nanog or oct-4 expression.

Figure 4 shows that the reactivation of mouse nanog gene expression is dose dependent on the amount of axolotl nanog added to Xenopus oocytes.

These two experiments (figure 4 and 5) demonstrate the specificity of Axnanog-HA, demonstrating that the effect we see is not due to nonspecific binding of the protein to the mammalian nanog gene's promoter.

Figure 5 shows that axolotl derived nanog and oct-4 affect the reactivation of other known pluripotency genes - in this case Sox-2 and Rex-1 . This demonstrates that AxOct-4 is more efficient for reprogramming than the related Xenopus gene, called XLPOU60, which is naturally expressed in Xenopus oocytes. This demonstrates that axolotl oocytes have superior capacity to reprogram pluripotency in mammalian cells, when compared to Xenopus.

Example 2 - Supplementation of amphibian extract using purified Nanog

Preparation of purified Axolotl Nanog

Recombinant AxNanog (Axolotl Nanog) protein was prepared by subcloning the AxNanog cDNA into the pGex-6P1 vector (Amersham) and overexpression and purification using GST-sepharose. GST protein was cleaved from the recombinant protein by using the PreScission protease system (Amersham). Protein was stored in 10% glycerol at -20'C.

Isolation of Axolotf ovary/oocyte extract

Axolotl ovaries were washed in ice cold extraction buffer and were lysed by using a Dounce homogeneizer, applying 5-10 strokes on ice.

The resulting lysate was packed into 10-ml centrifuge tubes and excess buffer was removed before centrifugation at 10,000 g for 10 min at 4⁰C. The cytoplasmic layer was removed and supplemented with 50 μg ml-1 cytochalasin B before centrifugation at 100,000 g for 30 min at 4⁰C. The cleared cytoplasm was supplemented with 10% glycerol and snap frozen in liquid nitrogen in 100-200 μl aliquots.

Reprogramming Protocol

Mouse Embryonic Fibroblasts (MEFs) or NIH3t3 cells were trypsinised, counted using haemocytorneter, and cells resuspended at a concentration of 2x10⁶ cells/ml in permeabilisation buffer (PB) supplemented with 20μg/mi digitonin, termed PBD. Instantly after resuspension cells were incubated for 80 seconds with continuous mixing on ice swirl.

Cells were then directly added to a large volume (1 OmIs) of PB to halt permeabiiisation. Cells were then recounted and trypan blue vital dye used to estimate efficiency of permeabilisation.

Cells were then pelleted and either transferred to axolotl oocyte extract at a concentration of 5,000 cells/ul extract supplemented with 50ng/ul recombinant AxNanog protein or alternatively exposed to varying amounts (0, 5, 10, 15, 25 or 50 pg/μl, 20,000 cells /μl) of recombinant axoltl nanog (in the absence of axolotl oocyte extract). Also Creatine Phosphokinase (CPK) and Phosphatidylcholine (PC) were added (both 5μl/100μl extract).

Cells were then incubated for 6 hours at 15⁰C. PCR Protocol for Gene Expression in Reprogrammed Cells

Total RNA was extracted from cells using the RNAeasy total RNA purificatiuon system (Qiagen). This was DNAse I treated (Amersham).

40ng of RNA was reverse-transcribed using the Superscript III system and random hexamers in a total volume of 4OuI. 0.5ul of this was used per reaction for RT-PCR analysis. PCRs were set-up in 2OuI volumes using

RedTaq (Sigma). Reactions conditions were: 94'C-5mins, then cycles of 94'C-I min, 56'C-I min, 72^JC-1 min10secs, and final extension 72'C-5mins.

Primers and cycle numbers were as follows:

Oct-4 forward: 5'-gtttgccaagctgctgaagc, reverse: 5'-caccagggtctccgatttgc, 38 cycles Nanog: forward: δ'-atgaagtgcaagcggcagaaa, reverse: 5'-cctggtggagtcacagagtagttc; 38 cycles β-acfcin: forward: δ'-ttctttgcagctccttcgtt, reverse: 5'-cttttcacggttggccttag; 32 cycles

Figure 6 illustrates that the reactivation of mouse nanog gene expression is dose dependent on the amount of axolotl nanog added to axolotl oocyte extract.

Figure 6A shows the results of varying amounts of purified Axήanog protein being added directly to 3T3 cells without axolotl oocyte extract presence. Maximal expression of mouse Nanog was observed at 50ug/ml of protein. Oct-4 was not expressed under these conditions. Nanog is not expressed in the absence of added Axnanog protein. Bottom panel (B). Lane 1. Permeabili∑ed CeNs in media; Lane 2, Media plus 50ug/ml axnanog; Lane 3, axolotl oocyte extract alone; Lane 4, axolotl oocyte extract plus 50ug/m! Axnanog; Lane 5 RNa from Mouse. ES cells; Lane 6, Negative control for PCR. Increased mouse nanog expression when extract is supplemented with 50μg/μl axolotl nanog demonstrates that axolotl nanog enhances the pluripotency inducing effects of the axolotl oocyte extract.

Example 3 - Kit for reprogramming

The compositions, cells and cell extracts of the inventions can be provided in the form of a kit for use in the method of the invention. These kits preferably contain the cell/cell extract reagent, and at least one of the following:

Instructions for use; progenitor medium for re-differentiation of the reprogrammed cells; disposable equipment for conducting the re- programming e.g. multi-well plates, dispensers such as pre-loaded pipettes; differentiated cells to be reprogrammed and permeabilization Buffer.

The kits may be customised according to the re-differentiated cell type is required in that the progenitor medium and the instructions may vary according to the cell type and end use.

Example 4 - Pharmaceutical formulations and administration.

A further aspect of the invention provides a pharmaceutical formulation comprising a compound according to the first aspect of the invention in admixture with a pharmaceutically or veterinarily acceptable adjuvant, diluent or carrier.

Preferably, the formulation is a unit dosage containing a daily dose or unit, daily sub-dose or an appropriate fraction thereof, of the active ingredient.

The compounds of the invention will normally be administered orally or by any parenteral route, in the form of a pharmaceutical formulation comprising the active ingredient, optionally in the form of a non-toxic organic, or inorganic, acid, or base, addition salt, in a pharmaceutically acceptable dosage form. Depending upon the disorder and patient to be treated, as well as the route of administration, the compositions may be administered at varying doses.

In human therapy, the compounds of the invention can be administered alone but will generally be administered in admixture with a suitable pharmaceutical excipient diluent or carrier selected with regard to the intended route of administration and standard pharmaceutical practice.

For example, the compounds of the invention can be administered orally, buccally or sublingually in the form of tablets, capsules, ovules, elixirs, solutions or suspensions, which may contain flavouring or colouring agents, for immediate-, delayed- or controlled-release applications. The compounds of invention may also be administered via intracavernosal injection.

Such tablets may contain excipients such as microcrystalline cellulose, lactose, sodium citrate, calcium carbonate, dibasic calcium phosphate and glycine, disintegrants such as starch (preferably corn, potato or tapioca starch), sodium starch glycollate, croscarmellose sodium and certain complex silicates, and granulation binders such as polyvinylpyrrolidone, hydroxypropylmethylcellulose (HPMC), hydroxy-propylcellulose (HPC), sucrose, gelatin and acacia. Additionally, lubricating agents such as magnesium stearate, stearic acid, glyceryl behenate and talc may be included.

Solid compositions of a similar type may also be employed as fillers in gelatin capsules. Preferred excipients in this regard include lactose, starch, a cellulose, milk sugar or high molecular weight polyethylene glycols. For aqueous suspensions and/or elixirs, the compounds of the invention may be combined with various sweetening or flavouring agents, colouring matter or dyes, with emulsifying and/or suspending agents and with diluents such as water, ethanol, propylene glycol and glycerin, and combinations thereof. The compounds of the invention can also be administered parenterally, for example, intravenously, intra-arterially, intraperitoneal^, intrathecally, intraventricular^, intrastemally, intracranially, intra-muscularly or subcutaneously, or they may be administered by infusion techniques. They are best used in the form of a sterile aqueous solution which may contain other substances, for example, enough salts or glucose to make the solution isotonic with blood. The aqueous solutions should be suitably buffered (preferably to a pH of from 3 to 9), if necessary. The preparation of suitable parenteral formulations under sterile conditions is readily accomplished by standard pharmaceutical techniques well-known to those skilled in the art.

Formulations suitable for parenteral administration include aqueous and non-aqueous sterile injection solutions which may contain anti-oxidants, buffers, bacteriostats and solutes which render the formulation isotonic with the blood of the intended recipient; and aqueous and non-aqueous sterile suspensions which may include suspending agents and thickening agents. The formulations may be presented in unit-dose or multi-dose containers, for example sealed ampoules and vials, and may be stored in a freeze-dried (lyophilised) condition requiring only the addition of the sterile liquid carrier, for example water for injections, immediately prior to use. Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules and tablets of the kind previously described.

For oral and parenteral administration to human patients, the daily dosage level of the compounds of the invention will usually be from 1 mg/kg to 30 mg/kg. Thus, for example, the tablets or capsules of the compound of the invention may contain a dose of active compound for administration singly or two or more at a time, as appropriate. The physician in any event will determine the actual dosage which will be most suitable for any individual patient and it will vary with the age, weight and response of the particular patient. The above dosages are exemplary of the average case. There can, of course, be individual instances where higher or lower dosage ranges are merited and such are within the scope of this invention. The compounds of the invention can also be administered intranasal!;/ or by inhalation and are conveniently delivered in the form of a dry powder inhaler or an aerosol spray presentation from a pressurised container, pump, spray or nebuliser with the use of a suitable propellant, e.g. dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoro- ethane, a hydrofluoroalkane such as 1 ,1 ,1 ,2-tetrafluoroethane (HFA 134A3 or 1 ,1 ,1 , 2,3, 3,3-heptafluoropropane (HFA 227EA3), carbon dioxide or other suitable gas. In the case of a pressurised aerosol, the dosage unit may be determined by providing a valve to deliver a metered amount. The pressurised container, pump, spray or nebuliser may contain a solution or suspension of the active compound, e.g. using a mixture of ethanol and the propellant as the solvent, which may additionally contain a lubricant, e.g. sorbitan trioleate. Capsules and cartridges (made, for example, from gelatin) for use in an inhaler or insufflator may be formulated to contain a powder mix of a compound of the invention and a suitable powder base such as lactose or starch.

Aerosol or dry powder formuiations are preferably arranged so that each metered dose or "puff" delivers an appropriate dose of a compound of the invention for delivery to the patient. It will be appreciated that he overall daily dose with an aerosol will vary from patient to patient, and may be administered in a single dose or, more usually, in divided doses throughout the day.

Alternatively, the compounds of the invention can be administered in the form of a suppository or pessary, or they may be applied topically in the form of a lotion, solution, cream, ointment or dusting powder. The compounds of the invention may also be transdermaily administered, for example, by the use of a skin patch. They may also be administered by the ocular route, particularly for treating diseases of the eye.

For ophthalmic use, the compounds of the invention can be formulated as micronised suspensions in isotonic, pH adjusted, sterile saline, or, preferably, as solutions in isotonic, pH adjusted, sterile saline, optionally in combination with a preservative such as a benzylalkonium chloride. Alternatively, they may be formulated in an ointment such as petrolatum.

For application topically to the skin, the compounds of the invention can be formulated as a suitable ointment containing the active compound suspended or dissolved in, for example, a mixture with one or more of the following: mineral oil, liquid petrolatum, white petrolatum, propylene glycol, polyoxyethylene polyoxypropylene compound, emulsifying wax and water. Alternatively, they can be formulated as a suitable lotion or cream, suspended or dissolved in, for example, a mixture of one or more of the following: mineral oil, sorbitan monostearate, a polyethylene glycol, liquid paraffin, polysorbate 60, cetyl esters wax, cetearyl alcohol, 2- octyldodecanol, benzyl alcohol and water.

Formulations suitable for topical administration in the mouth include lozenges comprising the active ingredient in a flavoured basis, usually sucrose and acacia or tragacanth; pastilles comprising the active ingredient in an inert basis such as gelatin and glycerin, or sucrose and acacia; and mouth-washes comprising the active ingredient in a suitable liquid carrier.

Generally, in humans, oral or topical administration of the compounds of the invention is the preferred route, being the most convenient. In circumstances where the recipient suffers from a swallowing disorder or from impairment of drug absorption after oral administration, the drug may be administered parenterally, e.g. sublingually or buccally.

For veterinary use, a compound of the invention is administered as a suitably acceptable formulation in accordance with normal veterinary practice and the veterinary surgeon will determine the dosing regimen and route of administration which will be most appropriate for a particular animal.

Claims

1 . An isolated animal cell or cell extract thereof comprising an exogenous nucleic acid molecule expressible therein encoding a nanog protein or functionally equivalent fragment thereof.

2. An isolated cell or cell extract thereof as claimed in claim 1 wherein the nucleic acid molecule encoding nanog protein is identical to an endogenous nucleic acid molecule of the cell that encodes nanog protein.

3. An isolated cell or cell extract thereof as claimed in claim 1 wherein the nucleic acid molecule encoding nanog protein is not identical to an endogenous nucleic acid molecule of the cell that encodes nanog protein.

4. An isolated animal cell or cell extract thereof comprising an exogenous nanog protein or functionally equivalent thereof.

5. An isolated cell or cell extract thereof as claimed in claim 4 wherein the exogenous nanog protein is identical to an endogenous nanog protein of the cell.

6. An isolated cell or cell extract thereof as claimed in claim 4 wherein the exogenous nanog protein is not identical to an endogenous nanog protein of the cell.

7. An isolated cell or cell extract thereof as claimed in any previous claim wherein the cell did not contain nanog protein before introduction of the exogenous nucleic acid molecule encoding nanog protein or the exogenous nanog protein.

8. An isolated cell or cell extract thereof as claimed in claim 7 wherein the cell does not contain an endogenous nucleic acid molecule encoding nanog protein.

9. An isolated cell or cell extract thereof as claimed in any previous claim wherein the cell type is one selected from the following: early embryo, ovary, oocyte and egg cells.

10. An isolated cell or cell extract thereof as claimed in any previous claim wherein the cell is derived from a cold blooded vertebrate including frogs (such as Xenopuε), reptiles and teleosts.

1 1. An isolated cell or cell extract thereof as claimed in any of claims 1 to 7 or 9 wherein the cell is derived from a cold blooded vertebrate, wherein the cold blooded vertebrate has one or more of the following properties:

(ii) germ cells which do not contain germ plasm; and/or

12. An isolated cell or cell extract thereof as claimed in any previous claim wherein the exogenous nucleic acid molecule and/or exogenous nanog protein have the nucleic acid or amino acid sequence of nanog derived from a cold blooded vertebrate, wherein the cold blooded vertebrate has one or more of the following properties:

(ii) germ cells which do not contain germ plasm; and/or

13. An isolated cell or cell extract thereof as claimed in claim 1 1 or 12 wherein the cold blooded vertebrate is selected from the group comprising amphibians, reptiles and fish.

14. An isolated cell or cell extract thereof as claimed in claim 13 wherein the cold blooded vertebrate is selected from the group comprising salamanders, turtles, lizards, crocodilians, Hyperotreti (hagfish); Hyperoartia (lamprey); Chondrichthyes (sharks, rays, skates, chimeras); Chondrostei (bichirs, sturgeons, paddlefish etc); Semionotiformes (gars); Amiiformes (bowfins); Dipnoi (lungfish); and Coelacanthimorpha (coelacanths).

15. An isolated cell or cell extract thereof as claimed in claim 14 wherein the cold blooded vertebrate is selected from the group comprising salamanders, turtles, lungfish and sturgeon.

16. An isolated cell or cell extract thereof as claimed in claim 15 wherein the cold blooded vertebrate is a salamander

17. An isolated cell or cell extract thereof as claimed in claim 16 wherein the salamander is an axolotl or a notopthaimus.

18. An isolated cell or cell extract thereof as claimed in claim 16 wherein the cold blooded vertebrate is a sturgeon.

19. A pharmaceutical composition comprising an isolated cell or cell extract as defined in any of claims 1 to 18 and a pharmaceutically acceptable carrier, excipient or diluent.

20. An isolated nucleic acid molecule encoding a nanog protein having the nucleic acid sequence of nanog derived from a cold blooded vertebrate, wherein the cold blooded vertebrate has one or more of the following properties:

(ii) germ cells which do not contain germ plasm; and/or

(iii) the oocyte, egg, ovary or early embryo eel! or cell from which the cell extract is derived, expresses Oct-4 in a highly conserved form and/or nanog in a highly conserved form.

21. An isolated nanog protein having the amino acid sequence of nanog derived from a cold blooded vertebrate, wherein the cold blooded vertebrate has one or more of the following properties:

(ii) germ cells which do not contain germ plasm; and/or

22. An isolated nucleic acid or protein molecule as claimed in claim 20 or 21 wherein the cold blooded vertebrate is selected from the group comprising amphibians, reptiles and fish.

23. An isolated nucleic acid or protein molecule as claimed in claim 22 wherein the cold blooded vertebrate is selected from the group comprising salamanders, turtles, lizards, crocodilians, Hyperotreti (hagfish); Hyperoartia (lamprey); Chondrichthyes (sharks, rays, skates, chimeras); Chondrostei (bichirs, sturgeons, paddlefish etc); Semionotiformes (gars); Amiiformes (bowfins); Dipnoi (lungfish); and Coeiacanthimorpha (coelacanths).

24. An isolated nucleic acid or protein molecule as claimed in claim 23 wherein the cold blooded vertebrate is selected from the group comprising salamanders, turtles, lungfish and sturgeon.

25. An isolated nucleic acid or protein molecule as claimed in claim 24 wherein the cold blooded vertebrate is a salamander

26. An isolated nucleic acid or protein molecule as claimed in claim 25 wherein the salamander is an axolotl or a notopthalmus.

27. An isolated nucleic acid or protein molecule as claimed in claim 26 wherein the salamander is not an axolotl.

28. An isolated nucleic acid or protein molecule as claimed in claim 27 wherein the cold blooded vertebrate is a sturgeon.

29. A pharmaceutical composition comprising an isolated nucleic acid or protein molecule as defined in any of claims 20 to 28 and a pharmaceutically acceptable carrier, excipient or diluent.

30. A method of producing a reprogrammed cell or reprogrammed cell nucleus comprising exposing a differentiated cell, or the nucleus of a differentiated cell to a cell or cell extract as defined in any of claims 1 to 18.

31 . A method of producing a reprogrammed cell or reprogrammed cell nucleus comprising exposing a differentiated cell, or the nucleus of a differentiated cell to either (a) an isolated nucleic acid molecule encoding a nanog protein having the nucleic acid sequence of nanog derived from a cold blooded vertebrate or (b) an isolated nanog protein having the amino acid sequence of nanog derived from a cold blooded vertebrate, wherein the cold blooded vertebrate has one or more of the following properties:

(ii) germ cells which do not contain germ plasm; and/or

(iii) the oocyte, egg, ovary or- early embryo cell or ceil from which the cell extract is derived, expresses Oct-4 in a highly conserved form and/or nanog in a highly conserved form.

32. A method as claimed in claim 31 wherein the cold blooded vertebrate is selected from the group comprising amphibians, reptiles and fish.

33. A method as claimed in claim 32 wherein the cold blooded vertebrate is selected from the group comprising salamanders, turtles, lizards, crocodilians, Hyperotreti (hagfish); Hyperoartia

(lamprey); Chondrichthyes (sharks, rays, skates, chimeras); Chondrostei (bichirs, sturgeons, paddlefish etc); Semionotiformes (gars); Amiiformes (bowfins); Dipnoi (lungfish); and Coelacanthimorpha (coelacanths).

34. A method as claimed in claim 33 wherein the cold blooded vertebrate is selected from the group comprising salamanders, turtles, lungfish and sturgeon.

35. A method as claimed in claim 34 wherein the cold blooded vertebrate is a salamander

36. A method as claimed in claim 35 wherein the salamander is an axolotl or a notopthalmus.

37. A method as claimed in claim 36 wherein the salamander is not an axolotl.

38. A method as claimed in claim 37 wherein the cold blooded vertebrate is a sturgeon.

39. A method according to claim 30 to 38 wherein the reprogrammed cell is an embryonic stem cell-like cell.

40. A method according to any of claims 30 to 39 where the reprogrammed cell, and/or the reprogrammed cell nucleus, expresses Oct-4.

41. A method according to any of claims 30 to 40 where the reprogrammed cell, or the reprogrammed cell nucleus, expresses nanog.

42. A method according to any of claims 30 to 41 wherein the reprogrammed cell, or the reprogrammed cell nucleus is pluripotent.

43. A method according to any of claims 30 to 42 wherein the Oct-4 and/or the nanog in the cold-blooded vertebrate oocyte, egg, ovary or early embryo cell or cell extract has at least 69% amino acid identity with the human transcription factor Oct-4 and the human nanog protein, respectively.

44. A method according to any of claims 30 to 43 wherein the Oct-4 and/or the nanog in the cold blooded vertebrate oocyte, egg, ovary or early embryo cells has at least 69% amino acid identity with the DNA binding domains (DBD) of the human transcription factor Oct-4 or the human nanog protein, respectively.

45. A method according to any of claims 30 to 44 wherein the oocyte, egg, or early embryo cell extract comprises material from the nucleus or germinal vesicle (GV) of the oocyte, egg, or early embryo cell.

46. A method according to any of claims 30 to 45 wherein the differentiated cell is permeabilised.

47. A method according to any of claims 30 to 46 wherein the differentiated cell is a eukaryotic cell.

48. A method according to claim 47 wherein the differentiated cell is mammalian.

49. A method according to claim 48 wherein the differentiated cell is human.

50. A method according to any of claims 30 to 49 wherein the differentiated cell is a healthy cell.

51. A method according to any of claims 30 to 49 wherein the differentiated cell is derived from an individual with a genetic disease.

52. A method according to claim 51 wherein the genetic disease is an inherited genetic disease, an epigenetic disease, a degenerative disease or metabolic disease.

53. A reprogrammed cell produced according to the method of claims 30 to 52.

54. An embryonic stem cell-like cell produced according to the method of claims 32 to 52.

55. A reprogrammed cell nucleus produced according to the method of claims 30 to 52.

56. A method of producing a re-differentiated cell comprising:

(a) producing a reprogrammed cell as described in any of claims 30 to 52; and

57. A method as claimed in claim 56 wherein the re-differentiation is effected using a progenitor medium.

58. A re-differentiated cell produced according to the method of claim 56 or 57.

59. A pharmaceutical composition comprising a reprogrammed cell as defined in claim 53 and/or a reprogrammed cell nucleus as defined in claim 55 or a re-differentiated cell as defined in claim 58, and a pharmaceutically acceptable carrier, excipient or diluent.

60. A method of treating a disease requiring the replacement or renewal of cells comprising administering to an animal an effective amount of isolated cell or cell extract as defined in claims 1 to 18 and/or an isolated nucleic acid or protein molecule as defined in claims 20 to 28 and/or an effective amount of reprogrammed cells as defined in claim 53 and/or a reprogrammed cell nucleus as defined in claim 55 and/or an effective amount of re-differentiated cells produced by the method of claim 58.

61 . The isolated cell or cell extract as defined in claims 1 to 18 and/or an isolated nucleic acid or protein molecule as defined in claims 20 to 28 and/or the reprogrammed cells as defined in claim 53 and/or a reprogrammed cell nucleus as defined in claim 55 and/or the re- differentiated cells produced by the method of claim 58 for use as a medicament.

62. The use of the isolated cell or cell extract as defined in claims 1 to 18 and/or an isolated nucleic acid or protein molecule as defined in claims 20 to 28 and/or the reprogrammed cells as defined in claim 53 and/or a reprogrammed cell nucleus as defined in claim 55 and/or the re-differentiated ceils produced by the method of claim

58 in the manufacture of a medicament for the treatment of a disease requiring the replacement or the renewal of cells.

63. The method of claim 60 or use of claim 61 or 62 wherein the disease is selected from the group comprising neurological disease

(Parkinson's disease, Alzheimer's disease, spinal cord injury, stroke), skin alternation, burns, heart disease, diabetes, osteoarthritis, diseases requiring organ and tissue transplantation, infertility and rheumatoid arthritis.

64. The method or use of claim 63 wherein the disease is a neurological disease.

65. The method use of claim 64 wherein the neurological disease is selected from the group comprising Parkinson's disease,

Alzheimer's disease, spinal cord injury, stroke.

66. A kit for reprogramming a differentiated cell, or for reprogramming the nucleus of a differentiated cell, comprising an isolated cell or cell extract thereof as defined in claims 1 to 18 and/or the isolated nucleic acid or protein molecule as defined in claims 20 to 28;

and instructions to use the cell or cell extract thereof.

67. A kit as claimed in claim 66 further comprising one or more differentiated cells to be reprogrammed.

68. A kit according to either claim 66 or 67 further comprising a progenitor medium to effect the further step of re-differentiation of the reprogrammed cell.

69. Use of the isolated cell or cell extract as defined in claims 1 to 18 and/or an isolated nucleic acid or protein molecule as defined in claims 20 to 28 and/or the reprogrammed cells as defined in claim

53 and/or a reprogrammed cell nucleus as defined in claim 55 and/or the re-differentiated cells produced by the method of claim 58 in the identification of agents effective in treating and/or preventing and/or diagnosing disease.

70. A use as claimed in claim 69 wherein the disease is a genetic disease.

71 . A use as claimed in claim 70 wherein the disease is an inherited genetic disease.

72. A use as claimed in claim 71 wherein the disease is selected from neurological disease (Parkinson's disease, Alzheimer's disease, spinal cord injury, stroke), skin alternation, burns, heart disease, diabetes, osteoarthritis, diseases requiring organ and tissue transplantation, infertility and rheumatoid arthritis.

73. An isolated cell . or cell extract substantially as described herein with reference to the examples and figures.

74. A composition substantially as described herein with reference to the examples and figures.

75. A method substantially as described herein with reference to the examples and figures.

76. A use substantially as described herein with reference to the examples and figures.

77. A kit of parts substantially as described herein with reference to the examples and figures.