WO2008083598A1

WO2008083598A1 - Transgenic crop being selectively killed, preparation and utilization thereof

Info

Publication number: WO2008083598A1
Application number: PCT/CN2007/071373
Authority: WO
Inventors: Zhicheng Shen
Original assignee: Zhicheng Shen
Priority date: 2006-12-30
Filing date: 2007-12-28
Publication date: 2008-07-17

Abstract

A method for preparing transgenic gramineal plants that could be selectively killed by herbicides. The method comprises inhibiting the expression of detoxifying P450 genes and the degradation of the herbicides by using antisense RNA of P450 genes in the transgenic plants, thereby the resulting plants could be selectively killed by bentazon and sulfonylurea-type herbicides, and the spreading and mix of these plants into non-transgenic plants could be prevented.

Description

GM crops that can be selectively eliminated and their methods and applications

(1) Technical field

The present invention relates to a transgenic grass crop which can be selectively eliminated, a method and application thereof, and a gene and a plasmid, which belong to the field of plant genetic engineering.

(2) Background technology

Genetically modified crops have been widely promoted in many countries around the world. For example, genetically modified insect-resistant and herbicide-tolerant corn has been widely promoted in North America, and genetically modified cotton has also been widely planted in China. Further, the use of genetically modified crops as bioreactors for the production of pharmaceutical proteins, industrial enzymes, etc. is also being developed in the broad and pan-stone research (Larrick and Thomas, Current Opinion in Biotechnology, 2001, 12: 411-418). An important concern in growing these genetically modified crops is the spread of their environment and the incorporation of inappropriate genetically modified crops into our food. Therefore, controlling their spread and preventing them from being mixed into non-GM crops is an important measure for planting genetically modified crops; while preventing the production of genetically modified crops that produce pharmaceutical proteins and industrial proteins as bioreactors, the varieties used to produce food and feed are more It is very important. Therefore, inventing a simple method to help control the spread of transgenic crops has great application value.

Cytochrome P450 enzymes are a class of heme proteins that utilize NADPH to transfer electrons to catalyze the activation of molecular oxygen. They mediate a sequence of oxidation reactions in plants that function as lignin, sterols, terpenoids, alkaloids, fatty acids, and Many of the sub-biomass anabolisms of phytoalexins, as well as the degradation and detoxification of many natural and synthetic ingredients such as herbicides. Studies have shown that the cytochrome P450 enzyme is a super gene family, the plant has named more than 1000 P450 genes, and there are 528 possible P450 genes in rice. Applying traditional reverse genetics Means include EMS mutagenesis, T-DNA and transposon insertion, and gene overexpression techniques, gene chip technology, and antisense RNA or RNAi inhibition techniques to study the biological functions of such genes, often due to the large number of complexities between different genes. The presence of homologous sequences, the low abundance of individual gene expression, and the instability of gene expression products in the extract are impeded. So far, there are less than 40 plant P450 genes that have been validated for their biological functions.

There is currently no way to selectively eradicate genetically modified crops.

(3) Summary of the invention

The present invention provides a transgenic grass crop, a method and an application for which it can be selectively eliminated, and further provides a DNA sequence and a plasmid for producing a gene for transgenic rice and maize which can be selectively eliminated. The present invention achieves the goal of selectively eliminating transgenic crops by inhibiting the degradation of their herbicides and the expression of detoxifying metabolic enzymes in transgenic crops.

The technical solution adopted by the invention is:

A transgenic grass crop capable of being selectively eliminated, the target gene expression cassette of the transgenic grass crop and the inhibition frame of the expression of the detoxification enzyme gene (ie, the gene involved in the detoxification of the target herbicide) inhibiting the target herbicide In the same transform import clip.

Specifically, the target herbicide is a bentazon or a sulfonylurea herbicide. Bentazon and sulfonylurea herbicides are commonly used agricultural herbicides. They have good herbicidal ability against many broadleaf weeds. Gramineous crops have good resistance to these herbicides due to their detoxifying enzymes (Siminszky, Phytochemistry Reviews 5: 445-458; Pan et al., Plant Molecular Biology, 2006, 61: 933-943; Werck-Reichhart et al., Trends in Plant Science 5: 116-123). Therefore, in the transgenic grass crops, if the target gene is expressed while inhibiting the expression of the detoxification enzyme genes of the bentazon and sulfonylurea herbicides, these transgenic crops can be weeded by bentazon or sulfonylurea if necessary. The agent is selectively eliminated. Can inhibit bentazon and sulfonylurea herbicides in gramineous crops by using antisense A or RNAi The expression of detoxification genes makes transgenic crops sensitive to bentazone and sulfonylurea herbicides. The mechanisms and techniques for inhibiting gene expression using antisense RNA and RNAi have been fully described and are already available (Casci, Nature Reviews Genetics 7: 334-335; Smith et al., Nature 334: 724-726). The antisense RNA expression inhibition cassette can be functionally joined by a promoter and all or a fragment of the reversed suppressed gene. The promoter can be selected from the maize ubiquitin promoter ZmUbi-1 (Christensen and Quail, Transgenic Res.. 5:213-8), or the rice ubiquitin promoter (Wang and Oard, Plant Cell Reports, 22: 129-134). Or the rice Actin promoter (McElroy et al., Plant Cell 2: 163-171), or the CaMV 35S promoter, or other promoters active in grass crops. The terminator can be the widely utilized CaMV 35S terminator, the Nos terminator. The RNAi expression inhibition cassette can be functionally joined by a promoter, a reverse symmetric sequence of a DNA fragment of the suppressed gene, and a terminator.

In the present invention, in order to enable stable passage to the transgenic crop, the target gene expression cassette is closely linked to the expression inhibition block of the detoxification enzyme gene of the bentazon and sulfonylurea herbicides. This linkage is achieved in the present invention by the construction of the inserted DNA fragment: the target gene expression cassette and the target herbicide detoxification enzyme gene expression inhibition cassette are ligated on the same vector, and they are in the same DNA fragment at the time of transformation. Introduce plants on. For example, when using Agrobacterium transformation, it is ligated in the same T-DNA fragment; when using the "gene gun method", it is connected to the same DNA insertion fragment on the same vector.

Further, the detoxification enzyme gene of two or more of the bentazon and sulfonylurea herbicides in the grass crop can be simultaneously inhibited and expressed. In order to simultaneously inhibit the expression of two or more target herbicide detoxification enzyme genes, two or more closely linked expression inhibition frameworks for inhibiting different detoxification enzyme genes may be constructed. The present invention also provides a method for simultaneously inhibiting genes of different detoxification enzymes by expressing a suppression cassette: ligating DNA fragments from different detoxification enzyme genes into a hybrid fragment, and then using the hybrid fragment to construct antisense NA or RNAi expression Inhibition of the framework to achieve the goal of simultaneously inhibiting two or more detoxification enzyme genes (eg

SEQ NO ID: 10).

Specifically, the grass crop is rice or corn. When the gramineous crop is rice, at least one of the detoxifying enzymes of the target herbicide inhibited to be expressed is encoded by the following nucleotide sequence: 1 SEDIDNo: 1 (rice); 2 SEDIDNo: 2 (rice); SED ID No: 3 (corn); 4 SEDIDNo: 4 (corn); 5 SEDIDNo: 5 (corn). In the transgenic rice or maize, expression of at least one of the above genes is inhibited, thereby making the transgenic rice or corn susceptible to at least one herbicide. In the present invention, SEDID No: 2, SEDID No: 3, SEDID No: 4 and SED ID No: 5 are one of the inventions of the present invention for the first disclosure having the effect of participating in herbicide detoxification.

According to the rice gene sequence SEDIDNo: 1 and SED ID No: 2 and the maize gene sequence SEDIDNo: 3, SEDIDNo: 4 and SED ID No: 5, and their 3' end and

The 5' non-coding region sequence can construct different expression inhibition frameworks to inhibit the expression of cytochrome P450 genes involved in herbicide metabolism in rice and maize, respectively.

The present invention further provides a reverse symmetry sequence which can be used to construct an expression inhibition frame based on the design of a cytochrome P450 gene deficient in a bentura or sulfonylurea herbicide in rice and maize: 1 SEDIDNo: 6 (rice); 2 SEDIDNo: 7 (rice); 3 SEDIDNo: 8 (corn); 4 SEDIDNo: 9 (corn); 5 SEDIDNo: 10 (corn).

Further, the target herbicide is one or more of the following herbicides and their analogues: bentazon, bensulfuron, nicosulfuron, metsulfuron, chlorsulfuron, a Sulfasulfuron, pyrazosulfuron, chlorsulfuron and thiasulfuron.

The invention also relates to a method for obtaining the transgenic grass crop which can be selectively eliminated as follows: when expressing the gene of interest, using an antisense RNA or RNAi method, The expression of the gene involved in the detoxification of the herbicide in the transgenic grass crops is obtained, and the transgenic grass crop which can be selectively eliminated is obtained.

Specifically, the target herbicide is a bentazon or a sulfonylurea herbicide, and the method is as follows:

(1) An antisense RNA or RNAi inhibitory box that inhibits the expression of a cytochrome P450 gene involved in the detoxification of a bentazone or sulfonylurea herbicide in a grass crop is constructed in the same transformation-introduced DNA fragment. ;

( ² ) The transformation obtained by the step (1) is introduced into a DNA fragment and introduced into a grass crop to obtain the transgenic grass crop which can be selectively eliminated.

Alternatively, a DNA fragment of a cytochrome P450 gene involved in the detoxification of a bentazone or sulfonylurea herbicide in a grass crop can be ligated into a hybrid fragment, and an antisense RNA or RNAi inhibition can be constructed based on the hybrid fragment. a frame, the antisense RNA or RNAi inhibition cassette and the target gene expression cassette are constructed in the same transformation-introduced DNA fragment, and the DNA fragment is introduced into a corresponding grass crop to obtain the transgenic grass which can be selectively eliminated. Undergraduate crops.

Where necessary, one or more herbicides may be used to conventionally spray grass crops to selectively kill the above-described transgenic gramineous plants. The target herbicide may be a bentazon or a sulfonylurea herbicide. Thus, transgenic grass crops obtained by the method of the present invention can be selectively killed by a bentazone or a sulfonylurea herbicide when necessary. This prevents their spread and the incorporation of non-GMO grass crops.

Specifically, the grass crop is rice, and an antisense RNA or RNAi inhibition frame designed to inhibit expression of a herbicide detoxification enzyme gene according to SED ID No: 1 or SED ID No: 2, the antisense A or RNAi The inhibition cassette and the target gene expression cassette are ligated into the same transformed introduction DNA fragment, and the DNA fragment is introduced into rice to obtain transgenic rice.

Specifically, the grass crop is corn, according to SED ID No: 3 or SED ID No: 4 or SEQ ID No: 5 is an antisense RNA or RNAi inhibition frame designed to inhibit the expression of a herbicidal detoxification enzyme gene, and the RNA or RNAi inhibition cassette and the target gene expression cassette are ligated into the same transformation-introduced DNA fragment, The DNA fragment was introduced into corn to obtain transgenic corn.

When the gramineous crop is rice, the antisense RNA or RNAi expression inhibition cassette contains one of the following nucleotide sequence fragments: 1 SED ID No: 6; 2 SED ID No: 7

When the gramineous crop is maize, the antisense A or RNAi expression inhibition cassette contains one of the following nucleotide sequence fragments: 1 SED ID No: 8; 2 SED ID No: 9; 3 SED ID No: 10.

In the present invention, the selection of the gene of interest is not limited. The key point of the present invention is to construct a restriction frame for detoxification enzyme gene expression of the target herbicide and a target gene expression frame in the same transformation and introduction into the DNA fragment, and then to the DNA fragment. Introducing methods in gramineous plants to obtain transgenic crops that can be selectively eliminated by target herbicides. This method is of great significance for future research on genetically modified crops.

The gene of interest of the present invention includes, but is not limited to, an insect resistance gene, a herbicide resistance gene, a drug protein gene, or an industrial protein gene. Insect resistance genes include, but are not limited to, CrylAb, CrylAc, CrylCa, CrylF, Cry2Ab, Cry3A, Cry3B, Cry9A, Vip3, etc.; herbicide resistance genes include, but are not limited to, glyphosate resistant genes, 5-enolpyruvate shikimic acid-3 - Phosphate synthase gene (EPSPS). The drug protein gene includes, but is not limited to, therapeutic drug proteins such as human growth factors, antibodies, etc., antigenic proteins for immunization, proteins for diagnosis, and the like. Industrial protein genes include, but are not limited to, various industrial enzymes. The expression of proteins for various uses in plants is a prior art (Franken et al. Current Opinion in Biotechnlogy. 8: 411-416).

The gene of interest described in the present invention may be one or more. They can be ligated to a transforming DNA fragment simultaneously with the detoxification enzyme gene expression inhibition cassette.

Preferably, one of the above target genes is a glyphosate resistant gene. Glyphosate resistant gene Description (e.g., Park et al., Molecular Microbiology 51: 963-971; Eschenburg et al., Planta 216: 129-135; US Pat. No. 4,769,061; US Pat. No. 4,940,835). The transgenic crops obtained by this method are highly resistant to glyphosate herbicides and sensitive to bentazon or sulfonylurea herbicides, so that the transgenic plants thus obtained can be screened and weed control using glyphosate, It is also possible to use bentazon and sulfonylurea herbicides to prevent the spread of genetically modified gramineous crops.

The method of transgene described in the present invention includes, but is not limited to, a gene gun method, an Agrobacterium-mediated method, and a pollen tube introduction method. The gene gun method, the Agrobacterium-mediated method, and the pollen tube introduction method are existing techniques (Hiei et al. (1994) The Plant Journal 6: 271-282; Ishida et al. (1996) Nature Biotechnology 14: 745-750 Ayres and Park (1994) Critical Reviews in Plant Science 13: 219-239; Bommineni and Jauhar (1997) Maydica 42: 107-120; Kong Qing et al., Molecular Plant Breeding 3: 113-116).

The present invention also relates to a plasmid capable of inhibiting the expression of a benzathine or a sulfonylurea herbicide detoxifying enzyme in a grass crop after introduction into rice or corn. The plasmid contains 1 SED ID No: 1 (for rice); 2 SED ID No: 2 (for rice); 3 SED ID No: 3 (for corn); 4 SED ID No: 4 (for Maize); and 5 SED ID No: 5 (for corn) are designed to produce antisense RNA or double-stranded RNA after introduction into rice or maize. The plasmid may also contain one or more genes of interest.

When the gene of interest is a glyphosate resistant gene, the plasmid contains both an expression cassette for the glyphosate resistant gene and an expression inhibition frame for controlling the expression of the bentazone and sulfonylurea detoxification enzyme genes.

The invention also relates to the use of said transgenic grass crops which are selectively eradicable in transgenic techniques. The transgenic gramineous crops obtained by the method of the present invention can be selectively killed by the target herbicide when needed.

The invention also relates to a method for enhancing the herbicide resistance of a grass crop, the method The method comprises introducing a nucleotide sequence having herbicide resistance into a grass crop to enhance herbicide resistance of the transgenic grass crop; the nucleotide sequence encoding the amino acid sequence and 90% of one of the following amino acid sequences The above homology: 1 SED ID No: 11 (for rice); 2 SED ID No: 12 (for corn); 3 SED ID No: 13 (for corn). The homology of the amino acid sequence can be calculated by the method of Karlin and Altschul (Karin and Altschul, Proc. Natl. Acad. Sci. USA 87: 2264-2268; Karlin and Altschul, Proc. Natl. Acad. Sci. USA 90: 5873 -5877). A segment of a nucleotide sequence having herbicide resistance can be introduced to enhance the resistance to the herbicide, and a plurality of nucleotide sequences having herbicide resistance can be introduced to enhance the transgenic grass crop simultaneously. Herbicide resistance.

Preferably, the introduced nucleotide sequence is one of the following: 1 SED ID No: 4 (for rice); 2 SED ID No: 4 (for corn); 3 SED ID No: 5 (for corn) ).

A plasmid for transgenic enhanced herbicide resistance of a grass crop containing the aforementioned nucleotide sequence. These nucleotide sequences are functionally linked to promoters and terminators to form genes that can be expressed in crop cells. Promoters and terminators can be foreign or native promoters and terminators. The promoter and terminator are promoters and terminators that are active in grass crops.

The method for enhancing the herbicide resistance of a grass crop comprises: 1) a method for transforming a cell by using a gene comprising the above nucleotide sequence; 2) a method for producing a transgenic crop by using the cell transformed by the above gene; 3) A method of enhancing the resistance of a crop containing the above gene to at least one herbicide. The crop containing the above genes may be dicotyledonous or monocotyledonous, including but not limited to corn, rice, cotton, soybean, wheat. The present invention provides a method for obtaining a transgenic grass crop which can be selectively eliminated. The beneficial effects of the present invention are mainly as follows: The transgenic grass crop obtained by the method of the present invention can be bentazon or sulfonyl when necessary. Urea herbicides are selectively killed, preventing their spread and mixing into non-transgenic grass crops, which is of great significance for future research on genetically modified crops.

(4) BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 is a schematic diagram of the structure of T-DNA.

(5) Specific implementation

The present invention is further described below in conjunction with specific examples, but the scope of protection of the present invention is not limited thereto: The molecular biology and biochemical methods used in the following examples of the present invention are known techniques. The Current Protocols in Molecular Biology, published by Au Wiel and Sons, and the Molecular Cloning: A Labortory Manual, 3rd ED., published by Cold Spring Harbor Laboratory Press (2001), are published in detail. instruction of. Examples Rice Transformation Construction of T-DNA Vector

1) Construction of rice T-DNA transformation vector pCAMB 1300Rice-GlyR-450i:

Rice cytochrome P450 gene CYP81A6 ( SEQ ID NO: 1 , Pan et al., Plant

Molecular Biology, 61:933-943) Fragments were obtained by PCR from rice ( > sativa japonica L.) total genomic DNA amplification.

One of the 207 bp fragments R450FR is using PCR primers. 450F (5'CTCGAG CAG TGC ACC AGA GTC ACA GAA ACA CAT CAC AC, lower horizontal line is ^ site) and 450R (5'AGACTC CT TCT TGA CGA GGT GGAGGT GT, lower horizontal line is g/II site) , which is a 5' end 1 ~ 207 bp fragment of the cDNA of the gene C 3⁄47^6;

Another fragment, R450FR2, 327 bp long, was obtained by PCR using primers 450F (5'CTCGAG point) and 450R2 (5, AGA TCT CGG TGAAGC ACT CCC TGG CGC AC, lower horizontal line is 3⁄4/11 locus) of. It is a 5' end 1~327 bp fragment of the cytochrome P450 gene cDNA. These two fragments were cloned into the T vector (Shanghai Shenggong) to obtain the vectors T-vector-R450FR1 and T-vector-R450FR2, respectively. The fragments R450FR1 and R450FR2 were then obtained by double digestion with ol and g/II from the T vector, and further ligated to the T-DNA vector pCambial300 vector which was digested with the hygromycin-resistant gene and dephosphorylated. Cambia, Australia), get pl300-450i.

The plasmid pl300-450i contains a gene sequence under the control of the CaMV 35S promoter capable of producing double-stranded RNA (dsRNA) to inhibit detoxification enzyme expression by RNA interference (RNAi) (the nucleotide sequence of which is SEQ ID NO. 6).

Glyphosate-tolerant gene G6 (gb: EU169459, including chloroplast signal peptide, enol pyruvate oxalic acid-3-phosphate synthase and terminator), was synthesized by Shanghai Shenggong Company (Shanghai, China).

It can be obtained by double digestion with a HI and coRI from a vector. The maize (Zea a ) promoter ZmUbi-1 was obtained by PCR amplification from maize genomic DNA. PCR primers are

TCG TGC, the lower horizontal line is the Hz III site) and ZmUbiR (5' GTG GGA TCC TCT AGA GTC GAC CTG CAG AAG TAA CAC CAAACAACA G, the lower horizontal line is the apparent HI site). The promoter ZmUbi-1 amplified by PCR was digested with H iIII and a HI and The glyphosate-resistant gene G6 (obtained by a HI and coRI double digestion) and the T-DNA vector p OO-ASOi (pre-digested by H mm and _CO RI) were ligated simultaneously to obtain a rice transformed T-DNA vector pCAMB1300Rice. -GlyR-450i. This vector T-DNA contains both a G35-resistant glyphosate gene expression cassette and a structure that inhibits the expression of the detoxification enzyme gene CT 3⁄47 (Fig. 1a).

2) Construction of rice T-DNA transformation vector pCAMB 1300Rice-G6-450Bi:

Another Ai fragment of a rice transformation vector is derived from another rice cytochrome P450 gene (SEQ ID NO: 2, encoding the amino acid sequence of SEQ ID NO: 11). It is directly amplified from the rice genome by PCR. One of the fragments is Rice450Bl, and the PCR primers are Rice450bFl (5, GTCACTCGAG).

AATGAAGTACTCCACTTCTGTAACC )

Rice450bR460 ( 5'GATCGGATCC

Another fragment is Rice450B2, and the PCR primers are Rice450bFl (ibid.) and Rice450bR350 (5, CATGAGATCTTGCGACTCG AACCTG GGCCGG TTCG). These two fragments were cloned into the T vector (Shanghai Shenggong). The fragment Rice450B1 was digested with [and a HI from the Τ vector; Rice450B2 was obtained by ol and enzymatic cleavage from the T vector. Then, Rice450B1 and Rice450B2 were ligated to the pCambia 1300 vector in which the hygromycin-resistant gene (hyg+) was pre-cleared with Xhol and dephosphorylated to obtain the pCamb 1300-450 ΒΪ vector. pCambl300-450Bi contains an expression block for RNAi production under the control of the CaMVS35 promoter (nucleotide sequence is SEQ ID NO: 7). The vector pCambl300-450Bi is further processed with _CO RI and

Digestion, and then with the glyphosate-resistant gene G6 (synthesized by Shanghai Biotech, gb: EU169459, Sa HI and coRI) and the promoter ZmUbi-1 (from the vector pCAMB 1300Rice-GlyR-450i) The SawHI was digested to obtain a T-DNA vector pCAMB1300Rice-G6-450Bi (Fig. 1b). Example 2: Obtaining transgenic rice for glyphosate-tolerant transgenic rice sensitive to benzathine and sulfonylurea herbicides is based on prior art (Lu Xiongbin et al. 1998 Life Science 10: 125-131; Liu Fan Et al., 2003 Molecular Caries Breeding 1: 108-115). The mature and full-bodied "Xiushui 110" seeds were selected for shelling, and callus was induced to be used as a transformation material. The T-DNA vector pC AMB 13 OORice-GlyR-45 Oi or pC AMB 1300Rice-G6-45 OBi was introduced into Agrobacterium LBA4404 by electroporation. Agrobacterium tumefaciens containing the T-DNA vector pCAMB 13 OORice-GlyR-45 Oi or pCAMB1300Rice-G6-450Bi was taken, and a single colony was inoculated to prepare for transformation with Agrobacterium. The callus to be transformed is placed in the Agrobacterium liquid (containing acetosyringone, 40 mg/L) having an OD660 of 0.6, and the Agrobacterium is bound to the surface of the callus, and then the callus is transferred to the co-culture medium. Co-culture for 2 to 3 days. The transformed callus was washed with sterile water, transferred to a screening medium containing 2 mM glyphosate, and cultured for two months (intermediate subculture). After the screening, the callus with good growth vigor was transferred to the pre-differentiation medium for about 20 days, and then the pre-differentiated callus was transferred to the differentiation medium, and the light was differentiated and germinated in 14 hours. After 2~3 weeks, the resistant regenerated plants were transferred to the rooting medium and the roots were rooted. Finally, the regenerated plants were washed away from the agar and transplanted into the greenhouse as identification materials.

The insertion of T-DNA and the expression of its gene can be detected by PCR and Western blot analysis. Genomic DNA can be extracted from transformed and non-transformed grass crops according to existing methods. Example 3: Positive and negative selection of transgenic rice using herbicides

The obtained TO transgenic rice plants transformed with pC AMB 13 OORice-GlyR-45 Oi and pC AMB 1300Rice-G6-45 OBi and the untransformed rice plants were individually cultured in a culture solution. These plants are divided into 3 treatments, each treatment consisting of two transgenes from different transformation events. Plants and 10 non-transgenic plants. Treatment 1: Spray 10 mM glyphosate; Treatment 2: Spray 2

500 mg/L bentazon; Treatment 3: Water spray. Each treatment was sprayed at 80 mL/m 2 and the survival rate of the plants was recorded 10 days after treatment. The results are shown in Table 1 below.

Table 1: Sensitivity of transgenic rice to glyphosate and bentazon.

Selective killing of T1 transgenic rice.

Two of the T1 positive plants of the two transformation events (450i-2 and 450Ϊ-4) of pCAMB1300Rice-GlyR-450i transgenic rice were mixed with 100 non-transgenic conventional rice plants, and sprayed at 80mL/m2 during 4-5 leaves. 2500 mg / L bentazon. After 10 days, the positive plants of both transformation events were 100% killed, while all non-transgenic conventional rice grew normally. Example 4: Maize cytochrome P450 gene Cloning of ZM-450A

By analyzing the sequence of the maize genome database, several cytochrome P450 genes involved in the detoxification of herbicides in the maize genome were amplified and cloned. One of the cytochrome P450 genes that may cause herbicide resistance is named ZM-450A. ZM-450A was obtained by a PCR amplification reaction. The reaction conditions for PCR amplification reaction primers zm450aF (5 'GGATCCACCATGGATAAGG CCTA CGTGGCCGTG) Wo port _{zm450aR (5' CAGTATACAGGACAACCTG CAGAAGACCACAATTT) 0} PCR was: 95 ° C 1 minutes, 60 ° C 1 minutes, 72 ° C 2 minutes, 30 cycles. This cytochrome P450 genomic PCR product was cloned into T In the vector (Shanghai Shenggong), the pT-zm450A plasmid was obtained. The cDNA sequence of this cytochrome P450 gene is SEQ ID NO: 4, and the encoded protein amino acid sequence is SEQ ID NO: 12. Example 5: Cloning of the anti-Betason corn cytochrome P450 gene ZM-450B

By analyzing the sequence of the maize genome database, several cytochrome P450 genes involved in the detoxification of herbicides in the maize genome were amplified and cloned. One of the cytochrome P450 genes that may cause herbicide resistance is named ZM-450B. ZM-450B is obtained by a PCR amplification reaction. PCR amplification reactions The primers zm450bF (5 'GGATCCACCATGGATCTGG CGGCCTACATCGCCA) Wo port zm450bR (5, CAGTATACAGCCTATTGTGAC G CA GAAGACCCA A) the reaction conditions of ₀ PCR was: 95 ° C 1 minutes, 60 ° C 1 minutes, 72 ° C 2 minutes , for 30 cycles. This cytochrome P450 genomic PCR product was cloned into a T vector (Shanghai Labor) to obtain a pT-zm450B plasmid. The cDNA sequence of this cytochrome P450 gene is SEQ ID NO: 5, and the encoded protein amino acid sequence is SEQ ID NO: 13. Example 6: Construction of T-DNA Transformation Vector of ZM-450A and ZM-450B Genes

To study the functions of ZM-450A and ZM-450B, these two genes were cloned into the T-DNA vector pCAMB1300Rice-G6-450i (Example 1) for expression in transgenic rice, respectively. The T-DNA in pCAMB1300Rice-G6-450i contains an Ai-producing fragment that inhibits the expression of a herbicide gene in rice and a herbicide-tolerant glyphosate-bearing gene. Thus pCAMB1300Rice-G6-450i-based T-DNA will result in sensitivity of transgenic rice to bentazone and sulfonylurea herbicides (Example 3). However, Simultaneous introduction of ZM-450A or ZM-450B If the ability of transgenic rice to resist benturazone and sulfonylurea herbicides can be restored, ZM-450A or ZM-450B has the function of resisting these herbicides.

The maize promoter ZmUbi-1 is functionally linked to ZM-450A and ZM-450B, respectively. A recombinant gene (expression cassette) that can be expressed in rice. These two recombinant genes were cloned into the Agrobacterium transformation vector pCAMB1300Rice-GlyR-450i, respectively, and the T-DNA vectors pCAMB 1300Rice-GlyR-450i-ZM450A and pCAMB1300Rice-GlyR-450i-ZM450B were obtained. These two T-DNA vectors contain 1) glyphosate resistant gene G6, 2) detoxification enzyme gene CT3⁄47^6 expression inhibition cassette, and 3) maize cytochrome P450 gene expression cassette (Fig. lc, d).

Obtainment of pCAMB1300Rice-GlyR-450i-ZM450A and pCAMB1300Rice-GlyR-450i-ZM450B transgenic rice:

Two transformed T-DNA vectors of pCAMB1300Rice-GlyR-450i-ZM450A, pCAMB1300Rice-GlyR-450i-ZM450B and pCAMB1300Rice-Gly6-450i were introduced into Agrobacterium LBA4404 by electroporation. The method for obtaining transgenic plants in rice is based on the prior art (Lu Xiongbin, Gong Yu 1998, Life Science 10: 125-131; Liu Fan et al., 2003 Molecular Animals. 1: 108-115). To put it simply, the steps are as follows: Select the mature and full-fledged rice variety "Xiushui 110" seed to be shelled, and induce the callus to be used as a transformation material; take the Agrobacterium to draw the plate, and select the colony for inoculation and prepare for transformation with Agrobacterium. The callus to be transformed is placed in the Agrobacterium liquid with an OD660 of 0.6 (containing acetosyringone 40 mg/L), and the Agrobacterium is bound to the surface of the callus, and then the callus is transferred to the co-culture medium. Incubate for 2 to 3 days; rinse the transformed callus with sterile water, transfer to a screening medium containing 1 ~ 4 mM glyphosate, and screen for two months (intermediate subculture); The viable callus was transferred to the pre-differentiation medium for about 20 days, and then the pre-differentiated callus was transferred to the differentiation medium, and the light was differentiated and germinated in 14 hours; after 2 to 3 weeks, the resistant regenerated plants were transferred. The roots were rooted on the rooting medium, and the regenerated plants were washed away from the agar and transplanted into the greenhouse as identification materials. More than 15 independent regenerated rice lines were obtained for each transformation vector.

The insertion of T-DNA and the expression of its gene can be detected by PCR and western blot analysis. Genomic DNA can be extracted from transformed and non-transformed rice according to existing methods. Example 7. Determination of resistance to transgenic rice of pCAMB 1300Rice-GlyR-450i-ZM450A and pCAMB1300Rice-GlyR-450Ϊ-ΖΜ450Β

Different 10 independent transformed strains of rice plants obtained from each transformation vector and untransformed rice plants were cultured in a single plant in a greenhouse. These regenerated plants were divided into 4 treatments, treatment 1 : spraying 20 mM glyphosate; treatment 2: spraying 1000 mg/L bentazon; treatment 3: 4 mg/L bensulfuron-methyl; treatment 4: spraying water. The survival rate of the plants was recorded 7 days after the treatment. The results are as follows (Table 2).

Table 2: Survival rates of 10 independent rice transformed lines under different herbicides

The results showed that the expression of ZM-450A and ZM-450B in rice enhanced the resistance to bentazon and bensulfuron. Example 8. Construction of a maize transformation vector for inhibiting maize cytochrome P450 gene expression

1) pCAMB1300-G6-ZM450i

Based on the cytochrome P450 gene of maize, a DNA fragment capable of producing RNAi (SEQ ID NO: 8) was designed and synthesized, which includes two different maize cytochrome P450 genes (SEQ ID NO: 3, SEQ ID NO). :4) . This DNA fragment was digested with ^3⁄4oI and ligated into the pCambial300 vector (Cambia, Australia), which was previously digested with οί, to obtain the new vector pl300-ZM-P450Ai. This new carrier is further The vector was digested with Ecom and Hindm, and then ligated with the G6 glyphosate-resistant gene obtained by digesting pCAMB1300Rice-GlyR-450i with the same enzyme to obtain the vector PCAMB1300-G6-ZM450i (Fig. le). This vector contains a sequence under the control of the CaMV 35S promoter that produces Ai inhibition of two different maize cytochrome P450 expression.

2) pCAMB 1300Corn-GlyR-450i-AMY

Two fragments of the bentazon and sulfonylurea herbicide detoxification enzyme genes in maize were obtained by PCR amplification from the maize genome. The fragment T-ZM450-1 was 259 bp long, and the PCR primers were ZmSac731F (5, TCGAC GAGCTC G TGC CGT ACA TCG G), and ZmXholR (5 'AGCG CTCGAG TT TAG AGC AGT GAT CAC AGT GTC AG). Fragment T-R450-2, 147 bp long, PCR primers were ZmBgl2-80F (5, GCTT AGATCT CG TAC ATC GGC ACG GCC AAC CGC T ) and Zm880R ( 5 ' AGCG CTCGAG CCAGCCTCCGCCGCTCCCCGT). These two PCR products were separately cloned into a T vector (Shanghai Shenggong). These two fragments are ligated by a usual molecular biological method to obtain a fragment having the DNA sequence of SEQ ID NO: 9. Then, SEQ ID NO: 9 was functionally linked to the maize ubiquitin promoter (ZmUbi-1) to obtain a maize bentazon and sulfonylurea herbicide detoxification enzyme gene expression inhibition frame. This detoxification enzyme gene expression inhibition cassette using the NAi method was further cloned into the T-DNA vector PCAMB 1300-GlyR (pCAMB1300) containing the glyphosate-resistant gene, and the detoxification enzyme gene expression inhibition frame and anti-grass resistance were obtained. A T-DNA plasmid vector (pCAMB1300Com-GlyR-450i) of the phosphine gene expression cassette. The pCAMB 1300Corn-GlyR-450i was digested with H «i III to obtain a vector fragment of 15.8 kb, which was then dephosphorylated to further express the α-amylase expression cassette (the rice promoter-optimized manipulated by the rice promoter Gtl) The synthetic α-amylase gene ((gb:245490)) was cloned into the T-DNA plasmid vector to obtain the T-DNA vector pCAMB 1300Com-GlyR-450i-AMY (Fig. lf) for transformation of maize. Therefore, pCAMB1300Com-GlyR -450i-AMY T-DNA contains: 1) One suppress The genes for the expression of the debenzoate gene of the bentazon and sulfonylurea herbicides, 2) a glyphosate resistant gene, and 3) an amylase gene (Fig. lf).

3) pCAMB 1300Corn-GlyR-450i-254

The maize T-DNA transformation vector pCAMB 1300Com-GlyR-450i-254 (Fig. lg) was also constructed based on PCAMB1300. Its T-DNA fragments include: 1) glyphosate resistant gene G6; 2) expression inhibition framework for maize cytochrome P450 gene expression. This expression inhibition cassette was designed based on three maize cytochrome P450 genes (SEQ ID No: 3, 4 and 5) and contained three different maize cytochrome P450 gene fragments (SEQ ID No: 10). Example 9. Production of Bentazon and Sulfonylurea Herbicide Sensitive Transgenic Maize

Hi-II corn ear 8 to 10 days after pollination. Collect all immature embryos (size 1.0~1.5mm). Agrobacterium containing T-DNA vector pCAMB 1300-G6-ZM450i, pCAMB 1300Com-GlyR-450i-AMY and pCAMB1300Corn-GlyR-450i-254 was co-cultured with immature embryos for 2 to 3 days (22 °C). The immature embryos were transferred to callus induction medium (containing 200 mg/L of Timentin Agrobacterium) and cultured at 28 °C for 10 to 14 days. All callus was transferred to a screening medium with 2 mM glyphosate and incubated at 28 °C for 2 to 3 weeks.

All tissues were transferred to fresh glyphosate screening medium and cultured at 28 ° C for 2 to 3 weeks. Then, all the embryogenic tissues that survived the screening were transferred to the regeneration medium, and cultured at 28 ° C for 10 to 14 days, one per dish. Transfer the embryogenic tissue to fresh regeneration medium and incubate at 26 °C for 10-14 days. All well-developed plants were transferred to rooting medium and cultured at 26 ° C until the roots were fully developed, then transplanted to a greenhouse for single-plant culture, and their herbicide resistance was calmed. Example 10: Determination of the sensitivity of pCAMB1300-G6-ZM450i transgenic corn to bentazon

Obtained transformed pCAMB 1300-GlyR-ZM450i corn plants and conventional jade without transformation Rice plants are grown in a single plant in the greenhouse. These regenerated plants were divided into 3 treatments, each of which included 20 plants of pCAMB1300-G6-ZM450i transformed plants and 20 non-transformed plants. 20 transformed plants were 20 transformation events. Treatment 1: Spray 10 mM glyphosate; Treatment 2: Spray 2000 mg/L bentazon; Treatment 3: Spray water. The survival rate of the plants was recorded 10 days after the treatment. The results are as follows (Table 3). Table 3: Survival of pCAMB1300-G6-ZM450i transgenic maize plants under different herbicides

Example 11: Determination of the sensitivity of pCAMB 1300Com-GlyR-450i-AMY transformed maize callus to bentazon

20 live maize calli tissues cultured for 56 days on Agrobacterium-infected screening medium of glyphosate, and 20 undeveloped 20 live maize calli tissues without Agrobacterium infection, respectively 2 mM glyphosate screening medium and 5 mg/L bentazon medium were cultured, and the growth of callus was observed after 10 days. The pCAMB 1300Com-GlyR-450i transformed callus was significantly resistant to glyphosate (100% callus growth), but 75% died on bentazon (5 mg/L) medium. In contrast, callus transformed without Agrobacterium infection was significantly resistant to glyphosate but resistant to bentazone. Example 12: pCAMB1300Com-GlyR-450i-254 transgenic maize was sensitive to bentazon. 10 independent pCAMB1300-G6-ZM450i-254 maize transformation events were cultured. Fertilization and herbicide resistance determination. The TO plants were cultured in a greenhouse, and pollen was collected and crossed with a conventional maize inbred line "Deonong 01" to obtain seeds. Transgenic plants (identified by PCR) produced by germination of these seeds and conventional non-transgenic controls were tested for herbicide resistance. Treatment 1: Spray 10 mM glyphosate; Treatment 2: Spray 2000 mg/L bentazon and 100 mg/L fusulfuron mixture; Treatment 3: Spray water. The survival rate of the plants was recorded 10 days after the treatment. The results are as follows (Table 3).

Table 3: Survival rates of pCAMB 1300-G6-ZM450i-254 transgenic maize transformation events 254-4 under different herbicides.

80% of the other conversion events of pCAMB1300-G6-ZM450i-254 achieved the same results. Example 11: Transgenic rice expressing human lactoferrin which can be selectively killed

The recombinant gene expressing human lactoferrin is composed of a rice seed-specific promoter Gtl (Molecular Plant Breeding, 2005, Vol. 3, No. 6, 768-772) and a synthetic DNA fragment encoding human lactoferrin (SEQ ID). No: 14) and a terminator are functionally connected. This artificially recombinant gene was further cloned into the T-DNA vector pCAMB1300Rice-GlyR-450i to obtain pCAMB1300Rice-GlyR-450i-hLF (Fig. lh). The T-DNA in this vector comprises: 1) an RNAi fragment that inhibits the expression of the P450 of the benturazone and sulfonylurea herbicide genes in rice 2) a herbicide tolerant glyphosate gene, and 3) An expression cassette for specific expression of human lactoferrin in rice endosperm. 100 independent transformation events were obtained after transformation with pCAMB1300Rice-GlyR-450i-hLF. Ten of the highly expressed human lactoferrin transformation events were tested for their glyphosate And the resistance levels of bentazon, these transgenic rice were found to be highly resistant to glyphosate herbicides while being highly sensitive to bentazon. Field trials have shown that 50% of 48% of bentazon per square meter can kill this GM rice in the 3~4 leaf stage. Therefore, bentazon can effectively control the unplanned spread and spread of this transgenic rice. Example 12: Transgenic rice expressing serum albumin that can be selectively killed

The recombinant gene expressing human lactoferrin is composed of a rice seed-specific promoter Gtl (Molecular Plant Breeding, 2005, Vol. 3, No. 6, 768-772) and a synthetic DNA encoding serum albumin (hSA) (SEQ ID NO: 15) and the terminator are functionally connected. This artificially recombinant gene was further cloned into the T-DNA vector pCAMB1300Rice-GlyR-450i to obtain pCAMB1300Rice-GlyR-450i-HSA (Fig. li). The T-DNA in the vector comprises: 1) an RNAi fragment which inhibits the expression of a P450 of the bentazone and sulfonylurea herbicide gene in rice; 2) a herbicide tolerant glyphosate gene; An expression cassette for specific expression of human serum albumin in rice endosperm. 80 independent transformation events were obtained with pCAMB1300Rice-GlyR-450i-HSA transformation, and 10 of them were highly expressed for human serum albumin conversion events, and their resistance to glyphosate herbicides and parabens were further determined. Loose sensitivity. Field trials found that 50 mL of 48% of bentazon per square meter in the 3~4 leaf stage was able to kill all of the transgenic rice with 8 conversion events. Therefore, bentazon can effectively control the unplanned spread and spread of this transgenic rice. Finally, it should also be noted that the above list is only a few specific embodiments of the invention. It is apparent that the present invention is not limited to the above embodiment, and many variations are possible. All modifications that can be directly derived or associated by those of ordinary skill in the art from the disclosure of the present invention are considered to be the scope of the present invention.

Claims

1 . A transgenic grass crop capable of being selectively eliminated, characterized in that the target gene expression cassette of the transgenic grass crop and the inhibition frame of the expression of the detoxification enzyme gene of the target herbicide are linked in the same transformation Import into the DNA fragment.

2. The selectively eradicated transgenic grass crop according to claim 1, characterized in that at least one of the detoxifying enzymes of the target herbicide inhibited to be expressed is encoded by the following nucleotide sequence: 1 SED ID No: 1; 2 SED ID No: 2; 3 SED ID No: 3; © SED ID No: 4; © SED ID No: 5.

3. The transgenic gramineous crop capable of being selectively eliminated according to claim 1, wherein the target herbicide is a bentazon or a sulfonylurea herbicide.

4. The transgenic gramineous crop capable of being selectively eliminated according to claim 1, wherein the gramineous crop is rice or corn.

5. A method for obtaining a transgenic grass crop which can be selectively eliminated according to claim 1, characterized in that, while expressing a gene of interest, an antisense RNA or RNAi method is used to inhibit participation in a transgenic grass crop The expression of the herbicidal detoxification gene results in the transgenic grass crop which can be selectively eliminated.

6. The method according to claim 5, wherein the target herbicide is a bentazon or a sulfonylurea herbicide, and the method is as follows: 1) inhibiting the participation of bentazon in grass crops Or the antisense RNA or RNAi inhibition cassette of the cytochrome P450 gene detoxification of the sulfonylurea herbicide is constructed in the same transformation and introduced into the DNA fragment; 2) the transformation obtained in step (1) is introduced into the DNA fragment Introduced into grass crops, the transgenic grass crops that can be selectively eliminated are obtained.

7. The method according to claim 6, wherein: a DNA fragment of a cytochrome P450 gene involved in the detoxification of a bentazone or sulfonylurea herbicide in a grass crop is joined into a hybrid fragment, and then Constructing an antisense RNA or RNAi inhibition cassette according to the hybrid fragment, constructing the antisense RNA or RNAi inhibition cassette and the target gene expression cassette in the same transformation introduction DNA fragment, and introducing the DNA fragment into the corresponding grass crop, The transgenic grass crops that can be selectively eliminated are obtained.

8. The method according to claim 6, wherein: the grass crop is rice, and an antisense RNA that inhibits expression of a herbicide detoxification enzyme gene according to SED ID No: 1 or SED ID No: 2 is designed or RNAi inhibition cassette, ligating the antisense RNA or RNAi inhibition cassette and the target gene expression cassette into the same transformation-introduced DNA fragment, and introducing the DNA fragment into water In rice, GM rice is obtained.

9. The method according to claim 6, wherein: the grass crop is corn, and the herbicidal detoxification enzyme gene is designed according to SED ID No: 3 or SED ID No: 4 or SEQ ID No: 5. Expression of an antisense NA or RNAi inhibition cassette, the RNA or

The RNAi inhibition cassette and the target gene expression cassette are ligated in the same transformation and introduced into the DNA fragment, and the

The DNA fragment was introduced into corn to obtain transgenic corn.

The method according to claim 6, wherein the grass crop is rice, and the antisense RNA or RNAi inhibitory expression cassette comprises one of the following nucleotide sequence fragments: 1 SED

ID No: 6; 2 SED ID No: 7.

Ii. The method according to claim 6, wherein the grass crop is maize, and the antisense RNA or RNAi inhibitory expression cassette comprises one of the following nucleotide sequence fragments: 1 SED

ID No: 8; 2 SED ID No: 9; 3 SED ID No: 10.

The use of a transgenic gramineous crop capable of being selectively eliminated according to claim 1 in transgenic technology.

1 . A method for enhancing the herbicide resistance of a grass crop, the method comprising introducing a nucleotide sequence having herbicide resistance into a grass crop to enhance herbicide resistance of the transgenic grass crop; The amino acid sequence encoded by the nucleotide sequence has 90% or more homology with one of the following amino acid sequences: 1 SED ID No: 11; 2 SED ID No: 12; 3 SED ID No: 13.