WO2008080015A2

WO2008080015A2 - Compounds and methods for kinase modulation, and indications therefor

Info

Publication number: WO2008080015A2
Application number: PCT/US2007/088443
Authority: WO
Inventors: Prabha N. Ibrahim; Ryan Bremer; Chao Zhang; Jiazhong Zhang; Klaus-Peter Hirth; Guoxian Wu; Hongyao Zhu
Original assignee: Plexxikon, Inc.
Priority date: 2006-12-21
Filing date: 2007-12-20
Publication date: 2008-07-03
Also published as: CA2673736A1; BRPI0720695A2; MX2009006688A; WO2008080001A2; WO2008080001A3; CN101641351A; IL199278A0; US20080221148A1; AU2007336811A1; JP2010514695A; US7872018B2; NO20092612L; RU2009122670A; WO2008080015A3; EP2094701A2

Abstract

Compounds active on protein kinases are described, as well as methods of using such compounds to treat diseases and conditions associated with aberrant activity of protein kinases. Formula (II), all salts, prodrugs, tautomers, and isomers thereof, wherein: t is 0, 1, 2, or 3; Z2 is N or CR12; Z6 is N or CR16; L4 is selected from the group consisting of -(CR10R11)P-NR25-(CR10R11)q-, -(CR10R11)p-X-(CR10R11)q, -(CR10R11)p-C(X)-(CR10R11)q, -(CR10R11)p-S(O)-(CR10R11)q-, -(CR10R11)p -S(O)2-(CR10R11)q-, -(CR10R11)p-C(X)NR25-(CR10R11)q-, -(CR10R11)p-S(O)2NR25-(CR10R11)q-,-(CR10R11)p-NR25C(X)-(CR10R11)q-, -(CR10R11)p-NR25S(O)2-(CR10R11)q-, -(CR10R11)p-NR25-(CR10R11)q-, and -(CR10R11)p-NR25S(O)2NR25-(CR10R11)q-; p and q are independently 0, 1, or 2 provided, however, that at least one of p and q is O.

Description

Atty. Dkt. No.: 039363-3303

COMPOUNDS AND METHODS FOR KINASE MODULATION, AND INDICATIONS

THEREFOR

RELATED PATENT APPLICATIONS

[0001] This application claims priority to U.S. Provisional App. No. 60/877,052, entitled "Compounds and Methods for Kinase Modulation, and Indications Therefor", filed December 21 , 2006, and is related to U.S. Patent App. No. 11/473.347, entitled "Compounds and Methods for Kinase Modulation, and Indications Therefor", filed June 21 , 2006, which claims the benefit of U.S. Provisional App. No. 60/731,528, entitled "Compounds and Methods for Kinase Modulation, and Indications Therefor", filed October 28, 2005, and U.S. Provisional App. No. 60/692,960, entitled "Compounds and Methods for Kinase Modulation, and Indications Therefor", filed June 22, 2005, all of which are incorporated herein by reference in their entireties and for all purposes.

FIELD OF THE INVENTION

[0002] The present invention relates to kinases and compounds which modulate kinases, and uses therefor. Particular embodiments contemplate disease indications which arc amenable to treatment by modulation of kinase activity by the compounds of the present invention.

BACKGROUND OF THE INVENTION

[0003] The information provided herein is intended solely to assist the understanding of the reader. None of the information provided nor references cited is admitted to be prior art to the present invention. Each of the references cited herein is incorporated herein by reference in its entirety.

[0004] Receptor protein kinases regulate key signal transduction cascades that control or are involved in the control of a plethora of physiological functions including cellular growth and proliferation, cell differentiation, cellular development, cell division, cell adhesion, stress response, short-range contact-mediated axonal guidance, transcription regulation, aberrant mitogenesis, angiogenesis, abnormal endothelial cell-cell or cell-matrix interactions during vascular development, inflammation, lymphohematopoietic stem cell activity, protective immunity against specific bacteria, allergic asthma, aberrant tissue-specific responses to the activation of the JNK signal transduction pathway, cell transformation, memory, apoptosis, competitive activity-dependent synapse modification at the neuromuscular synapse, immunological mediation of disease, and calcium regulation. Atty Dkt No 039363-3303

[0005] Specific disease states associated with aberrant regulation of protein kinases include, for example without limitation, acrocephalo-syndactyly type I, acute myeloid leukemia, AIDS-induced non-Hodgkm's lymphoma, Alzheimer's disease, amyotrophic lateral sclerosis, arthritis, asthma, atherosclerosis, atopic dermatitis, autoimmune diseases, bacterial infection, bladder cancer, cancer of the breast, cancer of the central nervous system, cancer ot the colon, cancer of the endometrium, cancer of the fallopian tube, cancer of the gastrointestinal tract, cancer of the ovary, heart failure, chronic myeloid leukemia, colon carcinoma, colorectal cancer, chronic obstructive pulmonary disease (COPD), Crouzon Syndrome, diabetes, diabetic nephropathy, emphysema, endometriosis, epidermoid cancer fϊbrotic disorders, gastrointestinal stromal tumor (GIST ), glomerulonephritis, Graves' disease, head injury, hepatocellular carcinoma, Hirschsprung's disease, human gliomas, immunodeficiency diseases, inflammatory disorders, ischemic stroke, Jackson-Weiss syndrome, leiomyosarcoma, leukemias, lupus nephritis, malignant melanoma, malignant nephrosclerosis, mastocytosis, mast cell rumors, melanoma of the colon, MEN2 syndromes, metabolic disorders, migraine, multiple sclerosis, myeloproliferative disorders, nephritis, neurodegenerative diseases, neurotraumatic diseases, non small cell lung cancer, organ transplant rejection, osteoporosis, pain, Parkinson's disease, Pfeiffer Syndrome, polycystic kidney disease, primary lymphoedema, prostate cancer, psoriasis, vascular restenosis, rheumatoid arthritis, dermal and tissue scarring, selective 1 -cell detect (STD), severe combined immunodeficiency (SCID), small cell lung cancer, spinal cord injury, squamous cell carcinoma, systemic lupus crythematosis, testicular cancer, thrombotic microangiopathy syndromes, Wegener's granulomatosis, X-lmked agammaglobulinemia, viral infection, diabetic retinopathy, alopecia, erectile dysfunction, macular degeneration, chronic lymphocytic leukemia (CLL), myelodysplasia syndrome (MDS), neurofibromatosis, and tuberous sclerosis

[0006] T. his application is related to the following published patent applications WO 2004024895, US 20040142864, WO 2004078923, US 20050170431 , WO 2005028624, US 20050164300, and WO 2005062795, each of which are hereby incorporated by reference herein in their entireties including all specifications, figures, and tables, and for all purposes

SUMMARY OF THE INVENTION

[0007] Compounds are contemplated that are active on protein kinases in general, including, but not limited to, AbI, Aktl , Akt2, Akt3, ALK, Alk5, A-Raf, B-Raf, Brk, Btk, Cdk2, CDK4, CDK5, CDK6, CHK 1 , c-Raf-1 , Csk, EGFR, EphAl , EphA2, EphB2, EphB4, Erk2, Fak, FGFRl , FGFR2, FGFR3, FGFR4, Flt l , Flt3, Flt4, Fms, Frk, Fyn, Gsk3α, Gsk3β, HCK, Her2/Erbb2, Her4/Erbb4, IGFlR, IKK beta, Irak4, Itk, Jakl , Jak2, Jak3, Jnkl , Ink2, Jnk3, Kdr, Kit, LCK, MAP2K1 , MAP2K2, MAP4K4, MΛPKΛPK2, Met. Mnkl , MLKl , p38, PDGFRA, PDGIHB, PDPKl Pirn 1 , Pim2, Pim3, PKC alpha, PKC beta, PKC theta, Plkl , Pyk2, Ret, ROCKl , ROCK2, Ron, Src, Stk6, Syk, I EC, Fie2, TrkA, TrkB, Yes, and/or Zap70, including any mutations of these kinases In some aspects, the Atty, Dkt. No. : 039363-3303 compounds are active on protein kinases including, but not limited to. Fms, Kit, MAP4K4, TrkA, and/or TrkB, including any mutations thereof. In some aspects, compounds are of Formula I, Formula II, Formula III, or Formula IV as described below.

[0008] Also contemplated in accordance with the present invention are methods for the use of the above-described compounds in treating diseases and conditions associated with regulation of the activity of the above-described kinases. Thus, the use of compounds for therapeutic methods involving modulation of protein kinases is provided, as well as compounds that can be used for therapeutic methods involving modulation of protein kinases.

[0009] In some embodiments, compounds have the structure according to the following Formula I:

Formula I

all salts, prodrugs, tautomers, and isomers thereof, wherein: Q has a structure selected from the group consisting of

in which ? indicates the attachment point of Q to A of Formula I;

Z₂ is N or CR¹²; Z₄ is N or CR¹⁴; Z₅ is N or CR¹⁵; Z₆ is N or CR¹⁶;

L₂ is selected from the group consisting of -(CR¹V %-NR²⁵-(CR¹⁰R¹ '),,->

-(CR¹⁰R¹¹VX-(CR¹⁰R^{1 1}),-, -(CR¹⁰R¹¹VC(X)-(CR¹V ^!)_q-, -(CR¹⁰R^{1 1}^-S(O)-(CR¹⁰R^{1 1}V, -(CR¹V)_P-S(O)₂-(CR¹ V¹)_q-, -(CR¹⁰R^{1 I})_p-C(X)NR²⁵-(CR¹⁰R")_L|-₎

-(CR¹V¹)_p-S(O)₂NR²⁵-(CR¹¹⁾R^u)₍,-, -(CR¹V ¹^-NR²⁵C(X)-(CR¹⁰R¹ ')_q-, and

-(CR¹V¹VMrS(O)₂-(CR 1¹OV_n IK¹V; Atty Dkt No 039363-3303 p and q are independently 0, 1 , or 2 provided, however, that at least one of p and q is 0, s is 1 or 2,

A is selected from the group consisting of -O-, -S-, -CR^aR^b-, -NR¹-, -C(O)-, -C(S)-, -S(O)-, and -S(O)₂-,

R^a and R^b at each occurrence are independently selected from the group consisting of lndrogen, fjuoro, -OH, -NH;, lower alkyl, lower alkoxy, lower alkylthio, mono-alkvlammo, di-alkylammo, and -NR⁸R⁹, wherein the alkyl cham(s) of lower alkyl, lower alkoxy, lower alkylthio, mono-alkylammo, or di-alkylammo arc optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylammo, di-alkylammo, and cycloalkylammo, provided, however, that any substitution of the alkyl chain carbon bound to O of alkoxy, S of thioalkyl or N of mono- or di-alkylainino is fluoro, or

R^a and R^b combine to form a 3-7 membered monocyclic cycloalkyl or 5-7 membered monocyclic heterocycloalkyl, wherein the monocyclic cycloalkyl or monocyclic heterocycloalkyl are optionally substituted with one or more substituents selected from the group consisting of halogen, -OH, -NH₂, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylammo, and cycloalkylammo,

R¹ is selected from the group consisting of hydrogen, lower alkyl, cycloalkyl, heterocycloalkyl, aryl, heteroaryl, -C(O)R⁷, -C(S)R⁷, -S(O)₂R⁷, -C(O)NHR⁷, -C(S)NHR⁷, and -S(O)₂NHR⁷, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, lower alkylthio, mono-alkylamino, di-alkylammo, and -NR⁸R⁹, wherein the alkyl chain(s) of lower alkoxy, lower alkylthio, mono-alkylamino, or di-alkylamino are optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylammo, di-alkylamino, and cycloalkylammo, provided, however, that any substitution of the alkyl chain carbon bound to O of alkoxy, S of thioalkyl or N of mono- or di-alkylammo is fluoro, further provided that when R¹ is lower alkyl, any substitution on the lower alkyl carbon bound to the N of -NR¹- is fluoro, and wherein cycloalkyl, heterocycloalkyl, aryl or heteroaryl are optionally substituted with one or more substituents selected from the group consisting of halogen, -OH, -NH₂, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylammo,

R⁷ is selected from the group consisting of lower alkyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents Atty Dkt No 039363-3303 selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxv, lower alkylthio, mono-alkylaπnno, di-alkylammo, and -NR⁸R⁹, provided however, that any substitution of the alkyl carbon bound to the N of -C(O)NHIf, -C(S)NHR' or -S(O)₂NHR⁷ is fluoro, wherein the alkyl cham(s) of lower alkoxy, lower alkylthio, mono-alkylamino, or di-alkylamino are optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH;, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylammo, and cycloalkylamino provided, however, that any substitution of the alkyl chain carbon bound to O of alkoxy, S of thioalkyl or N of mono- or di-alkylammo is fluoro, and wherein cycloalkyl, heterocycloalkyl, aryl and heteroaryl are optionally substituted with one or more substituents selected from the group consisting of halogen, -OH, -NH₂, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino, each of R⁴, R⁵, R⁶, R¹², R¹⁴, R¹⁵, and R¹⁶, are independently selected from the group consisting of hydrogen, halogen, optionally substituted lower alkyl, optionally substituted lower dlkenyl, optionally substituted lower alkynyl, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, optionally substituted heteroaryl, -CN, -NOi, -CR^aR^bR²⁶, and -LR²⁶,

L at each occurrence is independently selected from the group consisting of -(alk)_d-X-(alk)_b- -(alk)_a-NR²⁵-(alk)_b-, -(alk),-C(X)-(alk)_b-, -(alk)_a-S(O)-(alk)_b-, -(alk)_a-S(O)₂-(alk)_b-, -(alk)_η-OC(X)-(alk)_b-, -(alk)_a-C(X)O-(alk)_b-, -(alk)_a-C(X)NR²⁵-(alk)_b-, -(alk)_a-S(O)₂NR²⁵-(alk)_b-, -(alk)_a-NR²⁵C(X)-(alk)_b-, -(alk)_a-NR²⁵S(O)₂-(alk)_b-, -(alk)_a-NR²⁵C(X)O-(alk)_b-, -(alk)_a-OC(X)NR²⁵-(alk)_b-, -(alk)_a-NR²³C(X)NR²⁵-(alk)_b-, and -(alk)_a-NR²'S(O)₂NR²⁵-(alk)_b-, a and b are independently O or 1 , alk at each occurrence is independently C) •) alkylene or C| ₃ alkylcne substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkyl, lower alkoxy, lower alkylthio, mono-alkylammo, di-alkylamino, and -NR^SR⁹, wherein lower alkyl or the alkyl chdin(s) of lower alkoxy, lower alkylthio, mono-alkylamino or di-alkylamino are optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylammo, di-alkylammo and cycloalkylamino, provided, however, that any substitution of the alkyl chain carbon bound to O of alkoxy, S of thioalkyl or N of mono- or di-alkylamino is fluoro, X at each occurrence is independently O or S, Atty Dkt No 039363-3303

R^" at each occurrence is independently selected from the group consisting of hydrogen, optionall} substituted lower alkyl, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, and optionally substituted heteroarvl, R ^ft at each occurrence is independently selected from the group consisting of h>drogcn provided, bowe\er, that hydrogen is not bound to any of S(O) S(O)₂, C(O) or C(S) of L, optionally substituted low er alkyl, optionally substituted low er alkenyl provided, however, that when R^"' is optionally substituted lower alkenyl, no alkene carbon thereof is bound to N, S, O, S(O), S(O)₂, C(O) or C(S) of L, optionally substituted lower alkynyl, provided, however, that when R^2β is optionally substituted lower alkynyl, no alkyne carbon thereof is bound to N, S, O, S(O), S(O)₂, C(O) or C(S) of L, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, and optionally substituted heteroaryl, R¹⁰ and R¹¹ at each occurrence are independently selected from the group consisting of hydrogen, fluoro, lower alkyl, and lower alkyl optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylammo, di- alkylammo, and cycloalkylammo, or any two of R¹⁰ and R" on the same or adjacent carbon atoms combine to form a 3-7 membered monocyclic cycloalkyl or 5-7 membered monocyclic heterocycloalkyl, and any others of R¹⁰ and R^{1 1} are independently selected from the group consisting of hydrogen, fluoro, lower alkyl, and lower alkyl optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylammo, and cycloalkylammo, and wherein the monocyclic cycloalkyl or monocyclic heterocycloalkyl are optionally substituted with one or more substituents selected from the group consisting of halogen, -OH, -NH₂, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylammo, di-alkylamino, and cycloalkylammo, R⁸ and R⁹ combine with the nitrogen to which they are attached to form a 5-7 membered heterocycloalkyl optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkyl, fluoro substituted lower alkyl, lower alkoxy. fluoro substituted lower alkoxy, lower alkylthio, and fluoro substituted lower alkylthio, R¹⁷ is selected from the group consisting of hydrogen, halogen, optionally substituted lower alkyl and -OR¹⁵, each of R¹¹ and R¹³ are independently selected from the group consisting of optionally substituted aryl, optionally substituted heteroaryl, optionally substituted cycloalkyl, and optionally substituted heterocycloalkyl, Atty. Dkt. No. : 039363-3303

R³² is selected from the group consisting of hydrogen, optionally substituted lower alkyl, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, optionally substituted heteroaryl. and -OR¹⁸, and

R¹ * is hydrogen or optionally substituted lower alkyl; provided, however, that the compound is not 3-{3-[2-(tetrahydropyran-2-yloxy)-ethoxyJ-bcnzyl} - 5-thiophen-3-yl-lH-pyrrolo[2,3-b]pyridine, which has the structure

4-(4-Methyl-piperazin-l-ylmethyl)-N-[4-(lH-pyrrolo[2.3-b]pyridm-3-ylmethyl)-phenyl]- benzamide, which has the structure

[0010] In some embodiments, compounds of Formula I have the structure according to the following sub-generic structure Formula Ia:

Foπnula Ia all salts, prodrugs, tautomers and isomers thereof, wherein A, L₂, Z₂, Z₆, R⁴, R⁵, R⁶, R¹⁵, R¹⁷ and R³¹ are as defined for Formula I.

[0011] In some embodiments of compounds of Formula Ia, R⁴ and R⁶ are hydrogen, A is -O-, -CR^aR^b-, -NR¹-, or -C(O)-, preferably -CH₂- or -C(O)-, more preferably -CH₂-, R¹⁷ is selected from the group consisting of hydrogen, halogen, lower alkyl and lower alkoxy, wherein the alkyl chain of lower alkyl or lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkyl thio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino, provided, however, that any substitution on the alkyl carbon bound to the -O- of lower alkoxy is fluoro, and R¹⁵ Atty. Dkt. No.: 039363-3303 is selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy.

[0012] In some embodiments of compounds of Formula Ia, R⁴ and R⁶ are hydrogen, A is -O-, -CR^aR^b-, -NR¹-, or -C(O)-, preferably -CH₂- or -C(O)-, R¹⁷ is selected from the group consisting of hydrogen, halogen, lower alkyl and lower alkoxy, wherein the alkyl chain of lower alkyl or lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NII₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino, provided, however, that any substitution on the alkyl carbon bound to the -O- of lower alkoxy is fluoro, R¹⁵ is selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy, Z₂ is N or CR¹², Z₆ is N or CR¹⁶, R¹² and R¹⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy, and R⁵ is selected from the group consisting of hydrogen, halogen, lower alkyl, lower alkoxy, optionally substituted aryl, optionally substituted heteroaryl, and NR²¹R²². wherein R²¹ is hydrogen or lower alkyl, and R²² is hydrogen, lower alkyl, optionally substituted aryl or optionally substituted heteroaryl, and wherein the alkyl chain of R^", R" or R²², when lower alkyl, or the alkyl chain of lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino.

[0013] In some embodiments, compounds of Formula I have the structure according to the following sub-generic structure Formula Ib:

Formula Ib all salts, prodrugs, tautomers, and isomers thereof, wherein:

A₁ is -O-, -CR⁴⁰R⁴¹-, -C(O)- or -NR⁴⁸-; Z₁₂ is N or CR⁵²; Z₁₆ is N or CR⁵⁶; Atty. Dkt. No.: 039363-3303

R⁴⁰ and R⁴¹ are independently selected from the group consisting of hydrogen, fluoro, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylammo, and cycloalkylammo; or R⁴⁰ and R ' combine to form a 3-7 membered monocyclic cycloalkyl or 5-7 membered monocyclic heterocycloalkyl, wherein the monocyclic cycloalkyl or monocyclic heterocycloalkyl is optionally substituted with one or more substituents selected from the group consisting of halogen, -OH, -NH₂, lower alkyl, fluoro substituted lower alky], lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylammo, and cycloalkylamino;

U is selected from the group consisting of -NR⁴⁸-, -S-, -O-, -NR⁴⁸CII(R⁴⁹)-, -SCH(R⁴⁹)-, -OCH(R⁴⁹)-, -C(O)NR⁴⁸-, -S(O)₂NR⁴⁸-, -CH(R⁴'^J)NR⁴⁸-, -CH(R⁴⁹)O-, -CH(R⁴⁹)S-, -NR⁴⁸C(O)-, and -NR⁴⁸S(O)₂-;

R⁵³ and R⁵³ are independently selected from the group consisting of hydrogen, halogen, lower alkyl and lower alkoxy, wherein the alkyl chain of lower alkyl or lower alkoxy is optionally substituted with fluoro, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino or cycloalkylamino, provided, however, that any substitution on the alkyl carbon bound to the -O- of lower alkoxy is fluoro; R⁵² and R⁵⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy, R⁴⁹ is selected from the group consisting of hydrogen, lower alkyl, and fluoro substituted lower alkyl;

Cy is selected from the group consisting of aryl, heteroaryl, cycloalkyl, and heterocycloalkyl; R^TO is selected from the group consisting of hydrogen, halogen, lower alkyl, lower alkoxy, aryl, heteroaryl, and NR⁵⁰R.", wherein the alkyl chain of lower alkyl or lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino, and wherein aryl and heteroaryl are optionally substituted with one or more independent substituents R²³; R⁵⁰ is hydrogen or lower alkyl optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylammo, di-alkylammo and cycloalkylamino; R⁵¹ is aryl or heteroaryl, wherein aryl and heteroaryl are optionally substituted with one or more independent substituents R^" ,

R²¹ at each occurrence is independently selected from the group consisting of -OH, -NH₂, -CN, -NO₂, -C(O)OH, -S(O)₂NH₂, -C(O)NH₂, -OR⁵⁷. -SR⁵⁷, -NR⁴⁸R⁵⁷, -NR⁴⁸C(O)R⁵⁷, Λtty. Dkt, No.: 039363-3303

-NR⁴⁸S(O)₂R⁵⁷, -S(O)₂R⁵⁷, -C(O)R⁵⁷, -C(O)OR⁵⁷, -C(O)NR⁴⁸R⁵⁷, -S(O)₂NR⁴⁸R⁵⁷, halogen, lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaryl as R²³, or as substituents of lower alkyl, are optionally substituted with one or more substituents selected from the group consisting of -OH, -NH₂, -CN, -NO₂, -C(O)OH, -S(O)₂NH₂, -C(O)NH₂, -OR⁵⁸, -SR⁵⁸, -NR⁴⁸R⁵⁸, -NR⁴⁸C(O)R⁵*, -NR⁴⁸S(O)₂R⁵⁸, -S(O)₂R⁵⁸, -C(O)R⁵⁸, -C(O)OR⁵⁸, -C(O)NR⁴⁸R⁵⁸, -S(O)₂NR⁴⁸R⁵⁸, halogen, lower alkyl, fluoro substituted lower alkyl, and cycloalkylamino; R⁵⁷ at each occurrence is independently selected from the group consisting of lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono- alkylamino, di-alkylamino, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, provided, however, that any substitution of the alkyl carbon bound to O, S, or N of -OR⁵⁷, -SR⁵⁷, -NR⁴⁸R⁵⁷, -C(O)OR⁵⁷, -C(O)NR⁴⁸R⁵⁷, or -S(O)₂NR⁴⁸R⁵⁷ is fluoro, cycloalkyl, heterocycloalkyl, aryl or heteroaryl, and wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaryl as R⁵⁷ or as substituents of lower alkyl are optionally substituted with one or more substituents selected from the group consisting of -OH, -NH₂, -CN, -NO₂, -C(O)OH, -S(O)₂NH₂, -C(O)NH₂, -OR⁵⁸, -SR⁵⁸, -NR⁴⁸R⁵⁸, -NR⁴⁸C(O)R⁵⁸, -NR⁴⁸S(O)₂R⁵⁸, -S(O)₂R⁵⁸, -C(O)R⁵⁸, -C(O)OR⁵⁸, -C(O)NR⁴⁸R⁵⁸, -S(O)₂NR⁴⁸R⁵⁸, halogen, lower alkyl, fluoro substituted lower alkyl, and cycloalkylamino;

R⁵⁸ at each occurrence is independently selected from the group consisting of lower alkyl, heterocycloalkyl and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono- alkylamino, di-alkylamino, and cycloalkylamino, provided, however, that any substitution of the alkyl carbon bound to O, S, or N of -OR⁵⁸, -SR⁵⁸, -NR⁴⁸R⁵⁸, -C(O)OR⁵⁸, -C(O)NR⁴⁸R⁵⁸, or -S(O)₂NR⁴⁸R⁵⁸ is fluoro, and wherein heterocycloalkyl and heteroaryl are optionally substituted with one or more substituents selected from the group consisting of halogen, -CN, lower alkyl, fluoro substituted lower alkyl, lower alkoxy and fluoro substituted lower alkoxy; R⁴⁸ at each occurrence is independently hydrogen or lower alkyl; and t is O, 1, 2, or 3.

[0014] In some embodiments of compounds of Formula Ib, Λ| is -CR⁴⁰R^'11- or -C(O)-, preferably -CH₂- or -C(O)-, more preferably -CH₂-. In some embodiments, A, is -CR⁴V- Or -C(O)-, preferably Atty. Dkt. No,: 039363-3303

-CH₂- or -C(O)-, more preferably -CH₂-, and R^ϊ3 and R⁵⁵ are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy. In some embodiments, L₁ is -NR⁴⁸CH(R⁴⁹)-, -SCH(R⁴⁹)-, or -OCH(R⁴⁹)-, preferably -OCH(R⁴⁹)-. In some embodiments, A, is -CR⁴⁰R⁴¹- or -C(O)-, preferably -CH₂- or -C(O)-, more preferably -CH₂-, and L, is -NR⁴⁸CH(R⁴⁹)-, -SCH(R⁴⁹)-, or -OCH(R⁴⁹)-, preferably -OCH(R⁴⁹)-.

[UU 15] In some embodiments, compounds of Formula I have the structure according to the following sub-generic structure Formula Ic;

Formula Ic all salts, prodrugs, tautomers, and isomers thereof, wherein:

A], R²³, R³⁹, Cy, and t are as defined in Formula Ib;

Z₂₂ is N or CR⁶²;

Z₂₆ is N or CR^hh; r is O, 1 , or 2; and

R⁶², R⁶³, R⁶⁵ and R⁶⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl and lower alkoxy, wherein the alkyl chain of lower alkyl or lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino, provided, however, that any substitution on the alkyl carbon bound to the -O- of lower alkoxy is fluoro.

[UOI 6] In some embodiments of compounds of Formula Ic, A₁ is -CR⁴⁰R⁴¹- or -C(O)-, preferably -CH₂- or -C(O)-. In some embodiments, A, is -CR⁴⁰R⁴¹- or -C(O)-, preferably -CH₂- or -C(O)-, and R⁶², R⁶⁴, R⁶⁵ and R⁶⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy.

[OUI 7] In some embodiments, compounds of Formula I have the structure according to the following sub-generic structure Formula Id: Atty. Dkt. No.: 039363-3303

Formula Id all salts, prodrugs, tautomers and isomers thereof, wherein A, s, Z₂, Z₆, R⁴, R⁵, R⁶, R¹⁵, R^π, and R³² are as defined for Formula I.

[0018] In some embodiments of compounds of Formula Id, R⁴ and R⁶ are hydrogen, A is -O-, -CR^aR^b-, -NR¹-, or -C(O)-, preferably -CH₂- or -C(O)-, more preferably -CH₂-, R¹⁷ is selected from the group consisting of hydrogen, halogen, lower alkyl and lower alkoxy, wherein the alkyl chain of lower alkyl or lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino, provided, however, that any substitution on the alkyl carbon bound to the -O- of lower alkoxy is fluoro, and R¹⁵ is selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy.

[0019J In some embodiments of compounds of Formula Id, R⁴ and R⁶ are hydrogen, A is -O-, -CR^aR^b-, -NR¹-, or -C(O)-, preferably -CH₃- or -C(O)-, R¹⁷ is selected from the group consisting of hydrogen, halogen, lower alkyl and lower alkoxy, wherein the alkyl chain of lower alkyl or lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino. di-alkylamino and cycloalkylamino, provided, however, that any substitution on the alkyl carbon bound to the -O- of lower alkoxy is fluoro, R¹⁵ is selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy, Z₂ is N or CR¹², Z₆ is N or CR^{l fi}, R¹² and R¹⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy, and R⁵ is selected from the group consisting of hydrogen, halogen, lower alkyl, lower alkoxy, optionally substituted aryl, optionally substituted heteroaryl, and -NR²¹R²², wherein R²¹ is hydrogen or lower alkyl, and R²² is hydrogen, lower alkyl, optionally substituted aryl or optionally substituted heteroaryl, and wherein the alkyl chain of R⁵, R²' or R²², when lower alkyl, or the alkyl chain of lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluoro substituted Atty. Dkt. No/ 039363-3303 lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylammo, di-alkylamino and cycloalkylammo, further wherein R³² is optionally substituted lower alkyl or -OR¹⁸, where R¹⁸ is as defined for Formula I.

[0020] In some embodiments, compounds of Formula I have the structure according to the follow mg sub-generic structure Formula Ie

Formula Ie all salts, prodrugs, tautomers and isomers thereof, wherein A, s, Z₂, Z₆, R⁴, R⁵, R⁶, R¹⁵, and R¹² are as defined for Formula I.

[0021] In some embodiments of compounds of Formula Ie, R⁴ and R⁶ arc hydrogen, A is -O-, -CR^aR^b-, -NR¹-, or -C(O)-, preferably -CH₂- or -C(O)-, more preferably -CH₂-, and R¹⁵ is selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy.

[0022] In some embodiments of compounds of Formula Ie, R⁴ and R⁶ are hydrogen, A is -O-, -CR^aR^b-, -NR¹-, or -C(O)-, preferably -CH₂- or -C(O)-, R¹⁵ is selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy, Z₂ is N or CR¹², Z₆ is N or CR¹⁶, R¹² and R¹⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy, and R⁵ is selected from the group consisting of hydrogen, halogen, lower alkyl, lower alkoxy, optionally substituted aryl, optionally substituted heteroaryl, and -NR²¹R'², wherein R²¹ is hydrogen or lower alkyl, and R²² is hydrogen, lower alkyl, optionally substituted aryl or optionally substituted heteroaryl, and wherein the alkyl chain of R⁵, R²¹ or R²², when lower alkyl, or the alkyl chain of lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NII₂, lower alkoxy. fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino, further wherein R³² is optionally substituted lower alkyl or -OR¹⁸, where R¹⁸ is as defined for Formula Atty. Dkt No 039363-3303

[0023J In some embodiments, compounds of Formula I have the structure according to the following sub-generic structure Formula If

Formula If all salts, prodrugs, tautomers and isomers thereof, wherein A, L₂, Z₂, Z₄, Z₅, Z₆, R⁴, R⁵, R⁶, and R^3? are as defined for Formula I

[0024] In some embodiments of compounds ol Formula If, R⁴ and R⁶ are hydrogen, A is -O-, -CR^aR^b-, -NR¹-, or -C(O)-, preferably -CH₂- or -C(O)-, Z₂ is N or CR¹², Z₄ is N or CR¹⁴, Z₅ is N or CR¹⁵, Zh is N or CR¹⁶, and R¹², R¹⁴, R¹⁵ and R¹⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl and lower alkoxy, wherein the alkyl chain of lower alkyl or lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylammo, di-alkylammo and cycloalkylammo, provided, however, that any substitution on the alkyl carbon bound to the -O- of lower alkoxy is fluoro

[0025] In some embodiments of compounds of Formula If, R⁴ and R⁶ are hydrogen, A is -O-, -NR¹-, or -C(O)-, preferably -CH₂- or -C(O)-, Z₂ is N or CR¹², Z₄ is N or CR¹⁴, Z₅ is N or CR¹⁵, Z₆ is N or CR¹⁶, R¹², R¹⁴, R¹⁵ and R¹⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl and lower alkoxy, wherein the alkyl chain of lower alkyl or lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylammo, provided, however, that any substitution on the alkyl carbon bound to the -O- of lower alkoxy is fluoro, and R' is selected from the group consisting of hydrogen, halogen, lower alkyl, lower alkoxy, optionally substituted aryl, optionally substituted heteroaryl, and NR²¹R", wherein R²¹ is hydrogen or lower alkyl and R²² is hydrogen, lower alkyl, optionally substituted aryl or optionally substituted heteroaryl, and wherein the alkyl chain of R⁵, R²¹ or R²², when lower alkyl, or the alkyl chain of lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylammo, di-alkylammo and cycloalkylammo

[0026] In some embodiments of compounds of Formula If, R⁴ and R⁶ are hydrogen, A is -O- -CR^dR^b-, -NR¹-, or -C(O)-, preferably -CH₂- or -C(O)-, Z₂ is N or CR¹², Z₄ is N or CR¹⁴, Z₅ is N or Atty. Dkt. No.: 039363-3303

CR ⁵, Z₆ is N or CR¹⁶, R¹², R¹⁴, R¹⁵ and R¹⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fhioro substituted lower alkoxy, and R⁵ is selected from the group consisting of hydrogen, halogen, lower alkyl, lower alkoxy, optionally substituted aryl, optionally substituted heteroaryl, and NR²¹R²², wherein R^*1 is hydrogen or lower alkyl, and R²² is hydrogen, lower alkyl, optionally substituted aryl or optionally substituted heteroaryl, and wherein the alkyl chain of R⁵, R²¹ or R²², when lower alkyl, or the alkyl chain of lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino.

[0027] In some embodiments, compounds of Formula I have the structure according to the following sub-generic structure Formula Ig:

Formula Ig all salts, prodrugs, tautomers, and isomers thereof, wherein:

A,, L₃, Z₁₂, Z₍₆, R²³, R³⁹, Cy and t are as defined for Formula Ib;

Z₁₄ is N or CR⁵⁴;

and

R⁵⁴ and R⁵⁵ are independently selected from the group consisting of hydrogen, halogen, lower alkyl and lower alkoxy, wherein the alkyl chain oflower alkyl or lower alkoxy is optionally substituted with fluoro, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino or cycloalkylamino, provided, however, that any substitution on the alkyl carbon bound to the -O- of lower alkoxy is fluoro.

[0028] In some embodiments of compounds of Formula Ig, A₁ is -CR⁴⁰R⁴¹- or -C(O)-, preferably -CH₂- or -C(O)-, more preferably -CH₂-. In some embodiments, A₁ is -CR⁴⁰R⁴¹- or -C(O)-, preferably -CH₂- or -C(O)-, more preferably -CII₂-, and R⁵⁴ and R⁵⁵ are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy. In some embodiments, L₃ is -NR⁴⁸CH(R⁴⁹)-, -SCH(R⁴⁹)-, or -OCH(R⁴⁹)-, Atty. Dkt, No.: 039363-3303 preferably -OCH(R⁴⁹)-. In some embodiments, A₁ is -CR⁴⁰R⁴¹ - or -C(O)-, preferably -CH₂- or -C(O)- more preferably -CH₂-, and L₃ is -NR⁴⁸CH(R⁴⁹)-, -SCH(R⁴⁹)-, or -OCH(R⁴⁹)-, preferably -OCH(R⁴⁹)-

[0029] In some embodiments, compounds of Formula I have the structure according to the following sub-generic structure Formula Ih:

Formula Ih all salts, prodrugs, tautomers and isomers thereof, wherein A, Z₂, Z₄, Z₅, Z₆, R⁴, R⁵, R⁶, R'⁰, R" and R³³ are as defined for Formula I, and r is 0, 1 , or 2.

[0030] In some embodiments of compounds of Formula Di, R⁴ and R⁶ are hydrogen, A is -O-, -CR^aR^b-, -NR¹-, or -C(O)-, preferably -CH₂- or -C(O)-, Z₂ is N or CR¹², Z₄ is N or CR¹⁴, Z₅ is N or CR¹⁵, Z₆ is N or CR¹⁶, and R¹², R¹⁴, R¹⁵ and R¹⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl and lower alkoxy, wherein the alkyl chain of lower alkyl or lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NII₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino, provided, however, that any substitution on the alkyl carbon bound to the -O- of lower alkoxy is fluoro.

[0031] In some embodiments of compounds of Formula Ih, R⁴ and R⁶ are hydrogen, A is -O-, -CR^aR^b-, -NR¹-, or -C(O)-, preferably -CH₂- or -C(O)-, Z₂ is N or CR¹², Z₄ is N or CR¹⁴, Z₅ is N or CR¹⁵, Z₆ is N or CR¹⁶, R¹², R¹⁴, R¹⁵ and R¹⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl and lower alkoxy, wherein the alkyl chain of lower alkyl or lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino, provided, however, that any substitution on the alkyl carbon bound to the -O- of lower alkoxy is fluoro, R¹⁰ and R¹¹ are independently selected from the group consisting of hydrogen, fluoro, lower alkyl, and fluoro substituted lower alkyl, and R⁵ is selected from the group consisting of hydrogen, halogen, lower alkyl, lower alkoxy, optionally substituted aryl, optionally substituted heteroaryl, and NR" ¹R²², wherein R²¹ is hydrogen or lower alkyl, and R²² is hydrogen, lower alkyl, optionally substituted aryl or optionally substituted heteroaryl, and wherein the alkyl chain of R³, R²¹ or R²², when lower alkyl, or the alkyl chain of lower alkoxy is optionally substituted with one or more substituents selected from Atty. Dkt. No.; 039363-3303 the group consisting of fluoro, -OH, -NHj, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino,

[0032] In some embodiments of compounds of Formula Ih, R⁴ and R⁶ are hydrogen, A is -O-, -CR^aR^b-, -NR¹-, or -C(O)-, preferably -CH₂- or -C(O)-, Z₂ is N or CR¹², Z₄ is N or CR¹⁴, Z₅ is N or CR¹⁵, Z₆ is N or CR¹⁶, R¹², R¹⁴, R¹⁵ and R¹⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy, R¹⁰ and R^{1 1} are independently selected from the group consisting of hydrogen, fluoro. lower alkyl, and fluoro substituted lower alkyl, and R⁵ is selected from the group consisting of hydrogen, halogen, lower alkyl, lower alkoxy, optionally substituted aryl, optionally substituted heteroaryl, and NR²¹R²², wherein R²¹ is hydrogen or lower alkyl, and R²² is hydrogen, lower alkyl, optionally substituted aryl or optionally substituted heteroaryl, and wherein the alkyl chain of R⁵, R²¹ or R²², when lower alkyl, or the alkyl chain of lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino.

[0033J In some embodiments, compounds of Formula I have the structure according to the following sub-generic structure Formula Ii:

Formula Ii all salts, prodrugs, tautomers, and isomers thereof, wherein:

A), R²³, R³⁹, Cy and t are as defined for Formula Ib;

Z₂₂, ^₂₆, and r are as defined for Formula Ic;

Z₂₄ is N or CR⁶⁴;

Z₂₅ is N or CR⁶⁵;

R^M and R^6S are independently selected from the group consisting of hydrogen, halogen, lower alkyl and lower alkoxy, wherein the alkyl chain of lower alkyl or lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower Atty. Dkt. No,: 039363-3303 alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino, provided, however, that any substitution on the alkyl carbon bound to the -O- of lower alkoxy is fluoro.

[0034] In some embodiments of compounds of Formula Ii, A] is -CR⁴⁰R⁴¹ - or -C(O)-, preferably -CH₂- or -C(O)- In some embodiments, A₁ is -CR⁴⁰R⁴¹- or -C(O)-, preferably -CH₂- or -C(O)-, and R ², R ⁴, R ⁵ and R⁶* are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy.

[0035] In some embodiments, compounds have the structure according to the following Formula

II:

Formula II all salts, prodrugs, tautomers, and isomers thereof, wherein: t is 0, 1 , 2, or 3;

L₄ is selected from the group consisting of -(CR^l0R^π)_p-NR²⁵-(CR^I0Rⁿ)_q-,

-(CR¹⁰R¹¹VX-(CR¹⁰R¹¹V, -(CR^I0R")_p-C(XHCR¹⁰R^π)_q-, -(CR¹⁰R^{1 1}^-S(O)-(CR¹⁰R¹ ')_q-, -(CR¹⁰R¹ VS(O)₂-(CR¹V)₀ -(CR¹⁰R¹ VC(X)NR²⁵-(CR^IOR ¹¹V, -(CR¹⁰R¹ VS(O)₂NR^2S-(CR^I0RⁿV, -(CR¹⁰R¹ ^_p-NR²⁵C(X)-(CR¹⁰R¹ ')_q-, -(CR¹⁰R¹¹J_p-NR²⁵S(O)₂-(CR¹⁰R¹¹V, -(CR^loR^π)_p-NR²⁵C(X)NR²⁵-(CR¹⁰R^{1 1})_q-, and -(CR¹⁰R¹¹)_p-NR²⁵S(O)₂NR²⁵-(CR^I0R")_q-;

R is selected from the group consisting of hydrogen, halogen, optionally substituted lower alkyl, optionally substituted lower alkenyl, optionally substituted lower alkynyl, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, optionally substituted heteroaryl, -CN, -NO₂, -CR^aR^bR²⁶, and -LR²⁶;

R is hydrogen, lower alkyl, or fluoro substituted lower alkyl; and

A, Z₂, Z₆, R^d, R^b, R⁴, R⁵, R⁶, R¹⁰, R¹ ', R¹⁵, R¹⁷, R²⁵, R²⁶, p, q, X and L are as defined for

Formula I, provided, however, that the compound is not

Atty. Dkt. No.: 039363-3303

[0036] In some embodiments of compounds of Formula II, R⁶¹ is hydrogen, lower alkyl, or fluoro substituted lower alkyl and t is 0, 1 , 2, 3 or 4, provided, however, that when t is 0, R⁶¹ is lower alkyl or fluoro substituted lower alkyl.

[0037] In some embodiments of compounds of Formula II, R⁴ and R⁶ are hydrogen and R⁵ is selected from the group consisting of hydrogen, -OH. -NH₂, -CN, -NO₂, -C(O)OH, -S(O)₂NH₂, -C(O)NH₂, -OR⁵⁷. -SR⁵⁷, -NR⁴⁸R⁵⁷, -NR⁴⁸C(O)R⁵⁷, -NR⁴⁸S(O)₂R⁵⁷, -S(O)R^5", -S(O)₂R⁵', -C(O)R⁵⁷, -C(O)OR⁵⁷, -C(O)NR⁴⁸R⁵⁷, -S(O)₇NR⁴⁸R⁵⁷, halogen, lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, C(O)OH, -C(O)NH₂, -OR⁵", -SR⁵⁷, -NR⁴⁸R⁵⁷, -C(O)OR⁵⁷, -C(O)NR^4SR⁵⁷, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, and wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaryl as R⁵, or as substituents of lower alkyl, are optionally Atty. Dkt. No.: 039363-3303

substituted with one or more substituents selected from the group consisting of -OH, -NFI₂, -CN, -NO₂, -C(O)OH, -S(O)₂NH₂, -C(O)NH₂, -OR⁵⁸, -SR⁵⁸, -NR⁴⁸R⁵⁸, -NR^4SC(O)R^5S, -NR⁴⁸S(O)₂R⁵⁸, -S(O)R⁵⁸, -S(O)₂R⁵⁸, -C(O)R⁵⁸, -C(O)OR⁵⁸, -C(O)NR⁴⁸R⁵⁸, -S(O)₂NR⁴⁸R⁵⁸, halogen, lower alkyl, fluoro substituted lower alkyl, and cycloalkylamino. wherein R⁴⁸, R⁵⁷, and R⁵⁸ are as defined for Formula Tb. In some embodiments, R⁴ and R⁶ are hydrogen and R⁵ is optionally substituted aryl or optionally substituted hcteroaryl.

[0038] In some embodiments of compounds of Formula II, R⁴ and R⁶ are hydrogen, A is -O-, -CR^aR^b-, -NR¹-, or -C(O)-, preferably -CH₂- or -C(O)-, more preferably -CH₂-, R¹⁷ is selected from the group consisting of hydrogen, halogen, lower alkyl and lower alkoxy, wherein the alkyl chain of lower alkyl or lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino. provided, however, that any substitution on the alkyl carbon bound to the -O- of lower alkoxy is fluoro, and R¹⁵ is selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy. R^a, R^b, and R¹ are as defined for Formula I.

[0039] In some embodiments of compounds of Formula II, R⁶¹ is hydrogen, lower alkyl, or fluoro substituted lower alkyl and t is O, 1, 2, 3 or 4, provided, however, that when t is 0, R⁶¹ is lower alkyl or fluoro substituted lower alkyl, R⁴ and R⁶ are hydrogen, A is -O-, -CR^aR^b-, -NR¹-, or -C(O)-, preferably -CH₂- or -C(O)-, more preferably -CH₂-, R¹⁷ is selected from the group consisting of hydrogen, halogen, lower alkyl and lower alkoxy, wherein the alkyl chain of lower alkyl or lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -Oil, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino, provided, however, that any substitution on the alkyl carbon bound to the -O- of lower alkoxy is fluoro, and R¹⁵ is selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy, R^a, R^b, and R¹ are as defined for Formula I.

[0040] In some embodiments of compounds of Formula II, R⁴ and R⁶ are hydrogen, R⁵ is selected from the group consisting of hydrogen, -OH, -NH₂, -CN, -NO₂, -C(O)OH, -S(O)₂NH,, -C(O)NII₂, -OR⁵⁷, -SR⁵⁷, -NR⁴⁸R⁵⁷, -NR⁴⁸C(O)R⁵⁷, -NR⁴⁸S(O)₂R⁵⁷, -S(O)R⁵⁷, -S(O)₂R⁵⁷, -C(O)R⁵⁷, -C(O)OR⁵⁷, -C(O)NR⁴⁸R⁵⁷, -S(O)₂NR⁴⁸R⁵⁷, halogen, lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, C(O)OH, -C(O)NH₂, -OR⁵⁷, -SR⁵⁷, -NR⁴⁸R⁵⁷, -C(O)OR⁵⁷, -C(O)NR⁴⁸R⁵⁷, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, and wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaryl as R⁵, or as substituents of lower alkyl, are optionally substituted with one or more substituents selected from the group consisting of -OH, -NH₂, -CN, Atty. Dkt. No.: 039363-3303

-NO₂, -C(O)OH, -S(O)₂NH₂, -C(O)NH₂, -OR⁵⁸, -SR⁵⁸, -NR⁴⁸R⁵⁸, -NR⁴⁸C(O)R⁵⁸, -NR⁴⁸S(O)₂R⁵⁸, -S(O)R⁵⁸, -S(O)₂R⁵⁸, -C(O)R⁵⁸, -C(O)OR⁵⁸, -C(O)NR⁴⁸R⁵⁸, -S(O)₂NR⁴⁸R⁵⁸, halogen, lower alkyl, fluoro substituted lower alkyl, and cycloalkylamino, wherein R⁴⁸, R'⁷, and R^5S are as defined for Formula Ib , A is -0-, -CR^aR^b-, -NR¹-, or -C(O)-, preferably -CH₂- or -C(O)-, more preferably -CII₂-, R is selected from the group consisting of hydrogen, halogen, lower alkyl and lower alkoxy, wherein the alkyl chain of lower alkyl or lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylammo and cycloalkylamino, provided, however, that any substitution on the alkyl carbon bound to the -O- of lower alkoxy is fluoro, and R¹⁵ is selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy. R^a, R^b, and R¹ are as defined for Formula I,

[0041] In some embodiments of compounds of Formula II, R⁴ and R⁶ are hydrogen, A is -0-, -CR^aR^b-, -NR¹-, or -C(O)-, preferably -CH₂- or -C(O)-, R¹⁷ is selected from the group consisting of hydrogen, halogen, lower alkyl and lower alkoxy, wherein the alkyl chain of lower alkyl or lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NII₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino, provided, however, that any substitution on the alkyl carbon bound to the -O- of lower alkoxy is fluoro, R¹⁵ is selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy, R¹² and R¹⁶ are independently selected from the group consisting of hydrogen, halogen, lower alky], fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy, and R⁵ is selected from the group consisting of hydrogen, halogen, lower alkyl, lower alkoxy, optionally substituted aryl, optionally substituted heteroaryl, -CN, -C(O)OH, -C(O)OR²², -OR²², -S(O)₂R²², and NR²¹R²², wherein R²¹ is hydrogen or lower alkyl, and R²² is hydrogen, lower alkyl, optionally substituted aryl or optionally substituted heteroaryl, and wherein the alkyl chain of R⁵, R²¹ or R²², when lower alkyl, or the alkyl chain of lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di- alkylamino and cycloalkylamino. R", R^b, and R¹ are as defined for Formula I.

[0042] In some embodiments of compounds of Formula II, R⁶¹ is hydrogen, lower alkyl, or fluoro substituted lower alkyl and t is O, 1, 2, 3 or 4, provided, however, that when t is O, R^ftl is lower alkyl or fluoro substituted lower alkyl, R⁴ and R⁶ are hydrogen, A is -0-, -CR^aR^b-₍ -NR¹-, or -C(O)-, preferably -CH₂- or -C(O)-, R¹⁷ is selected from the group consisting of hydrogen, halogen, lower alkyl and lower alkoxy, wherein the alkyl chain of lower alkyl or lower alkoxy is optionally Atty. Dkt. No.: 039363-3303 substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy. fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alky lamino, di-alkylamino and cycloalkylamino, provided, however, that any substitution on the alkyl carbon bound to the -O- of lower alkoxy is fluoro, R¹⁵ is selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy. and fluoro substituted lower alkoxy, R and R ⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy, and R³ is selected from the group consisting of hydrogen, halogen, lower alkyl, lower alkoxy, optionally substituted aryl, optionally substituted heteroaryl, -CN, -C(O)OH, -C(O)OR²", -OR²², -S(O)₂R²², and NR²¹R²², wherein R²¹ is hydrogen or lower alkyl, and R²² is hydrogen, lower alkyl, optionally substituted aryl or optionally substituted heteroaryl, and wherein the alkyl chain of R⁵, R²¹ or R²², when lower alkyl, or the alkyl chain of lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino. R^a, R^b, and R¹ are as defined for Formula I.

[0043] In some embodiments of any of the above embodiments of compounds of Formula II, both ofZ₂ and Z₆ are N, also one of Z₂ or Z_$ is N and the other of Z₂ or Zg is CR¹² or CR¹⁶, preferably Z₂ is CR¹⁷ and Z₆ is CR¹⁶.

[0044] In some embodiments of any of the above embodiments of compounds of Formula II, each R⁶⁰ is independently selected from the group consisting of -OH, -NH₂, -CN, -NO₂, -C(O)OH, -S(O)₂NH₂, -C(O)NH₂, -OR⁵⁷, -SR⁵⁷, -NR⁴⁸R⁵⁷, -NR⁴⁸C(O)R⁵⁷, -NR⁴⁸S(O)₂R⁵⁷, -S(O)R⁵⁷, -S(O)₂R⁵⁷, -C(O)R⁵⁷, -C(O)OR⁵⁷, -C(O)NR⁴⁸R⁵⁷, -S(O)₂NR⁴⁸R⁵⁷, halogen, lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, -C(O)OH, -C(O)NH₂, -OR⁵⁷, -SR⁵⁷, -NR⁴⁸R⁵⁷, -C(O)OR⁵⁷, -C(O)NH⁴⁸R⁵⁷, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, and wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaryl as R⁶⁰, or as substituents of lower alkyl, are optionally substituted with one or more substituents selected from the group consisting of -OH, -NH₂, -CN, -NO₂, -C(O)OH, -S(O)₂NH₂, -C(O)NH₂, -OR⁵⁸, -SR⁵⁸, -NR⁴⁸R⁵⁸, -NR⁴⁸C(O)R⁵⁸, -NR⁴⁸S(O)₂R⁵⁸, -S(O)R⁵⁸, -S(O)₂R⁵⁸, -C(O)R⁵⁸, -C(O)OR⁵⁸, -C(O)NR⁴⁸R⁵⁸, -S(O)₂NR⁴⁸R⁵⁸, halogen, lower alkyl, fluoro substituted lower alkyl, and cycloalkylamino, wherein R⁴⁸, R⁵⁷ and R⁵⁸ are as defined for Formula Ib, Z₂ is CR¹³, Z₆ is CR¹⁶, and R¹², R¹⁵, R¹⁶ and R¹⁷ are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy.

[0045] In one embodiment of compounds of Formula II, the compound is selected from the group consisting of: Atty. Dkt. No.: 039363-3303

2-[5-Chloro-4-(5-chloro-lH-pyrrolo[2,3-b]pyridin-3-ylmethyl)-2-fluoro-phenoxymethyl]-lH- benzoimidazole (P-2099),

2-[4-(5-Chloro-IH-pyrrolo[2,3-b]pyridin-3-ylmethyl)-2,5-difluoro-phenoxymethylJ-lH- benzoimidazole (P-2100),

2-[2,5-Difluoro-4-(5-methoxy-lH-pyrrolo[2,3-b]pyridin-3-ylmethyl)-phenoxymethyl]-lH- benzoimidazole (P-2101),

2-[3,5-Difluoro-4-(lH-p>τrolo[2,3-b]pyridin-3-ylmethyl)-phenoxymethyl]-lH-benzoimidazolc (P-2102),

2-[5-Chloro-2-methoxy-4-(lH-pyrrolo[2,3-b]pyridiπ-3-ylmethy])-phenoxymethyl]-lH- benzoimidazole (P-2103),

2-[5-Chloro-4-(5-chloro-lH-pyrrolo[2,3-b]pyridin-3-ylmethyl)-2-methoxy-phenoxymethyl]-lH- benzoimidazole (P-2104),

2-[4-(5-Chloro-lH-pyrrolo[2,3-b]pyridin-3-ylmethyl)-3,5-difluoro-phenoxymethyl]-lH- benzoimidazole (P-2105),

2-[4-(5 -Chloro- 1 H-pyrrolo[2,3 -b]pyridin-3-ylmethyl)-5-fluoro-2-methoxy-phenoxymethyl] - 1 -methyl - lH-benzoimidazole (P-2106),

2-[4-(5-Bromo-lH-pyrrolo[2,3-b]pyridin-3-ylmethyl)-2,5-difluoro-phenoxymcthylJ-lH- benzoimidazole (P-2107),

2-{2,5-Difluoro-4-[5-(l -methyl-lH-pyrazol-4-yl)-lH-pyrrolo[2,3-b]pyridin-3-ylmethyl]- phenoxymethyl}-lH-benzo imidazole (P-2108),

2-{5-Chloro-2-fluoro-4-[5-(l-methyl-lH-pyrazol-4-yl)-lH-pyrrolo[2,3-b]pyridin-3-ylmcthylJ- phenoxymethyl} -lH-benzoimidazole (P-2109),

2-{l-[4-(5-Chloro-lH-pyrrolo[2,3-b]pyridm-3-ylmethyl)-5-fIuoro-2-methoxy-phenoxy]-ethyl}-lH- benzoimidazole (P-2110),

6-Chloro-2-[4-(5 -chloro- lH-pyrrolo[2,3-b]pyridin-3-ylmethyl)-5-fluoro-2-methoxy-phenoxymethyl]- lH-benzoimidazolc (P-2111),

6-Chloro-2-[5-fluoro-2-methoxy-4-(lH-pyrrolo[2,3-b]pyridin-3-ylmethyl)-phenoxymethyl]-lH- benzoimidazole (P-2112),

2-[5-Fluoro-2-methoxy-4-(lH-pyrrolo[2,3-b]pyridin-3-ylmethyl)-phenoxymethyl]-6-methoxy-lH- benzoimidazole (P-2113),

2-[5-Chloro-2-fluoro-4-(5-methoxy-lH-pyrrolo[2,3-b]pyridin-3-ylmethyl)-phenoxymethyl]-lH- benzoimidazole (P-2114),

2-[5-Fluoro-4-(5-fluoro-IH-pyrrolo[2,3-b]pyridin-3-ylmethyl)-2-methoxy-phenoxymethyl]-lH- benzoimidazole (P-2115),

2-[2-Chloro-5-fluoro-4-(5-methoxy-lH-pyrrolo[2,3-bJpyridin-3-ylmethyl)-phenoxymethyl]-lH- benzoimidazole (P-2116),

2-{2-Chloro-5-fluoro-4-[5-(l -methyl-lH-pyrazol-4-yl)-lH-pyrrolo[2,3-b]pyridin-3-ylmethyl]- Atty Dkt No 039363-3303 phenoxymethyl} -lH-benzoimidazole (P-2117),

2-{4-[(5-Ch^]oro-lH-pyrrolo[2,3-b]pyridin-3-yl)-methoxy-methyl]-5-fluoro-2-methoxy- phenoxymethyl } - 1 H-benzoimidazole (P-2168),

[4-(lH-Benzoimidazol-2-ylmethoxy)-2-fluoro-5-methoxy-phenyl]-(5-chloro-lH-pyrrolo[2,3- b]pyτidm-3-yI)-methanoπe (P-2169),

2-[2,5-Difluoro-4-(5-methanesulfonyl-lH-ρyrrolo[2,3-b]pyπdin-3-ylmethyπ-phenoxymethyl]-lH- benzoimidazole (P-2170),

3-[4-(lH-Benzoimidazol-2-ylmethoxy)-2-fluoro-5-methoxy-benzyl]-lH-pyrrolo[2,3-b]pyπdine-5- carbomtnle (P-2171),

5,6-Dichloro-2-[4-(5-chloro-lH-pyrrolo[2,3-b]pyridin-3-ylmethyl)-5-fluoro-2-methoxy- phenoxymethyl]-lH-benzoimidazoIe (P-2172),

2-[4-(5-Chloro-lH-pyrrolo[2,3-b]pyridin-3-ylmethyl)-5-fluoro-2-methoxy-phenoxymethyI]-lH- benzoimidazole-5 -sulfonic acid dimethylamide (P-2173),

3-[4-(lH-Benzoimidazo]-2-ylmethoxy)-2-fluoro-5-methoxy-benzyl]-lH-pyrrolo[2,3-b]pyridine-5- carboxylit acid methyl ester (P-2174),

3-[4-(lH-Benzoimidazol-2-ylmethoxy)-2-fluoro-5-methoxy-benzyl]-lH-pyrτolo[2,3-b]pyπdine-5- carboxylic acid (P-2175),

2-{2,5-Difluoro-4-[5-(2-methoxy-ethoxy)-lII-pyrrolo[2,3-b]pyπdin-3-ylmethyl]-phenoxymethyl}-

1 H-benzoimidazole (P-2176),

2-[4-(5-Chloro-l H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-5-fluoro-2-methoxy-phenoxymethyl]-l-ethyl- lH-benzoimidazole (P-2177),

2-[4-(5-Chloro-lH-pyrrolo[2,3-b]pyridin-3-ylmethyl)-5-fluoro-2-methoxy-phenoxyinethyl]-5- tπfluoromethyl-lH-benzoimidazole (P-2178),

2-[4-(5-Chloro-lH-pyrrolo[2,3-b]pyπdin-3-ylmethyl)-5-fluoro-2-methoxy-phenoxymethyl]-5-fluoro- lH-benzoimidazole (P-2179),

2-{2-[4-(5-Chloro-lH-pyrrolo[2,3-b]pyπdin-3-ylmethyl)-5-fluoro-2-methoxy-phenoxy]-ethyl}-lH- benzoimidazole (P-2180),

2-[4-(5-Bromo-lH-pyrτolo[2,3-b]pyπdin-3-yImethyl)-5-fluoro-2-methoxy-phenoxymethyl]-lII- benzoimidazole (P-2181),

2-[4-(5-Chloro-lH-pyrrolo[2,3-b]pyπdin-3-ylmethyl)-5-fluoro-2-methoxy-pheπoxymethyl]-5- methoxy-1 H-benzo imidazole (P-2182),

5-Chloro-2-[5-fluoro-2-methoxy-4-(5-methyl-lH-pyrτolo[2,3-b]pyπdin-3-ylmethyl)-phenoxymethyl]- lH-benzomudazole (P-2184),

3-[4-(lH-Benzoimidazol-2-ylmethoxy)-2,5-difluoro-bcnzyl]-lII-pyrrolo[2,3-b]pyndine-5-carbonitnle

(P-2185),

2-[5-Fluoro-4-(5-methanesulfonyl-lH-pyrrolo[2,3-b]pyτidin-3-ylmethyl)-2-methoxy- Atty. Dkt. No.; 039363-3303 phenoxymcthyl]-lH-benzoimidazole (P-2186), and all salts, prodrugs, tautomers, and isomers thereof.

[0046] In some embodiments, compounds of Formula II have the structure according to the following sub-generic structure Formula Ha:

Formula Ha all salts, prodrugs, lautomers, and isomers thereof, wherein:

R⁶¹ is hydrogen, lower alkyl, or fluoro substituted lower alkyl;

R¹⁰⁰ is selected from the group consisting of hydrogen, -OH, -NH₂, -CN, -NO₃, -C(O)OII, -S(O)₂NH₂, -C(O)NH₂, -OR", -SR⁵⁷, -NR⁴⁸R⁵⁷, -NR⁴⁸C(O)R⁵⁷, -NR⁴⁸S(O)₂R⁵⁷, -S(O)R⁵⁷, -S(O)₂R⁵⁷, -C(O)R⁵⁷, -C(O)OR⁵⁷, -C(O)NR⁴⁸R⁵⁷, -S(O)₂NR⁴⁸R⁵⁷, halogen, lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, C(O)OH, -C(O)NH₂, -OR⁵⁷, -SR⁵⁷, -NR⁴⁸R⁵⁷, -C(O)OR⁵⁷, -C(O)NR⁴⁸R⁵⁷, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, and wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaryl as R¹⁰⁰, or as substituents of lower alkyl, are optionally substituted with one or more independent substituents R¹⁰¹;

R¹⁰¹ at each occurrence is independently selected from the group consisting of -OH, -NH₂, -CN, -NO₂, -C(O)OH, -S(O)₂NH₂, -C(O)NH₂, -OR⁵⁷, -SR⁵⁷, -NR⁴⁸R⁵⁷, -NR⁴⁸C(O)R⁵⁷, -NR⁴⁸S(O)₂R⁵⁷, -S(O)R⁵⁷, -S(O)₂R⁵⁷, -C(O)R⁵⁷, -C(O)OR⁵⁷, -C(O)NR⁴⁸R⁵⁷, -S(O)₃NR⁴⁸R⁵⁷. halogen, lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, C(O)OH, -C(O)NH₂, -OR⁵⁷, -SR⁵⁷, -NR⁴⁸R⁵⁷, -C(O)OR⁵⁷, -C(O)NR⁴V⁷, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, and wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaryl as R¹⁰¹, or as substituents of lower alkyl, are optionally substituted with one or more substituents selected from the group consisting of -OH, -NH₂, -CN, -NO₂, -C(O)OH, -S(O)₂NH₂, -C(O)NH₂, -OR⁵⁸, -SR⁵⁸, -NR⁴⁸R⁵⁸, -NR⁴³C(O)R⁵⁸, -NR⁴⁸S(O)₂R⁵⁸, Atty. Dkt. No.: 039363-3303

-S(O)R⁵³, -S(O)₂R⁵⁸, -C(O)R⁵⁸, -C(O)OR⁵⁸, -C(O)NR⁴⁸R⁵⁸, -S(O)₂NR⁴⁸R⁵⁸, halogen, lower alkyl, fluoro substituted lower alkyl, and cycloalkylamino; and Ai, Z₁₂, Z₁,, L₃, t, R⁴⁸, R⁵³, R⁵³, R⁵⁷, and R⁵⁸ are as defined for Formula Ib.

[0047] In some embodiments of compounds of Formula Ha, R⁶'' is hydrogen, lower alkyl, or fluoro substituted lower alkyl and t is 0, 1, 2, 3 or 4, provided, however, that when t is 0, R⁶¹ is lower alkyl or fluoro substituted lower alkyl.

[0048] In some embodiments of compounds of Formula Ha, R¹⁰⁰ is selected from the group consisting of hydrogen, -OH, -NH₂, -CN, -NO₂, -C(O)OH, -S(O)₂NH₂, -C(O)NH₂, -OR⁵⁷, -SR⁵⁷, -NR⁴⁸R⁵⁷, -NR⁴⁸C(O)R⁵⁷, -NR⁴⁸S(O)₂R⁵⁷, -S(O)R⁵⁷, -S(O)₂R⁵⁷, -C(O)R⁵⁷, -C(O)OR⁵⁷, -C(O)NR⁴⁸R⁵⁷, -S(O)₂NR⁴⁸R⁵⁷, halogen, lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaryl as R¹⁰⁰ or as substituents of lower alkyl are optionally substituted with one or more substituents selected from the group consisting of -OH, -NH₂, -CN, -NO₂, -S(O)₂NH₂, -C(O)NH₂, -OR⁵⁸, -SR⁵⁸, -NHR⁵⁸, -NR⁴⁸R⁵⁸, -NR⁴⁸C(O)R⁵⁸, -NR⁴⁸S(O)₂R⁵⁸, -S(O)₂R⁵⁸, -S(O)₂NR⁴⁸R⁵⁸, -C(O)R⁵⁸, -C(O)NR⁴⁸R⁵⁸, halogen, lower alkyl, fluoro substituted lower alkyl, and cycloalkylamino.

[0049] In some embodiments of compounds of Formula Ha, Aj is -CR⁴⁰R⁴¹- or -C(O)-, preferably -CH₂- or -C(O)-, more preferably -CH₂-. In some embodiments, A₁ is -CR⁴⁰R⁴¹- or -C(O)-, preferably -CH₂- or -C(O)-, more preferably -CH₂-, and R⁵³ and R⁵⁵ are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy. In some embodiments, L₃ is -NR⁴⁸CH(R⁴⁹)-, -SCH(R⁴⁹)-, or -OCH(R⁴⁹)-, preferably -OCH(R⁴⁹)-. In some embodiments, A₁ is -CR⁴⁰R⁴¹- or -C(O)-, preferably -CH₂- or -C(O)-, more preferably -CH₂-, and L₃ is -NR⁴³CH(R⁴⁹)-, -SCH(R⁴⁹)-, or -OCH(R⁴⁹)-, preferably -OCH(R⁴⁹)-. R⁴⁰, R⁴¹, R^4S and R⁴⁹ arc as defined for Formula Ib.

[0050] In some embodiments of compounds of Formula Ha, R⁶¹ is hydrogen, lower alkyl, or fluoro substituted lower alkyl and t is O, 1, 2, 3 or 4, provided, however, that when t is O, R⁶¹ is lower alkyl or fluoro substituted lower alkyl, Ai is -CR⁴⁰R⁴¹- or -C(O)-, preferably -CH₂- or -C(O)-, more preferably -CH₂-. In some embodiments, R⁶¹ is hydrogen, lower alkyl, or fluoro substituted lower alkyl and t is O, 1, 2, 3 or 4, provided, however, that when t is O, R⁶¹ is lower alkyl or fluoro substituted lower alkyl, A₁ is -CR⁴⁰R⁴¹- or -C(O)-, preferably -CH₂- or -C(O)-, more preferably -CH₂-, and R⁵³ and R⁵⁵ are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted Atty, Dkt No.: 039363-3303 lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy. In some embodiments, R⁶¹ is hydrogen, lower alkyl, or fluoro substituted lower alkyl and t is 0, 1, 2, 3 or 4, provided, however, that when t is 0, R⁶¹ is lower alkyl or fluoro substituted lower alkyl, L₃ is -NR⁴⁸CH(R⁴⁹)-, -SCH(R⁴⁹)-, or -OCH(R⁴⁹)-, preferably -OCH(R⁴⁹)-. In some embodiments, R⁶¹ is hydrogen, lower alkyl, or fluoro substituted lower alkyl and t is 0, 1, 2, 3 or 4, provided, however, that when t is 0, R⁶¹ is lower alkyl or fluoro substituted lower alkyl, A, is -CR⁴⁰R⁴¹- or -C(O)-, preferably -CH₂- or -C(O)-, more preferably -CH₂-, and L₃ is -NR⁴⁸CH(R⁴⁹)-, -SCH(R⁴⁹)-, or -OCH(R⁴⁹)-, preferably -OCH(R*)-. R⁴⁰, R^4!. R⁴⁸ and R⁴⁹ are as defined for Formula Ib.

[0051] In some embodiments of compounds of Formula Ha, R¹⁰⁰ is selected from the group consisting of hydrogen, -OH, -NH₂, -CN, -NO₂, -C(O)OH, -S(O)₂NH₂, -C(O)NH₂, -OR⁵⁷, -SR⁵⁷, -NR⁴⁸R⁵⁷, -NR⁴⁸C(O)R⁵⁷, -NR⁴⁸S(O)₂R⁵⁷, -S(O)R⁵⁷, -S(O)₂R⁵⁷, -C(O)R⁵⁷, -C(O)OR⁵⁷, -C(O)NR⁴⁸R⁵⁷. -S(O)₂NR⁴⁸R⁵⁷, halogen, lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, and wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaryl as R¹⁰⁰ or as substituents of lower alkyl are optionally substituted with one or more substituents selected from the group consisting of -OH, -NH₂, -CN, -NO₂, -S(O)₂NH₂, -C(O)NH₂,

-SR⁵⁸, -NHR⁵⁸, -NR⁴⁸R⁵⁸, -NR^4bC(O)R⁵⁸, -NR⁴⁸S(O)₂R⁵⁸, -S(O)₂R⁵⁸, -S(O)₂NR⁴⁸R⁵⁸, -C(O)R⁵⁸, -C(O)NR⁴⁸R⁵⁸, halogen, lower alkyl, fluoro substituted lower alkyl, and cycloalkylamino; A₁ is -CR⁴⁰R⁴¹- or -C(O)-, preferably -CH₂- or -C(O)-, more preferably -CH₂-.

[0052] In some embodiments of compounds of Formula Ha, R¹⁰⁰ is selected from the group consisting of hydrogen, -OH, -NH₂, -CN, -NO₂, -C(O)OH, -S(O)₂NH₂, -C(O)NH₂, -OR⁵⁷, -SR⁵⁷, -NR⁴⁸R⁵⁷, -NR⁴⁸C(O)R'⁷, -NR⁴⁸S(O)₂R⁵⁷, -S(O)R⁵⁷, -S(O)₂R⁵⁷, -C(O)R⁵⁷, -C(O)OR⁵⁷, -C(O)NR⁴⁸R⁵⁷, -S(O)₂NR⁴⁸R⁵⁷, halogen, lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, and wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaryl as R¹⁰ or as substituents of lower alkyl are optionally substituted with one or more substituents selected from the group consisting of -OH, -NH₂, -CN, -NO₂, -S(O)₇NH₂, -C(O)NH₂, -OR⁵⁵, -SR⁵⁸, -NHR⁵⁸, -NR⁴⁸R³⁸, -NR⁴⁸C(O)R⁵⁸, -NR⁴⁸S(O)₂R⁵⁸, -S(O)₂R⁵⁸, -S(O)₂NR⁴⁸R⁵⁸, -C(O)R⁵⁸, -C(O)NR⁴⁸R⁵⁸, halogen, lower alkyl, fluoro substituted lower alkyl, and cycloalkylamino; Ai is -CR⁴⁰R⁴¹- or -C(O)-, preferably -CH₂- or -C(O)-, more preferably -CH₂-; and R⁵³ and R⁵⁵ are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy, Atty. Dkt. No.: 039363-3303

[0053] In some embodiments of compounds of Formula lla, R¹⁰⁰ is selected from the group consisting of hydrogen, -OH, -NH₂, -CN, -NO₂, -C(O)OH, -S(O)₂NII₂, -C(O)NH₂, -OR⁵⁷, -SR", -NR⁴⁸R⁵⁷, -NR⁴⁸C(O)R⁵⁷, -NR⁴⁸S(O)₂R⁵⁷, -S(O)R⁵⁷, -S(O)₂R⁵⁷, -C(O)R⁵⁷, -C(O)OR⁵⁷, -C(O)NR⁴⁸R⁵⁷, -S(O)₂NR⁴⁸R⁵⁷, halogen, lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, and wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaryl as R^1IM or as substituents of lower alkyl are optionally substituted with one or more substituents selected from the group consisting of -OH, -NH₂, -CN, -NO₂, -S(O)₂NH₂, -C(O)NH₂, -OR⁵⁸, -SR⁵⁸, -NHR⁵⁸, -NR⁴⁸R⁵⁸, -NR⁴⁸C(O)R⁵⁸, -NR⁴⁸S(O)₂R³⁸, -S(O)₂R⁵⁸, -S(O)₂NR⁴⁸R⁵⁸, -C(O)R⁵⁸, -C(O)NR⁴⁸R⁵⁸, halogen, lower alkyl, fluoro substituted lower alkyl, and cycloalkylamino; L₃ is -NR⁴⁸CH(R⁴⁹)-, -SCH(R⁴⁹)-, or -OCH(R⁴⁹)-, preferably -OCH(R⁴⁹)-.

|0054] In some embodiments of compounds of Formula lla, R^10α is selected from the group consisting of hydrogen, -OH, -NH₂, -CN, -NO₂, -C(O)OH, -S(O)₂NH₂, -C(O)NH₂, -OR⁵⁷, -SR⁵⁷, -NR⁴⁸R⁵⁷, -NR⁴⁸C(O)R⁵⁷, -NR⁴⁸S(O)₂R⁵⁷, -S(O)R⁵⁷, -S(O)₂R⁵⁷, -C(O)R⁵⁷, -C(O)OR⁵⁷, -C(O)NR⁴⁸R⁵⁷, -S(O)₂NR⁴⁸R⁵⁷, halogen, lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, and wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaryl as R¹⁰⁰ or as substituents of lower alkyl are optionally substituted with one or more substituents selected from the group consisting of -OH, -NH₂, -CN, -NO₂, -S(O)₂NH₂, -C(O)NH₂, -OR⁵⁸, -SR⁵⁸, -NHR⁵⁸, -NR⁴⁸R⁵⁸, -NR⁴⁸C(O)R⁵⁸, -NR⁴⁸S(O)₂R⁵⁸, -S(O)₂R⁵⁸, -S(O)₂NR⁴⁸R⁵⁸, -C(O)R⁵⁸, -C(O)NR⁴⁸R⁵⁸, halogen, lower alkyl, fluoro substituted lower alkyl, and cycloalkylamino; A, is -CR⁴⁰R⁴¹- or -C(O)-, preferably -CH₂- or -C(O)-, more preferably -CH₂-; and L₃ is -NR⁴⁸CH(R⁴⁹)-, -SCH(R⁴⁹)-, or -OCH(R⁴⁹)-, preferably -OCH(R⁴⁹)-. R⁴⁰, R⁴¹, R⁴⁸ and R⁴⁹ are as defined for Formula Ib.

[0055] hi some embodiments of compounds of Formula Ha, R¹⁰⁰ is selected from the group consisting of hydrogen, -CN₁ -C(O)OH, -C(O)OR⁵⁷, -NR⁴⁸R⁵⁷, -OR⁵⁷, -S(O)₂R⁵⁷, fluoro, chloro, bromo, lower alkyl, fluoro substituted lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl or heteroaryl are optionally substituted with one or more substituents selected from the group consisting of halogen, lower alkyl, fluoro substituted lower alkyl, -NR⁴⁸R⁵⁸, -OR⁵⁸ and -S(O)₂R⁵⁸. In some embodiments, R¹⁰⁰ is selected from the group consisting of hydrogen, -CN, -C(O)OH, -C(O)OR⁵⁷, -NR⁴⁸R⁵⁷, -OR⁵⁷, -S(O)₂R⁵⁷, fluoro, chloro, bromo, lower alkyl, fluoro substituted lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl or heteroaryl are optionally substituted with one or more Atty. Dkt. No.: 039363-3303 substituents selected from the group consisting of halogen, lower alkyl, fluoro substituted lower alkyl, -NR⁴⁸R⁵⁸, -OR⁵⁸ and -S(O)₂R⁵⁸; and R^lϋl is selected from the group consisting of -OH, -NH₂, -CN, -NO₂, -C(O)OH, -C(O)NH₂, -S(O)₂NH₂-, C(O)OR⁵⁷, -NR⁴⁸R⁵⁷, -OR⁵⁷, -S(O)₂R⁵⁷, -C(O)NR⁴⁸R⁵⁷, -S(O)₂NR⁴⁸R⁵⁷, halogen, lower alkyl, fluoro substituted lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl or heteroaryl are optionally substituted with one or more substituents selected from the group consisting of halogen, lower alkyl, fluoro substituted lower alkyl, -NR⁴⁸R⁵⁸, -OR⁵⁸ and -S(O)₂R⁵⁸.

[0056] In some embodiments of compounds of Formula Ha, A, is -CH₂-; L₃ is -OCH(R¹')-; R^{I Oϋ} is selected from the group consisting of hydrogen, -CN, -C(O)OH, -C(O)OR⁵⁷, -NR^4SR⁵⁷, -OR⁵⁷, -S(O)₂R⁵⁷, fluoro, chloro, bromo, lower alkyl, fluoro substituted lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl or heteroaryl are optionally substituted with one or more substituents selected from the group consisting of halogen, lower alkyl, fluoro substituted lower alkyl, -NR⁴⁸R⁵⁸, -OR⁵⁸ and -S(O)₂R⁵⁸; Z₁₂ is CR⁵²; Z₁₆ is CR⁵"; Rⁱⁿⁱ is selected from the group consisting of -OH, -NH₂, -CN, -NO₂, -C(O)OH, -C(O)NH₂, -S(O)₂NH₂-, C(O)OR⁵⁷, -NR⁴⁸R⁵⁷, -OR⁵⁷, -S(O)₂R⁵⁷, -C(O)NR⁴⁸R⁵⁷, -S(O)₂NR⁴⁸R⁵⁷, halogen, lower alkyl, fluoro substituted lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl or heteroaryl are optionally substituted with one or more substituents selected from the group consisting of halogen, lower alkyl, fluoro substituted lower alkyl, -NR⁴⁸R⁵³, -OR⁵⁸ and -S(O)₂R⁵⁸; and R⁵², R⁵³, R⁵⁵ and R⁵⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy.

[0057] In some embodiments of any of the above embodiments of compounds of Formula Ha, both of Z₁₂ and Z_]6 are N, also one of Z_n or Zi₆ is N and the other of Z_n or Zi₆ is CR⁵² or CR⁵⁵, preferably Z_n is CR⁵² and Z₁₆ is CR⁵⁶. R⁵² and R⁵⁶ are as defined for Formula Ib.

[0058] In some embodiments, compounds of Formula II have the structure according to the following sub-generic structure Formula lib:

Atty. Dkt. No.; 039363-3303

Formula lib all salts, prodrugs, tautomers, and isomers thereof, wherein:

A| and t are as defined for Formula Ib; R¹⁰⁰, R¹⁰¹ are as defined for Formula Ha; R⁶³, R⁶⁵, Z₂₂ and Z₂β are as defined for Formula Ic; and R⁷⁰ and R⁶¹ are independently hydrogen, lower alkyl, or fluoro substituted lower alkyl.

[0059] In some embodiments of compounds of Formula lib, R⁶¹ is hydrogen, lower alkyl, or fluoro substituted lower alkyl and t is 0, 1, 2, 3 or 4, provided, however, that when t is 0, R⁶¹ is lower alkyl or fluoro substituted lower alkyl.

|0060] In some embodiments of compounds of Foπnula lib, R¹⁰⁰ is selected from the group consisting of hydrogen, -OH, -NH₂, -CN, -NO₂, -C(O)OH, -S(O)₂NH₂, -C(O)NII₂, -OR⁵⁷, -SR⁵⁷, -NR⁴⁸R⁵⁷, -NR⁴⁸C(O)R⁵⁷, -NR⁴⁸S(O)₂R⁵⁷, -S(O)R⁵⁷, -S(O)₂R", -C(O)R⁵⁷, -C(O)OR⁵⁷, -C(O)NR⁴⁸R³⁷, -S(O)₂NR⁴⁸R⁵⁷, halogen, lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, and wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaryl as R¹⁰⁰ or as substituents of lower alkyl are optionally substituted with one or more substituents selected from the group consisting of -OH, -NH₂, -CN, -NO₂, -S(O)₂NH₂, -C(O)NH₂, -OR⁵⁸, -SR⁵⁸, -NHR⁵⁸, -NR⁴⁸R⁵⁸, -NR⁴⁸C(O)R⁵⁸, -NR⁴⁸S(O)₂R⁵⁸, -S(O)₂R⁵⁸, -S(O)₂NR⁴⁸R⁵⁸, -C(O)R⁵⁸, -C(O)NR⁴⁸R⁵⁸, halogen, lower alkyl, fluoro substituted lower alkyl, and cycloalkylamino. In some embodiments, R¹⁰⁰ is selected from the group consisting of hydrogen, -CN, -C(O)OII, -C(O)OR⁵⁷, -NR⁴⁸R⁵⁷, -OR⁵⁷, -S(O)₂R⁵⁷, fluoro, chloro, bromo, lower alkyl, βuoro substituted lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl or heteroaryl are optionally substituted with one or more substituents selected from the group consisting of halogen, lower alkyl, fluoro substituted lower alkyl, -NR⁴⁸R⁵⁸, -OR⁵⁸ and -S(O)₂R⁵⁸. Atty. Dkt. No.: 039363-3303

[0061] In some embodiments of compounds of Formula lib, A₁ is -CR⁴⁰R⁴'- or -C(O)-, preferably -CH₂- or -C(O)-. In some embodiments, A, is -CR⁴⁰R⁴¹- or -C(O)-, preferably -CH₂- or -C(O)-, Z₂₂ is CR⁵², and Z₂₆ is CR⁶⁶.

[0062] In some embodiments of compounds of Formula lib, R⁶¹ is hydrogen, lower alkyl, or fluoro substituted lower alkyl and t is, 0, 1 , 2, 3 or 4, provided, however, that when t is 0, R⁶¹ is lower alkyl or fluoro substituted lower alkyl, A, is -CR⁴⁰R⁴¹- or -C(O)-, preferably -CH₂- or -C(O)-. In some embodiments, R⁶¹ is hydrogen, lower alkyl, or fluoro substituted lower alkyl and t is 0, 1 , 2, 3 or 4, provided, however, that when t is 0, R⁶¹ is lower alkyl or fluoro substituted lower alkyl, Ai is -CR⁴⁰R⁴¹- or -C(O)-, preferably -CH₂- or -C(O)-, Z₂₂ is CR⁶², and Z₂₆ is CR⁶⁶.

[0063] In some embodiments of compounds of Formula lib, R¹⁰⁰ is selected from the group consisting of hydrogen, -OH, -NH₂, -CN, -NO₂, -C(O)OH, -S(O)₂NH₂, -C(O)NH₂, -OR⁵⁷, -SR⁵⁷, -NR⁴⁸R⁵⁷, -NR⁴⁸C(O)R⁵⁷, -NR⁴⁸S(O)₂R³⁷, -S(O)R⁵⁷, -S(O)₂R⁵⁷, -C(O)R⁵⁷, -C(O)OR⁵⁷, -C(O)NTl⁴⁸R⁵⁷, -S(O)₂NR⁴⁸R⁵⁷, halogen, lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, and wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaryl as R¹⁰⁰ or as substituents of lower alkyl are optionally substituted with one or more substituents selected from the group consisting of -OH, -NH₂, -CN, -NO₂, -S(O)₂NH₂, -C(O)NH₂, -OR⁵⁸, -SR⁵⁸, -NHR⁵⁸, -NR⁴V⁸, -NR⁴⁸C(O)R⁵⁸, -NR⁴⁸S(O)₂R⁵⁸, -S(O)₂R⁵⁸, -S(O)₂NR⁴⁸R⁵⁸, -C(O)R⁵⁸, -C(O)NR⁴⁸R⁵⁸, halogen, lower alkyl, fluoro substituted lower alkyl, and cycloalkylamino; A₁ is -CR⁴⁰R⁴¹- or -C(O)-, preferably -CH₂-; and R¹⁰¹ is selected from the group consisting of -OH, -NH₂, -CN, -NO₂, -C(O)OH, -C(O)NH₂, -S(O)₂NH₂-, C(O)OR⁵⁷, -NR⁴⁸R⁵⁷, -OR⁵⁷, -S(O)₂R⁵⁷, -C(O)NR⁴⁸R⁵⁷, -S(O)₂NR⁴⁸R⁵⁷, halogen, lower alkyl, fluoro substituted lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl or heteroaryl are optionally substituted with one or more substituents selected from the group consisting of halogen, lower alkyl, fluoro substituted lower alkyl, -NR⁴⁸R⁵⁸, -OR⁵⁸ and -S(O)₂R⁵⁸.

[0064] In some embodiments of compounds of Formula lib, R¹⁰⁰ is selected from the group consisting of hydrogen, -CN, -C(O)OH, -C(O)OR⁵⁷, -NR⁴⁸R⁵⁷, -OR⁵⁷, -S(O)₂R⁵⁷, fluoro, chloro, bromo, lower alkyl, fluoro substituted lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl or heteroaryl are optionally substituted with one or more substituents selected from the group consisting of halogen, lower alkyl, fluoro substituted lower alkyl, -NR⁴⁸R^5S, -OR⁵⁸ and -S(O)₂R⁵⁸; A₁ is -CR⁴⁰R⁴¹- or -C(O)-, preferably -CH₂-; R¹⁰¹ is selected from the group consisting of -OH, -NH₂, -CN, -NO₂, -C(O)OH, -C(O)NH₂, -S(O)₂NH₂-, C(O)OR⁵⁷, -NR⁴⁸R⁵⁷, -OR⁵⁷, -S(O)₂R⁵⁷, -C(O)NR⁴⁸R⁵⁷, -S(O)₂NR⁴⁸R⁵⁷, halogen, lower alkyl, fluoro substituted lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl or Atty. Dkt. No.: 039363-3303 heteroaryl are optionally substituted with one or more substituents selected from the group consisting of halogen, lower alkyl, fluoro substituted lower alkyl, -NR⁴³R⁵⁸, -OR⁵⁸ and -S(O)₂R⁵ⁱ; Z₂₂ is CR^²; and Z₂₅ is CR⁶⁶.

[0065] In some embodiments of any of the above embodiments of compounds of Formula lib, both of Z₂₂ and Z₂₆ are N, also one of Z₂₂ or Z₂₆ is N and the other OfZ₂₂ or Z₂₅ is CR⁶² or CR⁶⁶, preferably

Z,- is CR^M and Z 66

-2,6_s : is CR

[0066] In some embodiments, compounds have the structure according to the following Formula HI:

Formula III all salts, prodrugs, tautomers, and isomers thereof, wherein:

A, Z₄, Z₅, Z₆, R⁴, R⁵, and R⁶, are as defined for Formula I; L.₄ is as defined for Formula II; R⁸⁰ is C_1^J alkyl or C₃_₅ cycloalkyl, wherein Ci.₃ alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro and C₃^₅ cycloalkyl; and R⁸¹ is selected from the group consisting of optionally substituted aryl, optionally substituted heteroaryl, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, C₂.₄ alkyl, fluoro substituted C₂_₄ alkyl, and -(CH₂CH₂O)_1nR⁷¹; m is 1, 2, or 3; and R⁷¹ is Cu alkyl or fluoro substituted C_1^3 alkyl, provided, however, that the compound is not

Atty. Dkt. No.: 039363-3303

[0067] In some embodiments of compounds of Formula 111, R⁸¹ is optionally substituted heteroaryl.

[0068] In some embodiments of compounds of Formula III, R⁴ and R^h are hydrogen and R⁵ is selected from the group consisting of hydrogen, -OH, -NH₂, -CN, -NO₂, -C(O)OH, -S(O)₂NH₂, -C(O)NH₂, -OR⁵⁷, -SR⁵⁷, -NR⁴⁸R⁵⁷, -NR⁴⁸C(O)R⁵⁷, -NR⁴⁸S(O)₂R⁵⁷, -S(O)R⁵⁷, -S(O)₃R⁵⁷, -C(O)R⁵⁷, -C(O)OR⁵⁷, -C(O)NR⁴⁸R⁵⁷, -S(O)₂NR⁴⁸R⁵⁷, halogen, lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fiuoro, -OH, -NH₂, -C(O)OH, -C(O)NH₂. -OR⁵⁷, -SR⁵⁷, -NR⁴⁸R⁵⁷, -C(O)OR⁵⁷, -C(O)NR⁴⁸R⁵⁷, cycloalkyl, heterocycloalkyl. aryl, and heteroaryl, and wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaryl as R⁵, or as substituents of lower alkyl, are optionally substituted with one or more substiluents selected from the group consisting of -OH, -NH₂, -CN, -NO₂, -C(O)OH, -S(O)₂NH₂, -C(O)NH₂, -OR⁵⁸, -SR⁵⁸, -NR⁴⁸R⁵⁸, -NR⁴⁸C(O)R⁵⁸, -NR⁴⁸S(O)₂R⁵⁸, Atty. Dkt. No.: 039363-3303

-S(O)R⁵⁸, -S(O)₂R⁵⁸, -C(O)R⁵⁸, -C(O)OR⁵⁸. -C(O)NR⁴⁸R⁵⁸, -S(O)₂NR⁴⁸R⁵⁸, halogen, lower alkyl, fluoro substituted lower alkyl, and cycloalkylamino, wherein R⁴⁸, R⁵⁷, and R⁵⁸ are as defined for Formula Ib. In some embodiments, R⁴ and R⁶ are hydrogen and R⁵ is optionally substituted aryl or optionally substituted heteroaryl.

[0069] In some embodiments of compounds of Formula III, R⁴ and R⁶ are hydrogen, A is -O-, -CR^aR^b-, -NR¹-, or -C(O)-. preferably -CH₂- or -C(O)-, and R¹⁴, R¹⁵ and R¹⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl and lower alkoxy, wherein the alkyl chain of lower alkyl or lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino, provided, however, that any substitution on the alkyl carbon bound to the -O- of lower alkoxy is fluoro. R^a, R^b, and R¹ are as defined for Formula I.

[0070] In some embodiments of compounds of Formula III, R⁴ and R⁶ are hydrogen, A is -O-, -CRV-, -NR¹-, or -C(O)-, preferably -CH₂- or -C(O)-, R¹⁴, R¹⁵ and R¹⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl and lower alkoxy, wherein the alkyl chain of lower alkyl or lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino, provided, however, that any substitution on the alkyl carbon bound to the -O- of lower alkoxy is fluoro, and R^S1 is optionally substituted heteroaryl. R^a, R^b, and R¹ are as defined for Formula 1.

[0071] In some embodiments of compounds of Formula III, R⁴ and R⁶ are hydrogen, R⁵ is selected from the group consisting of hydrogen, -OH, -NH₂, -CN, -NO₂, -C(O)OH, -S(O)₂NH₂, -C(O)NH₂, -OR³⁷, -SR⁵⁷, -NR⁴⁸R⁵⁷, -NR⁴⁸C(O)R⁵⁷, -NR⁴⁸S(O)₂R⁵⁷, -S(O)R⁵⁷, -S(O)₂R⁵⁷, -C(O)R⁵⁷, -C(O)OR⁵⁷, -C(O)NR⁴⁸R⁵⁷, -S(O)₂NR⁴⁸R⁵⁷, halogen, lower alkyl, cycloalkyl, hcterocycloalkyl, aryl and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, -C(O)OH, -C(O)NH₂, -OR⁵⁷, -SR⁵⁷, -NR⁴⁸R⁵⁷, -C(O)OR⁵⁷, -C(O)NR⁴⁸R⁵⁷, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, and wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaryl as R⁵, or as subslituents of lower alkyl, are optionally substituted with one or more substituents selected from the group consisting of -OH, -NH₂, -CN, -NO₂, -C(O)OH, -S(O)₂NH₂, -C(O)NH₂, -OR⁵³, -SR⁵⁸, -NR⁴⁸R⁵⁸, -NR⁴⁸C(O)R⁵⁸, -NR⁴⁸S(O)₂R⁵⁸, -S(O)R⁵⁸, -S(O)₂R⁵⁸, -C(O)R⁵⁸, -C(O)OR⁵⁸, -C(O)NR⁴⁸R⁵⁸, -S(O)₂NR⁴⁸R⁵⁸, halogen, lower alkyl, fluoro substituted lower alkyl, and cycloalkylamino, wherein R⁴⁸, R⁵⁷, and R^5S, A is -0-, -CR^aR -, -NR¹-, or -C(O)-, preferably -CH₂- or -C(O)-, and R¹⁴, R¹⁵ and R¹⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl and lower alkoxy, wherein the alkyl chain of lower alkyl or lower alkoxy is optionally substituted with one or more substituents selected from the Atty, Dkt. No. : 039363-3303 group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino, provided, however, that any substitution on the alkyl carbon bound to the -O- of lower alkoxy is fluoro. R^a, R^b, and R¹ are as defined for Formula I.

[0072] In some embodiments of compounds of Formula III, R⁴ and R⁶ are hydrogen, A is -O-, -CR^aR^b-, -NR¹-, or -C(O)-, preferably -CH₂- or -C(O)-, R¹⁴, R¹⁵ and R¹⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl and lower alkoxy, wherein the alkyl chain of lower alkyl or lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino, provided, however, that any substitution on the alkyl carbon bound to the -O- of lower alkoxy is fluoro, and R⁵ is selected from the group consisting of hydrogen, halogen, lower alkyl, lower alkoxy, optionally substituted aryl, optionally substituted heteroaryl, -CN, -C(O)OH, -C(O)OR²², -OR²², -S(O)₂R²², and NR²¹R²², wherein R²¹ is hydrogen or lower alkyl, and R²² is hydrogen, lower alkyl, optionally substituted aryl or optionally substituted heteroaryl, and wherein the alkyl chain of R⁵, R²¹ or R"⁴, when lower alkyl, or the alkyl chain of lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino. R^a, R^b, and R¹ are as defined for Formula I.

[0073] In some embodiments of compounds of Formula III, R⁴ and R⁶ are hydrogen, A is -O-, -CR^aR^b-, -NR¹-, or -C(O)-, preferably -CH₂- or -C(O)-, R¹⁴, R^{1 S} and R^lh are independently selected from the group consisting of hydrogen, halogen, lower alkyl and lower alkoxy, wherein the alkyl chain of lower alkyl or lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino, provided, however, that any substitution on the alkyl carbon bound to the -O- of lower alkoxy is fluoro, R⁵ is selected from the group consisting of hydrogen, halogen, lower alkyl, lower alkoxy, optionally substituted aryl, optionally substituted heteroaryl, -CN, -C(O)OH, -C(O)OR²², -OR²², -S(O)₂R²², and NR²¹R²², wherein R²¹ is hydrogen or lower alkyl, and R²² is hydrogen, lower alkyl, optionally substituted aryl or optionally substituted heteroaryl, and wherein the alkyl chain of R\ R²¹ or R²², when lower alkyl, or the alkyl chain of lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₃, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino, and R⁸¹ is optionally substituted heteroaryl. R^a, R^b, and R¹ are as defined for Formula I. Atty, Dkt, No.: 039363-3303

[0074] In some embodiments of compounds of Formula III, R⁴ and R⁶ are hydrogen, A is -O-, -CR^aR^b-, -NR¹-. or -C(O)-, preferably -CH₂- or -C(O)-, R¹⁴, R¹⁵ and R¹⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy, and R⁵ is selected from the group consisting of hydrogen, halogen, lower alkyl, lower alkoxy, optionally substituted aryl, optionally substituted heteroaryl, -CN, -C(O)OH, -C(O)OR²², -OR²², -S(O)₂R²², and NR²¹R²², wherein R²¹ is hydrogen or lower alkyl, and R²² is hydrogen, lower alkyl, optionally substituted aryl or optionally substituted heteroaryl, and wherein the alkyl chain of R⁵, R²¹ or R²², when lower alkyl, or the alkyl chain of lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino. R^a, R^b, and R¹ are as defined for Formula I.

[0075] In some embodiments of compounds of Formula III, R⁴ and R⁶ are hydrogen, A is -O-, -CR^aR^b-, -NR¹-, or -C(O)-, preferably -CH₂- or -C(O)-, R¹⁴, R¹⁵ and R¹⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy, and R⁵ is selected from the group consisting of hydrogen, halogen, lower alkyl, lower alkoxy, optionally substituted aryl, optionally substituted heteroaryl, -CN, -C(O)OH, -C(O)OR²², -OR²², -S(O)₂R²², and NR²¹R²², wherein R²¹ is hydrogen or lower alkyl, and R²² is hydrogen, lower alkyl, optionally substituted aryl or optionally substituted heteroaryl, and wherein the alkyl chain of R⁵, R²¹ or R²², when lower alkyl, or the alkyl chain of lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino, and R⁸¹ is optionally substituted heteroaryl. R^a, R^b, and R¹ are as defined for Formula I.

[0076] In some embodiments of any of the above embodiments of compounds of Formula III, at most two OfZ₄, Z<ι, or Z₅ are N, also at most one of Z₄, Z₅, or Z₆ is N, preferably Z₄ is CR¹⁴, Z_; is CR¹⁵ and Z₆ is CR¹⁶.

[0077] In some embodiments of any of the above embodiments of compounds of Formula III, R ' is selected from the group consisting of aryl, heteroaryl, cycloalkyl, heterocycloalkyl, CY₄ alkyl, fluoro substituted C₂-₄ alkyl, and -(CH₂CH₂O)JR⁷¹, wherein aryl, heteroaryl, cycloalkyl, or heterocycloalkyl are optionally substituted with one or more substituents selected from the group consisting of -OH, -NH₂, -CN, -NO₂, -C(O)OH, -S(O)₂NH₂, -C(O)NH₂, -OR⁵⁷, -SR⁵⁷, -NR⁴⁸R", -NR⁴⁸C(O)R⁵⁷, -NR⁴⁸S(O)₂R⁵⁷, -S(O)R⁵⁷, -S(O)₂R", -C(O)R⁵⁷, -C(O)OR⁵⁷, -C(O)NR⁴⁸R⁵⁷, -S(O)₂NR⁴⁸R⁵⁷, halogen, lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂. Atty. Dkt. No.: 039363-3303

-C(O)OH, -C(O)NH₂,

-SR⁵⁷, -NR⁴⁸R⁵⁷, -C(O)OR⁵⁷, -C(O)NR⁴⁸R⁵⁷, cycloalkyl, heterocycloalkyl, aryl. and heteroaryl, and wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaryl as a substituent of R⁸', or as substituents of lower alkyl, are optionally substituted with one or more substituents selected from the group consisting of -OH, -NH₂, -CN, -NO₂, -C(O)OH, -S(O)₂NH₂, -C(O)NH₂, -OR⁵⁸, -SR^SS, -NR⁴⁸R⁵⁸, -NR^4SC(O)R⁵⁸, -NR⁴⁸S(O)₂R⁵⁸, -S(O)R⁵⁸, -S(O)₂R⁵⁸, -C(O)R⁵⁸, -C(O)OR⁵⁸, -C(O)NR⁴⁸R⁵⁸, -S(O)₂NR⁴⁸R⁵³, halogen, lower alkyl, fluoro substituted lower alkyl, and cycloalkylamino, wherein R⁴⁸, R⁵⁷ and R⁵⁸ are as defined for Formula Ib, Z₄ is CR¹⁴, Z₅ is CR¹⁵, Z₆ is CR¹⁶, and R¹⁴, R¹⁵ and R¹⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy.

[0078] In one embodiment of compounds of Formula III, the compound is selected from the group consisting of: r3-(4-Chloro-benzyloxy)-2-(2-fluoro-ethoxy)-phenyl]-(lH-pyrrolo[2,3-b]pyridin-3-yl)-methanone

(P-2118), t3-(4-Chloro-2-fluoro-benzyloxy)-2-(2,2-difluoro-ethoxy)-phenyl]-(lH-pyrrolo[2,3-bJpyridin-3-yl)- methanone (P-2119), f3-(4-Chloro-2-fluoro-benzyloxy)-2-cyclopropylmethoxy-phenyl]-(lH-pyrrolo[2,3-b]pyridin-3-yl)- melhanone (P-2120),

[2-Ethoxy-3-(2-pyrrolidin-l-yl-ethoxy)-phenyl]-(lH-pyrrolo[2,3-b]pyridin-3-yl)-methanone (P-2121),

[2-Ethoxy-3-(6-methyl-pyridin-2-ylmethoxy)-phenyl]-(lH-pyrrolo[2,3-b]pyridin-3-yl)~methanone

(P-2122),

[3.(4-Chloro-2-fluoro-benzyloxy)-2-ethoxy-phcnyl]-(lH-pyrrolo[2,3-b]pyridin-3-yl)-mcthanone

(P-2123),

[3-(2,4-Dimethyl-thiazol-5-ylmethoxy)-2-ethoxy-phenyl]-(lH-pyrrolo[2,3-b]pyridin-3-yl)-methanone

(P-2124),

[3-(2,5-Dimethyl-2H-pyrazol-3-ylmethoxy)-2-ethoxy-phenyl]-(lH-pyrrolo[2,3-b]pyridin-3-yl)- methanone (P-2125),

[2-Ethoxy-3-(2-fluoro-benzyloxy)-phenyl]-(lH-pyrrolo[2,3-b]pyridin-3-yl)-methanone (P-2127). r2-Ethoxy-3-(6-moφholin-4-yl-pyridin-3-ylmethoxy)-phenyl]-(lH-pyrrolo[2,3-b]pyridin-3-yl)- methanone (P-2128),

[2-Ethoxy-3-(6-trifluoromethyl-pyridin-3-ylmethoxy)-phenyl]-(lH-pyrrolo[2,3-b]pyridin-3-yl)- methanone (P-2129),

[3-(2,4-Dichloro-benzyloxy)-2-ethoxy-phenyl]-(lH-pyrrolo[2,3-b]pyridin-3-yl)-methanone (P-2130). [2-Ethoxy-3-(4-imidazol-l-yl-benzyloxy)-phenyl]-(lH-pyrrolo[2,3-b]pyridin-3-yl)-methanone

(P-2131),

[3-(2,4-Difluoro-benzyloxy)-2-ethoxy-phenyl]-(lH-pyrrolo[2,3-b]pyridin-3-yl)-methanone (P-2132), {2-Ethoxy-3-[l-(2-fluoro-phenyl)-ethoxy]-phenyl}-(lH-pyrrolo[2,3-b]pyridin-3-yl)-methanone Atty Dkt No 039363-3303

(P-2133),

[3 -( 1 ^,5 -Dimethyl-1 H-pyrazol-3-ylmethoxy)-2-ethoxy-phenyl]-( 1 H-pyrrolo [2,3 -b]pyπdm-3 -yl)- methanone (P-2134),

[2-Ethoκ>-3-(l-pyπdin-4-yl-ethoxy)-phenyl]-(lH-pyττolo[2,3-b]pyπdm-3-yl)-methanone (P-2135),

[2-Ethoxy-3-((R)-l-pyndin-4-yl-ethoxy)-phenyl]-(lH-pyrrolo[2,3-b]pyndin-3-yl)-methanone

(P-2136),

[2-rthoxy-3-(2,4,6-trifluoro-ben7yloxy)-phenyl]-(lH-pyrrolo[2,3-b]pyndm-3-yl)-methanone

(P-2137),

{3-[l-(2₎4-Dichloro-phenyl)-ethoxy]-2-ethoxy-phenyl}-(lH-pyrrolo[2,3-b]pyπdm-3-yl)-raethanone

(P-2138),

[3-(4-Chloro-2-fluoro-benzyloxy)-2-(2,2,2-tπfluoro-ethoxy)-phenyl]-(lH-pyrrolo[2,3-b]pyridin-3-yl)- mcthanone (P-2139),

(5-Chloro-lH-pyrrolo[2,3-b]pyridin-3-yl)-[2-cyclopropylmethoxy-3-(2,4-dimeth>l-thiazol-5- ylmethoxy)-phenyl]-methanone (P-2140),

(5-Chloro-lH-pyrrolo[2,3-b]pyπdin-3-yl)-[2-cyclopropylmethoxy-3-(2,4,6-tπfluoro-benzyloxy)- phenyl] -methanone (P-2141).

(5-Chloro-lH-pyπOlo[2,3-b]pyndm-3-yl)-[2-cyclopropylmethoxy-3-(6-tufluoromethyl-pyπdm-3- ylmethoxy)-phenyl] -methanone (P-2142),

[3-(6-Diethylamino-pyridin-3-ylmethoxy)-2-ethoxy-phenyl]-(lH-pyrrolo[2,3-b]pyπdin-3-yI)- methanone (P-2143),

[2-Ethoxy-3-(6-pyrrohdin-l-yl-pyridin-3->lmethoxy)-phenyl]-(lH-pyrrolo[2,3-b]pyπdin-3-yl)- methanone (P-2144), and all salts, prodrugs, tautomers, and isomers thereof

[0079] In some embodiments, compounds of Formula III have the structuie according to the following sub-geneπc structure Formula Ilia

-₁

Formula Ilia all salts, prodrugs, tautomers, and isomers thereof, wherein R¹⁰⁰ and R¹⁰¹ are as defined tor Formula Ha, Atty. Dkt, No.: 039363-3303

Z₁₄ and Zi₅ are as defined for Formula Ig;

Cy is selected from the group consisting of aryl, heteroaryl, cycloalkyl, and heterocycloalk>'l;

L_3a is selected from the group consisting of -NR⁴⁸-, -S-, -O-, -NR⁴⁸CH(R⁴⁹)-, -SCH(R⁴⁹)-,

-OCH(R⁴⁹)-, -C(O)NR⁴⁸-, -S(O)₂NR⁴⁸-,

-CH(R⁴^)S-,

-NR⁴⁸C(O)-, and -NR⁴⁸S(O)₂-; R is Ci j alkyl or C₃^₅ cycloalkyl, wherein C_M alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro and C_3-, cycloalkyl; and Ai, Zi ₆, R⁴⁸, R⁴ , and t are as defined for Formula Ib.

[0080] In some embodiments of compounds of Formula Ilia, Cy is heteroaryl.

[0081] In some embodiments of compounds of Formula Ilia, R¹⁰⁰ is selected from the group consisting of hydrogen, -OH, -NH₂, -CN, -NO₂, -C(O)OH, -S(O)₂NH₂, -C(O)NH₂, -OR⁵⁷, -SR⁵⁷, -NR⁴⁸R⁵⁷, -NR⁴⁸C(O)R⁵⁷, -NR⁴⁸S(O)₂R⁵⁷, -S(O)R⁵⁷, -S(O)₂R⁵⁷, -C(O)R", -C(O)OR⁵⁷, -C(O)NR⁴⁸R⁵⁷, -S(O)₂NR⁴⁸R⁵⁷, halogen, lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, and wherein cycloalkyl, heterocycloalkyl, aryl, or heteroaryl as R¹⁰⁰ or as substituents of lower alkyl are optionally substituted with one or more substituents selected from the group consisting of -OH, -NH₂, -CN, -NO₂, -S(O)₂NH₂, -C(O)NH₂, -OR⁵⁸, -SR⁵⁸, -NHR⁵⁸, -NR⁴⁸R⁵⁸, -NR⁴⁸C(O)R⁵⁸, -NR⁴⁸S(O)₂R⁵⁸, -S(O)₂R⁵⁸, -S(O)₂NR⁴⁸R⁵⁸, -C(O)R⁵⁸, -C(O)NR⁴⁸R⁵⁸, halogen, lower alkyl, fluoro substituted lower alkyl, and cycloalkylamino. In some embodiments, R¹⁰⁰ is selected from the group consisting of hydrogen, -CN, -C(O)OH, -C(O)OR⁵⁷, -NR⁴⁸R⁵⁷, -OR⁵⁷, -S(O)₂R⁵⁷, fluoro, chloro, bromo, lower alkyl, fluoro substituted lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl or heteroaryl are optionally substituted with one or more substituents selected from the group consisting of halogen, lower alkyl, fluoro substituted lower alkyl, -NR⁴⁸R⁵⁸, -OR⁵⁸ and -S(O)₂R⁵⁸.

[0082] In some embodiments of compounds of Formula Ilia, A| is -CR⁴⁰R⁴¹- or -C(O)-, preferably -C(O)-. In some embodiments, A₁ is -CR⁴⁰R⁴¹- or -C(O)-, preferably -C(O)-, and R⁵⁴ and R³⁵ are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy. In some embodiments, L₃ is -NR⁴⁸ClI(R⁴⁹)-, -SCH(R⁴⁹)-, or -OCH(R⁴⁹)-, preferably -OCH(R⁴⁹)-. In some embodiments, A₁ is -CR⁴⁰R⁴¹- or -C(O)-, preferably -C(O)-, and L₃ is -NR⁴⁸CH(R⁴⁹)-, -SCH(R⁴⁹)-, or -OCH(R⁴⁹)-, preferably -OCH(R⁴⁹)-. Atty. Dkt. No.: 039363-3303

10083] In some embodiments of compounds of Formula Ilia, Cy is heteroaryl, Λ, is -CR⁴⁰R⁴¹- or -C(O)-, preferably -C(O)-. In some embodiments, Cy is heteroaryl, A₁ is -CR⁴⁰R⁴¹- or -C(O)-, preferably -C(O)-, and R⁵⁴ and R⁵⁵ are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy. In some embodiments, Cy is heteroaryl, Lj is -NR⁴⁸CH(R⁴⁹)-, -SCH(R⁴⁹)-, or -OCH(R⁴⁹)-, preferably -OCH(R⁴⁹)-. In some embodiments, Cy is heteroaryl, A, is -CR⁴⁰R⁴¹- or -C(O)-, preferably -C(O)-, and L₃ is -NR⁴⁸CH(R⁴⁹)-, -SCH(R⁴⁹)-, or -OCH(R⁴⁹)-, preferably -OCH(R⁴⁹)-.

[0084] In some embodiments of compounds of Formula Ilia, R¹⁰⁰ is selected from the group consisting of hydrogen, -OH, -NH₂, -CN, -NO₂, -C(O)OH, -S(O)₂NH₂, -C(O)NH₂, -OR⁵⁷, -SR³⁷, -NR⁴⁸R⁵⁷, -NR⁴⁸C(O)R⁵⁷, -NR⁴⁸S(O)₂R⁵⁷, -S(O)R⁵⁷, -S(O)₂R⁵⁷, -C(O)R⁵⁷, -C(O)OR⁵⁷, -C(O)NR⁴⁸R⁵⁷, -S(O)₂NR⁴ R³⁷, halogen, lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, and wherein cycloalkyl, heterocycloalkyl, aryl, or heteroaryl as R¹⁰⁰ or as substituents of lower alkyl are optionally substituted with one or more substituents selected from the group consisting of -OH, -NH₂, -CN, -NO₂, -S(O)₂NH₂, -C(O)NH₂, -OR⁵⁸, -SR⁵⁸, -NHR⁵⁸, -NR⁴⁸R⁵⁸, -NR⁴⁸C(O)R⁵⁸, -NR⁴⁸S(O)₂R⁵⁸, -S(O)₂R⁵⁸, -S(O)₂NR⁴⁸R⁵⁸, -C(O)R⁵⁸, -C(O)NR⁴⁸R⁵⁸, halogen, lower alkyl, fluoro substituted lower alkyl, and cycloalkylamino; A , is -CR⁴⁰R⁴¹- or -C(O)-, preferably -C(O)-.

[0085] hi some embodiments of compounds of Formula Ilia, R¹⁰⁰ is selected from the group consisting of hydrogen, -OH, -NH₂, -CN, -NO₂, -C(O)OII, -S(O)₂NH₂, -C(O)NH₂, -OR⁵⁷, -SR⁵⁷, -NR⁴⁸R⁵⁷, -NR⁴⁸C(O)R⁵⁷, -NR⁴⁸S(O)₂R⁵⁷, -S(O)R⁵⁷, -S(O)₂R⁵⁷, -C(O)R⁵⁷, -C(O)OR⁵⁷, -C(O)NR⁴⁸R⁵⁷, -S(O)₂NR⁴⁸R⁵⁷, halogen, lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, and wherein cycloalkyl, heterocycloalkyl. aryl, or heteroaryl as R¹⁰⁰ or as substituents of lower alkyl are optionally substituted with one or more substituents selected from the group consisting of -OH, -NH₂, -CN, -NO₂, -S(O)₂NH₂, -C(O)NH₂, -OR⁵⁸, -SR⁵⁸, -NHR⁵⁸, -NR⁴⁸R⁵⁸, -NR⁴⁸C(O)R⁵⁸, -NR⁴⁸S(O)₂R⁵⁸, -S(O)₂R⁵⁸, -S(O)₂NR⁴⁸R⁵⁸, -C(O)R⁵⁸, -C(O)NR⁴⁸R⁵⁸, halogen, lower alkyl, fluoro substituted lower alkyl, and cycloalkylamino; A₁ is -CR⁴⁰R⁴¹- or -C(O)-, preferably -C(O)-; and R⁵⁴ and R⁵⁵ are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy.

|0086] In some embodiments of compounds of Formula IHa, R¹⁰⁰ is selected from the group consisting of hydrogen, -OH, -NH₂, -CN, -NO₂, -C(O)OH, -S(O)₂NII₂, -C(O)NH₂, -OR⁵⁷, -SR⁵⁷, Atty. Dkt. No.: 039363-3303

-NR⁴⁸R⁵⁷, -NR^4HC(O)R⁵⁷, -NR⁴⁸S(O)₂R⁵⁷, -S(O)R⁵⁷, -S(O)₂R⁵⁷, -C(O)R⁵⁷, -C(O)OR⁵⁷, -C(O)NR⁴⁸R⁵⁷, -S(O)₂NR⁴⁸R⁵⁷, halogen, lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, lower alkoxy. fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, and wherein cycloalkyl, heterocycloalkyl, aryl, or heteroaryl as R¹⁰⁰ or as substituents of lower alkyl are optionally substituted with one or more substituents selected from the group consisting of -OH, -NH₂, -CN, -NO₂, -S(O)₂NH₂, -C(O)NH₂, -OR⁵⁸, -SR⁵⁸, -NHR⁵⁸, -NR⁴⁸R⁵⁸, -NR⁴⁸C(O)R⁵⁸, -NR⁴⁸S(O)₂R⁵⁸, -S(O)₂R⁵⁸, -S(O)₂NR⁴⁸R⁵⁸, -C(O)R⁵⁸, -C(O)NR⁴⁸R⁵⁸, halogen, lower alkyl, fluoro substituted lower alkyl, and cycloalkylamino; L₃ is -NR⁴⁸CH(R⁴⁹)-, -SCH(R⁴⁵)-, or -OCH(R⁴⁹)-, preferably -OCH(R⁴')-.

[0087] In some embodiments of compounds of Formula Ilia, R¹⁰⁰ is selected from the group consisting of hydrogen, -OH, -NH₂, -CN, -NO₂, -C(O)OH, -S(O)₂NH₂, -C(O)NH₂, -OR⁵⁷, -SR⁵⁷, -NR⁴³R⁵⁷, -NR⁴⁸C(O)R⁵⁷, -NR⁴⁸S(O)₂R⁵⁷, -S(O)R³⁷, -S(O)₂R⁵⁷, -C(O)R⁵⁷, -C(O)OR⁵⁷, -C(O)NR⁴⁸R⁵⁷, -S(O)₂NR⁴⁸R⁵⁷, halogen, lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, and wherein cycloalkyl, heterocycloalkyl, aryl, or heteroaryl as R^ltw or as substituents of lower alkyl are optionally substituted with one or more substituents selected from the group consisting of -OH, -NH₂, -CN, -NO₂, -S(O)₂NH₂, -C(O)NH₂, -OR⁵⁸, -SR⁵⁸, -NHR⁵⁸, -NR⁴⁸R⁵⁸, -NR⁴⁸C(O)R⁵⁸, -NR⁴⁸S(O)₂R⁵⁸, -S(O)₂R⁵⁸, -S(O)₂NR⁴⁸R⁵⁸, -C(O)R⁵⁸, -C(O)NR⁴⁸R⁵⁸, halogen, lower alkyl, fluoro substituted lower alkyl, and cycloalkylamino; A₁ is -CR⁴⁰R⁴¹- or -C(O)-, preferably -C(O)-; and L₃ is -NR⁴⁸CH(R⁴⁹)-, -SCH(R⁴⁹)-, or -OCH(R⁴*)-, preferably -OCH(R⁴⁹)-.

[0088] In some embodiments of compounds of Formula Ilia, R¹⁰⁰ is selected from the group consisting of hydrogen, -CN, -C(O)OH, -C(O)OR⁵⁷, -NR⁴⁸R⁵⁷, -OR⁵⁷, -S(O)₂R⁵⁷, fluoro, chloro, bromo, lower alkyl, fluoro substituted lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl or heteroaryl are optionally substituted with one or more substituents selected from the group consisting of halogen, lower alkyl, fluoro substituted lower alkyl, -NR⁴⁸R⁵⁸, -OR⁵⁸ and -S(O)₂R⁵⁸. In some embodiments, R¹⁰⁰ is selected from the group consisting of hydrogen, -CN, -C(O)OH, -C(O)OR⁵⁷, -NR⁴⁸R⁵⁷, -OR⁵⁷, -S(O)₂R⁵⁷, fluoro, chloro, bromo, lower alkyl, fluoro substituted lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl or heteroaryl are optionally substituted with one or more substituents selected from the group consisting of halogen, lower alkyl, fluoro substituted lower alkyl, -NR⁴⁸R⁵⁸. -OR⁵⁸ and -S(O)₂R'⁸; and R¹⁰¹ is selected from the group consisting of -OH, -NH₁, -CN, -NO₂, -C(O)OH, -C(O)NH₂, -S(O)₂NH₂-, C(O)OR⁵⁷, -NR⁴⁸R⁵⁷, -OR⁵⁷, -S(O)₂R⁵⁷, -C(O)NR⁴⁸R⁵⁷, T/US2007/088443

Atty. Dkt. No.: 039363-3303

-S(O)₂NR R^" , halogen, lower alkyl, fluoro substituted lower alkyl, cycloalkyl, heterocycloalkyl, aryl or heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl or heteroaryl are optionally substituted with one or more substituents selected from the group consisting of halogen, lower alkyl, fluoro substituted lower alkyl. -NR⁴⁸R⁵⁸, -OR⁵⁸ and -S(O)₂R³⁸.

[0089] In some embodiments of compounds of Formula IHa, Ai is -C(O)-; L₃ is -OCH(R⁴¹*)-; R¹⁰⁰ is selected from the group consisting of hydrogen, -CN, -C(O)OH, -C(O)OR⁵⁷. -NR⁴⁸R⁵⁷, -OR⁵⁷, -S(O)₂R³⁷, fluoro, chloro, bromo, lower alkyl, fluoro substituted lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl or heteroaryl are optionally substituted with one or more substituents selected from the group consisting of halogen, lower alkyl, fluoro substituted lower alkyl. -NR⁴⁸R⁵⁸, -OR⁵⁸ and -S(O)₂R⁵⁸; Z₁₄ is CR⁵⁴; Z₁₅ is CR⁵⁵; Z₁₆ is CR⁵⁶; R¹⁰¹ is selected from the group consisting of -OH, -NH₂, -CN, -NO₂, -C(O)OH, -C(O)NH₂, -S(O)₂NH₂-, C(O)OR⁵⁷, -NR⁴⁸R⁵⁷, -OR⁵⁷, -S(O)₂R⁵⁷, -C(O)NR⁴⁸R⁵⁷, -S(O)₂NR⁴⁸R⁵⁷, halogen, lower alkyl, fluoro substituted lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl or heteroaryl are optionally substituted with one or more substituents selected from the group consisting of halogen, lower alkyl, fluoro substituted lower alkyl, -NR⁴⁸R⁵⁸, -OR⁵⁸ and -S(O)₂R⁵⁸; and R⁵⁴, R⁵⁵ and R⁵⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy.

[0090] In some embodiments of any of the above embodiments of compounds of Formula IHa, two OfZ)₄, Z|₅, or Zi₆ are N and the other of Z₁₄, Z₁₅, or Z₁₆ is CR⁵⁴, CR⁵⁵ or CR⁵⁶, also one OfZ₁₄, Z₁₅, or Zi_fi is N and the others of Z₁₄, Z₁₅, or Z₁₆ are CR⁵⁴, CR⁵⁵ or CR⁵⁶, preferably Z₁₄ is CR⁵⁴, Z₁₃ is CR⁵⁵ and Z₎₆ is CR⁵⁵.

[0091] In some embodiments, compounds of Formula III have the structure according to the following sub-generic structure Formula HIb:

Formula IHb all salts, prodrugs, tautomers, and isomers thereof, wherein:

A, Z₄, Z₅, Z₆, R⁴, R⁵, R^h, R¹⁰, R" and R³³ are as defined for Formula I; R⁸⁰ is as defined for Formula 111; and Atty. Dkt. No.: 039363-3303 r is O, 1, or 2.

[0092] In some embodiments of compounds of Formula HIb, R." is optionally substituted heteroaryl.

[0093] In some embodiments of compounds of Formula IHb, R⁴ and R⁵ are hydrogen and R⁵ is selected from the group consisting of hydrogen, -OH, -NH₂, -CN, -NO₂, -C(O)OH, -S(O)₂NH₂, -C(O)NH₂, -OR", -SR⁵⁷, -NR⁴⁸R⁵⁷, -NR⁴⁸C(O)R⁵⁷, -NR⁴⁸S(O)₂R⁵⁷, -S(O)R⁵⁷, -S(O)₂R⁵⁷, -C(O)R³⁷, -C(O)OR⁵⁷, -C(O)NR⁴⁸R⁵⁷, -S(O)₂NR⁴⁸R⁵⁷, halogen, lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, and wherein cycloalkyl, heterocycloalkyl, aryl, or heteroaryl as R⁵ or as substituents of lower alkyl are optionally substituted with one or more substituents selected from the group consisting of -OH, -NH₂, -CN, -NO₂, -S(O)₂NH₂, -C(O)NH₂, -OR⁵⁸, -SR⁵⁸, -NHR^5S, -NR⁴⁸R⁵⁸, -NR⁴⁸C(O)R⁵⁸, -NR⁴⁸S(O)₂R⁵⁸, -S(O)₂R⁵⁸, -S(O)₂NR⁴⁸R⁵⁸, -C(O)R⁵⁸, -C(O)NR⁴⁸R^5S, halogen, lower alkyl, fluoro substituted lower alkyl, and cycloalkylamino. In some embodiments, R⁴ and R⁶ are hydrogen and R⁵ is optionally substituted aryl or optionally substituted heteroaryl,

[0094] In some embodiments of compounds of Formula HIb, R⁴ and R⁶ are hydrogen, A is -0-, -CR^aR^b-, -NR¹-, or -C(O)-, preferably -CH₂- or -C(O)-, and R¹⁴, R¹⁵ and R¹⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl and lower alkoxy, wherein the alkyl chain of lower alkyl or lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino, provided, however, that any substitution on the alkyl carbon bound to the -O- of lower alkoxy is fluoro. R^a, R^b, and R¹ are as defined for Formula I.

[0095] In some embodiments of compounds of Formula HIb, R⁴ and R⁶ are hydrogen, A is -0-, -CR^aR^b-, -NR¹-, or -C(O)-, preferably -CH₂- or -C(O)-, R¹⁴, R¹⁵ and R¹⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl and lower alkoxy, wherein the alkyl chain of lower alkyl or lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino, provided, however, that any substitution on the alkyl carbon bound to the -O- of lower alkoxy is fluoro, and R³³ is optionally substituted heteroaryl. R\ R^b, and R¹ are as defined for Formula I. Atty. Dkt. No.: 039363-3303

[0096] In some embodiments of compounds of Formula HIb, R⁴ and R⁶ are hydrogen, R⁵ is selected from the group consisting of hydrogen, -OH, -NH₂, -CN, -NO₂, -C(O)OH, -S(O)₁NH₂, -C(O)NH₂, -OR^r, -SR⁵⁷, -NR⁴⁸R⁵⁷, -NR⁴⁸C(O)R⁵⁷, -NR⁴⁸S(O)₁R", -S(O)R⁵⁷, -S(O)₂R⁵⁷, -C(O)R", -C(O)OR⁵⁷, -C(O)NR⁴⁸R⁵⁷, -S(O)₂NR⁴⁸R⁵⁷, halogen, lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, and wherein cycloalkyl, heterocycloalkyl, aryl, or heteroaryl as R⁵ or as substituents of lower alkyl are optionally substituted with one or more substituents selected from the group consisting of -OH, -NH₂, -CN, -NO₂, -S(O)₂NH₂, -C(O)NH₂, -OR⁵⁸, -SR⁵⁸, -NHR⁵⁸, -NR⁴⁸R⁵⁸, -NR⁴⁸C(O)R⁵⁸, -NR⁴⁸S(O)₂R⁵⁸, -S(O)₂R⁵⁸, -S(O)₂NR⁴⁸R⁵⁸, -C(O)R⁵⁸, -C(O)NR⁴⁸R^W, halogen, lower alkyl, fluoro substituted lower alkyl, and cycloalkylamino, A is -0-, -CR^aR^b-, -NR¹-, or -C(O)-, preferably -CH₃- or -C(O)-, and R¹⁴, R¹⁵ and R¹⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl and lower alkoxy, wherein the alkyl chain of lower alkyl or lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino, provided, however, that any substitution on the alkyl carbon bound to the -O- of lower alkoxy is fluoro. R^a, R^b, and R¹ are as defined for Formula I.

[0097] In some embodiments of compounds of Formula HIb, R⁴ and R" are hydrogen, Λ is -0-, -CR^aR^b-, -NR¹-, or -C(O)-, preferably -CH₂- or -C(O)-, R¹⁴, R¹⁵ and R¹⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl and lower alkoxy, wherein the alkyl chain of lower alkyl or lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of tluoro, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino, provided, however, that any substitution on the alkyl carbon bound to the -O- of lower alkoxy is fluoro. R¹⁰ and R^{1 1} are independently selected from the group consisting of hydrogen, fluoro, lower alkyl, and fluoro substituted lower alkyl, and R⁵ is selected from the group consisting of hydrogen, halogen, lower alkyl, lower alkoxy, optionally substituted aryl, optionally substituted heteroaryl,-CN, -C(O)OH, -C(O)OR²², -OR²², -S(O)₂R²², and NR²¹R²², wherein R²¹ is hydrogen or lower alkyl, and R²² is hydrogen, lower alkyl, optionally substituted aryl or optionally substituted heteroaryl, and wherein the alkyl chain of R³, R²¹ or R²², when lower alkyl, or the alkyl chain of lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio. mono-alkylamino, di-alkylamino and cycloalkylamino. R^a, R^b, and R¹ are as defined for Formula I. Atty, Dkt. No.: 039363-3303

[0098] In some embodiments of compounds of Formula IHb, R⁴ and R⁶ are hydrogen, A is -O-, -CR^aR^b-, -NR¹-, or -C(O)-, preferably -CH₂- or -C(O)-, R¹⁴, R^1S and R¹" are independently selected from the group consisting of hydrogen, halogen, lower alkyl and lower alkoxy, wherein the alkyl chain of lower alkyl or lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino, provided, however, that any substitution on the alkyl carbon bound to the -O- of lower alkoxy is fluoro, R^!0 and R¹¹ are independently selected from the group consisting of hydrogen, fluoro, lower alkyl, and fluoro substituted lower alkyl, R⁵ is selected from the group consisting of hydrogen, halogen, lower alkyl, lower alkoxy, optionally substituted aryl, optionally substituted heteroaryl, -CN, -C(O)OH, -C(O)OR²², -OR²², -S(O)₂R²², and NR²¹R²², wherein R²¹ is hydrogen or lower alkyl, and R²² is hydrogen, lower alkyl, optionally substituted aryl or optionally substituted heteroaryl, and wherein the alkyl chain of R⁵, R²¹ or R²², when lower alkyl, or the alkyl chain of lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino, and R³³ is optionally substituted heteroaryl. R^a, R^b, and R¹ are as defined for Formula I.

10099] In some embodiments of compounds of Formula HIb, R⁴ and R⁶ are hydrogen, A is -O-, -CR^aR^b-, -NR¹-, or -C(O)-, preferably -CH₂- or -C(O)-, R¹⁴, R¹⁵ and R¹⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy, R¹⁰ and R¹¹ are independently selected from the group consisting of hydrogen, fluoro, lower alkyl, and fluoro substituted lower alkyl, and R⁵ is selected from the group consisting of hydrogen, halogen, lower alkyl, lower alkoxy, optionally substituted aryl, optionally substituted heteroaryl, -CN, -C(O)OH, -C(O)OR²², -OR²², -S(O)₂R²², and NR²¹R²², wherein R²¹ is hydrogen or lower alkyl, and R²² is hydrogen, lower alkyl, optionally substituted aryl or optionally substituted heteroaryl, and wherein the alkyl chain of R⁵, R²¹ or R²², when lower alkyl, or the alkyl chain of lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino. R^a, R^b, and R¹ are as defined for Formula I.

[0100] In some embodiments of compounds of Formula IHb, R⁴ and R⁶ are hydrogen, A is -0-, -CR^aR^b-, -NR¹-, or -C(O)-, preferably -CH₂- or -C(O)-, R¹⁴, R¹⁵ and R¹⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy, R¹⁰ and R¹ ' are independently selected from the group consisting of hydrogen, fluoro, lower alkyl, and fluoro substituted lower alkyl, R⁵ is selected from the Atty. Dkt. No.: 039363-3303 group consisting of hydrogen, halogen, lower alkyl, lower alkoxy, optionally substituted aryl, optionally substituted heteroaryl, -CN, -C(O)OH, -C(O)OR²², -OR²², -S(O)₂R²², and NR²¹R²², wherein R^" is hydrogen or lower alkyl, and R²² is hydrogen, lower alkyl, optionally substituted aryl or optionally substituted heteroaryl, and wherein the alkyl chain of R⁵, R²¹ or R²², when lower alkyl, or the alkyl chain of lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH. -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino, and R³³ is optionally substituted heteroaryl. R^a, R^b, and R¹ are as defined for Formula I.

[0101] In some embodiments of any of the above embodiments of compounds of Formula HIb, two OfZ₄, Z₅, or Z₆ are N and the other of Z₄, Z₅, or Z₆ is CR¹⁴, CR¹⁵ or CR¹⁶, also one of Z₄, Z₅, or Z₆ is N and the others of Z₄, Z,, or Z₆ are CR¹⁴, CR¹⁵ or CR¹⁶, preferably Z₄ is CR¹⁴, Z₅ is CR¹⁵ and Z₅ is CR¹⁶.

[0102] In some embodiments of any of the above embodiments of compounds of Formula Mb, R³³ is aryl, heteroaryl, cycloalkyl or heterocycloalkyl, wherein aryl, heteroaryl, cycloalkyl, or heterocycloalkyl are optionally substituted with one or more substituents selected from the group consisting of -OH, -NH₂, -CN, -NO₂, -C(O)OH, -S(O)₂NH₂, -C(O)NH₂, -OR⁵⁷, -SR⁵⁷, -NR⁴⁸R⁵⁷, -NR⁴⁸C(O)R⁵⁷, -NR⁴⁸S(O)₂R⁵⁷, -S(O)R⁵⁷, -S(O)₂R⁵⁷, -C(O)R⁵⁷, -C(O)OR⁵⁷, -C(O)NR⁴⁸R⁵⁷, -S(O)₂NR⁴⁸R⁵⁷, halogen, lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, C(O)OH, -C(O)NH₂, -OR⁵⁷, -SR⁵⁷, -NR⁴⁸R⁵⁷, -C(O)OR⁵⁷, -C(O)NR⁴⁸R⁵⁷, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, and wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaryl as a substituent of R³³, or as substituents of lower alkyl, are optionally substituted with one or more substituents selected from the group consisting of -OH, -NH₂, -CN, -NO₂, -C(O)OH, -S(O)₂NH₂, -C(O)NH₂, -OR⁵⁸, -SR⁵⁸, -NR⁴⁸R⁵⁸, -NR⁴⁸C(O)R⁵⁸, -NR⁴³S(O)₂R⁵⁸, -S(O)R⁵⁸, -S(O)₂R⁵⁸, -C(O)R⁵⁸, -C(O)OR⁵⁸, -C(O)NR⁴⁸R⁵⁸, -S(O)_?NR⁴⁸R⁵⁸, halogen, lower alkyl, fluoro substituted lower alkyl, and cycloalkylamino, wherein R⁴⁸, R⁵⁷ and R⁵⁸ are as defined for Formula Ib. Z₄ is CR¹⁴, Z₅ is CR¹⁵, Z₆ is CR¹⁰, and R¹⁴, R¹⁵ and R¹⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy.

[0103] In some embodiments, compounds of Formula III have the structure according to the following sub-generic structure Formula IHc: Atty. Dkt. No.: 039363-3303

Formula IIIc all salts, prodrugs, tautomers, and isomers thereof, wherein:

Ai, Cy and t are as defined for Formula Ib; R^lM and R¹⁰¹ arc as defined for Formula Ha; R⁸⁰ is as defined for Formula Ilia; Z₂₆ and r are as defined for Formula Ic; and Z₂₄ and Z₂₅ are as defined for Formula Ii.

[0104] In some embodiments of compounds of Formula IIIc, Cy is heteroaryl.

[0105] In some embodiments of compounds of Formula IIIc, R^luo is selected from the group consisting of hydrogen, -OH, -NH₂, -CN, -NO₂, -C(O)OH, -S(O)₂NH₂, -C(O)NH₂, -OR⁵¹, -SR⁵⁷, -NR⁴⁸R⁵⁷, -NR⁴⁸C(O)R⁵⁷, -NR⁴⁸S(O)₂R⁵⁷, -S(O)R⁵⁷, -S(O)₂R⁵⁷, -C(O)R⁵⁷, -C(O)OR⁵⁷, -C(O)NR⁴⁸R⁵⁷, -S(O)₂NR⁴⁸R⁵⁷, halogen, lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, and wherein cycloalkyl, heterocycloalkyl, aryl, or heteroaryl as R¹⁰⁰ or as substituents of lower alkyl are optionally substituted with one or more substituents selected from the group consisting of -OH, -NH₂, -CN, -NO₂, -S(O)₂NH₂, -C(O)NH₂, -OR⁵⁸, -SR⁵⁸, -NHR⁵⁸, -NR⁴⁸R⁵⁸, -NR⁴⁸C(O)R⁵⁸, -NR⁴³S(O)₂R⁵⁸, -S(O)₂R⁵⁸, -S(O)₂NR⁴⁸R⁵⁸, -C(O)R⁵⁸, -C(O)NR^4SR⁵⁸, halogen, lower alkyl, fluoro substituted lower alkyl, and cycloalkylamino. In some embodiments, R¹⁰⁰ is selected from the group consisting of hydrogen, -CN, -C(O)OH, -C(O)OR⁵⁷, -NR⁴⁸R⁵⁷, -OR⁵⁷, -S(O)₂R⁵⁷, fluoro, chloro, bromo, lower alkyl, fluoro substituted lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl or heteroaryl are optionally substituted with one or more substituents selected from the group consisting of halogen, lower alkyl, fluoro substituted lower alkyl, -NR⁴⁸R⁵⁸, -OR⁵⁸ and -S(O)₂R⁵⁸.

[0106] In some embodiments of compounds of Formula IIIc, Aj is -CR⁴⁰R⁴¹- or -C(O)-, preferably -CH₂- or -C(O)-. In some embodiments, A₁ is -CR⁴⁰R⁴¹- or -C(O)-, preferably -CH₂- or -C(O)-, and Atty. Dkt. No.: 039363-3303

R , R and R ' are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy,

[0107] In some embodiments of compounds of Formula IIlc, Cy is heteroaryl, A, is -CR⁴⁰R⁴¹ - or -C(O)-, preferably -CH₂- or -C(O)-. In some embodiments, Cy is heteroaryl, A, is -CR⁴⁰R⁴¹- or -C(O)-, preferably -CH₂- or -C(O)-, and R^M, R⁶³ and R⁶⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy.

[0108] In some embodiments of compounds of Formula HIc, R¹⁰⁰ is selected from the group consisting of hydrogen, -OH, -NH₂, -CN, -NO₂, -C(O)OH, -S(O)₂NH₂, -C(O)NH₂, -OR⁵⁷, -SR⁵⁷, -NR⁴⁸R⁵⁷, -NR⁴⁸C(O)R⁵⁷, -NR⁴⁸S(O)₂R⁵⁷, -S(O)R⁵⁷, -S(O)₂R⁵⁷, -C(O)R⁵⁷, -C(O)OR⁵⁷, -C(O)NR⁴⁸R⁵⁷, -S(O)₂NR⁴⁸R⁵⁷, halogen, lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, and wherein cycloalkyl, heterocycloalkyl, aryl, or heteroaryl as R¹⁰⁰ or as substituents of lower alkyl are optionally substituted with one or more substituents selected from the group consisting of -OH, -NH₂, -CN, -NO₂, -S(O)₂NH₂, -C(O)NH₂, -OR⁵⁸, -SR⁵⁸, -NHR^S8, -NR⁴⁸R⁵⁸, -NR⁴⁸C(O)R⁵⁸, -NR⁴¹¹S(O)₂R⁵⁸, -S(O)₂R⁵⁸, -S(O)₂NR⁴⁸R⁵⁸, -C(O)R⁵⁸, -C(O)NR⁴⁸R⁵⁸, halogen, lower alkyl, fluoro substituted lower alkyl, and cycloalkylamino; Aj is -CR⁴⁰R⁴¹- or -C(O)-, preferably -CH₂- or -C(O)-.

[0109] In some embodiments of compounds of Formula 11Ic, R¹⁰⁰ is selected from the group consisting of hydrogen, -OH, -NH₂, -CN, -NO₂, -C(O)OH, -S(O)₂NH₂, -C(O)NH₂, -OR⁵⁷, -SR⁵⁷, -NR⁴⁸R⁵⁷, -NR⁴⁸C(O)R⁵⁷, -NR⁴⁸S(O)₂R⁵⁷, -S(O)R⁵⁷, -S(O)₂R⁵⁷, -C(O)R⁵⁷, -C(O)OR", -C(O)NR⁴⁸R⁵⁷, -S(O)₂NR⁴⁸R⁵⁷, halogen, lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, and wherein cycloalkyl, heterocycloalkyl, aryl, or heteroaryl as R¹⁰⁰ or as substituents of lower alkyl are optionally substituted with one or more substituents selected from the group consisting of -OH, -NH₂, -CN, -NO₂, -S(O)₂NII₂, -C(O)NH₂, -OR⁵⁸, -SR⁵⁸, -NHR⁵⁸, -NU⁴⁸R⁵⁸, -NR⁴⁸C(O)R⁵⁸, -NR⁴⁸S(O)₂R⁵⁸, -S(O)₃R⁵⁸, -S(O)₂NR⁴⁸R⁵⁸, -C(O)R⁵⁸, -C(O)NR⁴⁸R⁵⁸, halogen, lower alkyl, fluoro substituted lower alkyl, and cycloalkylamino; A, is -CR⁴⁰R⁴'- or -C(O)-, preferably -CH₂- or -C(O)-; and R⁶⁴, R⁶⁵ and R⁶⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy. Atty. Dkt. No.: 039363-3303

10110] In some embodiments of compounds of Formula IHc, R¹⁰⁰ is selected from the group consisting of hydrogen, -CN, -C(O)OH, -C(O)OR⁵⁷, -NR⁴⁸R⁵⁷, -OR⁵⁷, -S(O)₂R⁵⁷, fluoro, chloro, bromo, lower alkyl, fluoro substituted lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl or heteroaryl are optionally substituted with one or more substituents selected from the group consisting of halogen, lower alkyl, fluoro substituted lower alkyl, -NR⁴⁵R⁵⁸, -OR⁵⁸ and -S(O)₂R⁵⁸. In some embodiments, A, is -CH₂- or -C(O)-; R^1Q0 is selected from the group consisting of hydrogen, -CN, -C(O)OH, -C(O)OR⁵⁷, -NR⁴⁸R⁵⁷, -OR⁵⁷, -S(O)₂R⁵⁷, tluoro, chloro. bromo, lower alkyl, fluoro substituted lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl or heteroaryl are optionally substituted with one or more substituents selected from the group consisting of halogen, lower alkyl, fluoro substituted lower alkyl, -NR⁴⁸R⁵⁸, -OR⁵⁸ and -S(O)₂R⁵⁸; and R⁶⁴, R⁶⁵ and R⁶⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy.

[0111) In some embodiments of compounds of Formula IHc, Aj is -CH₂- or -C(O)-; R¹⁰⁰ is selected from the group consisting of hydrogen, -CN, -C(O)OH, -C(O)OR⁵⁷, -NR⁴⁸R⁵⁷, -OR⁵⁷, -S(O)₂R⁵⁷, fluoro, chloro, bromo, lower alkyl, fluoro substituted lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl or heteroaryl arc optionally substituted with one or more substituents selected from the group consisting of halogen, lower alkyl, fluoro substituted lower alkyl, -NR⁴⁸R⁵⁸, -OR⁵⁸ and -S(O)₃R⁵⁸; Z₂₄ is CR⁶⁴; Z₂₅ is CR⁶⁵; Z₂₆ CR⁶⁶; and R⁶⁴, R⁶⁵ and R⁶⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy.

[0112] In some embodiments of any of the above embodiments of compounds of Formula IHc, two

Of Z₂₄, Z₂₅, or Z₂₆ are N and the other of Z₂₄, Z₂₅, or Z₂₆ is CR⁶⁴, CR⁶⁵ or CR⁶⁶. one of Z₂₄, Z₂₅, or Z₂₆ is

N and the others of Z₂₄, Z₂₅, or Z₂₆ are CR^M, CR⁶⁵ or CR⁶⁶, preferably Z₂₄ is CR^M, Z₂₅ is CR" and Z₂ is CR⁶⁶.

[0113] In some embodiments, compounds have the structure according to the following Formula IV:

Formula IV Atty. Dkt. No.: 039363-3303

all salts, prodrugs, tautomers, and isomers thereof, wherein;

A, R⁴, R⁵, R⁶, Z₂, Z₄, Z₅, and Z₆ are as defined for Formula I; and R⁹⁰ is C₂^ alkyl, fluoro substituted C_M alkyl, or -(CH₂CH₂.OO;)_mR⁹¹; mm iiss 11 ,, 22.. o orr 33;; aanndd

R⁹¹ is C_i_₃ alkyl or fluoro substituted Cu alkyl, provided, however, the compound is not

Attv Dkt No 039363-3303

(0114] In some embodiments of compounds of Formula IV, R⁴ and R⁶ are hydrogen, A is -O-, -CR^aR^b-, -NR¹-, or -C(O)-, pretcrably -CH₂- or -C(O)-, and R¹², R¹⁴, R¹' and R^ltl are independently selected from the group consisting of hydrogen, halogen, lower alkyl and lower alkoxy, wherein the alkyl chain of lower alkyl or lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylammo and cycloalkylamino, provided, however, that any substitution on the alkyl carbon bound to the -O- of lower alkoxy is fluoro R^a, R^b, and R¹ are as defined for Formula I

[0115] In some embodiments of compounds of Formula IV, R⁴ and R⁶ are hydrogen, A is -O-, -CR^aR\ -NR¹-, or -C(O)-, preferably -CH₂- or -C(O)-, R¹², R^H, R¹⁵ and R¹⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl and lower alkoxy, wherein the alkyl chain ot lower alkyl or lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylammo, di-alkylamino and cycloalkykmino, provided, however, that any substitution on the alkyl carbon bound to the -O- ot Atty. Dkt. No.: 039363-3303 lower alkoxy is fluoro, and R⁵ is selected from the group consisting of hydrogen, halogen, lower alkyl, lower alkoxy, optionally substituted aryl, optionally substituted heteroaryl, -CN, -C(O)OH, -C(O)OR²², -OR²², -S(O)₂R²², and NR²¹R²², wherein R²¹ is hydrogen or lower alkyl, and R²² is hydrogen, lower alkyl, optionally substituted aryl or optionally substituted heteroaryl, and wherein the alkyl chain of R⁵, R²¹ or R ², when lower alkyl, or the alkyl chain of lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino. R\ R^b, and R¹ are as defined for Formula I.

[0116] In some embodiments of compounds of Formula IV, R⁴ and R⁶ are hydrogen, A is -O-, -CR^aR^b-, -NR¹-, or -C(O)-, preferably -CH₁- or -C(O)-, R¹², R¹⁴, R¹⁵ and R¹⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy, and R⁵ is selected from the group consisting of hydrogen, halogen, lower alkyl, lower alkoxy, optionally substituted aryl, optionally substituted heteroaryl, -CN, -C(O)OH, -C(O)OR²², -OR²², -S(O)₂R²², and NR²¹R²², wherein R²¹ is hydrogen or lower alkyl, and R²² is hydrogen, lower alkyl, optionally substituted aryl or optionally substituted heteroaryl, and wherein the alkyl chain of R⁵, R²¹ or R²², when lower alkyl, or the alkyl chain of lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino. R^a, R^b, and R¹ are as defined for Formula I.

[0117] Tn some embodiments of any of the above embodiments of compounds of Formula IV, two Of Z₂, Z₄, Z₅, or Z₆ are N and the others of Z₂, Z₄, Z₅, or Z₆ arc CR¹², CR¹⁴, CR¹⁵ or CR¹⁶, also one of Z₂, Z₄, Z₅, or Z₆ is N and the others of Z₂, Z₄, Z₅, or Z₆ are CR¹², CR¹⁴, CR¹⁵ or CR¹⁶, preferably Z₂ is CR¹², Z₄ is CR¹⁴, Z₃ is CR¹⁵ and Z₆ is CR¹⁶.

[0118] In one embodiment of compounds of Formula IV, the compound is selected from the group consisting of:

3-[2-Chloro-6-fluoro-3-(2,2,2-tπfluoro-ethoxy)-benzyl]-lH-pyrrolo[2,3-b]pyridine (P-2148), [2-Chloro-6-fluoro-3-(2,2,2-trifluoro-ethoxy)-phenyl]-(5-methoxy-lH-pyrrolo[2,3-b]pyridin-3-yl)- methanone (P-2149), [2-Chloro-6-fluoro-3-(2,2_>2-trifluoro-ethoxy)-phenyl]-(lH-pyrrolo[2,3-b]pyridin-3-yl)-methanone

(P-2150),

[2,6-Dichloro-3-(2,2,2-trifluoro-ethoxy)-phcnyl]-[5-(l-methyl-lH-pyrazol-4-yl)-lH-pyrrolo[2,3- b]pyridin-3-yl]-methanone (P-2151),

3-[2,6-ϋichloro-3-(2,2,2-trifIuoro-ethoxy)-benzyl]-5-methoxy-lH-pyrrolo[2_>3-b]pyridme (P-2153),

[2,6-Dichloro-3-(2,2,2-trifluoro-ethoxy)-phenyl]-(5-methoxy-lH-pyrrolo[2,3-b]pyridin-3-yl)- Atty. Dkt. No.: 039363-3303 methanone (P-2154),

5-Chloro-3-[2^{^}chloro-6-fluoro-3-(2-methoxy-ethoxy)-benzyl]-lH-pyrrolo[2,3-b]pyridine (P-2157), 3-[2-Chloro-6-fluoro-3-(2-raethoxy-ethoxy)-benzyl]-lH-pyrrolo[2,3-b]pyridine (P-2158), [2-Chloro-6-nuoro-3-(2-methoxy-ethoxy)-phenyl]-(5-chloro-lH-pyrrolo[2,3-b]pyridin-3-yl)- methanone (P-2159),

[2-Chloro-6-fluoro-3-(2-methoxy-ethoxy)-phenyl]-(lH-pyrrolo[2,3-b]pyridin-3-yl)-methanone (P-2160), and all salts, prodrugs, tautomers, and isomers thereof,

10119] In some embodiments, compounds of Formula IV have the structure according to the following sub-generic structure Formula Wa:

Formula IVa

all salts, prodrugs, tautomers, and isomers thereof, wherein:

A and R^s are as defined for Formula I;

R⁹⁰ is as defined for Formula IV;

Z₃₂ is N or CR⁷²;

Z₃₄ is N or CR⁷⁴;

Z₃₅ is N or CR⁷⁵;

Z₃₆ is N or CR⁷⁶; and

R⁷², R⁷⁴, R⁷⁵, and R^7fl are independently selected from the group consisting of hydrogen, halogen, lower alkyl and lower alkoxy, wherein the alkyl chain of lower alkyl or lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino, provided, however, that any substitution on the alkyl carbon bound to the -O- of lower alkoxy is fluoro.

[0120] In some embodiments of compounds of Formula IVa, A is -O-, -CR^aR^b-, -NR¹-, or -C(O)-, preferably -CII₂- or -C(O)-. In some embodiments, A is -O-, -CR"R^b-, -NR¹-, or -C(O)-, preferably -CH₂- or -C(O)-, and R⁷², R¹⁴, R⁷⁵ and R'⁶ are independently selected from the group consisting of Atty. Dkt. No.: 039363-3303 hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy and fluoro substituted lower alkoxy, R^a, R^b, and R¹ are as defined for Formula I.

[01211 In some embudiments of compounds of Formula IVa, A is -O-, -CR^aR^b-, -NR¹-, or -C(O)-, preferably -CH₂- or -C(O)-, and R⁵ is selected from the group consisting of hydrogen, halogen, lower alkyl, lower alkoxy, optionally substituted aryl, optionally substituted heteroaryl, -CN, -C(O)OH, -C(O)OR²², -OR²², -S(O)₂R²², and NR²¹R²², wherein R²¹ is hydrogen or lower alkyl, and R²² is hydrogen, lower alkyl, optionally substituted aryl or optionally substituted heteroaryl, and wherein the alkyl chain of R³, R²¹ or R²². when lower alkyl, or the alkyl chain of lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino. R^a, R^b, and R¹ are as defined for Formula I.

(0122] In some embodiments of compounds of Formula IVa, A is -O-, -CR^aR^b-, -NR¹-. or -C(O)-, preferably -CH₂- or -C(O)-, R⁷², R⁷⁴, R⁷⁵ and R⁷⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy, and R⁵ is selected from the group consisting of hydrogen, halogen, lower alkyl, lower alkoxy, optionally substituted aryl, optionally substituted heteroaryl, -CN, -C(O)OH, -C(O)OR²², -OR²², -S(O)₁R²², and NR²¹R²², wherein R²¹ is hydrogen or lower alkyl, and R²² is hydrogen, lower alkyl, optionally substituted aryl or optionally substituted heteroaryl, and wherein the alkyl chain of R⁵, R²¹ or R²², when lower alkyl, or the alkyl chain of lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro. -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di- alkylamino and cycloalkylamino. R^a, R^b, and R¹ are as defined for Formula I.

[0123] In some embodiments of any of the above embodiments of compounds of Formula IVa, two Of Z₃₂, Z₃₄, Z₃₅, or Z₃₆ are N and the others of Z₃₂, Z₃₄, Z₃₅, or Z₃₆ are CR⁷², CR⁷⁴, CR⁷⁵ or CR⁷⁶, also one of Z₃₂, Z₃₄, Z₃^, or Z_i6 is N and the others of Z₃₂, Z₃₄, Z₃₅, or Z₃₆ are CR⁷², CR⁷⁴, CR⁷⁵ or CR ⁶, preferably Z₂ is CR⁷², Z₄ is CR⁷⁴, Z₅ is CR⁷⁵ and Z₆ is CR⁷⁶.

[U 124] In some embodiments, compounds have the structure according to the following Formula IVb: Atty. Dkt. No. : 039363-3303

Formula IVb

all salts, prodrugs, tautoraers, and isomers thereof, wherein:

A) is as defined for Formula Ib; R¹⁰⁰ is as defined for Formula Ha;

Zj₂ , Zj4, Z₁₅, and X^_b are as defined for Formula FVa; and R⁹⁰ is as defined for Formula IV.

[0125] In some embodiments of compounds of Formula FVb, A₁ is -CR⁴⁰R⁴¹- or -C(O)-, preferably -CH₂- or -C(O)-. In some embodiments, A, is -CR⁴V¹- or -C(O)-, preferably -CH₂- or -C(O)-, and R⁷², R⁷⁴, R⁷⁵ and R⁷⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy.

[0126] In some embodiments of compounds of Formula FVb, R ⁰⁰ is selected from the group consisting of hydrogen, -OH, -NH₂, -CN, -NO₂, -C(O)OH, -S(O)₂NH₂, -C(O)NH₂, -OR⁵⁷,

-NR⁴⁸R⁵⁷, -NR⁴⁸C(O)R⁵⁷, -NR⁴⁸S(O)₂R⁵⁷, -S(O)R⁵⁷, -S(O)₂R⁵⁷, -C(O)R⁵⁷, -C(O)OR", -C(O)NR⁴⁸R⁵⁷, -S(O)₂NR⁴⁸R⁵⁷, halogen, lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, lower alkoxy, fluoro substituted lower alkoxy, lower alkyllhio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, and wherein cycloalkyl, heterocycloalkyl, aryl, or heteroaryl as R¹⁰ or as substituents of lower alkyl are optionally substituted with one or more substituents selected from the group consisting of -OH, -NH₂, -CN, -NO₂, -S(O)₂NH₂, -C(O)NH₂, -OR⁵⁸, -SR⁵⁸, -NHR⁵⁸, -NR⁴⁸R⁵⁸, -NH⁴⁸C(O)R⁵⁸, -NR⁴⁸S(O)₂R⁵⁸, -S(O)₂R⁵⁸, -S(O)₂NR⁴⁸R⁵⁸, -C(O)R⁵³, -C(O)NR⁴⁸R⁵⁸, halogen, lower alkyl, fluoro substituted lower alkyl, and cycloalkylamino. In some embodiments, Ai is -CH₂- or -C(O)-; R¹⁰⁰ is selected from the group consisting of hydrogen, -OH, -NH₂, -CN, -NO₂, -C(O)OH, -S(O)₂NH₂, -C(O)NH₂, -OR⁵⁷, -SR⁵⁷, -NR⁴⁸R⁵⁷, -NR⁴⁸C(O)R⁵⁷, -NR⁴⁸S(O)₂R⁵⁷, -S(O)R⁵⁷, -S(O)₂R⁵⁷, -C(O)R⁵⁷, -C(O)OR⁵⁷, -C(O)NR⁴⁸R⁵⁷, -S(O)₂NR⁴⁸R⁵⁷, halogen, lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted Atty. Dkt. No.: 039363-3303 lower alkylthio, mono-alkylamino, di-alkylamino, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, and wherein cycloalkyl, heterocycloalkyl, aryl, or heteroaryl as R¹⁰⁰ or as substituents of lower alkyl arc optionally substituted with one or more substituents selected from the group consisting of -OH, -NH₂, -CN, -NO₂, -S(O)₂NH₂, -C(O)NH₂, -OR⁵⁸, -SR⁵⁸, -NHR⁵\ -NR⁴⁸R⁵⁸, -NR⁴⁸C(O)R⁵⁸, -NR⁴⁸S(O)₂R⁵⁸, -S(O)₂R⁵⁸, -S(O)₂NR⁴⁸R⁵⁸, -C(O)R⁵⁸, -C(O)NR⁴⁸R⁵⁸, halogen, lower alkyl, fluoro substituted lower alkyl, and cycloalkylamino; and R⁷², R'⁴, R'⁵ and R⁷⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy.

[0127] In some embodiments of compounds of Formula IVb, R¹⁰⁰ is selected from the group consisting of hydrogen, -CN, -C(O)OH, -C(O)OR⁵⁷, -NR⁴⁸R⁵⁷, -OR⁵⁷, -S(O)₂R⁵⁷, fluoro, chloro, bromo, lower alkyl, fluoro substituted lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein cycloalkyl. heterocycloalkyl, aryl or heteroaryl are optionally substituted with one or more substituents selected from the group consisting of halogen, lower alkyl, fluoro substituted lower alkyl, -NR⁴⁸R⁵⁸, -OR⁵⁸ and -S(O)₂R⁵⁸. In some embodiments, Ai is -CH₂- or -C(O)-; R¹⁰⁰ is selected from the group consisting of hydrogen, -CN, -C(O)OH, -C(O)OR⁵⁷, -NR⁴⁸R⁵⁷, -OR⁵⁷, -S(O)₂R⁵⁷, fluoro, chloro, bromo, lower alkyl, fluoro substituted lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl or heteroaryl are optionally substituted with one or more substituents selected from the group consisting of halogen, lower alkyl, fluoro substituted lower alkyl, -NR⁴⁸R⁵⁸, -OR⁵⁸ and -S(O)₂R⁵⁸; and R⁷², R⁷⁴, R⁷⁵ and R⁷⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy.

[0128] In some embodiments of compounds of Formula IVb, Aj is -CH₂- or -C(O)-; R¹⁰⁰ is selected from the group consisting of hydrogen, -OH, -NH₂, -CN, -NO₂, -C(O)OH, -S(O)₂NH₂, -C(O)NH₂, -OR⁵⁷, -SR⁵⁷, -NR⁴⁸R⁵⁷, -NR⁴⁸C(O)R⁵⁷, -NR⁴⁸S(O)₂R", -S(O)R³⁷, -S(O)₂R⁵⁷, -C(O)R⁵⁷, -C(O)OR⁵⁷, -C(O)NR⁴⁸R⁵⁷, -S(O)₂NR⁴⁸R⁵⁷, halogen, lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, and wherein cycloalkyl, heterocycloalkyl, aryl, or heteroaryl as R¹⁰⁰ or as substituents of lower alkyl are optionally substituted with one or more substituents selected from the group consisting of -OH, -NII₂, -CN, -NO₂, -S(O)₂NH₂, -C(O)NH₂, -OR⁵⁸, -SR⁵⁸, -NHR⁵⁸, -NR⁴⁸R⁵⁸, -NR⁴⁸C(O)R⁵⁸, -NR⁴⁸S(O)₂R⁵⁸, -S(O)₂R⁵⁸, -S(O)₂NR⁴⁸R⁵⁸, -C(O)R⁵⁸, -C(O)NR⁴⁸R⁵⁸, halogen, lower alkyl, fluoro substituted lower alkyl, and cycloalkylamino; Z₃₂ is CR⁷²; Z₃₄ is CR⁷⁴; Z₃₅ is CR⁷⁵; Z₃₆ is CR'⁶; and R⁷², R⁷⁴, R⁷⁵ and R⁷⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy. Atty. Dkt. No.: 039363-3303

[0129J ^m some embodiments of compounds of Formula IVb, A, is -CH₂- or -C(O)-; R¹⁰⁰ is selected from the group consisting of hydrogen, -CN, -C(O)OH, -C(O)OR^S7, -NR⁴⁸R⁵⁷, -OR⁵⁷, -S(O)₂R⁵⁷, fluoro, chloro, bromo, lower alkyl, fluoro substituted lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl or heteroaryl are optionally substituted with one or more substituents selected from the group consisting of halogen, lower alkyl, fluoro substituted lower alkyl, -NR⁴⁸R⁵⁸, -OR⁵⁸ and -S(O)₂R⁵⁸; Z₃₂ is CR⁷²; Z₃₄ is CR⁷⁴; Z_3J is CR⁷⁵; Z₃₆ is CR⁷⁶; and R⁷², R⁷⁴, R⁷⁵ and R⁷⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy.

[0130] In some embodiments of any of the above embodiments of compounds of Formula IVb, two OfZ₃₂, Z₃₄, Z₁₅, or Z₃₆ are N and the others of Z₃₂, Z₃₄, Z₃₅, or Z₃₆ are CR⁷², CR⁷⁴, CR⁷⁵ or CR⁷⁶, also one Of Z₃₂, Z₃₄, Z₃₅, or Z₃₆ is N and the others of Z₃₂, Z₃₄, Z₃₅, or Z₃₆ are CR⁷², CR^{^4}, CR⁷⁵ or CR^"6, preferably Z₂ is CR⁷², Z₄ is CR⁷⁴, Z₅ is CR⁷⁵ and Z₆ is CR⁷⁶.

[0131] In some embodiments of the above compounds, compounds are excluded where N (except where N is a heteroaryl ring atom), O, or S is bound to a carbon that is also bound to N (except where N is a heteroaryl ring atom), O, or S except where the carbon forms a double bond with one of the heteroatoms, such as in an amide, carboxylic acid, and the like; or where N (except where N is a heteroaryl ring atom), O, C(S), C(O), or S(O)_n (n is 0-2) is bound to an alkene carbon of an alkenyl group or bound to an alkyne carbon of an alkynyl group; accordingly, in some embodiments compounds which include linkages such as the following are excluded from the compounds provided: -NR-CH₂-NR-, -0-CII₂-NR-, -S-CH₂-NR-, -NR-CH₂-O-, -0-CH₂-O-, -S-CH₂-O-, -NR-CH₂-S-, -0-CH₂-S-, -S-CH₂-S-, -NR-CH=CH-, -CII=CH-NR-, -NR-C =C-, -C ≡€-NR-, -0-CH=CH-, -CH=CH-O-, -O-C Ξ£-, -C =£-0-, -S(OV₂-CH=CH-, -CH=CH-S(OV₂-, -S(OV₂-C =€-, -C ≡€-S(OV₂-, -C(O)-CH=CH-, -CH=CH-C(O)-, -C ^C-C(O)-, or -C(O)-C =€-, -C(S)-CH=CH-, -CH=CH-C(S)-, -C ≡€-C(S)-, or -C(S)-C -C-.

[0132] In reference to compounds herein, unless clearly indicated to the contrary, specification of a compound or group of compounds includes pharmaceutically acceptable salts of such compound(s), prodrug(s), and all stereoisomers thereof. In reference to compositions, kits, methods of use, etc. of compounds of Formula I, II, III, or IV described herein, it is understood that a compound of Formula I includes compounds of Formulae Ia-Ii, and all sub-embodiments thereof, Formula II includes compounds of Formulae Ha-IIb, and all sub-embodiments thereof, Formula III includes compounds of Formulae IHa-IIIc, and all sub-embodiments thereof, Formula IV includes compounds of Formulae IVa-IVb, and all sub-embodiments thereof, unless indicated otherwise.

[0133] In one aspect, methods are provided for treating a protein kinase mediated disease or condition in an animal subject, wherein the method involves administering to the subject an effective Atty. Dkt. No : 039363-3303 amount of one or more compounds of Formula II, Formula III, or Formula IV The terms "treat," "therapy," and like terms refer to the administration of matenal, e.g., one or more compounds of Formula II, Formula III or Formula IV, in an amount effective to prevent, alleviate, or ameliorate one or more symptoms of a disease or condition, i.e., indication, and/or to prolong the survival of the subject being treated The term "protein kinase mediated disease or condition" refers to a disease or condition in which the biological function of a protein kinase affects the development, course and/or symptoms of the disease or condition, and/or in which modulation of the protein kinase alters the development, course, and/or symptoms of the disease or condition. A protein kinase mediated disease or condition includes a disease or condition for which modulation provides a therapeutic benefit, e.g. wherein treatment with protein kinase inhibitors, including compounds described herein, provides a therapeutic benefit to the subject suffering from or at risk of the disease or condition. In one aspect, the method involves administering to the subject an effective amount of one or more compounds of Formula II, Formula III or Formula IV in combination with one or more other therapies for the disease or condition

[0134] In one aspect, methods are provided for treating a protein kinase mediated disease or condition in an animal subject, wherein the method involves administering to the subject an effective amount of a compound of any one or more of Formula II, Formula III or Formula IV.

[0135] In one aspect, methods are provided for treating a Fms protein kinase mediated disease or condition in an animal subject, wherein the method involves administering to the subject an effective amount of one or more compounds of Formula II, Formula III or Formula IV The terms "Fms protein kinase mediated disease or condition," "Fms mediated disease or condition," and the like refer to a disease or condition in which the biological function of a Fms protein kinase, including any mutations thereof, affects the development, course and/or symptoms of the disease or condition, and/or in which modulation of Fms alters the development, course, and/or symptoms of the disease or condition A Fms mediated disease or condition includes a disease or condition for which Fms inhibition provides a therapeutic benefit, e.g wherein treatment with Fms inhibitors, including compounds described herein, provides a therapeutic benefit to the subject suffering from or at risk of the disease or condition. In one aspect, the method involves administering to the subject an effective amount of one or more compounds of Formula II, Formula III or Formula IV in combination with one or more other therapies for the disease or condition.

[0136] In one aspect, methods are provided for treating a Kit protein kinase mediated disease or condition m an animal subject, wherein the method involves administering to the subject an effective amount of one or more compounds of Formula II, Formula III or Formula IV. The terms ''Kit mediated disease or condition," "Kit protein kinase mediated disease or condition," and the like refer to a disease or condition in which the biological function of a Kit protein kinase, including any Atty Dkt No 039363-3303 mutation thereof, affects the development, course and/or symptoms of the disease or condition, and or in which modulation of Kit alters the development, course, and/or symptoms of the disease or condition A Kit mediated disease or condition includes a disease or condition for which Kit inhibition provides a therapeutic benefit, e g wherein treatment with Kit inhibitors, including compounds described herein, prov ides a therapeutic benefit to the subject suffering from or at risk of the disease or condition In one aspect, the method involves administering to the subject an effective amount of one or more compounds of Formula II, Formula III or Formula IV in combination w ith one or more other therapies for the disease or condition

[0137] In one aspect, methods are provided for treating a TrkA protein kinase mediated disease or condition in an animal subject, wherein the method involves administering to the subject an effective amount of one or more compounds of Formula II, Formula III or Formula IV The terms "TrkA mediated disease or condition," "TrkA protein kinase mediated disease or condition," and the like refer to a disease or condition in which the biological function of a TrkA protein kinase, including any mutation thereof, affects the development, course, and/or symptoms of the disease or condition, and/ or in which modulation of TrkA alters the development, course, and/or symptoms of the disease or condition A TrkA mediated disease or condition includes a disease or condition for which TrkA inhibition provides a therapeutic benefit, e g wherein treatment w ith 1 rkΛ inhibitors, including compounds described herein, provides a therapeutic benefit to the subject suffering from or at risk of the disease or condition In one aspect, the method involves administering to the subject an effective amount of one or more compounds of Formula II, Formula III or Formula IV in combination with one or more other therapies for the disease or condition

[0138] In one aspect, methods are provided for treating a TrkB protein kinase mediated disease or condition in an animal subject, wherein the method involves administering to the subject an effective amount of one or more compounds of Formula II, Formula III or Formula IV The terms "TrkB mediated disease or condition," "TrkB protein kinase mediated disease or condition," and the like refer to a disease or condition in which the biological function of a TrkB protein kinase, including any mutation thereof, affects the development, course and/or symptoms of the disease or condition, and/or in which modulation of TrkB alters the development, course, and/or symptoms of the disease or condition A TrkB mediated disease or condition includes a disease or condition for w hich 1 rkB inhibition provides a therapeutic benefit, e g wherein treatment with TrkB inhibitors, including compounds described herein, provides a therapeutic benefit to the subject suffering from or at nsk of the disease or condition In one aspect, the method involves administering to the subject an effective amount of one or more compounds of Formula II, Formula III or Formula IV in combination with one or more other therapies for the disease or condition Atty. Dkt. No.: 039363-3303

|01391 ϊⁿ some embodiments, a compound of Formula I, Formula II, Formula III or Formula IV will have an IC₅₀ of less than 500 urn, less than 100 nM, less than 50 tiM, less than 20 nM, less than 10 nM, less than 5 nM, or less than 1 nM as determined in a generally accepted kinase activity assay, In some embodiments, a compound of any of Formula I, Formula II, Formula III or Formula IV will have an IC₅₀ of less than 500 nm, less than 100 nM, less than 50 nM, less than 20 nM, less than 10 nM, less than 5 nM, or less than 1 nM with respect to at least one kinase selected from the group consisting of AbI, Aktl, Akt2, Akt3. ALK, Alk5, A-Raf, B-Raf, Brk, Btk, Cdk2, CDK4, CDK5, CDK6, CHKl, c-Raf-1, Csk, EGFR, EphAl, EphA2, EphB2, EphB4, Erk2, Fak, FGFRl, FGFR2, FGFR3, FGFR4, Fltl, Flt3, Flt4, Fms, Frk, Fyn, Gsk3α, Gsk3β, HCK, Her2/Erbb2, Hcr4/Erbb4, IGFlR, IKK beta, Irak4, Itk, Jakl, Jak2, Jak3, Jnkl, Jnk2, Jnk3, Kdr. Kit, LCK, MAP2K1, MAP2K2, MAP4K4, MAPKAPK2, Met, Mnkl, MLKl, p38, PDGFRA, PDGFRB, PDPKl, Piml, Pim2, Pim3, PKC alpha, PKC beta, PKC theta, Plkl , Pyk2, ROCKl, ROCK2, Ron, Src, Stk6, Syk, TEC, Tie2, TrkA, TrkB, Yes, and Zap70, including any mutations thereof.

[0140] In some embodiments, a compound of Formula I, Formula II, Formula III or Formula IV will have an IC₅₀ of less than 500 nm, less than 100 nM, less than 50 nM, less than 20 nM, less than 10 nM, less than 5 nM, or less than 1 nM with respect to at least one kinase selected from the group consisting of AbI, Akt 1, Akt2, Akt3, ALK, Alk5, A-Raf, B-Raf, Btk, Cdk2, CDK4, CDK5, CDK6, CHKl, c-Raf-1, Csk, EGFR, EphAl, EphA2, EphB2, EphB4, Erk2, Fak, Fms, Fyn, Gsk3α, Gsk3β, HCK, Her2/Erbb2, Her4/Erbb4, IGFlR, IKK beta, Irak4, Itk, Jakl, Jak2, Jak3, Jnkl, Jnk2, Jnk3, Kit, LCK, MAP2K1, MAP2K2, MAP4K4, MAPKAPK2, Met, Mnkl, MLKl, p38, PDPKl, Piml, Pim2, Pim3, PKC alpha, PKC beta, PKC theta, Plkl , Pyk2, Ron, Src, Stk6, Syk, TEC, Tie2, TrkA, TrkB, Yes, and Zap70, including any mutations thereof.

[0141] In some embodiments, a compound of Formula I, Formula II, Formula III or Formula IV will have an IC_5U of less than 500 nm, less than 100 nM, less than 50 nM, less than 20 nM, less than 10 nM, less than 5 nM, or less than 1 nM with respect to at least one kinase selected from the group consisting of AbI, A-Raf, B-Raf, Btk, c-Raf-1, EGFR, EphB2, Erk2, Fak, FGFRl. Fltl, Flt3, FH4, Fms, Irak4, Jnkl , Jnk2, Jnk3, Kdr, Kit, MAP2K1, MAP4K4, MAPKAP kinase 2, Met, p38, PDGFRB, Piml, PKC theta, Pyk2, Ret, Src, Stk6, TrkA, TrkB, Yes, and Zap70, including any mutations thereof,

[0142] In some embodiments, a compound of Formula I, Formula II, Formula III or Formula IV will have an IC₅₀ of less than 500 nm, less than 100 nM, less than 50 nM, less than 20 nM, less than 10 nM, less than 5 nM, or less than 1 nM with respect to at least one kinase selected from the group consisting of AbI, A-Raf, B-Raf, Btk, c-Raf-1, EGFR, EphB2, Erk2, Fak, Fms, Irak4, Jnkl, Jnk2, Jnk3, Kit, MAP2K1, MAP4K4, MAPKAP kinase 2, Met, p38, Piml, PKC theta, Pyk2, Src, Stk6, TrkA, TrkB, Yes, and Zap70, including any mutations thereof. Atty Dkt No 039363-3303

[0143] In some embodiments, a compound of Formula I, Formula II, Formula III or Formula IV will an ICs₀ of less than 500 mn, less than 100 nM, less than 50 nM, less than 20 nM, less than 10 iiM, less than 5 nM, or less than 1 nM with respect to at least one kinase selected from the group consisting of Fms, Kit, MAP4K4, TrkA and TrkB, and any mutations thereof In some embodiments, a compound of any of Foπnula I, Formula II, Formula III or Formula IV will have an IC_W of less than 500 nm, less than 100 nM, less than 50 nM, less than 20 nM, less than 10 nM, less than 5 nM, or less than 1 nM with respect to Fms, MAP4K4, TrkA, and/or TrkB

|0144] In some embodiments, a compound of Formula I, Formula II, Formula III or Formula IV is an inhibitor of a Fms kinase and has an IC₅₀ of less than 500 nm, less than 100 nM, less than 50 nM, less than 20 nM, less than 10 nM, less than 5 nM, or less than 1 nM as determined in a generally accepted Fms kinase activity assay In some embodiments, a compound of Formula I Formula II, Formula III or Formula IV will selectively inhibit Fms kinase relative to Kit kinase

[0145] In some embodiments, a compound of Formula I, Formula II, Formula III or Formula TV is an inhibitor of a Fms kinase, a MAP4K4 kinase, a TrkA kinase, and/or a TrkB kinase and has an ICNo of less than 500 nm, less than 100 nM, less than 50 nM, less than 20 nM, less than 10 nM, less than 5 nM, or less than 1 nM as determined m a generally accepted Fms kinase activity assay, MAP4K4 kinase activity assay, TrkA kinase activity assay, and/or TrkB kinase activity assay In some embodiments, a compound of Formula I, Formula II, Foπnula III or Formula IV will selectively inhibit Fms kinase, MAP4K4 kinase, TrkA kinase, and' or TrkB kinase relative to Kit kinase

[0146] In some embodiments, a compound of Formula I, Formula II, Formula III or Foπnula W is an inhibitor of a Kit kinase and has an IC_so of less than 500 nm, less than 100 nM, less than 50 nM, less than 20 nM, less than 10 nM, less than 5 nM, or less than 1 nM as determined in a generally accepted Kit kinase activity assay

[0147] Further to any of the above embodiments, a compound may selectively inhibit one kinase relative to one or more other kinases, where preferably inhibition is selective with respect to any of the other kinases whether a kinase discussed herein, or other kinases In some embodiments, the compound may selectively inhibit the effects of a mutation of the kinase relative to the wild type kinase, for example B-Raf V600E relative to wild type B-Raf In some embodiments, the compound may selectively inhibit Fms relative to Kit Selective inhibition of one kinase relative to another is such that the IC₅₀ for the one kinase may be at least about 2-fold, also 5-fold, also 10-fold, also 20-fold, also 50-fold, or at least about 100-fold less than the IC₅₀ for any of the other kinases as determined m a generally accepted kinase activity assay Atty. Dkt. No : 039363-3303

[0148| Further to any of the above embodiments, a compound may selectively inhibit one or more kinases relative to one or more other kinases, where preferably inhibition is selective with respect to any of the other kinases, whether a kinase discussed herein, or other kinases. In some embodiments, the compound may selectively inhibit Fms and one or more kinases relative to Kit, such as Fms and/or TrkA relative to Kit Selective inhibition of one kinase relative to another is such that the IC₅₀ for the one kinase may be at least about 2-fold, also 5-fold, also 10-fold, also 20-fold, also 50-fold, or at least about 100-fold less than the IC₅₀ for any of the other kinases as determined in a generally accepted kinase activity assay.

[0149J In another aspect, compositions are provided that include a therapeutically effective amount of one or more compounds of Formula II, Formula III or Formula IV and at least one pharmaceutically acceptable carrier, excipient, and/or diluent, including combinations of any two or more compounds of Formula II, Formula III or Formula IV. The composition can further include a plurality of different pharmacologically active compounds, which can include one or more compounds of Formula I, Formula II, Formula III or Formula IV In another aspect, the composition can include one or more compounds of Formula II, Formula III or Formula IV along with one or more compounds that arc therapeutically effective for the same disease indication. In one aspect, the composition includes one or more compounds of Formula II, Formula III or Formula IV along with one or more compounds that are therapeutically effective for the same disease indication, whcrem the compounds have a synergistic effect on the disease indication.

[0150] In another aspect, methods are provided for modulating the activity of a protein kinase selected from the group consisting of AbI, Aktl , Akt2, Akt3, ALK, Alk5, Λ-Raf, B-Raf, Brk, Btk, Cdk2, CDK4, CDK5, CDK6, CHKl, c-Raf-1, Csk, EGFR, EphAl, EphA2, EphB2, EphB4, Erk2, Fak, FGFRl, FGFR2, FGFR3, FGFR4, Fltl, Flt3, Flt4, Fms. Frk, Fyn, Gsk3α, Gsk3β, HCK, Her2/Erbb2, Her4/Erbb4, IGFlR, IKK beta, Irak4, Itk, Jakl, Jak2, Jak3, Jnkl , Jnk2, Jnk3, Kdr, Kit, LCK, MAP2K1, MAP2K2, MAP4K4, MAPKAPK2, Met, Mnkl, MLKl, p38, PDGFRA, PDGFRB, PDPKl, Piml, Pim2, Pim3, PKC alpha, PKC beta, PKC theta, PM, Pyk2, ROCKl, ROCK2, Ron, Src, Stk6, Syk, TEC, Tie2, TrkA, TrkB, Yes, or Zap70 by contacting the protein kinase with an effective amount of one or more compounds of Formula II, Formula III or Formula IV.

[0151] In another aspect, methods are provided for treating a protein kinase mediated disease or condition in an animal subject, wherein the method involves administering to the subject an effective amount of a composition including one or more compounds of Formula II, Formula III or Formula IV.

(01521 In ^one aspect, methods are provided for treating a disease or condition mediated by a protein kinase selected from the group consisting of AbI, Akt 1, Akt2, Akt3, ALK, Alk5, A-Raf, B-Raf, Btk, Cdk2, CDK4, CDK5, CDK6, CHKl, c-Raf-1, Csk, EGFR, EphAl, EphA2, EphB2, EphB4, Erk2, Atty. Dkt. No.: 039363-3303

Fak, FGFRl, FGFR2, FGFR3, FGFR4, FHl, Flt3, Flt4, Fms, Fyn, Gsk3α, Gsk3β, HCK, Her2/Erbb2, Her4/Erbb4, IGFlR, IKK beta, Irak4, Itk, Jakl, Jak2, Jak3, Jnkl, Jnk2, Jnk3, Kdr, Kit, LCK, MAP2K1, MAP2K2, MAP4K4, MAPKAPK2, Met, Mnkl, MLKl, p38, PDGFRA, PDGFRB, PDPKl, Piml, Pim2, Pim3, PKC alpha, PKC beta, PKC theta, Plkl, Pyk2, ROCKl, ROCK2, Ron, Src, Stk6, Syk, TEC, Tie2, TrkΛ, TrkB, Yes, and Zap70 by administering to the subject an effective amount of a composition including one or more compounds of Formula II, Formula III or Formula IV

[0153] Ln one aspect, the invention provides methods for treating a disease or condition mediated by a protein kinase selected from the group consisting of AbI, Aktl, Λkt2, Akt3, ALK, Alk5, A-Raf, B-Raf, Btk, Cdk2, CDK4, CDK5, CDK6, CHKl , c-Raf-1, Csk, EGFR, EphAl , EphA2, EphB2, EphB4, Erk2, Fak, Fms, Fyn, Gsk3α, Gsk3β, HCK, Her2/Erbb2, Her4/Erbb4, IGFlR, IKK beta, Irak4, Itk, Jakl, Jak2, Jak3, Jnkl, Jnk2, Jnk3, Kit, LCK, MAP2K1, MAP2K2, MAP4K4, MAPKAPK2, Met, Mnkl, MLKl, p38, PDPKl, Piml, Pim2, Pim3, PKC alpha, PKC beta, PKC theta, Plkl, Pyk2, Ron, Src, Stk6, Syk, TEC, Tie2, TrkA, TrkB, Yes, and Zap70 by administering to the subject an effective amount of a composition including one or more compounds of Formula II, Formula III or Formula PV.

[0154] In one aspect, the invention provides methods for treating a disease or condition mediated by a protein kinase selected from the group consisting of AbI, A-Raf, B-Raf, Btk, c-Raf-1, EGFR, EphB2, Erk2, Fak, FGFRl, Fltl, Flt3, Flt4, Fms, Irak4, Jnkl, Jnk2, Jnk3, Kdr, Kit, MAP2K1, MAP4K4, MAPKAPK2, Met, p38, PDGFRB, Piml, PKC theta, Pyk2, Ret, Src, Stk6, TrkA, TrkB, Yes, and Zap70 by administering to the subject an effective amount of a composition including one or more compounds of Formula II, Formula III or Formula FV.

[0155] In one aspect, the invention provides methods for treating a disease or condition mediated by a protein kinase selected from the group consisting of AbI, A-Raf, B-Raf, Btk, c-Raf-1, EGFR, EphB2, Erk2, Fak, Fms, Irak4, Jnkl, Jnk2, Jnk3, Kit, MAP2K1, MΛP4K4, MAPKAPK2, Met, p38, Piml, PKC theta, Pyk2, Src, Stk6, TrkA, TrkB, Yes, and Zap70 by administering to the subject an effective amount of a composition including one or more compounds of Formula II, Formula III or Formula IV.

[0156] In one aspect, the invention provides methods for treating a disease or condition mediated by a protein kinase selected from the group consisting of Fms, Kit, MAP4K4, TrkA, and TrkB, and any mutations thereof, by administering to the subject an effective amount of a composition including one or more compounds of Formula II, Formula III or Formula IV,

[0157] In one aspect, the invention provides a method of treating a cancer by administering to the subject an effective amount of a composition including one or more compounds of Formula II, Atty. Dkt. No 039363-3303

Formula III or Formula IV, m combination with one or more other therapies or medical procedures effective in treating the cancer Other therapies or medical procedures include suitable anticancer therapy (e g drug therapy, vaccine therapy, gene therapy, photodynamic therapy) or medical procedure (e g surgery, radiation treatment, hyperthermia heating, bone marrow or stem cell transplant) In one aspect, the one or more suitable anticancer therapies or medical procedures is selected lrom treatment with a chemotherapeutic agent (e g chemotherapeutic drug), radiation treatment (e g x-ray, γ-ray, or electron, proton, neutron, or α particle beam), hyperthermia heating (e g microwave, ultrasound, radiofrequency ablation), Vaccine therapy (e g AFP gene hepatocellular carcinoma vaccine, AFP adenoviral vector vaccine, AG-858, allogeneic GM-CSF-secretion breast cancer vaccine, dendritic cell peptide vaccines), gene therapy (e g Ad5CMV-p53 vector, adenovector encoding MDA7, adenovirus 5-tumor necrosis factor alpha), photodynamic therapy (e g aminolevulinic acid, motexafin lutetium), surgery, and bone marrow and stem cell transplantation

(0158] In one aspect, the invention provides a method ot treating a cancer by administering to the subject an effective amount of a composition including one or more compounds of Formula II, Formula III or Formula IV, in combination with one or more suitable chemotherapeutic agents In one aspect, the one or more suitable chemotherapeutic agents is selected from an alkylating agent, including, but not limited to, adozelesm, altretamme, bizelesm, busulfan, caiboplatm, carboquone, carmustme, chlorambucil, cisplatin, cyclophosphamide, dacarbazme, estramustme, fotemustme, hepsulfam, lfosfamide, lmprosulfan, lrofulven, lomustme, mechlorethamme, melphalan, oxahplatin, piposulfan, semustine, streptozocin, temozolomide, thiotepa, and treosulfan, an antibiotic, including, but not limited to, bleomycin, dactinomycm, daunorubicin, doxorubicin, epirubicin, ldarubicin, menogaπl, mitomycin, mitoxantrone, neocarzmostatin, pentostatin, and plicamycin, an antimetabolite, including, but not limited to, azacitidinc, capecitabme, cladπbine, clofarabme, cytarabine, decitabine, floxuπdine, fludarabine, 5-fluorouracil, ftorafur, gemcitabme, hydroxyurea, mercaptopurme, methotrexate, nelarabme, pemetrexed, raltitrexed, thioguamne, and tπmetrexate, an immunotherapy, including, but not limited to, alemtuzumab, bevacizumab, cetuximab, gahximab, gemtuzumab, pamtumumab, pertuzumab, πtuximab, tositumomab, trastu7umab, and 90 Y ibntumomab tiuxetan, a hormone or hormone antagonist, including, but not limited to, anastrozole, androgens, buserelm, diethylstilbestrol, exemestane, flutamide, fulvestrant, goserelm, idoxifene, letrozole, leuprolide, magestrol, raloxifene, tamoxifen, and toremifcne, a taxane, including, but not limited to, DJ-927, docetaxel, TPI 287, paclitaxel and DHA-paclitaxel, a retinoid, including, but not limited to, ahtretmoin, bexarotene, fenretinide, isotretinoin, and tretinoin; an alkaloid, including, but not limited to, etoposide, homoharπngtonine, temposide, vinblastine, vincristine, vindesinc, and vmorelbine, an antiangiogenic agent, including, but not limited to, AE-941 (GW786034, Neovastat), ABT-510, 2- methoxyestradiol, lenahdomide, and thalidomide, a topoisomerase inhibitor, including, but not limited to, amsacnne, edotecaπn, exatecan, innotecan (also active metabolite SN-38 (7-ethyl-10-hydroxy- Atty. Dkt. No : 039363-3303 caπφtothecm)), rubitecan, topotecan, and 9-aminocaraptothecin; a kinase inhibitor, including, but not limited to, erlotimb, gefitinib, flavopiridol, imatimb mesylate, lapatinib. sorafenib, sunitinib malate, AEE-788, AG-013736, AMG 706, AMN107, BMS-354825, BMS-599626, UCN-Ol (7- hydroxystaurosporine), and vatalanib; a targeted signal transduction inhibitor including, but not limited to bortezomib, geldanamycin, and rapamycm, a biological response modifier, including, but not limited to, imiquimod, mterferon-α, and interleukin-2; and other chemotherapeutics, including, but not limited to, 3-AP (3-amino-2-carboxyaldehyde fhiosemicarba/one), ammoglutethimide, asparaginase, bryostatin-1, cilengitide, E7389, ixabepilone, procarbazine, suhndac, temsirolimus, tipifaraib. Preferably, the method of treating a cancer involves administering to the subject an effective amount of a composition of Formula II, Formula III or Formula IV in combination with a chemotherapeutic agent selected from 5-fluorouracil, carboplatin. dacarbazme, gefitinib, oxaliplatm, paclitaxel, SN-38, temozolomide, vinblastine, bevacizumab, cetuximab, or erlotinib.

10159] In another aspect, the invention provides a method of treating or prophylaxis of a disease or condition in a mammal, by administering to the mammal a therapeutically effective amount of one or more compounds of Formula II, Formula III or Formula IV, a prodrug of such compound, or a pharmaceutically acceptable salt of such compound or prodrug. The compound can be alone or can be part of a composition

[0160] In a related aspect, the invention provides kits that include a composition as descnbed herein In some embodiments, the composition is packaged, e g , in a vial, bottle, flask, which may be further packaged, e.g., within a box, envelope, or bag, the composition is approved by the U. S Food and Drug Administration or similar regulatory agency for administration to a mammal, e.g., a human; the composition is approved for administration to a mammal, e g , a human, for a protein kinase mediated disease or condition; the invention kit includes written instructions for use and/ or other indication that the composition is suitable or approved for administration to a mammal, e.g., a human, for a protein kinase -mediated disease or condition, and the composition is packaged m unit dose or single dose form, e.g., single dose pills, capsules, or the like.

[0161] In aspects involving treatment or prophylaxis of a disease or condition with the compounds of Formula II, Formula III or Formula IV, the disease or condition is, for example without limitation, neurologic diseases, including, but not limited to, cerebrovascular ischemia, multi-mfarct dementia, head injury, spinal cord injury, Alzheimer's disease (AD), Parkinson's disease, amyotrophic lateral sclerosis, dementia, senile chorea, and Huntmgton's disease; neoplastic diseases and associated complications, including, but not limited to, chemotherapy-mduced hypoxia, gastrointestinal stromal tumors (GISTs), prostate tumors, mast cell tumors (including, but not limited to, canine mast cell tumors), acute myeloid leukemia, acute lymphocytic leukemia, chronic myeloid leukemia, chronic lymphocytic leukemia, multiple myeloma, melanoma, mastocytosis, gliomas, glioblastoma, Atty. Dkt No 039363-3303 astrocytoma neuroblastoma, sarcomas (e g sai comas of neuroectodermal ongin, leiomyosarcoma), carcinomas (c g lung, breast, pancreatic colon, hepatocellular, renal, female genital tract, squamous cell, carcinoma m situ), lymphoma (e g histiocytic lymphoma, non-IIodgkm's lymphoma), MFN2 syndromes, neurofibiomatosis (including but not limited to, Schwann cell neoplasia), myelodysplastic syndrome, leukemia, tumor angiogenesis, cancers of the thyroid, liver, bone, skin, brain, central nervous system, pancieas, lung (e g small cell lung cancer, non small cell lung cancel), breast, colon, bladder, prostate, gastrointestinal tract, endometrium, fallopian tube, testes and o\ ary, and metastasis of tumors to other tissues, pain of neuropathic or inflammatory origin, including, but not limited to, acute pain, chrome pain, bone pam, cancer-related pain and migraine, cardiovascular diseases, including, but not limited to, heart failure, ischemic stroke, cardiac hypertrophy, thiombosis (e g thrombotic microangiopathy syndromes), afherosdeiosis, reperfusion injury and ischemia (e g cerebrovascular ischemia, lrver ischemia), inflammation including, but not limited to, age-related macular degeneration, rheumatoid arthritis, allergic rhinitis, inflammatory bowel disease (IBD), ulcerative colitis, Crohn's disease, systemic lupus erythematosis, Sjogren's Syndrome, Wegener's granulomatosis, psoriasis, scleroderma, chronic thyroiditis, Grave's disease, myasthenia gravis, multiple sclerosis, osteoarthritis, endometriosis, scarring (e g dermal, tissue), vascular restenosis, fibrotic disorders, hypereosinophiha, CNS inflammation, pancreatitis, nephritis, atopic dermatitis, and hepatitis, immunodeficiency diseases .including, but not limited to, severe combined immunodeficiency (SCID), organ transplant rejection, and graft versus host disease, renal or prostatic diseases, including, but not limited to, diabetic nephropathy, polycystic kidney disease, nephrosclerosis, glomerulonephritis, interstitial nephritis, Lupus nephritis, prostate hypeq^lasia, chronic renal failure, tubular necrosis, diabetes-associated renal complications, and hypertrophy, metabolic diseases, including, but not limited to, type 1 diabetes, type 2 diabetes, metabolic syndrome, obesity, hepatic steatosis, insulin lesistance, hyperglycemia, hpolysis and obesity, infection, including, but not limited to, Helicobacter pylori, Hepatitis and Influenza viruses, fever, and sepsis, pulmonary diseases, including, but not limited to, chronic obstructive pulmonary disease (COPD), acute respiratory distress syndrome (ARDS), asthma, allergy, bronchitis, emphysema, and pulmonary fibrosis, genetic developmental diseases, including, but not limited to, Noonan's syndrome, Crouzon syndrome, acrocephalosyndactyly type I, Pfeiffer's syndrome, Jackson-Weiss syndrome, Costello syndrome, (faciocutaneoskeletal syndrome), LEOPARD syndrome, cardio- faciocutaneous syndrome (CFC) and neural crest syndrome abnormalities causing cardiovascular, skeletal, intestinal, skin, hair and endocrine diseases, disorders of bone structure, mineralization and bone reformation and resorption, including, but not limited to, osteoporosis, increased risk of fracture, Paget's disease, hypercalcemia, and metastatis of cancer to bone, Grave's disease, Hirschsprung's disease, lymphoedema, selective T-cell defect (STD), X-hnked agammaglobulinemia, diabetic retinopathy, alopecia, erectile dysfunction, tuberous sclerosis, and diseases associated with muscle regeneration or degeneration, including, but not limited to, sarcopema, muscular dystrophics Atty. Dkt. No 039363-3303

(including, but not limited to, Duchenne, Becker, Emcry-Dreifuss, Limb-Girdle, Facioscapulohumeral, Myotonic, Oculopharyngeal, Distal and Congenital Muscular Dystrophies), motor neuron diseases (including, but not limited to, amyotrophic lateral sclerosis, infantile progressive spinal muscular atrophy, intermediate spinal muscular atrophy, juvenile spinal muscular atrophy, spinal bulbar muscular atrophy, and adult spinal muscular atrophy), inflammatory myopathies (including, but not limited to, dermatomyositis, polymyositis, and inclusion body myositis), diseases of the neuromuscular junction (including, but not limited to, myasthenia gravis, Lambert-Eaton syndrome, and congenital myasthenic syndrome), myopathies due to endocrine abnormalities (including, but not limited to, hyperthyroid myopathy and hypothyroid myopathy) diseases of peripheral nerve (including, but not limited to, Charcot-Maπe-Tooth disease, Dejenne- Sottas disease, and Friedreich's ataxia), other myopathies (including, but not limited to, myotonia congenita, paramyotonia congenita, central core disease, nemahne myopathy, myotubular myopathy, and periodic paralysis), and metabolic diseases of muscle (including, but not limited to, phosphorylase deficiency, acid maltase deficiency, phosphofructokmase deficiency, debrancher enzyme deficiency, mitochondrial myopathy, carnitine deficiency, carnitine palmatyl transferase deficiency, phosphoglycerate kinase deficiency, phosphoglycerate mutase deficiency , lactate dehydrogenase deficiency, and myoadenylate deaminase deficiency).

[0162] In a further aspect, the invention provides methods for treating a c-fms-mediated disease or condition in an animal subject (e g a mammal such as a human, other primates, sports animals, animals of commercial interest such as cattle, farm animals such as horses, or pets such as dogs and cats), e g , a disease or condition characterized by abnormal c-fms activity (e g kinase activity) Invention methods involve administering to the subject suffering from or at risk of a c-fms-mediated disease or condition an effective amount of compound of Formula II, F ormula III or Formula IV Ln one embodiment, the c-fms mediated disease is selected from the group consisting of immune disorders, including, but not limited to, rheumatoid arthritis, systemic lupus erythematosis (SLE), and transplant rejection, inflammatory diseases including, but not limited to, osteoarthritis, inflammatory bowel syndrome, ulcerative colitis, Crohn's disease, chronic obstructive pulmonary disease (COPD), emphysema, Kawasaki's Disease, hemophagocytic syndrome (macrophage activation syndrome), multicentric reticulohistiocytosis, and atherosclerosis, metabolic disorders, including, but not limited to, Type I diabetes, Type II diabetes, insulin resistance, hyperglycemia, obesity, and hpolysis, disorders of bone structure, mineralization and bone formation and resorption including, but not limited to, osteoporosis, increased risk of fracture, Paget's disease, hypercalcemia, infection-mediated osteolysis (e g osteomyelitis), pen-prosthetic or wcar-debns-mediated osteolysis, and metastasis of cancer to bone, kidney and genitourinary diseases, including, but not limited to, endometriosis, nephritis (e g glomerulonephritis, interstitial nephritis, I upus nephritis), tubular necrosis, diabetes- associated renal complications (e g diabetic nephiopathy), and renal hypertrophy, disorders of the Atty Dkt No 039363-3303 central nervous system, including, but not limited to, multiple sclerosis, stroke, Alzheimer s disease and Parkinson's disease, inflammatory and chronic pain, including, but not limited to, bone pain, and cancers, including, but not limited to, multiple myeloma, acute myeloid leukemia (AML) chrome myeloid leukemia (CML), prostate cancer, breast cancer, ovanan cancer, melanoma, glioblastoma multiforme, metastasis of tumors to other tissues, and other chronic myeloproliferative diseases such as myelofibrosis In one embodiment, the c-fms mediated disease is selected from the group consisting of inflammatory bowel syndrome, ulceratrve colitis, Crohn's disease, Type I diabetes, Type II diabetes, Paget's disease, diabetic nephiopafhy, multiple sclerosis, stroke, Alzheimer's disease and Parkinson's disease, inflammatory pain, chrome pain, bone pain, prostate cancer, and metastasis of tumors to tissues other than bone In one embodiment, the c-fms mediated disease is selected from the group consisting of multiple sclerosis, stroke, Alzheimer's disease, Parkinson's disease, inflammatory pam, chronic pain, and bone pain In one embodiment, the c-fms mediated disease is selected from the group consisting of multiple sclerosis, stroke, Alzheimer's disease, and Parkinson's disease In one embodiment, the c-fms mediated disease is selected from the group consisting of inflammatory pam, chronic pain, and bone pain

[0163] In a further aspect, the invention provides methods for treating a c-fms-mediated disease or condition in an animal subject (e g a mammal such as a human, other primates, sports animals, animals of commercial interest such as cattle, farm animals such as horses, or pets such as dogs and cats), e g , a disease or condition characterized by abnormal c-fms activity (e g kinase activity) Invention methods involve administering to the subject suffering from or at risk of a c-fms-mediated disease or condition an effective amount of compound of Formula I In one embodiment, the c-fms mediated disease is selected from the group consisting of inflammatory bowel syndrome, ulcerative colitis, Crohn's disease, Type I diabetes, Type II diabetes, Paget's disease, diabetic nephropathy, multiple sclerosis, stroke, Alzheimer's disease and Parkinson's disease, inflammatory pain, chronic pam, bone pain, prostate cancer, and metastasis of tumors to tissues other than bone In one embodiment, the c-fms mediated disease is selected from the group consisting of multiple sclerosis, stroke, Alzheimer's disease, Parkinson's disease, inflammatory pain, chronic pain, and bone pain In one embodiment, the c-fms mediated disease is selected from the group consisting of multiple sclerosis, stroke, Alzheimer's disease, and Parkinson's disease In one embodiment, the c-fms mediated disease is selected from the group consisting of inflammatory pam, chionic pain, and bone pam

[0164] In a related aspect, invention methods involve administering to the subject suffering from or at risk of a c-fms-mediated disease or condition an effective amount of compound of Formula I, Formula II, Formula III or Formula IV, wherin the Fms-mediated disease or condition is selected from the group consisting of inflammatory bowel syndrome, ulcerative colitis, Crohn's disease, Type I Atty Dkt No 039363-3303 diabetes, Type II diabetes, Paget's disease diabetic nephropathy, multiple sclerosis stroke, Abheimcr's disease. Parkinson's disease inflammatory pain, chronic pain, bone pain, prostate cancer, and metastasis of tumors to other tissues

[0165] In a related aspect, invention methods involve administering to the subject suffering trom or at nsk of a c-fms-mediated disease or condition an effective amount of compound of Formula I, Formula II, Formula III or Formula IV, whenn the Fms-mediated disease or condition is selected from the group consisting of multiple sclerosis, stroke, Alzheimer's disease, Parkinson's disease, inflammatory pam, chronic pain, and bone pain

[0166] In a related aspect, invention methods involve administering to the subject suffering from or at nsk of a c-fms-mediated disease or condition an effective amount of compound of Formula I, Formula II, Formula III or Formula IV, whenn the Fms-mediatcd disease or condition is selected from the group consisting of multiple sclerosis, stroke, Alzheimer's disease, and Parkinson's disease

[0167] In a related aspect, invention methods involve administering to the subject suffering from or at nsk of a c-fms-mediated disease or condition an effective amount of compound of Formula I, Formula II, Formula III or Formula IV, whenn the Fms-mediated disease or condition is selected from the group consisting of inflammatory pam, chronic pain, and bone pain

[0168] In a related aspect, compounds of Formula II, Formula III or Formula IV, can be used in the preparation of a medicament for the treatment of a Fms-mediated disease or condition selected from the group consisting of immune disorders, including, but not limited to, rheumatoid arthritis, systemic lupus erythematosa (SLE), and transplant rejection, inflammatory diseases including, but not limited to, osteoarthntis, inflammatory bowel syndrome, ulcerative colitis, Crohn's disease, chronic obstructive pulmonary disease (COPD), emphysema, Kawasaki's Disease, hemophagocytic syndrome (macrophage activation syndrome), multicentric reticulohistiocytosis, and atherosclerosis, metabolic disorders, including, but not limited to, Type I diabetes, Type II diabetes, insulin resistance, hyperglycemia, obesity, and hpolysis, disorders of bone structure, mineralization and bone formation and resorption, including, but not limited to, osteoporosis, increased risk of fracture, Paget's disease, hypercalcemia, infection-mediated osteolysis (e g osteomyelitis), pen-prosthetic or wear-debns- mediated osteolysis, and metastasis of cancer to bone, kidney and genitourinary diseases, including, but not limited to, endometriosis, nephntis (e g glomerulonephritis, interstitial nephritis, Lupus nephritis), tubular necrosis, diabetes-associated renal complications (e g diabetic nephropathy), and renal hypertrophy, disorders of the central nervous system, including, but not limited to, multiple sclerosis, stroke, Alzheimer's disease and Parkinson's disease, inflammatory and chronic pam, including, but not limited to, bone pain, and cancers, including, but not limited to, multiple myeloma, acute myeloid leukemia (AML), chronic myeloid leukemia (CML), prostate cancer, breast cancer, Atty. Dkt No 039363-3303 ovarian cancer, melanoma, glioblastoma multiforme, metastasis of tumors to other tissues, and other chronic myeloproliferative diseases such as myelofibrosis

[0169] In a related aspect, compounds of Formula II, Formula III or Formula IV, can be used in the preparation of a medicament for the treatment of a Fms-mcdiated disease or condition selected from the group consisting of inflammatory bowel syndrome, ulcerative colitis, Crohn's disease, Type I diabetes, Iype II diabetes. Paget's disease, diabetic nephropathy), multiple sclerosis, stroke, Alzheimer's disease, Parkinson's disease, inflammatory pain, chronic pain, bone pain, prostate cancer, and metastasis of tumors to other tissues

[0170] In a related aspect, compounds of Formula II, Formula III or Formula IV, can be used in the preparation of a medicament for the treatment of a Fms-mediated disease or condition selected from the group consisting of multiple sclerosis, stroke, Alzheimer's disease, Parkinson's disease, inflammatory pam, chronic pam, and bone pain

[0171] In a related aspect, compounds of Formula II, Formula III or Formula IV, can be used m the preparation of a medicament for the treatment of a Fms-mediatcd disease or condition selected from the group consisting of multiple sclerosis, stroke, Alzheimer's disease, and Parkinson's disease

[0172] In d related aspect, compounds of Formula II, Formula III or Formula IV, can be used in the preparation of a medicament for the treatment of a Fms-mediated disease or condition selected from the group consisting of inflammatory pain, chronic pam, and bone pam

[0173] In a related aspect, compounds of Formula II, Formula III or Formula IV, can be used m the preparation of a medicament for the treatment of a Kit-mediated disease or condition selected from the group consisting of malignancies, including, but not limited to, mast cell tumors, small cell lung cancer, testicular cancer, gastrointestinal stromal tumors (GISTs), glioblastoma, astrocytoma, neuroblastoma, carcinomas of the female genital tract, sarcomas of neuroectodermal origin, colorectal carcinoma, carcinoma in situ, Schwann cell neoplasm associated with neurofibromatosis, acute myelocytic leukemia, acute lymphocytic leukemia, chronic myelogenous leukemia, mastocytosis, melanoma, and canine mast cell tumors, and inflammatory diseases, including, but not limited to, asthma, rheumatoid arthritis, allergic rhinitis, multiple sclerosis, inflammatory bowel syndrome, transplant rejection, and hypereosmophiha

[0174] The compounds of Formula I, Formula II, Formula III or Formula IV with kinase activity IC_5C less than 10 μM as determined in a standard ass>ay described herein can be used to treat protein kinase mediated diseases and conditions related to the following protein kinases, for example without limitation Atty Dkt No 039363-3303

AbI, related to chronic myeloid leukemia (CML), acute lymphoblastic leukemia (ALL) and acute myelogenous leukemia (AML),

Λktl, related to gastric, prostate, colorectal ovaπan, pancreatic and breast cancer, glioblastoma and leukemia, as w ell as schizophrenia and bipolar disorders, and also use in combination with other chemotherapeutic drugs,

Akt2, related to hyperglycemia due to penpheral insulin resistance and nonsuppressible hepatic glucose production accompanied by inadequate compensatory hyperinsulinemia, also related to pancreatic, ovarian and breast cancer,

Akt3, related to melanoma, prostate and breast cancer,

ALK, related to non-Hodgkin lymphomas such as diffuse large B-cell lymphoma and anaplastic large cell lymphoma

Alk5, related to pancreatic and biliary cancers, and cutaneous T-cell lymphoma,

A-Raf, related to neurologic diseases such as multi-infarct dementia, head injury, spinal cord injury, Alzheimer's disease (AD), Parkinson's disease, neoplastic diseases including, but not limited to, melanoma, glioma, sarcoma, carcinoma (e g colorectal, lung, breast, pancreatic, thyroid, renal, ovanan), lymphoma (e g histiocytic lymphoma), neurofibromatosis, myelodysplastic syndrome, leukemia, tumor angiogenesis, pam of neuropathic or inflammatory origin, including, but not limited to, acute pam, chronic pam, cancer-related pam and migraine, and diseases associated with muscle regeneration or degeneration, including, but not limited to, \ascular restenosis, sarcopema, muscular dystrophies (including, but not limited to, Duchenne, Becker, Emery-Dreifuss, Limb-Girdle, Facioscapulohumeral, Myotonic, Oculopharyngeal, Distal and Congenital Muscular Dystrophies), motor neuron diseases (including, but not limited to, amyotrophic lateral sclerosis, infantile progressive spinal muscular atrophy, intermediate spinal muscular atrophy, juvenile spinal muscular atrophy, spinal bulbar muscular atrophy, and adult spinal muscular atrophy), inflammatory myopathies (including, but not limited to, dermatomyositis, polymyositis, and inclusion body myositis), diseases of the neuromuscular junction (including, but not limited to, myasthenia gravis, Lambert-Eaton syndrome, and congenital myasthenic syndrome), myopathies due to endocrine abnormalities (including, but not limited to, hyperthyroid myopathy and hypothyroid myopathy) diseases of peripheral nerve (including, but not limited to, Charcot- Mane-Tooth disease, Dejeπne-Sottas disease, and Friedreich's ataxia), other myopathies (including, but not limited to, myotonia congenita, paramyotonia congenita, central core disease, nemahne myopathy, myotubular myopathy, and periodic paralysis), and metabolic diseases of muscle (including, but not limited to, phosphorylase deficiency acid maltase deficiency, phosphofructokmase deficiency, debrancher enzyme deficiency, mitochondrial myopathy, carnitine deficiency, carnitine palmatyl transferase deficiency, phosphoglycerate Atty Dkt No 039363-3303 kinase deficiency, phosphoglycerate mutase deficiency, lactate dehydrogenase deficiency, and myoaden\late deaminase deficiency)

B-Raf or c-Raf-1 , related to neurologic diseases, including, but not limited to, as multi-infarct dementia, head injury, spinal cord injury, Alzheimer's disease (AD), Parkinson's disease, neoplastic diseases including, but not limited to, melanoma, glioma, sarcoma, carcinoma (e g colorectal, lung, breast, pancreatic, thyroid, renal, ovarian), lymphoma (e g histiocytic lymphoma) neurofibromatosis, acute myeloid leukemia, myelodvsplastic syndrome, leukemia, tumor angiogenesis, neuroendocπne tumors such as medullary thyroid cancer, carcinoid, small cell lung cancer and pheochromocytoma, pain of neuropathic or inflammatory origin, including, but not limited to, acute pain, chronic pam, cancer-related pain, and migraine, cardiovascular diseases including, but not limited to, heart failure, ischemic stroke, cardiac hypertrophy, thrombosis (e g thrombotic microangiopathy syndromes), atherosclerosis, reperfusion injury, inflammation including, but not limited to, psoriasis, arthritis and autoimmune diseases and conditions, osteoarthritis, endometriosis, scarring, vascular restenosis, fibrotic disorders, rheumatoid arthritis, inflammatory bowel disease (IBD), immunodeficiency diseases, including, but not limited to, organ transplant rejection, graft versus host disease, renal or prostatic diseases, including, but not limited to, diabetic nephropathy, polycystic kidney disease, nephrosclerosis, glomerulonephritis, prostate hyperplasia, metabolic disorders, including, but not limited to obesity, infection, including, but not limited to, Helicobacter pylori Hepatitis and Influenza viruses, fever, and sepsis, pulmonary diseases including, but not limited to, chronic obstructive pulmonary disease (COPD) and acute respiratory distress syndrome (ARDS), genetic developmental diseases, including, but not limited to, Noonan's syndrome, Costello syndrome, (faciocutaneoskeletal syndrome), LEOPARD syndrome, cardio-faciocutaneous syndrome (CFC), and neural crest syndrome abnormalities causing cardiovascular skeletal, intestinal, skin, hair and endocrine diseases Brk, related to breast and colon cancer, and head and neck squamous cell carcinoma,

Btk, related to X-linked agammaglobulinemia, acute lymphocytic leukemia, autoimmune diseases such as multiple sclerosis, systemic lupus erythematosis, rheumatoid arthritis, and Graves' disease, immune suppression in organ transplant, and drug sensitivity of B-hneage cells,

Cdk2, related to prostate, breast, colorectal and ovanan cancer,

Cdk4, related to glioblastoma (e g glioblastoma multiforme), anaplastic astrocytoma, and breast cancer,

Cdk5, related to Alzheimer's disease, amyotrophic lateral sclerosis and Lewy body disease.

Cdk6, related to glioblastoma multiforme, non-Hodgkin's lymphoma, splenic marginal zone lymphoma, T-cell lymphoblastic lymphoma (T-LBL) and T-cell acute lymphoblastic leukemia (T-ALL),

CHKl, related to DNA damage repair, sensitizes cells to chemotherapeutic agents, Atty Dkt No 039363-3303

Csk, related to colon and pancreatic carcinomas, and autoimmune pathology such as type 1 diabetes, rheumatoid arthritis and systemic lupus erythematosus,

EGFR, related to breast, colorectal, bladder, prostate and non small cell lung cancer, squamous cell carcinomas of the head and neck cancer, oral cavity and esophagus, and glioblastoma multiforme,

EphAl , related to head and neck squamous cell carcinoma, hepatoma and lung cancer, EphΛ2, related to aberrant short-range contact-mediated axonal guidance, bladder, breast, prostate, colon, skin, cervical, ovaπan, pancreatic and lung cancers, and metastatic melanoma, EphB2, related to angiogenesis disorder (e g ocular angiogenesis disease such as retinopathy), and cancer (e g glioblastoma, breast and liver cancer), EphB4, related to colorectal cancer (CRC), head and neck squamous cell carcinoma, and tumours of the prostate, breast, endometrium, and bladder,

Erk2, related to aberrant proliferation, differentiation, transcription regulation and development, and may be usctul in treating inflammation, for example inflammation associated with Lyme neuroborrehosis, and in treating cancers, such as gastric cancer,

Fak, related to colon and breast tumors, and is also related to esophageal squamous cell carcinoma, melanoma, anaplastic astrocytoma, glioblastoma, ductal carcinoma in situ, prostate and hepatocellular carcinoma, and tumor metastases, and may also provide synergistic effects when used with other chemotherapeutic drugs, FGFRl , related to 8pl 1 myeloproliferative syndrome; FGFR2, related to Crouzon Syndrome, Jackson-Weiss Syndrome, Apert Syndrome, craniosynostosis, Pfeiffer Syndrome, acrocephalo syndactyly type V, and Beare-Stevenson Cutis Gyrata Syndrome;

FGFR3, related to angiogenesis, wound healing, achondroplasia, Muenke craniosynostosis, Crouzon syndrome, acanthosis nigricans, thanatophoric dysplasia, bladder carcinomas, and multiple myeloma;

FGFR4, related to cancer of the breast, lung, colon, medullary thyroid, pancreas, ovary, prostate, endometrium, and fallopian tube, head and neck squamous cell carcinomas and leiomyosarcoma;

Fltl , related to non-small cell lung carcinoma, prostate carcinoma, and colorectal cancer, Flt3, related to acute myeloid leukemia, myelodysplastic syndrome, acute lymphoblastic leukemia,

Flt4, related to primary lymphoedcma,

Fms, related to immune disorders, including, but not limited to, rheumatoid arthritis, systemic lupus erythematosis (SLE), and transplant rejection, inflammatory diseases including, but not limited to, osteoarthritis, inflammatory bowel syndrome, ulcerative colitis, Crohn's disease, chronic obstructive pulmonary disease (COPD), emphysema, Kawasaki's Disease, Atty Dkt No ^• 039363-3303 hemophagocytic syndrome (macrophage activation syndrome), multicentric reticulohistiocytosis, and atherosclerosis, metabolic disorders, including but not limited to. Type I diabetes, Type II diabetes, insulin resistance, hyperglycemia, obesity, and hpolysis, disorders of bone structure, mineralization and bone formation and resorption, including, but not limited to, osteoporosis, increased risk of fracture, Paget' s disease, hypercalcemia, infection-mediated osteolysis (e g osteomyelitis), pen-prosthetic or wear-dcbπs-mediated osteolysis and metastasis of cancer to bone, kidney and genitourinary diseases, including, but not limited to, cndometπosis, nephritis (e g glomerulonephritis, interstitial nephritis, Lupus nephritis), tubular necrosis, diabetes-associated renal complications (e g diabetic nephropathy), and renal hypertrophy, disorders of the central nervous system, including, but not limited to, multiple sclerosis, stroke, Alzheimer's disease and Parkinson's disease, inflammatory and chronic pain, including, but not limited to, bone pain, and cancers, including, but not limited to, multiple myeloma, acute myeloid leukemia (AML), chronic myeloid leukemia (CML), prostate cancer, breast cancer, ovarian cancer, melanoma, glioblastoma multiforme, metastasis of tumors to other tissues, and other chronic myeloproliferative diseases such as myelofibrosis,

Frk, related to acute myeloid leukemia and type 1 diabetes,

Fyn, related to Alzheimer's disease, schizophrenia and prevention of metastases, e g in melanoma and squamous cell carcinoma,

GSK3 (Gsk3α and/or Gsk3β), related to CNS disorders such as Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, diabetes type II, bipolar disorders, stroke, cancer, chronic inflammatory disease, leucopenia, schizophrenia, chronic pain, neuropathic pain, and traumatic head injury,

HCK, related to chronic myelogenous leukemia and acute lymphocytic leukemia,

Her2/Erbb2, related to prostate and breast cancer;

Her4/Erbb4, related to childhood medulloblastoma,

IGFlR, related to prostate cancer, hepatocellular carcinoma,

IKK beta, related to leukemia of T-cells, necrosis, insulin resistance, and malignant neoplasms,

Irak4, related to bacterial infections, immunodeficiency syndrome, Crohn's disease, ulcerative colitis, asthma, chronic bronchitis, cardio hypertrophy, and kidney hypertension,

Itk, related to allergic asthma,

Jakl, related to Hepatitis C virus infection,

Jak2, related to myeloproliferative disorders such as polycythaemia \ era, myelofibrosis, essential thrombocythemia, myeloid metaplasia and leukemias, including, but not limited to, acute lymphoblastic leukemia, chronic neutrophilic leukemia, juvenile myelomonocytic leukemia, CMML, Philadelphia chromosome-negative CML, megakaryocyte leukemia, and acute erythroid leukemia, Atty Dkt No 039363-3303

Jak3, related to X-lmked severe combined immunodeficiency, myeloproliferative disorders, transplant rejection and autoimmune diseases such as rheumatoid arthritis inflammatory bowel syndrome, Crohn's disease, systemic lupus erythematosis, ulcerative colitis, psoriasis, and multiple sclerosis,

Jnk (Jnkl Jnk2, Jnk3), related to metabolic diseases including, but not limited to, type 1 diabetes, type 2 diabetes, metabolic syndrome, obesity, and hepatic steatosis, cardiovascular diseases such as atherosclerosis, ischemia (e g cerebrovascular ischemia, liver ischemia), reperfusion injury, cardiac hypertrophy, renal diseases such as chronic renal failure, neoplastic diseases and associated complications, including, but not limited to, chemotherapy-mduced hypoxia, prostate tumors, myeloid leukemia and cancers of the liver bone, skin, brain, pancreas, lung breast, colon, prostate and ovary, transplant rejection, pam ot neuropathic or inflammatory origin including, but not limited to, acute and chronic pain, inflammatory and autoimmune diseases including, but not limited to, age-related macular degeneration, rheumatoid arthritis, inflammatory bowel disease, ulcerative colitis, Crohn's disease, systemic lupus erythematosis, Sjogren's Syndrome, psonasis, scleroderma, chronic thyroiditis, Grave's disease, myasthenia gravis, and multiple sclerosis, and inflammation in other organs including, but not limited to, CNS inflammation, pancreatitis, nephritis, atopic dermatitis, and hepatitis, airway inflammatory diseases such as asthma, allergy, bronchitis, pulmonary fibrosis, chronic obstructive pulmonary disease, neurologic diseases such as stroke, cerebrovascular ischemia, neurodegenerative diseases such as Parkinson s disease, Alzheimer's disease amyotrophic lateral sclerosis, dementia, senile chorea, head and spinal cord trauma, and Huntmgton's disease More particularly, Jnkl is related to type 1 diabetes, type 2 diabetes, metabolic syndrome, obesity and hepatic steatosis, Jnk2 is related to atherosclerosis, and Jnk3 is related to inflammatory diseases including, but not limited to, autoimmune diseases such as rheumatoid arthritis, inflammatory bowel syndrome, Crohn's disease, systemic lupus erythematosis, Sjogren's Syndrome, psoriasis and multiple sclerosis, airway inflammatory diseases such as asthma, allergy, pulmonary fibrosis, and chronic obstructive pulmonary disease, and inflammation in other organs, such as CNS inflammation, pancreatitis, nephritis, and hepatitis, neurologic diseases such as stroke, cerebrovascular ischemia, and neurodegenerative diseases such as Parkinson's disease, Alzheimer's disease, and Huntmgton's disease, and neoplastic diseases such as prostate tumors and myeloid leukemia,

Kdr, related to anti-angiogenesis for treating solid tumor growth (e g ovarian, lung, breast, prancreatic, prostate, colon, gastrointestinal stromal tumor, non small cell lung cancer, and epidermoid cancer), metastasis, psoriasis, rheumatoid arthritis, diabetic retinopathy and age related macular degeneration,

Kit, related to malignancies, including, but not limited to, mast cell tumors, small cell lung cancer, testicular cancer, gastrointestinal stromal tumors (GISTs), glioblastoma, astrocytoma, 2007/088443

Atty Dkt No 039363-3303 neuroblastoma, carcinomas of the female genital tract, sarcomas ot neuroectodermal ongin, colorectal carcinoma, carcinoma in situ, Schwann cell neoplasia associated with neurofibromatosis, acute myelocytic leukemia, acute lymphocytic leukemia, chionic myelogenous leukemia, mastocytosis, melanoma, and canine mast cell tumors, and inflammatory diseases, including, but not limited to, asthma, rheumatoid arthritis, allergic rhinitis, multiple sclerosis, inflammatory bowel syndrome, transplant re_jection, and hypereosmophiha,

LCK, related to acute lymphoblastic leukemia, T-cell lymphoma, lymphopenia, renal carcinoma, colon carcinoma, severe combined immunodeficiency, multiple sclerosis, inflammatory bowel and type I diabetes

MAP2K1 , related to acute myeloid leukemia, breast, ovarian and liver cancer, MAP2K2, related to cancer and inflammation,

MAP4K4, related to metabolic indications, including, but not limited to, re-sens>itizing fat and muscle cells to insulin, ameliorating the pathology in adipocytes, ameliorating the pathology in muscle cells, metabolic syndrome, and type II diabetes, a broad range of oncology indications, including, but not limited to, blocking the migration, invasion and metastasis in many different tumor types, and T-cell mediated autoimmune diseases, MAPKAPK2, cancer (e g prostate, breast), stroke, menengitis, and inflammatory disorders, Met, related to kidney, breast, bladder, non-small-cell lung, colorectal, and bladder cancers, and hepatocellular carcinoma,

Mnkl , related to conditions associated with heat shock, nutπent depπvation, oxidative or osmotic stress, and infection of mammalian cells (e g with viruses such as adenovirus (Ad) or influenza virus), and autoimmune diseases, MLKl, related to neurodegenerative diseases such as Alzheimer's disease and Parkinson^'s disease, and inflammatory disorders, p38, related to acute coronary syndrome, stroke, atherosclerosis, and inflammatory autoimmune diseases such as rheumatoid arthritis, inflammatory bowel disease, and Crohn's disease, PDGrR (PDGFRΛ, PDGFRB), related to idiopathic hypereosinophilic syndrome, chronic eosinophilic leukemia glioma, gastrointestinal stromal tumors (GISTs), juvenile myelomonocytic leukemia, metastatic medulloblastoma, atherogenesis, and restenosis More particularly, PDGFRA related to idiopathic hypereosinophilic syndrome, chronic eosinophilic leukemia, glioma, gastrointestinal stromal tumors (GISTs), juvenile myelomonocytic leukemia, metastatic medulloblastoma, atherogenesis, and restenosis, and PDGFRB related to idiopathic hypereosinophilic syndrome, chronic eosinophilic leukemia, juvenile myelomonocytic leukemia, and metastatic medulloblastoma, PDPKl , related to cancer and diabetes, Atty Dkt No 039363-3303

Piml, related to cancers such as hematopoietic (e g acute myeloid and acute lymphoid leukemias) and prostate cancers and non-Hodgkm's lymphomas, Pim2, related to lymphomas, Pim3, related to hepatocellular carcinoma,

PKC alpha, related to pituitary tumors and prefrontal cortical dysfunction such as distractibihty, impaired judgment, impulsivity, and thought disorder, also may be used to sensitize chemotherapy in breast, colon, and non small cell lung cancers, PKC beta, related to diabetic retinopathy, PKC-theta, related to insulin resistance, F-cell lymphoma, Plkl, related to cancers (e g lymphoma of the thyroid, non-Hodgkin's lymphomas, colorectal cancers leukemias and melanoma), also useful as sensitizer in chemotherapy, Pyk2, related to inflammation (e g osteoporosis, polycystic kidney disease, rheumatoid arthintis and inflammatory bowel disease), CNS disease (e g Parkinson's disease and Alzheimer's disease), stroke and cancers (e g gliomas, breast cancer, and pancreatic cancer), Ret, related to cancer of the thyroid, neuroblastoma, familial medullary thyroid carcinoma (FM PC), multiple endocrine neoplasia type I1A and HB (MEN2A, MEN2B), and neurodegenerative disorders (e g Hirschsprung's disease, Parkinson's disease, Alzheimer's disease, and amyotrophic lateral sclerosis),

ROCK (ROCK-I , ROCK-2), related to cancers (e g o\aπan cancer, hepatocellular carcinoma, pancreatic cancer), ocular disease (e g glaucoma), cardiac hypertrophy, improved renal perfusion, transplant rejection, and acute respiratory distress syndrome, Ron, related to cancer and inflammation, Src, related to cancer and osteoporosis, Stk6, related to gastric bladder, breast, lung, CNS, ovarian, kidney, colon, prostate, pancreas, and cervical cancers, melanoma, leukemia, and neuroblastoma, Syk, related to lymphomas (e g mantle cell lymphoma), TEC, related to sepsis, septic shock, inflammation, rheumatoid arthritis, Crohn's disease, irritable bowel disease (EBD), and ulcerative colitis,

Tie2 (TEK), related to cancer, arthritis (e g rheumatoid arthritis), and atherosclerosis, IYkA, related to pain (e g chronic pam, neuropathic pain), cancer (e g prostate cancer, lung cancer, pancreatic cancer), allergic disorders (e g asthma), arthritis, diabetic retinopathy, macular degeneration and psoriasis,

TrkB, related to obesity, hyperphagia, developmental delays, cancer (e g prostate cancer, lung cancer, Wilms tumors, neuroblastoma pancreatic cancer), \ anous neuropathies (e g stroke, multiple sclerosis, transverse myelitis, and encephalitis), and diabetes

Yes, related to various cancers including, but not limited to, esophageal squamous cell carcinoma, and US2007/088443

Atty. Dkt, No.: 039363-3303

Zap70, related to AIDS, systemic lupus erythematosus, myasthenia gravis, atherosclerosis, rejection of transplanted organs or tissues, allograft rejection including, but not limited to, acute and chronic allograft rejection, graft versus host disease, rheumathoid arthritis, psoriasis, systemic sclerosis, atopic dermatitis, eczematous dermatitis, alopecia, and inflammation of the nasal mucus membrane, including all forms of rhinitis.

[0175] Additional aspects and embodiments will be apparent from the following Detailed Description and from the claims.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0176] As used herein the following definitions apply unless clearly indicated otherwise:

[0177] "Halogen" refer to all halogens, that is, chloro (Cl), fluoro (F), bromo (Br), or iodo (I).

[0178] "Hydroxyl" or "hydroxy" refer to the group -OH.

[0179] "Thiol" refers to the group -SH.

[0180] "Lower alkyl" alone or in combination means an alkane -derived radical containing from 1 to 6 carbon atoms (unless specifically defined) that includes a straight chain alkyl or branched alkyl. The straight chain or branched alkyl group is attached at any available point to produce a stable compound. In many embodiments, a lower alkyl is a straight or branched alkyl group containing from 1-6, 1-4, or 1-2, carbon atoms, such as methyl, ethyl, propyl, isopropyl, butyl, t-butyl, and the like. A "substituted lower alkyl" denotes lower alkyl that is independently substituted, unless indicated otherwise, with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents, attached at any available atom to produce a stable compound, wherein the substituents are selected from the group consisting of -F, -OH, -NH₂, -NO₂, -CN, -C(O)OH, -C(S)OH, -C(O)NH₂, -C(S)NH₂, -S(O)₂NH₂, -NHC(O)NH₂, -NHC(S)NH₂, -NHS(O)₂NH₂, -C(NH)NH₂, -OR⁰, -SR⁰, -OC(O)R⁰, -OC(S)R⁰, -C(O)R⁰, -C(S)R⁰, -C(O)OR⁰, -C(S)OR⁰, -S(O)R⁰, -S(O)₂R⁰, -C(O)NHR⁰, -C(S)NHR⁰, -C(O)NR⁰R⁰, -C(S)NR⁰R⁰, -S(O)₂NHR⁰, -S(O)₂NR⁰R⁰, -C(NH)NHR⁰. -C(NH)NR^PR^C, -NHC(O)R⁰, -NIIC(S)R⁰, -NR⁰C(O)R⁰, -NR⁰C(S)R⁰, -NHS(O)₂R⁰, -NR⁰S(O)₂R⁰, -NHC(O)NHR⁰, -NHC(S)NHR⁰, -NR⁰C(O)NH₂, -NR⁰C(S)NH₂, -NR⁰C(O)NHR⁰, -NR⁰C(S)NHR⁰, -NHC(O)NR⁰R⁰, -NHC(S)NR⁰R⁰, -NR⁰C(O)NR⁰R⁰, -NR⁰C(S)NR⁰R⁰, -NHS(O)₂NHR⁰, -NR⁰S(O)₂NH₂, -NR⁰S(O)₂NHR⁰, -NHS(O)₂NR⁰R⁰, -NR⁰S(O)₂NR⁰R⁰, -NHR⁰, -NR⁰R⁰, -R^e, -R^f, and -R^g. Furthermore, possible substitutions include subsets of these substitutions, such as are indicated herein, for example, in the description of compounds of Formula I, Formula II, Formula III or Formula IV, attached at any available atom to produce a stable compound. For example "fluoro substituted lower alkyl" denotes a lower alkyl group substituted with one or more fluoro atoms, such as perfluoroalkyl, where preferably Atty. Dkt. No.: 039363-3303 the lower alkyl is substituted with 1, 2, 3, 4 or 5 fluoro atoms, also 1, 2, or 3 fluoro atoms. While it is understood that substitutions are attached at any available atom to produce a stable compound, when optionally substituted alkyl is an R group of a moiety such as -OR (e.g. alkoxy), -SR (e.g. thioalkyl), -NHR (e.g. alkylamino), -C(O)NHR, and the like, substitution of the alkyl R group is such that substitution of the alkyl carbon bound to any O, S, or N of the moiety (except where N is a heteroaryl ring atom) excludes substituents that would result in any O, S, or N of the substituent (except where N is a heteroaryl ring atom) being bound to the alkyl carbon bound to any O, S, or N of the moiety. "C2-6 alkyl" denotes lower alkyl containing 2-6 carbon atoms. A "substituted C₂.₆ alkyl" denotes optionally substituted lower alkyl containing 2-6 carbon atoms. A "substituted methyl" denotes methyl that is independently substituted, unless indicated otherwise, with 1 , 2, or 3 substituents, wherein the substituents are selected as per optionally substituted lower alkyl.

[0181] "C₁.₃ alkylene" refers to a divalent alkane-derived radical containing 1-3 carbon atoms, straight chain or branched, from which two hydrogen atoms are taken from the same carbon atom or from different carbon atoms. C) ₃ alkylene includes methylene -CH₂-, ethylene -CHaCH₂-. propylene -CH₂CH₂CH₂-, and isopropylene -CH(CH₃)CH₂- or -CH₂CH(CH₃)-. C_1-3 alkylene substituted with one or more substituents indicates C₁.₃ alkylene that is independently substituted, with one or more, preferably 1 , 2, 3, 4 or 5, also 1 , 2, or 3 substituents as indicated, attached at any available atom to produce a stable compound.

[0182] "Lower alkenyl" alone or in combination means a straight or branched hydrocarbon containing 2-6 carbon atoms (unless specifically defined) and at least one, preferably 1-3, more preferably 1-2, most preferably one, carbon to carbon double bond. Carbon to carbon double bonds may be either contained within a straight chain or branched portion. Examples of lower alkenyl groups include ethenyl, propenyl, isopropenyl, butenyl, and the like. A "substituted lower alkenyl" denotes lower alkenyl that is independently substituted, unless indicated otherwise, with one or more, preferably 1 , 2, 3, 4 or 5, also 1 , 2, or 3 substituents, attached at any available atom to produce a stable compound, wherein the substituents are selected from the group consisting of -F, -OH, -NH₂, -NO₂, -CN, -C(O)OH, -C(S)OH, -C(O)NH₂, -C(S)NH₂, -S(O)₂NH₂, -NHC(O)NH₂, -NHC(S)NH₂, -NHS(O)₂NH₂, -C(NH)NH₂, -OR⁰, -SR⁰, -OC(O)R⁰, -OC(S)R⁰, -C(O)R", -C(S)R⁰, -C(O)OR⁰, -C(S)OR⁰, -S(O)R⁰, -S(O)₂R⁰, -C(O)NHR⁰, -C(S)NHR⁰, -C(O)NR⁰R⁰, -C(S)NR⁰R⁰, -S(O)₂NHR⁰, -S(O)₂NR⁰R⁰, -C(NH)NHR⁰, -C(NH)NR^PR^C, -NHC(O)R⁰, -NHC(S)R⁰, -NR⁰C(O)R⁰, -NR⁰C(S)R⁰, -NHS(O)₂R⁰, -NR⁰S(O)₂R⁰, -NHC(O)NHR⁰, -NHC(S)NHR⁰, -NR⁰C(O)NH₂, -NR⁰C(S)NH₂, -NR⁰C(O)NHR⁰, -NR⁰C(S)NHR⁰, -NHC(O)NR⁰R⁰, -NHC(S)NR⁰R⁰, -NR⁰C(O)NR⁰R⁰, -NR⁰C(S)NR⁰R⁰, -NHS(O)₂NHR⁰, -NR⁰S(O)₂NH₂, -NR⁰S(O)₂NHR⁰, -NHS(O)₂NR⁰R⁰, -NR⁰S(O)₂NR⁰R⁰, -NHR⁰, -NR⁰R⁰, -R^d, -R^f, and -R^g. Further, possible substitutions include subsets of these substitutions, such as are indicated herein, for example, in the description of compounds of Atty. Dkt. No.: 039363-3303

Formula I, Formula II, Formula III or Formula IV, attached at any available atom to produce a stable compound. For example "fluoro substituted lower alkenyl" denotes a lower alkenyl group substituted with one or more fluoro atoms, where preferably the lower alkenyl is substituted with 1, 2, 3, 4 or 5 fluoro atoms, also 1, 2, or 3 fluoro atoms. While it is understood that substitutions are attached at any available atom to produce a stable compound, substitution of alkenyl groups are such that -F, -C(O)-, -C(S)-, -C(NH)-, -S(O)-, -S(O)₂-, -O-, -S-, or N (except where N is a heteroaryl ring atom), are not bound to an alkene carbon thereof. Further, where alkenyl is a substituent of another moiety or an R group of a moiety such as -OR, -NHR, -C(O)R, and the like, substitution of the moiety is such that any -C(O)-, -C(S)-, -S(O)-, -S(O)₂-, -O-, -S-, or N thereof (except where N is a heteroaryl ring atom) are not bound to an alkene carbon of the alkenyl substituent or R group. Further, where alkenyl is a substituent of another moiety or an R group of a moiety such as -OR, -NHR, -C(O)NHR, and the like, substitution of the alkenyl R group is such that substitution of the alkenyl carbon bound to any O, S, or N of the moiety (except where N is a heteroaryl ring atom) excludes substitucnts that would result in any O, S, or N of the substituent (except where N is a heteroaryl ring atom) being bound to the alkenyl carbon bound to any O, S, or N of the moiety. An "alkenyl carbon" refers to any carbon within an alkenyl group, whether saturated or part of the carbon to carbon double bond. An "alkene carbon" refers to a carbon within an alkenyl group that is part of a carbon to carbon double bond.

[0183] "Lower alkynyl" alone or in combination means a straight or branched hydrocarbon containing 2-6 carbon atoms (unless specifically defined) containing at least one, preferably one, carbon to carbon triple bond. Examples of alkynyl groups include ethynyl, propynyl, butynyl, and the like. A "substituted lower alkynyl" denotes lower alkynyl that is independently substituted, unless indicated otherwise, with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents, attached at any available atom to produce a stable compound, wherein the substituents are selected from the group consisting of -F, -OH, -NH₂, -NO₂, -CN, -C(O)OH, -C(S)OH, -C(O)NH₂, -C(S)NH₂, -S(O)₂NH₂, -NHC(O)NH₂, -NHC(S)NH₂, -NHS(O)₂NH₂, -C(NH)NH₂, -OR⁰, -SR⁰, -OC(O)R⁰, -OC(S)R⁰, -C(O)R⁰, -C(S)R⁰, -C(O)OR⁰, -C(S)OR⁰, -S(O)R", -S(O)₂R⁰, -C(O)NHR⁰, -C(S)NHR⁰, -C(O)NR⁰R⁰, -C(S)NR⁰R⁰, -S(O)₂NHR⁰, -S(O)₂NR⁰R⁰, -C(NH)NHR⁰, -C(NH)NR^PR^C, -NHC(O)R", -NHC(S)R⁰, -NR⁰C(O)R⁰, -NR⁰C(S)R⁰, -NHS(O)₂R⁰, -NR⁰S(O)₂R⁰, -NFIC(O)NHR⁰, -NHC(S)NHR⁰, -NR⁰C(O)NH₂, -NR⁰C(S)NH₂, -NR⁰C(O)NHR⁰, -NR⁰C(S)NHR⁰, -NHC(O)NR⁰R⁰, -NHC(S)NR⁰R⁰, -NR⁰C(O)NR⁰R⁰, -NR⁰C(S)NR⁰R", -NFIS(O)₂NHR⁰, -NR⁰S(O)₂NH₂, -NR⁰S(O)₂NHR⁰, -NHS(O)₂NR⁰R⁰, -NR⁰S(O)₂NR⁰R⁰, -NHR⁰, -NR⁰R⁰, -R^d, -R^e, and -R^E. Further, possible substitutions include subsets of these substitutions, such as are indicated herein, for example, in the description of compounds of Formula I, Formula II, Formula III or Formula IV, attached at any available atom to produce a stable compound. For example "'fluoro substituted lower alkynyl" denotes a lower alkynyl group substituted with one or more fluoro atoms, where preferably the lower alkynyl is substituted with 1, 2, 3, 4 or 5 fluoro atoms, also 1, 2, or 3 fluoro atoms. While it is understood that substitutions 43

Atty. Dkt. No.: 039363-3303 are attached at any available atom to produce a stable compound, substitution of alkynyl groups arc such that -F, -C(O)-, -C(S)-, -C(NH)-, -S(O)-, -S(O)₂-, -O-, -S-, or N (except where N is a heteroaryl ring atom) are not bound to an alkyne carbon thereof. Further, where alkynyl is a substituent of another moiety or an R group of a moiety such as -OR, -NHR, -C(O)R, and the like, substitution of the moiety is such that any -C(O)-, -C(S)-,-S(O)-, -S(O)₂-, -O-. -S-, or N thereof (except where N is a heteroaryl ring atom) are not bound to an alkyne carbon of the alkynyl substituent or R group. Further, where alkynyl is a substituent of another moiety or an R group of a moiety such as -OR, -NHR, -C(O)NHR, and the like, substitution of the alkynyl R group is such that substitution of the alkynyl carbon bound to any O, S, or N of the moiety (except where N is a heteroaryl ring atom) excludes substituents that would result in any O, S, or N of the substituent (except where N is a heteroaryl ring atom) being bound to the alkynyl carbon bound to any O, S, or N of the moiety. An "alkynyl carbon" refers to any carbon within an alkynyl group, whether saturated or part of the carbon to carbon triple bond. An "alkyne carbon" refers to a carbon within an alkynyl group that is part of a carbon to carbon triple bond.

[0184] "Cycloalkyl" refers to saturated or unsaturated, non-aromatic monocyclic, bicyclic or tricyclic carbon ring systems of 3-10, also 3-8, more preferably 3-6, ring members per ring, such as cyclopropyl, cyclopentyl, cyclohexyl, adamantyl, and the like. A "substituted cycloalkyl" is a cycloalkyl that is independently substituted, unless indicated otherwise, with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents, attached at any available atom to produce a stable compound, wherein the substituents are selected from the group consisting of halogen, -OH, -NH₂, -NO₂, -CN, -C(O)OH, -C(S)OH, -C(O)NH₂, -C(S)NH₂, -S(O)₂NH₂, -NHC(O)NH₂, -NHC(S)NH₂, -NHS(O)₂NH₂, -C(NH)NH₂, -OR⁰, -SR⁰, -OC(O)R⁰, -OC(S)R⁰, -C(O)R⁰, -C(S)R⁰, -C(O)OR⁰, -C(S)OR⁰, -S(O)R⁰, -S(O)₂R⁰, -C(O)NHR⁰, -C(S)NHR⁰, -C(O)NR⁰R⁰, -C(S)NR⁰R⁰, -S(O)₂NHR⁰, -S(O)₂NR⁰R⁰, -C(NH)NHR⁰, -C(NH)NR^PR^C, -NHC(O)R⁰, -NHC(S)R⁰, -NR⁰C(O)R⁰, -NR⁰C(S)R⁰, -NHS(O)₂R⁰, -NR⁰S(O)₂R⁰, -NHC(O)NHR⁰, -NHC(S)NHR⁰, -NR⁰C(O)NH₂, -NR⁰C(S)NH₂, -NR⁰C(O)NHR⁰, -NR⁰C(S)NHR⁰, -NHC(O)NR⁰R⁰, -NHC(S)NR⁰R⁰, -NR⁰C(O)NR⁰R⁰, -NR⁰C(S)NR⁰R⁰, -NHS(O)₂NHR⁰, -NR⁰S(O)₂NH₂, -NR⁰S(O)₂NHR⁰, -NHS(O)₂NR⁰R⁰, -NR⁰S(O)₂NR⁰R", -NHR⁰, -NR⁰R⁰, -R^d, -R^e, -R^f, and -R^E.

[Ol 85] "Hetcrocycloalkyl" refers to a saturated or unsaturated non-aromatic cycloalkyl group having from 5 to 10 atoms in which from 1 to 3 carbon atoms in the ring are replaced by heteroatoms of O, S or N, and are optionally fused with benzo or heteroaryl of 5-6 ring members. Heterocycloalkyl is also intended to include oxidized S or N, such as sulfinyl, sulfonyl and N-oxide of a tertiary ring nitrogen. Heterocycloalkyl is also intended to include compounds in which a ring carbon may be oxo substituted, i.e. the ring carbon is a carbonyl group, such as lactones and lactams. The point of attachment of the heterocycloalkyl ring is at a carbon or nitrogen atom such that a stable ring is US2007/088443

Atty. Dkt. No.: 039363-3303 retained. Examples of heterocycloalkyl groups include, but are not limited to, morpholino, tetrahydrofuranyl, dihydropyridinyl, piperidinyl, pyrrolidinyl, pyrrolidonyl, piperazinyl, dihydrobenzofuryl, and dihydroindolyl. A "substituted heterocycloalkyl" is a heterocycloalkyl that is independently substituted, unless indicated otherwise, with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents, attached at any available atom to produce a stable compound, wherein the substituents are selected from the group consisting of halogen, -OH, -NH₂, -NO₂, -CN, -C(O)OH, -C(S)OH, -C(O)NH₂, -C(S)NlI₂, -S(O)₂NH₂, -NHC(O)NH₂, -NHC(S)NH₂, -NHS(O)₂NII₂, -C(NH)NH₂, -OR⁰, -SR⁰, -OC(O)R⁰, -OC(S)R⁰, -C(O)R⁰, -C(S)R⁰, -C(O)OR⁰, -C(S)OR⁰, -S(O)R⁰, -S(O)₂R⁰. -C(O)NHR⁰, -C(S)NHR", -C(O)NR⁰R⁰, -C(S)NR⁰R⁰, -S(O)₂NHR⁰, -S(O)₂NR⁰R⁰, -C(NH)NHR⁰, -C(NH)NR^PR^C, -NHC(O)R⁰, -NHC(S)R⁰, -NR⁰C(O)R⁰, -NR⁰C(S)R⁰, -NHS(O)₂R⁰, -NR⁰S(O)₂R⁰, -NHC(O)NHR⁰, -NHC(S)NHR⁰, -NR⁰C(O)NH₂, -NR⁰C(S)NH₂, -NR⁰C(O)NHR⁰, -NR⁰C(S)NHR⁰, -NHC(O)NR⁰R⁰, -NHC(S)NR⁰R⁰, -NR⁰C(O)NR⁰R⁰, -NR⁰C(S)NR⁰R⁰, -NHS(O)₂NHR⁰, -NR⁰S(O)₂NH₂, -NR⁰S(O)₂NHR⁰, -NHS(O)₂NR⁰R⁰, -NR⁰S(O)₂NR⁰R⁰. -NHR⁰, -NR⁰R⁰, -R^d, -R^e, -R^r, and -R^e.

[0186] "Aryl" alone or in combination refers to a monocyclic or bicyclic ring system containing aromatic hydrocarbons such as phenyl or naphthyl, which may be optionally fused with a cycloalkyl of preferably 5-7, more preferably 5-6, ring members. "Arylene" is a divalent aryl, A "substituted aryl" is an aryl that is independently substituted, unless indicated otherwise, with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents, attached at any available atom to produce a stable compound, wherein the substituents are selected from the group consisting of halogen, -OH, -NH₂, -NO₂, -CN, -C(O)OH, -C(S)OH, -C(O)NH₂, -C(S)NH₂, -S(O)₂NH₂, -NHC(O)NH₂, -NHC(S)NH₂, -NHS(O)₂NH₂, -C(NH)NH₂, -OR⁰, -SR⁰, -OC(O)R⁰, -OC(S)R⁰, -C(O)R", -C(S)R⁰, -C(O)OR⁰, -C(S)OR", -S(O)R⁰, -S(O)₂R⁰, -C(O)NHR⁰, -C(S)NHR⁰, -C(O)NR⁰R⁰, -C(S)NR⁰R⁰, -S(O)₂NHR⁰, -S(O)₂NR⁰R⁰, -C(NH)NHR⁰, -C(NH)NR^PR^C, -NHC(O)R⁰, -NHC(S)R⁰, -NR⁰C(O)R⁰, -NTl⁰C(S)R⁰, -NHS(O)₂R⁰, -NR⁰S(O)₂R⁰, -NHC(O)NHR⁰, -NHC(S)NHR⁰, -NR⁰C(O)NH₂, -NR⁰C(S)NH₂, -NR⁰C(O)NHR⁰, -NR⁰C(S)NHR⁰, -NHC(O)NR⁰R⁰, -NHC(S)NR⁰R⁰, -NR⁰C(O)NR⁰R⁰, -NR⁰C(S)NR⁰R⁰, -NHS(O)₂NHR⁰, -NR⁰S(O)₂NH₂, -NR⁰S(O)₂NIIR⁰, -NHS(O)₂NR⁰R⁰, -NR⁰S(O)₂NR⁰R⁰, -NHR⁰, -NR⁰R⁰, -R^d, -R^e, -R^f, and -R⁸. A "substituted arylene" is a divalent substituted aryl.

[0187] "Heteroaryl" alone or in combination refers to a monocyclic aromatic ring structure containing 5 or 6 ring atoms, or a bicyclic aromatic group having 8 to 10 atoms, containing one or more, preferably 1-4, more preferably 1-3, even more preferably 1-2, heteroatoms independently selected from the group consisting of O, S, and N. Heteroaryl is also intended to include oxidized S or N, such as sulfmyl, sulfonyl and N-oxide of a tertiary ring nitrogen. A carbon or nitrogen atom is the point of attachment of the heteroaryl ring structure such that a stable compound is produced. Atty. Dkt No.: 039363-3303

Examples of heteroaryl groups include, but are not limited to, pyridinyl, pyridazinyl pyrazinyl, quinaoxalyl, indolizinyl, benzo[b]thienyl, quinazolinyl, purinyl, indolyl, quinolinyl, pyrimidinyl, pyrrolyl, pyrazolyl, oxazolyl, thiazolyl, thienyl, isoxazolyl, oxathiadiazolyl, isothiazolyl, tetrazolyl, imidazolyl, triazolyl, furanyl, benzofuryl, and indolyl. "Nitrogen containing heteroaryl" refers to heteroaryl wherein any heteroaloms are N. "Heteroarylene" is a divalent heteroaryl. Λ "substituted heteroaryl" is a heteroaryl that is independently substituted, unless indicated otherwise, with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents, attached at any available atom to produce a stable compound, wherein the substituents are selected from the group consisting of halogen, -OH, -NH₂, -NO₂, -CN, -C(O)OH, -C(S)OH, -C(O)NH₂, -C(S)NH₂, -S(O)₂NH₂, -NHC(O)NH₂, -NHC(S)NH₂, -NHS(O)₂NH₂, -C(NH)NH₂, -OR⁰, -SR⁰, -OC(O)R⁰, -OC(S)R⁰, -C(O)R⁰, -C(S)R⁰, -C(O)OR⁰, -C(S)OR⁰, -S(O)R", -S(O)₂R", -C(O)NHR⁰, -C(S)NHR⁰, -C(O)NR⁰R⁰, -C(S)NR⁰R⁰, -S(O)₂NHR", -S(O)₂NR⁰R⁰, -C(NH)NHR⁰, -C(NH)NR^PR^C, -NHC(O)R⁰, -NHC(S)R⁰, -NR⁰C(O)R⁰, -NR⁰C(S)R⁰, -NHS(O)₂R⁰, -NR⁰S(O)₂R⁰, -NHC(O)NHR⁰, -NHC(S)NHR⁰, -NR⁰C(O)NH₂, -NR⁰C(S)NH₂, -NR⁰C(O)NHR⁰, -NR⁰C(S)NHR⁰, -NHC(O)NR⁰R⁰, -NHC(S)NR⁰R", -NR⁰C(O)NR⁰R⁰, -NR⁰C(S)NR⁰R⁰, -NHS(O)₂NHR⁰, -NR⁰S(O)₂NH₂, -NR⁰S(O)₂NHR⁰, -NHS(O)₂NR⁰R⁰, -NR⁰S(O)₂NR⁰R⁰, -NHR⁰, -NR⁰R⁰, -R^d, -R^e, -R^f, and -R^g. "Substituted heteroarylene" is a divalent substituted heteroaryl.

[0188] The variables R⁰, R^p, R^c, R^d, R^e, R¹ and R^B as used in the description of optional substituents for alkyl, alkenyl, alkynyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl are defined as follows:

each R⁰, R^p, and R^c are independently selected from the group consisting of R^d, R^e, R^f, and R^g, or R^p and R^c combine with the nitrogen to which they are attached to form a 5-7 membered heterocycloalkyl or a 5 or 7 membered nitrogen containing heteroaryl, wherein the 5-7 membered heterocycloalkyl or 5 or 7 membered nitrogen containing heteroaryl are optionally substituted with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents selected from the group consisting of halogen, -NO₂, -CN, -OH, -NII₂, -OR^U, -SR^U, -NHR^U, -NR^UR^U, -R\ and -R^y;

each R^d is independently lower alkyl, wherein lower alkyl is optionally substituted with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2 or 3 substituents selected from the group consisting of fluoro, -OH, -NH₂, -NO₂, -CN, -C(O)OH, -C(S)OH, -C(O)NH₂, -C(S)NH₂, -S(O)₂NH₂, -NHC(O)NH₂, -NHC(S)NH₂, -NHS(O)₂NH₂, -C(NH)NH₂, -0R^k, -SR\ -0C(0)R^k, -OC(S)R^k, -C(O)R", -C(S)R^L, -C(0)0R\ -C(S)OR", -S(O)R^k, -S(O)₂R\ -C(O)NHR", -C(S)NHR^k, -C(0)NR^kR^k, -C(S)NR^fcR^k, -S(O)₂NHR",

-C(NH)NHR^k, -C(NH)NR^mRⁿ, -NHC(O)R", -NHC(S)R", -NR^kC(0)R^k, -NR^kC(S)R^k, -NHS(0)₂R\ -NR^kS(0)₂R^k, -NHC(0)NHR^k, -NHC(S)NHR", -NR^kC(0)NH₂, -NR^kC(S)NH₂, -NR"C(0)NHR^k, -NR^kC(S)NHR^k, -NHC(0)NR^kR^k. -NHC(S)NR^kR^k, -NR^kC(0)NR^kR^k, -NR^kC(S)NR^kR^k, -NHS(O)₂NHR", -NR^kS(O)₂NH₂, -NR^kS(0)₂NHR^k, -NHS(0)₂NR^kR^k, -NR^kS(0)₂NR^kR^k, -NHR^k, -NR^kR^k, -R¹, and -R^J; Atty. Dkt. No.: 039363-3303 each R^c is independently lower alkenyl, wherein lower alkenyl is optionally substituted with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2 or 3 substituents selected from the group consisting of fluoro, -OH, -NH₂, -NO₂, -CN, -C(O)OH, -C(S)OH, -C(O)NH₂, -C(S)NH₂, -S(O)₂NH₂, -NHC(O)NH₂, -NHC(S)NH₂, -NHS(O)₂NH₂. -C(NH)NH₂, -0R^k, -SR^k, -OC(O)R^k, -OC(S)R^k, -C(O)R^k, -C(S)R^k, -C(O)OR", -C(S)OR^k, -S(O)R\ -S(O)₂R^k, -C(O)NHR^k, -C(S)NHR^k, -C(O)NR^kR^k, -C(S)NR^kR^k, -S(O)₂NHR^k, -S(O)₂NR^kR^k, -C(NH)NHR^k, -C(NH)NR^mR", -NHC(O)R\ -NHC(S)R^k, -NR^kC(O)R^k, -NR^kC(S)R^k, -NHS(0)₂R^k, -NR^kS(O)₂R^k, -NHC(O)NHR", -NHC(S)NHR^k, -NR^kC(0)NH₂, -NR^kC(S)NH;, -NR^kC(O)NHR\ -NR^kC (S)NIIR", -NHC(0)NR^kR^k, -NHC(S)NR^kR^k, -NR^kC(O)NR^kR^k,

-NHS(O)₂NHR^k, -NR^kS(0),NH₂, -NR^kS(O)₂NHR^k, -NHS(O)₂NR^kR^k, -NR^kS(0)₂NR^kR\ -NHR^k, -NR^kR^k, -R^h, and -R^J;

each R* is independently lower alkynyl, wherein lower alkynyl is optionally substituted with one or more, preferably 1 , 2, 3, 4 or 5, also 1 , 2 or 3 substituents selected from the group consisting of fluoro, -OH, -NH₂, -NO₂, -CN, -C(O)OH, -C(S)OH, -C(O)NH₂, -C(S)NH₂, -S(O)₂NH₂, -NHC(O)NH₂, -NHC(S)NH₂, -NHS(O)₂NII₂, -C(NH)NH₂, -0R^k, -SR^k, -OC(O)R^k, -OC(S)R", -C(O)R^k, -C(S)R^k, -C(O)OR", -C(S)OR^k, -S(O)R\ -S(O)₂R", -C(0)NHR^k, -C(S)NHR^k, -C(0)NR^kR^k, -C(S)NR^kR^k, -S(O)₂NHR",

-C(NH)NHR", -C(NH)NR¹¹¹R", -NHC(0)R^k, -NHC(S)R", -NR^kC(0)R^k, -NR^kC(S)R", -NHS(O)₂R", -NR^kS(O),R^k, -NHC(O)NHR", -NHC(S)NHR^k, -NR^kC(0)NH₂, -NR^kC(S)NH₂, -NR^kC(0)NHR", -NR^kC(S)NHR^k, -NHC(0)NR^kR^k, -NHC(S)NR^kR^k, -NR^kC(0)NR^kR^k, -NR^kC(S)NR^kR^k, -NHS(O)₂NHR\ -NR^kS(O)₂NH₂, -NR^kS(0)₂NHR^k, -NHS(O)₂NR^kR^k, -NR"S(0)₂NR^kR^k, -NHR\ -NR^kR^k, -R^h, and -R^J;

each R^g is independently selected from the group consisting of cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are optionally substituted with one or more, preferably 1, 2, 3, 4 or 5, also 1 , 2 or 3 substituents selected from the group consisting of halogen, -OH, -NH₇, -NO₂, -CN, -C(O)OH, -C(S)OH, -C(O)NH₂, -C(S)NH₂, -S(O)₂NH₂, -NHC(O)NH₂, -NHC(S)NH₂, -NHS(O)₂NH₂, -C(NH)NH₂, -0R^k, -SR^k, -OC(O)R", -OC(S)R^k, -C(O)R^k, -C(S)R^k, -C(O)OR^k, -C(S)OR\ -S(O)R^k, -S(O)₂R^k, -C(0)NHR^k, -C(S)NHR^k, -C(0)NR^kR^k, -C(S)NR^kR^k, -S(O)₂NHR^k, -S(0)₂NR^kR^k, -C(NH)NHR^k, -C(NH)NR¹¹¹R", -NHC(O)R", -NHC(S)R", -NR^kC(0)R^k, -NR^kC(S)R^k, -NHS(O)₂R", -NR^kS(0)₂R^k, -NHC(0)NHR^k, -NHC(S)NHR^k, -NR"C(0)NH₂₎ -NR^kC(S)NH₂, -NR^kC(O)NHR", -NR^kC(S)NHR^k, -NHC(0)NR^kR^k, -NHC(S)NR^kR^k, -NR"C(0)NR"R^k, -NR^kC(S)NR^kR^k, -NHS(0)₂NHR^k, -NR^kS(O)₂NH₂, -NR^kS(0)₂NHR^k, -NHS(0)₂NR^kR^k, -NR^kS(0)₂NR^kR^k, -NHR^k, -NR^kR^k, -R^h, -R¹, and -R¹;

wherein R^k, R'ⁿ, and R" at each occurrence are independently selected from the group consisting of R^h, R', and R', or R^ra and Rⁿ combine with the nitrogen to which they are attached form a 5-7 membered heterocycloalkyl or a 5 or 7 membered nitrogen containing heteroaryl, wherein the 5-7 membered heterocycloalkyl or 5 or 7 membered nitrogen containing heteroaryl are optionally 88443

Atty. Dkt. No.: 039363-3303 substituted with one or more, preferably 1 , 2, 3, 4 or 5, also 1, 2, or 3 substituents selected from the group consisting of halogen, -NO₂. -CN, -OH, -NII₂, OR", -SR", -NHR¹¹. -NR^UR^U, -R\ and -R^y;

wherein each R^h is independently lower alkyl optionally substituted with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents selected from the group consisting of fluoro, -OH, -NHT₁ -NO₂, -CN, -C(O)OH, -C(S)OH, -C(O)NH₂, -C(S)NH₂, -S(O)₂NH₂, -NHC(O)NH₂, -NHC(S)NH₂, -NHS(O)₂NH₂, -C(NH)NH₂, -0R^r, ~SR^r, -OC(O)R^r, -OC(S)R^r, -C(0)R^r, -C(S)R^r, -C(O)OR^r, -C(S)OR^r, -S(O)R^r, -S(O)₂R^r, -C(0)NHR^r, -C(S)NHR^r, -C(O)NR¹R', -C(S)NR^rR^r, -S(0)₂NHR^r, -S(0)₂NR^rR^r, -C(NH)NHR', -C(NH)NR⁸R¹, -NHC(O)R¹, -NHC(S)R^r, -NR^rC(0)R^r, -NR^rC(S)R^r, -NHS(O)₂R', -NR^rS(0)₂R^r, -NHC(O)NHR', -NHC(S)NIIR', -NR^rC(0)NH₂, -NR'C(S)NH₂, -NR^rC(0)NHR^r, -NR'C(S)NHR^r, -NHC(0)NR^rR', -NHC(S)NR'R', -NR^rC(O)NR^rR^r, -NR^rC(S)NR^rR^r, -NHS(O)₂NHR', -NR'S(O)₂NH₂, -NR'S(0)₂NHR', -NHS(O)₂NR'R^r, -NR^rS(0)₂NR'R^r, -NHR', -NR¹R', -R¹, and -R^J;

wherein each R' is independently selected from the group consisting of lower alkenyl and lower alkynyl, wherein lower alkenyl or lower alkynyl are optionally substituted with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2 or 3 substituents selected from the group consisting of fluoro, -OH, -NH₂, -NO₂, -CN, -C(O)OH, -C(S)OH, -C(O)NH₂, -C(S)NH₂, -S(O)₂NH₂, -NHC(O)NH₂, -NHC(S)NH₂, -NHS(O)₂NH₂, -C(NH)NH₂, -OR', -SR', -OC(O)R', -OC(S)R', -C(O)R', -C(S)R', -C(O)OR', -C(S)OR', -S(O)R', -S(O)₂R', -C(O)NHR', -C(S)NHR', -C(O)NR¹R', -C(S)NR'R^r, -S(O)₂NHR', -S(O)₂NR¹R', -C(NH)NHR', -C(NH)NRX -NHC(O)R'. -NHC(S)R', -NR¹C(O)R', -NR'C(S)R^r, -NHS(O)₂R', -NR'S(0)₂R', -NHC(O)NHR', -NHC(S)NHR', -NR^rC(0)NH₂, -NR'C(S)NH₂, -NR'C(0)NHR^r, -NR'C(S)NHR^r, -NHC(O)NR¹R', -NHC(S)NR¹R', -NR'C(0)NR'R^r, -NR^rC(S)NR'R^r, -NHS(O)₂NHR', -NR'S(O)₂NH₂, -NR^rS(0)₂NHR', -NHS(0)₂NR'R', -NR¹S(O)₂NR¹R', -NHR', -NR¹R', and -R^J;

wherein each R¹ is independently selected from the group consisting of cycloalkyl, hcterocycloalkyl, aryl, and heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are optionally substituted with one or more, preferably 1 , 2, 3, 4 or 5, also 1 , 2 or 3 substituents selected from the group consisting of halogen, -OH, -NH₂, -NO₂, -CN, -C(O)OH, -C(S)OH, -C(O)NII₂, -C(S)NH₂, -S(O)₂NH₂, -NHC(O)NH₂, -NHC(S)NH₂, -NHS(O)₂NH₂, -C(NH)NH₂, -OR', -SR', -OC(O)R', -OC(S)R^r, -C(O)R', -C(S)R', -C(O)OR', -C(S)OR^r, -S(O)R', -S(O)₂R', -C(O)NHR', -C(S)NHR', -C(O)NR¹R', -C(S)NR'R^r, -S(O)₂NHR'. -S(O)₂NR¹R', -C(NH)NHR', -C(NH)NR⁴R¹, -NIIC(O)R', -NHC(S)R', -NR'C(0)R^r, -NR'C(S)R', -NHS(O)₂R', -NR'S(O)₂R^r, -NHC(O)NHR', -NHC(S)NHR', -NR'C(O)NH₂, -NR'C(S)NH₂, -NR¹C(O)NHR', -NR'C(S)NHR^r, -NHC(O)NR¹R', -NHC(S)NR¹R', -NR^(O)NR¹R'. -NR'C(S)NR'R^r, -NHS(O)₂NHR', -NR'S(O)₂NH₂, -NR'S (O)₂NHR', -NHS(0)₂NR'R', -NR'S(0)₂NR'R^r, -NHR', -NR'R', cycloalkylamino, and -R^x; Atty. Dkt. No.: 039363-3303 wherein each R^r, R\ and R¹ at each occurrence are independently selected from the group consisting of lower alkyl, C₃_₆ alkenyl, C,_₆ alkynyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein lower alkyl is optionally substituted with one or more, preferably 1, 2, 3, 4 or 5, also 1 , 2, or 3 substituents selected from the group consisting of-R^y, fluoro, -OH, -NH₂. lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino, provided, however, that any substitution of the lower alkyl carbon bound to any O, S, or N, of -OR^r, -SR^r, -C(O)OR^r, -C(S)OR^r, -C(0)NHR^r, -C(S)NIW, -C(0)NR^rR^r, -C(S)NRV, -S(O)₂NHR^r, -S(O)₂NR^rR^r, -C(NH)NHR^r, -NR^rC(O)R^r, -NR^rC(S)R^r, -NR^rS(O)₂R^r, -NHC(0)NHR^r, -NHC(S)NHR^r, -NR^rC(0)NH₂, -NR^rC(S)NH₂, -NR^rC(0)NHR^r, -NR^rC(S)NHR^r, -NHC(O)NR^rR^r, -NΗC(S)NR^rR^r, -NR^rC(0)NR^rR^r, -NR^rC(S)NR^rR^r, -NHS(O)₂NHR^r, -NR^rS(O)₂NH₂, -NR^rS(O)₂NHR^r, -NHS(O)₂NR^rR^r, -NR^rS(O)₂NRTl^r, -NHR^r, or -NR^rR^r is selected from the group consisting of fluoro and -R_\ and wherein C₃_₆ alkenyl or C₃_₆ alkynyl are optionally substituted with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents selected from the group consisting of -R^y, fluoro, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino, provided, however, that any substitution of the C₃.₆ alkenyl or C₃.₆ alkynyl carbon bound to any O, S, or N, of -0R^r, -SR^r, -C(0)0R^r, -C(S)OR^r, -C(0)NHR^r, -C(S)NHR^r, -C(0)NR^rR^r, -C(S)NR^rR^r, -S(O)₂NIIR^r, -S(O)₂NR'R^r, -C(NH)NHR¹, -NR^rC(0)R^r, -NR^rC(S)R^r, -NR^rS(0)₂R^r, -NIIC(0)NHR^r, -NHC(S)NHR^r, -NR^rC(0)NH₂, -NR¹C(S)NH₂, -NR^rC(O)NHR^r, -NR^rC(S)NHR^r, -NHC(0)NR^rR^r, -NHC(S)NRTf, -NR^rC(0)NR^rR^r, -NR^rC(S)NR^rR^r, -NHS(O)₂NHR^r, -NR^rS(O)jNH₂, -NR^rS(0)₂NHR^r, -NHS(O)₂NRTl', -NR^rS(O)₂NR^rR^r, -NHR^r, or -NR^rR^r is selected from the group consisting of fluoro, lower alkyl, fluoro substituted lower alkyl, and -R^y, and wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are optionally substituted with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents selected from the group consisting of halogen, -OH, -NH₂, -NO₂, -CN, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino, or R^s and R¹ combine with the nitrogen to which they are attached form a 5-7 membered heterocycloalkyl or a 5 or 7 membered nitrogen containing heteroaryl, wherein the 5-7 membered heterocycloalkyl or 5 or 7 membered nitrogen containing heteroaryl are optionally substituted with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents selected from the group consisting of halogen, -NO₂, -CN, -OH, -NH₂, OR^U, -SR^U, -NHR^U, -NR^UR^U, -R\ and -R^y;

wherein each R¹¹ is independently selected from the group consisting of lower alkyl, C_M alkenyl, C₃_₆ alkynyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein lower alkyl is Atty. Dkt. No.: 039363-3303 optionally substituted with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents selected from the group consisting of-R^y, fluoro, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino, provided, however, that any substitution of the lower alkyl carbon bound to the O of -OR^U, S of -SR^U, or N of -NHR" is fluoro or -R^y, and wherein Cj-6 alkenyl or C₃.₆ alkynyl are optionally substituted with one or more, preferably 1 , 2, 3, 4 or 5, also 1, 2, or 3 substituents selected from the group consisting of -R*, fluoro, -OH, -NH₂, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino, provided, however, that any substitution of the C_M alkenyl or C₃.₆ alkynyl carbon bound to the O of -OR^U, S of -SR^U, or N of -NHR" is fluoro, lower alkyl, fluoro substituted lower alkyl, or -R^y, and wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are optionally substituted with one or more, preferably 1 , 2, 3, 4 or 5, also 1 , 2, or 3 substituents selected from the group consisting of halogen, -OH, -NH₂, -NO₂, -CN, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino;

wherein each R" is selected from the group consisting of lower alkyl, lower alkenyl and lower alkynyl, wherein lower alkyl is optionally substituted with one or more, preferably 1, 2, 3, 4 or 5, also 1 , 2, or 3 substituents selected from the group consisting of -R^y, fluoro, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino, and wherein lower alkenyl or lower alkynyl are optionally substituted with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents selected from the group consisting of -R^y, fluoro, -OH, -NH₂, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino;

wherein each R^y is selected from the group consisting of cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are optionally substituted with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents selected from the group consisting of halogen, -OH, -NH₂, -NO₂, -CN, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino.

[0189] In some embodiments, all occurrences of optionally substituted lower alkyl, optionally substituted C₂.₆ alkyl, optionally substituted lower alkenyl, or optionally substituted lower alkynyl are optionally substituted with one or more, also 1, 2 or 3 groups or substituents selected from the group Atty. Dkt. No.: 039363-3303 consisting of fluoro, -NO₂, -CN, -OR^la, -SR^la, -NR^laR^la, -OC(O)R^la, -OC(S)R¹", -C(O)R¹". -C(S)R^{l a}, -C(O)OR^!a, -C(S)OR^la, -C(0)NR^{l 3}R^{l a}, -C(S)NR^laR^la, -S (O)₂NR¹³R¹ \ -C(NH)NR¹³R¹", -NR^laC(0)R^la, -NR¹³C(S)R¹³, -NR¹³S(O)₂R¹³, -NR^laC(0)NR^laR^la, -NR^laC(S)NR^laR^la, -NR^{l a}S(0)₂NR^laR^{l a}, -S(O)R^{l a}, -S(O)₂R¹³, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl and heteroaryl arc optionally substituted with one or more, also 1, 2 or 3 groups or substituents selected from the group consisting of halogen, -NO₂, -CN, -0R^la. -SR^la, -NR^{l a}R^la, -OC(O)R^la, -OC(S)R¹³, -C(0)R^la, -C(S)R¹³, -C(O)OR¹³, -C(S)OR¹³, -C(0)NR^laR^la, -C(S)NR^laR^la, -S(0)₃NR^laR^la, -C(NH)NR^laR^la, -NR^IaC(O)R^la, -NR^laC(S)R^la, -NR^laS(O)₂R^la, -NR^laC(0)NR^laR^Ia, -NR^laC(S)NR^laR^la, -NR^laS(0)₂NR^laR^la, -S(O)R¹³, -S(O)₂R^la, -R^lb, and lower alkyl optionally substituted with one or more, also 1, 2 or 3 groups or substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and -R^lb, and all occurrences of optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted 5-7 membered heterocycloalkyl, optionally substituted aryl, optionally substituted arylene, optionally substituted heteroaryl, optionally substituted heteroarylene, or optionally substituted 5 or 7 membered nitrogen containing heteroaryl are optionally substituted with one or more, also 1, 2, or 3 groups or substituents selected from the group consisting of halogen, -NO₂, -CN, -OR^la, -SR^la, -NR^laR^la, -0C(0)R^la, -OC(S)R^la, -C(O)R¹³, -C(S)R^la, -C(O)OR^la, -C(S)OR^la, -C(0)NR^laR^la, -C(S)NR^laR^la, -S(O)₂NR¹³R¹³, -C(NH)NR^laR^u, -NR^{l a}C(0)R^la, -NR¹³C(S)R¹³, -NR^laS(O)₂R^{l a}, -NR¹³C(O)NR^{1 a}R^la, -NR¹³C(S)NR¹³R¹³, -NR^laS(0)₂NR^laR^la, -S(O)R^la, -S(O)₂R¹³, -R^lb, and lower alkyl optionally substituted with one or more, also 1, 2 or 3 groups or substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and -R^lb, wherein R^la is selected from the group consisting of hydrogen, provided, however, that hydrogen is not bound to any of C(S), C(O), S(O), or S(O)₂ of -OC(O)R^la, -OC(S)R¹', -C(O)R¹³, -C(S)R^la, -NR^laC(0)R^la, -NR^uC(S)R^la, -NR^laS(O)₂R^la, -S(O)R¹³, or -S(O)₂R¹", -R^lb, and lower alkyl optionally substituted with one or more, also 1, 2 or 3 groups or substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and -R^lb, provided, however, that any substitution of the alkyl carbon bound to O, S, or N of -OR¹³, -SR^{l a}, -NR¹⁸R¹", -C(O)OR^la, -C(S)OR¹³, -C(O)NR^laR^la, -C(S)NR¹³R¹⁸, -S(O)₂NR¹³R¹³, -C(NH)NR^laR^la, -NR^laC(0)R^la, -NR^laC(S)R^la, -NR^laS(O)₂R^la, -NR¹³C(O)NR¹³R¹³, -NR^laC(S)NR^l3R^la, or -NR^l3S(O)₃NR^laR^la, is fluoro or -R^lb, and wherein -R^lb is selected from the group consisting of cycloalkyl, heterocycloalkyl, aryl and heleroaryl, wherein cycloalkyl, heterocycloalkyl, aryl and heteroaryl are optionally substituted with one or more, also 1, 2 or 3 groups or substituents selected from the group consisting of halogen, -CN, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino. Atty Dkt. No.- 039363-3303

[0190] In some embodiments, all occurrences of optionally substituted lower alkyl, optionally substituted C₂_₆ alkyl, optionally substituted lower alkenyl, or optionally substituted lower alkynyl are optionally substituted with one or more, also 1, 2 or 3 groups or substituents selected from the group consisting of fluoro, -CN, -OR^la, -SR^la, -NR^laR^la, -C(O)R^la, -C(S)R^ld, -C(O)OR¹", -C(O)NR¹¹¹R^{1 a}, -C(S)NR^{l a}R^la, -S(O)₂NR¹³R¹³, -NR^laC(O)R^Ia, -NR^uC(S)R^la, -NR^laS(O)₂R^la, -S(O)R^Ia, -S(O)₂R^la, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl and heteroaryl are optionally substituted with one or more, also 1, 2 or 3 groups or substituents selected from the group consisting of halogen, -CN, -OR^{l a}, ~SR^la, -NR^laR^la, -C(O)R^la, -C(S)R^la, -C(O)OR^la, -C(0)NR^laR^la, -C(S)NR^laR^la, -S(O),NR^laR^u, -NR^laC(O)R^la, -NR^laC(S)R^ld, -NR^laS(O)₂R^la, -S(O)R^la, -S(O)₂R^la, -R^{l b}, and lower alkyl optionally substituted with one or more, also 1, 2 or 3 groups or substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and -R^lb, and all occurrences of optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted 5-7 membered heterocycloalkyl, optionally substituted aryl, optionally substituted arylene, optionally substituted heteroaryl, optionally substituted heteroarylene, or optionally substituted 5 or 7 membered nitrogen containing heteroaryl are optionally substituted with one or more, also 1, 2, or 3 groups or substituents selected from the group consisting of halogen, -CN, -OR^1J, -SR^la, -NR^laR^la, -C(O)R¹", -C(S)R^la, -C(O)OR^la, -C(O)NR¹¹¹R¹³, -C(S)NR^laR^la, -S(O)₂NR¹³R¹⁸, -NR¹¹¹C(O)R¹ \ -NR^{l a}C(S)R^la, -NR^laS(O)₂R^la, -S(O)R^{l a}, -S(O>R^la, -R^lb, and lower alkyl optionally substituted with one or more, also 1 , 2 or 3 groups or substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylammo, and -R^{l b}, wherein R^la is selected from the group consisting of hydrogen, provided, however, that hydrogen is not bound to any of C(S), C(O), S(O), or S(O)₂ Of -C(O)R¹³, -C(S)R^la, -NR^{l a}C(0)R^{l a}, -NR^{l a}C(S)R^la, -NR¹¹S(O)₂R¹ \ -S(O)R^la, or -S(O)₂R^la, -R^lb, and lower alkyl optionally substituted with one or more, also 1, 2 or 3 groups or substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and -R^lb, provided, however, that any substitution of the alkyl carbon bound to O, S, or N of -0R^{l a}, -SR^la, -NR^laR^la, -C(O)OR¹³, -C(0)NR^laR^Iϋ, -C(S)NR^laR^la, -S(0)₂NR^laR^{l a}, -NR^laC(0)R^la, -NR^laC(S)R^la, or -NR^laS(O)₂R^la, is fluoro or -R^lb, and wherein -R^{l b} is selected from the group consisting of cycloalkyl, heterocycloalkyl, aryl and heteroaryl. wherein cycloalkyl, heterocycloalkyl, aryl and heteroaryl are optionally substituted with one or more, also 1, 2 or 3 groups or substituents selected lrom the group consisting of halogen, -CN, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylammo, di-alkylamino, and cycloalkylamino. US2007/088443

Atty Dkt No 039363-3303

[0191] "Lower alkoxy'^" denotes the group -OR^Z, where R^ is lower alkyl "Substituted lower alkoxy" denotes lower alkoxy m which R^z is lower alkyl substituted with one or more substituents as indicated herein, for example, m the descnption of compounds of Formula I Formula II, Formula III υr Formula IV, including descriptions of substituted cycloalkyl, cycloheteroalkyl, aryl and heteroaryl, attached at any available atom to produce a stable compound Preferably, substitution of lower alkoxy is with 1 , 2, 3, 4, or 5 substituents, also 1, 2, or 3 substituents For example "fluoro substituted lower alkoxy" denotes lower alkoxy in which the lower alkyl is substituted with one or more fluoro atoms, where preferably the lower alkoxy is substituted with 1 , 2 3, 4 or 5 fluoro atoms, also 1 , 2, or 3 fluoro atoms W hile it is understood that substitutions on alkoxy are attached at any available atom to produce a stable compound, substitution ot alkoxy is such that O, S, or N (except where N is a heteroaryl nng atom), are not bound to the alkyl carbon bound to the alkoxy O Further, where alkoxy is descnbed as a substituent of another moiety, the alkoxy oxygen is not bound to a carbon atom that is bound to an O, S, or N of the other moiety (except where N is a heteroaryl ring atom), or to an alkene or alkyne carbon of the other moiety

[0192] "Lower alkylthio" denotes the group -SR^aa, where R^aa is lower alkyl "Substituted lower alkylthio" denotes lower alkylthio m which R^aa is lower alkyl substituted with one or more substituents as indicated herein, for example, in the description of compounds of Formula I, Formula II, Formula III or Formula IV, including descriptions of substituted cycloalkyl, cycloheteroalkyl, aryl and heteroaryl, attached at any available atom to produce a stable compound Preferably, substitution of lower alkylthio is with 1, 2, 3, 4, or 5 substituents, also 1, 2, or 3 substituents For example "fluoro substituted lower alkylthio" denotes lower alkylthio in which the lower alkyl is substituted with one or more fluoro atoms, where preferably the lower alkylthio is substituted with 1 , 2, 3, 4 or 5 fluoro atoms, also 1, 2, or 3 fluoro atoms While it is understood that substitutions on alkylthio are attached at any available atom to produce a stable compound, substitution of alkylthio is such that O, S, or N (except where N is a heteroaryl nng atom), are not bound to the alkyl carbon bound to the alkylthio S Further, where alkylthio is described as a substituent of another moiety, the alkylthio sulfur is not bound to a carbon atom that is bound to an O, S, or N of the other moiety (except where N is a heteroaryl nng atom), or to an alkene or alkyne carbon ol the other moiety

[0193J "Amino" or "amine" denotes the group -NFL "Mono-alkylammo" denotes the group -NHR^bb where R^bb is lower alkyl '-Di-alkylamino" denotes the group -NR^bbR^c", where R^bb and R^cc are independently lower alkyl "Cycloalkylammo" denotes the group -NR^ddR^ee, where R^dd and R" combine with the nitrogen to form a 5-7 membered heterocycloalkyl, where the heterocyc Io alkyl may contain an additional heteroatom within the nng, such as O, N, or S, and may also be further substituted with lower alkyl Examples of 5-7 membered heterocycloalkyl include, but are not limited to, pipeπdine, piperazme, 4-methylpiperazme, morphohne, and thiomorpholine While it is Atty Dkt No 039363-3303 understood that when mono-alkylammo, di-alkylamino, or cycloalkylamino are substituents on other moieties that are attached at any available atom to produce a stable compound, the nitrogen of mono-alkylammo, di-alkylammo, or cycloalkylamino as substituents is not bound to a carbon atom that is bound to an O, S, or N of the other moiety

10194] As used herein, the term "composition" refers to a formulation suitable tor administration to an intended ammal subject for therapeutic purposes that contains at least one pharmaceutically active compound and at least one pharmaceutically acceptable carrier or excipient

[0195] The term "pharmaceutically acceptable" indicates that the indicated material does not have properties that would cause a reasonably prudent medical practitioner to avoid administration of the material to a patient, taking into consideration the disease or conditions to be treated and the respective route of administration For example, it is commonly required that such a material be essentially sterile, e g , tor mjectibles

[0196] In the present context, the term "therapeutically effective" or "effective amount" indicates that the materials or amount of material is effective to prevent, alleviate, or ameliorate one or more symptoms of a disease or medical condition, and/or to prolong the survival of the subject being treated

[0197] In the present context, the terms "synergistically effective" or "synergistic effect" indicate that two or more compounds that are therapeutically effective, when used in combination, provide improved therapeutic effects greater than the additive effect that would be expected based on the effect of each compound used by itself

[0198] As used herein, the terms "ligand" and "modulator" are used equivalently to refer to a compound that changes (i e , increases or decreases) the activity of a target biornolecule, e g , an enzyme such as a kinase Generally a ligand or modulator will be a small molecule, where "small molecule refers to a compound with a molecular weight of 1500 daltons or less, or preferably 1000 daltons or less, 800 daltons or less, or 600 daltons or less Thus, an "improved ligand" is one that possesses better pharmacological and/or pharmacokinetic properties than a reference compound, where "better" can be defined by one skilled in the relevant art for a particular biological system or therapeutic use

[0199] hi the context of compounds binding to a target, the terms "greater affinity" and "selective" indicates that the compound binds more tightly than a reference compound, or than the same compound in a reference condition, i e , with a lower dissociation constant In some embodiments, the greater affinity is at least 2, 3, 4, 5, 8, 10, 50, 100, 200, 400, 500, 1000, or 10,000-fold greater affinity Atty Dkt No 039363-3303

[0200] As used herein in connection with compounds of the invention, the term 'synthesizing" and like terms means chemical synthesis from one or more precursor materials

[0201] By "assaying" is meant the creation of experimental conditions and the gathering of data regarding a particular result of the experimental conditions For example, enzymes can be assayed based on their ability to act upon a detectable substrate A compound or hgand can be assayed based on its ability to bind to a particular target molecule or molecules

[0202] As used herein, the term "modulating" or "modulate" refers to an effect of altering a biological activity especially a biological activity associated with a particular biomolecule such as a protein kinase For example, an agonist or antagonist of a particular biomolecule modulates the activity of that biomolecule, e g , an enzyme by either increasing (e g agonist, activator), or decreasing (e g antagonist, inhibitor) the activity of the biomolecule, such as an enzyme Such activity is typically indicated in terms of an inhibitory concentration (IC₅₀) or excitation concentration (EC₅₀) of the compound for an inhibitor or activator, respectively, with respect to, for example an enzyme

[0203] In the context of the use, testing, or screening of compounds that are or may be modulators, the term "contacting" means that the compound(s) are caused to be in sufficient proximity to a particular molecule, complex, cell, tissue, organism, or other specified material that potential binding interactions and/or chemical reaction between the compound and other specified material can occur

[0204] As used herein in connection with amino acid or nucleic acid sequence, the term "isolate" indicates that the sequence is separated from at least a portion of the ammo acid and/or nucleic acid sequences with which it would normally be associated

[0205] In connection with amino acid or nucleic sequences, the term "purified" indicates that the subject molecule constitutes a significantly greater proportion of the biomolecules in a composition than the proportion observed in a prior composition, e g , in a cell culture The greater proportion can be 2-fold, 5-fold, 10-fold, or more than 10-fold, with respect to the proportion found in the prior composition

[02061 The present invention concerns compounds of Formula I, and all sub-generic formulae, compounds of Formula II and all sub-generic formulae, compounds of Formula III and all sub-generic formulae, and compounds of Formula IV and all sub-geneπc formulae that are modulators of protein kinases, for example without limitation, the compounds are modulators of at least one of the kinases selected from the group consisting of AbI, Aktl, Λkt2, Akt3, ALK, Alk5, A-Raf, B-Raf, Brk, Btk, Cdk2, CDK4 CDK5, CDK6, CHKl, c-Raf-1, Csk, EGFR, EphAl, EphA2, EphB2, BphB4, Erk2, Fak, FGFRl , FGFR2, FGFR3, FGFR4, Fltl, Flt3, Flt4, Fms, Frk, Fyn, Gsk3α, Gsk3β, HCK, Atty. Dkt. No.: 039363-3303

Her2/Erbb2, Her4^/Erbb4, IGFlR, IKK beta, Irak4, ltk, Jakl, Jak2, Jak3, Jnkl, Jnk2, Jnk3, Kdr, Kit, LCK, MAP2K1, MAP2K2, MAP4K4, MAPKAPK2, Met, Mnkl, MLKl, p38, PDGFRA, PDGFRB, PDPKl, Piml, Pim2, Pim3, PKC alpha, PKC beta, PKC theta, Plkl, Pyk2, Ret, ROCKl, ROCK2, Ron. Src, Stk6, Syk, TEC, Tie2, TrkA. TrkB, Yes, and Zap70, and the use of such compounds m the treatment of diseases or conditions

II. Kinase targets and indications of the in\ ention

[0207] Protein kinases play key roles m propagating biochemical signals in diverse biological pathways More than 500 kinases have been described, and specific kinases have been implicated in a wide range of diseases or conditions (i e , indications), including for example without limitation, cancer, cardiovascular disease, inflammatory disease, neurological disease, and other diseases As such, kinases represent important control points for small molecule therapeutic intervention Description of specific target protein kinases contemplated by the present invention may be found, for example, in US Patent Application Serial number 1 1/473,347 (PCT publication WO2007002433) , the disclosure of which is hereby incorporated by reference in its entirety, m addition to the following

Exemplary Diseases Associated with Raf kinases.

[0208] A-Raf: Target kinase A-Raf (i e , v-raf murine sarcoma 3611 viral oncogene homolog 1 ) is a 67 6 kDa serine/threonine kinase encoded by chromosome XpI 1 4-pl 1 2 (symbol. ARAF) The mature protein comprises RDD (i e , Ras binding domain) and phorbol-ester^/DAG-type 7inc finger domain and is involved in the transduction of autogenic signals from the cell membrane to the nucleus A-Raf inhibitors may be useful in treating neurologic diseases including, but not limited to, multi-mfarct dementia, head injury, spmal cord injury, Alzheimer's disease (AD), Parkinson's disease, neoplastic diseases including, but not limited to, melanoma, glioma, sarcoma, carcinoma (e g colorectal, lung, breast, pancreatic, thyroid, renal, ovarian), lymphoma (e g histiocytic lymphoma), neurofibromatosis, myelodysplastic syndrome, leukemia, tumor angiogenesis; pain of neuropathic or inflammatory origin, including, but not limited to, acute pam, chronic pam, cancer-related pain and migraine, and diseases associated with muscle regeneration or degeneration, including, but not limited to, vascular restenosis, sarcopenia, muscular dystrophies (including, but not limited to, Duchenne, Becker, Emery-Dreifuss, Limb-Girdle, Facioscapulohumeral, Myotonic, Oculopharyngeal, Distal and Congenital Muscular Dystrophies), motor neuron diseases (including, but not limited to, amyotrophic lateral sclerosis, infantile progressive spinal muscular atrophy, intermediate spmal muscular atrophy, juvenile spmal muscular atrophy, spmal bulbar muscular atrophy and adult spmal muscular atrophy), inflammatory myopathies (including, but not limited to, dermatomyositis, polymyositis, and inclusion body myositis), diseases of the neuromuscular junction (including, but not limited to, myasthenia gravis, Lambert-Eaton syndrome, and congenital myasthenic syndrome), myopathies due to endocrine Atty Dkt No 039363-3303 abnormalities (including, but not limited to, hyperthyroid myopathy and hypothyroid myopathy) diseases ot peπpheral nerve (including, but not limited to, Charcot-Maπe Tooth disease, De_jenne- Sottas disease, and Friedreich's ataxia), other myopathies (including, but not limited to myotonia congenita, paramyotonia congenita central core disease, nemahne myopathy myotubular myopathy, and periodic paralysis), and metabolic diseases of muscle (including, but not limited to phosphorylase deficiency, acid maltase deficiency, phosphofructokmase deficiency, debrancher enzyme deficiency, mitochondrial myopathy, carnitine deficiency, carnitine palmatyl transferase deficiency, phosphoglycerate kinase deficiency, phosphoglycerate inutase deficiency, lactate dehydrogenase deficiency, and myoadenylate deaminase deficiency)

10209] B-Kaf: Target kinase B-Raf (i e , \-raf murine sarcoma viral oncogene homolog Bl) is a 84 4 kDa seπne'threomne kinase encoded by chromosome 7q34 (symbol BRAF) The mature protein comprises RBD (i e , Ras binding domain), Cl (i e , protein kinase C conserved region 1) and STK (i e , serine/threonine kinase) domains

[0210] Target kinase B-Raf is involved m the transduction of mitogenic signals from the cell membrane to the nucleus and may play a role in the postsynaptic responses of hippocampal neurons As such, genes of the RAF family encode kinases that are regulated by Ras and mediate cellular responses to growth signals Indeed, B-Raf kinase is a key component of the RAS-> Raf-> MEK->ERK/M AP kinase signaling pathway, which plays a fundamental role in the regulation of cell growth, division and proliferation, and, when constitutively actuated, causes tumoπgenebis Among several isoforms of Raf kinase, the B-type, or B-Raf, is the strongest activator of the downstream MAP kinase signaling

[0211] 1 he BRAF gene is frequently mutated in a vanety of human tumors, especially in malignant melanoma and colon carcinoma The most common reported mutation was a missense thymine (T) to adenine (A) transversion at nucleotide 1796 (T1796A, amino acid change in the B-Raf protein is Val<600> to Glu<600> ) observed in 80% of malignant melanoma tumors Functional analysis reveals that this transversion is the only detected mutation that causes constitutive activation of B-Raf kinase activity, independent of RAS activation, by converting B-Raf into a dominant transforming protein Based on precedents, human tumors develop resistance to kinase inhibitors by mutating a specific ammo acid in the catalytic domain as the "gatekeeper" (Balak, et al , CIm Cancer Res 2006, 12 6494-501) Mutation of Thr-529 in BRAF to He is thus anticipated as a mechanism of resistance to BRAF inhibitors, and this can be envisioned as a transition in codon 529 from ACC to ATC

[0212] Niihoπ et al , report that in 43 individuals with cardio-facio cutaneous (CFC) syndrome, they identified two heterozygous KRAS mutations in three individuals and eight BRAF mutations in 16 Atty Dkt No 039363-3303 individuals, suggesting that dysregulation of the RAS-RAF-ERK pathway is a common molecular basis for the three related disorders (Nnhoπ et al , Nat Genet 2006, 38(3) 294-6)

[0213] c-Raf-1: Target kinase c-Raf-1 (i e , v-raf murine sarcoma viral oncogene homolog 1 ) is a 73 0 kDa STK encoded by chromosome 3p25 (symbol RAFl) c-Raf-1 can be targeted to the mitochondria by BCL2 (i e , oncogene B-cell leukemia 2) which is a regulator of apoptotic cell death Active c-Raf-1 improves BCL2-mediated resistance to apoptosis, and c-Raf-1 phosphorylates BAD (i e , BCL2-bindmg protein) c-Raf-1 is implicated in carcinomas, including, but not limited to, colorectal, o\aπan, lung and renal cell carcinoma C-Raf-1 is also implicated as an important mediator of tumor angiogenesis (Hood, J D et al , 2002, Science 296, 2404) C-Raf-1 inhibitors may also be useful for the treatment of acute myeloid leukemia and mvelodysplastic syndromes (Crump, Curr Pharm Des 2002, 8(25) 2243-8) Raf-1 activators may be useful as treatment for neuroendocnne tumors, such as medullary thyroid cancer, carcinoid, small cell lung cancer and pheochromocytoma (Kunmmalaiyaan et al , Anticancer Drugs 2006, 17(2) 139-42)

[0214] B-Raf and/or C-Raf inhibitors may be useful in treating A-Raf-mediated, B-Raf-mediated or c-Raf-1 -mediated disease or condition selected from the group consisting of neurologic diseases, including, but not limited to, multi-infarct dementia, head injury, spinal cord injury, Alzheimer's disease (AD), Parkinson's disease, neoplastic diseases including, but not limited to, melanoma, glioma, sarcoma, carcinoma (e g colorectal, lung, breast, pancreatic, thyroid, renal, ovarian), lymphoma (e g histiocytic lymphoma) neurofibromatosis, acute myeloid leukemia, myelodysplastic syndrome, leukemia, tumor angiogenesis, neuroendocnne tumors such as medullary thyroid cancer, carcinoid, small cell lung cancer and pheochromocytoma, pain of neuropathic or inflammatory origin, including but not limited to, acute pam, chrome pain, cancer-related pain, and migraine, cardiovascular diseases, including, but not limited to, heart failure, ischemic stroke, cardiac hypertrophy, thrombosis (e g thrombotic microangiopathy syndromes), atherosclerosis, and reperfusion injury, inflammation including, but not limited to, psoriasis, arthritis and autoimmune diseases and conditions, osteoarthritis, endometriosis, scarring, vascular restenosis, fibrotic disorders, rheumatoid arthritis, inflammatory bowel disease (IBD), immunodeficiency diseases including, but not limited to, organ transplant rejection, graft versus host disease, renal or prostatic diseases, including, but not limited to, diabetic nephropathy, polycystic kidney disease, nephrosclerosis, glomerulonephritis, prostate hyperplasia, metabolic disorders, including, but not limited to, obesity, infection including, but not limited to, Helicobacter pylon Hepatitis and Influenza viruses, fever, and sepsis, pulmonary diseases, including, but not limited to, chronic obstructive pulmonary disease (COPD) and acute respiratory distress syndrome (ARDS), genetic developmental diseases, including, but not limited to, Noonan's syndrome, Costello syndrome, (faciocutaneoskeletal s>ndrome), Atty Dkt No 039363-3303

LFOPARD syndrome, cardio-faciocutaneous syndrome (CFC), and neural crest syndrome abnormalities causing cardiovascular, skeletal intestinal, skin, hair and endocπne diseases

Exemplary Diseases Associated with c-Kit.

[0215] The compounds described herein are useful for treating disorders related to c kit e g , diseases related to unregulated kinase signal transduction, including, but not limited to, cell proliferative disorders, fibrotic disorders and metabolic disorders, among others As described in more detail below and in Lipson et al , U S 20040002534 (U S application 10/600, 868, filed Tune 23, 2003) which is incorporated herein by reference in its entirety, cell proliferative disorders which can be treated by the present invention include cancers, and mast cell proliferative disorders.

10216] The presence of c-kit has also been associated with a number of different types of cancers In addition, the association between abnormalities in c-kit and disease are not rcstncted to cancer As such, c-kit has been associated with malignancies, including, but not limited to, mast cell tumors, small cell lung cancer, testicular cancer, gastrointestinal stromal tumors (GISTs), glioblastoma, astrocytoma, neuroblastoma, carcinomas of the female genital tract sarcomas of neuroectodermal origin, colorectal carcinoma, carcinoma in situ, Schwann cell neoplasia associated with neurofibromatosis, acute myelocytic leukemia, acute lymphocytic leukemia, chronic myelogenous leukemia, mastocytosis, melanoma, and canine mast cell tumors, and inflammatory diseases, including, but not limited to, asthma, rheumatoid arthritis, allergic rhinitis, multiple sclerosis, inflammatory bowel syndrome, transplant rejection, and hypereosinophilia

Exemplary diseases associated with c-fins

[0217] lhe presence of c-fms has been associated with a number of different types of diseases As such, c-fms has been associated with immune disorders, including, but not limited to, rheumatoid arthritis, systemic lupus erythematosa (SLE), and transplant rejection, inflammatory diseases including, but not limited to, osteoarthritis, inflammatory bowel syndrome, ulcerative colitis, Crohn's disease, chronic obstructive pulmonary disease (COPD), emphysema, Kawasaki's Disease, hemophagocytic syndrome (macrophage activation syndrome), multicentric reticulohistiocytosis, and atherosclerosis, metabolic disorders, including, but not limited to, Type I diabetes, Type II diabetes, insulin resistance, hyperglycemia, obesity, and lipo lysis, disorders of bone structure, mineralization and bone formation and resorption, including, but not limited to, osteoporosis, increased risk of fracture, Paget' s disease, hypercalcemia, infection-mediated osteolysis (e g osteomyelitis), pen- prosthetic or wear-debπs-mediated osteolysis, and metastasis of cancer to bone, kidney and genitourinary diseases, including, but not limited to, endometriosis, nephritis (e g glomerulonephritis, interstitial nephritis, Lupus nephritis), tubular necrosis, diabetes-associated renal complications (e g Atty Dkt No 039363-3303 diabetic nephropathy), and renal hypertrophy, disorders of the central nervous system, including, but not limited to, multiple sclerosis, stroke, Alzheimer's disease and Parkinson's disease, inflammatory and chronic pain, including, but not limited to, bone pam, and cancers, including, but not limited to, multiple myeloma, acute myeloid leukemia (AML), chronic myeloid leukemia (CML), prostate cancer, breast cancer, ovarian cancer, melanoma, glioblastoma multiforme, metastasis of tumors to other tissues, and other chronic myeloproliferative diseases such as myelofibrosis

Exemplary diseases associated with TrkA and TrkB

[0218] TrkA: 1 arget kinase TrkA (i e , neurotrophic tyrosine kinase, receptor, type 1) is a 140 kDa tyrosine kinase encoded by chromosome Iq21-q22 (symbol NTRKl) TrkA inhibitors may be useful in treating pam (e g chronic pam, neuropathic pain), cancer (e g prostate cancer, lung cancer, myeloid leukemia, pancreatic cancer), allergic disorders (e g asthma), arthritis, diabetic retinopathy, macular degeneration and psoriasis

[0219] LrkA is a plasma member receptor composed of an extracellular domain (responsible for high affinity binding to nerve growth factor, NGF), a transmembrane segment and an intracellular protein tyrosine kinase domain (responsible to transmit the NGF signal to initiate and coordinate neuronal responses) NGF binding induces TrkA clustering on the membrane and activates the kinase The kinase initiates a cascade of protein phosphorylation events through multiple pathways including SHC/Ras/MAPK, PI3K and PLCgI A TrkA kinase inhibitor would not prevent NGF'TrkA binding, but could prevent down-stream signal transduction

[0220] Nerve Growth Factor (NGF) is produced by a number of tissues and inflammatory cells during tissue injury and host immune response It initiates and maintains hypersensitivity to incoming stimulus (hyperalgesia) and the perception of non-noxious stimuli (allodynia) Through its high- affimty receptor TrkA, NGF increases the excitation state of sensory neurons leading to the central nervous system (peripheral sensitization), and increases transmitter release from the dorsal spinal cord (central sensitization) In clinical tπals, a single NGF subcutaneous injection generated local hyperalgesia persisting up to 7 weeks At doses above 0 1 microgram/kg, NGF caused muscle pain that varied from mild to moderate, primarily in the bulbar and truncal musculature Intravenous NGF produced earlier and more pronounced systemic effects (Petty et al, 1994, Ann Neurol 36 244-6) Conversely, TrkA kinase inhibitors could be used to treat diseases of enhanced states of nociception

[0221] In Complete Freund's Adjuvant (CFA)-induced hind-paw inflammation, spinal nerve ligation and streptozoticin-mduced neuropathic pam models, a single intraperitoneal injection of anti- NGF reversed established tactile allodynia from day 3 to day 7 following treatment In the mouse CCI model, anti-NGF reversed tactile allodynia when administered 2 weeks after surgery Repeated US2007/088443

Atty Dkt No 039363-3303 administration of this antibody to CCI mice for 3 weeks produced a sustained reversal of tactile allodynia (Wild et al, 2007, J Pharmacol Exp Ther 322 282-287)

[0222] Prostate tumors that have metastasized to bone frequently induce bone pam which can be difficult to fully control as it seems to be driven simultaneously by inflammatory, neuropathic, and tumorigenic mechanisms Anti-NGF produced a significant reduction in both early and late stage bone cancer pam— related behaviors This therapy did not influence tumor-mduced bone remodeling, osteoblast proliferation, osteoclastogenesis, tumor growth, or markers of sensory or sympathetic innervation in the skm or bone All nerve fibers that innervate the bone express TrkA and p75, and these are the receptors through which NGF sensitizes and/or activates nociceptors (Halvorson et al, 2005, Cancer Res 65 9426-35)

[0223| In patients with mild asthma due to exposure to cat allergen, NGF expression was strongly induced in epithelial cells, fibroblasts, blood vessels, and a few infiltrating cells TrkA mRNA and protein levels in bronchial biopsies were increased significantly after allergen exposure in infiltrating mast cells before the onset of symptoms (Kassel et al, 2001 , Clin Exp Allergy 31 1432-40)

[0224] The late phase reaction in asthma following allergen provocation is dominated by an influx of activated eosinophils into the bronchial lumen, which correlates with the release of eosinophilic products into the airways to increase disease severity The viability and activation of eosinophils from patients with mild asthma were significantly enhanced after NGF stimulation Addition of neutralizing anti-NGF antibodies ex vivo abrogated the effects (Nassentein et al, 2003, J Exp Med 198 455-467) TrkA kinase inhibitors could decrease this paracrine loop between the respiratory tract and infiltrating mast cells as well as endobronchial eosinophils, and thus be useful for the treatment ol asthma and other allergic disorders

[0225] TrkB: Target kinase TrkB (i e , neurotrophic tyrosine kinase, receptor, type 2) is a 145 kDa tyrosine kinase encoded by chromosome 9q22 1 (symbol NTRK2) TrkB inhibitors may be useful in treating various cancers and their metastases (e g prostate cancer, lung cancer, Wilms tumors, neuroblastoma, and pancreatic cancer), and various neuropathies (e g stroke, multiple sclerosis, trans\erse myelitis, and encephalitis)

[0226] In clinical trials with recombinant BDNF, paresthesia was developed at the site of subcutaneous injection (Couhe et al, 2000, Gastroenterology 119 41-50) Intrathecal infusion of BDNF in humans also induced paresthesia and warmth as side effects (Ochs et al, 2000, Amyotroph Lateral Scler Other Motor Neuron Disord 1 201-6) Chronic paresthesia is often a symptom of an underlying neurological disease or traumatic nerve damage Paresthesia can be caused by disorders affecting the central nervous system, such as stroke and transient ischemic attacks (mini-strokes), 007/088443

Atty Dkt No 039363-3303 multiple sclerosis, transverse myelitis, and encephalitis Since BDNt binds to TrkB specifically with high affinity these neuropath effects are mediated through TrkB signaling Thus Trkb kinase inhibitors could be used to treat certain patients with neuropathy

[0227] BDNF is known to act at the synapses between primary sensory and spmal dorsal horn neurons to affect pam transmission during inflammation f he primary afferent is the only source of BDNF in the spmal cord, and it is up-regulated m the dorsal root ganglion (DRG) by peripheral NGF a few days aftei inflammation, and is transported and released into the superficial dorsal horn in an activity-dependent manner TrkB expression in the dorsal horn also increases for a few days after inflammation These findings suggest that BDNF may act during the restricted peπod in the early phase of inflammation Through TrkB, BDNF activates two distinct channels (1) transient receptor potential canonicals (TRPC3), which produces a slow response by opening ot a non-selective cation channel, and (2) Na+ channel, which mediates a rapid depolarization in the hippocampus These channels have been strongly associated with inflammatory pain Anti-BDNF significantly increased the withdrawal threshold m CFA-treatcd rats, a model of inflammatory pain Since the swelling at the site of CFA injection was not affected by antiserum, the residual component might be due to peripheral sensitization (Matayoshi et al, 2005, J Physiol 569 685-95)

[0228] In patients with neuroblastomas, co-expression of TrkB and BDNF, co-expression ot TrkB with N-Myc amplification, and expression of truncated TrkB are found to be associated with poorer clinical outcome (Nakagawara et al, 1994, MoI Cell Biol 14 759-767) Co-expression of TrkB with its hgand BDNF could generate a positive feedback loop through autocrine and paracrine loops Also TrkB truncations found in these tumors generate activated forms of the intracellular protcm tyrosine kinase The constitutively active TrkB signals through multiple pathways to promote cancer initiation, progression and metastasis These truncated TrkB kinases were also found in hepatocellular carcinoma (Yang et al, 2005, Cancer Res 65 219-225) Thus TrkB inhibitors could be used to treat a sub-population of cancer patients with an activated TrkB pathway

[0229] In patients with pancreatic cancer, TrkB expression is correlated with perineural invasion, positive reti opeπtoneal margin, and shorter latency to development of liver metastasis (Sclabas et al, 2005, Clin Cancer Res Vl 1 440-449) Mechanistically, TrkB activates the PI3K pathway to suppress anoikis (apoptosis resulting from loss of cell-matrix interactions) which is one of the physiological barriers to metastasis TrkB kinase inhibition could break down resistance to anoikis of metastasizing tumors (Douma et al, 2004, Nature 430 1034-9) Therefore, TrkB inhibitors could have utility in a broad range of tumor types

Exemplary diseases associated with MΛPK4K Atty Dkt No 039363-3303

[⁰²³⁰I MAF4K4: Target kinase MAP4K4 (i e , Mitogen-actn ated protein kinase kinase 4, aka Hematopoietic progenitor kinase/Germinal center kinase-hke Kinase) is a 130 kDa senne/threonine kinase encoded by chromosome 2ql 1 2-ql2 (symbol MAP4K4) and is also known as HGK It is a member of the human STE20/mitogen-activated protein kinase kinase kinase kinase (MAP4K) family of serine/threonine kinases and is the human ortholog of mouse NIK (Nck-interacting kinase) The N- terminus of the mature HGK protein has a catalytic kinase domain that shares 47" o and 48% ammo acid sequence identity to the catalytic domain of Hematopoietic progenitor kinase 1 (HPKl) and Germinal center kinase (GCK), respectively Yao et al (J Biol Chem 274 2118 2125, 1999) identified 2 HGK isoforms, one of which has no pioline-πch domains, and another, longer variant that contains such domains and appears to be expressed in brain only Northern blot analysis revealed expression of 3 HGK transcripts of approximately 4 6, 6 5, and 8 5 kb in heart, brain, skeletal muscle, pancreas, placenta, liver, lung, and kidney By Western blot analysis with a polyclonal antibody, Yao et al (J Biol Chem 274 2118-2125, 1999) found that the 130-kD protein is expressed in multiple cell lines

[0231] Expression of HGK in transfected cell lines resulted in strong JNK activation and, in turn, c- iun transcriptional activity (Yao et al J Biol Chem 274 2118-2125, 1999) HGK-induced JNK activation was inhibited by dominant-negative MAP2K4, MAP2K7, and TAKl mutants TNP-alpha also stimulated HGK kinase activity HGK was identified as a putative effect of Rap2 to activate JNK (Machida et al J Biol Chem 279 1571 1-15714, 2004) This link establishes HGK as a potential target for a range of metabolic indications, since the JNK pathway clearly antagonizes insulin signaling An HGK inhibitor could re-sensitize fat and muscle cells to insulin

[0232] HGK is found to be broadly expressed in human tumor cells and can modulate cellular transformation, invasion, and adhesion (Wright et al MoI Cell Biol 23 2068-2082, 2003) Wright et al showed HGK to be highly expressed in most tumor cell lines relative to normal tissue An active role for this kinase in transformation was suggested by an inhibition of H-Ras(V12)-induced focus formation by expression of inactive, dominant-negative mutants of HGK in both fibroblast and epithelial cell lines Expression of an inactive mutant of HGK also inhibited the anchorage- independent growth of cells yet had no effect on proliferation in monolayer culture Expression of HGK mutants modulated integπn receptor expression and had a striking effect on hepatocyte growth factor-stimulated epithelial cell invasion Together, these results suggest an important role for HGK in cell transformation and invasiveness More recently, a small interfering RNA screen for modulators of tumor cell motility identifies MAP4K4 as a promigratory kinase (Collins et al Proc Natl Acad Sci USA, 103 3775-3780, 2006) Collins et al showed that the knockdown of the HGK transcnpt inhibited the migration of multiple carcinoma cell lines, indicating a broad role in cell motility, and potently suppressed the invasion of SKO V-3 cells in vitro The effect of HGK on cellular migration Atty Dkt No 039363-3303 was found to be mediated through JNK kinase, independent of API activation and downstream transcription Accordingly, small molecule inhibition of c-Jun N-terminal kinase suppressed SKOV-3 cell migration, undersconng the potential therapeutic utility of mitogen-activated protein kinase pathw ay inhibition in cancer progression (Collins et al Proc Natl Acad Sci USA, 103 3775-3780, 2006) These studies strongly support HGK as a target in a broad range of oncology indications In particular, an HGK inhibitor could have utility m blocking the migration, invasion and metastasis in many different tumor types

[0233] Activation of T-cells by antigens initiates a complex series of signal-transduction events that are critical for immune responses Mack et al (Immunol Lett 96, 129-145, 2005) developed a genetic screen to survey the functional roles of kinases in antigen mediated T-cell activation and identified 19 protein kinases that were previously implicated in T-cell signaling processes and 12 kinases that were not previously linked to T-cell activation, including HGK siRNA studies showed a role for HGK in antigen mediated T-cell responses in Jurkat and primary T-cells In addition, by analyzing multiple promoter elements using reporter assays, Mack ct al have shown that MAP4K4 is implicated in the activation of the TNF-alpha promoter Therefore, inhibition of HGK could have broad therapeutic utility for T-cell-mediated autoimmune diseases

[0234] Insulin-regulated glucose transporter GLUT4 is a key modulator of whole body glucose homeostasis, and its selective loss in adipose tissue or skeletal muscle causes insulin resistance and diabetes Using an RNA interference-based screen, Tang et al (Proc Natl Acad Sci U S A 103 208⁷- 2092, 2006) tound 4 negative regulators of msulin-responsive glucose transport in mouse adipocytes Pctkl, Pftkl, Ikbka (CHUK), and HGK HGK suppressed expression of adipogenic transcnption factors, C/EBPA, C/EBPB, and PPARG, and it suppressed surface expression of GLUT4 (SLC2A4), resulting in attenuated membrane hexose transport activity RNA interference-mediated depletion of HGK early in differentiation enhanced adipogenesis and triglyceride deposition, in fully differentiated adipocytes, loss of HGK upregulated GLUT4 expression Conversely, conditions that inhibited adipogenesis, such as TNF-alpha treatment or PPARG depletion, markedly upregulated HGK Tang ct al (Proc Natl Acad Sci U S A 103 2087-2092, 2006) concluded that MAP4K4-dependcnt signaling inhibited PPARG-responsive gene expression, adipogenesis, and insulin-stimulated glucose transport Furthermore, TNF-alpha signaling to down-regulate GLUT4 is impaired in the absence of HGK, indicating that HGK expression is required for optimal TNF-alpha action This study further supports HGK as a target m metabolic disease, and suggests a role for HGK inhibition in ameliorating the pathology in adipocytes

[0235] In a separate study (Bouzakπ and Zierath J Biol Chein 282 7783-7789, 2007), using small interfering RNA (siRNA) to suppress the expression of HGK protein 85% in primary human skeletal muscle cells, TNF-alpha-mduced insulin resistance on glucose uptake was completely prevented 7 088443

Atty Dkt No 039363-3303

HGK silencing inhibited TNF-alpha-induced negative signaling inputs by preventing excessive JNK and ERK-I /2 phosphorylation, as well as IRS- 1 scπne phosphorylation These results highlight the HGK/JNK'ERK 'IRS module in the negative regulation of insulin signaling to glucose transport in response to TNt- -alpha Depletion of HGK also prevented TNF-alpha-induced insulin resistance on AKT and the AKT substrate 160 (AS 160), providing evidence that appropπate insulin signaling inputs for glucose metabolism were rescued The authors suggested that strategies to inhibit HGK may be efficacious in the prevention of TNF-alpha-mduced inhibitory signals that cause skeletal muscle insulin resistance on glucose metabolism in humans Moreover, in myotubes from msuhn- resistant type II diabetic patients, siRNA against HGK restored insulin action on glucose uptake to levels observed in healthy subjects This study further supports HGK as a target in metabolic diseases such as type II diabetes, and suggests a role for HGK inhibition in ameliorating the pathology in muscle cells

[0236] HGK inhibitors may be useful m treating metabolic indications, including, but not limited to, re-sensitizing fat and muscle cells to insulin, ameliorating the pathology in adipocytes, ameliorating the pathology in muscle cells, metabolic syndrome and type II diabetes, a broad range of oncology indications, including, but not limited to, blocking the migration, invasion and metastasis in many different tumor types, and T-cell mediated autoimmune diseases

Kinase Activity Assays

[0237] A number of different assays for kinase activity can be utilized for assaying for active modulators and/or determining specificity of a modulator for a particular kinase or group or kinases In addition to the assay mentioned m the Examples below, one of ordinary skill in the art will know of other assays that can be utilized and can modify an assay for a particular application For example, numerous papers concerning kinases describe assays that can be used

[0238] Additional alternative assays can employ binding determinations For example, this sort of assay can be formatted either in a fluorescence resonance energy transfer (FRET) format, or using an ΛlphaScreen (amplified /ummescent proximity Λomogeneous assay) format by varying the donor and acceptor reagents that are attached to streptavidin or the phosphor-specific antibody

Organic Synthetic Techniques

[0239] The versatility of computer-based modulator design and identification lies in the diversity of structures screened by the computer programs The computer programs can search databases that contain very large numbers of molecules and can modify modulators already complexed with the enzyme with a wide variety of chemical functional groups A consequence of this chemical diversity is that a potential modulator of kinase function may take a chemical form that is not predictable A Atty Dkt No 039363-3303

\\ ide array of organic synthetic techniques exist m the art to facilitate constructing these potential modulators Many of these organic synthetic methods arc described in detail in standard reference sources utilized by those skilled in the art One example of such a reference is March, 1994 Advanced Organic Chemistry, Reactions, Mechanisms and Structure. New York, McGraw Hill Thus, the techniques useful to synthesize a potential modulator of kinase function identified by computer-based methods aie ieadily available to those skilled in the art of organic chemical synthesis

[0240] Regarding the synthetic examples described herein, sohents include polar and non-polar solvents known to those of skill in the art, including polar aprotic and polar protic solvents Polar solvents include, without limitation, protic solvents such as methanol, ethanol, isopropyl alcohol, t- butanol, n-butanol, acetic acid, formic acid or water, or aprotic solvents such as tetrahydrofuran (THF), acetonitnle, dioxane, methylene chloride, dimethylsulfoxide (DMSO), acetone, N,N- dimethylformamide (DMF), N,N-dimethylacetamide (DMA), ethyl acetate, 1,2-dimethoxyethane, 1,2- dichloroethane, chloroform, 1 ,2-dichloroethane, or pyridine Polar solvents include a mixture of water with any of the above, or a mixture of any two or more of the above Apolar solvents include, without limitation, toluene, benzene, chlorobenzene, xylenes and hexanes

[0241] Regarding the synthetic examples described herein, reducing agent includes, without limitation, a reducing agent such as catalytic reducing agents using hydrogen and transition metal catalysts such as palladium, platinum, rhodium, etc (e g Pt/acetic acid/H->), a mixture of tπfluoroacetic acid and tπethylsilane, borane tetrahydrofuran complex, diborane, borane dimethylsulfide complex, and a combination of sodium borohydπde and boron tπfluoπde, metals such as reduced iron, zinc powder, magnesium etc , metal hydrogen complex compounds such as alkali metal borohydπdes (for example, potassium borohydπde, sodium borohydπde, lithium borohydπde, zinc borohydπde, sodium tnacetoxyborohydride, etc ), aluminum lithium hydride, etc , metal hydrides such as sodium hydride, etc , organic tin compounds (tnphenyltin hydride, etc ), and metal salts such as nickel compounds, zinc compounds, tin compounds (for example tm(TI) chloride), and samarium lodide/pivahc acid/hexamethylphorphoπc tπamide

[0242] Regarding the synthetic examples described herein, oxidizing agent includes, without limitation, an oxidizing agent such as Dess-Martin reagent TEMPO (2,2,6,6-tetramethylpipeπdine-N- oxide), DDQ (2,3-Dichloro-5,6-dicyano-l ,4-bcnzoqumone), PDC (pyπdimum dichromate), PCC (pyπdinium chlorochromate), Pyridine SO3, Chromium tπoxide, p-mtroperbenzoic acid, magnesium monoperoxyphthalatc, sodium penodate, potassium peπodate, hydrogen peroxide, urea peroxide, alkali metal bromates, cumene hydroperoxide, tert-butyl peroxide, peracids such as performic acid, peracetic acid, pertπfluoroacetic acid, perbenzoic acid, m-chloroperbenzoic acid, o- carboxyperbenzoic acid and the like, sodium metapenodate, bichromic acid bichromates such as Att>. Dkt. No . 039363-3303 sodium bichromate, potassium bichromate, permanganic acid, permanganates such as potassium permanganate, sodium permanganate, and lead salts such as lead tetraacetate

[0243] Regarding the synthetic examples described herein, a nitrogen protecting group is a chemical group covalently bound to a nitrogen atom of a compound that is used to protect the nitrogen from reaction during a synthetic step The nitrogen protecting group may be added to a compound and removed in a subsequent step by methods known to those of skill in the art Nitrogen protecting groups include, without limitation, carbamates, amides, N-sulfon>l derivatives, groups of formula -C(O)OR, wherein R is, for example, methyl, ethyl, t-butyl, benzyl, phenylethyl, CH₂=CHCH₂-, and the like, groups of the formula -C(O)R', wherein R' is, for example, methyl, phenyl, tπfluoromethyl, and the like, groups of the formula -SOjR", wherein R" is, for example, tolyl, phenyl, tπfluoromethyl, 2,2,5,7,8-pentamethylchroman-6-yl, 2,3,6-tπmethyl-4-methoxyphenyl, and the like, and silanyl containing groups, such as 2-tπmethylsilylethoxymethyl, t-butyldimethylsilyl, tπisopropylsilyl, and the like Other suitable nitrogen protecting groups may be found in texts such as T W Gieene & P G M Wuts, Protective Groups in Organic Synthesis, John Wiley & Sons, 1991

Alternative Compound Forms or Derivatives

[0244] Compounds contemplated herein aie described with reference to both generic foπnulae and specific compounds In addition, invention compounds may exist m a number of different forms or derivatives, all within the scope of the present invention Alternative forms or derivatives, such as (a) Isomeis, Prodrugs, and Active Metabolites (b) Tautomers, Stereoisomers, Regioisomers, and Solvated Forms (c) Prodrugs and Metabolites (d) Pharmaceutically acceptable salts and (e) Polymorphic forms, are described, for example, in US Patent Application Seπal number 11 '473,347 (see also, PCI publication WO2007002433), the disclosure of which is hereby incorporated by reference in its entnety

Administration

[0245] The methods and compounds will typically be used in therapy for human subjects However, they may also be used to treat similar or identical indications in other animal subjects In this context, the terms "subject," "animal subject," and the like refer to human and non-human vertebrates, e g mammals, such as non-human primates, sports and commercial animals, e g , equmes, bovines, porcmes, ovines, rodents, and pets, e g , canines and felines A description of possible methods and routes of administration may be found, for example, in US Patent Application Seπal number 11/473,347 (see also, PCT publication WO2007002433), the disclosure of which is hereby incorporated by reference in its entirety

EXAMPLES Atty. Dkt. No.; 039363-3303

[0246] Examples related to the present invention are described below. In most cases, alternative techniques can be used. The examples are intended to be illustrative and are not limiting or restrictive to the scope of the invention. In some examples, the mass spectrometry result indicated for a compound may have more than one value due to the isotope distribution of an atom in the molecule, such as a compound having a bromo or chloro substituent.

[0247] Unless specifically indicated otherwise, the Formula enumeration and R group enumeration used in the following examples is not related to such enumeration in other sections of this application. The reagents and solvents used in these examples can be readily substituted with appropriate alternatives as are known in the art and isolation of products is readily achieved by methods known in the art, including, but not limited to, extraction, crystallization, and chromatographic methods. In addition to the following Examples, exemplary methods which may be employed for synthesis of compounds of the present invention may be found in US Patent Application Serial number 11/473,347 (see also, PCT publication WO2007002433), the disclosure of which is hereby incorporated by reference in its entirety. The lH-pyrrolo[2,3-b]pyridine core of compounds described in the examples may also be referred to as 7-azaindole in the examples.

Example 1. Synthesis of compounds of Formula X

Step I - Preparation of compounds of Formula Xc and Xd

[0248] To a compound of Formula Xa (R⁴, R⁵, and R⁶ are as defined in paragraph [0008]) and a compound of Formula Xb (Y is consistent with compounds of Formula II, Formula III, or Formula IV, e.g. Y is:

where Z₂, Z₄,

Z₅, Z₆, R¹⁵ and R¹⁷ are as defined in paragraph [0008], L₄, R⁶⁰ and R⁶¹ are as defined in paragraph [0034], R⁸⁰ and R⁸¹ are as defined in paragraph [0057], and R > 9^w0 is as defined in paragraph [0093], where * indicates the attachment point to the carbonyl carbon) is added an appropriate solvent (e.g. methanol) followed by an appropriate base (e.g. potassium hydroxide, Atty. Dkt. No.: 039363-3303 sodium methoxide). The reaction is typically allowed to stir at room temperature overnight. Isolation by conventional means (e.g. extraction, washing and filtering) affords a mixture of compounds of Formula Xc and Xd, which may be separated by silica gel chromatography if desired.

Step 2 - Preparation of compounds of Formula X

[0249] To a compound of Formula Xc or Xd in an appropriate solvent (e.g. acetonitrile) is added a reducing agent (e.g. trifhioroacetic acid and triethylsilane). Typically, the reaction is allowed to stir at room temperature overnight. Isolation by conventional means (e.g. extraction and silica gel column chromatography) affords compounds of Formula X.

Example 2. Synthesis of compounds of Formula XI

Step 1 - Preparation of compounds of Formula XI

[0250] To a compound of Formula Xc (See Example 1) in an appropriate solvent (e.g. tetrahydrofuran) is added an oxidizing agent (e.g.Dess-Martin periodane, TEMPO, DDQ). Typically, the reaction is allowed to stir at room temperature for 20 minutes. Isolation by conventional means (e.g. extraction and silica gel column chromatography) affords compounds of Formula XL

Example 3. Synthesis of Compounds of Formula XI

Step -I- Synthesis of compound υf Formula XI

[0251] Compound of Formula Xl is synthesized by reacting a compound of Formula Xa (see Example 1) with a compound of Formula Xe (Y is as defined in Example 1), e.g. benzoyl chloride, in the presence of a Lewis acid (e.g. aluminum trichloride) in an inert solvent (e.g. dichloromethane) under an inert atmosphere (e.g. argon) at room temperature or with heating up to reflux for 1-18 hours. The desired compound XI is isolated by extraction and silica gel column chromatography, Atty. Dkt. No.: 039363-3303 Example 4: Synthesis of 5-chloro-lH-pyrrolo[2,3-b]pyridine 4,

[0252] Compound 4 was synthesized in three steps from 5-bromo-7-azaindole 1 as shown in Scheme 1.

Scheme 1

Step 1 - Preparation of5-bromo-l-triisυpropylsilanyl-lli-pyrrolo[2,3-b]pyridine (2): [0253] To 5-bromo-7-a/aindole (1, 1.5 g, 7,6 mmol) in N,N-dimethylformamide (20 mL) were added sodium hydride (60% in mineral oil, 0.27 g, 11.0 mmol) and trriisopropylsilyl chloride ( 2.6 mL, 12.0 mmol), under an atmosphere of nitrogen. The reaction was stirred for 2 hours at room temperature. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 10 % ethyl acetate in hexane to give the compound (2, 1.6 g, 59%). MS(ESI)[M+H⁺]⁺ = 352.3.

Step 2 - Preparation 5-chloro-l-triisυpropykilanyl-lH-pyrrolo[2,3-b] pyridine (3): [0254] To 5-bromo-l -triisopropylsilyl-7-azaindole (2, 1 ,60 g, 4.53 mmol) in tetrahydrofuran (50.0 mL), under an atmosphere of nitrogen at -78 ⁰C, was added terr-butyllithium (1.70 M in hexane, 6.12 mL). The reaction was stirred for 1 hour, followed by addition of hexachloroethane (1.29 g, 5.43 mmol). The reaction was stirred for 3 hours, poured into water, and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated to give the crude compound (3, 1.60 g). MS (ESI) [M+H^"]⁺ = 309.3.

Step 3 - Preparation 5-chloro-LH-pyrrolo[2,3-b] pyridine (4):

[0255] To 5-chloro-l-triisopropylsilanyl-lH-pyrrolo[2,3-b]pyridine (3, 1.40 g, 4.53 mmol) in tetrahydrofuran (15 mL) was added feft-α-n-butylammonium fluoride (1.42 g, 5.43 mmol). The reaction mixture was stirred at room temperature for 10 minutes. The reaction mixture was concentrated and isolated by silica gel column chromatography eluting with 30% ethyl acetate in hexane to give the compound (4, 0.40 g. 58% over 2 steps), MS(ESI)[M-H⁺]^" = 153.1.

[0256] 5-Fluoro-l H-pyrrolo[2,3-b]pyridine 5

T7US2007/088443

Atty. Dkt. No.: 039363-3303 was prepared using the protocol of Scheme 1, substituting hexachloroethane with N-fluoro-N- (phenylsulfonyl) benzenesulfonamide in Step 2. MS(ESl) [M + ϊCf = 137.1.

Example 5: Synthesis of l-triisopropylsHanyl-lH-pyrrolo[2,3-b]pyridine-3-carbaldehyde 8. [0257] Compound 8 was synthesized in two steps from 7-azaindole 6 as described in Scheme 2.

Scheme 2

Step 1 - Preparation of 1 H-pyrrolo[2,3-b] pyridine-3-carbaldehyde (7):

[0258] To lH-Pyrrolo[2,3-b]pyridine (6, 16.0 g, 135 mmol) in water (110 mL), were added hexamethylenetetramine (26.0 g, 185 mmol), and acetic acid (55.0 mL, 967 mmol). The reaction was refluxed for 12 hours. Water (329 mL) was added and the reaction was cooled to room temperature.

The reaction was filtrated and washed with water to give the compound (7, 15.0 g, 76%).

MS(ESI)[M+H⁺]⁺ = 147.

Step 2 - Preparation υf 1 -triisopropylsilanyl- 1 H-pyrrolo [2 ,3-b] pyridine-3-carbaldehyde (8): [0259] To lH-Pyrrolo[2,3-b]pyridine-3-carbaldehyde (7, 4.05 g, 27.71 mmol) in tetrahydrofuran (30.0 mL) were added sodium hydride (60% in mineral oil, 1.5 g, 38 mmol) and trriisopropylsilyl chloride (8.0 mL, 38 mmol) under an atmosphere of nitrogen. The reaction was stirred for 2 hours at room temperature. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 10 % ethyl acetate in hexane to give the compound (8, 3.0 g, 36%). MS(ESI)[M+H⁺f = 303.

Example 6: Synthesis of 5-isopropyl-lH-pyrrolo[2,3-b]pyridine 11.

[0260] Compound 11 was synthesized in three steps from 5-bromo-l-triisopropylsilanyl-lH- pyrrolo[2,3-b]pyridine 2 described in Scheme 3.

Scheme 3

Atty. Dkt. No/. 039363-3303

Step 1 Preparation of2-(l-trnsopropylsilanyl-lH-pyrrolo[2,3-b]pyridin-5-yl)-propan-2-ol (9): [0261] To 5-bromo-l -triisopropylsilanyl-lH-pyrrolo[2,3-b]pyridine (2, 2.0 g, 5.66 mmol, prepared as described in Example 4) in tetrahydrofuran (20.0 rriL), cooled in a -78 ⁰C acetone/dry ice bath, under an atmosphere of nitrogen, was added tert-butyllithium (1.7 M in tetrahydrofuran, 7.3 mL, 12 mmol) dropwise. After 20 minutes, acetone (0,830 mL, 11 mmol) was added dropwise to the reaction. The reaction was stirred for 30 minutes at -78 ⁰C and then allowed to reach room temperature. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 10 % ethyl acetate in hexane to give the compound (9, 1.30 g, 69%). MS(ESI)[M-rH⁺]⁺ = 333.

Step 2 - Preparation of 5-isopropenyl-lH-pyrrolo[2.3-b] pyridine (10):

[0262] To 2-(l-triisopropylsilanyl-lH-pyrrolo[2,3-b]pyridin-5-yl)-propan-2-ol (9, 0.500 g, 1.5 mmol) in acetonitrile (10.0 mL) were added triethylsilane (1.00 mL, 6.3 mmol) and trifluoroacetic acid (0.50 mL, 6.5 mmol) under an atmosphere of nitrogen. The reaction was refluxed for 3 hours, then cooled down to room temperature. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 50 % ethyl acetate in hexane to give the compound (10, 0.200 g, 84%). MS(HSI) [M+HT = 159.

Step 3- Preparation of5-isopropyl-lH-pyrrolo[2,3-b]pyridine (11):

[0263] To 5-isopropenyl-lH-pyrrolo[2,3-b]pyridine (10, 0.080 g, 0.501 mmol) in tetrahydrofuran (5.0 mL) was added 20 % palladium hydroxide on carbon (5.0 mg). The reaction was stirred under hydrogen at 40 psi for 30 minutes. The reaction mixture was filtered and concentrated to give the compound (11 , 0.078 g, 96%). MS(ESI)[M+H⁺]⁺ = 161.

Example 7: Synthesis of 5-Methyl-lH-pyrrolo[2,3-b]pyridine 13.

[0264] Compound 13 was synthesized in two steps from 5-bromo-l-triisopropylsilanyl-lH- pyrrolo[2,3-b]pyridine 2 described in Scheme 4.

Scheme 4

Step 1 - Preparation of5-Methyl-l-triisopropyisilanyl-lH-pyrrolo[2,3-b]pyridine (12): Atty Dkt No 039363-3303

[0265] 1 o PdCL(dppf) (O 04 g, O 05 mmol) in toluene (10 0 mL) under an atmosphere of nitrogen were added 5-bromo-l-tπisopropylsilanyl-lH-pyrrolo[2,3-b]pyridine (2, 0 3 g, 0 8 mmol, prepared as described in Example 4, 1 0 mL in toluene) and methylmagnesium bromide (1 O M m tetrahydrofuran, 3 0 ml 3 0 mmol) The reaction was stirred 90 ⁰C for 2 hours and then allowed to reach to room temperature The reaction was poured into citric acid (0 1 M in water) and extracted with ethyl acetate The organic layer was washed with brine, dried over anhydrous sodium sulfate and filtered The filtrate was concentrated and purified by silica gel column chromatography clutmg with 50 % ethyl acetate m hexane to give the compound (12, 0 16 g, 60 0 %) MS(ESI)[M+H⁺f = 289 4

Step 2 - Preparation of5-Methyl-lH-pyrrolo[2,3-b]pyrιdιne (13)

[0266] To 5-Methyl-l-tπιsoproρylsilanyl-lH-pyrrolo[2,3-b]pyndinc (12, 0 160 g, 0 55 mmol) in tetrahydrofuran (3 0 mL) was added tetra-n-butylammonium fluoride (0 145 g, 0 55 mmol) The reaction was stirred for 1 hour at room temperature The reaction was poured into water and extracted with ethyl acetate The organic layer was washed with brine, dried over anhydrous sodium sulfate and filtered The filtrate was concentrated and purified by silica gel column chromatography eluting with 3% methanol in dichloromethane to provide light yellow solid (13, 0 07 g, 95%)

2

[0267] 5-Methyl-lH-pyrrolo[2,3-b]pyπdine 14

was prepared following the protocol of Scheme 4, substituting methylmagnesium bromide with ethylmagnesium bromide m Step 1

Example 8: Synthesis of 5-Methoxy-lH-pyrrolo[2,3-b]pyridine 15 and related compounds.

[0268] Compound 15 was synthesized in one step from 5-bromo-lH-pyrrolo[2 3-b]pyπdine 1 as described in Scheme 5

Scheme 5

1 15

Step 1 - Preparation of 5-Methoxy-IH-pyrrolo[2,3 b] pyridine (15)

[0269] 1 o 5-bromo-7-azaindole (1, 500 0 mg, 2 53 mmol) in N,N-dimethylforrnamide (8 mL) were 007/088443

Atty. Dkt. No,: 039363-3303 added copper(I) iodide (966 mg, 5.08 mmol) and sodium methoxide in methanol (3 M, 5 mL). The reaction was stirred overnight at 120 °C under an atmosphere of Argon. The reaction was poured into water, and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate, filtered. The filtrate was concentrated and purified with silica gel column chromatograph eluting with 20% ethyl acetate in hexane to give white solid (15, 140 mg, 28%). MS(ESI)[M+HT = 149.1. In an alternative method, 2.3 g (11.7 mmol) 5-bromo-7-azaindole (1, 2.3 g, 11.7 mmol) was dissolved in 75 mL N,N-dimethylfϋrmamide and 50 mL methanol (50 mL), adding sodium methoxide (32 g, 0.6 mol) and copper-(T) bromide (3.2 g, 22.4 mmol) at room temperature. The reaction was stirred for three hours at 100 ⁰C under an atmosphere of argon. The mixture was diluted with ethyl acetate and poured into a solution of ammonium chloride: ammonium hydroxide (4:1). The organic layer was extracted with ammonium chloride:ammonium hydroxide (4: 1), washed with brine, dried over anhydrous sodium sulfate, fdtered and concentrated. The desired compound was isolated by silica gel column chromatography eluting with 30% to 70% ethyl acetate in hcxanes to give a yellow solid (15, 0.27 g, 15.6%). MS(ESI) [M + H⁺J⁺ = 149.2.

[0270] 5-Ethoxy-lH-pyrrolo[2,3-b]pyridme 16

was prepared using the protocol of Scheme 5, substituting methanol with ethanol and sodium methoxide with sodium ethoxide.

[0271] 5-(2-Methoxy-ethoxy)-lH-pyrrolo[2,3-b]pyridine 17

was prepared using the protocol of Scheme 5, substituting methanol with 2-mefhoxy-ethanol and sodium methoxide with sodium 2-methoxy-ethoxide (prepared from 2-mefhoxy-ethanol and sodium hydride). MS(ESI) [M + H⁺J⁺ = 193.3.

[0272| Diethyl-[2-(lH-pyrrolo[2,3-b]pyridin-5-yloxy)-ethyl]-amine l8

was prepared using the protocol of Scheme 5, substituting methanol with 2-diethylamino-efhanol and sodium methoxide with sodium 2-diethylammo-ethoxide (prepared from 2 2-diethylamino -ethanol and sodium hydride). MS(ESI) [M + H']⁺ = 234.5.

I l l Atty Dkt No : 039363-3303 Example 9: Synthesis of 5-P}ridm-3-yl-lH-pyrrolo[2,3-b]p>ridine 20 and related compounds.

[0273] 5-Pyridm-3-yl-lH-pyrrolo[2,3-b]pyπdme 20 was synthesized m one step from 5-bromo-lH- pyrrolo[2 3-b]pyπdine 1 as desenbed in Scheme 6

Scheme 6

Step 1 - Preparation oj 5-Pyrιdm-3-yl-lH-pyrrolo[2,3-b] pyridine (20)

[0274] To 5-bromo-7-azaindole (1. 1 00 g, 5 08 mmol) in water (13 0 mL) and acetonitrile (36 mL) were added pyπdine-3 -boronic acid (19, 1 0 g, 8 1 mmol), potassium carbonate (1 79 g, 0 0130 mol) and Tetrakis(tnphenylphosphine)palladium(0) (50 0 mg, 0 043 mmol) under an atmosphere of nitrogen The reaction mixture was heated to 170 °C overnight The reaction mixture was poured into water and extracted with ethyl acetate The organic layer w as washed with brine, dried over sodium sulfate, and concentrated The residue was punfied with silica gel column chromatography eluting with 25% ethyl acetate in hexane to provide a light yellow solid (20, 820 mg, 82%) MS(ESI)[M+fT]⁺ = 196 1

[0275] Additional compounds were prepared following the protocol of Scheme 6, either by substituting pyridine-3-boromc acid with an appropriate boronic acid or by substituting the 5-bromo- 7-azaindole with 5-(4,4,5,5-Tetramethyl-[l,3,2]dioxaborolan-2-yl)-lH-pyrrolo[2,3-b]pyπdine and reacting with a suitable aryl or heteroaryl hahde (i e coupling with the boronic acid ester on the azaindole, and the hahde on the group to be coupled to the 5-position of the azaindole) The following compounds were prepared by this procedure

5-(4-Chloro-phenyl)-lH-pyrrolo[2,3-b]pyridme,

5-(4-Fluoro-phenyl)-lH-pyrrolo[2,3-b]pyπdme,

5-Phenyl-lH-pyrrolo[2,3-b]pyπdine,

5-(6-Methoxy-pyπdin-3-yl)-lH-pyrrolo[2,3~b]pyπdine,

5-(2-Methoxy-pyπmidin-5-yl)-lH-pyrrolo[2,3-b]pyridme,

5-Pyπdin-4-yl-lH-pyrrolo[2,3-b]pyπdine,

4-(lH-Pyrrolo[2,3-b]pyndin-5-yl)-benzenesulionamide,

3-(lH-Pyrrolo[2,3-b]pyridin-5-yl)-benzenesulfonamide,

5-Pyπmidin-5-yl-lH-pyrrolo[2,3-b]pyridine,

5-(3-Methanesulfonyl-phenyl)-lH-pyrrolo[2,3-b]pyridine,

3-(lH-Pyrrolo[2,3-b]pyπdin-5-yl)-benzamide, Atty. Dkt. No.: 039363-3303

5-(5-Methyl-lH-imidazol-2-yl)-lH-pyrrolo[2,3-b]pyridine,

5-(l-Methyl-lH-imidazol-2-yl)-lH-pyrrolo[2,3-b]pyridine, and

S-Cl .S-Dimethyl-lH-imidazol^-yO-lH-pyiTolo^.S-blpyridine.

The following table indicates either 5-bromo-7-azaindolc or 5-(4,4,5,5-Tetramethyl-[ 1 ,3,2] dioxaborolan-2-yl)-lH-pyrrolo[2,3-b]pyridine starting material (column 1) and the appropriate reagent to be coupled to the 5 position of the azaindole (column 2) to afford the resulting compound (column 3), with the observed mass given in column 4,

Atty. Dkt. No.: 039363-3303

Example 10: Synthesis of 3-(4-(4-chlorobenzyloxy)-3-methoxybenzyl)-lH-pyrrolo[2,3- b] pyridine P-1247.

[0276] Compound P-1247 was synthesized in three steps from 4-hydroxy-3-methoxybenzaldehyde 21 as shown in Scheme 7.

Scheme 7

Atty. Dkt, No.: 039363-3303

Step 1 - Preparation of4-(4-chloroben∑yloxy)-3-methoxyben∑aldehyde (23): [0277] To 4-hydroxy-3-methoxybenzaldehyde (21, 600.0 mg, 3.94 mmol) and 4-chlorobenzyl bromide (22, 1.20 g, 5.84 mmol) in acetonitrile (6 mL) was added potassium carbonate (0.390 g, 2.82 mmol). The reaction was microwaved on 300 watts, 120 ⁰C for 10 minutes. The reaction was extracted with ethyl acetate and water. The organic layer was washed with brine, dried over magnesium sulfate, filtered and the volatiles removed by evaporation. The desired compound was purified by recrystallization from hexanes to provide 23 (1.01 g, 93%). MS(tSI) [M-H"]^" - 275.1.

Step 2 - Preparation of3-((4-(4-chloroben∑yloxy)-3-methoxyphenyl)(methoxy)methyl)-lH- pyrrolo [2, 3-b] pyridine (24) ^■

[0278] To lH-Pyrrolo[2,3-b]pyridine (6, 0.235 g, 1.99 mmol) and 4-(4-chlorobenzyloxy)-3- methoxybenzaldehyde (23, 0.500 g, 1.81 mmol) was added 5 mL of methanol followed by the addition of solid potassium hydroxide (0.203 g, 3.61 mmol). The reaction was allowed to stir at ambient temperature for 18 days. The reaction mixture was poured into water and extracted with ethyl acetate. The organic layer was separated and volatiles removed to give a solid which was suspended in hot ethyl acetate. The suspension was allowed to cool and the solid collected by vacuum filtration to provide 24 (548 mg, 74%). MS(ESI) [M+H⁺f = 409.4.

Step 3 — Preparation of 3-(4-(4-chlorobenzyloxy)-3-methoxyhenzyl)- 1 H-pyrrolo[2,3-bJ pyridine (P-1247):

[0279] To 3-((4-(4-chlorobenzyloxy)-3-methoxyphenyl)(methoxy)methyl)-lH-pyrrolo[2,3- bjpyridine (24, 0.548 g, 1.34 mmol) in acetonitrile (20 mL) was added trifluoroacetic acid (1.7 mL, 2.21 mmol) and triethylsilane (3.47 mL, 2.17 mmol). The reaction was stirred at 60 ⁰C for 15 hours. The volatiles were removed and the desired compound was purified by silica gel chromatography, eluting with a gradient from 0% to 60% ethyl acetate in hexanes to provide a white solid (P-1247, 505 mg, 99%). MS(ESI) [M+H⁺]⁺ = 379.4.

[0280] Additional compounds were prepared using the protocol of Scheme 7, Steps 2 and 3, replacing 4-(4-chlorobenzyloxy)-3-methoxybenzaldehyde 23 with a suitable aldehyde (prepared as described in Example 15 or 33), and optionally replacing lH-Pyrrolo[2,3-b]pyridine 6 with an appropriate substituted 7-azaindole (5-chloro-7-azaindole per Example 4 or 5-methoxy-7-azaindole per Example 8) in Step 2. The following compounds were made following this procedure:

3-[3-Methoxy-4-(4-trifluoromcthyl-benzyloxy)-benzyl]-lH-pyrrolo[2,3-b]pyridine (P-1721),

3-[3-Trifluoromethyl-4-(4-trifluoromethyl-benzyloxy)-benzyl]-lH-pyrrolo[2,3-b]pyridine

(P-1797),

3-{3-Methoxy-4-[4-(4-methyl-piperazin-l -ylmethyl)-benzyloxy]-benzyl}-lH- pyrrolo[2,3-b]pyridine (P-1821),

3-[4-(4-Chloro-benzyloxy)-2-fluoro-5-methoxy-benzyl]-l H-pyrrolo[2,3-b]pyridine (P-1844), Atty. Dkt. No.: 039363-3303

3-[4-(3-Fluoro-4-trifluoromethyl-benzyloxy)-3-αiethoxy-beii2yl]-lH-pyrrolo[2,3-b]pyridine (P-1849),

3-[4-(4-Chloro-3-trifluoromethyl-benzyloxy)-3-methoxy-benzyl]-lH-pyrrolo[2,3-b]pyridine (P-1851),

2-[2-Methoxy-4-(lH-pyrrolo[2,3-b]pyridin-3-ylmethyl)-phenoxymethyl]-lH-benzoimidazole

(P-1870),

3-[4-(4-Chloro-2-fluoro-benzyloxy)-2-fluoro-5-methoxy-benzyl]-5-methoxy-lH- pyrrolo[2,3-b]pyridine (P-1885),

3-[4-(3,4-Dichloro-benzyloxy)-3-methoxy-benzyl]-lH-pyrrolo[2,3-b]pyridine (P-1886),

3-[4-(4-Chloro-benzyloxy)-3-fluoro-benzyl]-lH-pyrrolo[2,3-b]pyridine (P-1896)₎

2-[2-Fluoro-4-(lH-pyrrolo[2,3-b]pyridin-3-ylmethyl)-phenoxymethyl]-lH-benzoimidazole

(P-1899),

3 -(4-Benzyloxy-2,5 -difluoro-benzyl)- 1 H-pyrrolo [2,3 -bjpyridine (P-1901) ,

5-Chloro-3-[4-(4-chloro-benzyloxy)-2-fluoro-5-methoxy-benzyl]-lH-pyrrolo[2,3-b]pyridine

(P-1970),

5-Chloro-3-[4-(4-chloro-2-fluoro-benzyloxy)-2-fluoro-5-methoxy-benzyl]-lH- pyrrolo[2,3-b]pyridine (P-1972),

3-[4-(4-Chloro-2-fluoro-benzyloxy)-2-fluoro-5-methoxy-benzyl]-lH-pyrrolo[2,3-b]pyridine

(P-1973),

2-[4-(5-Chloro-lH-pyrrolo[2,3-b]pyridin-3-ylmethyl)-5-fluoro-2-methoxy-phenox>^rmethyl]-lH- benzoimidazole (P-1976),

2-[5-Fluoro-2-methoxy-4-(5-methoxy-lH-pyrrolo[2,3-b]pyridin-3-ylmethyl)-phenoxymethyl]- lH-benzoimidazole (P-1977),

2-[5-Fluoro-2-melhoxy-4-(lH-pyrrolo[2,3-b]pyridin-3-ylmethyl)-phenoxymethyl]-lH- benzoimidazole (P-1978),

3 - {4-[2-(2-Bromo-ethoxy)-ethoxy] -2-fluoro-5-methoxy-benzyl } -5-chloro- 1 H-pyrrolo[2,3 - b]pyridine (P-1984),

5-Chloro-3-[2,5-difluoro-4-(2-methoxy-ethoxy)-benzyl]-lH-pyrrolo[2,3-b]pyridine (P-1986),

5-Chloro-3-[2-fluoro-5-mcthoxy-4-(2-methoxy-ethoxy)-benzyl]-lH-pyrrolo[2,3-b]pyridine

(P-1990),

{3-[4-(5-Chloro-lH-pyrrolo[2,3-b]pyridin-3-ylmethyl)-5-fluoro-2-methoxy-phenoxy]-propyl}- diethyl-amine (P-2004),

5-Chloro-3-{2-fluoro-5-methoxy-4-[2-(2-methoxy-ethoxy)-ethoxy]-benzyl}-lH-pyrrolo[2,3- bjpyridine (P-2002),

3-(4-Benzyloxy-2,6-difluorϋ-benzyl)-lH-pyrro]o[2,3-b]pyi-idine (P-2022),

3-{2-Fluoro-5-methoxy-4-[2-(2-methoxy-ethoxy)-ethoxy]-benzyl}-5-methoxy-lH-pyrrolo[2,3- bjpyridine (P-2025), and Atty, Dkt. No.: 039363-3303

3-{2-Fluoro-5-methoxy-4-[2-(2-methoxy-ethoxy)-ethoxy]-bcnzyl}-lH-pyrrolo[2.3-b]pyndine (P-2026).

The following table indicates the aldehyde (column 2) and the azaindole (column 3) used to afford the target compound (column 4). Column 1 indicates the compound number and column 5 the observed mass.

Atty. Dkt, No.: 039363-3303

Atty. Dkt. No.; 039363-3303

Atty. Dkt. No.: 039363-3303

Example 11: Synthesis of (3-BenzyIoxy-2,6-difluoro-phenyl)-(5-pyridin-3-yl-lH-pyrroloI2,3- b]pyridiπ-3-yl)-methanone P-1467 and related compounds

[0281] Compound P-1467 was synthesized in four steps from 2,4-diiluorophenol 25 as shown in Scheme 8. Scheme 8

Step 1 - Preparation ofl-Benzyloxy-2,4-difluoro-benzene (26):

[0282] To 2,4-difluoro-phenol (25, 7.60 g, 0.0584 mol) in N,N-dimethylformamide (50.0 mL) were added benzyl bromide (8.0 mL, 0.067 mol) and potassium carbonate (9.00 g, 0.0651 mol) under an atmosphere of nitrogen. The reaction was stirred at room temperature overnight. The reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 20% ethyl acetate in hexane to give the compound as white solid (26, 3.2O g, 25%).

Step 2 - Preparation of3-Benzyloxy-2,6-difluoro-benzaldehyde (27):

[0283] To l-Benzyloxy-2,4-difluoro-benzene (26, 3.00 g, 13.6 mmol) in tetrahydrofuran (48 mL) under an atmosphere of nitrogen and cooled with dry ice/acetone was added n-butyllithium (1.60 M in hexane, 8.94 mL). After 20 minutes, N,N-dimethylformamide (1.46 mL, 0.0189 mol) was added to the reaction. After another 20 minutes, the flask was stirred at room temperature for 30 minutes. The Atty Dkt No 039363-3303 reaction mixture was poured into water, acidified to pH = 1 , and extracted with ethyl acetate The organic layer was washed with brme, dried over sodium sulfate, concentrated and purified with silica gel column chromatography cluting with 30% ethyl acetate in hexane to give the compound as a yellow solid (27, 2 5g, 74%)

Step 3 - Preparation of(3-Benzyloxy-2,6-difluoro-phenyl)-(5-pyndin-3-yl-lH-pytrolo[2,3-b]pvndm- 3-vlj-methanol (28)

[0284] 1 o 5-pyπdm-3-yl-l H-pyrrolo[2,3-b]pyridine (20, 750 0 mg, 0 003842 mol, prepared as in Example 9) in methanol (20 0 mL) were added 3-benzyloxy-2,6-difluoro-benzaldehyde (27, 1 12 g, 4 5 mmol) and potassium hydroxide (1 50 g, 0 0267 mol) under an atmosphere of nitrogen The reaction was stirred at room temperature overnight and then poured into water, acidified with IN HCl to pH around 2 and extracted with ethyl acetate The organic layer was dπed over anhydrous sodium sulfate and filtered The filtrate was concentrated and purified by silica gel column chromatography eluting with 20% ethyl acetate in hexane to give the compound (28 700 mg, 35%)

5Ve/? 4 — Preparation of (3-Benzyloxy-2, 6-dιfluoro-phenyl)-( 5-pyrιdιn-3-yl-lH-pyrrolo[2 3-bJpyndιn- 3-yl)-methanone (P-1467)

[0285] To (3-Benzyloxy-2,6-difluoro-phenyl)-( 5-pyndin-3-yl-lH-pyrrolo[2,3-b]pyridm-3-yl)- methanol (28, 300 0 mg, 0 68 mmol) in tetrahydrofuran (10 0 mL) was added Dess-Martin peπodmane (344 mg, 0 81 mmol) The reaction was stirred at room temperature for 10 minutes The reaction mixture was concentrated with silica and purified with silica gel column chromatography elutmg with 10% methanol in dichloromethane to give the compound (P-1467, 240 mg, 80%) MS(ESI) [M+H⁺]⁺ = 442 2

[0286] (5-Bromo-lH-pyrrolo[2,3-b]pyridin-3-yl)-[2,6-difluoro-3-(2-methoxy-ethoxy)-phenyll- mcthanone P-1453

was prepared following the protocol of Scheme 8, substituting benzyl bromide w^rith l-Bromo-2- methoxy-ethane in Step 1 and 5-Pyπdin-3-yl-lH-pyrrolo[2,3-b]pyπdine 20 with 5-Bromo-lH- pyrrolo[2,3-b]pyridme 1 in Step 3 MS (ESI) [M + IT]⁺ = 410 1, 412 1

[0287] [2,6-Difluoro-3-(2-methoxy-ethoxy)-phenyl]-(5-methoxy-l H-pyrrolo[2,3-b]pyπdm-3-yl)- methanone P-1584 Atty Dkt No 039363-3303

was prepared following the protocol of Scheme 8, substituting benzyl bromide with l-Bromo-2- methoxy-ethane in Step 1 and 5-Pyridin-3-yl-lH-pyrrolo[2,3-b]pyndine 20 with 5-methoxy-lH- pyrrolo[2,3-b]pyndine (15, prepared as in Example 8) m Step 3 MS (ESl) [M + H⁺]^* - 363 2

[0288] (3-Benzylo\y-2,6-difluoro-phenyl)-(5-methoxy-lH-pyrrolo[2,3-b]pyπdin-3-yl)-mcthanone P-1597

was prepared following the protocol of Scheme 8, substituting 5-ρyπdin-3-yl-lH-pyrrolo[2,3- bjpyπdine 20 with 5-methoxy-lH-pyrrolo[2,3-b]pyridme (15, prepared as in Example 8) m Step 3 MS(ESI) [M + H⁺J⁺ = 395 2

[0289] (5-Bromo-lH-pyrrolo[2,3-b]pyπdin-3-yl)-(2,6-difluoro-3-methoxy-phenyl)-inethanone P-1386

was prepared following the protocol of Steps 2, 3 and 4 of Scheme 8, substituting 1 -benzyloxy-2,4- difluoro-benzene 26 with 2,4-difluoro-l -methoxy-benzene m Step 2 and 5-Pyπdin-3->l-lH- pyrrolo[2 3-b]pyndine 20 with 5-bromo-lH-pyrrolo[2,3-b]pyridine 1 m Step 3 MS (ESI) [M + H^f]⁺ = 367 0, 369 0

[0290] (3-Benzyloxy-2,6-difluoro-phenyl)-(lH-pyrrolo[2,3-b]pyπdin-3-yl)-methanone P-1802

was prepared following the protocol of Scheme 8, substituting 5-pyπdin-3-yl-l H-pyrrolo[2,3- b]pyπdme 20 with 7-azaindole 6 in Step 3 To a solution of (3-benzyloxy-2,6-difluoro-phenyl)-(lH- Atty. Dkt No : 039363-3303 pyrrolo[2,3-A]pyridin-3-yl)-rnethanone (P-1802, O 5 g, 1 37 mol) in methanol (70 mL) and tetrahydrofuran (30 mL) was added palladium on carbon (120 mg, 10% wt , 0.58 mol). The mixture was stirred under hydrogenation (60 psi) for six hours After removal of solvent, the residue was dried under vacuum, which provided (2,6-Difluoro-3-hydroxy-phenyl)-(lH-pyrrolo[2.3-b]pyπdine-3- yl)-methanone 89

as a white solid (363 mg, 96%). MS (ESI) [M+H⁺]⁺ = 275.36.

[0291] Additional compounds were prepared following steps 3 and 4 of Scheme 8, replacing 3- benzyloxy-2,6-difluoro-ben7aldehyde 27 with an appropriate aldehyde and/or pyridin-3-yl- I H- pyrrolo[2,3-bjpyπdine 20 with an appropriate azaindole in Step 3. The 5-chloro-7-azaindole was synthesized as described in Example 4. The 4-(4-Chloro-benzyloxy)-3-methoxy benzaldehyde and 2- fluoro~5-methoxy-4-[2-(2-methoxy-ethoxy)-ethoxy]-benzaldehyde used were synthesized as described in Example 15. The following compounds were made following this procedure.

(5-Chloro-lH-pyrτolo[2,3-b]pyπdin-3-yl)-{2-fluoro-5-methoxy-4-[2-(2-methoxy-ethoxy)- ethoxy]-phenyl}-methanone (P-2003),

(4-Benzyloxy-2,6-difluoro-phenyl)-(lH-pyrτolo[2,3-b]pyridin-3-yl)-methanone (P-2020), and

[4-(4-Chloro-benzyloxy)-3-methoxy-phenyl]-(lII-pyrrolo[2,3-b]pyridin-3-yl)-mcthanone

(P-1698).

The following table indicates the aldehyde (column 2) and the azaindole (column 3) used to afford the target compound (column 4). Column 1 provides the compound number and column 5 the observed mass

Atty. Dkt. No.: 039363-3303

Example 12: Synthesis of 3-(3-Ben2yloxy-2,6-difluoro-benzyl)-5-pyridin-3-yl-lH-pyrrolo[2,3- bjpyridine P-1455:

[0292] Compound P-1455 was synthesized in four steps from 2,4-difluorophenol 25 as shown in Scheme 8a.

Scheme 8a

[0293] Steps 1-3 are identical to Steps 1-3 of Scheme 8.

Step 4 - Preparation of3-(3-Benzy/oxy-2, 6-diβuoro-ben∑yl) -5-pyridin-3-yl-lH-pyrrolo[2,3- bjpyridine (P-1455):

[0294] To (3-benzyloxy-2,6-difluoro-phenyl)-( 5-pyridin-3-yl-lH-pyrrolo[2,3-b]pyridin-3-yl)- methanol (28, 580.0 mg, 1.3 mmol) in acetonitrile (29.0 mL) were added trifluoroacetic acid (1.9 mL, 0.025 mol) and triethylsilane (3.9 mL, 0.024 mol). The reaction was stirred at 80 ⁰C for 1 hour. The reaction was poured into water, basificd with 1 M potassium carbonate to pH = 4, and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 50% ethyl acetate in hexane to give as a yellow solid (P-1455, 530 mg). MS(ESI) [M+H^fj' = 428.3.

[0295] 5-Bromo-3-[2,6-difluoro-3-(2-methoxy-ethoxy)-benzyl]-lH-pyrrolo[2,3-b] pyridine P-1454 Λtty. Dkt. No.: 039363-3303

was prepared following the protocol of Scheme 8a by substituting benzyl bromide with l-bromo-2- methoxy-ethane in Step 1 and 5-pyridin-3-yl-l H-pyrrolo[2,3-b]pyridine 20 with 5-Bromo-lH- pyrrolo[2,3-b]pyridine 1 in Step 3. MS (ESI) [M + H⁺]⁴ = 410.1, 412.1.

Example 13: Synthesis of 3-[3-chIoro-4-(4-chIoro-benzyIoxy)-benzyI]-lH-pyrroIo[2,3-b]pyridine P-1449.

[0296] Compound P-1449 was synthesized in three steps from 3-chloro-4-hydroxy-bcnzaldehyde 29 as shown in Scheme 9.

Scheme 9

Step 1 Preparation o/3-chloro-4-(4-chloro-benzyloxy)-ben∑aldehyde (31): [0297] To acetonitrile (15.0 mL) were added 3-chloro-4-hydroxy-benzaldehyde (29, 0.6 g, 4 mmol), 4-chlorobenzyl bromide (22, 1.2 g, 6 mmol), and potassium carbonate (0.9 g, 7 mmol). The reaction was heated to 150 ⁰C for 10 minutes in a CEM Discover microwave instrument. The reaction was poured into water, extracted with ethyl acetate, and washed with brine. The organic layer was dried over anhydrous sodium sulfate, filtered and concentrated. The desired compound was isolated by silica gel column chromatography (ethyl acetate: hexanes) (31, 0.85 g, 76%).

Step 2 - Preparation of3-[3-chloro-4~(4-chloro-hcnzyloxy)-phenyl]-methoxy-methyl-lH-pyrrolo[2,3- b] pyridine (32):

[0298] lH-Pyrrolo[2,3-b]pyridine (6, 0.3 g, 2.8 mmol) was mixed with 3-chloro-4-(4-chloro- benzyloxy)-benzaldehyde (31, 0.8 g, 3 mmol), potassium hydroxide (0.9 g, 17 mmol) and methanol (90.0 mL). The reaction was heated to 50 ⁰C under an atmosphere of nitrogen for six days. After Atty. Dkt. No.; 039363-3303 neutralization with 6N hydrochloric acid the reaction was poured into water, extracted with ethyl acetate, and washed with brine. The organic layer was dried over anhydrous sodium sulfate, filtered and concentrated. The desired compound was isolated by silica gel column chromatography (ethyl acetate: hexanes) to give a yellow solid (32, 0.6 g, 41 %). MS(ESI) [M + H⁺]"= 413.2, 415.2 [M- YfJ = 411.1, 413.1.

Step 3 - Preparation υf 3-[3-chloro-4-(4-ch!oro-benzyloxy)-benzyl]-lH-pyrrolo[2,3-h] pyridine (P-1449):

[0299] 3-[3-Chloro-4-(4-chloro-benzyloxy)-phenyl]-methoxy-methyl-lH-pyrrolo[2,3-b]p>τidine (32, 0.2 g, 0.6 mmol) was mixed with trifluoroacetic acid (0.226 mL, 3 mmol), triethylsilane (0.4 ml., 3 mmol) and acetonitrile (5 mL). The reaction was heated at 50 ⁰C and stirred for two days. The reaction was concentrated. The residue was diluted with ethyl acetate and neutralized with 2M aqueous sodium hydroxide. The reaction was poured into water, extracted with ethyl acetate, and washed with brine. The organic layer was dried over anhydrous sodium sulfate, filtered and concentrated. The desired compound was isolated by silica gel column chromatography (ethyl acetate: hcxancs) to give a yellow solid (P-1449, 0.0744 g, 33%). MS(ESI) [M + H"]⁺= 383.2, 385.2.

[0300] Additional compounds were prepared following the protocol of Scheme 9, replacing 3-chloro-4-hydroxy-benzaldehyde 29 with an appropriate aldehyde and optionally replacing 4-chlorobenzyl bromide 22 with an appropriate benzyl halide in Step 1 , and optionally replacing 1 H- pyrrolo[2,3-b]pyridine 6 with an appropriate azaindole (7-azaindole (5-chloro-7-azaindole per Example 4 or 5-methoxy-7-azaindole per Example 8) in Step 2. The following compounds were made following this procedure:

3-[4-(4-chloro-benzyloxy)-2-methoxy-benzyl]-lH-pyrrolo[2,3-b]pyridine (P-1450),

3-[4-(4-Chloro-benzyloxy)-benzyl]-lH-pyrrolo[2,3-b]pyridine (P-1462), 3-[4-(4-Chloro-benzyloxy)-3-fluoro-5-methoxy-benzyl]-lH-pyrrolo[2,3-b]pyridine (P-1466), 3-[4-(4_Chloro-benzyloxy)-3-ethoxy-benzyl]-lH-pyrrolo[2,3-b]pyridine (P-1470), 3-[2-Chloro-4-(4-chloro-benzyloxy)-benzyl]-lH-pyrrolo[2,3-b]pyridme (P-1471), 3.[4-(4-Chloro-bcnzyloxy)-3-trifluoromethoxy-benzyl]-lH-pyrrolo[2,3-b]pyridine (P-1487), 3-[4-(4-Chloro-benzyloxy)-3-methoxy-benzyl]-5-methoxy-lH-pyrrolo[2,3-b]pyridine (P-1531), 5-Chloro-3-[4-(4-chloro-benzyloxy)-3-methoxy-benzyl]-lH-pyrrolo[2,3-b]pyridine (P-1532), 3-[4-(4-Chloro-2-fluoro-benzyloxy)-3-methoxy-benzyl]-lH-pyrrolo[2,3-b]pyridine (P-1544), 3-[4-(2,4-Dichloro-bcnzyloxy)-3-methoxy-benzyl]-lH-pyrrolo[2,3-b]pyridine (P-1568), 3-[3-Methoxy-4-(4-methoxy-benzyloxy)-benzyl]-lH-pyrrolo[2,3-b]pyridine (P-1569), 3-[3-Methoxy-4-(2,4,6-trifluoro-benzyloxy)-benzyl]-lH-pyrrolo[2,3-b]pyridinc (P-1578), 3-[4-(2,6-Dichloro-benzyloxy)-3-methoxy-benzyl]-lH-pyrrolo[2,3-b]pyridine (P-1579), and 3-[3- Chloro-4-(4-chloro-benzyloxy)-5-methoxy-benzyl] - 1 H-pyrrolo [2 ,3 -b]pyridine (P-1616) Atty. Dkt. No.: 039363-3303

The following table indicates the aldehyde (Column 2), the benzyl halide (Column 3), and the azaindole (Column 4) used to afford the target compound (Column 5), Column 1 indicates the compound number and column 6 the observed mass.

Atty. Dkt. No.: 039363-3303

Example 14: Synthesis of 3-(4-benzyloxy-3-methoxy-benzyl)-lH-pyrrolo[2,3-b]pyridine P-1613.

[0301] Compound P-1613 was synthesized in two steps from 4-benzyloxy-3-methoxy- benzaldehyde 33 as shown in Scheme 10.

Scheme 10 Atty. Dkt. No.: 039363-3303

Step 1 - Preparation of3-[(4-benzyloxy-3-methoxy-phenyl)-methoxy-methyl]-lH-pyrrolo[2,3- b] pyridine (34):

[0302] Methanol (125 mL) and potassium hydroxide (4.4 g, 79 mmol) were mixed with IH- pyrτolo[2,3-b]pyridine (6, 3.1 g, 26.6 mmol) and 4-benzyloxy-3-methoxy-benzaldehyde (33, 12.9 g, 53.2 mmol). The reaction was stirred at room temperature for 2 days. The resulting white solid was filtered and washed with water. Crude material was carried forward without further purification.

Step 2 - Preparation of 3-(4-ben∑yloxy-3-methoxy-benzyl)-lH-pyrrolo[2,3-b] pyridine (P-1613): [0303] The crude 3-[(4-benzyloxy-3-methoxy-phenyl)-methoxy-methyl]-lH-pyrrolo[2,3-b]pyτidine (34, 0.9g, 2.4 mmol) from step 1 and acetonitrile (50 mL) were mixed with trifluoroacetic acid (0.360 mL, 4.7 mmol) and triethylsilanc (0.746 mL, 4.7 mmol). The reaction was heated at 80 ⁰C and stirred overnight. The reaction was concentrated. The mixture was extracted with ethyl acetate and saturated sodium bicarbonate. The organic layer was dried over anhydrous sodium sulfate, filtered and concentrated. The desired compound was isolated by silica gel column chromatography to give the compound (P-1613, 0.454 g 54.8%). MS(ESI) [M + H⁺]⁺= 345.3.

Example 15: Synthesis of aldehyde reagents for coupling to 7-azaindoles

[0304] Aldehyde compounds for coupling to the 3 -position of a 7-azaindole are shown in the following Schemes. 3-Methoxy-4-[4-(4-methyl-piperazin-l -ylmethyl)-benzyloxy]-benzaldehyde 37 was prepared in one Step as shown in Scheme 11.

Scheme 11

Step 1- Synthesis of3-methoxy-4-[4~(4-methyl-piperazin-l-ylmethyI)-hen∑yloxy]~benzaldehyde (37): Atty. Dkt. No.: 039363-3303

[0305] To 4-hydroxy-3-methoxybenzaldehyde (21, 2.1 g, 0.014 mol) in N,N-dimethylformamide (40.0 ml.) were added 1 ,4-bis(bromomethyl)-benzene (35, 4.00 g, 0.0152 mυl) and potassium carbonate (5.0 g, 0.036 mol) under an atmosphere of nitrogen. After 12 hours 1 -methyl-piperaκine (36, 3.8 mL, 0.034 mol) was added to the reaction. After 2 hours, the reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 20% methanol in dichloromethane to give the compound (37, 1.2 g, 25.0%). MS(ESI) [M+H^r]' = 355.3.

[0306] 2-Fluoro-4-hydroxy-5-methoxy-benzaldehyde 39 was synthesized in one step from 2-fluoro- 4,5-dimethoxy-benzaldehyde 38 as shown in Scheme 12.

Scheme 12

Step 1 - Synthesis of2-fluoro-4-hydroxy-5-methoxy-benzaldehyde (39):

[0307] To 2-fluoro-4,5-dimethoxy-benzaldehyde (38, 1.00 g, 5.43 mol) in dichloromethane (50.0 mL) was added aluminum trichloride (4.34 g, 32.6 mmol) under an atmosphere of nitrogen. The reaction was stirred at room temperature overnight. The reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and washed with ethyl acetate and hexane to give a white solid (39, 0.7Og,

76.0%).

[0308] 2,5-Difluoro-4-hydroxy-benzaldchyde 43 was synthesized in three steps from 2,5- difluorophenol 40 as shown in Scheme 13.

Scheme 13

Step 1 - Synthesis of 4-bromo-2,5-difluoro-phenol (41):

[0309] To 2,5-difluorophenol (40, 5.50 g, 0.0423 mol) in chloroform (1 10.0 mL), bromine (2.18 mL, 0.0423 mol) was added slowly. After 3 hours, the reaction was poured into a solution of sodium thiosulfate and extracted with ethyl acetate. The organic layer was dried over sodium sulfate, Atty. Dkt. No.: 039363-3303 concentrated and purified with silica gel column chromatography eluting with 20% ethyl acetate in hexane to give a colorless oil (41, 6.20 g, 70.2%).

Step 2 - (4-Bromo-2,5-difluoro-phenoxy)-tert-hutyl-dimethyl-silane (42):

[0310] To 4-bromo-2,5-difluoro-phenol (41, 3.50 g, 0.0167 mol) in N.N-dimethylformamide (50.0 mL) were added tert-butyldimethylsilyl chloride (3.83 g, 0.0254 mol) and lH-imidazole (6.00 g, 0.0529 mol). The reaction was stirred at room temperature overnight, then poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 4% to 20% ethyl acetate in hexane to give the compound (42, 3.0 g, 55.4%).

Step 3 - 2,5-Difluoro-4-hydroxy-benzaldehyde (43):

[0311] To (4-bromo-2,5-difluoro-phenoxy)-tert-butyl-dimethyl-silane (42, 3.00 g, 9.28 mmol) in tetrahydrofuran (37.5 mL), under an atmosphere of nitrogen at -78 ⁰C, n-butyllithium (3.90 mL, 2.50 M in hexane) was added slowly. After 30 minutes, N,N-dimethylformamide (0.825 mL, 0.0106 mol) was added to the reaction. One hour later, the reaction was allowed to come to room temperature. The reaction was poured into water and 1 N HCl, then extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 10% to 100% ethyl acetate in hexane to give the compound as an off-white solid (43, 0.86 g, 59.0%).

[0312] 4-(4-Chloro-benzyloxy)-3-fluoro-benzaldehyde 46 was synthesized in one step from 3- fluoro-4-hydroxy-benzaldehyde 44 as shown in Scheme 14.

Scheme 14

Step 1 - Synthesis of4-(4-chloro-ben∑yhxy)-3-βuoro-ben∑aldehyde (46):

[0313] To 3-fluoro-4-hydroxy-benzaldehyde (44, 0.800 g, 5.71 mmol) in N.N-dimethylformamide (50.0 mL) was added sodium hydride (260.0 mg, 60% in mineral oil, 6.50 mmol). After 15 minutes, 4-chlorobenzyl bromide (22, 1.29 g, 6.28 mmol) was added to the reaction mixture. The reaction was stirred at 80 ⁰C for 5 hours. The reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 30% ethyl acetate in hexane to give the Atty. Dkt. No.: 039363-3303 compound (46, 1.3 g, 86,0%).

[0314] Additional aldehydes were prepared using the protocol of Scheme 14, replacing either 4- chlorobenzyl bromide 22 with a suitable alkylating agent, and/or 3-fluoro-4-hydroxy-benzaldehyde 44 with a suitable aldehyde. The following table indicates the alkylating agent (column 1) and the starting aldehyde (column 2) used to afford the aldehyde (column 3) synthesized following this protocol.

Atty. Dkt. No.: 039363-3303

Atty. Dkt. No.: 039363-3303

Example 16: Synthesis of [4-(4-chloro-benzyloxy)-3-fluoro-phenyl]-(lH-pyrrolo[2,3-b]pyridin-3- yl)-methanone P-1897 and related compounds

[0315] Compound P-1897 was synthesized in two steps from 4-(4-chloro-benzyloxy)-3-fluoro- benzaldehyde 46 as shown in Scheme 15.

Step 1 - Synthesis of [4-(4-chloro-benzyloxy)-3~fluoro-phenyl]-(lH-pyrrolo[2,3-b]pyridin~3-yl)- methanol (P-1895):

[0316] To lH-Pyrrolo[2,3-b]pyridine (6, 100.0 mg, 0.85 mmol) in methanol (50.0 mL) were added 4-(4-chloro-benzyloxy)-3-fluoro-benzaldehyde (46, 250.0 mg, 0.94 mmol, prepared as described in Example 15) and potassium hydroxide (LOOg, 17.82 mmol) under an atmosphere of nitrogen. The reaction was stirred at room temperature overnight. The reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 30% ethyl acetate in hexane to give the compound (P-1895, 55 mg, 17.0%). MS(ESI) [M+lT]^* = 383.3.

Step 2 - Synthesis of[4-(4-chloro-benzyloxy)-3-fluoro-phenyl]-(lH-pyrrolo[2,3-b]pyridin-3-yl)- methanone (P-1897):

[0317] To [4-(4-chloro-benzyloxy)-3-fluoro-phenyl]-(lH-pyrrolo[2,3-b]pyridin-3-yl)-methanol (P-1895, 17.7 mg, 0.046 mmol) in tetrahydrofuran (10.0 mL) was added Dess-Martin periodinane (23.5 mg, 0.056 mmol). The reaction was stirred at room temperature for 15 minutes. The reaction Atty. Dkt. No.: 039363-3303 was concentrated, then purified with silica gel column chromatography eluting with 50% ethyl acetate in hexane to give a white solid (P-1897, 6.4 mg, 36.3%). MS(ESI) [M+H⁺]⁺ = 381.3.

[0318] Additional compounds were prepared using the protocol of Scheme 15, replacing 4-4-(4- chloro-benzyloxy)-3-fluoro-bcnzaldehyde 46 with a suitable aldehyde (prepared as described in Examples 15 or 34), and optionally replacing lH-Pyrrolo[2,3-b]pyridine 6 with an appropriate substituted 7-azaindole (5-chloro-7-azaindole per Example 4, 5-methoxy-7-azaindole per Example 8, or 5-(l -methyl-lH-pyrazol-4-yl)-7-azaindole per Example 35) in Step 1. The following compounds were made following this procedure:

[4-(4-Chloro-benzyloxy)-2-fluoro-5-methoxy-phenyl]-(lH-pyrrolo[2,3-b]pyridin-3-yl)-methanone

(P-1845),

[4-(4-Chloro-3-trifluoromethyl-benzyloxy)-3-methoxy-phenyl]-(lH-pyrrolo[2,3-b]pyridin-3-yl)- methanone (P-1850),

[4-(lH-Benzoimidazol-2-ylmethoxy)-3-fluoro-phenyl]-(lH-pyrrolo[2,3-b]pyridin-3-yl)- methanone (P-1900),

(4-Benzyloxy-2,5-difluoro-phenyl)-(lII-pyrrolo[2,3-b]pyridin-3-yl)-methanone (P-1903),

[4-(lH-Benzoimidazol-2-ylmethoxy)-2-fluoro-5-methoxy-phenyl]-(5-methoxy-lH-pyrrolo[2,3- b]pyridm-3-yl)-methanone (P-1979),

[4-(lH-Benzoimidazol-2-ylmethoxy)-2-fluoro-5-niethoxy-phenyl]-(lH-pyrrolo[2,3-b]pyridin-3- yl)-methanone (P-1982),

[4-(lH-Benzoimidazol-2-ylmethoxy)-2,5-difluoro-phenyl]-(lH-pyrτolo[2,3-b]pyridin-3-yl)- methanone (P-1987),

{4-[2-(2-Bromo-ethoxy)-ethoxy]-2-fluoro-5-methoxy-phenyl}-(5-chloro-lH-pyrrolo[2,3- b]pyridin-3-yl)-methanone (P-1988)₍

(5-Chloro-lII-pyrrolo[2,3-b]pyridin-3-yl)-[2,5-difluoro-4-(2-methoxy-ethoxy)-phenyl]- mcthanone (P-1989),

(5-Chloro-lH-pyrrolo[2,3-b]pyridin-3-yl)-[2-fluoro-5-methoxy-4-(2-methoxy-ethoxy)-phenyl]- methanone (P-1991),

2-[2-Chloro-5-fluoro-4-(5-methoxy-lH-pyrrolo[2,3-b]pyridin-3-ylmethyl)-phenoxymethyl]-lH- bcnzoimidazole (P-2116),

2-{2-Chloro-5-fluoro-4-[5-(l -methyl-lH-pyrazol-4-yl)-lH-pyrrolo[2,3-b]pyridin-3-ylmethyl]- phenoxymethyl}-lH-benzoimidazolc (P-2117),

2-[2,5-Difluoro-4-(5-methanesuIfonyl-lH-pyrrolo[2,3-b]pyridin-3-ylmethyl)-phenoxymcthyl]- l H-benzoimidazole (P-2170),

3 -[4-( 1 H-Benzoimidazol-2-ylmethoxy)-2-fluoro-5 -mcthoxy-benzyl] - 1 H-pyrrolo[2,3 -b]pyridine-5 - carbonitrile (P-2171),

3-[4-(lH-Bcnzoimidazol-2-ylmethoxy)-2-fluoro-5-methoxy-benzyl]-l H-pyrrolo[2,3-b]pyridine-5- Atty. Dkt. No.: 039363-3303 carboxylic acid methyl ester (P-2174),

2-{2,5-Difluoro-4-[5-(2-methoxy-ethoxy)-l H-pyrrolo[2,3-b]pyridin-3-ylmethyl]- phenoxymethyl } -1 H-benzoimidazolc (P-2176),

2-[4-(5-Bromo-lH-pyrrolo[2,3-b]pyridin-3-ylmethyl)-5-fluoro-2-methoxy-phenoxymethyl]-lII- benzoimidazole (P-2181),

3-[4-(lH-Benzoimidazol-2-ylmethoxy)-2,5-difluoro-benzyl]-lH-pyrrolo[2,3-b]pyπdme-5- carbonitrile (P-2185), and

2-[5-Fluoro-4-(5-methanesulfonyl-lH-pyrrolo[2.3-b]pyπdm-3-ylmethyl)-2-methoxy- phenoxymethyl]-lH-benzoimidazole (P-2186)

The following table indicates the aldehyde (column 2) and the azamdole (column 3) used to afford the target compound (column 4). Column 1 indicates the compound number and column 5 the observed mass.

Atty. Dkt. No.: 039363-3303

Atty. Dkt. No.: 039363-3303

Example 17: Synthesis of 3-(4-Benzyloxy-2,5-difluoro-benzyI)-lH-pyrrolo[2,3-b]pyridine P-1901

[0319] Compound P-1901 was synthesized in four steps from 4-bromo-2,5-difluoro-phenol 41 as shown in Scheme 16.

Scheme 16

Atty. Dkt. No.: 039363-3303

Step 1 — Synthesis of J -Ben∑yluxy-4-bromo-2, 5-difluoro-benzene (47):

[03201 To 4-bromo-2,5-difluoro-phenol (41, 0.90 g, 0.0043 mol, prepared as described in Example 15, Scheme 13) in N,N-dimethylformamide (30.0 mL) were added sodium hydride (0.21 g, 60% in mineral oil, 0.0052 mol) and benzyl bromide (0.563 mL, 0.00474 mol). The reaction was stirred at room temperature overnight. The reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 5% ethyl acetate in hexane to give a white solid (47, 0.84 g, 65,0%).

Step 2 - (4-Benzy!oxy-2, 5-difluoro-phenyl)-(l-triisopropylsilanyl- lH-pyrrolo[2, 3-b]pyridin-3-yl)- methanol (48):

[0321] To 1 -Benzyloxy-4-bromo-2,5-difluoro-benzene (47, 0.84 g, 2.80 mmol) in tetrahydrofuran (15.0 mL) and ether (15.0 mL), under an atmosphere of nitrogen at -78 ⁰C, n-butyllithium (1.20 mL, 2.50 M in hexane) was added slowly. After 20 minutes, l-Triisopropylsilanyl-lH-pyrrolo[2,3- b]pyridine-3-carbaldehyde (8, 0.82 g, 0,0027 mol, prepared as described in Example 5) was added to the reaction. After 20 minutes, the reaction was allowed to warm to room temperature for 10 minutes, then poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified with silica gel column chromatography eluting with 20% ethyl acetate in hexane to a white solid (48, 1.Og, 70.0%). MS(ESI) [M+H⁺]⁺ = 523.4.

Step 3 - Synthesis υf(4-Benzyloxy-2,5-difluoro-phenyl)-(lH-pyrrolo[2,3-b]pyridin-3-yl)-methanol (P-1902):

[0322] To (4-Benzyloxy-2,5-difluoro-phenyl)-(l -triisopropylsilanyl-lH-pyrrolo[2,3-b]pyridin-3- yl)-methanol (48, 1.00 g, 1.91 mmol) in tetrahydrofuran (15.0 mL) was added tetrabutylammonium fluoride, trihydrate (0.63 g, 2.04 mmol). The reaction was stirred at room temperature for 10 minutes. The reaction was roto-cvaporated and purified with silica gel column chromatography eluting with 50% ethyl acetate in hexane to give the compound as a white solid (P-1902, 0.59 g, 84.0%). MS(ESl) [M+HT = 367.4.

Step 4 - Synthesis of3-(4-Benzyloxy-2,5-diflnoro-benzyl)-lH-pyrrolo[2,3-b]pyridine (P-1901): [0323] To (4-Bcnzyloxy-2,5-difluoro-phenyl)-(lH-pyrrolo[2,3-b]pyridin-3-yl)-methanol (P-1902, 500.0 mg, 1.37 mmol) in acetonitrile (25.0 mL) were added triethylsilane (2.00 mL, 0.0125 mol) and trifluoroacetic acid (1.00 mL, 0.0130 mol). The reaction was heated to reflux for 2 hours. The reaction was concentrated and purified with silica gel column chromatography eluting with 50% ethyl acetate in hexane to give a white solid (P-1901, 60.0 mg, 94.1%). MS(ESI) [M+HT = 351.4.

[0324] 3 -[3 -Trifluoromethyl-4-(4-trifluoromethyl-benzyl oxy)-benzy I]- 1 H-pyrroIo [2,3 -b]pyridine Atty. Dkt. No.: 039363-3303

P-1797

was prepared using the protocol of Scheme 16, substituting 4-bromo-2,5-difluoro-phenol 41 with 4-bromo-2-trifjuoromethyl-phenol (prepared as described in Example 15, Scheme 13, Step 1. substituting 2,5-difluoro-phenol 40 with 2-trifluoromethyl-phenol) and benzyl bromide with 1- bromomethyl-4-trifluoromethyl-benzene in Step 1. MS(ESI) [M+H⁺]⁺ = 451.

Example 18: Synthesis of 3-[4-(4-chloro-benzyloxy)-2,5-difluoro-benzyl]-lH-pyrrolo[2,3- b]pyridine P-1974

[0325] Compound P-1974 was synthesized in four steps from 3-(4-benzyloxy-2,5-difluoro-bcnzyl)- lH-pyrrolo[2,3-b]pyridine P-1901 as shown in Scheme 17.

Scheme 17

Step 1 - Synthesis of3-(4-benzyloxy-2,5-difluoro-benzyl)-l-triisopropylsilanyl-lH-pyrrπla[2,3- b] pyridine (49):

[0326] To 3-(4-benzyloxy-2,5-difluoro-benzyl)-lH-pyrrolo[2,3-b]pyridine (P-1901, 560.0 mg, 1.60 mmol, prepared as described in Example 17) in tetrahydrofuran (28.0 mL) was added sodium hydride (100.0 mg, 60% in mineral oil, 2.50 mmol). After 10 minutes, triisopropylsilyl chloride (0.500 mL, 2.36 mmol) was added to the reaction. After 4 hours, the reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 30% ethyl acetate in hcxane to give the compound (49, 0.70 g, 86.1%).

Step 2 - Synthesis of2,5-difluoro-4-(l-trii$opropylsilanyl-lH-pyrrolo[2,3~b]pyridin-3-ylmethyl)- phenol (50): Atty Dkt No 039363-3303

[0327] To 3-(4-Benzyloxy-2,5-difluoro-benzyl)-l-tπisopropylsilanyl-lH-pyrrolo[2,3-b]pyridme (49, 0 70 g, 0 0014 inol) in methanol (30 0 ml ) was added 50% palladium hydroxide on carbon (0 1 g) under an atmosphere of hydrogen I he reaction was stirred at room temperature overnight The reaction was filtered and concentrated to give a colorless oil (50, 0 47 g, 82 0%)

Step 3 - 3-[4-(4-Chloro-benzyIoxv)-2,5-ώfluoro-benzylJ-l-trusυprυpylsιlanyI-lH-pyrrolo[2,3- bjpyndute (51)

[0328] To 2,5-difluoro-4-(l-tπisopropylsilanyl-lH-pyrrolo[2,3-b]pyπdin-3 ylmethyl)-phenol (50, 120 0 mg, 0 29 mmol) in N,N-dimethylformamide (15 0 mL) was added sodium hydride (18 0 mg, 60% in mineral oil, 0 45 mol) under an atmosphere of nitrogen After 10 minutes, 4-chlorobenzyl bromide (22, 65 1 mg, 0 32 mol) was added to the reaction I he reaction was stirred at 40 ⁰C overnight The reaction was poured into water and extracted with ethyl acetate The organic layer was dried over anhydrous sodium sulfate, and filtered The filtrate was concentrated to give the crude compound (51, 0 15 g) that was used directly in the next step

Step 4 - Synthesis of 3-[4-(4-chloi o-benzvloxy)-2,5-dιfluoi o-benzvl]-lH-pvrrolo[2,3 bjpvriώne

(P-1974)

[0329] To 3-[4-(4-chloro-benzyloxy)-2,5-difluoro-benzyl]-l -tπisopropylsilanyl-1 H-pynolo[2,3- bjpyridme (51, 0 150 g, 0 28 mmol) in tetrahydrofuran (10 0 mL) was added tctra-n-butylammonium fluoride (80 0 mg, 0 31 mmol) After 10 minutes, the reaction was concentrated and puπfied by silica gel column chromatography eluting with 50% ethyl acetate in hexane to give the compound as a white solid (P-1974, 30 8 mg, 28 9%) MS(ESI) [M+lT]⁺= 385 3

[0330] 2-[2_]5-Difluoro-4-(lH-pyrrolo[2,3-b]pyridin-3-ylmcthyl)-phenoxymethyl] IH- benzoimidazole P-1975

was prepared using the protocol of Scheme 17, substituting 4-chlorobenzyl bromide 22 with 2- chloromethyl-lH-ben/Coimidarole m step 3 MS(ESI) [M+H¹] = 391 3

Example 19: Synthesis of 3-(3-Benzyloxy-2-chloro-6-fluoro-benzyl)-lH-pyrrolo[2,3-ft]pyridine P-1852, (3-Benzyloxy-2-chloro-6-fluoro-phenyI)-(lH-pyrrolo[2,3-6]pyridin-3-jl)-methanone P- 1853 and related compounds

[0331] Compounds P-1852 and P-1853 were synthesized in four steps from 2-chloro 4- fluorophenol 52 and lH-pyrrolo[2,3 έjpyridine 6 as shown in Scheme 18 Atty Dkt No 039363-3303

Scheme 18

Step 1 - Preparation of l-Benzyloxy-2-chloro-4-fluoro-benzene (S3)

[0332] To a solution of 2-chloro-4-fluorophenol (52, 7 g, 0 05 mol) in tetrahydroftiran (100 mL) was added sodium hydπde (1 8 g, 95% dry powder, 0 071 mol) at room temperature o\er 15 minutes under an atmosphere of nitrogen The reaction mixture was stirred at room temperature for 30 minutes Benzyl bromide (10 g, 0 060 mol) was added slowly to the reaction mixture, then stirred at room temperature overnight The reaction mixture was poured into ice water, extracted with ethyl acetate, washed with hydrochloπc acid (10%), water, brine, and dπed over magnesium sulfate After removal of solvent, the residue was purified by silica gel column chromatography eluting with ethyl acetate in hexane to provide compound as a white solid (53, 7 6 g, 60%)

Step 2 - Preparation of 3-Benzyloxy-2-chloro-6-flιιoro benzaldehvde (54) [0333J To a solution of l-benzyloxy-2-chloro-4-fluoro-benzene (53, 5 8 g, 0 024 mol) in tetrahydroftiran (100 mL) was added 2 50 M of n-butylhthium (2 7 mL, 2 50 M in hexane, 0 029 mol) slowly at -78 ⁰C over 15 minutes under nitrogen The reaction mixture was stirred at -78 ⁰C for 30 minutes To the reaction mixture was then added N,N-dimethylformamide (4 2 mL, 0 054 mol) The reaction was allowed to warm to room temperature and was continued at room temperature overnight l he reaction mixture was poured into ice water, extracted with ethyl acetate, washed with hydrochloric acid (10%), water, brine, and dried over magnesium sulfate After removal of solvent, the residue was purified by silica gel column chromatography eluting with ethyl acetate in hexane to provide the compound as a white solid (54, 2 1 g, 32%) MS(ESI) [M+H⁺]⁺ = 265 08

Step 3 Preparation of3-[(3-Benzyloxy-2-thloro~6-fluoro-phenyl)-methoxy~methyl] IH pyrrolo[2,3- Atty. Dkt. No.: 039363-3303 b J pyridine (P-1867) and (3-Bt^jnzy1oxy-2-chloro-6-fluoro-phenyl)-(lH-pyrrolo[2,3-b]pyridin-3-yl) - methanol (P-1868):

[0334] A mixture of lH-pyrrolo[2,3-£>]pyridine (6, 0,5 g, 4 mmol), 3-benzyloxy-2-chloro-6-fluoro- benzaldehyde (54, 1.3 g, 4,9 mmol), and potassium hydroxide (0.99 g, 18 mmol) in methanol (30 mL) was stirred at room temperature overnight. The reaction mixture was concentrated and the residue was dissolved in ethyl acetate and water. The organic layer was collected and washed with brine. After removal of solvent, the residue was purified by silica gel column chromatography eluting with ethyl acetate in hexane to provide compound P-1867 as a white solid (1.3 g, 70%. MS(ESI) [M+JT]⁺ = 397.16), and compound P-1868 as an off-white solid (0.2 g, 10, MS(ESI) [M+ff ] ^" = 383.14).

Step 4a - Preparation of3-(3-benzyloxy-2-chloro-6-fluoro-benzyl)-lH-pyrrυlo[2,3-b]pyridine (P-1852):

[0335] A mixture of 3-[(3-benzyloxy-2-chloro-6-fluoro-phenyl)-methoxy-methyl]-lH-pyrrolo[2,3- ftjpyridine (P-1867, 0.1 g, 0.2 mmol), trifluoroacetic acid (0.6 mL, 8 mmol), and triethylsilane (0.3 mL, 2 mmol) in acetonitrile (10 mL) was refluxed for 2 hours. The mixture was concentrated and the residue was dissolved in ethyl acetate. The solution was washed with saturated sodium bicarbonate, brine, and dried over sodium sulfate. After removal of solvent, the residue was purified by silica gel column chromatography eluting with methanol in dichloromethane to provide compound as an off- white solid (P-1852, 62 mg, 70%). MS(ESI) [M+H⁺]⁺ = 367.16.

Step 4b Preparation of(3-benzyloxy-2-ch1oro-6-flιωro-phenyl)-(lH-pyrrolo[2,3-b]pyridin-3-yl) - methanone (P-18S3):

[0336] To a solution of (3-benzyloxy-2-chloro-6-fluoro-phenyl)-(lH-pyrrolo[2,3-b]pyridin-3-yl)- methanol (P-1868, 65 mg, 0.17 mmol) in tetrahydrofuran (10 mL) was added Dess-Martin periodinane (79 mg, 0.19 mmol) at 0 °C. The reaction mixture was stirred at room temperature for 2 hours. The reaction was quenched with a saturated solution of sodium thiosulfate, extracted with ethyl acetate, washed with sodium bicarbonate, brine, and dried over magnesium sulfate. After removal of solvent, the residue was purified by silica gel column chromatography eluting with methanol in dichloromethane to provide the compound as a light yellow solid (P-1853, 32 mg, 50%). MS(ESI) [M+HT = 381.13.

[0337] Additional compounds were prepared following the protocol of Scheme 18, optionally replacing 2-chloro-4-fluorophenol 52 with 2,6-difluorophenol or 2,6-dichlorophenol, optionally replacing benzyl bromide with an appropriate substituted benzyl bromide, and optionally replacing lH-pyrrolo[2,3-£]pyridine 6 with an appropriate substituted lH-pyrτolo[2,3-/)]pyridine (5-chloro-7- azaindole per Example 4 or 5-methoxy-7-azaindole per Example 8). The following compounds were made following this procedure:

3-[2,6-Dichloro-3-(4-chloro-benzyloxy)-benzyl]-lH-pyrrolo[2,3-/?]pyridine (P-1768), Atty. Dkt. No.: 039363-3303

[2,6-Dichloro-3-(4-chloro-benz>'loxy)-phenyl]-(lH-pyiτolo[2,3- δ]pyridin-3-yl) methanone (P-1769),

(3-Benzyloxy-2,6-difluoro-phenyl)-(lH-pyrrolo[2₎3- fc]pyridin-3-yl)-methaiione (P-1802), 3-(3-Benzyloxy-2,6-difluoro-benzyl)-lH-pyrrolo[2,3- Z)]pyridine (P-1803), 3-(3-Benzyloxy-2,6-difluoro-benzyl)-5-methoxy-lH-pyrrolo[2,3- £]pyridine (P-1804), 3-(3-BenzyIoxy-2,6-difluoro-benzyl)-5-chloro-lH-pyrrolo[2,3- 6]pyridine (P-1824), (3-BenzyIoxy-2,6-difluoro-phenyl)-(5-chloro-lH-pyrrolo[2,3- fr]pyridin-3-yl)-methanone (P-1825),

[2-ChIoro-3-(3-chloro-benzyIoxy)-6-fluoro-phenyl]-(lH-pyrrolo[2,3- 5]pyridin-3-yl)-methanone (P-1869),

[2-Chloro-3-(4-ch]oro-benzyloxy)-6-fluoro-phenyl]-(lH-pyrro]o[2,3- />]pyridin-3-yl)-methanone (P-1874),

3-[2,6-Difluoro-3-(pyridin-4-ylmethoxy)-benzyl]-lH-pyrrolo[2,3-b]pyridine (P-1993), and 3-[3-(4-Chloro-2-fluoro-benzyloxy)-2,6-difluoro-benzyI]-lH-pyτrolo[2,3-b]pyridine (P-1992). The phenol, benzyl bromide and azaindole used in Steps 1, 2, and 3, respectively, are indicated in columns 2, 3, and 4 of the following table, respectively, to afford the target compound (column 5). The compound number is provided in column 1, and the observed mass is given in column 6.

Atty. Dkt. No.: 039363-3303

Example 20: Synthesis of (3-Benzyloxy-2-methyI-phenyI)-(lH-pyrrolo[2,3-6]pyridin-3-yl)- methanone P-1848 and 3-(3-BenzyIoxy-2-methyI-benzyl)-lH-pyrroIo[2,3-6]pyridine P-1857

[0338] Compounds P-1848 and P-1857 were synthesized in five steps from compounds 55 and IH- pyrrolo[2,3-&]pyridine 6 as shown in Scheme 19, Atty Dkt No 039363-3303

Scheme 19

Step 1 - Preparation of 3-Benzyloxy-2-methyl-benzoιc acid (56)

[0339] To a solution of 3-hydroxy-2-methyl-benzoic acid (55, 5 0 g, 0 033 mol) in tetrahydrofuran (100 mL) and N,N-dimethylformamide (50 niL), sodium hydride (4 4 g as 60% dispersion in mineral oil, 0 11 mol) was added slowly over 30 minutes and the reaction was stirred at 0 ⁰C under an atmosphere of nitrogen The reaction mixture was allowed to warm to room temperature, then stirred at room temperature for 1 hour Benzyl bromide (9 0 mL, 0 076 mol) was added slowly into the reaction mixture, and the reaction mixture was stirred at room temperature overnight I he reaction mixture was poured into water, extracted with ethyl acetate, washed with a solution of ammonium chloride and ammonium hydroxide (4 1), bπne, and dried over magnesium sulfate After removal of solvent, (he residue was purified by silica gel column chromatography eluting with ethyl acetate in hexane to provide the compound as a white solid (56, 5 8 g, 73%)

Step 2 Preparation of(3-Benzyloxy-2-methyl-ρhenyl)-methanol (57) [0340] To a solution of 3-benzγloxy-2-methyl-benzoic acid (56, 3 0 g, 0 012 mol) in tetrahydrofuran (100 mL), lithium aluminum hydride (25 mL, IM solution m tetrahydrofuran, 0 025 mol) was added dropwise at 0 ⁰C for 5 minutes The reaction mixture was then stirred at room temperature overnight under an atmosphere of nitrogen After sodium sulfate decahydrate (20 0 g, 0 062 mol) was added, the reaction mixture was stirred at room temperature for 10 minutes A white solid was collected by filtration I he solid compound was further washed with a mixture of hexane and dichloromethane (9 1) and dried under high-vacuum (57, 2 8 g, 91%) Atty. Dkt. No.: 039363-3303

Step 3 Preparation of3-Benzyloxy-2-methyl-benzaldehyde (58):

[0341] To a solution of (3-benzyloxy-2-mεthyl-phenyl)-methanol (57, 627 mg, 2,75 mmol) in tetrahydrofuran (60 mL) was added Dcss-Martin penodinane (2,9 g, 6,87 mmol) at 0 °C. The resulting mixture was stirred at 0 ⁰C for 50 minutes. The reaction mixture was quenched with a solution of saturated sodium thiosulfate, extracted with ethyl acetate, washed with sodium bicarbonate, brine, and dried over magnesium sulfate. After removal of solvent, the residue was purified by silica gel column chromatography eluting with ethyl acetate in hexane to provide the compound as a white solid (58, 0.55 g, 84%).

Step 4 - Preparation of(3-Benzyloxy-2-methyl-phenyl)-(lH-pyrrolo[2,3-b]pyridin-3-yl)-methanol (59) and 3-[(3-Benzyloxy-2-methyl-phenyl)-methoxy-methyl]-lI1-pyrrolo[2, 3-bJpyridine (60): [0342] A mixture of lH-pyrrolo[2,3-έ]pyridine (6, 0.33 g, 2.8 mmol), 3-benzyloxy-2-methyl- benzaldehyde (58, 0.55 g, 2.4 mmol), and potassium hydroxide (0.39 g, 6.1 mmol) in methanol (40 mL) was stirred at room temperature for 17 hours. The reaction mixture was poured into water and then extracted with ethyl acetate. The organic layer was collected, washed with brine, and dried over sodium sulfate. After removal of solvent, the residue was purified by silica gel column chromatography eluting with ethyl acetate in hexane to provide compound 59 as an off-white solid (330 mg, 39%, MS(ESI) [M+H⁺f - 345.29, and compound 60 as a white solid (24 mg, 3%, MS(ESI) [M+H⁺]⁺ - 359.30).

Step 5 a - Preparation of (3-Benzyloxy-2~methyl-phenyl)-(lH-pyrrolo[2,3-b]pyridin-3-yl)-methanone (P-1848):

[0343] To a solution of (3-Benzyloxy-2-methyl-phenyl)-(lH-pyrrolo[2,3-έι]pyridin-3-yl)-methanol (59, 0.12g, 0.35 mmol) in tetrahydrofuran (15 mL) was added Dess-Martin periodinane (0.37 g, 0.89 mmol) at 0 ⁰C . The reaction mixture was stirred at 0 ⁰C for 50 minutes, then quenched with a saturated solution of sodium thiosulfate, extracted with ethyl acetate, washed with sodium bicarbonate, brine, and dried over magnesium sulfate. After removal of solvent, the residue was washed with a mixture of ethyl ether and hexanes (1 :1) to provide the compound as a yellow solid (P-1848, 108 mg, 90%). MS(ESI) [M+ϊTf = 343.22.

Step 5b Preparation of 3-(3-Benzyloxy-2-methyl-benzyl)-]II-pyrrolo[2,3-b]pyridine (P-1857): [0344] A mixture of 3-[(3-benzyloxy-2-methyl-phenyl)-methoxy-methyl]-lH-pyrrolo[2,3- bjpyridine (60, 24 mg, 0.067 mmol), trifluoroacetic acid (1 mL, 13 mmol), and triethylsilane (2 mL, 12.5 mmol) in acetonitrile (10 mL) was refluxed for 4 hours. The mixture was concentrated and the residue was dissolved in ethyl acetate. The solution was washed with saturated sodium bicarbonate, brine, and dried over sodium sulfate. After removal of solvent, the residue was washed with a mixture of ethyl ether and hexanes (1 : 1 ) to provide the compound as a yellow solid (P-1857, 17 mg, 75%), MS(ESI) [M+H⁺]⁺ = 329.24. Atty. Dkt. No.: 039363-3303

Example 21: Synthesis of [3-(4-chloro-benzyloxy)~2-ethoxy-phenyI]-(lH-pyrroloI2,3-£]pyridin- 3-yI)-methanone P-1892 and 3-I3-(4-chloro-benzyloxy)-2-ethoxy-benzyl]-lH-pyrroIo[2,3- 6]pyridine P-1893

[0345] Compounds P-1892 and P-1893 were synthesized in five steps from compounds 61, 22 and lH-pyrrolo[2,3-&]pyridine 6 as shown in Scheme 20,

Scheme 20

Step 1 - Preparation of2,3-Bis-(4-chloro-benzyloxy)-benzaldehyde (62):

[0346] To a solution of 2,3-dihydroxybenzaldehyde (61, 2.0 g, 14.5 mmol) in tetrahydrofiiran (100 mL) was added sodium hydride (0.52 g, 13.0 mmol) at 0 ⁰C under an atmosphere of nitrogen. The reaction mixture was allowed to warm to room temperature and was stirred at room temperature for 30 minutes. To the reaction mixture was then added 4-chlorobenzyl bromide (22, 2.7 g, 13.0 mmol). The reaction mixture was stirred at room temperature under an atmosphere of nitrogen overnight. N, N-dimethylformamide (50 mL) was added into the reaction mixture and it was stirred at room temperature for 24 hours. The reaction mixture was poured into ice water and extracted with ethyl acetate. The organic layer was collected, washed with brine, and dried over magnesium sulfate. After removal of solvent, the residue was purified by silica gel column chromatography eluting with ethyl acetate in hexane to provide the compound as an off-white solid (62, 2.3 gm, 46%).

Step 2 - Preparation of3-(4-chloro-henzyloxy)-2-hydrυxy-benzaldehyde (63): [0347] To magnesium (0.098 g, turnings, 4.0 mmol) in a mixture of anhydrous ether (20 mL) and benzene (20 mL) at 0 ⁰C, bromine (0,10 mL, 2.0 mmol) was added dropwise. When the reaction had started, stirring was commenced and the addition of bromine continued until complete. The ice bath Atty. Dkt. No. : 039363-3303 was removed and the reaction mixture was heated until the solution was almost colorless. After cooling down, the reaction mixture was slowly added to a solution of 2, 3-bis-(4-chloro-benzyloxy)- benzaldchyde (62, 0.78 g, 2.0 mmol) in benzene (60 mL) at room temperature while stirring vigorously. Upon completion of the addition, the reaction mixture was stirred at room temperature overnight, then refluxed for 36 hours. After the reaction mixture was cooled down to room temperature, a solid was collected by filtration and washed with benzene, then boiled in hydrochloric acid (100 mL, 1.0 M) for 30 minutes. After cool down, the solution was extracted with dichloromcthane. The organic layer was washed with brine and dried over magnesium sulfate. An off-white solid was obtained after removal of the solvent (63, 0.32 mg, 60%). MS(ESI) [M-H⁺]^" =261.25.

Step 3 — Preparation of3-(4-chloro-ben∑yloxy)-2-ethoxy-benzaldehyde (64):

[0348] To a mixture of 3-(4-chloro-benzyloxy)-2-hydroxy-benzaldehyde (63, 110 mg, 0.42 mmol), potassium carbonate (150 mg, 1.1 mmol) in acetonitrilc (8 mL) was added iodoethane (0.2 mL, 2.5 mmol) at room temperature. The mixture was stirred at 98 ⁰C for 18 hours. The reaction mixture was poured into a solution of saturated ammonium chloride and was extracted with ethyl acetate. The organic layer was collected, washed with brine, and dried over magnesium sulfate. After removal of solvent, a light yellow solid was obtained (64, 116 mg, 95%).

Step 4 — Preparation of [3-(4-chloro-benzyloxy)-2-ethoxy-phenyl]-(lH-pyrrυ1o[2,3-h]pyridin-3-yl)- methanol (65) and 3-{[3-(4-chloro-benzyloxy)-2-ethoxy-phenyl]-methoxy-methyl}-lH-pyrrolo[2,3- bjpyridine (66):

[0349] A mixture of lH-Pyrrolo[2,3-6]pyridine (6, 26 mg, 0.22 mmol), 3-(4-chloro-benzyloxy)-2- ethoxy-benzaldehyde (64, 54 mg, 0.19 mmol), and potassium hydroxide (30 mg, 0.4.6 mmol) in methanol (5 mL) was stirred at room temperature for 4 days. The reaction mixture was poured into water and extracted with ethyl acetate. The organic layer was collected, washed with brine, and dried over sodium sulfate. After removal of solvent, the residue was purified by silica gel column chromatography eluting with ethyl acetate in hexane to provide compound 65 as an off-white solid (20 mg, 26%, MS(ESI) [M+H⁺]⁺ = 409.32) and compound 66 as an off-white solid (44 mg, 56%, MS(ESI) [M+H⁺]⁺ = 423.33.

Step 5a - Preparation of[3-(4-chloro-benzyloxy)-2-ethoxy-phenyl]-(lH-pyrrolo[2,3-b]pyridin-3-yl)- methanone (P-J 892):

[0350] To a solution of [3-(4-chloro-benzyloxy)-2-ethoxy-phenyl]-(lH-pyrrolo[2,3-b]pyridin-3-yl)- methanol (65, 20 mg, 0.05 mmol) in tetrahydrofuran (8 mL) was added Dess-Martin periodinane (52 mg, 0.12 mmol) at 0 ⁰C. The reaction mixture was stirred at 0 ⁰C for 50 minutes. The reaction was quenched with a saturated solution of sodium thiosulfate, extracted with ethyl acetate, washed with sodium bicarbonate, brine, and dried over magnesium sulfate. After removal of solvent, the residue Atty. Dkt. No.: 039363-3303 was washed with a mixture of ethyl ether and hexanes (1 : 1) to provide the compound as a yellow solid (P-1892, 15 mg, 75%). MS(ESI) [M+ITf = 407.38.

Step 5b - Preparation of3-[3-(4-chlυrυ-bemylυxy)-2-ethυxy-benzyl]-lH-pyrrυh[2,3-b]ρyridine (P-1893):

[0351] Λ mixture of 3-{[3-(4-chloro-benzyloxy)-2-ethoxy-phenyl]-methoxy-methyl} -lH- pyrrolo[2,3-&]pyridine (66. 44 mg, 0.1 mmol), trifluoroacetic acid (1 mL, 13 mmol), and triethylsilane (2 mL, 12.5 mmol) in acelonitrile (10 mL) was refluxed for 4 hours. The mixture was concentrated and the residue was dissolved in ethyl acetate. The solution was washed with saturated sodium bicarbonate, brine, and dried over sodium sulfate. After removal of solvent, the residue was washed with a mixture of ethyl ether and hexanes (1 : 1) to provide the compound as a yellow solid (P-1893, 40 mg, 98%). MS(ESI) [M+lTf - 393.39.

[0352] [3-(4-Chloro-benzyloxy)-2-methoxy-phenyl]-(lH-pyrrolo[2,3-b]pyridin-3-yl)-methanone (P-1891), [3-(4-Chloro-benzyloxy)-2-(2,2,2-trifluoroethoxy)-phenyl]-(lH-pyrrolo[2,3-b]pyridin-3- yl)-methanone (P-2076), [3-(4-chloro-2-fluoro-benzyloxy)-2-ethoxy-phenyl]-(5-methoxy-l H- pyrrolo[2,3-b]pyridin-3-yl)-methanone (P-2016), and 3-(4-Chloro-benzyloxy)-2-(2-fluoro-ethoxy)- phenyl]-(lH-pyrrolo[2, 3-6]pyπdin-3-yl)-methanone (P-2118)

were prepared following the protocol of Scheme 20, substituting iodoethane with iodomethane in Step 3 to provide P-1891, or substituting iodoethane with 2-iodo-l ,l ,l -trifluoroethane in Step 3 to provide P-2076, or substituting iodoethane with 2-iodo-l-fluoroethane in Step 3 to provide P-2118, or substituting 4-chlorobenzyl bromide 22 with 4-chloro-2-fluoro-benzyl bromide in Step 1 and 7- azaindole 6 with 5-methoxy-7-azaindole in Step 4 to provide P-2016. MS(ESl) [M⁺H⁺J⁺ - 393.4 (P-1891), 461.08 (P-2076), 455.2 (P-2016), and 425.17 (P-2118).

Example 22: Synthesis of 3-Iodo-l-triisopropyIsilanyI-lH-pyrrolo[2,3-b]pyridiπe 68

[0353] 3-Iodo-l-triisopropylsilanyl-lH-pyrrolo[2,3«b]pyridine 68 was synthesized in one step from 3-Iodo-lH-pyrrolo[2,3-b]pyridine 67 as shown in Scheme 21. Atty. Dkt. No.: 039363-3303

Scheme 21

68

Step 1 - Preparation of3-Iodo-l-trHsopropylsilanyl-lH-pyrrolo[2,3-b]pyridine (68): [0354] 3-Iodo-lH-pyrrolo[2,3-b]pyridine 67 (2.00 g, 8.20 mmol) was dissolved in N,N- dimethylformamide (50 mL). Sodium hydride (60% dispersion in mineral oil, 390 mg, 9.8 mmol) was added. After 20 minutes, triisopropylsilyl chloride (1.74 mL, 8.20 mmol) was added dropwise. After 1.5 hours, the reaction was poured into water and extracted with ethyl acetate, washed with saturated sodium bicarbonate and brine. The organic portions were dried over anhydrous sodium sulfate and concentrated. Purification by silica gel chromatography, 0-25% gradient ethyl acetate/ hexane gave compound 68 as a white solid (3.224 g, 98.2%). ¹H-NMR was consistent with the desired compound.

Example 23: Synthesis of l-(tert-ButyI-dimethyI-siIanyI)-3-iodo-lH-pyrrolo[2,3-b]pyridine 69

[0355] l-(tert-Butyl-dimethyl-silanyl)-3-iodo-lH-pyrrolo[2,3-b]pyridiπe 69 was synthesized in one step from 3-Iodo-l H-pyrrolo[2,3-b]pyridine 67 as shown in Scheme 22.

Scheme 22

69

Step 1 - Preparation ofl-(tert-Butyl-dimethyl-silanyl)-3-iodo-lH-pyrrolo[2,3-b]pyridine (69): |0356] 3-Iodo-lH-pyrrolo[2,3-b]pyridine 67 (1.11 g, 4.6 mmol) was dissolved in tetrahydrofuran (120 mL). Sodium hydride (60% dispersion in mineral oil, 0.13 g, 5.5 mmol) was added, followed by tert-butyldimethylsilyl chloride (0.85 g, 5.5 mmol). The reaction was stirred at room temperature overnight. The reaction was poured into water and extracted with ethyl acetate. The organic portion was washed with brine, dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified with silica gel column chromatography eluting with 30% ethyl acetate in hexane to give the compound as a white solid (69, 100 mg, 15%). Atty. Dkt. No,: 039363-3303

Example 24: Synthesis of [5-(4-chloro-benzyloxy)-4-methoxy-pyridin-2-yl]-(lII-pyrrolo[2,3- bJpyridin-3-yl)-methanone P-2024

[0357J [5-(4-Chloro-benzyloxy)-4-methoxy-pyridin-2-yl]-(lH-pyrτolo[2,3-b]pyridin-3-yl)- methanone P-2024 was synthesized in six steps from Kojic acid 70 and 3-iodo-l-triisopropylsilanyl- lH-pyrrolo[2,3-b]pyridine 68 as shown in Scheme 23.

Scheme 23

Step 1 - Preparation of5-(4-chloro-benzyloxy)-2-hydroxymethyl-pyran-4-one (71): [0358] Kojic acid (70, 5.00 g, 35.2 mmol) and 4-chlorobenzyl bromide (22, 7.95 g, 38.7 mmol) were suspended in methanol (40 mL) in an 80 mL sealed tube. Sodium hydroxide in water (12 M, 2.93 mL) was added. The reaction was heated at 80 ⁰C overnight. The resulting suspension was concentrated. Water was added and the mixture was filtered and washed with water to provide a brown solid. Washing with minimal methanol on the filter removed the brown color. A white solid (71, 7.58 g, 80%) was isolated. ¹H-NMR was consistent with the desired compound.

Step 2 — Preparation of 5-(4-ch1υrυ-benzyloxy)-2-hydroxymelhyl- 1 H-pyridin-4-one (72) ^■ [0359] 5-(4-Chloro-benzyloxy)-2-hydroxymethyl-pyran-4-onc (71, 8.00 g, 3.00 mmol) was suspended in ammonium hydroxide (200 mL) in an 80 mL sealed tube. The reaction was heated at 90 Atty Dkt No 039363-3303

⁰C overnight Upon cooling, the reaction was lowered to pi I 10 with 6N HCl to provide a beige solid that was collected by filtration (72, 7 8 g, 98%)

Step 3 Preparation of [5-(4-chloro-henz\lox\)-4-methory-pχndιn-2-vl] -methanol (73) [0360] 5-(4-Chloro-benz} loxy)-2-hydroxymcthyl-l H-pyπdin-4-one (72, 1 06 g, 3 99 mmol) was dissolved in methanol (8 5 rnL) and N,N-dimethylformamide (46 rnL) frimethylsilyldiazomethane in hexane (2 00 M, 3 99 rnL) was added The reaction was stirred at room temperature overnight, then additional trimethylsilyldiazomethane in hexane (2 00 M, 3 99 mL) was added The reaction w as stirred at room temperature for 2 days The mixture was adsorbed onto silica and purified by silica gel chromatography, methanol dichloromethane to provide the compound (73, ^98 mg, 72 %)

282 4

Step 4 — Preparation of5-(4-cMoro-benzylo\y)-4-methυxy-pyrιdιne-2-caihaldehyde (74) [0361] [5-(4-Chloro-benzyloxy)-4-methoxy-pyπdin-2-yl]-methanol (73, 480 mg, 1 7 mmol) was dissolved in dimethyl sulfoxide (26 mL) and Dess-Martin penodinane (909 mg, 2 1 mmol) was added The reaction was allowed to stir at room temperature for 2 hours The reaction was concentrated under high vacuum and then poured into a solution OfNaHCO₃ and Na₂S₂Oi The mixture was extracted with ethyl acetate The organic portions were dried with anhydrous sodium sulfate and filtered 1 he filtrate was adsorbed onto silica and purified by silica gel chromatography, ethyl acetate hexanes, to provide the desired compound as a white powder (74, 343 mg, 72 %)

Step 5 - Preparation of [5-(4-chloro-benzyloxy)-4-methoxy-pyndιn-2-yl] -(I -trιιsopropylsdanyl-1 H- pyrroh[2 3-h]pyrιdιn-3-yl)-methanol (75)

[0362] 3-Iodo-l-tπisopropylsilanyl-lH-pyrrolo[2,3-b]pyndine (68, 180 mg, 0 450 mmol, prepared as described in Example 22) was dissolved m tetrahydrofuran (2 5 ml ) and the reaction was cooled to -20 ⁰C under an atmosphere of nitrogen Isopropylmagnesium chloride in tetrahydrofuran (2 00 M, 0 243 ml ) was added The reaction was stirred for 1 hour, during which the temperature rose to 0 ⁰C The reaction was cooled to -20 ⁰C and 5-(4-chloro-benzyloxy)-4-methoxy-pyπdme-2-carbaldehyde (74, 80 0 mg, 0 288 mmol) in tetrahydrofuran (0 75 mL) was added The reaction was allowed to warm to room temperature and stirred overnight The reaction was quenched with methanol and adsorbed onto silica, then purified by silica gel chromatography, methanol dichloromethane, to provide the desired compound (75, 94 mg, 59%) ¹H-NMR was consistent with the desired compound MS(ESI) [M+H⁺]⁺= 552 4, 554 4, 555 4

Step 6- Preparation of [5-(4-chlof o-ben∑ylo\y)~4-methoxy-pyrιdιn-2-γl] -(I H-pyrrolo[2,3 bjpyndin- 3-yl)-methanone (P-2024)

[U363] [5 (4-Chloro-benzyloxy)-4-methoxy-pyndm-2-yl]-(l -triisopropylsilanyl-lH-pyrrolo[2,3- b]pyπdm-3-yl)-methanol (75, 60 0 mg, 0 11 mmol) was dissolved in tetrahydrofuran (2 00 mL) Atty. Dkt. No.: 039363-3303

Dess-Martin periodinane (55.3 mg, 0.13 mraol) was added to the reaction and it was stirred at room temperature overnight. The mixture was extracted with ethyl acetate and saturated sodium bicarbonate. The organic portions were dried with anhydrous sodium sulfate, filtered and the filtrate was adsorbed onto silica and purified by silica gel chromatography. methanol:dichloromethane, to provide the desired compound (P-2024, 10.7 mg, 25%). ¹H-NMR was consistent with the desired compound. MS(ESI) [M+H⁺f = 394.1 , 396.1.

Example 25: Synthesis of 3-4-[l-(4-chIoro-phenyI)-ethoxy]-3-methoxy-benzyI-lH-pyrrolo[2,3- b] pyridine P-2000

[0364] 3-4-[l -(4-Chloro-phenyl)-ethoxy]-3-methoxy-benzyl-lH-pyrrolo[2,3-b]pyridine P-2000 was synthesized in three steps from vanillin 21, 4-chlorophenylmethylcarbinol 76, and l-(tert-butyl- dimethyl-silanyl)-3-iodo-lH-pyrrolo[2,3-b]pyridine 69, as shown in Scheme 24.

Scheme 24

Step 1 - Preparation of4-[l-(4-chloro-phenyl)-ethoxy]-3-methoxy-ben∑aldehyde (77): [0365] 4-Chlorophenylmefhylcarbinol (76, 0.668 mL, 6.57 mmol) was dissolved in tetrahydrofuran (60.0 mL) at 0 °C under an atmosphere of nitrogen. 4-Hydroxy-3-methoxybenzaldehyde (21, 1.00 g, 6.57 mmol) and triphenylphosphiπe (2.07 g, 7.89 mmol) were added to the reaction, followed by diisopropyl azodicarboxylate (1.55 mL, 7.89 mmol) over 10 minutes. The reaction was stirred for 2 hours. The mixture was adsorbed onto silica and purified by silica gel chromatography, ethyl acetate:hexanes, to provide the desired compound, (77, 1.14 g, 60 %). ¹H-NMR was consistent with the desired compound. Any. Dkt. No.: 039363-3303

Step 2 - Preparation of ^' [ 1 -(tert-Butyl-dimethyl-silanyl)-lII -pyrrolo[2,3-bJpyridin-3-ylJ -4-[ l-(4- chloro-phenyl)-ethoxy]-3-methoxy-phenyl-methanol (78):

[03661 l-(tert-Butyl-dimethyl-silanyl)-3-iodo-lH-pyrrolo[2,3-b]p)τidine (69, 647.0 mg₅ 1.81 mmol, prepared as described in Example 23) was dissolved in tetrahydrofuran (10.0 niL) at -20 ⁰C under an atmosphere of nitrogen. Isopropylmagnesium chloride in tetrahydroruran (2,0 M. 0.98 mL) was added to the reaction. The reaction was stirred for 1 hour, during which the temperature rose to 0 °C. The reaction was cooled to -20 ⁰C and 4-[l -(4-chloro-phenyl)-ethoxy]-3-methoxy-benzaldehyde (77, 420 mg. 1.4 mmol) in tetrahydrofuran (3.00 mL) was added. The reaction was stirred for 2 hours during which time the temperature rose to 10 ⁰C. The reaction was quenched with methanol and adsorbed onto silica, then purified by silica gel chromatography, ethyl acetate:hexanes, to provide the desired compound, (78, 463 mg, 61%). ¹H-NMR was consistent with the desired compound.

Step 2 - Preparation υf3-4-[l-(4-chlnm-phenyl)-ethoxy]-3-rnethoxy-benzyl-lH-pyrrolo[2,3- b] pyridine (P-2000):

[0367] [l-(tert-Butyl-dimethyl-silanyl)-lH -pyrrolo[2,3-b]pyridin-3-yl]-4-[l -(4-chloro-phenyl)- ethoxy]-3-methoxy-phenyl-methanol (78, 0.200 g, 0.382 mmol) was dissolved in acetonitrile (5.00 mL). Trifluoroacetic acid (0 138 mL) was added and the reaction was stirred for five minutes. Triethylsilane (0.285 mL) was added and the reaction was heated at 80 ⁰C for 2 hours. The reaction was concentrated, then redissolved in ethyl acetate and adsorbed onto silica and purified by silica gel chromatography, ethyl acetate:hexanes, to provide the desired compound (P-2000, 57 mg, 38 %). ¹H- NMR was consistent with the desired compound. MS(ESI): [M^H⁺J⁺= 393.3, 395.3.

Example 26: Synthesis of 5-I4-(2-methoxyethoxy)-phenyl]-lH-pyrrolo[2,3-b]pyridine 81

[0368] 5-[4-(2-Methoxyethoxy)-phenyl]-lH-pyrrolo[2,3-b]pyridine 81 was synthesized in two steps from 4-bromophenol 79 as shown in Scheme 25.

Scheme 25

Step 1 - Preparation J-Bromo-4-(2-methoxy-ethoxy)-benzene (80):

[0369] To a solution of 4-bromophenol (79, 5.0 g, 28.9 mmol) in dimethylformamide (15 mL) were added potassium carbonate (4.40 g, 31.8 mmol) and 1 -bromo-2-mcthoxyethane (5.00 g, 36,0 mmol) under an atmosphere of nitrogen. The reaction mixture was stirred at ambient temperature overnight and concentrated under reduced pressure. The residue was slurried in ethyl acetate (50 mL) and Atty Dkt No 039363-3303 filtered The filtrate w as washed with saturated sodium bicarbonate solution, dried over magnesium sulfate and filtered Silica gel column chromatography (0-10% ethyl acetate in hexanes) ga\e the desired compound as a colorless oil (80, 3 2 g, 48%)

Step 2 - Preparation of 5-[4-(2-Metho\y-etho\y)-phenyl] -1 H-pyrmlo[2 3 b] pyridine (81) [0370] To a solution of 5-(4,4,5.5,-tetramethyl-[l ,3,2]dioxaborolan-2-yl)-lH-pyrrolol[2,3- b]pyπdme (1 1 g, 4 3 mmol) in tetrahydrofuran (40 mL) was added 1 -bromo-4-(2-methoxy-ethoxy)- benzene (80, 1 50 g, 6 49 mmol) and tetrdkis(tπphenylphosphme)palladium (0) (0 25 g, 0 21 mmol) The reaction mixture was stirred with potassium carbonate solution (10 mL, 1 0 M) and warmed to reflux overnight The biphasic reaction mixture was diluted with ethyl acetate (50 mL) and saturated sodium carbonate solution (20 mL) The organic layer was separated, w ashed w ith brine, dried over magnesium sulfate and punfied by silica gel column chromatography (50-100% ethyl acetate in hexanes) to give the desired compound as a colorless solid (81, 782 mg, 67%) MS (ESI) [M+H⁺]⁺ = 267 4

Example 27: Synthesis of 5-fluoro-2-methoxy-4-(l-triisopropylsilanyl-lH-pyrrolo[2,3-b]pyridin- 3-ylmethyl)-phenol 87.

[0371] 5-Fluoro-2-methoxy-4-(l-tπisopropylsilanyl-lH-pyrrolo[2,3-b]pyridin-3-ylmethyl)-phenol 87 was synthesized in five steps from 2-fluoro-4-hydroxy-5-methoxy-benzaldehyde 39 and benzyl bromide as shown in Scheme 26

Scheme 26

Step I Preparation of 4-Benzyloxy-2-fluo> o-5-methoxy-benzaldehyde (83)

[0372] 2-Fluorυ-4-hydroxy-5-methoxy-bcnzaldehyde (39, 1 62 %, 9 52 mmol, prepared as described in Scheme 12 of Example 15) was dissolved in N,N-dimethylformamide (50 ml ) and sodium hydride Atty, Dkt. No.: 039363-3303

(60% dispersion in mineral oil, 530 mg, 13 mmol) was added. After 20 minutes, benzyl bromide (1.5 niL, 12 mmol) was added to the reaction mixture The reaction was stirred at room temperature under an atmosphere of nitrogen for 5.5 hours. The reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 0-50 % ethyl acetate in hexane to provide compound as a white solid, consistent with the desired structure by ¹H-NMR (83, 2.0 g, 81 %).

Step 2 - Preparation υf(4-Benzyloxy-2-fluoro-5-methoxy-phenyl)-(l-triisopropylsi!anyl-lH~ pyrrolo[2,3-b]pyridin-3-yl)-methanol (84):

[0373] 3-Iodo-l -triisopropylsilanyl-lH-pyrrolo[2,3-b]pyridine (68, 620 mg, 1.5 mmol, prepared as described in Example 22) was dissolved in tetrahydrofuran (15 mL) at -20 °C under an atmosphere of nitrogen. Isopropylmagnesium chloride (2.0 M in tetrahydrofuran, 840 μL) was added to the reaction. The reaction was stirred for 1.5 hours, during which the temperature rose to 5 ⁰C. The reaction was cooled to -20 °C. 4-Benzyloxy-2-fluoro-5-methoxy-benzaldehyde (83, 250 mg, 0.9606 mmol) in tetrahydrofuran (5.0 mL) was added to the reaction. The reaction was stirred for 2.5 hours during which time the temperature rose to 5 °C. The reaction was poured into water. The mixture was extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 2-25 % ethyl acetate in hexane to provide compound as a white solid (84, 501 mg, 63 %). MS (ESI) [IvH H⁺J⁺ = 535.4.

Step 3 - Preparation of3-(4-Benzyloxy-2-fluoro-5-methoxy-benzyl)-lH-pyrrolo[2,3-b]pyridine (85): [0374] (4-Benzyloxy-2-fluoro-5-methoxy-phenyl)-(l-triisopropylsilanyl-lH-pyrrolo[2,3-b]pyridin- 3-yl)-methanol (84, 1.49 g, 2.79 mmol) was dissolved in acetonitrile (50 mL) and trifluoroacetic Acid (1.1 mL) was added. The reaction was stirred for 5 minutes. Triethylsilane (2.2 mL) was added to the reaction. The reaction was heated at 80 ⁰C for 6 hours. The reaction was concentrated and the crude material was dissolved into ethyl acetate and washed with 1 N HCl, saturated sodium bicarbonate, and brine. The organic portion was dried over anhydrous sodium sulfate and concentrated. The solid obtained was used in the next reaction without further purification (85, 833 mg, 83%). MS (ESI) [M+H⁺]⁺ = 363.4.

Step 4 - Preparation υf3-(4-Benzyloxy-2-flnoro-5-methoxy-benzyl)-l-triisopropylsilanyl-lH- μyrro!o[2,3-h]pyridine (86):

[0375] 3-(4-Benzyloxy-2-fluoro-5-methoxy-benzyl)-lH-pyrrolo[2,3-b]pyridine (85, 0.877 g, 2.42 mmol) was dissolved in N,N-dimethylformamide (30 mL). Sodium hydride (60% dispersion in mineral oil, 140 mg, 3.6 mmol) was added at room temperature. After 20 minutes, triisopropylsilyl chloride (513 μL, 2.42 mmol) was added dropwise. The reaction was stirred for four hours. The Atty. Dkt. No. : 039363-3303 reaction was poured into water and extracted with ethyl acetate. The organic portion was washed with saturated sodium bicarbonate and brine. The organic portion was dried over anhydrous sodium sulfate and filtered. The filtrate was adsorbed onto silica gel and purified by silica gel chromatography using 20-80% ethyl acetate/ hexane. The resulting material was purified a second time with 5-30% gradient ethyl acetate/ hexane to provide the desired compound (86, 831 mg, 66%), MS (ESI) [M+HT = 519.4.

Step 5 - Preparation of5-Fluoro-2-methoxy-4-(l-triisopropyhilanyl~lH-pyrrolo[2,3-b]pyridin-3- ylιnethyl)-phenol (87):

[0376] 3-(4-Benzyloxy-2-fluoro-5-methoxy-benzyl)-l-triisopropylsilanyl-lH-pyrrolo[2,3- bjpyridine (86, 0.831 g, 1.60 mmol) was dissolved in methanol (40 mL) and tetrahydrofuran (40 mL), 10% Palladium on carbon (3.41 g) was added. The reaction was shaken at 50 psi for 1 hour. The reaction was filtered through Celite and washed with methanol. The organic portion was passed through celite several times until a clear solution was obtained. The organic portion was concentrated under reduced pressure to provide the desired compound as an off-white solid (87, 587 mg, 86%). MS (ESI) [M+H⁺]⁺ = 429.5.

Example 28: Synthesis of 3-[2-fluoro-5-methoxy-4-(pyridin-4-yImethoxy)-benzyI]-lH- pyrrolo[2,3-b) pyridine P-2040 and related compounds.

[0377] Compound P-2040 was synthesized in one step from 5-fruoro-2-methoxy-4-(l- triisopropylsilanyl-lH-pyrrolo[2,3-b]pyridin-3-ylmethyl)-phenol 87 and pyridin-4-yl-methanol 88 as shown in Scheme 27.

Scheme 27

87

Step 1 - Preparation of3-[2-fluoro-5-methoxy-4-(pyridin-4-ylmethoxy)-benzyl]-lH-pyrro!o[2,3- b] pyridine (P-2040):

[0378] 5-Fluoro-2-methoxy-4-(l-triiisopropylsilanyl-lH-pyrrolo[2,3-b]pyridine-3-ylmethyl)- phenol (87, 10 mg, 0.024 mmol, prepared as described in Example 27) was combined with pyridin-4- yl-methanol (88, 3.2mg, 0.029 mmol) in a 4 mL vial and dissolved in dry tetrahydrofuran (200μl). Triphenylphosphine (7.7 mg) was added and the solution was shaken until homogenous. The mixture Atty. Dkt No/ 039363-3303 was cooled to below 0 ⁰C in a liquid nitrogen bath and dnsopropyl azodicarboxylate solution (50μl of 20mg/50μl in THF) was added The reaction mixture was allowed to warm to room temperature After 2 hours, the solvent was removed under reduced atmosphere The crude material was dissolved in dimethyl sulfoxide (300μl) and potassium fluoride (10 mg, 0 l δmmol) was added l he mixture was heated gently and allow ed to react overnight at room temperature The vial was centnfuged and the DMSO solution was puπfied by reverse phase HPLC using a YMC-Pack ODS-A C-18 column (50mm x 10mm ID), and eluting with water with 0 1% TFA and a gradient of 15%-80% acetonitrile with 0 1% TFA over 8 minutes and a flow rate of 6 mL/minute to provide the compound (P-2040, 4 4 mg, 50%) MS (ESI) [M+HT - 364 3

[0379] Additional compounds were prepared following the protocol of Scheme 27, replacing pyridin-4-yl -methanol 88 with an appropriate alcohol The following compounds were made following this procedure

3-[2-Fluoro-5-methoxy-4-(2-morpholm-4-yl-ethoxy)-benzyl]-lH-pyrrolo[2,3-b]pyπdine

(P-2037),

3-[2-Fluoro-5-methoxy-4-(pyridin-3-ylmethoxy)-benzyl]-lH-pyrrolo[2,3-b]pyridine (P-2038),

3-[2-Fluoro-5-methoxy-4-(6-methyl-pyπdin-2-ylmethoxy)-benzyl]-lH-pyrrolo[2,3-b]pyπdme

(P-2039),

3-[2-Fluoro-5-methoxy-4-(pyπdin-2-ylmethoxy)-benzyl]-l H-pyrrolo[2,3-b]pyπdme (P-2041),

3-[2-Fluoro-4-(2-fluoro-4-tπfluoromethyl-benzyloxy)-5-methoxy-benzyl]-lH-pyrτolo[2,3- b]pyridine (P-2042),

(P-1973),

3-[4-(2,4-Dimethyl-thiazol-5-ylmethoxy)-2-fluoro-5-methoxy-benzyl]-lH-pyrrolo[2,3-b]pyridme

(P-2043),

3-[4-(2,5-Dimethyl-2H-pyrazol-3-ylmethoxy)-2-fluoro-5-methoxy-benzyl]-l H-pyrrolo[2,3- bjpyπdme (P-2044),

3-[2-Fluoro-5-methoxy-4-(3-morpholin-4-yl-propoxy)-benzyl]-lH-pyrrolo[2,3-b]pyridine

(P-2045), l-{2-[5-Fluoro-2-methoxy-4-(lH-pyrrolo[2,3-b]pyridin-3-ylmethyl)-phenoxy]-ethyl} -pyrrolidm-

2-one (P-2046),

3-[2-Fluoro-4-(2-fluoro-benzyloxy)-5-methoxy-benzyl]-lH-pyrrolo[2,3-b]pyridine (P-2047),

3-[2-Fluoro-5-methoxy-4-(3-methyl-pyπdin-4-ylmethoxy)-benzyl]-lH-pyrrolo[2,3-b]pyridme (P-2048),

3-[2-Fluoro-5-methoxy-4-(6-tπfluoromethyl-pyridin-3-ylmethoxy)-benzyl]-lH-pyrrolo[2,3- bjpyridme (P-2049), 3-[4-(2,4-Dichloro-benzyloxy)-2-fluoro-5-methoxy-benzyl]-lH-pyrrolo[2,3-b]pyπdme (P-20S0), 7 088443

Atty. Dkt. No.: 039363-3303

3-[2-Fluoro-4-(4-imidazol-l-yl-benzyloxy)-5-methoxy-benzyl]-l H-pyrroloL2,3-b]ρyridine

(P-2051),

3-[4-(2,4.Difluorϋ-ben7>'loxy)-2-fluoro-5-methoxy-benzyl]-lH-pyrrolo[2,3-b]pyridine (P-2052),

3-{2-Fluoro-4-[l -(2-fluoro-phenyl)-ethoxy]-5-methoxy-benzyl}-lH-pyrrolo[2,3-b]pyridme

(P-2053),

3-[4-(3-Cyclopentyl-propoxy)-2-fluoro-5-methoxy-benzyl]-lH-pyrrolo[2,3-b]pyridine (P-2054),

3-[4-(l ,5-Dimethyl-lH-pyrazol-3-ylmethoxy)-2-fluoro-5-methoxy-benzyl]-lH-pyrrolo[2,3- b]pyridine (P-2055), and

3-[4-(2-Cyclopentyl-ethoxy)-2-fluoro-5-methoxy-benzyl]-lH-pyrrolo[2,3-b]pyridme (P-2056) The following table indicates the alcohol (column 2) used in Scheme 78 to provide the compounds (column 4). Column 1 provides the compound number and column 4 the observed mass.

Atty.Dkt.No.: 039363-3303

Atty. Dkt.No.: 039363-3303

Atty, Dkt. No.: 039363-3303

Example 29: Synthesis of [2,6-difluoro-3-(pyridin-3-ylmethoxy)-phenyl]-(lH-pyrrolo[2,3- blpyridin-3-yl)-methanone P-2058 and related compounds.

[0380] Compound P-2058 was synthesized in 1 step from (2,6-Difluoro-3-hydroxy-phenyl)-(lH- pyrrolo[2,3-b]pyridin-3-yl)-mefhanone 89 and Pyridin-3-yl-methanol 90 as shown in Scheme 28.

Scheme 28

89

P-2058

Step 1 - Preparation of[2, 6-Diβuoro-3-(pyridιn-3-ylmethoxy)-phenyl]-(lH-pyrrolo[2,3-b]pyridin-3- yl)-methanone (P-2058):

[0381] In a 4mL vial, (2,6-Difluoro-3-hydroxy-phenyl)-(lH-pyrrolo[2,3-b]pyridine-3-yl)- methanone (89, 10 mg, 0.037 mmol, prepared as described in Example 11) was combined with pyridin-3-yl-methanol (90, 4.9 mg 0.044 mmol). The solids were dissolved in dry tetrahydrofuran (200μl) and triphenylphosphine (11.5 mg, 0.044 mmol) was added. Once the solution was homogenous, the mixture was cooled to below 0 "C in liquid nitrogen bath and diisopropyl azodicarboxylate solution (50μl of 20mg/50μl THF) was added. The reaction mixture was allowed to warm to room temperature and the reaction was continued for 2 hours. The solvents were removed under reduced atmosphere. The resultant residue was diluted with 200μl DMSO and the mixture purified by reverse phase HPLC using a YMC-Pack ODS-A C-18 column (50mm x 1 Omm ID), and eluting with water with 0.1 % TFA and a gradient of 15%-80% acetonitrile with 0.1% TFA over 8 minutes and a flow rate of 6 mL/minute to provide P-2058 (5.9 mg, 44 %). MS (ESI) [M+H⁺]^τ = 365.9. Atty Dkt No 039363-3303

[0382] Additional compounds were prepared following the protocol of Scheme 28, replacing pyπdin-3-yl-methanol 90 with an appropriate alcohol and optionally replacing (2 6-difluoro-3- hydroxy-phenyl)-(l H-pyττolo[2,3-b]pyπdme-3-yI)-methanone 89 with (2,6-difluoro-3-h>droxy- phenyl)-(5-chloro-lH-pyrrolo[2,3-b]pyπdme-3-yl)-methanone (prepared as described in Example 11, 3 and 4 of Scheme 8, replacing pyridm-3-yl-lH-pyrrolo[2,3-b]pyndine 20 with 5-chloro-lH- pyrrolo[2,3-b]pyridme 4 (see Example 4) in Step 3) The following compounds were made following this procedure

[2,6-Difluoro-3 -( 1 -methyl- 1 H-imidazol-2-ylmethoxy)-phenyl]-( 1 H-pyrrolo[2,3-b]pyπdin-3 -yl)- methanone (P-2033),

[2,6-Difluoro-3-(6-moφholin-4-yl-pyridin-3-ylmethoxy)-phenyl]-(l H-pyrrolo[2,3-b]pyridm-3- yl)-methanone (P-2034),

{2,6-Difluoro-3-[4-(5-methyl-[l ,2,4]oxadiazoI-3-yl)-benzyloxy]-phenyl}-(lH-pyrrolo[2,3- b]pyridm-3-yl)-methanone (P-2035),

[3-(6-Diethylamino-pyπdm-3-ylmethoxy)-2,6-difluoro-phenyl]-(lH-pyrrolo[2,3-b]pyπdm-3-yl)- methanone (P-2036),

[3-(2-Chloro-4-fluoro-benzyloxy)-2,6-difluoro-phenyl]-(lH-pyrrolo[2,3-b]pyridm-3-yl)- methanone (P-2057),

[2,6-Difluoro-3-(6-methyl-pyπdm-2-ylmethoxy)-phenyl]-(lH-pyrrolo[2_!3-b]pyridin-3-yl)- methanone (P-2059),

[2,6-Difluoro-3-(pyridin-4-ylmethoxy)-phenyl]-(lH-pyrrolo[2,3-b]pyπdm-3-yl)-methanone

(P-2060),

[3-(4-Chloro-2-fluoro-benzyloxy)-2,6-difluoro-phenyl]-(lH-pyrrolo[2,3-b]pyridm-3-yl)- methanonc (P-2061),

[3-(2,4-Dimethyl-thiazol-5-ylmethoxy)-2,6-difluoro-phenyl]-(lH-pyrrolo[2,3-b]pyπdm-3-yl)- methanone (P-2062),

[3-(2,5-Dimethyl-2H-pyrazol-3-ylmethoxy)-2,6-difluoro-phenyl]-(lH-pyrrolo[2,3-b]pyridin-3- yl)-methanone (P-2063),

[2,6-Difluoro-3-(3-morpholin-4-yl-propoxy)-phenyl]-( lH-pyrrolo[2,3-b]pyridin-3-yl)-methanone

(P-2064),

(5-Chloro-l H-pyrrolo[2,3-b]pyπdm-3-yl)-[3-(2,4-dimethyl-thiazol-5-ylmethoxy)-2,6-difluoro- phenyl] -methanone (P-2162),

(5 -Chloro- 1 H-pyrrolo [2,3 -b]pyridm-3-yl)-[2, 6-difluoro-3 -(6-lπfluoromethyl-pyπdin-3 - ylmethoxy)-phenyl]-methanone (P-2163),

(5-Chloro-lH-pyrrolo[2,3-b]pyπdin-3-yl)-[3-(2,5-dimethyl-oxazol-4-ylmethoxy)-2,6-difluoro- phcnylj-methanone (P-2164), and

(5-Chloro-lH-pyrrolo[2,3-b]p>τidm-3-yl)-[2,6-difluoro-3-(l-πiethyl-lH-imidazol-2-ylmethoxy)- phenylj-melhanone (P2165) Atty. Dkt. No.; 039363-3303

The following table indicates the alcohol (column 2) used to afford the compound (column 3). P-2162, P-2163, P-2164 and P-2165 were made starting with (2,6-difluoro-3-hydroxy- phenyl)-(5-chloro-lII-pyrrolo[2,3-b]pyridine-3-yl)-methanone (not shown in table). Column 1 provides the compound number and column 4 the observed mass.

Atty. Dkt. No.: 039363-3303

Example 30: Synthesis of 4-chIoro-7-azaindole 92

[0383] 4-chloro-7-azaindole 92 was synthesized in two steps from 7-azaindole according to the 88443

Atty. Dkt. No.: 039363-3303 protocol of Scheme 29.

Scheme 29

Step -1 ~ Synthesis of IH-Py rrolo[ 2,3 -b] pyridine 7-oxιde (91)

[0384] lH-Pyrrolo[2,3-b]pyπdme

91 was synthesized by reacting

6 with an oxidizing agent (e g m-CPBA) m a non-reactive solvent (e g dimethoxyethane) as described by Schneller, S W ; Luo, Jiann-Kuan. J Org, Chem. 1980, 45 4045-4048 The compound was isolated by filtration of the resultmg solid that forms upon standing at 5 ⁰C for typically 1 -3 h.

Step - 2 - Synthesis of 4~chloro-7-azaιndole (92)

10385] 4-chloro-7-azamdole 92 was synthesized by reacting lH-Pyrrolo[2,3-b]pyridine 7-oxide 91 with a chlorinating agent (e g POCl₃) neat as described by Schneller, S W , Luo, Jiann-Kuan J Org. Chem 1980, 45-4045-4048. The resulting solution after heating for 3-5 h at elevated temperatures (100-150 ⁰C) was neutralized with a base (e g. NH₄OH) until a solid precipitated. The solid was isolated by filtration.

Example 31: Synthesis of [3-(4-Chloro-2-fluoro-benzyloxy)-2- (2-fluoro-ethoxy)-phenyl]-(lH- pyrro lo[2,3-b]pyridin-3-yl)-methanonc P-2086 and 3-[3-(4-Chloro-2-fluoro-benzyloxy)- 2-(2- fluoro-ethoxy)-benzyl]-lH-pyrr olo[2,3-b] pyridine P-2085

[0386] Compounds P-2086 and P-2085 were synthesized in three steps from compounds 93 and lH-pyrrolo[2,3-έ>]pyπdine 6 as shown in Scheme 30

88443

Atty. Dkt. No.: 039363-3303

Scheme 30

Step 1 - Preparation of3-(4-Chloro-2-fluoro-henzyloxy)-2-(2-fluoro-cthoxy)-benzaldehyde (94): [0387] To a solution of 3-(4-chloro-2-fluoro-benzyloxy)-2-hydroxy-benzaldehyde (93, yyyyl40 mg, 0.5 mmol, prepared by protocol of Example 21, Steps 1 and 2 of Scheme 20, using 4-chloro-2- fluoro-benzyl bromide in place of 4-chloro-benzyl bromide in Step 1 ) in tetrahydrofuran (8 mL) was added dropwise a mixture of 2-fluoro-ethanol (64 mg, 1.0 mmol), triphenylphosphine (180 mg, 0.7 mmol), and diisopropyl azodicarboxylate (120 mg, 0.6 mol) in tetrahydrofuran (5 ml) at 0 ⁰C. The reaction mixture was stirred at 0 ⁰C for 10 minutes and then at 40 ⁰C for 3 days. The reaction mixture was dissolved in water and ethyl acetate. The organic layers were collected, washed with brine, and dried over magnesium sulfate. After removal of solvent, the residue was purified by silica gel column chromatography eluting with ethyl acetate in hexanes to provide the compound as a white solid (94, 88 mg, 54%). MS (ESI) [M+H'T -327.12.

Step 2 - Preparation of[3-(4-Chloro-2-fluoro-benzyloxy)-2- (2-fluoro-ethoxy)-phenyl]-(lH-pyrro lo[2,3-b]pyridin-3-yl)-methanol (95) and 3-{[3-(4-Chloro-2-fluoro-benzyloxy) -2-(2-fluυrυ-ethoxy)- phenyl] -methox y-methyl} -IH-pyrrolo [2 ,3-b] pyridine (96):

[0388] A solution of 3-(4-chloro-2-fhjoro-benzyloxy)-2-( 2-fluoro-ethoxy)-benzaldehyde (94, 88 mg, 0.27 mmol), lH-pyrrolo[2,3-ό]pyridine (6, 38 mg, 0.32 mmol), and potassium hydroxide (45 mg, 0.81 mol) in methanol (5 mL) was stirred at room temperature for 24 hours. The reaction mixture was poured into water and extracted with ethyl acetate. The organic layer was collected, washed with brine, and dried over sodium sulfate. After removal of solvent, the residue was purified by silica gel Atty. Dkt. No.: 039363-3303 column chromatography eluting with ethyl acetate in hexane to provide compound 95 as a white solid (67 mg, 56%), MS(ESl) [M+H⁺f = 445.13 and compound 96 as a white solid (36 mg, 29%). MS(ESI) [M+HT = 459.15.

Step 3a - Preparation υf[3-(4-Chloro-2-fluoro-benzyloxy)-2- (2-fluoro-ethoxy)-phenyl]-(lH-pyrro Io [2, 3-b]pyridin-3-yl)-methanone (P-2086) :

[0389] To a solution of [3-(4-chloro-2-fluoro-benzyloxy)-2- (2-fluoro-ethoxy)-phenyl]-(lH- pyrrolo[2,3-£>]pyridin-3-yl)-methanol (95, 60 mg, 0.1 mmol) in tetrahydrofuran (10 mL) was added Dess-Martin periodinane (69 mg, 0.16 mmol) at 0 ⁰C. The reaction mixture was stirred at room temperature for 3 hours. The reaction was quenched with a saturated solution of sodium thiosulfate, extracted with ethyl acetate, washed with sodium bicarbonate, brine, and dried over magnesium sulfate. After removal of solvent, the residue was purified by silica gel column chromatography eluting with ethyl acetate in hexanes to provide the compound as a white solid (P-2086, 15 mg, 20%). MS(ESI) [M+H¹ ] ¹ = 441.06.

Step 3b - Preparation of 3-[ 3-(4-Chloro-2-βιιoro-benzyloxy)- 2-(2-fluoro-ethoxy)-benzyl]-lH-pyrr olo[2, 3-b] pyridine (P-2085):

[0390] A mixture of 3-{[3-(4-chloro-2-fluoro-benzyloxy) -2-(2-fluoro-ethoxy)-phenyl]-methoxy- methyl} -lH-pyrrolo[2,3-έ>]pyridine (96, 36 mg, 0.078 mmol) , triethylsilane (0.5 mL, 3 mmol), and trifluoroacetic acid (0.2 mL, 2 mmol) in acetonitrile (20 mL) was stirred at 80 ⁰C for 2 hours. The mixture was concentrated and the residue was dissolved in ethyl acetate. The solution was washed with saturated sodium bicarbonate, brine, and dried over sodium sulfate. After removal of solvent, the residue was purified by silica gel column chromatography eluting with ethyl acetate in hexanes to provide the compound as a yellow solid (P-2085, 24 mg, 71 %). MS(ESI) [M+HT = 429.15.

[0391] 3-(4-Chloro-benzyloxy)-2-(2,2-difluoro-ethoxy)-phenyl]-(lH-pyrrolo[2_! 3-i]pyridin-3-yl)- methanone (P-2075)

was prepared following the protocol of Scheme 30, substituting 2-fluoro-ethanol with 2,2-difluoro- ethanol and substituting 3-(4-chloro-2-fluoro-benzyloxy)-2-hydroxy-benzaldehyde 93 with 3-(4- chloro-benzyloxy)-2-hydroxy-benzaldehyde (63 of Example 21) in Step 1 to provide P-2075. MS(ESI) [M+HT = 443.1.

[0392] [3-(4-Chloro-2-fluoro-ben2yloxy)-2-(2,2-difluoro-ethoxy)-phenyl]-(lH-pyrrolo[2,3- b]pyridin-3-yl)-methanone (P-2119), [3-(4-Chloro-2-fluoro-benzyloxy)-2-cyclopropylmcthoxy- Atty. Dkt. No.: 039363-3303 phenyl]-(l II-pyrrolo[2,3-b]pyridin-3-yl)-methanone (P-2120), and [3-(4-Chloro-2-fluoro-benzyloxy)~ 2-(2,2,2-trifluoro-ethoxy)-phenyl]-(lH-pyrrolo[2,3-b]pyridin-3-yl)-methanone (P-2139)

were prepared following the protocol of Scheme 30, substituting 2-fluoro-ethanol with 2,2-difluoro- ethanol in Step 1 to provide P-2119 (MS(ESI) [M+HT = 461.15), or substituting 2-fluoro-ethanol with cyclopropyl-methanol in Step 1 to provide P-2120 (MS(ESI) [M+H⁺]' = 451.18), or substituting 2-fluoro-ethanol with 2,2,2-trifluoro-ethanol in Step 1 to provide P2139 (MS(ESI) [M+lT]' = 479.11).

Example 32: Synthesis of [3-(2-chloro-4-methanesulfonyl-benzyloxy)-2-ethoxy-phenyl]-(lH- pyrrolo[2,3-b]pyridin-3-yl)-methanone P-2094

[0393] Compound P-2094 was synthesized in four steps from compounds 68 and 97 as shown in Scheme 31.

Scheme 31

Step 1 Preparation of(3-Benzyhxy-2-ethoxy-phenyl)-(l-triisopropylsilanyl-lH-pyrroIo[2,3- b] pyridin-3-yl)-methanol (98): Atty. Dkt. No.: 039363-3303

[0394] To a solution of 3-iodo-l -tnιsopropylsilanyl-lH-pyrrolo[2,3-&]pyπdme (68, 1 306 g, 3.26 mmol, prepared as described in Example 22) in tetrahydrofuran (42 rtiL) at -20 ⁰C under nitrogen was added isopropylmagnesium chloride (1 70 mL, 2 0 M solution in tetrahydrofuran, 3 40 mmol) The reaction mixture was stirred at -20 ⁰C for 1.5 hours. It was allowed to warm to 5 ⁰C and then kept at 5 0C for 1 hour. The reaction mixture was then cooled down to -20 ⁰C. To this solution was slowly added a solution of 2-ethoxy-3-benzyloxybenzaldehyde (97, 0.698 g, 2.72 mmol, prepared by protocol of Example 21 , Steps 1-3 of Scheme 20, using benzyl bromide in place of 4-chloro-benzyl bromide in Step 1) in tetrahydrofuran (42 mL). The reaction mixture was stirred at -20 ⁰C for 2 5 hrs, and was allowed to warm to 5 ⁰C for 2 5 hours. The reaction mixture was poured into iced water, extracted with ethyl acetate, washed with saturated ammonium chloride and brine, and dried over magnesium sulfate. After removal of solvent, the residue was purified by silica gel column chromatography eluting with ethyl acetate in hexane to provide the compound as light-yellow oil (98, 200 mg, 13 9%).

Step 2 - Preparation of(2-ethoxy-3-hydroxy-phenyl)-(l-trusopropyhilanyl-lH-pyrrolo[2,3-b]pyridιn- 3-yl)-methanone (99)

[0395| To a solution of (3-benzyloxy-2-ethoxy-phenyl)-(l -triisopropylsilanyl-lH-pyrrolo[2,3- b]pyπdm-3-yl)-methanol (98,195 mg, 0.37 mmol) in a mixture of methanol (20 mL) and tetrahydrofuran (50 mL) was added palladium on carbon (50 mg, 10% wt., 0.2 mmol). The mixture was stirred under hydrogenation for seventeen hours After removal of solvent, the residue was washed with a mixture of ethyl ether and hexanes to provide the compound as a white solid (99, 63 mg, 95%). MS(ESI) [M+LT]⁺ = 439.37.

Step 3 — Preparation of [3-(2-Chloro-4-mcthanesιdfonyl-henzyloxy)~2-ethoxy-phenyl] ~(1 - triisopropyhιlanyl-lH-pyrrolo[2,3-b]pyridιn-3-yl)-methanone (100):

[0396] To a solution of (2-ethoxy-3-hydroxy-phenyl)-(l -triisopropyhilanyl-1 H-pyπolo[2,3- fc]pyπdm-3-yl)-mcthanonc (99, 40 mg, 0.064 mmol) in tetrahydrofuran (15 mL) was added sodium hydride (3.32 mg, 0.083 mmol) at room temperature under an atmosphere of nitrogen The mixture was stirred at room temperature for 40 minutes, thenl -bromomethyl-2-chloro-4-methanesulfonyl- benzene (21 72 mg, 0.077 mmol) was added to the reaction mixture It was stirred at room temperature overnight. The mixture was then poured into water and was extracted with ethyl acetate. The organic layer was collected and washed with brine, dried over magnesium sulfate. After removal of the solvent, a crude compound as light yellow oil was obtained (100, 84 mg)

Step 4 - Preparation of[3-(2-Chloro-4-methanesulfυnyl-benzyloxy)-2-ethoxy-phenyl]-(lH- pyrrolo[2, 3-b]pyridin-3-yl)-methanone (P-2094)

[0397| To a solution of (2-ethoxy-3-hydroxy-phenyl)-(l -tπisopropylsilanyl-lH-pyrrolo[2,3- b]pyridin-3-yl)-methanone (100, 84 mg, 0.054 mmol) in methanol (10 mL) was added potassium hydroxide (6 N solution) until pH of the solution turned to over 10 Potassiun fluoride (30 mg, 0 5 Atty. Dkt. No. : 039363-3303 mmol) was then added to the reaction mixture and the mixture was stirred at room temperature for 6 hours. The reaction mixture was then poured into saturated sodium carbonate and was extracted with ethyl acetate. The organic layer was collected and washed with brine, dried over magnesium sulfate. After removal of the solvent, the residue was purified by preparative HPLC to provide as a white solid (P-2094, 5 mg, 19%). MS(ESI) [M+HY = 485.17.

Example 33: Synthesis of 4-(3-diethylamino-propoxy)-2-fluoro-5-methoxy-benzaldehyde 102

[0398] 4-(3-Diethylamino-propoxy)-2-fluoro-5-methoxy-benzaldehyde 102 was synthesized in one step from 2-fluoro-4-hydroxy-5-rnethoxy-benzaldehyde 39 as shown in Scheme 32.

Scheme 32

Step 1 Synthesis of4-(3-diethylamino-propoxyJ-2-fluoro-5-methoxy-benzaldehyde (102): [0399] To 2-fluoro-4-hydroxy-5-methoxy-benzaldehyde (39, 1.20 g, 7.05 mmol, prepared as described in Scheme 12 of Example 15) in tetrahydrofuran (60.0 mL) were added triphenylphosphine (1.93 g, 7.35 mmol) and 3-(diethylamino)-propan-l-ol, (0.96 g, 7.30 mmol). The reaction was cooled to 0 ⁰C, followed by slow addition of diethyl azodicarboxylate (1.28 g, 7.35 mmol). The reaction was allowed to warm to room temperature overnight. The reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 10% methanol in dichloromethane to give a colorless oil (102, 0.90 g, 45.0%).

Example 34: Synthesis of 4-(lH-benzoimidazol-2-ylmethoxy)-5-chloro-2-fluoro-benzaldehyde 106

|0400] 4-(lH-benzoimidazol-2-ylmethoxy)-5-chloro-2-fluoro-benzaldehyde 106 was synthesized in three steps from 2-chloro-5-fluoro-phenol 103 as shown in Scheme 33.

Scheme 33

Atty. Dkt, No.: 039363-3303

Step 1 — Preparation of4-bromo-2-chloro-5-fluorυ-phenυl (104):

[0401] To 2-chloro-5-fluoro-phenol (103, 6.20 g, 0.0423 mol) in chloroform (110.0 mL) bromine (2.18 mL, 0.0423 mol) was added slowly. The reaction was stirred at room temperature for 3 hours. The reaction was poured into a solution of sodium thiosulfate and extracted with ethyl acetate. The organic layer was dried over sodium sulfate, concentrated and purified with silica gel column chromatography eluting with 20% ethyl acetate in hexane to give the desired compound as a colorless oil (104, 4.5O g, 47.2%).

Step 2 - Preparation of5-chloro-2-fluoro-4-hydrυxy-benzaldehyde (105): [0402] To 4-bromo-2-chloro-5-fluoro-phenol (104, 2.25 g, 9.98 mmol) in tetrahydronfuran (50 mL), cooled to -78 ⁰C under an atmosphere of nitrogen, was added n-butyllithium (2.50 M in hexane, 4.21 mL) and l ,2-bis-(chloro-dimethyl-silanyl)-ethane (1.08 g, 5.01 mmol). The reaction was stirred at room temperature for 2 hours. The reaction was cooled to -78 ⁰C, followed by adding tert- butyllithium (1.70 M in hexane, 12.4 mL). After 30 minutes, N,N-dimethylformamide (0.97 mL, 0.0125 mol) was added to the reaction. After 30 minutes, the reaction was warmed to room temperature for 10 minutes. 5N HCl (20 mL) was added to the reaction. After 30 minutes, the reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 20% to 100% ethyl acetate in hexane to give the desired compound (105, 0.50 g, 28.7). ¹H NMR consistent with structure.

Step 3 Preparation of4-(lH-benzoimidazυl-2-ylmethoxy)-5-chloro-2-fluoro-benzaldehyde (107): [0403] To 5-chloro-2-fluoro-4-hydroxy-benzaldehyde (105, 0.500 g, 2.86 mmol) in N,N- dimethylformamide (30.0 mL, 0.387 mol) was added sodium hydride (130.0 mg, 3.25 mmol, 60% in mineral oil). After 20 minutes, 2-chloromethyl-lH-benzo imidazole (106, 436.0 mg, 2.62 mmol) was added to the reaction. The reaction was stirred at 30 °C for 15 hours. The reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 20% to 100% ethyl acetate in hexane to give a white solid (107, 0.35 g, 43.9%). MS (ESI) [M+H⁺]~ = 305.1.

Example 35: Synthesis of 5-(l-methyl-lII-pyrazol-4-yl)-lH-pyrrolo[2,3-bJpyridiπe 109.

[0404] 5-(l-Methyl-lH-pyrazol-4-yl)-lH-pyrrolo[2,3-b]pyridine 109 was synthesized in 1 step from 5-bromo-lH-pyrrolo[2,3-b]pyridine 1 as shown in Scheme 34. Atty. Dkt. No.: 039363-3303

Scheme 34

Step 1 - Preparation of5-(l~Methyl-lH~pyra∑ol-4-yl)-lH-pyrrolo[2,3-b]pyridine (109): [0405] To 5-bromo-7-azaindole (1, 1.04 g, 5,28 mmol) in 1.00 M potassium carbonate in water (15.8 mL) and tetrahydrofuran (50.0 mL) were added 1 -methyl -4-(4,4,5, 5 -tetramethyl- [l,3,2]dioxaborolan-2-yl)-lH-pyrazole (108, 1.65 g, 7.92 mmol), Tetrakis(triphenylphosphine)- palladium(O) (0.305 mg, 0.26 mmol) and tetra-n-butylammonium iodide (0.20 g, 0.53 mmol). The reaction mixture was stirred at 70 ⁰C overnight. The reaction mixture was poured into water and the organic layer was washed with brine, dried over sodium sulfate, and concentrated. The residue was purified with silica gel column chromatography eluting with 25% ethyl acetate in hexane to provide a light yellow solid (109, 670 mg, 64.0%). MS(ESI)[M+H⁺]⁺ = 199.4.

Example 36: Synthesis of [2,6-dichloro-3-(2,2,2-trifluoro-ethoxy)-phenyl]-[5-(l-methyl-lH- pyrazol-4-yl)-lH-pyrrolo[2,3-b]pyridin-3-yll-methanone P-2151.

[0406] [2,6-Dichloro-3-(2,2,2-trifluoro-ethoxy)-phenyl]-[5-(l -methyl-lH-pyrazol-4-yl)-lH- pyrrolo[2,3-b]pyridin-3-yl]-mcthanone P-2151 was synthesized in five steps as shown in Scheme 35.

Step 1 - Preparation oftert-butyl-(2,4-dichloro-phenoxy)-dimethyl-silane (113):

[0407] To 2,4-dichloro-phenol, (112, 4.80 g, 0.0294 mol) in N,N-dimethylformamide (100.0 mL) were added lH-imidazole (5.21 g, 0.0766 mol) and tert-butyldimethylsilyl chloride (5.33 g, 0.0353 Atty. Dkt. No.: 039363-3303 mol). The reaction was stirred at room temperature overnight. The reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 15% to 50% ethyl acetate in hexane to give a colorless oil (113, 7, 1 O g, 87.0%).

Step 2 - Preparation of2,6-dichloro-3-hydroxy-benza!dehyde (114): [0408] To tert-butyl-(2,4-dichloro-phenoxy)-dimethyl-silane (113, 4.00 g, 0.0144 mol) in tetrahydrofuran (50.0 mL), under an atmosphere of nitrogen at -78 ⁰C, n-butyllithium (2.50 M in hexane, 6.06 mL) was added slowly. After 30 minutes, N,N-dimethylformamide (1.34 mL, 0.0173 mol) was added to the reaction. After 1 hour, the reaction was allowed to warm to room temperature. IN HCl (40 mL) was added to the reaction. The reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 20% ethyl acetate in hexane to give a yellow solid (114, 2.0 g, 72.6%).

Step 3 — Preparation of2, 6-dichloro-3-(2,2,2-trifluoro-ethoxy)~benzaldehyde (115): [0409] To 2,6-dichloro-3-hydroxy-benzaldehyde (114, 2.06 g, 0.0108 mol) in N-methylpyrrolidinone (25.0 mL) were added cesium carbonate (7.02 g, 0.0215 mol) and trifluoro- methanesulfonic acid 2,2,2 -trifluoro-ethyl ester (2.50 g, 0.0108 mol) under an atmosphere of nitrogen. The reaction was stirred at room temperature for 90 hours. The reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 15% to 100% ethyl acetate in hexane to give a colorless oil (115, 1.00 g, 34.0%).

Step 4 - Preparation of [2,6-dichloro-3-(2,2,2-trifluoro-ethoxy)-phenyl] -[5-(l-methyl-l H-pyrazol-4- yl)- 1 H-pyrrolo[2,3-bJ pyridin-3-yl] -methanol (116):

[0410] To 5-(l-methyl-lH-pyrazol-4-yl)-lH-pyrrolo[2,3-b]pyridine (109, 100.0 mg, 0.51 mmol, prepared as described in Example 35) in methanol (30 mL) were added 2,6-dichloro-3-(2,2,2- trifluoro-ethoxy)-benzaldehyde (115, 154 mg, 0.56 mmol) and potassium hydroxide (596.0 mg, 10.62 mmol) under an atmosphere of nitrogen. The reaction was stirred at room temperature overnight. The reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 2% to 25% methanol in dichloromethane to give the desired compound (116, 0.1 8 g, 75.7%).

Step 5 - Preparation of [2, 6-dichloro-3-(2,2,2-trifluoro-ethoxy)-phenyl]-[5-(l -methyl- 1 H-pyrazol-4- yl)-lH-pyrrolo [2, 3-b] pyridin-3-yl] -methanone (P-2151):

[0411] To [2,6-dichloro-3-(2,2,2-trifluoro-ethoxy)-phenyl]-[5-(l-methyl-lH-pyra/ol-4-yl)-lH- Atty. Dkt. No.: 039363-3303 pyrrolo[2,3-b]pyridin-3-yl]-methanol (116, 100,0 mg, 0.21 mmol) in dichloromethane (10.0 mL), Dess-Martin periodinane (108 mg, 0.26 mmol) was added. The reaction was stirred at room temperature for 10 minutes. The reaction mixture was poured into aqueous potassium carbonate and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography cluting with 20% to 100% ethyl acetate in hexane to give a white solid (P-2151, 19.4 mg, 19.5%). MS (ESI) [M+H'f = 469.1.

[0412] 2,6-Difluoro-4-hydroxy-benzaldehyde 117

was prepared following the protocol of Scheme 35, steps 1 and 2, substituting 2,4-dichloro-phenol with 3,5-difluoro-phenol in step 1.

Example 37: Synthesis of 2-chloro-5-fluoro-4-|2-(2-methoxy-ethoxy)-ethoxy]-benzaldehyde 121.

[0413] 2-Chloro-5-fluoro-4-[2-(2-methoxy-ethoxy)-ethoxy]-benzaldehyde 121 was synthesized in 4 steps as shown in Scheme 36.

Scheme 36

Step 1- Preparation of 2-chlυro-4,5-diflιιoro-benzoic acid methyl ester (119): [0414] To 2-chloro-4,5-difluoro-bcnzoic acid (118, 14.0 g, 0.0727 mol) in methanol (100 mL) was added sulfuric acid (concentrated, 98%, 2.00 mL, 0.0375 mol). The reaction was stirred at 60 ⁰C for 48 hours. The reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 20% ethyl acetate in hexane to give a colorless oil (119, 13.0 g, 86,6%).

Step 2 - Preparation of(2-chloro-4,5-diβuυro-phenyl)-rnethanol (120): [0415] To 2-chloro-4,5-difluoro-benzoic acid methyl ester (119, 5.70 g, 0,0276 mol) in tetrahydrofuran (120,0 mL), 1.00 M of lithium tetrahydroaluminate in tetrahydrofuran (30.0 mL) was added slowly under an atmosphere of nitrogen. The reaction was stirred at room temperature for 4 hours, followed by adding sodium sulfate decahydrate. After 30 minutes, the reaction mixture was Atty. Dkt. No.: 039363-3303 filtered, concentrated and purified with silica gel column chromatography eluting with 8% methanol in dichloromethane to give a white solid (120, 4.20 g, 85.2%),

Step 3 - Preparation of2-chloro-4,5-difluoro-benzaldehyde (UO):

[0416] To (2-chloro-4,5-difluoro-phenyl)-methanol (120, 2.40 g, 0.0134 mol) in dichloromethane (40.0 πiL) was added Dess-Martin periodinane (6.84 g, 0.0161 mol). The reaction was stirred at room temperature for 10 minutes. The reaction was poured into aqueous potassium carbonate and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 30% ethyl acetate in hexane to give a white solid (110, 1.7 g, 71 ,6%).

Step 4 - Preparation of 2-chloro-5-fluoro-4-[2-(2-methoxy-ethoxy)-ethoxy] -benzaldehyde (121): [0417] To 2-chloro-4,5-difluoro-benzaldehyde (110, 0.40 g, 0.0023 mol) in N,N- dimethylformamide (10.0 mL), 2-(2-methoxyethoxy)-ethanol (0.327 g, 2.72 mmol) and cesium carbonate (0.886 g, 2.72 mmol) were added. The reaction was stirred at 90 °C overnight. The reaction was poured into water, acidified to pH around 5, and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 30% ethyl acetate in hexane to give a white solid (121, 0.15 g, 24.0%).

Example 38: Synthesis of 2-chloro-5-fluoro-4-hydroxy-benzaldehyde 111.

[0418] 2-Chloro-5-fluoro-4-hydroxy-benzaldehyde 111 was synthesized in one step from 2-chloro- 4,5-difluoro-benzaldehyde 110 as shown in Scheme 37.

Scheme 37

Step 1 - Preparation of2-chhro-5-fluoro-4-hydroxy-henzaldehyde (111):

[0419] To 2-chloro-4,5-diiluoro-benzaldehyde (110, 0.40 g, 2.30 mmol, prepared as described in Example 37) in N,N-dimethylformamide (10.0 mL) were added 2-(2-methoxyethoxy)-ethanol, (0.327 g, 2.72 mmol) and cesium carbonate (0.886 g, 2.72 mmol). The reaction was stirred at 90 ⁰C overnight. The reaction was poured into water, acidified to pH around 5, and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 30% ethyl acetate in Atty. Dkt. No.: 039363-3303 hexane to give a white solid (111, 0.24 g, 61.0%). MS (ESI) [M-IFp = 173.1.

Example 39: Synthesis of 2-chloro-6-fluoro-3-(2-methoxy-ethoxy)-benzaldehyde 123.

10420] 2-Chloro-6-fluoro-3-(2-methoxy-ethoxy)-benzaldehyde 123 was synthesized in 2 steps from 2-chloro-4-fluorophenol 52 as shown in Scheme 38.

Step 1 — Preparation of 2-chloro-4-fluoro- 1 -(2-methoxy-ethoxy)-benzene (122); 10421] To 2-chloro-4-fluorophenol (52, 2.40 niL, 0.0213 mol) in N,N-dimethylformamide (30.0 mL), 1 -bromo-2-methoxy-ethane (2.00 mL, 0.0213 mol) and potassium carbonate (3.00 g, 0.0217 mol) were added under an atmosphere of nitrogen. The reaction was stirred at 80 ⁰C for 2 hours. The reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 20% ethyl acetate in hexane to give a colorless oil (122, 1.50 g, 34.4%).

Step 2 - Preparation of2-chhro-6-fluaro-3-(2-methoxy-ethoxy)-benzaldehyde (123): [0422] To 2-chloro-4-fluoro-l-(2-methoxy-ethoxy)-benzene (122, 1.50 g, 7.33 mmol) in tetrahydrofuran (44,0 mL), under an atmosphere of nitrogen at -78 ⁰C, n-butyllithium (2.50 M in hexane, 3.08 mL) was added slowly. After 15 minutes, N,N-dimethylformamidc (0.681 mL, 8.80 mmol) was added to the reaction. After 30 minutes, the reaction was allowed to warm to room temperature. The reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 30% ethyl acetate in hexane to give a light yellow solid (123, 1.2O g, 70.4%).

Example 40: Synthesis of 2-chloro-6-fluoro-3-(2,2,2-trifluoro-ethoxy)-benzaldehyde 125.

[0423] 2-Chloro-6-fluoro-3-(2,2,2-trifluoro-ethoxy)-benzaldehyde 125 was synthesized in 2 steps from 2-chloro-4-fluorophenol 52 as shown in Scheme 39.

Scheme 39 Atty. Dkt. No.: 039363-3303

Step 1 - Preparation of2-chϊoro~4-fluoro-l-(2,2,2-trifluoro-ethoxy)-henzene (124): [0424] To 2-chloro-4-fluorophenol (52, 1.58 g, 0.0108 mol) in N-methylpyrrolidinone (25.0 mL), cesium carbonate (7.02 g, 0.0215 mol) and trilluoro-methanesulfonic acid 2,2,2-trifluoro-ethyl ester (2.50 g, 0.0108 mol) were added under an atmosphere of nitrogen. The reaction was stirred at room temperature for 90 hours. The reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 15% to 100% ethyl acetate in hexane to give a colorless oil (124, 2.10 g, 85.3%).

Step 2 — Preparation of2-chloro-6-fluoro-3-(2,2,2-triflnυro-ethoxy)-benzaldehyde (125): [0425] To 2-chloro-4-fluoro-l -(2,2,2-trifluoro-ethoxy)-benzene (124, 2.1O g, 9.19 mmol), under an atmosphere of nitrogen at at -78 ⁰C, n-butyllithium (2.50 M in hexane, 3.86 mL) was added slowly. After 60 minutes, N,N-dimethylformamide (0.782 mL, 0.0101 mol) was added to the reaction. After 30 minutes, the reaction was allowed to warm to room temperature for 10 minutes. The reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 20% ethyl acetate in hexane to give the desired compound (125, 450 mg, 19

Example 41: Synthesis of 5-chIoro-3-2-chIoro-5-fluoro-4-[2-(2-methoxy-ethoxy)-ethoxy]-benzyI- lH-pyrroIo[2,3-b]pyridine P-2155.

[0426] 5-Chloro-3-2-chloro-5-fluoro-4-[2-(2-methoxy-ethoxy)-ethoxy]-ben7yl-lH-pyrrolo[2,3- bjpyridine P-2155 was synthesized in 2 steps from 5-Chloro-lH-pyrrolo[2,3-b]pyridine 4 as shown in Scheme 40.

LScheme 40

Atty. Dkt. No.: 039363-3303

Step 1 - Preparation of2-chloro-5-fluoro-4-[2-(2-methoxy-ethoxy)-ethoxy]-phenyl-(5-chloro-lH- pyrrolo[2, 3-b]pyridin-3-yl)-methanol (126):

[0427] To 5-chloro-lH-pyrrolo[2,3-b]pyridine (4, 74.1 mg, 0.49 mmol, prepared as described in Example 4) in methanol (30.0 mL), 2-chloro-5-fluoro-4-[2-(2-methoxy-ethoxy)-ethoxy]- benzaldehyde (121, 150.0 mg, 0.54 mmol, prepared as described in Example 37) and potassium hydroxide (574.0 mg, 10.23 mmol) were added under an atmosphere of nitrogen. The reaction was stirred at room temperature overnight. The reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 20% ethyl acetate in hexane to give the desired compound (126, 0.11 g, 52.7%).

Step 2 — Preparation of 5-chloro-3-2-chloro-5~fluoro-4-[2-(2-methoxy-ethoxy)-ethoxy] -benzyl- III- pyrrolo[2, 3-b] pyridine (P-2155):

[0428] To 2-chloro-5-fluoro-4-[2-(2-methoxy-ethoxy)-cthoxy]-phenyl-(5-chloro-lH-p>τrolo[2,3- b]pyridin-3-yl)-methanol (126, 65.0 mg, 0.15 mmol) in acetonitrile (10.0 mL), triethylsilane (1 ,00 mL, 6.26 mmol) and trifluoroacetic acid (0.50 mL, 6.50 mmol) were added. The reaction was heated to reflux for 2 hours. The reaction was poured into aqueous potassium carbonate and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and washed with ethyl acetate in hexane to give a white solid (P-2155, 21.3 mg, 34.0%). MS (ESI) [M+H⁺]⁺ = 413.2.

[0429] Additional compounds were prepared using the protocol of Scheme 40, substituting 2- chloro-5-fluoro-4-[2-(2-methoxy-ethoxy)-cthoxy]-benzaldehyde 121 with a suitable aldehyde (prepared as described in Examples 15, 36, 39, or 40), and optionally replacing 5-chloro-lH- pyrrolo[2,3-b]pyridine 4 with an appropriate substituted 7-azaindole (5-methoxy-7-azaindole per Example 8, 5-(l -methyl- lH-pyrazol-4-yl)-7-azaindole per Example 35) in Step 1. The following compounds were made following this procedure:

5-Chloro-3-[2-chloro-5-fluoro-4-(pyridin-3-ylmethoxy)-benzyl]-lH-pyrrolo[2,3-b]pyridine (P-

2156),

2-[4-(5-Chloro-lH-pyrrolo[2,3-b]pyridin-3-ylmethyl)-2,5-difluoro-phenoxymethyl]-lH- benzoimidazole (P-2100),

2-[2,5-Difluoro-4-(5-melhoxy-lH-pyrrolo[2,3-b]pyridin-3-ylmethyl)-phenoxymethyl]-lH- benzoimidazole (P-2101),

2-[3,5-Difluoro-4-(lH-pyrrolo[2,3-b]pyridin-3-ylmethyl)-phenoxymethyl]-lH-benzoimidazole

(P-2102), Atty. Dkt. No.: 039363-3303

2-[4-(5-Chloro-lH-pyrrolo[2,3-b]pyridin-3-ylmethyl)-3,5-difluoro-phcnoxymethyl]-lH- benzoimidazole (P-2105),

2-[4-(5-Bromo-lH-pyrrolo[2,3-b]pyridin-3-ylmethyl)-2,5-difluoro-phenoxymethyl]-lH- benzoimidazole (P-2107),

2-{2,5-Difluoro-4-[5-(1 -methyl-lH-pyrazol-4-yl)-lH-pyrrolo[2,3-b]pyridin-3-ylmethyl]- phenoxymethy 1 } - 1 H-benzo imidazole (P-2108),

2-{5-Chloro-2-fluoro-4-[5-(l -methyl-lH-pyrazol-4-yl)-lH-pyrrolo[2,3-b]pyridin-3-ylmethyl]- phenoxymethyl } -1 H-benzoimidazole (P-2109),

5-Chloro-3-[2-chloro-6-fluoro-3-(2-methoxy-ethoxy)-benzyl]- lH-pyrrolo[2,3-b]pyridine

(P-2157),

3-[2-Chloro-6-fluoro-3-(2-methoxy-ethoxy)-benzyl]- l H-pyrrolo[2,3-b]pyridine (P-2158),

3-[2-Chloro-6-fluoro-3-(2,2,2-trifluoro-ethoxy)-bcnzyl]-5-(l -methyl-lH-pyrazol-4-yl)-lH- pyrrolo[2,3-b]pyridine (P-2146),

3-[2-Chloro-6-fluoro-3-(2,2,2-trifluoro-ethoxy)-benzyl]-5-methoxy-lH-pyττolo[2,3-b]pyridinc

(P-2147),

3-[2-Chloro-6-fluoro-3-(2,2,2-trifluoro-ethoxy)-benzyl]-l H-pyrrolo[2,3-b]pyridine (P-2148)₎

3-[2,6-Dichloro-3-(2,2,2-trifluoro-ethoxy)-benzyl]-5-(l-methyl-lH-pyrazol-4-yl)-lH-pyrrolo[2,3- b]pyridine (P-2152), and

3-[2,6-Dichloro-3-(2,2,2-trifluoro-ethoxy)-benzyl]-5-methoxy-lH-pyrrolo[2,3-b]pyndine

(P-2153).

Atty. Dkt. No.: 039363-3303

Atty. Dkt. No.: 039363-3303

Example 42: Synthesis of I2-chIoro-6-fluoro-3-(2-methoxy-ethoxy)-phenyI]-(5-chloro-lH- pyrrolol2,3-b]pyridin-3-yI)-methanone P-2159.

10430] [2-Chloro-6-fluoro-3-(2-methoxy-ethoxy)-phenyl]-(5-chloro-lH-pyrrolo[2,3-b]pyridin-3-yl)- methanone P-2159 was synthesized in 2 steps from 5-Chloro-lH-pyriOlo[2,3-b]pyridine 4 as shown in Scheme 41.

Scheme 41

Step 1 --■ Preparation of[2-chloro-6-fluoro-3-(2-ntethoxy-ethoxy)-phenyl]-(5-chlυro-lII-pyrrolo[2,3- b]pyridin-3-yl)-methanol (127):

[0431] To 5-chloro-lH-pyrrolo[2,3-bJpyridine (4, 270.0 mg, 1.77 mmol, prepared as described in Example 4) in methanol (15.0 mL), 2-chloro-6-fluoro-3-(2-methoxy-ethoxy)-benzaldehyde (123. 474.0 mg, 2.04 mmol, prepared as described in Example 39) and potassium hydroxide (1.20 g, 0.0214 mol) were added under an atmosphere of nitrogen. The reaction was stirred at room temperature for 4 hours. The reaction was poured into water and extracted with ethyl acetate. The organic layer was Atty. Dkt. No.: 039363-3303 dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 40% ethyl acetate in hexane to give a colorless oil (127, 0,26 g, 38.1 %). MS (ESI) [M-H⁺]^' = 383.1.

Step 2 ^■- Preparation of[2-chloro-6-fluow-3-(2-nιethoxy-ethoxy)-phenyl]-(5-chloro-lH-pvrrolo[2,3- b]pyridin-3-yl)-methanone (P-2159):

[0432] To [2-chloro-6-fluoro-3-(2-methoxy-ethoxy)-phenyl]-(5-chloro-lH-pyrrolo[2,3-b]pyridin-3- yl)-methanol (127, 210.0 mg, 0.5.45 mmol) in tetrahydrofuran (20.0 mL) was added Dess-Martin periodinane (277 mg, 0,65 mmol). The reaction was stirred at room temperature for 10 minutes. The reaction was poured into aqueous potassium carbonate and extracted with ethyl acetate. The organic layer was dried with anhydrous sodium sulfate. The filtrate was concentrated and purified silica gel column chromatography eluting with 50% ethyl acetate in hexane to give a white solid (P-2159, 88.1 mg, 42.2%). MS (ESI) [M-H⁺]^' = 381.1.

[0433] Additional compounds were prepared using the protocol of Scheme 41 , optionally substituting 2-chloro-6-fluoro-3-(2-methoxy-ethoxy)-benzaldehyde 123 with a suitable aldehyde (prepared as described in Examples 36, 39 or 40), and/or optionally replacing 5-chloro-lH- pyrτolo[2,3-b]pyridine 4 with an appropriate substituted 7-azaindole (5-methoxy-7-azaindole per Example 8, 5-(l -methyl-lII-pyrazol-4-yl)-7-azaindole per Example 35) in Step 1. The following compounds were made following this procedure:

[2-Chloro-6-fluoro-3-(2-methoxy-ethoxy)-phenyl]-(lH-pyrrolo[2,3-b]pyridin-3-yl)-methanone

(P-2160),

[2-Chloro-6-fluoro-3-(2,2,2-trifluoro-ethoxy)-phenyl]-[5-(l -methyl-lH-pyrazol-4-yl)-lH- pyrrolo[2,3-b]pyridin-3-yl]-methanone (P-2145),

[2-Chloro-6-fluoro-3-(2,2,2-trifluoro-ethoxy)-phenyl]-(5-methoxy-lH-pyrrolo[2,3-b]pyridin-3- yl)-methanone (P-2149),

[2-Chloro-6-fluoro-3-(2,2,2-trifluoro-ethoxy)-phenyl]-(lH-pyrrolo[2,3-b]pyridin-3-yl)-methanone

(P-2150),

[2,6-Dichloro-3-(2₎2,2-trifluoro-ethoxy)-phenyl]-[5-(l-methyl-lH-pyrazol-4-yl)-lH-pyrrolo[2,3- b]pyridin-3-yl]-methanone (P-2151), and

[2,6-Dichloro-3-(2,2_!2-trifluoro-ethoxy)-phenyl]-(5-methoxy-lH-pyrrolo[2,3-b]pyridin-3-yl)- methanone (P-2154).

The following table indicates the aldehyde (column 2) and the azaindole (column 3) used to afford the target compound (column 4). Column 1 indicates the compound number and column 5 the observed mass. Atty. Dkt. No.: 039363-3303

Example 43: Synthesis of 2,5-Difluoro-4-[5-(l-methyl-lH-pyrazol-4-yl)-lH-pyrrolo[2,3- b]pyridin-3-ylmcthyl]-phenol P-2161.

[0434] 2,5-Difluoro-4-[5-(l -methyl-lH-pyrazol-4-yl)-lH-pyrrolo[2,3-b]pyridin-3-ylmethyl]-phenol P-2161 was synthesized in 1 step from 2-[4-(5-bromo-lH-pyrrolo[2,3-b]pyridin-3-ylmethyl)-2,5- difluoro-phenoxymethyl]-l ll-benzoimidazole P-2107 as shown in Scheme 42.

Scheme 42

Atty. Dkt. No.: 039363-3303

Step 1 ~ Preparation of2,5-difluoro-4-[5-(l-methyl-lH-pyrazol-4-yl)-lH-pyrrolo[2,3-h]ρyridin-3- ylmethyl] -phenol (P-2161):

|0435] To 2-[4-(5-bromo-lH-pyτrolo[2,3-b]pyridin-3-ylmethyl)-2,5-difluoro-phenoxymethyl]-lH- benzoimidazole (P-2107, 25.0 mg, 0.053 mmol, prepared as described in Example 41) in acetonitrile (4.00 mL) and IM potassium carbonate in water (2.00 mL), l -methyl-4-(4,4,5,5-tetramethyl- [l ,3,2]dioxaborolan-2-yl)-l H-pyrazolc (13.3 mg, 0.064 mmol) and tetrakis(triphenylphosphine)- palladium(O) (10.0 mg, 8.65E-3 mmol) were added. The reaction was heated to 160 ⁰C for 20 minutes in a CHM Discover microwave instrument. The reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 20% to 100% ethyl acetate in hexane to give a white solid (P-2161, 5.4 mg, 29.8%). MS (ESI) [M+HT = 341.2.

Example 44: Synthesis of (5-chloro-lH-pyrrolo[2,3-b|pyridin-3-yl)-[2-cycIopropyImethoxy-3- (2,4,6-trifluoro-benzyloxy)-phenyll-methanone P-2141.

[0436] (5-Chloro-lH-pyrrolo[2,3-b]pyridin-3-yl)-[2-cyclopropylmethoxy-3-(2,4,6-trifluoro- benzyloxy)-phenyl]-methanone P-2141 was synthesized in 7 steps as shown in Scheme 43.

Step 1 - Preparation of2,3-bis-henzylυxy-benzaldehyde (128):

[0437] To a solution of 2,3-dihydroxybenzaldehyde (61, 25 g, 0.18 mol) in N,N-dimethylformamide (150 mL) tctrahydrofuran (250 mL), sodium hydride (7.24 g, 0.18 mol) was added at 0 °C under an atmosphere of nitrogen. The reaction mixture was allowed to warm to room temperature and was stirred at room temperature for 10 minutes. To the reaction mixture was then added benzyl bromide (54 mL, 0.45 mol). The reaction mixture was stirred at room temperature under an atmosphere of nitrogen for 3 hours, then cooled down to 0 ⁰C. Sodium hydride (8 g, 0.2 mol) was added to the reaction mixture. The reaction mixture was allowed to warm to room temperature and was stirred at room temperature overnight. The reaction mixture was poured into ice water and extracted with ethyl acetate. The organic layer was collected, washed with brine, and dried over magnesium sulfate. After removal of solvent, the residue was purified by silica gel column chromatography eluting with ethyl Atty. Dkt, No,: 039363-3303 acetate in hexane to provide the compound as an off-white solid (128, 46.2 gm, 80%).

Step 2 — Preparation of 3-benzyloxy-2-hydroxy-benza!de.hyde (129):

[0438] To magnesium (2.9 g, turnings, 0.12 mol) in a mixture of anhydrous ether (85 mL) and benzene (85 mL) at 0 ⁰C, bromine (3.4 mL, 0.066mol) was added dropwise. When the reaction had started, stirring was commenced and the addition of bromine continued until complete. The ice bath was removed and the reaction mixture was heated until the solution was almost colorless. After cooling down, the reaction mixture was slowly added to a solution of 2,3-bis-benzyloxy-benzaldehyde (128, 20 g, 0.063mol) in benzene (415 mL) at room temperature while stirring vigorously. Upon completion of the addition, the reaction mixture was stirred at room temperature overnight, and then re fluxed for 36 hours. After the reaction mixture was cooled down to room temperature, a solid was collected by filtration and washed with benzene, then boiled in hydrochloric acid (100 mL, 1.0 M) for 30 minutes. After cool down, the solution was extracted with dichloro methane. The organic layer was washed with brine and dried over magnesium sulfate. A light tan solid was obtained after removal of the solvent (129, 12.5 g, 87%).

Step 3 Preparation of3~benzyloxy~2~cydopropylmethoxy~benzaldehyde (130): [0439] To a mixture of 3-benzyloxy-2-hydroxy-benzaldehyde (129, 1.0 g, 4.38 mmol) and cesium carbonate (2.14 g, 6.57 mmol) in N,N-dimethylformamide (50 mL), cyclopropylmethyl bromide (1.77 g, 13.1 mmol) was added at room temperature. The mixture was stirred at 40 ⁰C for 3 days. The reaction mixture was poured into a solution of saturated ammonium chloride and was extracted with ethyl acetate. The organic layer was collected, washed with brine, and dried over magnesium sulfate. After removal of solvent, a viscous liquid was obtained (130, 1.21 g, 98%).

Step 4 - Preparation of[3-benzyloxy-2-cyclopropylmethoxy-phenyl]-(5-chloro-lH-pyrrolo[2,3- b]pyridin-3-yl)-methanol (131):

[0440] A mixture of 5-chloro-lH-Pyrrolo[2,3-6]pyridine (4, 0.68 g, 4.46 mmol, prepared as described in Example 4), 3-benzyloxy-2-cyclopropylmethoxy-benzaldehyde (130, 1.2 g, 4.25 mmol), and potassium hydroxide (0.68 g, 1 1 mmol) in methanol (50 mL) was stirred at room temperature for 4 days. The reaction mixture was poured into water and extracted with ethyl acetate. The organic layer was collected, washed with brine, and dried over sodium sulfate. After removal of solvent, the residue was purified by silica gel column chromatography eluting with ethyl acetate in hexane to provide compound as a white solid (131, 0.99g, 54%). MS(ESI) [M+H⁺]⁺ = 435.21.

Step 5 - Preparation of[3-benzyloxy-2-cyclopropylmethoxy-phenyl]-(5-chloro-lH-pyrroIo[2,3- b]pyridin-3-yl)-methanυne (132):

[0441] To a solution of [3-benzyloxy-2-cyclopropylmethoxy-phcnyl]-(5-chloro-l H-pyrrolo[2,3- b]pyridin-3-yl)-methanol (131, 0.99g, 2.28 mmol) in tetrahydrofuran (120 mL), Dess-Martin Atty. Dkt. Ko.: 039363-3303 periodinane (2.4 g, 5.69 mmol) was added at O ⁰C. The reaction mixture was stirred at 0 ⁰C for 50 minutes. The reaction was quenched with a saturated solution of sodium thiosulfate, extracted with ethyl acetate, washed with sodium bicarbonate, brine, and dried over magnesium sulfate. After removal of solvent, the residue was dried over vacuum to provide the compound as a yellow solid (132, 0.92 g, 93%).

Step 6- Preparation of(5-chloro-lH-pyrrolo[2,3-b]pyridin-3-yl)-(2-cyclopropylmethoxy-3-hydroxy- phenylj-methanone (133):

[0442] A mixture of [3-benzyloxy-2-cyclopropylmethoxy-phenyl]-(5-chloro-lH-pyrrolo[2,3- b]pyridin-3-yl)-metbanone (132, 0.92 g, 2.13 mmol) and palladium on carbon (100 mg, 10%, 0.5 mmol) in methanol (60 mL) and tetrahydrofuran (60 mL) was stirred under an atmosphere of hydrogen overnight. After filtering off of catalyst and removal of solvent, the residue was purified by silica gel column chromatography eluting with ethyl acetate in hexane to provide the compound as a white solid (133, 236 mg, 32%).

Step 7- Preparation of(5-chloro-lH-pyrrolo[2,3-b]pyridin-3-yl)-[2-cyclopropylmethoxy-3-(2,4, 6- trifluoro-benzyloxy)-phenyl]-methanone (P-2141):

[0443] To a solution of (5-chloro-lH-pyrrolo[2,3-b]pyridin-3-yl)-(2-cyclopropylmethoxy-3- hydroxy-phenyl)-methanone (133, 50 mg, 0.15 mmol) in tetrahydrofuran (3.0 mL), a mixture of (2,4,6-trifluoro-phenyl)-methanol (47.3 mg, 0.29 mmol), triphenylphosphine (53.6 mg, 0.20 mmol), and diisopropyl azodicarboxylate (35.4 mg, 0.18 mmol) in tetrahydrofuran (2.0 mL) was added at 0 ⁰C. The reaction mixture was stirred at 65 °C overnight. The reaction mixture w^ras poured into ice water and extracted with ethyl acetate. The organic layer was collected, washed with brine, and dried over magnesium sulfate. After removal of solvent, the residue was purified by silica gel column chromatography eluting with ethyl acetate in hexane to provide the compound as a white solid (P-2141, 19.3 mg, 27%). MS(ESI) [M+H"]⁺ = 487.22.

[0444] [(5-Chloro-lII-pyrrolo[2,3-b]pyridin-3-yl)-[2-cyclopropylmethoxy-3-(6-trifluoromethyl- pyridin-3-ylmethoxy)-phenyl]-methanone (P-2142) and (5-chloro-lH-pyrrolo[2,3-b]pyridin-3-yl)-[2- cyclopropylmethoxy-3-(2,4-dimethyl-thiazol-5-ylmethoxy)-phenyl]-methanone (P-2140)

were prepared following the protocol of Scheme 43, substituting (2,4,6-trifluoro-phenyl)-methanol with (6-trifluoromethyl-pyridin-3-yl)-rnethanol in Step 7 to provide P-2142 (MS(ESI) [M+H¹] ' = 502.23), or substituting (2,4,6-trifluoro-phenyl)-methanol with (2,4-dimethyl-thiazol-5-yl)-methanol in Step 7 to provide P-2140. (MS(ESI) [M+H⁺]⁺ = 468.19). Atty. Dkt. No.: 039363-3303

Example 45: Synthesis of [2-ethoxy-3-(2-fluoro-benzyloxy)-phenyl]-(lH-pyrrolo[2,3-blpyridin-3- yl)-methanoπe P-2127 and related compounds.

[0445] t2-Ethoxy-3-(2-fluoro-benzyloxy)-phenyl]-(lH-pyrrolo[2,3-b]pyridin-3-yl)-methaπone P-2127 was synthesized in one step from (2-ethoxy-3-hydroxy-phenyl)-(l -triisopropylsilanyl-lH- pyrrolo[2.3-b]pyridin-3-yl)-methanone 99 as shown in Scheme 44.

Scheme 44

Step 1 — Preparation [2-ethoxy-3-(2-fluoro-benzyloxy)-phenyl]-(lH-pyrrolo[2,3-b]pyridin-3-yl)- methanone (P-2127):

[0446] In a 4 mL vial, (2-ethoxy-3-hydroxy-phenyl)-(l-triisopropylsilanyl-lH-pyrrolo[2,3-b]pyridin- 3-yl)-methanone (99, 10 mg, 0.022 mmol, isolated after step 2 of Scheme 31 , Example 32) was combined with (2-fluoro-phenyl)-methanol (134, 3.5 mg 0.027 mmol). The solids were dissolved in dry tetrahydrofuran (200μl) and triphenylphosphine (7.0 mg, 0.022 mmol) was added. Once the solution was homogeneous, the mixture was cooled to below 0 ⁰C in a liquid nitrogen bath and diisopropyl azodicarboxylate solution (20mg in 100μl tetrahydrofuran) was added. The reaction mixture was allowed to warm to room temperature and the reaction was continued for 2 hours. The solvents were removed under reduced atmosphere. The resultant residue was diluted with 200μl dimethyl sulfoxide and potassium fluoride (10 mg) was added. The solution was allowed to react overnight to remove the TiPS group. The supernatant was purified by reverse phase HPLC using a Phenomcnex C-18 column (50mm x 10mm ID), and eluting with water with 0.1 % trifluoroacetic acid and a gradient of 20%-100% acetonitrile with 0.1% trifluoroacetic acid over 16 minutes and a flow rate of 6 mL/minute to provide P-2127 (1.2 mg, 14 %). MS(ESI) [M+H^*]⁺ = 391.1.

[0447] Additional compounds were prepared following the protocol of Scheme 44, replacing (2- fluoro-phcnyl)-methanol 134 with an appropriate alcohol. The following compounds were made following this procedure:

[2-Ethoxy-3-(2-pyrrolidin-l -yl-ethoxy)-phenyl]-(lH-pyrrolo[2,3-b]pyridin-3-yl)-methanone

(P-2121),

[2-Ethoxy-3-(6-methyl-pyridin-2-ylmethoxy)-phenyl]-(lH-pyrrolo[2,3-b]pyridin-3-yl)-methanone

(P-2122), Atty. Dkt No.: 039363-3303

[3-(4-Chloro-2-fluoro-benzyloxy)-2-ethoxy-phenyl]-(lH-pyrrolo[2,3-b]pyridin-3-yl)-mcthanone

(P-2123),

[3-(2,4-Dimethyl-thiazol-5-ylmethoxy)-2-ethoxy-phenyl]-(lH-pyrrolo[2,3-b]pyridin-3-yl)- methanone (P-2124),

[3 -(2,5-Dimethyl-2H-pyrazol-3-ylmethoxy)-2-ethoxy-phenyl] -( 1 I I-pyrrolo[2,3 -b]pyndin-3 -yl)- methanone (P-2125),

[2-Ethoxy-3-(3-morpholin-4-yl-propoxy)-phenyl]-(lH-pyrrolo[2,3-b]pyπdin-3-yl)-methanone

(P-2126),

[2 -Ethoxy-3 ~(6-morpholin-4-yl ~pyridin-3-ylmethoxy)-phenyl]-( 1 H-pyrrolo[2,3 -b]pyπdm-3 -yl)- methanone (P-2128),

[2-Ethoxy-3-(6-tnfluoromethyl-pyridin-3-ylmethoxy)-phenyl]-(lH-pyrTolo[2.3-b]pyridin-3-yl)- methanone (P-2129),

[3-(2,4-Dichloro-benzyloxy)-2-ethoxy-phenyl]-(lH-pyrrolo[2,3-b]pyridin-3-yl)-methanone

(P-2130),

[2-Ethoxy-3-(4-imidazol-l -yl-benzyloxy)-phenyl]-(lH-pyrrolo[2,3-b]pyridin-3-yl)-methanone

(P-2131),

[3-(2,4-Difluoro-benzyloxy)-2-ethoxy-phenyl]-(lH-pyrrolo[2,3-b]pyridin-3-yl)-methanone

(P-2132),

{2-Ethoxy-3-[l -(2-fluoro-phenyl)-ethoxy]-phenyl}-(lH-pyrrolo[2,3-b]pyridin-3-yl)-mcthanone

(P-2133),

[3-(l ,5-Dimethyl-lH-pyrazol-3-ylmethoxy)-2-ethoxy-phenyl]-(lH-pyrrolo[2,3-b]pyridin-3-yl)- methanone (P-2134),

[2-Ethoxy-3-(l-pyridin-4-yl-ethoxy)-phenyl]-(lH-pyrrolo[2,3-b]p>τidin-3-yl)-mcthanone

(P-2135),

[2-Ethoxy-3-((R)-l -p>τidin-4-yl-ethoxy)-phenyl]-(lH-pyrrolor2,3-b]pyridin-3-yl)-methanone

(P-2136),

[2-Ethoxy-3-(2,4,6-trifluoro-benzyloxy)-phenyl]-(lH-pyrrolo[2,3-b]pyridin-3-yl)-methanone

(P-2137),

{3-[l-(2,4-Dichloro-phenyl)-ethoxy]-2-ethoxy-phenyl}-(lH-pyrrolo[2_>3-b]pyπdin-3-yl)- methanonc (P-2138),

[3-(6-Diethylamino-pyridin-3-ylmethoxy)-2-ethoxy-phenyl]-(lH-pyrrolo[2,3-b]pyridin-3-yl)- methanone (P-2143), and

[2-Ethoxy-3-(6-pyrrolidm-l-yl-pyridin-3-ylmethoxy)-phenyl]-(lH-pyrrolo[2,3-b]pyπdin-3-yl)- methanone (P-2144),

The following table indicates the alcohol used in Column 2 to provide the compounds shown by structure in Column 3 Column 1 provides the compound number and Column 4 the mass spectrometry result. Atty Dkt. No.: 039363-3303

Atty. Dkt. No.: 039363-3303

Example 46: Synthesis of 2-I5-chIoro-4-(5-chIoro-lH-pyrrolo[2,3-b]pyridin-3-ylmethyl)-2- methoxy-phenoxyπiethyI]-lH-benzoimidazolc P-2104.

[0448] 2-[5-Chloro-4-(5-chloro-lH-pyrrolo[2,3-b]pyridin-3-ylmethyl)-2-methoxy-phenoxymethyI]- lH-benzoimidazole P-2104 was synthesized in four steps from 2-chloro-4,5-dimethoxy-benzaldehyde 135 as shown in Scheme 45. Atty Dkt No 039363-3303

Step I - Preparation of2-chloro 4 hydroxy -5 methoxy benzaldehyde (136)

[0449] 2-Chloro-4,5-dimethoxy-benzaldehyde (135, 2 OO g, O 00997 mol), dichloromethane (73 44 mL) and aluminum trichloride (2 50 g, 0 0187 mol) were combined under an atmosphere of nitrogen The reaction was stirred at room temperature overnight The reaction was poured into water and extracted with ethyl acetate The organic layer was dried over anhydrous sodium sulfate and filtered The filtrate was concentrated and washed with 5% ethyl acetate in hexane to provide an off-white solid (136, 757 mg, 41%) MS (ESI) [M-H⁺] = 185 0, 187 0

Step 2 - Preparation of 4-(lH-benzounιda∑ol-2-ylmethoxy)-2-chloro-5-methoxy benzaldehyde (137) [0450] 2-Chloro-4-hydroxy-5-methoxy-benzaldehyde (136, 2 30 g, 0 0123 mol) was dissolved in N,N-dimethylformamide (89 5 mL, 1 16 mol) and sodium hydride (60% dispersion in mineral oil, 541 mg, 0 0135 mol) was added After 20 minutes, 2-chloromethyl-lH-benzoimidazole (106, 2 05 g, 0 0123 mol) was added to the reaction The reaction was stirred at 80 °C overnight The reaction was concentrated in vacuo to an oil Ethyl acetate was added and washed with saturated sodium bicarbonate and brine The organic layer was dried over anhydrous sodium sulfate and filtered The filtrate was concentrated and puπfied b> silica gel column chromatography e luting with 30-70% ethyl acetate in hexane over 30 minutes to provide a white solid (137, 1 79 g, 46%) MS(ESI) [M+H⁺]⁺ = 317 1, 319 1

Step 3 - Preparation of [4-(lH-benzounidazol-2-ylmethoyy)-2-thloro-5-methoxy-phenvl]-(5-chloro- IH-pyrrυlυ[2, 3-b]pvndιn-3-yl)-methano! (138)

[0451] 5-Chloro-lH-pyrrolo[2,3-b]pyridme (4, 783 9 mg, 0 005138 mol, prepared as described in Example 4) and 4-(lH-benzoimidazol-2-ylmethoxy)-2-chloro-5-methoxy-benzaldehyde (137, 1 79 g, 0 00565 mol) were combined in methanol (100 mL, 2 mol) and potassium hydroxide (2 88 g, 0 0514 mol) was added The reaction was stirred at room temperature overnight The reaction was adsorbed onto silica and puπfied by silica gel column chromatography, elutmg with 1-15% methanol Atty. Dkt. No.: 039363-3303 dichloromethane to provide the desired compound as a yellow oil, which was redissolved in 200 mL of 25% ethyl acetate: hexanes and concentrated to provide a yellow solid (138, 1 .2 g, 50%). MS(EST) [M+HT = 469.1. 471.1.

Step 4 - Preparation of2-[5-chhro-4-(5-chloro-lH-pyrrolo[2,3-b]pyridiri-3-ylrnethyl)-2-methoxy- phenoxymethyl]-lH-ben∑oimidazole (P-2104):

[0452] [4-(l H-Benzoimidazol-2-ylmethoxy)-2-chloro-5-methoxy-phenyl]-(5-chloro-lH- pyrrolo[2,3-b]pyridin-3-yl)-methanol (138, 1.25 g, 0.00266 mol) was dissolved in acetonitrile (100 mL, 2 mol) and trifluoroacetic acid (5.65 mL, 0.0734 mol) and triethylsilane (11.3 mL, 0.0708 mol) were added. The reaction was heated at 70 °C for 2.5 hours The reaction was concentrated and ethyl acetate and 1 M aqueous potassium carbonate were added. The organic layer was washed with brine, dried over anhydrous sodium sulfate, and filtered. The filtrate was adsorbed onto silica and purified with silica gel column chromatography, eluting with 0-8% methanol: dichloromethane to provide the desired compound as a solid, which was washed with a minimum of ethyl acetate and hexanes and filtered. The collected solid was dried to provide P-2104 (232 mg, 19%). MS(ESI) [M+H⁺] " = 453.1, 455.1.

[0453] 2-[5-Chloro-2-methoxy-4-(lH-pyrrolo[2,3-b]pyridin-3-ylmethyl)-phenoxymethyl]-lH- benzoimidazole P-2103

was prepared following the protocol of Scheme 45, replacing 5-chloro-lH-pyrrolo[2,3-b]pyridine 4 with lH-pyrrolo[2,3-b]pyridine in Step 3. MS(ESI) [M+H⁺f = 419.2, 421.2.

Example 47: Synthesis of 3-[2-chloro-4-(4-chloro-2-fluoro-beπzyloxy)-5-methoxy-benzyl]-lH- pyrrolo[2,3-b] pyridine P-2166

[0454] 3-[2-Chloro-4-(4-chloro-2-fluoro-benzyloxy)-5-methoxy-benzyl]-lH-pyrrolo[2,3-b]pyridine P-2166 was synthesized in three steps from 2-chloro-4-hydroxy-5-methoxy-benzaldehyde 136 as shown in Scheme 46.

Scheme 46 Atty. Dkt. No.: 039363-3303

Step 1 - Preparation of2-chloro-4-(4-chloro-2-fluoro-benzyloxy)-5-methoxy-benzaldehyde (140): [0455] 2-Chloro-4-hydroxy-5-methoxy-benzaldehyde (136, 0.548 g, 2.94 mmol, prepared as described in Example 46, Scheme 45, step 1) was dissolved in N,N-dimethylformamide (40 mL) and sodium hydride (60% dispersion in mineral oil, 0.200 g, 5.00 mmol) was added. After 20 minutes, 1- bromomethyl-4-chloro-2-fluoro-benzene (139, 685 μL, 5.00 mmol) was added to the reaction mixture. The reaction was stirred at room temperature under an atmosphere of nitrogen for 5.5 hours. The reaction was concentrated to dryness in vacuo. The reaction was resuspended in water/saturated sodium bicarbonate and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography, eluting with 5-35 % ethyl acetate in hexane give a white solid (140, 0.942 g, 97 %), consistent with the desired compound by ¹H-NMR.

Step 2 - Preparation of [2-chloro-4-(4-chloro-2-fluoro-benzyloxy)-5-methoxy-phenyl]-(l- triisopropylsilanyl-lH-pyrrolo[2,3-b]pyridin-3-yl)-methanol (141):

[0456] 3-iodo-l -triisopropylsilanyl-lH-pyrrolo[2,3-b]pyridine (68, 582.0 mg, 1.45 mmol, prepared as described in Example 22) was dissolved in tetrahydrofuran (10.0 mL) at -20 ⁰C under an atmosphere of nitrogen, lsopropylmagnesium chloride in tetrahydrofuran (2.0 M, 0.79 mL) was added to the reaction. The reaction was stirred for 1 hour, during which the temperature rose to 0 ⁰C. The reaction was cooled to -20 ⁰C and 2-chloro-4-(4-chloro-2-fluoro-benzyloxy)-5-methoxy- benzaldehyde (140, 200 mg, 0.61 mmol) in tetrahydrofuran (7.0 mL) was added. The reaction was stirred for 1.5 hours during which time the temperature rose to 0 ⁰C. The reaction was quenched with methanol and adsorbed onto silica, then purified by silica gel chromatography, eluting with 0-20% ethyl acetate: hexanes, to provide the desired compound (141, 318 mg, 87%). MS (ESI): [M+H⁺] ⁺ = 603.3, 605.3. Atty. Dkt. No.: 039363-3303

Step 3 - Preparation of3-4-[l-(4-chIoro-phenyl)-ethoxy]~3-methoxy-benzyl-lH-pyrroϊo[2,3- h] pyridine (P-2166):

[0457] [2-Chloro-4-(4-chloro-2-fluoro-benzyloxy)-5-methoxy-phenyl]-(l -triisopropylsilanyl-lH- pyrrolo[2,3-b]pyridin-3-yl)-methanol (141. 0.160 g, 0.27 mmol) was dissolvewd in acetonitrile (10.0 mL). Trifluoroacetic acid (0.150 mL) and triethylsilane (0.250 mL) were added and the reaction was heated at 80 ⁰C for 1.5 hours. The reaction was adsorbed onto silica and purified by silica gel chromatography, eluting with 20-65% ethyl acetaterhexanes, to provide the desired compound (P-2166, 83.4 mg, 74 %). MS (ESI): [M+HT = 431.2, 433.2.

[0458] 5-Chloro-3 -[2-chloro-4-(4-chloro-2-fluoro-benzyloxy) -5 -methoxy-benzyl] - 1 H-pyrrolo[2,3 - b]pyridme P-2167

was prepared following the protocol of Scheme 46, replacing 3-iodo-l -triisopropylsilanyl-lH- pyrrolo[2,3-b]pyridine 68 with 5-chloro-3-iodo-l-triisopropylsilanyl-lH-pyrrolo[2,3-b]pyridine (prepared as described in Example 49) in Step 2 and eluting with 30-95% ethyl acetate in hexanes in Step 3. MS(ESI) [M+H⁺]⁺ = 465.1 , 467.1.

Example 48: Synthesis of 2-[4-(5-Chloro-lH-pyrrolo[2,3-b]pyridin-3-ylmethyl)-5-fluoro-2- methoxy-phenoxymethyl]-l-mettayl-lH-benziinidazole P-2106

[0459] 2-[4-(5 -Chloro- 1 H-pyrrolo [2,3-b]pyridin-3 -ylmethyl)-5 -fluoro-2-methoxy-phenoxymethyl] - 1 -methyl- lH-benzimidazole P-2106 was synthesized in four steps from 2-Fluoro-4-hydroxy-5- methoxy-benzaldehyde 39 as shown in Scheme 47.

Scheme 47

Atty. Dkt. No.: 039363-3303

Step 1 ~ Preparation of4-(lH-benzimidazol-2-ylmethoxy)-2-fluoro-5-methoxy-benzaldehyde (142): |0460] 2-Fluoro-4-hydroxy-5-methoxy-benzaldehyde (39, 0.290 g, 1.7 rnmol, prepared as described in Scheme 12 of Example 15) was dissolved in N,N-dimethylfoπnamide (20 mL, 200 mmol). Sodium hydride (60% dispersion in oil, 0.852 g, 2.13 mmol) was added to the solution and after the mixture was stirred for 20 minutes at room temperature, 2-chloromethyl-lH-benzoimidazole (106, 0.28 g, 1.7 mmol) was added to the reaction. The obtained mixture was heated to 80 ⁰C and stirred overnight. After cooling to room temperature, the reaction was poured into water and extracted with ethyl acetate. The organic portion was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with a gradient of ethyl acetate (40 to 100%) in hexane to give the desired coompound (142, 0.233 g, 45%).

Step 2- Preparation of 2-βuoro-5-methoxy-4-(l -methyl- lII-benzimidazol-2-ylmethoxy)-benzaldehyde (143):

[0461] 4-(lH-Benzimidazol-2-ylmethoxy)-2-fluoro-5-methoxy-benzaldehyde (142) (0.600 g, 2,0 mmol) was dissolved in N,N-dimethylformamide (15 mL, 190 mmol). After the addition of sodium hydride (60% dispersion in oil, 0.072 g, 3.0 mmol) the reaction was stirred for 15 minutes at room temperature. Methyl iodide (140 μL, 2.2 mmol) was added dropwise to the mixture. The reaction was stirred overnight at room temperature under an atmosphere of nitrogen. The solvent was evaporated to dryness under reduced pressure. Ethyl acetate was added and the organic portion was washed with water, dried over anhydrous sodium sulfate and concentrated. Purification with silica gel flash chromatography with a gradient of ethyl acetate in hexanes gave the desired compound as a white powder (143, 0.345 g, 55%). MS (ESI) [M+H⁺]⁺= 315.2.

Step 3 - Preparation ( 5 -Chloro-1-triisυprυpylsilanyl- IH- pyrrol o[2,3-b]pyridin-3-yl)-[2-fluυ ro-5- methoxy-4-( 1 -methyl- 1 H-benzυimida∑ol-2-ylmethoxy)-phenyl] -methanol (145): [0462] 5-Chloro-3-iodo-l -triisopropylsilanyl-lH-pyrrolo[2,3-b]pyridine (144, 0.235g, 0.541 mmol, prepared as described in Example 49) was dissolved in tetrahydrofuran (5 mL, 60 mmol). The Atty. Dkt. No.: 039363-3303 solution was cooled to -25 ⁰C. After the addition of 2 M of isopropylmagnesium chloride in tetrahydrofuran (400 μL) the reaction was wanned to -10 ⁰C with stirring. The reaction was cooled to -30 ⁰C and 2-fluoro-5-methoxy-4-(l -methyl- lH-bcnzimidazol-2-ylmcthoxy)-benzaldchydc (143, 0.170 g, 0.541 mmol) in 4 mL of tetrahydrofuran was added at once to the mixture. The reaction warmed to -10 ⁰C and then evaporated to dryness. Ethyl acetate was added and the organic portion was washed with saturated sodium bicarbonate solution and brine, dried over anhydrous sodium sulfate and concentrated. Purification with silica gel flash chromatography with a gradient of ethyl acetate (5 to 80%) in hexanes gave the desired compound 145.

Step 4 — Preparation 2-[4-(5-Chlυrυ-lH-pyrrυlυ[2,3-h]pyridin-3-ylmethyl)-5-fluυrυ-2-methυxy - phenoxymethyl] -J -methyl- IH-benzimidazole (P-2106):

[0463] (5-Chloro-l -triisopropylsilanyl-lH- pyrrolo[2,3-b]pyridin-3-yl)-[2-fluo ro-5-methoxy-4-(l - methyl-lH-benzimidazol-2-ylmethoxy)-phenyl]-methanol (145) (0.140 g, 0.225 mmol) was suspended in acetonitrile (5 mL, 100 mmol). Triethylsilane (1 .0 mL, 6.3 mmol) was added followed by trifluoroacetic acid (0.500 mL, 6.4 mmol). After the reaction was stirred at 60-80 ⁰C for 1.5 hours the solvent was evaporated to dryness. Ethyl acetate was added and the organic portion was washed with saturated sodium bicarbonate solution and brine, dried over anhydrous sodium sulfate and concentrated. Purification with silica gel flash chromatography eluting with a gradient of ethyl acetate (20 to 100%) in hexanes gave the desired compound as a white powder (P-2106, 0.034g, 34%). MS (ESI) [M+HT= 451.2.

[0464] 2-(l-Chloro-ethyl)-lH-benzoimidazole 147 was prepared in one step from 1-(1H- benzoimidazol-2-yl)-ethanol 146 as shown in Scheme 48.

Scheme 48

146 147

Step I - Preparation of 2-(l-Chloro-ethyl)-l H-benzimidazole (147): [0465] l-(lH-Benzimidazol-2-yl)-ethanol (146) (1.00 g, 6.16 mmol) was suspended in dichloromethane (50 mL, 800 mmol), Thionyl chloride (4.00 mL, 54.8 mmol) was added dropwise and the reaction was stirred at room temperature and then heated to 60 ⁰C for 6 hours. After cooling to room temperature the reaction was evaporated to dryness under reduced pressure. The obtained solid was washed with ethyl acetate. The powder was suspended in ethyl acetate and washed with saturated sodium bicarbonate solution and brine. The organic portion was dried over anhydrous sodium sulfate and concentrated. The obtained off-white solid was used without further purification Atty. Dkt. No.: 039363-3303

(147, 0.864 g, 76%). MS (ESI) [NMT]⁺ = 181.2.

[0466] 2-l-[4-(5-Chloro-lH-pyrrolo[2,3-b] pyridin-3-ylmethyl)-5-iluoro-2-methoxy-phenoxy]- ethyl-lH-benzimidazole P-2110

was prepared following the protocol of Scheme 47, replacing 2-chloromethyl-lH-benzimidazole 106 with 2-(l-chloro-ethyl)-lH-benzimidazole 147. MS(ESI) [M+H⁺]⁺ = 451.2, 453.2.

[0467] S-Chloro^-chloromethyl-lH-benzoimidazole 148 and 2-Chloromethyl~5-methoxy-lH- benzoimidazole 149

= 197.2) were prepared following the protocol of Scheme 48 replacing l-(lH-benzimidazol-2-yl)-ethanol 146 with (5-chloro-lH-benzoimidazol-2-yl)-methanol and (5-methoxy-lH-benzoimidazol-2-yl)-methanol, respectively.

Example 49: Synthesis of 5-chloro-3-iodo-l-triisopropylsilanyl-lH-pyrrolo[2,3-b]pyridine 144

[0468] 5-Chloro-3-iodo-l -triisopropylsilanyl-lH-pyrrolo[2,3-b]pyridine 144 was synthesized in one step from 5-Chloro-3-iodo-lH-pyrrolo[2,3-b]pyridine 150 as shown in Scheme 49.

Scheme 49

Step 1 - Preparation of5-Chloro-3-iodo-l-triisopropylsilanyl-lH-pyrrolo[2,3-b]pyridine (144): [0469] 5-Chloro-3-iodo-lH-pyrrolo[2,3-b]pyridine (150, 31.2 g, 0.1 12 mol) was dissolved in N- methylpyrrolidinone (800 mL) and NaH (60% dispersion, 4.93 g, 0.123 mol) was added at room temperature. The resulting mixture was stirred for 30 minutes. To this mixture was then added triisopropylsilylchloride (24.0 mL, 0.1 12 mol) and the resulting mixture was stirred for 2 hours. The reaction was quenched with water and extracted with ethyl acetate three times, washed by brine, dried, filtered, and concentrated in vacuo. The residue was subjected to silica gel Hash chromatography Atty. Dkt, No.: 039363-3303

(eluted by heptane to 5% ethyl acetate/heptane) to afford the desired compound (43 g, 88 %) as a pale-yellow solid.

Example 50: Synthesis of 6-chloro-2-[5-fluoro-2-methoxy-4-(l H-pyrrolo[2,3-b]pyridin-3- ylmethyl) -phenoxymethyl]-lH-benzimidazole P-2112

[0470] 6-chloro-2-[5-fluoro-2-methoxy-4-(l H-pyrrolo[2,3-b]pyridm-3-ylmethyl) -phenoxymethyl]- lH-benzimidazole P-2112 was synthesized in four steps from 2-Fluoro-4-hydroxy-5-methoxy- benzaldehyde 39 as shown in Scheme 50.

Scheme 50

Step 1 - Preparation of4-(6-chloro-lH-benzimidazol-2-ylmethoxy)-2-flιwro-5-methoxy-benzaldehyde

(151):

[0471] 4-(6-Chloro-lH-benzimidazol-2-ylmethoxy)-2-fluoro-5-methoxy-benzaldehyde (151) was prepared using the same protocol as described in Scheme 47 substituting 2-chloromethyl-lH- benzoimidazole 106 with 5-Chloro-2-chloromethyl-H-benzoimidazole 148 (prepared as described in

Example 48) in Step 1. Purification through silica gel column chromatography eluting with a gradient of ethyl acetate (10 to 100%) in hcxanc gave the desired compound 151,

Step 2 - Preparation of 6-chloro-2-(5-βuoro-4-formyl-2-methoxy-phenoxymethyl)-benzimidazole- 1 - carboxylic acid ten-butyl ester (152):

[0472] To a solution of 4-(5-chloro-l H-benzoimidazol-2-ylmethoxy)-2-fluoro-5-methoxy- benzaldehyde (151) (0.330 g, 0,98 mmol) in tetrahydrofuran (10 ml ) at room temperature was added N,N-diisopropylethylamine (0.40 mL, 2.3 mmol) followed by the addition of 4- dimethylaminopyridine (0.01 g, 0.1 mmol) polymer bound. To the stirring mixture a solution of di- tert-butyldicarbonate (0.24 g, 1.1 mmol) in tetrahydrofuran (5 mL) was added. After the reaction Atty. Dkt. No.: 039363-3303 mixture was stirred at room temperature overnight the solvent was removed under reduced pressure. The resulting solid was dissolved in ethyl acetate and the organic portion was washed with water, dried over anhydrous sodium sulfate and evaporated to dryness. The desired compound 152 was used without further purification.

Step 3 -- Preparation υf(5-Chlυro-2-{5-fluoro-4-[hydroxy-(l- triisopropylsilanyl-lH-pyrrolo[2,3- bj ^] pyridin- 3 -yl) -methyl) '-2-methoxy-phenoxymethyl}-benzimidazole- 1 -carboxylic acid tert-hutyl ester (153):

[0473] 3-Iodo-l -triisopropylsilanyl-lH-pyrrolo[2,3-b]pyridine (68, 0.200 g, 0.5 mmol, prepared as described in Example 22) was dissolved in tetrahydrofuran (3 mL, 40 mmol). After the reaction reached the temperature of -20 °C, a solution of 2M of isopropylmagnesium chloride in tetrahydrofuran (300 μL) was added dropwise. The resulted mixture was stirred to -5 °C. After cooling the reaction to -20 ⁰C, a solution of 6-chloro-2-(5-fluoro-4-formyl-2-methoxy- phenoxymethyl)-benzoimidazole-l -carboxylic acid tert-butyl ester (152, 0.2 g, 0.46 mmol) in tetrahydrofuran (4 mL) was added at once to the mixture. The reaction warmed to -5 ⁰C and was then evaporated to dryness under reduced pressure. Ethyl acetate was added. The organic portion was washed with saturated sodium bicarbonate solution, brine, dried over anhydrous sodium sulfate and concentrated. Purification with silica gel flash chromatography eluting with a gradient of ethyl acetate (5 to 80%) in hexanes gave the desired compound (153, 0.142 g, 44%). MS (ESI) [M+H⁺]⁺ = 709.4.

Step 4 - Preparation of6-Chloro-2-[5-fluυrυ-2-methυxy-4-(l H-pyrroIo[2,3-h]pyridin-3-ylmethyl) - phenoxy methyl]- 1 H-benzimidazole (P-2112):

10474] 6-Chloro-2-[5-fluoro-2-methoxy-4-(l H-pyrrolo[2,3-b]pyridin-3-ylmethyl) - phenoxymethy I]-I H-benzimidazole (P-2112) was prepared using the same protocol as described in Scheme 47, step 4, substituting (5-chloro-l-triisopropylsilanyl-lH- pyrrolo[2,3-b]pyridin-3-yl)-[2- fluoro-5-methoxy-4-(l -methyl- 111-benzoimidazol-2-ylmethoxy)-phenyl]-methanol 145 with (5- chloro-2- {5 -fluoro-4-[hydro xy-( l- triisopropylsilanyl-lH-pyrrolo[2,3- b]pyridin-3-yl)-methyl]-2- methoxy-phenoxymethyl}-benzoimidazole-l-carboxylic acid tert-butyl ester 153. Purification with silica gel flash chromatography eluting with a gradient of methanol (2 to 25%) in dichloromefhane gave the desired compound (P-2112, 0.052 g, 59%). MS (ESI) [M+H¹] ' = 437.1, 439.1.

[0475] Additional compounds were prepared following the protocol of Scheme 50, substituting 5-chloro-2-chloromethyl-lH-benzoimidazole 148 with the appropriate benzoimidazole in Step 1 , and 3-iodo-l-triisopropylsilanyl-lH-pyrrolo[2₎3-b]pyridine 68 with the appropriate substituted 7-azaindole in Step 3. Compound P-1976 (see Example 10) was prepared by this procedure and isolated with silica gel flash chromatography eluting with a gradient of ethyl acetate (60 to 100%) in hexanes followed by additional washes with acetonitrile over the final solid. Compound P-2113 was Atty. Dkt. No.: 039363-3303 further purified with silica gel flash chromatography eluting with a gradient of ethyl acetate (20 to 100%) in hexanes. The following compounds were also made following this procedure:

5-Chloro-2-[4-(5-chloro-lH-pyrrolo[2,3-b]pyridin-3-ylmethyl)-5-fluoro-2-methoxy- phenoxymethyl] - 1 H-benzimidazole (P-2111 ) ,

2-[5-Fluoro-2-methoxy-4-(lH-pyrrolo[2,3-b]pyridin-3-ylmcthyl)-phenoxymethyl]-5- mcthoxy-1 H-benzimidazole (P-2113),

2-[5-Fluoro-4-(5-fluoro-lH-pyrrolo[2,3-b]pyridin-3-ylmethyl)-2-methoxy-phenoxymethyl]-

1 H-benzimidazole (P-2115)

The following table indicates the benzoimidazole used in Column 2 and the 7-azaindole used in Column 3 to provide the compounds shown by structure in Column 4. Column 1 provides the compound number and Column 5 the mass spectrometry result.

Example 51: Synthesis of N-phenyl-lH-pyrrolo[2,3-b]pyridin-6-amine 158 and related compounds

[0476] N-phcnyl-lH-pyrrolo[2,3-b]pyridin-6-amine 158 was synthesized in five steps from IH- pyrτolo[2,3-b]pyridine 6 as shown in Scheme 51. Atty, Dkt. No.; 039363-3303 Scheme 51

Ste/7 i - Preparation of 1 H-pyrrolo[2,3-b]pyridine-N-oxide (154):

[0477] To lH-pyrrolo[2,3-b]pyridine (6, 3.0 g, 25.3mmol) dissolved in 175 mL of diethyl ether was added m-CPBA (1.5 equiv) in portions over 30 minutes with vigorous stirring. The solution turned yellow, and precipitates formed. After two hours the solid was collected, washed with 2 x 50 mL of ether, and recrystallized from acetone: ether. Yield was approximately 125% due to contaminating acid. This crude material was carried through to the next step.

Step 2 - (6-bromo-lH-pyrrolo[2,3-b]pyridin-l-yl)(phenyl)methanone (155):

[0478] lH-pyrrolo[2,3-b]pyridine-N-oxide (154, 500 mg, 3.72mmol) was dissolved in 40 mL of dry benzene. In a separate dry flask, benzoyl bromide (2.5 equiv) and 1,1, 1 ,3,3, 3-hexamethyldisilazane (1.0 equiv) were combined in 20 mL of dry benzene, The bromide solution was added in 5 mL aliquots over 30 minutes to the reaction flask, The reaction was stirred at ambient temperature for two hours. It was then washed with 3 x 30 mL NaHCOj (aq,, satd.) and 1 x 30 mL brine. The organic layer was dried over sodium sulfate and evaporated, The crude material was taken directly to the next step without further purification.

Step 3 — Preparation of 6-bromo-lH-pyrrolo [2, 3-b] pyridine (156):

[0479] (6-bromo-lH-pyrrolo[2,3-b]pyridin-l -yl)(phenyl)methanone 155 was dissolved in 20 mL of dioxane and 20 mL of 2M KOH (aq). This was stirred at ambient temperature until analysis indicated all of the starting material had been consumed (2 to 4 hours). The reaction was diluted with 50 mL of ethyl acetate and washed with 2 x 25 mL OfNaHCO₃ (aq. satd.) and 25 mL of brine. The organic layer was dried with sodium sulfate, evaporated and purified by column chromatography. Combined steps 2 and 3 gave approximately 65% overall yield.

Step 4 - Preparation of6-hromo~l-(triisopropy!silyl)~-JH-pyrro!o[2,3-h]pyridine (157): [0480] 6-bromo-lH-pyrrolo[2,3-b]pyridine (156, 275 mg, 1.39mmol) was dissolved in 4 mL of dry dioxane. DIEA (3 equiv) and TIPS-OTf (2.5 equiv) were added and the reaction was stirred at 50 "C overnight. The reaction was then diluted with 20 mL of ethyl acetate and washed 2 times with 10 mL NaHCθ₃ (aq., 5%) and once with 10 mL brine. The organic fraction was dried over MgSO₄, Atty. Dkt. No.: 039363-3303 evaporated and diluted with 5.5 niL of dry toluene (~ 10 mg bromide per 0.2 mL of solution) to use directly in the next reaction step.

Step 5- Preparation ofN-pheny!-lH-pyrrolo[2,3-b]pyridin-6-amine (158):

[0481] A 1 dram vial was charged with aniline (2 -3 equiv), and 0.200 mL of the 157 stock solution of bromide in toluene was added. A catalyst stock solution containing 3 mmol Pd(OAc)₂, 3 mmol biphenyl-2-yl-di-tert-butyl-phosphane and 15 mL of toluene was prepared and 0.050 mL of the catalyst solution was added to the reaction. An excess of NaOtBu was added as a solid to the reaction. The vial was placed in an 80 ⁰C oven for 60 minutes (shaken several times over the hour). After cooling, the reaction was neutralized with 0.100 mL of TFA. After 30 minutes the sample was evaporated and resolvated in 0.300 mL of DMSO. The desired compound was isolated by preparative HPLC/MS. MS(ESI) PVH-IT]⁺ = 210.4.

[0482] The following compounds were prepared following the protocol of scheme 51 , substituting aniline with a suitable amine is Step 5:

Cyclohexyl-(lH-pyrrolo[2,3-b]pyridin-6-yl)-amine (159), Benzyl-(lH-pyrrolo[2,3-b]pyridin-6-yl)-amine (160), Cyclopropylmethyl-( 1 H-pyrrolo [2,3 -b]pyridin-6-yl)-amine (161), (3-Methoxy-benzyl)-(lH-pyrrolo[2,3-b]pyridin-6-yl)-amine (162), (lH-Pyrrolo[2,3-b]pyridin-6-yl)-(3-trifluoromethyl-benzyl)-amine (163), (lH-Pyrrolo[2,3-b]p>τidin-6-yl)-(2-trifluoromethyl-benzyl)-amine (164), Cyclohexylmethyl-(lH-pyrrolo[2,3-b]pyridin-6-yl)-amine (165), (lH-Pyrrolo[2,3-b]pyridin-6-yl)-(4-trifluoromethoxy-benzyl)-amine (166), (lH-PyrroloP^-bJpyridin-ό-y^^S-trifluoromcthoxy-bcnzyO-aminc (167), (lH-Pyrrolo[2,3-b]pyridin-6-yl)-(2-trifluoromethoxy-benzyl)-amine (168), Pyridin-2-ylmethyl-(lH-pyrrolo[2,3-b]pyridin-6-yl)-amine (169), (4-Methanesulfonyl-benzyl)-(1 H-pyrrolo[2,3-b]pyridin-6-yl)-amine (170), (4-Methoxy-benzyl)-(lH-pyrrolo[2,3-b]pyridin-6-yl)-amine (171), Ethyl-(lH-pyrrolo[2,3-b]pyridin-6-yl)-amine (172), (3 -Chloro-benzyl)-( 1 H-pyrrolo [2,3 -b]pyridin-6-yl)-amine (173), (4-Methyl-benzyl)-( 1 H-pyrro]o[2,3-b]pyridin-6-yl)-amine (174), (l-Methyl-piperidin-4-yl)-(lH-pyrrolo[2,3-b]pyridin-6-yl)-amine (175), Pyridin-3 -ylmethyl-( 1 H-pyrrolo [2,3 -b]pyridin-6-yl)-amine ( 176), [4-(Morpholine-4-sulfonyl)-phenyl]-(lH-pyrrolo[2,3-b]pyridin-6-yl)-amine (177), (4-Methanesulfonyl-phenyl)-(lH-pyrrolo[2,3-b]pyridin-6-yl)-amine (178), (2-Chloro-benzyl)-(lH-pyrrolo[2,3-b]pyridin-6-yl)-amine (179), (lH-Pyrrolo[2,3-b]pyridin-6-yl)-(tetrahydro-pyran-4-yl)-amine (180), Atty. Dkt, No,: 039363-3303

(4-Chloro-benzyl)-(lH-pyrrolo[2,3-b]pyridin-6-yl)-amine (181), (3-Methyl-benzyl)-(lH-pyrrolo[2,3-b]pyridin-6-yl)-amine (182), [3-(Moφholinc-4-sulfonyl)-phenyl]-(lH-pyrrolo[2,3-b]pyridin-6-yl)-amine (183), (3-Methanesulfonyl-phenyl)-(lH-pyrrolo[2,3-b]pyτidin-6-yl)-amine (184), Pyridin-3-yl-(lH-pyrrolo[2,3-b]pyridin-6-yl)-amine (185), (2-Methoxy-phenyl)-(lH-pyrrolo[2,3-b]pyridin-6-yl)-amine (186), (lH-Pyrrolo[2,3-b]pyridin-6-yl)-(3-trifluoromethyl-phenyl)-amine (187), (lH-Pyrrolo[2,3-b]pyridin-6-yl)-(4-trifIuoromethoxy-phenyl)-amiπe (188), (4-Methoxy-phenyl)-(lH-pyrτolo[2_J3-b]pyridin-6-yl)-amine (189), N,N-Dimethyl-N^l-(lH-pyπ-olo[2,3-b]pyridin-6-yl)-benzene-l ,4-diamine (190), (3-Methoxy-phenyl)-(lH-pyrrolo[2,3-b]pyridin-6-yl)-amine (191), (4-Morpholin-4-yl-phenyl)-(lH-pyrrolo[2,3-b]pyridin-6-yl)-amine (192), (4-Piperidin-l -yl-phenyl)-(lH-pyrrolo[2,3-b]pyridin-6-yl)-amine (193), (HI-Pyrrolo[2,3-b]pyridin-6-yl)-(3-trifluoromethoxy-plienyl)-amine (194), (lH-Pyrrolo[2,3-b]pyridin-6-yl)-p-tolyl-amine (195), (3-tert-Butyl-phenyl)-( 1 H-pyrrolo [2,3 -b]pyridin-6-yl)-amine (196), (3-Dimethylamino-benzyl)-(lH-pyrrolo[2,3-b]pyridin-6-yl)-amine (197), (3,5-Dichloro-phenyl)-(lH-pyrrolo[2,3-b]pyridin-6-yl)-amine (198), (lH-Pyrrolo[2,3-b]pyridin-6-yl)-(4-trifluoromethyl-benzyl)-ainine (199), N,N-Dimethyl-N'-(lH-pyrrolo[2,3-b]pyridin-6-yl)-benzene-l,3-diamine (200), (3-Chloro-phenyl)-(lH-pyrrolo[2,3-b]pyridin-6-yl)-amiπe (201), (4-Chloro-phenyl)-(lH-pyrrolo[2,3-b]pyridin-6-yl)-aminc (202), (2-Chloro-phenyl)-(lH-pyrrolo[2,3-b]pyridin-6-yl)-amine (203), (5 -Methyl-isoxazol-3 -yl)-( 1 H-pyrrolo [2,3 -b]pyridin-6-yl)-amine (204) , (2-Mθφholin-4-yl-phenyl)-(lH-pyrrolo[2,3-b]pyridin-6-yl)-amine (205), and (2-Methanesulfonyl-phenyl)-(lH-pyrrolo[2,3-b]pyridin-6-yl)-amine (206).

The following table indicates the amine (Column 2) that is substituted in place of the aniline in Step 5 to afford the compound (Column 3), Column 1 provides the compound number and Column 4 the observed mass.

Atty. Dkt. No,: 039363-3303

Atty. Dkt. No.: 039363-3303

Atty. Dkt. No.: 039363-3303

Atty. Dkt. No.: 039363-3303

Example 52: Synthesis of 5-methanesulfonyl-lH-pyrroloI2,3-b]pyridiπe 207

[0483] 5-Methanesulfonyl-lH-pyrrolo[2,3-b]pyridine 207 was synthesized in one step from 5-bromo-7-azaindole 1 as shown in Scheme 52.

Scheme 52

[0484] I'o 5-bromo-7-azaindole (1, 1.00 g, 5.08 mmol) in dimethyl sulfoxide (15.0 mL) were added sodium methanesulfmate (0.622 g, 6.09 mmol), L-proline (0.117 g, 1.02 mmol), copper(I) iodide (0.200 g, 1.05 mmol), and sodium hydroxide (0.0406 g, 1 .02 mmol). The reaction was stirred at 120 ⁰C overnight. The reaction was poured into aqueous ammonia, and extracted with ethyl acetate, The Atty Dkt No 039363-3303 organic layer w as dried over anhydrous sodium sulfate, and filtered The filtrate was concentrated and purified by silica gel column chromatography eluting with 20% to 100% ethyl acetate in hexane to give the desired compound as a white solid (207, 0 50 g, 50 2%) MS (ESI) [M-H⁺] = 195 1

Example 53: Synthesis of 3-[4-(lH-Benzoimidazol-2-ylmethoxy)-2-fluoro-5-methoxy-bcnz>l]- lH-pyrrolo[2,3-b]pyridine-5-carboxylk acid P-2175

[0485] 3-[4-(lH-Benzoimidazol-2-ylmethoxy)-2-fluoro-5-methoxy-benzyl]-lH-p>rrolo[2,3- b]pyπdme-5-carboxylic acid P-2175 was synthesized in one step from 3-[4-(lII-benzoimidazol-2- yhnethoxy)-2-fluoro-5-methoxy-benzyl]-lH-pyrτolo[2,3-b]p>ridine-5-carboxylic acid methyl ester P- 2174 as shown in Scheme 53

Scheme 53

[0486] To 3-[4-(lH-benzoimidazol-2-ylmethoxy)-2-fluoro-5-methox>-benzyl]-lH-pyrrolo[2,3- b]pyridine-5-cdrboxyhc acid methyl ester (P-2174, 0 030 g, 0 065 mmol, prepared as described in Example 16) in tetrahydrofuran (9 0 mL) were added water (3 0 mL) and lithium hydroxide (20 0 mg, 0 84 mmol) The reaction was stirred at room temperature overnight The reaction was poured into water, and extracted with ethyl acetate The organic layer was discarded The aqueous layer was acidified with 5 N HCl to pH around 3, and then extracted with ethyl acetate The organic layer was dried over anhydrous sodium sulfate, and filtered The filtrate was concentrated, and washed with ethyl acetate and hexane to give a white solid (P-2175, 21 3 mg, 73%) MS (ESI) [M+H⁺]⁺ = 447 0

Example 54: Synthesis of S_jό-Dichloro^-^-fS-chloro-lH-pyrroloβ^-blpyridin-S-ylmethy^-S- fluoro-2-methoxy-phenoxymethyl]-lH-benzoimidazole P-2172

[0487] 5,6-Dichloro-2-[4-(5-chloro-lH-pyrrolo[2,3-b]pyridin-3-ylmethyl)-5-fIuoro-2-methoxy- phenoxymethyl]-lH-benzoimidazole P-2172 was synthesized in 3 steps from 2-fluoro-4-hydroxy-5- methoxy-benzaldehyde 38 as shown in Scheme "54 Scheme 54 Atty. Dkt. No.; 039363-3303

Step 1 - Preparation of4-(5, 6-dichlorυ-lH-benzoimidazol-2-ylmethoxy)-2-fluoro-5-methoxy~ benzaldehyde (209):

[0488] 2-Fluoro-4-hydroxy-5-methoxy-benzaldehyde (38, 0.364 g, 2.14 rnmol) was dissolved in N,N-dimethylformamide (10.0 mL) and sodium hydride (60% dispersion in mineral oil, 100 mg, 2.50 mmol) was added. After 20 minutes, 5,ό-dichloro-2-chloromethyl~lH-benzoimidazole (208, 0.420 g, 1.78 mmol) was added. The reaction was stirred at 80 ⁰C overnight. The reaction was concentrated, then washed with ethyl acetate and saturated sodium bicabonate. The organic portions were dried with anhydrous sodium sulfate, filtered and the filtrate was adsorbed onto silica. The mixture was purified by silica gel chromatography, eluting with methanol/ dichloromethane, to provide the desired compound, consistent by ¹H-NMR (209, 140 mg, 21%).

Step 2 — Preparation of 5, 6-dich!oro~2-4-[(5-ch!oro-lH-pyrrolo[2, 3-b] pyridin-3-yl)-methoxy-methyl] - 5-fluoro-2-methoxy-phenoxymethyl-lH-benzoimidazυh (210):

[0489] 5-Chloro-lH-pyrrolo[2,3-b]pyridine (4, 52.6 mg, 0.345 mmol) and 4-(5,6-dichloro-lH- benzoimidazol-2-ylmethoxy)-2-fluoro-5-methoxy~benzaldehyde (209. 0.140 g, 0.379 mmol) were dissolved in methanol (7 mL) and potassium hydroxide (0.193 g, 3.45 mmol) was added. The reaction was stirred at room temperature for 72 hours. The reaction was adsorbed onto silica and purified by silica gel chromatography, eluting with methanol/ dichloromethane to provide the desired compound, consistent by ¹H-NMR and MS(ESI) [M+H⁺]⁺=535.1 (210, 60 mg, 33%).

Step 3 - Preparation of 5, 6-Dichloro-2-[4~(5-chloro-lH-pyrrolo[2,3-b]pyridin-3-ylmethyl)-5-fluoro- 2-methoxy-phenoxymethyl]-lH-benzoimidazole (P-2172):

[0490] 5,6-Dichloro-2-4-[(5-chloro-l H-pyrrolo[2,3-b]pyτidin-3-yl)-methoxy-methyl]-5-fluoro-2- methoxy-phenoxymethyl- 1 H-benzoimidazole (210, 0.041 g, 0.077 mmol) was dissolved in acetonitrile (10 mL) and trifluoroacetic acid (0.3 mL, 4.0 mmol) and triethylsilane (0.6 mL, 4.0 mmol) were added. The reaction was heated to reflux for 2 hours. The mixture was adsorbed onto silica gel Atty. Dkt. No.: 039363-3303 and purified by silica gel chromatography, eluting with methanol/dichloromethane, to provide the desired compound, consistent by ¹H-KMR and MS(ESI): [M+HT = 505.0, 507.0 (P-2172, 8.1 mg, 21 %).

[0491] 2-[4-(5-Chloro-lH-pyrrolo[2,3-b]pyridin-3-ylmethyl)-5-fluoro-2-methoxy-phenoxymethyl]- 5-trifluoromethyl-lH-benzoimidazole P-2178 and 2-[4-(5-chIoro-lH-pyrrolo[2,3-b]pyridin-3- ylmethy^-S-fluoro^-mcthoxy-phcnoxymcthylJ-S-fluoro-lH-benzoimidazole P-2179 ,

were prepared following the protocol of Scheme 54, replacing 5,6-dichloro-2-chloromethyl-lH- benzoimidazole 208 with 2-chloromethyl-5-trifluoromethyl-lH-benzoimidazole or 2-chloromethyl-5- fluoro-lH-benzoimidazole, respectively, in Step 1. MS(ESI): [M+lT]⁺= 505.1 , 507.1 (P-2178) and 455.0, 456.5 (P-2179).

Example 55: Synthesis of 2-[4-(5-chloro-lH-pyrrolo[2,3-b]pyridin-3-ylmethyl)-5-fluoro-2- methoxy-phenoxymethyl]-l-methyl-lH-benzoimidazole P-2106

[0492] 2-[4-(5-Chloro-lH-pyrrolo[2,3-b]pyridiπ-3-ylmethyl)-5-fluoro-2-methoxy-phenoxymethyl]- 1-methyl-lH-benzoimidazolc P-2106 was synthesized in 4 steps from N-methyl-phenylenediamine 211 as shown in Scheme 55.

Scheme 55

Step 1 - Preparation of 2-chloromethyl- 1 -methyl- 1 H-benzoimidazole (212):

[0493] N-methyl-phenylenediamine (1 g, 8,2 mmol) and chloroacetic acid (0.9 g, 9.4 mol) were dissolved in 5 N aqueous hydrochloric acid (10 mL) and stirred at 55 ⁰C overnight. The reaction Atty. Dkt. No.: 039363-3303 mixture was then diluted with water and basified with solid sodium bicarbonate to give a precipitate which was filtered, washed with water and dried to provide the desired compound (1.3 g, 87 %).

Step 2 - Preparation of 2-fluoro- 5-methoxy-4-( 1 -methyl- 1 H-benzoimidazol-2-ylmcthoxy)- benzaldehyde (213):

[0494] To a solution of 2-fluoro-4-hydroxy-5-methoxy-benzaldehyde (39, 3.0 g, 18 mmol) in N,N- dimethylacetamide (120 rnL) was added sodium hydride (60% dispersion in mineral oil, 0.8 g, 19 mmol) portion wise. After the addition was complete, the reaction was stirred for 30 minutes after which 2-chloromethyl-l -methyl- lH-benzoimidazole (212, 2.9 g, 16 mmol) was added and then heated at 80 ⁰C overnight. The reaction mixture was then poured into water (1 L) with stirring and the precipitated solid was filtered, washed with water and dried to give the desired compound (213, 4.2 g, 84 % yield).

Step 3 - Preparation of(5-chloro-lH-pyrrolo[2,3-b]pyridin-3-yl)-[2-βuoro-5-methoxy-4-(l-methyl- 1 H-benzoimidazol-2-ylmethoxy)-phenyi] -methanol (214a) and 2-{4-[(5-chloro- 1 H-pyrrolo[2,3- bJpyridin-3-yl)-methoxy-methyl]-5-fluoro-2-methoxy-phenoxymethyl}-l -methyl- IH-benzoimidazole (214b):

[0495] To a solution of 2-fluoro-5-methoxy-4-(l -methyl-lH-benzoimidazol-2-ylmethoxy)- benzaldehyde (213, 4 g, 13 mmol) and 5-chloro-l H-pyrrolo[2,3-b]pyridine (4, 2 g, 13 mmol) in methanol (140 mL) and tetrahydrofuran (140 mL) was added potassium hydroxide (5 g, 89 mmol). The reaction was stirred for 5 days at room temperature. The solution was diluted with water and extracted with ethyl acetate. The layers were separated and the aqueous layer was back-extracted with ethyl acetate. The combined organic layers were dried over sodium sulfate and evaporated in vacuo to give crude compound as a yellow semi-solid which was used directly in the next step.

Step 4 - Preparation of2-[4-(5-Chloro-lH-pyrrolo[2,3-b]pyridin-3-ylmethyl)-5-fluoro-2-methoxy- phenoxymethyl] -1 -methyl- lH-benzυimidazυle (P-2106) ^•

[0496] To a solution of above crude mixture of aldol compounds 214a and 214b (13 mmol, theoretical yield) in acetonitrile (300 mL) was added trifluoroacetic acid (5.7 mL, 77 mmol) and triethylsilane (54 mL, 339 mmol). The resulting mixture was stirred for 2 hours at reflux. The solvent was removed in vacuo and the residue taken up in ethyl acetate (1 L) and then washed with saturated aqueous potassium carbonate. The layers were separated and the aqueous layer was back-extracted with ethyl acetate (1 L). The combined organic layers were dried over sodium sulfate and evaporated in vacuo to give a crude oily solid that was subjected to Boc protection (20 volumes of tetrahydrofuran, 2.0 equiv. of Boc-anhydride, 0.10 equiv of DMAP) followed by silica gel chromatography (ethyl acetate/hexanes). The isolated material was then deprotected using 20% trifluoroacetic acid in dichloromethane (10 volumes) and neutralized to the free base using saturated aqueous potassium carbonate. The dichloromethane was removed in vacuo and the resulting product Atty. Dkt. No.: 039363-3303 was filtered, washed with water and the solid was slurried with ethyl acetate, filtered, and dried to give P-2106 (1.3 g, 23% over 2 steps) MS(ESI): [M+H^'J ¹ = 451.2, 453.0.

[0497] 2-[4-(5-Chloro-lH-pyrrolo[2,3-b]pyridin-3-ylmethyl)-5-fluoro-2-methoxy-phenoxymethyl]- 1 -ethyl- lH-benzoimidazole P-2177

was prepared following the protocol of Scheme 55, steps 3 and 4, substituting 2-fluoro-5-methoxy-4- (1 -methyl- lH-benzoimidazol-2-ylmethoxy)-benzaldehyde 213 with 4-(l-ethyl-lH-benzoimidazol-2- ylmethoxy)-2-fluoro-5-methoxy-benzaldehyde 216 (see Example 56) in step 3. MS(ESI): [M+H"]⁺ = 465.3, 467.1.

Example 56: Synthesis of 4-(l-ethyl-lH-bcnzoimidazol-2-ylmethoxy)-2-fluoro-5-methoxy- benzaldehyde 216

[0498] 4-(l-Ethyl-lH-benzoimidazol-2-ylmethoxy)-2-fluoro-5-methoxy-benzaldehyde 216 was synthesized in 1 step from 4-(lH-Benzoimidazol-2-ylmethoxy)-2-fluoro-5-methoxy-benzaldehyde 215 as shown in Scheme 56.

Step 1 — Preparation of4-(l-Ethyl-lH-ben∑oirnidazol-2-ylmethoxy)-2-βuoro-5-methυxy-benzaldehyde (22):

[0499] To a solution of 4-( 111-benzoimidazol-2-ylmethoxy)-2-fluoro-5-methoxy-benzaldehyde (215, 4,0 g, 13 mmol) in N,N-dimethylacetamide (80 mL) was added sodium hydride (60% dispersion in mineral oil, 0.65 g, 16 mmol) portion wise. After the addition was complete, the reaction was stirred for 30 minutes after which bromoethane (1.2 mL, 16 mmol) was added and then allowed to stir for several hours. The reaction mixture was then poured into water (1 L) with stirring and the precipitated solid was filtered, washed with water and dried to give the desired compound (216, 3.8 g, 87 % yield). Atty. Dkt. No.: 039363-3303

Example 57: Synthesis of 2-[4-(5-chloro-lH-pyrrolo[2,3-b]pyridin-3-yImcthyI)-5-fluoro-2- πiethoxy -pheiioxyinethyl]-lH-benzoimidazole-5 -sulfonic acid diethylamide P-2173

[050Oj 2-[4-(5-Chloro-lH-pyrrolo[2,3-b]pyridin-3-ylmethyl)-5-fluoro-2-methoxy-phenoxymelhyl]- lH-benzoimidazole-5-sulfonic acid dimethylamide P-2173 was synthesized in 4 steps from 2-fluoro- 4-hydroxy-5-methoxy-benzaldehyde 39 as shown in Scheme 57.

Scheme 57

ftep / - Preparation oj 2-(5-fluoro-4-formyl-2-methoxy-phenoxymethyl)-lH-benzoimidazole-5- sulfonic acid dimethylamide (218):

[0501] 2-Fluoro-4-hydroxy-5-methoxy-benzaldehyde (39, 0.38 g, 2.2 mmol) was dissolved in N,N- dimethylformamide (30 mL) and sodium hydride 60% dispersion in mineral oil (120 mg) was added. After 20 minutes, 2-chloromethyl-lH-benzoimidazolc-5-sulfonic acid dimethylamide hydrochloride salt (217. 0.559 g, 1.80 mmol) was added to the mixture. The reaction was stirred at 60 °C overnight. The solvent was removed under reduced pressure. Ethyl acetate was added and the organic layer was washed with water, dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with a gradient of ethyl acetate (20-100 %) in hexane to provide the desired compound (218, 0, 122 g, 17%).

Step 2 - Preparation υf5-dimethylsulfamoyl-2-(5-fluoro-4-formyl-2-methoxy-phenoxymethyl)- benzimidazole-1-carboxylic acid tert-butyl ester (219):

[0502] 2-(5-Fluoro-4-formyl-2-methoxy-phenoxymethyl)-l H-benzoimidazole-5 -sulfonic acid dimethylamide (218, 0.122 g, 0.299 mmol) was dissolved in tetrahydrofuran (5 mL). N,N- Diisopropylethylamine (0.10 mL, 0.60 mmol) and 4-dimethyl aminopyridine polymer bound (0.007 g. 0.06 mol) were added followed by di-tert-butyldicarbonate (0.072 g, 0.33 mmol). The reaction was stirred at room temperature overnight. The solvent was removed under reduced pressure. Ethyl acetate was added and washed with water, dried over anhydrous sodium sulfate, and concentrated. The Atty. Dkt. No.: 039363-3303 resulting compound was used without further purification (219, 0.133 g, 87 %).

Step 3 - Preparation of2-4-[(5-chloro-I-triisopropylsilanyl-lH-pyrrnln[2, 3-h]pyridin-3-yl)-hydroxy- methylJ-S-fluoro-I-methoxy-phenoxymethyl-S-dimethylsulfamoyl-benzoimidazole-l-carhoxylic acid tert-butyl ester (220):

[0503] 5-Chloro-3-iodo-l-triisopropylsilanyl-lH-pyrrolo[2,3-b]pyridine (144, 0.17 g, 0.39 mmol) was dissolved in tetrahydrofuran (2 mL). The reaction was cooled to -20 ⁰C. 2 M isopropylmagnesium chloride in tetrahydrofuran (0.2 mL) was added drop wise to the mixture. The reaction was stirred to -5 ⁰C. 5-Dimefhylsulfamoyl-2-(5-fluoro-4-formyl-2-methoxy- phenoxymethyl)-benzimidazole-l -carboxylic acid tert-butyl ester (219, 0.133 g, 0.262 mmol) in tetrahydrofuran (3 mL) was added at once to the mixture at -20 ⁰C. The reaction was stirred to -5 ⁰C and concentrated. Ethyl acetate was added and washed with sodium bicarbonate saturated solution and brine, dried over anhydrous sodium sulfate and concentrated. Purification with silica gel column chromatography, eluting with a gradient of ethyl acetate (5-80%) in hexanes, gave the isolation of the desired compound (220, 0.083 g, 39%).

Step 4 - Preparation of2-[4-(5-chloro-lH-pyrrolo[2,3-b]py idin-3-ylmethyl)-5-fluoro-2-methoxy - phenoxymethyl] -1 H-benzoimidazole-5-sulfonic acid dimethyϊamide (P-2173) [0504] 2-4-[(5-Chloro-l-triisopropylsilanyl-lH-pyrrolo[2,3-b]pyridin-3-yl)-hydroxy-methyl]-5- fluoro-2-methoxy-phenoxymethyl-5-dimethylsulfamoyl-benzoimidazole-l -carboxylic acid tert-butyl ester (220, 0.083 g, 0.10 mmol) was combined with acetonitrile (4 mL). Triethylsilane (0.6 mL) was added followed by trifluoroacetic acid (0.3 mL). The reaction was stirred at 60 ⁰C for one hour. The solvent was removed under reduced pressure. Ethyl acetate was added and washed with sodium bicarbonate saturated solution and brine. After the organic layer was dried over anhydrous sodium sulfate the solvent was evaporated to dryness. Purification by trituration with a mixture of ethyl acetate in hexanes allowed obtaining the desired compound. The remaining material was further purified with silica gel column chromatography, eluting with a gradient of methanol (5-35%) in dichloromethane, to provide the desired compound (P-2173, 0.022 g, 41%). MS (ESI):[M+lT] ⁺ = 544.1 , [M-H⁺] ^• = 542.1.

[0505] 2-[4-(5-Chloro-lH-pyrrolo[2,3-b]pyridin-3-ylmethyl)-5-fluoro-2-methoxy-phenoxymethyl]- 5-methoxy-l H-benzoimidazole P-2182

was prepared following the protocol of Scheme 57, replacing 2-chloromethyl-lH-benzoimidazole-5- sulfonic acid dimethylamide hydrochloride salt 217 with 2-Chloromethyl-5-mefhoxy-lH- Atty Dkt No 039363-3303 ben/oimida/ole 222 (see Example 58) in step 1 MS (ESI) [M+H⁺] ⁺ = 467 2

Example 58: Synthesis of 2-chloromethyl-5-methoxy-lH-benzoimidazole 222

[0506] 2-Chloromethyl-5-methoxy-lH-benzoimidazole 222 was synthesized in 1 step from (5- Methoxy-lH-benzoimidazol-2-yl)-methanol 221 as shown in Scheme 58

Scheme 58

Step 1 - Preparation oj 2-chloromethyl-5-methoxy-lH-benzoιmιdazole (222)

[0507] (5-Methoxy-lH-benzoimidazol~2-yl)-methanol (221, 0 5 g, 3 mmol) was combined with 30 mL dichloromethane Thionyl chloride (0 51 mL, 7 mmol) was added and the reaction was stirred at room temperature for 2 hours The reaction was concentrated Fthyl acetate was added and washed with sodium bicarbonate saturated solution and brine The organic portion was dned over anhydrous sodium sulfate, filtered through Celite and evaporated to dryness The resulting desired compound was used without further purification MS (ESI) [TvH-H⁺] ⁺ = 197 2

Example 59: Synthesis of 2-2-[4-(5-chloro-lH-pyrrolo[2,3-b]pyridin-3-ylπiethyl)-5-fIuoro-2- methoxy-phenoxy]-ethyl-lH-benzimidazole P-2180

[0508] 2-2-[4-(5-Chloro-lH-pyrrolo[2,3-b] pyridin-3-ylmethyl)-5-fluoro-2-methoxy-phenoxy]- ethyl- lH-benzimidazole P-2180 was synthesized in 4 steps from 4-Benzyloxy-2-fluoro-5-methoxy- benzdldehyde 83 as shown in Scheme 59

Scheme 59

Atty. Dkt. No,: 039363-3303

Step 1 - Preparation of(4-Benzyloxy-2-fluoro-5-methoxy-phcnyl)-(5-chloro-lH-pyrrolo[2,3- b] pyridin~3-vl)~methanol (223a) and 3-[(4-Benzyloxy-2-fluoro-5-methoxy-phenyl)-methoxy-methylJ-

5-chloro-lH-pyrrolϋ[2, 3-b] pyridine (223b)

[0509] 4-Benzyloxy-2-fluoro-5-methoxy-benzaldehyde (83, 12.4 g, 48 mmol) was combined with

5-chloro-lH-pyrrolo[2,3-b]pyridine (4, 7.3 g, 48 mmol), methanol (500 mL) and potassium hydroxide

(22 g, 335 mmol). The reaction was stirred overnight at room temperature. The solution was diluted with water and extracted with ethyl acetate. The organic portion was dried over anhydrous sodium sulfate and evaporated under reduced pressure to give the desired compounds 223a and 223b that were used without further purification.

Step 2 - Preparation of3-(4-benzyloxy-2-fluoro-5-methoxy-benzyl)-5-chloro-lH-pyrrolo[2,3- bjpyridine (224)

[0510] (4-Benzyloxy-2-fluoro-5-methoxy-phenyl)-(5-chIoro-llI-pyrrolo[2,3-b]pyridin-3-yl)- methanol 223a and 3-[(4-benzyloxy-2-fluoro-5-methoxy-phenyl)-methoxy-methyl]-5-chloro-lH- pyrrolo[2,3-b]pyridine 223b (48 mmol) were combined with acetonitrile (1.4 L), trifluoroacetic acid (21 mL, 288 mmol) and triethylsilane (31 mL, 192 mmol). The resulting mixture was stirred for two hours at reflux. The solvent was removed under reduced pressure. Ethyl acetate (6 L) was added and the organic layer was washed with aqueous potassium carbonate saturated solution. The layers were separated and the aqueous layer was back-extracted with ethyl acetate (2 L). The combined organic portions were dried over anhydrous sodium sulfate and evaporated under reduced pressure to give the desired compound 224 which was used without further purification.

Step 3 — Preparation of4-(5-chloro-lH-pyrrolo[2,3-b]pyridin-3-ylmethyl)-5-fluoro-2-rnethoxy-phenol

(225)

[0511] 3-(4-Benzyloxy-2-fluoro-5-methoxy-benzy])-5-chloro-lH-pyrrolo[2,3-b]pyridine (224, 48 mmol) was dissolved in tetrahydrofuran (300 mL) and 20 % palladium on carbon (50% water wet, 2.3 g) was added. The mixture was stirred under an atmosphere of hydrogen at 50 psi in the presence of acetic acid (100 mL). The reaction mixture was filtered through Celite and evaporated to dryness to give the desired compound 225. MS (ESI) :[M+H⁺] ⁺ = 307.1.

Step 4 - Preparation of 2-2-[4-(5-Chioro-lH-pyrrolo[2, 3-b] pyridin-3-ylmethyi)-5-fluoro-2-meth oxy- phenoxy] -ethyl- 1 H-benzimidazole (P-2180)

[0512] 4-(5-Chloro-lH-pyrrolo[2,3-b]pyridin-3-ylmethyl)-5-fluoro-2-methoxy-phenoI (225, 0.200 g, 0.652 mmol) was dissolved in tetrahydrofuran (5 mL). Triphenylphosphine (0.190 g, 0,72 mmol) and 2-(lH-benzoimidazol-2-yl)-ethanol (226, 0.110 g, 0.68 mmol) were added followed by diisopropyl azodicarboxylate (0.140 mL, 0.72 mmol). The reaction was stirred at room temperature overnight. The mixture was placed into water and extracted with ethyl acetate. The organic portion was dried over anhydrous sodium sulfate, and concentrated. Purification with silica gel column Atty. Dkt. No.: 039363-3303 chromatography, eluting with a gradient of ethyl acetate (20-100%) in hexanes, gave the isolation of the desired compound (P-2180, 0.0189 g, 6%). MS (ESI):[M+HT = 451.0, [M-H"] ^" = 449,1

Example 60: Synthesis of 5-chloro-2-[5-fluoro-2-methoxy-4-(5-methyl-lH-pyrrolo|2,3- bJpyridiπ-3-ylαiethyl)-phenoxymethyl]-lH-benzoimidazole P-2184

[0513J 5-Chloro-2-[5-fluoro-2-methoxy-4-(5-methyl-lH-pyrrolo[2,3-b]pyridin-3-ylmethyl)- phenoxymethyl]-lH-benzoimidazole P-2184 was synthesized in 2 steps from 4-(lII-Benzoimidazol- 2-ylmethoxy)-2-fluoro-5-methoxy-benzaldehyde 227 as shown in Scheme 60.

Scheme 60

Step 1 ~ Preparation of [4-(5-chloro-lH-benzoimidazol-2-ylmethoxy)-2-fluoro-5-methoxy-phenyl]-(5- methyl-lH-pyrrolo[2,3-b]pyridin-3-yl)-methanol (228a) and 5-chloro-2-{5-fluoro-2-methoxy-4- [methoxy-(5-methyl-lH-pyrrolo[2,3-b]pyridin-3-yl)-methyl]-phenoxymethyl}-lH-benzoimidazole (228b):

[0514] 5-Methyl-lH-pyrrolo[2,3-b]pyridine (13) was combined with methanol and potassium hydroxide. After the mixture was stirred for 45 minutes 4-(5-chloro-lH-benzoimidazol-2-ylmethoxy)- 2-fluoro-5-methoxy-benzaldehyde (227, per step 1 of Example 57 substituting 2-chloromethyl-lH- benzoimidazole-5-sulfonic acid dimethylamide 217 with 5-chloro-2-chloromethyl-lH- bcnzoimidazole) was added and the reaction was stirred at room temperature overnight. The solvent was removed under reduced pressure. Ethyl acetate was added and washed with sodium bicarbonate saturated solution and brine, dried over anhydrous sodium sulfate and concentrated. Purification with silica gel chromatography, eluting with a gradient of ethyl acetate (10-100%) in hexanes, gave the desired compounds 228a and 228b as a mixture.

Step 2 - Preparation of5-chloro-2-[5-fluoro-2~methoxy-4-(5 -methyl-lH-pyrrolo[2,3-b]pyrιdin-3- ylmethyl)-phenoxymethyl]-lH-ben∑oimidazole (P-2184):

[0515J t4-(5-chloro-lH-benzoimidazol-2-ylmethoxy)-2-fluoro-5-methoxy-phenyl]-(5-methyl-lH- pyrrolo[2,3-b]pyridin-3-yl)-methanol (228a) and 5-chloro-2-{5-fluoro-2-methoxy-4-[methoxy-(5- methyl-lH-pyrrolo[2,3-b]pyridin-3-yl)-methyl]-phenoxymethyl} -lH-benzoimidazole (228b) were Atty. Dkt. No.: 039363-3303 dissolved in acetonitrile. Triethylsilane was added followed by trifluoroacetic acid. The reaction was stirred for one hour at 60 ⁰C. The solvent was removed under reduced pressure. Ethyl acetate was added and the organic layer was washed with sodium bicarbonate saturated solution and brine, then dried over anhydrous sodium sulfate and concentrated. Purification with silica gel column chromatography, eluting with a gradient of methanol (2-25%) in dichloromethane, provided the desired compound P-2184. MS (ESi): [M+H ¹J ' = 451.0, [M-H^f] ^~ = 449.1.

Example 61: Synthesis of benzoimidazole compounds of Formula XXX

XXXa XXXb XXX

Step 1 - Preparation of compounds of Formula XXXh

[0516] A phenyldiamine compound of Foπnula XXXa (R is an optional substituent of benzoimidazole) and chloroacctic acid arc typically refluxed in 4N hydrochloric acid for one to several hours and then cooled and neutralized. Isolation by conventional means (e.g. extraction, washing and filtering) affords a mixture containing compound of Foπnula XXXb, which may be isolated by silica gel chromatography if desired. Bloom and Day, J. Org. Chem. 1939, 14, 17.

Example 62: Synthesis of compounds of Formula XXX

XXXa XXXc xxx

Step 1 - Preparation of 2-Chloro-acetimidic acid ethyl ester

[0517] 2-Chloro-acetimidic acid ethyl ester may be prepared by dissolving chloroacetonitrile in an appropriated solvent (e.g. ether, THF) with ethanol and bubbling hydrogen chloride gas with cooling. The hydrogen chloride solution is stirred in a closed system for one to deveral hours and warmed to room temperauture. Isolation by conventional means (e.g. extraction, distillation, washing and filtering) affords a mixture containing compound of Formula XXXc, which may be isolated by silica gel chromatography if desired. Atty Dkt No 039363-3303

Step! - Preparation of compounds of Formula XXX

[0518] A phenyldiamine compound of Formula XXXa (sec Example 52) and 2-chloro-acetimidic acid ethyl ester XXXc arc typically stirred together in an appropπate solvent (e g ethanol) for one to se\eral hours at room temperature Isolation by conventional means (e g extraction, washing and filtering) affords a mixture containing compound of Formula X, which may be isolated by silica gel chromatography if desired Komoyira et al , Bioorg Med Chem 2004, 12, 2099

Example 63: Cell-based assays of c-fins kinase activity or c-kit kinase activity.

[0519] M-CSF dependent RAW264 7 cells were seeded on a 12 well plate, 2 5\10⁵ cells/well and the cells were allowed to attach overnight at 37 ⁰C, 5% CO₂ The cells were then starved in serum- free medium overnight at 37 ⁰C, 5% CO₂ The cells were treated with compound for 1 hour m scrum- free media (1% DMSO final concentration), and then stimulated with 20 ng/ml M-CSF for 5 minutes After stimulation, the cells were lysed on ice, and the lysates were centπfuged at 13,000 rpm for 1 minute The amount of protein in the sample was quantitated sample buffer was added, and the samples were boiled at 95 ⁰C for 10 minutes The samples w ere then centπfuged at 13 000 rpm for 1 minute The samples (15-20 μg/lane) were loaded and run on 4-12% tπs-glycine gel at 75V, and then transferred onto a PVDF membrane The membrane was blocked for 1 hour with 5% BbA in PBS '1% Tween-20 (PBST), or 5% milk, depending on the primary antibody used Then the blots were incubated with primary antibody overnight at 4 degrees with gentle shaking After incubation with the capture antibody, the membranes were washed 3 x 10 minutes with PBST, then incubated with detection antibody Goat Anti-Rdbbit-HRP for 1 hour, with gentle shaking l he membranes were washed again 3 x 10 minutes with PBST ECL Plus substrate was then added to the blots the image captured with chemilummescence camera, and the bands quantitated for pFMS and FMS levels

[0520] The Fms inhibitors may also be assessed using M-NFS-60 mouse myelogenous leukemia cell line (ATCC catalog #CRL-1838) This cell line proliferation is stimulated by M-CSF, which binds and activates the fms tyrosine kinase receptor Inhibitors of fms kinase activity reduce or eliminate the M-CSF stimulated kinase activity, resulting in reduced cell proliferation This inhibition is measured as a function of compound concentration to assess IC₅₀ values M-NTS-60 cells were seeded at 5 x 10⁴ cells per well of a 96 well cell culture plate in 50 μl of cell culture medium of RPMI 1640 (CellGro Mediatech catalog #10-040-CV) supplemented with 10 % FBS (HyClone catalog #SH30071 03) Compounds were dissolved in DMSO at a concentration of 1 mM and were serially diluted 1 3 for a total of eight points and added to the cells to final concentrations of 10 3 3, 1 1 , 0 37, 0 12, 0 041 , 0 014 and 0 0046 μM in 100 μl cell culture medium (final concentration 0 2% DMSO) Cells were also treated with staurospoπne as a positive control The cells were stimulated by adding 20 μl ot 372 ng/ml M-CSF to a final concentration of 62 ng/ml (R&D Systems catalog #216-MC) The cells were incubated at 37 ¹C, 5% CO₂ for three days CellTiter-Glo Buffer (Promega Cell Atty. Dkt. No.: 039363-3303

Viability Assay catalog #G7573) and substrate were equilibrated to room temperature, and enzyme/substrate Recombinant Firefly Luciferasc/Bectle Luciferin was reconstituted. The cell plates were equilibrated to room temperature for 30 minutes, then lysed by addition of an equivalent volume of the Celltiter-Glo Reagent. The plate was mixed for 2 minutes on a plate shaker to lyse the cells, then incubated for 10 minutes at room temperature. The plates were read on a Victor Wallac II using Luminescence protocol modified to read 0.1s per well. The luminescence reading assesses the ATP content, which correlates directly with cell number such that the reading as a function of compound concentration was used to determine the IC₅₀ value.

[0521] The c-Kit inhibitors were assessed using M-07e cell line (DSMZ catalog #ACC 104). The M-07e proliferation is stimulated by SCF (Stem Cell Factor), which binds and activates c-Kit tyrosine kinase receptor. Inhibitors of c-Kit kinase reduce or eliminate the SCF mediated kinase activation, resulting in reduced cell proliferation of SCF stimulated cells. This inhibition is measured by the effect of compound concentration on cell growth to assess IC₅₀ values. M-07e cells were seeded at 5 x 10⁴ cells per well of a 96 well cell culture plate in 50 μl of cell culture medium of Iscove's Medium I X (MOD, CcllGro Mediatech catalog #15-016-CV) supplemented with 10% FBS (HyClone catalog #SH30071.03). Compounds were dissolved in DMSO at a concentration of 0.1 mM and were serially diluted 1 :3 for a total of eight points and added to the cells to final concentrations of 1 , 0.33, 0.1 1, 0.037, 0.012, 0.0041, 0.0014 and 0.00046 μM in 100 μl cell culture medium (final concentration 0.2% DMSO). Cells were also treated with staurosporine as a positive control. Cells were stimulated by adding 20 μl of 600 ng/ml SCF to a final concentration of 100 ng/ml (Biosource International SCF kit ligand catalog #PHC2115) in cell culture medium. The cells were incubated at 37 ⁰C, 5% CO₂ for three days. CellTiter-Glo Buffer (Promega Cell Viability Assay catalog #G7573) and substrate were equilibrated to room temperature, and enzyme/substrate Recombinant Firefly Luciferase/Beetle Luciferin was reconstituted. The cell plates were equilibrated to room temperature for 30 minutes, then lysed by addition of an equivalent volume of the Celltiter-Glo Reagent. The plate was mixed for 2 minutes on a plate shaker to lyse the cells, then incubated for 10 minutes at room temperature. The plates were read on a Victor Wallac II using Luminescence protocol modified to read 0.1s per well. The luminescence reading assesses the ATP content, which correlates directly with cell number such that the reading as a function of compound concentration is used to determine the IC_5O value.

[0522] This cell based assay was also used to assess phosphorylation. Samples were prepared with compounds as described for the growth inhibition assay only M-07e cells were seeded at 2 x 10 cells per well m a 96 well filter plate. Cells were incubated for 1 hour at 37 ⁰C with the compounds as described above, and then stimulated by adding SCF to a final concentration of 50 ng/ml and incubated for 10 minutes at 37 ⁰C. The culture medium was removed by centrifugation and the cells were lysed by addition of 30 μl lysis buffer (25 mM Tris HCl pll 7.5, 150 mM NaCl, 5 mM EDTA, Atty Dkt No 039363-3303

1 % Tπton XlOO, 5 mM NaF, 1 mM NaVanadate, 10 mM Beta-glycerophosphate, no FDTA (Boehπnger-Roche catatalog #1873580) and placed on ice for 30 minutes A 15 μl aliquot of the lvsate was taken and assayed according to Biosource Immunoassay Kit Human c-Kit [pY823] (Catalog # KHO0401) by diluting the aliquot with 85 μl dilution buffer in the assay plate, incubating for 2 hours at room temperature and washing the plate 4 times with wash buffer Detection antibody (100 μl) was added to the plate and samples incubated for 1 hour at room temperature, then washed 4 times with wash buffer HRP anti-rabbit antibody (100 μl) was added and samples incubated for 30 minutes at room temperature, then washed 4 times with wash buffer Stabilized chromogen (100 μl) was added and samples incubated for 15-25 minutes at room temperature, then washed 4 times with wash buffer Stop solution (100 μl) was added and the samples read on a Wallac Victor reader at 450 nm The absorbance w as plotted against the compound concentration and the IC₅₀ concentration was determined

[0523] Additional cell based assays can be correlated to the Fms activity of compounds of the invention For example, the ability or osteoclast precursor cells (commercially available from Lonza) to differentiate into mature osteoclasts, due to stimulation by M-CSF and RANKL, in the presence of compounds, can be measured using a method analogous to that previously reported (Hudson et al , Journal of Urology, 1947, 58 89-92), where the amount of acid phosphatase in the supernatant (1 e TRAP5b excreted by mature osteoclasts) is proportional to the number of mature osteoclasts present In another example, the ability of M-CSF-dependent munne macrophage cells (BACl 2F5) to proliferate in the presence of compounds can be measured by cultunng cells as previously described (Morgan et al , Journal of Cellular Physiology, 1987, 130 420-427) and determining cell viability by analysis of ATP levels in the cell culture (Crouch et al , Journal of Immunological Methods, 1993, 160 81-8)

Example 64: Kinase Activity Assays

[0524] The effect of potential modulators of kinase activity of c-kit and other kinases can be measured in a variety of different assays known m the art, e g , biochemical assays, cell-based assays, and in vivo testing (e g model system testing) Such in vitro and/or in vivo assays and tests can be used in the present invention As an exemplary kinase assay, the kinase activity of c-kit or Fms is measured in AlphaScreemng (Packard BioSciencc) Assays for the activity of various kinases are described, for example, in US Patent Application Serial number 11/473,347 (see also PCT publication WO2007002433), the disclosure of which is hereby incorporated by reference

Exemplary c-kit biochemical assay Atty Dkt No 039363-3303

[0525] The c-kit (or kinase domain thereof) is an active kinase in AlphaScreen KN₀ values are determined with respect to inhibition of c-Kit kinase activity, where inhibition of phosphorylation of a peptide substrate is measured as a function of compound concentration Compounds to be tested w ere dissolved in DMSO to a concentration of 20 mM These were diluted 30 μl into 120 μl of DMSO (4 mM) and 1 μl was added to an assay plate These were then serially diluted 1 3 (50 μl to 100 μl DMSO) for a total of 8 points Plates were prepared such that each kinase reaction is 20 μl m 1 x kinase buffer (50 mM HFPES, pH 7 2, 5 mM MgCl₂, 5 mM MnCl,, 0 01 % NP-40, 0 2% BSA), 5% DMSO and 10 μ\l ATP Substrate was 100 nM biotm-(E4Y)3 (Open Source Biotech, Inc ) C-kit kinase was at 0 1 ng per sample After incubation of the kinase reaction for 1 hour at room temperature, 5 μl of donor beads (Streptavidin coated beads (Perkin Flmer Life Science) final concentration 1 μg/ml) in stop buller (5OmM EDTA m ix kinase buffer) was added, the sample was mixed and incubated for 20 minutes at room temperature before adding 5 μl of acceptor beads (PY20 coated beads (Perkin Elmer Life Science) final concentration 1 μg/ml) in stop buffer The samples were incubated for 60 minutes at room temperature and the signal per well was read on AlphaQucst reader Phosphorylated substrate results in binding of the PY20 antibody and association of the donor and acceptor beads such that signal correlates with kinase activity The signal vs compound concentration was used to determine the IC₅₀

[0526] Compounds were also tested using a similar assay with a 10-fold higher AJ P concentration For these samples, compounds to be tested were dissolved m DMSO to a concentration of 20 mM 1 hese were diluted 30 μl into 120 μl of DMSO (4 mM) and 1 μl was added to an assay plate These were then serially diluted 1 3 (50 μl to 100 μl DMSO) for a total of 8 points Plates were prepared such that each kinase reaction is 20 μl in Ix kinase buffer (25 mM HEPES, pH 7 5, 2 mM MgCk, 2 mM MnCl₂, 0 01 % Twecn-20, 1 mM DTT, and 0 001% BSA), 5% DMSO and 100 μM ATP Substrate was 30 nM biotin-(E4Y)10 (Upstate Biotech, Cat# 12-440) C-kit kinase was at 1 ng per sample After incubation of the kinase reaction for 1 hour at room temperature, 5 μl of donor beads (Streptavidin coated beads (Perkin Flmer Life Science) final concentration 10 μg/ml) in stop buffer (25 mM HEPES pH 7 5, 100 mM ED 1 A, 0 3% BSA) was added, the sample was mixed and incubated for 20 minutes at room temperature before adding 5 μl of acceptor beads (PY20 coated beads (Perkin Elmer Life Science) final concentration 10 μg/ml) in stop buffer The samples were incubated for 60 minutes at room temperature and the signal per well was read on AlphaQuest or Envision reader (Perkin Elmer Life Science) Phosphorylated substrate results in binding of the PY20 antibody and association of the donor and acceptor beads such that signal correlates w ith kinase activity The signal vs compound concentration was used to determine the IC₅Q

[0527] The c-kit enzyme used in the above assay was cither optained from Cell Signaling Technology (Cat #7⁷54) or was prepared as follows A plasmid encoding kit (DNA and encoded Atty Dkt No 039363-3303 protein sequences shown below) was engineered using common polymerase chain reaction (PCR) methods Complementary DN A. cloned from various human tissues were purchased from Invitrogen, and these were used as substrates in the PCR reactions Specific custom synthetic oligonucleotide primers were designed to initiate the PCR product, and also to provide the appropπate restnction enzyme cleavage sites for ligation with the plasmids The entire sequence encoding the enzyme was made through a gene synthesis procedure, using custom synthetic oligonucleotides covering the entire coding sequence (Invitrogen, see below)

[0528] The plasmid used for ligation with the kinase-encodmg inserts was denvatrve of pET (Novagen) for expression using E coli The Kit kinase was engineered to include a Histidine tag for purification using metal affinity chromatography 1 he kinase-encoding plasmid was engineered as bicistromc mRNA to co-express a second protein that modifies the kinase protein during its expression in the host cell Protein tyrosine phosphatase IB (PTP), was co-expressed for dephosphorylation of the phospho-Tjrosines

[0529] For protein expression, the plasmid containing the Kit gene was transformed into E coli strains BL21 (DE3)RIL and transformants selected for growth on LB agar plates containing appropriate antibiotics Single colonies were grown overnight at 37⁰C in 200ml TB (Terrific broth) media 16x1 L of fresh TB media in 2 8L flasks were inoculated with 10ml of overnight culture and grown with constant shaking at 37⁰C Once cultures reached an absorbance of 1 0 at 600nm, IPTG was added and cultures were allowed to grow for a further 12 to 18hrs at temperatures ranging from 12-30⁰C Cells were harvested by centπfugation and pellets frozen at 80⁰C until ready for lysis

[0530] For protein Purification, frozen E coli cell pellets were resuspended in lysis buffer and lysed using standard mechanical methods Protein was purified via poly-Histidine tags using immobilized metal affinity purification IMAC The Kit kinase was purified using a 3 step purification process utilizing, IMAC, size exclusion chromatography and ion exchange chromatography The poly- Histidine tag was removed using Thrombin (Calbiochem)

[0531] Compounds were assayed using a similar assay to that described above, using in a final reaction volume of 25 μl c-Kit (h) (5-10 mU) in 8mM MOPS pH 7 0, 0 2 mM EDTA, 10 mM MnCL, 0 1 mg'ml poly (GIu, Tyr) 4 1 , 10 mM MgAcetate and γ- ¹³P-ATP (approximately 500 cpm/pmol), with appropriate concentrations ot compound Incubated for 40 minutes at room temperature and stopped by addition of 5 μl of 3% phosphonc acid Spotted 10 μl of each sample onto Filtermat A and washed 3x with 75 mM phosphoric acid, once with methanol, dried and measured on scintillation counter (performed at Upstate USA, Charlottesville, VA)

Kit Atty.Dkt.No.: 039363-3303

PCR primers

Atty. Dkt. No.: 039363-3303

Atty. Dkt. No.: 039363-3303

Atty. Dkt. No.: 039363-3303

Atty. Dkt. No.: 039363-3303

P1332.N6 BI PTP KIT M552-K948-X COD

(Nucleic Acid SEQ ID NO:_ ) (Protein SEQ ID NO:_ )

taatacgactcactataggggaattgtgagcggataacaattcccctctagaaataattt tgtttaactttaagaaggagatataccatgggtcaccaccatcaccatcatatgtacgaa

M G H H H H H H M Y E gttcagtggaaagttgttgaagaaatcaacggtaacaactacgtttacatcgacccgacc

V Q W K V V E E I N G N N Y V Y I D P T cagctgccgtacgaccacaaatgggagttcccgcgtaaccgtctgtctttcggtaaaacc

Q L P Y D H K W E F P R N R L S F G K T ctgggtgcgggtgcgttcggtaaagttgttgaagcgaccgcgtacggtctgatcaaatct

L G A G A F G K V V E A T A Y G L I K S gacgcggcgatgaccgttgcggttaaaatgctgaaaccgtctgcgcacctgaccgaacgt

D A A M T V A V K M L K P S A H L T E R gaagcgctgatgtctgaactgaaagttctgtcttacctgggtaaccacatgaacatcgtt

E A L M S E L K V L S Y L G N H M N I V aacctgctgggtgcgtgcaccatcggtggtccgaccctggttatcaccgaatactgctgc

N L L G A C T I G G P T L V I T E Y C C tacggtgacctgctgaacttcctgcgtcgtaaacgtgactctttcatctgctctaaacag

Y G D L L N F L R R K R D S F I C S K Q gaagaccacgcggaagcggcgctgtacaaaaacctgctgcactctaaagaatcttcttgc

E D H A E A A L Y K N L L H S K E S S C tctgactctaccaacgaatacatggacatgaaaccgggtgtttcttacgttgttccgacc

S D S T N E Y M D M K P G V S Y V V P T aaagcggacaaacgtcgttctgttcgtatcggttcttacatcgaacgtgacgttaccccg

K A D K R R S V R I G S Y I E R D V T P gcgatcatggaagacgacgaactggcgctggacctggaagacctgctgtctttctcttac

A I M E D D E L A L D L E D L L S F S Y caggttgcgaaaggtatggcgttcctggcgtctaaaaactgcatccaccgtgacctggcg Atty. Dkt. No,: 039363-3303

Q V A K G M A F L A S K N C I H R D L A gcgcgtaacatcctgctgacccacggtcgtatcaccaaaatctgcgacttcggtctggcg

A R N I L L T H G R I T K I C D F G L A cgtgacatcaaaaacgactctaactacgttgttaaaggtaacgcgcgtctgccggttaaa

R D I K N D S N Y V V K G N A R L P V K tggatggcgccggaatctatcttcaactgcgtttacaccttcgaatctgacgtttggtct

W M A P E S I F N C V Y T F E S D V W S tacggtatcttcctgtgggaactgttctctctgggttcttctccgtacccgggtatgccg

Y G I F L W E L F S L G S S P Y P G M P gttgactctaaattctacaaaatgatcaaagaaggtttccgtatgctgtctccggaacac

V D S K F Y K M I K E G F R M L S P E H gcgccggcggaaatgtacgacatcatgaaaacctgctgggacgcggacccgctgaaacgt

A P A E M Y D I M K T C W D A D P L K R ccgaccttcaaacagatcgttcagctgatcgaaaaacagatctctgaatctaccaaccac

P T F K Q I V Q L I E K Q I S E S T N H atctactctaacctggcgaactgctctccgaaccgtcagaaatagtcgactgaaaaagga

I Y S N L A N C S P N R Q K - agagt

Additional biochemical and cell-based assays

[0532] In general, any protein kinase assay can be adapted for use with c-kit. For example, assays (e.g. biochemical and cell-based assays) as descnbed in Lipson et al , U.S. Patent Publ.20040002534 (incorporated herein by reference in its entirety) can be used in the present invention

In vivo model system testing

[0533] For in vivo testing, a suitable animal model system can be selected for use. For example, for multiple scerosis, the rodent experimental allergic encephalomyelitis (EAE) is commently used This system is well-known, and is described, for example, in Steinman, 1996, Cell 85299-302 and Secor et al., 2000, J Exp. Med 5:813-821, which are incorporated herein by reference in their entireties. Similarly, other model systems can be selected and used m assessing compounds of the present invention Atty. Dkt. No.: 039363-3303 Exemplary Fms biochemical assay

[0534] IC₅₀ values were determined with respect to inhibition of Fms kinase activity, where inhibition of phosphorylation of a peptide substrate is measured as a function of compound concentration. Compounds to be tested, dissolved in DMSO (1 μL), were added to a white 384-wcll plate (Costar #3705). Working stocks of Fms kinase (Upstate Biotech, #14-551), biotin-(E4Y)₁₀ substrate (Upstate Biotech, Cat# 12-440), and ATP (Sigma, Cat#A-3377) were prepared in 8 niM MOPS pH 7.4, 2 mM MgCl₂ 8 rnM MnCl₂, 2 niM DTT, and 0.01% Tween-20. All components were added to the 384-well plate for a final concentration of 0.5 ng/well Fms, 30 nM biotin-(E4Y)io (Upstate Biotechnology) and 10 μM ATP in a volume of 20 μL. Each sample was at 5% DMSO. The plate was then incubated for 60 minutes at room temperature. Just before use, working stocks of donor and acceptor beads from the AlphaScreen PY20 Detection Kit (PerkinElmer, Cat#676601M) were prepared in 8 mM MOPS, pH 7.4, 100 mM EDTA, 0.3% BSA. To stop the reaction, the plate was uncovered in the dark and 5 μl of Donor Beads solution (Streptavidin beads) was added to each well. The plate was incubated at room temperature for 20 minutes. Five microliters of Acceptor Beads solution (PY20 coated beads) were then added to each well. The final concentration of each bead was 20 μg/mL. The plates were incubated at room temperature for 60 minutes. Fluorescence signal was recorded on the Fusion Alpha reader or AlphaQuest reader. Phosphorylated substrate results in binding of the PY20 antibody and association of the donor and acceptor beads such that signal correlates with kinase activity. The signal vs. compound concentration was used to determine the IC₅₀.

|0535] Compounds were also tested using a similar assay with a 10-fold higher ATP concentration. Compounds to be tested, dissolved in DMSO (1 μL), were added to a white 384-well plate (Costar #3705). Working stocks of Fms kinase (Upstate Biotech, #14-551), biotin-(E4Y)_!0 substrate (Upstate Biotech, Cat# 12-440), and ATP (Sigma, Cat#A-3377) were prepared in 25 mM HEPES pH 7.5, 0.5 mM MgCl_2, 2 mM MnCl_2, 2 mM DTT, 0.01% BSA, and 0.01% Tween-20. All components were added to the 384-well plate for a final concentration of 0.5 ng/well Fms, 30 nM biotin-(E4Y)_]0 (Upstate Biotechnology) and 100 μM ATP in a volume of 20 μL. Each sample was at 5% DMSO. The plate was then incubated for 30 minutes at room temperature. Just before use, working stocks of donor and acceptor beads from the AlphaScreen PY20 Detection Kit (PerkinElmer, Cat#676601M) were prepared in 25 mM IIEPES pH 7.5, 100 mM EDTA, 0.01 % BSA. To stop the reaction, the plate was uncovered in the dark and 5 μl of Donor Beads solution (Streptavidin beads) was added to each well. The plate was incubated at room temperature for 20 minutes. Five microliters of Acceptor Beads solution (PY20 coated beads) were then added to each well. The final concentration of each bead was 10 μg/mL. The plates were incubated at room temperature for 60 minutes. Fluorescence signal was recorded on the AlphaQuest or Envision reader. Phosphorylated substrate results in Atty. Dkt. No.; 039363-3303 binding of the PY20 antibody and association of the donor and acceptor beads such that signal correlates with kinase activity. The signal vs. compound concentration was used to determine the IC₅₀,

[0536] Compounds were assayed using a similar assay to that described above, using in a final reaction volume of 25 μl: Fms (h) (5-10 mU) in 8mM MOPS pH 7.0, 0.2 mM EDTA, 250 mM

KKKSPGEYVNIEFG (SEQ ID NO:_ ), 10 mM MgAcetate and 7- ³³P-ATP (approximately 500 cpm/pmol), with appropriate concentrations of compound. Samples were incubated for 40 minutes at room temperature and stopped by addition of 5 μl of 3% phosphoric acid, 10 μl of each sample is spotted onto a P30 filtermat and washed 3x with 75 mM phosphoric acid, once with methanol, dried and measured on scintillation counter (Upstate USA, Charlottesville, VA).

Exemplary TrkA biochemical assay

10537] Compounds were similarly assayed to determine IC₅₀ values with respect to inhibition of TrkA kinase activity, where inhibition of phosphorylation of a peptide substrate was measured as a function of compound concentration. Compounds tested were dissolved in DMSO (1 μL) and added to a white 384-well plate (Costar #3705). Working stocks of TrkA kinase (Upstate Biotech, #14-571), biotin-(E4Y)i₀ substrate (Upstate Biotech, Cat# 12-440), and ATP (Sigma, Cat#A-3377) were prepared in 25 mM Hepes pH 7.5, 10 mM MnCl_2, 1 mM DTT, and 0.01 % Tween-20. All components were added to the 384-well plate for a final concentration of 1 ng/well TrkA, 30 nM biotin-(E4Y)₁₀ (Upstate Biotechnology) and 100 μM ATP in a volume of 20 μL. Each sample was at 5% DMSO. The plate was then incubated for 40 minutes at room temperature. Just before use, working stocks of donor and acceptor beads from the AlphaScreen PY20 Detection Kit (PerkinElmer, Cat#676601M) were prepared in 25 mM Hepes pH 7.5, 100 mM EDTA, 0.3% BSA. To stop the reaction, the plate was uncovered in the dark and 5 μl of Donor Beads solution (Streptavidin beads) was added to each well. The plate was incubated at room temperature for 20 minutes. Five microliters of Acceptor Beads solution (PY20 coated beads) were then added to each well. The final concentration of each bead was 10 μg/mL. The plates were incubated at room temperature for 60 minutes. Fluorescence signal was recorded on the AlphaQuest or Envision reader. Phosphorylated substrate results in binding of the PY20 antibody and association of the donor and acceptor beads such that signal correlates with kinase activity. The signal vs. compound concentration was used to determine the IC₅₀.

Exemplary HGK biochemical assay

|0538] The MΛP4K4 (or kinase domain thereof) is an active kinase in AlphaScreen. IC₅₀ values are determined with respect to inhibition of MAP4K4 kinase activity, where inhibition of phosphorylation Atty. Dkt. No.: 039363-3303 of a peptide substrate is measured as a function of compound concentration. Compounds to be tested were dissolved in DMSO to a concentration of 20 mM. These were diluted 30 μl into 120 μl of DMSO (4 mM) and 1 μl was added to an assay plate. These were then serially diluted 1 :3 (50 μl to 100 μl DMSO) for a total of 8 points. Plates were prepared such that each kinase reaction is 20 μl in Ix kinase buffer (20 mM Tris, pH 7.4, 10 mM MgCl₂, ImM DTT, 0.01% Twccn-20), 5% DMSO and 10 μM ATP. Substrate was 10 nM biotin-ERM (T567/T564/T558, Cell Signaling, Inc., cat#1344). MAP4K4 kinase was at 0.5 ng per sample. After incubation of the kinase reaction for 40min at room temperature, 5 μl of donor beads and protein A acceptor beads (Perkin Elmer Life Science, cat# 67606017) at final concentration 1 μg/ml in stop buffer (20 mM Tris, pH 7.4,20OmM Nacl, 10OmM EDTA ,0.03% BSA) was added, along with Phospho-ERM Antibody (T567/T564/T558, Cell Signaling, Inc., cat#3141) at 1 :1000 dilution. The samples were incubated for 2 hours at room temperature and the signal per well was read on AlphaQuest reader. Phosphorylated substrate results in binding of the antibody which binds to protein A acceptor bead and association of the donor and acceptor beads is such that the signal correlates with kinase activity. The signal vs. compound concentration was used to determine the IC₅₀.

[0539] Representative compounds screened by at least one of the methods described above, or as described in US Patent Application Serial number 11/473,347 (PCT publication WO2007002433), or by similar methods, having IC₅₀ of less than 10 μM under the test conditions employed are shown in tables 2a (B-Raf), 2b (B-Raf V600E), 2c (B-Raf V600E/T529I), 2d (Btk), 2e (c-Raf-1), 2f (Fak), 2g (FGFRl), 2h (FItI), 2i (Fms), 2j (Jnkl), 2k (Kdr), 21 (Kit), 2m (Met), 2n (p38), 2o (Src), 2p (TrkA), and 2q (HGK).

Table 2a, Compounds with activity toward kinase B-Raf with ICso≤ 10 μM under the test conditions employed.

B-Raf P-1247, P-1453, P-1454, P-1455, P-1467, P-1532, P-1544, P-1568, P-] 569, P-1584, P-1597, P-1613, P-1616, P-1721, P-1768, P-1769, P-1802, P-1825, P-2100, P-2144, P-2145, P-2151 , P-2164, P-2165, P-2170, P-2173, P-2185, P-2186

Table 2b. Compounds with activity toward kinase B-Raf V600E with ICso£ 10 μM under the test conditions employed.

B-Raf P-1247, P-1449, P-1450, P-1453, P-1454, P-1455, P-1462, P-1466, P-1467, P-1470, V600E P-1471, P-1531 , P-1 532, P-1544, P-1568, P-1569, P-1578, P-1579, P-1584, P-1597, P-1613, P-1698, P-1721 , P-1768, P-1769, P-1797, P-1802, P-2100, P-2164, P-2165, P-2185, P-2186

Table 2c. Compounds with activity toward kinase B-Raf V600E/T529I with IC₅₀ < 10 μM under the test conditions employed.

B-Raf P-2151, P-2152, P-2154, P-2156, P-2166

V600E/

T529I Atty. Dkt. No.: 039363-3303

Table 2d. Compounds with activity toward kinase Btk with IC₅₀ < 10 μM under the test conditions employed.

Btk: P-2140, P-2143, P-2144, P-2145, P-2161, P-2162, P-2163, P-2164

Table 2e. Compounds with activity toward kinase c-Raf-1 with IC₅₀ < 10 μM under the test conditions employed. c-Raf-1 : P-1247, P-1453, P-1454, P-1455, P-2107, P-2143, P-2155, P-2185

Table 2f. Compounds with activity toward kinase Fak with IC₅₀ < 10 μM under the test conditions employed.

Fak: P-1247, P-1449, P-1450, P-1453, P-1455, P-2181

Table 2g. Compounds with activity toward kinase FGFR with ICs₀^ 10 μM under the test conditions employed.

FGFR: P-1249, P-1453, P-1454, P-1455, P-1467, P-1584, P-1597, P-2155, P-2157, P-2159, P-2160

Table 2h. Compounds with activity toward kinase Fltl with IC₅₀5 10 μM under the test conditions employed.

Fltl: P-1247, P-1462, P-1467, P-1531, P-1532, P-1544, P-1569, P-1584, P-1597, P-1613,

P-2101, P-2107, P-2108, P-2109, P-2117, P-2145, P-2146, P-2149, P-2151 , P-2154,

P-2161 , P-2164, P-2165, P-2170, P-2185

Table 2i. Compounds with activity toward kinase Fms with IC₅₀ < 10 μM under the test conditions employed.

2113, P-2114, P-2125,

P-2180,

Atty. Dkt. No. : 039363-3303

Table 2j Compounds with activity toward kinase Jnkl with IC₅₀ < 10 μM under the test conditions employed.

Jnkl : P-1896. P-1897

Table 2k. Compounds with activity toward kinase Kdr with IC₅₀ ≤ 10 μM under the test conditions employed. P-2145, P-2146, P-2156, P-2157, P-2166, P-2167,

Table 21. Compounds with activity toward kinase Kit with IC₅₀ < 10 μM under the test conditions employed.

Kit: P-1247, P-1449, P-1450. P-1453, P-1454, P-1455, P-1462, P-1466, P-1467, P-1470, P-1471, P-1531, P-1532, P-1544, P-1568, P-1569, P-1578, P-2100, P-2101, P-2105, P-2106, P-2107, P-2108, P-2109, P-21 10, P-21 11 , P-2112, P-21 14, P-2117, P-2120, P-2130, P-2137, P-2139, P-2140, P-2145, P-2146, P-2148, P-2149, P-2151 , P-2156, P-2157, P-2158, P-2159, P-2160, P-2161, P-2162, P-2163, P-2164, P-2165, P-2167, P-2172, P-2173, P-2174, P-2176, P-2178, P-2180, P-2184, P-2185

Table 2m. Compounds with activity toward kinase Met with IC₅₁) < 10 μM under the test conditions employed.

Table 2n. Compounds with activity toward kinase p38 with IC₅₀ < 10 μM under the test conditions employed. p38: P-2167

Table 2o. Compounds with activity toward kinase Src with IC₅₀ < 10 μM under the test conditions employed.

Src: P-1247, P-2108, P-2109, P-21 17, P-2145, P-2151

Table 2p. Compounds with activity toward kinase TrkA with IC₅₀ < 10 μM under the test conditions employed.

TrkA: ] P-1844, P-1885, P-1976, P-1978, P-2038, P-2099, P-2100, P-2101 , P-2103, P-2104, P-2106, P-2107, P-2108, P-2109, P-2110, P-211 1 , P-21 12, P-2114, P-21 15, P-21 16, , P-21 17, P-2145, P-2146, P-2170, P-2171, P-2172, P-2173, P-2174, P-2175, P-2176, P-2178, P-2179, P-2180, P-2181, P-2182, P-2185, P-2186 Atty. Dkt. No.: 039363-3303

Tabic 2q, Compounds with activity toward kinase HGK with IC_S0 < 10 μM under the test conditions employed.

Example 55: Efficacy of Compounds in Combination with Standard-of-Care Chemotherapeutic agents in four human cancer cell lines.

[0540] Compounds of the invention, such as compounds of Formula I, Formula II, Formula III, or Formula IV, in combination with a standard chemotherapeutic agent, such as 5-fluorouracil, carboplatin, dacarbazine, gefitinib, oxaliplatin, paclitaxel, SN-38, temozolomide, or vinblastine, can be assessed for their effectiveness in killing human tumor cells. Human tumor cell lines, such as A- 375 (malignant melanoma), SK-MEL-2 (malignant melanoma, skin metastasis), COLO 205 (colorectal adenocarcinoma, ascites metastasis) or SW-620 (colorectal adenocarcinoma, lymph node metastasis) can be treated with a compound of Formula I, Formula II, Formula III, or Formula IV, alone, or in combination with one of the above-mentioned chemotherapeutic agents.

[0541] Tumor cells are grown as a monolayer at 37 ⁰C in a humidified atmosphere (5% CO₂, 95% air). Cells are grown in a suitable culture medium, e.g. RPMl 1640 (Ref BE12-702F, Cambrex, Verviers, Belgium) containing 2 mM L-glutamine and supplemented with 10% fetal bovine serum (Ref DE 14-80 IE, Cambrex). For experimental use, the tumor cells are detached from the culture flask by a 5-minute treatment with trypsin-versene (Ref 02-007E, Cambrex), diluted in Hanks' medium without calcium or magnesium (Ref BE10-543F, Cambrex). Trypsin treatment is neutralized by culture medium addition. The cells arc counted in a hemocytometer and their viability assessed by 0.25% trypan blue exclusion.

[0542] The cell lines are checked for mycoplasma contamination with the Mycotect assay kit (Ref 15672-017, Invitrogen, Cergy-Pontoise, France) in accordance with the manufacturer's instructions. The mycoplasma test is assayed from the culture supernatants of the cell lines and compared to negative and positive controls.

[0543] The tumor cells (10,000 per well) are plated in 96-well flat-bottom microtitration plates (Ref 055260, Nunc, Dutscher, Brumath, France) and incubated at 37 ⁰C for 24 hours before treatment in 100 μl of drug-free culture medium supplemented with 10% FBS. In order to assess the IC₅₀ of each compound to be used for each cell line, the tumor cells are incubated in a 200 μl final volume of RPMI 1640 supplemented with 10% FBS and containing either a compound of Formula I, Formula II, Atty. Dkt. No - 039363-3303

Formula III, or Formula IV, or one of 5-fluorouracil, carboplatm, dacarbazine, gefitimb, oxahplatin, pachtaxel, SN-38, temozolomide, or vinblastine The compounds are tested in a suitable concentration range, such as 10 ⁸ to 10 ³ M for a compound of Formula I, Formula II, Formula III, or Formula IV, 5-fluorouracil, dacarbazine or gefitimb, 10 ⁹ to 10⁴ M for carboplatm, oxahplatin, or temozolomide, 10 " to 10 ⁶ M for pachtaxel or SN-38, and 10 ^1S to 10 ¹⁰ M for vinblastine Compounds of Formula I, Formula II, Formula III, or Formula IV, are dissolved in DMSO and diluted with culture medium to the desired concentrations 5-fluorouracil (50 mg/ml, Dakota Pharm, LePlessis Robmson, France), carboplatm (10 mg/ml, A.guettant, Lyon, France), and pachtaxel (6 mg/ml, Bristol-Myers Squibb SpA, Rueil Malmaison, France), are diluted with culture medium to the desired concentrations Dacarbazine (Sigma, Saint Quentin Fallavier, France) and vinblastine (Lilly France S A , Saint Cloud, France) are dissolved in NaCl 0 9% and diluted with culture medium to the desired concentrations Gefitimb is dissolved in a mixed solution of RPMI 1640 and DMSO and diluted with culture medium to the desired concentrations (maximum final DMSO of 0 1% v/v) SN- 38 (LKT Laboratories, lnc , St Paul, Minnesota) is dissolved in DMSO and diluted with culture medium to the desired concentrations (maximum final DMSO of 0 1 % v/v) Temozolomide (LKT Laboratories, lnc , St Paul, Minnesota) is dissolved in water for injection and diluted with culture medium to the desired concentrations Cells are incubated for 96 hours in the presence of test substances at 37 ⁰C under 5% CO₂ At the end of treatments, the cytotoxic activity is evaluated by an MTl assay

[0544] For the MTT assay, at the end of the cells treatment, 20 μl of a 5 mg/ml solution 0 22 μm filtered tetrazohum reagent (MTT, Ref M2128, Sigma) in Phosphate Buffered Saline (PBS, Ref BF17-517Q, Cambrex), is added in each well Culture plates are incubated for 2 h at 37 ⁰C The resulting supernatant is removed and formazan crystals dissolved with 200 μl of DMSO per well Absorbency (OD) is measured at 570 nm in each well using VICTOR¹™ 1420 multilabeled counter (Wallac, PerkinElmer, Courtaboeuf, France).

[0545] The IC₅₀ for each compound on each cell line is determined from the OD measurements of each sample The dose response inhibition of cell proliferation is expressed as

IC = (OD of drug exposed cells / OD of drug free wells) x 100

The mean of multiple measurements for each concentration is plotted vs the drug concentration The dose-response curves are plotted using XLF it 3 (IDBS, United Kingdom) The IC₅₀ (drag concentration to obtain 50% inhibition of cell proliferation) determination values are calculated using the XLF it 3 from semi-log curves The IC₅₀ value determined for each compound in each cell line is Atty. Dkt. No. : 039363-3303 used to determine the concentration of a compound of Formula I, Formula II, Formula III, or Formula IV, and of the standard chemotherapeutic to be used in combination.

[0546] The cells are treated with a combination of five concentrations of a compound of Formula I, Formula II, Formula III, or Formula IV, and five concentrations ot one of 5-fluorouracil, carboplatm, dacarbazine, gefitinib, oxaliplatm, paclitaxel, SN-38, temozolomide, or vinblastine, based on the IC^o results. The compounds and cells are treated per the IC50 determination described above and assayed by the MTT assay.

[0547] The results are assessed to determine whether the combination is synergistic or antagonistic. The compound interactions are calculated by multiple drug effect analysis and are perfoπned by the median equation principle according to the methodology described by Chou and Talalay (Adv. Enzyme Regul. 1984, 22: 27-55).

[0548] The combination index (CI) will be calculated by the Chou et al. equation (Adv En/yme Regul 1984, 22: 27-55 ; Encyclopaedia of human biology, Academic Press, 1991, 2 371-9: Synergism and Antagonism in Chemotherapy, Academic Press, 1991 , 61-102) which takes into account both the potency (D₁₁₁ or IC₅₀) and the shape of the dose-effect curve (the m value). The general equation for the CI of the two compounds is given by:

CI = ^(£>)l i ^(D)- i ^(jP)' ^(Z^ (£>,), (D_t)₂ (Z⁾J₁ (D.), where

(D_x) i and (D_x)₂ in the denominators are the doses (or concentrations) for compound 1 and compound 2 alone which demonstrate x% of inhibition, whereas (D) j and (D)₂ in the numerators are doses of both compounds (1 and 2) in combination that also inhibit x% (iso-effective). CI<1, =1, and >1 indicate synergism, additive effect and antagonism, respectively.

[0549] The (D_x)] and (D_x)₂ can be calculated from the median-effect equation of Chou et al (J, Natl. Cancer Inst. 1994, 86 1517-24): Atty Dkt No 039363-3303

where

D_1n is the median-effect dose that is oblamed from the anti-log of x-intercept of the median-effect plot, x - log(D) versus y = log {/7(1 -/J}, or D_n, = 10 ^{(> maL}'^{rt) m}, and m is the slope of the median-effect plot and /_a is the fraction of cells affected by the treatment

Each CI will be calculated with CalcuSyn software (Biosoft, UK) from the mean affected fraction at each drug ratio concentration

[0550] Additional examples of certain methods contemplated by the present invention may be found in the following applications U S Patent Pub 1 No 2006/058339, App Ser No 11/154,287, U S Patent Publ No 2006/058340, App Ser No 11/154,988, U S Prov App No 60/682,076, filed May 17, 2005, U S Prov App No 60/682,058, filed May 17, 2005, U S Prov App No 60/682,063, filed May 17, 2005, U S Prov App No 60/682,051, filed May 17, 2005, U S Prov App No 60/682,042, filed May 17, 2005, U S Prov App No 60/692,750, filed June 22, 2005, and U S Prov App No 60/692,960, filed June 22, 2005, U S Pro\ App No 60/731,528, filed October 28, 2005, U S Patent App No 1 1/435,381 , filed May 16, 2006, and U S Patent App No 11/473,347, filed June 21, 2006, each of which are hereby incorporated by reference herein in their entireties including all specifications, figures, and tables, and for all purposes

[0551] All patents and other references cited in the specification are indicative oi the level of skill of those skilled in the art to which the invention pertains, and arc incorporated by reference in their entireties, including any tables and figures, to the same extent as if each reference had been incorporated by reference in its entirety individually

[0552] One skilled in the art would readily appreciate that the present invention is well adapted to obtain the ends and advantages mentioned, as well as those inherent therein The methods vaπances, and compositions described herein as presently representative of preferred embodiments are exemplary and are not intended as limitations on the scope of the invention Changes therein and other uses will occur to those skilled in the art which are encompassed within the spirit of the invention, are defined by the scope of the claims

[0553] It will be readily apparent to one skilled in the art that varying substitutions and modifications may be made to the invention disclosed herein without departing from the scope and spirit of the invention Atty Dkt. No : 039363-3303

[0554] The invention illustratively descnbed herein suitably may be practiced in the absence ot any element or elements, limitation or limitations w hich is not specifically disclosed herein Thus, for example, in each instance herein any of the terms "comprising", "consisting essentially of and "consisting of may be replaced with either of the other two teπns Thus, for an embodiment of the in\ention using one of the teπns, the πrvention also includes another embodiment wherein one of these terms is replaced with another of these terms In each embodiment, the terms have their established meaning Thus, for example, one embodiment may encompass a method "comprising'^" a series of steps, another embodiment would encompass a method "consisting essentially of the same steps and a third embodiment would encompass a method "consisting of the same steps The terms and expressions which have been employed are used as terms of description and not of limitation, and there is no intention that m the use of such terms and expressions of excluding any equivalents of the features shown and descnbed or portions thereof, but it is recognized that various modifications are possible within the scope of the invention claimed 1 hus, it should be understood that although the present invention has been specifically disclosed by preferred embodiments and optional features, modification and variation of the concepts herein disclosed may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention as defined by the appended claims

[0555] In addition, where features or aspects of the invention are described in terms of Markush groups or other grouping of alternatives, those skilled in the art will recognize that the invention is also thereby descnbed in terms of any individual member or subgroup of members of the Markush group or other group

[0556] Also, unless indicated to the contrary, where various numerical values are provided for embodiments, additional embodiments are described by taking any 2 different values as the endpoints of a range Such ranges are also within the scope of the descnbed invention

[0557] Thus, additional embodiments are within the scope of the invention and withm the following claims

Claims

Atty Dkt No/ 039363-3303CLAIMSWhat is claimed is:

1. A compound having the chemical structure of Formula II,

all salts, prodrugs, tautomers, and isomers thereof, wherein t is O, 1, 2, or 3, Z₂ is N or CR¹², Z₆ is N or CR¹⁶, L₄ is selected from the group consisting of -(CR¹⁰R¹ ' VNR^-(CR¹⁰R¹ V_>

-(CR¹⁰R¹¹VX-(CR¹⁰R¹V, -(CR¹⁰R' ¹^-C(X)-(CR¹⁰R¹¹),-, -(CR¹⁰R¹¹^-S(O)-(CR¹⁰R¹¹V, -(CR¹⁰R¹¹VS(O)₂-(CR¹⁰R^{1 1}V -(CR¹V ¹)_p-C(X)NR²⁵-(CR¹⁰R")_q-,

-(CR¹⁰R¹¹VS(O)2NR²⁵-(CR¹⁰R^u)_q-, -(CR¹⁰R¹¹VNR²⁵C(X)-(CR¹⁰R¹¹V. -(CR¹⁰R¹¹VNR²⁵S(O)₂-(CR¹⁰R¹¹),,-, -(CR^l0R¹¹)_p-NR²'C(X)NR²⁵-(CR¹⁰R¹¹)_q-, and -(CR¹⁰R¹¹)_p-NR^2SS(O)₂NR²⁵-(CR¹⁰R¹¹)_q-, p and q are independently 0, 1, or 2 provided, however, that at least one of p and q is 0;

R is selected from the group consisting of hydrogen, halogen, optionally substituted lower alkyl, optionally substituted lower alkenyl, optionally substituted lower alkynyl, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, optionally substituted heteroaryl, -CN, -NO₂, -CR¹¹R¹¹R²⁶, and -LR²⁶,

R⁶¹ is hydrogen, lower alkyl, or fluoro substituted lower alkyl;

A is selected from the group consisting of -O-, -S-, -CR^aR^h-, -NR¹-, -C(O)-, -C(S)-, -S(O)-, and -S(O)₂-;

R^a and R^b at each occurrence are independently selected from the group consisting of hydrogen, fluoro, -OH, -NH₂, lower alkyl, lower alkoxy, lower alkylthio, mono-alkylammo, di-alkylamino, and -NR¹⁵R⁹, wherein the alkyl cham(s) of lower alkyl, lower alkoxy, lower alkylthio, mono-alkylammo, or di-alkylamino are optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, Atty. Dkt. No. 039363-3303 mono-alkylammo, di-alkylamino, and cycloalkylamino, provided, however, that any substitution of the alkyl chain carbon bound to O of alkoxy, S of thioalkyl or N of mono- or di-alkylamino is fluoro, or

R^a and R^b combine to form a 3-7 membered monocyclic cycloalkyl or 5-7 membered monocyclic heterocycloalkyl, wherein the monocyclic cycloalkyl or monocyclic heterocycloalkyl are optionally substituted with one or more substituents selected from the group consisting of halogen, -OH, -NH₂, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino;

R¹ is selected from the group consisting of hydrogen, lower alkyl, cycloalkyl, heterocycloalkyl, aryl, heteroaryl, -C(O)R⁷, -C(S)R⁷, -S(O)₂R⁷, -C(O)NHR⁷, -C(S)NHR⁷, and -S(O)₂NHR⁷, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, lower alkylthio, mono-alkylammo, di-alkylamino, and -NR⁸R^, wherein the alkyl chain(s) of lower alkoxy, lower alkylthio, mono-alkylamino, or di-alkylamino are optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino, provided, however, that any substitution of the alkyl chain carbon bound to O of alkoxy, S of thioalkyl or N of mono- or di-alkylammo is fluoro, further provided that when R¹ is lower alkyl, any substitution on the lower alkyl carbon bound to the N of -NR¹- is fluoro, and wherein cycloalkyl, heterocycloalkyl, aryl or heteroaryl are optionally substituted with one or more substituents selected from the group consisting of halogen, -OH, -NH₂, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino;

R⁷ is selected from the group consisting of lower alkyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, lower alkylthio, mono-alkylamino, di-alkylamino, and -NR⁸R*, provided, however, that any substitution of the alkyl carbon bound to the N of -C(O)NHR", -C(S)NHR⁷ or -S(O)₂NHR⁷ is fluoro, wherein the alkyl cham(s) of lower alkoxy, lower alkylthio, mono-alkylamino, or di-alkylamino are optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino, provided, however, that any substitution of the alkyl chain carbon bound to O of alkoxy, S of thioalkyl or N of mono- or di-alkylamino is fluoro, and wherein cycloalkyl, heterocycloalkyl, aryl and heteroaryl are optionally substituted with one or more substituents selected from the group Atty Dkt No ^• 039363-3303 consisting of halogen, -OH, -NH₂. lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylammo, di-alkylamino, and cycloalkylammo, each of R , R⁵, R⁶, R^1*, R¹³, and R¹⁶, are independently selected from the group consisting of hydrogen, halogen, optionally substituted lower alkyl, optionally substituted lower alkenyl, optionally substituted lower alkynyl, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, optionally substituted heteroaryl, -CN, -NO₂, -CR^aR^bR²⁶, and -LR²⁶,

L at each occurrence is independently selected from the group consisting of -(alk)_a-X-(alk)_b-, -(alk)_a-NR²⁵-(alk)_b-, -(alk)_d-C(X)-(alk)_b-, -(alk)_d-S(O)-(alk)_b-, -(alk)_a-S(O)₂-(alk)_b-, -(alk)_a-OC(X)-(alk)_b-, -(alk)_a-C(X)O-(alk)_b-, -(alk)_a-C(X)NR²⁵-(alk)_b-, -(alk)_a-S(O)₂NR^2S-(alk)_b-, -(alk)_a-NR²⁵C(X)-(alk)_b-, -(alk)_a -NR²⁵S(O)₂ -(alk)_b-, -(alk)_a-NR²⁵C(X)O-(alk)_h-, -(alk)_a-OC(X)NR^2S-(alk)_b-, -(alk)_a-NR²⁵C(X)NR⁹⁵-(alk)_b-, and -(alk)_a-NR²⁵S(O)₂NR²'-(alk)_b-, a and b are independently 0 or 1 , alk at each occurrence is independently C] ₃ alkylene or Ci ^ alkylene substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkyl, lower alkoxy, lower alkylthio, mono-alkylamino, di-alkylammo, and -NR⁸R⁹, wherein lower alkyl or the alkyl chain(s) of lower alkoxy, lower alkylthio, mono-alkylammo or di-alkylammo are optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylammo, di-alkylamino and cycloalkylammo, provided, however, that any substitution of the alkyl chain carbon bound to O of alkoxy, S of thioalkyl or N of mono- or di-alkylammo is fluoro, X at each occurrence is independently O or S; R²⁵ at each occurrence is independently selected from the group consisting of hydrogen, optionally substituted lower alkyl, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, and optionally substituted heteroaryl, R²⁶ at each occurrence is independently selected from the group consisting of hydrogen, provided, however, that hydrogen is not bound to any of S(O), S(O)₂, C(O) or C(S) of L, optionally substituted lower alkyl, optionally substituted lower alkenyl, provided, however, that when R²⁶ is optionally substituted lower alkenyl, no alkene carbon thereof is bound to N, S, O, S(O), S(O)₂, C(O) or C(S) of L, optionally substituted lower alkynyl, provided, however, that when R ^h is optionally substituted lower alkynyl, no alkyne carbon thereof is bound to N, S, O, S(O), S(O)₂, C(O) or C(S) of L, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, and optionally substituted heteroaryl, Atty Dkt No 039363-3303

R¹⁰ and R¹¹ at each occurrence are independently selected from the group consisting of hydrogen, fluoro, lower alkyl, and lower alkyl optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH,, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio mono-alky lammo di- alkylamino, and cycloalkylamino, or any two of R¹⁰ and R^{1 1} on the same or adjacent carbon atoms combine to form a 3-7 membered monocyclic cycloalkyl or 5-7 membered monocyclic heterocycloalkyl, and any others of R¹⁰ and R¹¹ are independently selected from the group consisting of hydrogen, fluoro, lower alkyl, and lower alkyl optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylammo, di-alkylamino, and cycloalkylamino, and wherein the monocyclic cycloalkyl or monocyclic heterocycloalkyl are optionally substituted with one or more substituents selected from the group consisting of halogen, -OH, -NH₂, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di alkylamino, and cycloalkylamino,

R⁸ and R⁹ combine with the nitrogen to which they are attached to form a 5-7 membered heterocycloalkyl optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, NH₂, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, and fluoro substituted lower alkylthio,

R^r IS selected from the group consisting of hydrogen halogen, optionally substituted lower alkyl and -OR¹⁸, and

R¹⁸ is hydrogen or optionally substituted lower alkyl, provided, however, that the compound is

Atty. Dkt. No.: 039363-3303

2. The compound of Claim 1, having the chemical structure of Formula Ha,

all salts, prodrugs, tautomers, and isomers thereof, wherein:

A₁ is -O-, -CR^4UR" '-, -C(O)- or -NR⁴⁸-;

Z_i2 is N or CR 5³2^/.;

L₃ is selected from the group consisting of -NR⁴ -, -S-, -O-, -NR⁴⁸ClI(R⁴")-, -SCH(R⁴>, -OCH(R⁴⁹)-, -C(O)NR⁴⁸-, -S(O)₂NR⁴⁸-, -CH(R⁴⁹)NR⁴⁸-, -CH(R⁴⁹)O-, -CH(R⁴⁹)S-, -NR⁴⁸C(O)-, and -NR⁴⁸S(O)₂-;

R⁴⁰ and R⁴¹ are independently selected from the group consisting of hydrogen, fluoro, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino; or

R⁴⁰ and R⁴¹ combine to form a 3-7 membered monocyclic cycloalkyl or 5-7 membered monocyclic heterocycloalkyl, wherein the monocyclic cycloalkyl or monocyclic Atty Dkt No. 039363-3303 hctcrocycloalkyl is optionally substituted with one or more substituents selected from the group consisting of halogen, -OH, -NH₂, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro substituted low er alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylammo, di-alkylamino, and cycloalkylamino, R⁶¹ is hydrogen, lower alkyl, or fluoro substituted lower alkyl,

R¹⁰⁰ is selected from the group consisting of hydrogen, -OH, -NH₂, -CN, -NO₂, -C(O)OH, -S(O)₂NH₂, -C(O)NH₂, -OR⁵⁷, -SR⁵⁷, -NR⁴⁸R⁵⁷, -NR⁴⁸C(O)R⁵⁷, -NR⁴⁸S(O)₂R'⁷ -S(O)R⁵⁷, -S(O)₂R⁵⁷, -C(O)R⁵⁷, -C(O)OR'⁷, -C(O)NR⁴⁸R⁵⁷, -S(O)₂NR⁴⁸R⁵⁷, halogen, lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, C(O)OH, -C(O)NH₂, -OR⁵⁷, -SR⁵⁷, -NR⁴V⁷, -C(O)OR⁵⁷, -C(O)NR⁴⁸R⁵⁷, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, and wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaryl as R¹⁰⁰, or as substituents of lower alkyl, are optionally substituted with one or more independent substituents R¹⁰¹,

R¹⁰¹ at each occurrence is independently selected from the group consisting of -OH, -NH₂, -CN, -NO₂, -C(O)OH, -S(O)₂NH₂, -C(O)NH₂, -OR⁵⁷, -SR⁵⁷, -NR⁴⁸R⁵⁷, -NR⁴⁸C(O)R⁵⁷, -NR⁴⁸S(O)₂R⁵⁷, -S(O)R⁵⁷, -S(O)₂R⁵⁷, -C(O)R^5", -C(O)OR⁵⁷, -C(O)NR⁴⁸R⁵⁷, -S(O)₂NR⁴⁸R⁵⁷, halogen, lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, C(O)OH, -C(O)NH₇, -OR⁵⁷, -SR^5", -NR⁴⁸R⁵⁷, -C(O)OR⁵⁷, -C(O)NR⁴⁸R", cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, and wherein c>cloalk>l, heterocycloalkyl, aryl, and heteroaryl as R¹⁰¹, or as substituents of lower alkyl, are optionally substituted with one or more substituents selected from the group consisting of -OH, -NH₂, -CN, -NO₂, -C(O)OH, -S(O)₂NH₂, -C(O)NH₂, -OR⁵⁸, -SR⁵⁸, -NR⁴⁸R⁵⁸, -NR⁴⁸C(O)R⁵⁸, -NR⁴⁸S(O)₂R⁵⁸, -S(O)R⁵⁸, -S(O)₂R⁵⁸, -C(O)R⁵⁸, -C(O)OR⁵⁸, -C(O)NR⁴⁸R⁵⁸, -S(O)₂NR⁴⁸R⁵⁸, halogen, lower alkyl, fluoro substituted lower alkyl, and cycloalkylamino,

R⁵³ and R⁵⁵ are independently selected from the group consisting of hydrogen, halogen, lower alkyl and lower alkoxy, wherein the alkyl chain of lower alkyl or lower alkoxy is optionally substituted with fluoro, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylammo or cycloalkylamino, provided, however, that any substitution on the alkyl carbon bound to the -O- of low er alkoxy is fluoro, R⁵² and R⁵⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy, R⁵⁷ at each occurrence is independently selected from the group consisting of lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, lower alkoxy, Atty Dkt No ^• 039363-3303 fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alk>lthio, mono- alkylammo, di-alkylamino, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, provided, however, that any substitution of the alkyl carbon bound to O, S, or N of -OR^5", -SR⁵⁷, -NR⁴⁸R⁵⁷, -C(O)OR⁵⁷, -C(O)NR⁴⁸R^3", or -S(O)₂NR⁴⁸R⁵⁷ is fluoro, cycloalkyl, heterocycloalkyl, aryl or heteroaryl, and wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaryl as R⁵⁷ or as substituents of lower alkyl are optionally substituted with one or more substituents selected from the group consisting of -OH, -NH₂, -CN, -NO₂, -C(O)OH, -S(O)₂NH₂, -C(O)NH₂, -OR³⁸, -SR⁵⁸, -NR⁴⁸R⁵⁸, -NR⁴⁸C(O)R⁵⁸, -NR⁴⁸S(O)₂R⁵⁸, -S(O)₂R⁵⁸, -C(O)R⁵⁸, -C(O)OR⁵⁸, -C(O)NR⁴⁸R⁵⁸, -S(O)_^NR⁴⁸R⁵⁸, halogen, lower alkyl, fluoro substituted lower alkyl, and cycloalkylamino,

R⁵⁸ at each occurrence is independently selected from the group consisting of lower alkyl, heterocycloalkyl and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono- alkylamino, di-alkylammo, and cycloalkylamino, provided, however, that any substitution of the alkyl carbon bound to O, S, or N of -OR⁵⁸, -SR⁵⁸, -NR⁴⁸R⁵⁸, -C(O)OR⁵⁸, -C(O)NR⁴⁸R⁵⁸, or -S(O)₂NR⁴⁸R⁵⁸ is fluoro, and wherein heterocycloalkyl and heteroaryl are optionally substituted with one or more substituents selected from the group consisting of halogen, -CN, lower alkyl, fluoro substituted lower alkyl, lower alkoxy and fluoro substituted lower alkoxy,

R⁴⁸ at each occurrence is independently hydrogen or lower alkyl;

R⁴⁹ is selected from the group consisting of hydrogen, lower alkyl, and fluoro substituted lower alkyl, and

t is O, 1, 2, or 3

3. The compound of Claim 2 wherein A₁ is -CR⁴⁰R⁴¹- or -C(O)-

4. The compound of Claim 3 wherein L₃ is -NR⁴⁸CH(R⁴⁹)-, -SCII(R⁴⁹)-, or -OCH(R⁴⁹)-

5. The compound of Claim 4 wherein R^5λ and R^5S are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy

6. The compound of Claim 5, wherein

R¹⁰⁰ is selected from the group consisting of hydrogen, -OH, -NH₂, -CN, -NO₂, -C(O)OH, -S(O)₂NH₂, -C(O)NH₂, -OR⁵⁷, -SR⁵⁷,

-NR⁴⁸C(O)R⁵⁷, -NR⁴⁸S(O)₂R⁵⁷, -S(O)R⁵⁷, -S(O)₂R⁵⁷, -C(O)R⁵⁷, -C(O)OR⁵⁷, -C(O)NR⁴⁸R⁵⁷, -S(O)₂NR⁴⁸R^5', halogen, lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein lower alkyl is optionally substituted Atty. Dkt. No.: 039363-3303 with one or more substituents selected from the group consisting of fluoro, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono- alkylamino, di-alkylamino, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, and wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaryl as R¹³⁰ or as substituents of lower alkyl are optionally substituted with one or more substituents selected from the group consisting of -OH, -NH₂, -CN, -NO₂, -S(O)₂NH₂, -C(O)NH₂, -OR^S8. -SR⁵⁸, -NHR^5S, -NR⁴⁸R⁵⁸, -NR⁴⁸C(O)R⁵⁸, -NR⁴⁸S(O)₂R⁵³, -S(O)₂R⁵⁸, -S(O)₂NR⁴⁸R⁵⁸, -C(O)R⁵⁸, -C(O)NR⁴⁸R⁵⁸, halogen, lower alkyl, fluoro substituted lower alkyl, and cycloalkylamino.

7. The compound of Claim 6 wherein A| is -CH₂-,

8. The compound of Claim 7 wherein L₃ is -OCH(R⁴⁹)-.

9. The compound of Claim 8 wherein:

Z₁₂ is CR⁵²;

Z₁₆ is CR⁵⁶;

R¹⁰⁰ is selected from the group consisting of hydrogen, -CN, -C(O)OH, -C(O)OR⁵⁷, -NR⁴⁸R⁵⁷, -OR⁵⁷, -S(O)₂R⁵⁷, fluoro, chloro, bromo, lower alkyl. fluoro substituted lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl or heteroaryl are optionally substituted with one or more substituents selected from the group consisting of halogen, lower alkyl, fluoro substituted lower alkyl, -NR⁴⁸R⁵⁸, -OR⁵⁸ and -S(O)₂R⁵⁸; and

R¹⁰¹ is selected from the group consisting of -OH, -NH₂, -CN, -NO₂, -C(O)OH, -C(O)NH₂,

-S(O)₂NH₂-, C(O)OR⁵⁷, -NR⁴⁸R⁵⁷, -OR⁵⁷, -S(O)₂R⁵⁷, -C(O)NR⁴⁸R⁵⁷, -S(O)₂NR⁴⁸R⁵⁷, halogen, lower alkyl, fluoro substituted lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl or heteroaryl are optionally substituted with one or more substituents selected from the group consisting of halogen, lower alkyl, fluoro substituted lower alkyl, -NR⁴⁸R⁵⁸, -OR⁵⁸ and -S(O)₂R⁵⁸.

10. The compound of claim 9. wherein the compound is selected from the group consisting of:

2-[5-Chloro-4-(5-chloro-lH-pyrrolo[2,3-b]pyridin-3-ylmethyl)-2-fluoro-phenoxymethyl]-l H- benzoimidazole,

2-[4-(5-Chloro-l H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-2,5-difluoro-phenoxymethyl]-l H- benzoimidazole,

2-[2.5-Difluoro-4-(5-methoxy-lH-pyrrolo[2,3-b]pyridin-3-ylmethyl)-phenoxymethyl]-l H- benzoimidazole, 2-[3,5-Difluoro-4-(lH-pyrrolo[2,3-b]pyridin-3-ylmethyl)-phenoxymethyl]-lH-benzoimidazole, Atty Dkt No 039363-3303

2-[5-Chloro-2-methoxy-4-(lH-pyrrolo[2,3-b]pyridin-3-ylmcthyl)-phenoxymethyl]-lH- benzoimidazole,

2-[5-Chloro-4-(5-chloro-lH-pyrrolo[2,3-b]pyπdin-3-ylmethyl)-2-methoxy-phenoxymethyl]-lH- benzoimidazole,

2-[4-(5-Chloro-lH-pyrrolo[2,3-b]pyπdin-3-ylmethyl)-3,5-difluoro-phcnoxymethyl]-lH- benzoimidazole,

2-[4-(5-Chloro-lH-pyrrolo[2,3-b]pyridin-3-yliτiethyl)-5-fluoro-2-methoxy-phenoxymetliyl]-l -methyl-

1 H-benzoimidazole,

2-[4-(5-Bromo-lH-pyrrolo[2,3-b]pyridm-3-ylmethyl)-2,5-difluoro-phenoxymethyl]-lH- benzoimidazole,

2- {2,5-Difluoro-4-[5-(l-methyl-lH-pyrazol-4-yl)-lH-pyrrolo[2,3-b]pyπdin-3-ylmethyl]- phenoxymethyl}-lH-benzoimidazole,

2- {5-Chloro-2-fluoro-4-[5-(l-methyl-lH-pyrazol-4-yl)-l H-pyrτolo[2,3-b]pyπdin-3-ylmethyl]- phenoxymethyl}-lH-benzoimidazole,

2- { 1 -[4-(5-Chloro- 1 H-pyrrolo[2,3-b]pyπdm-3 -ylmethyl)-5 -fluoro-2-m ethoxy-phenoxy] -ethyl} - IH- benzoimidazole,

6-Chloro-2-[4-(5-chloro-lH-pyrrolo[2,3-b]pyridm-3-ylmethyl)-5-fluoro-2-methoxy-phenoxymethyl]-

1 H-benzoimidazole,

6-Chloro-2-[5-fluoro-2-methoxy-4-(lH-pyrrolo[2,3-b]pyπdm-3-ylmethyl)-phenoxymethyl]-lH- benzoimidazole,

2-[5-Fluoro-2-methoxy-4-(lH-pyrrolo[2,3-b]pyridm-3-ylmethyl)-phenoxymethyl]-6-methoxy-lH- benzoimidazole,

2-[5-Chloro-2-fluoro-4-(5-methoxy-lH-pyrrolo[2,3-b]pyndin-3-ylmethyl)-phenoxymethyl]-lH- benzoimiddzole,

2-[5-Fluoro-4-(5-fluoro-lH-pyrrolo[2,3-b]pyπdin-3-ylmethyl)-2-methoxy-phenoxymethyl]-lH- benzoimidazole,

2-[2-Chloro-5-fluoro-4-(5 -methoxy- 1 H-pyrrolo[2,3-b]pyndm-3 -ylmethyl)-phenoxymethyl] - 1 H- ben7oimidazole,

2-{2-Chloro-5-fluoro-4-[5-(l-methyl-l H-pyra/ol-4-yl)-lH-pyrrolo[2,3-b]pyridin-3-ylmethyl]- phenoxymethyl}-lH-benzoimidazole,

2-{4-[(5-Chloro-lH-pyrrolo[2,3-b]pyridm-3-yl)-methoxy-methyl]-5-fluoro-2-methoxy- phenoxymethyl } - 1 H-benzoimidazole,

[4-( 1 H-Benzoimidazol-2-ylmethoxy)-2-fluoro-5-methoxy-phenyl]-(5 -chloro- 1 H-pyrrolo [2,3 - b]pyridm-3-yl)-methanone,

2-[2,5-Difluoro-4-(5-methanesulfonyl-lH-pyiτolo[2,3-b]pyπdin-3-ylmethyl)-phenoxymethyl]-lH- benzoimidazole,

3-[4-(lH-Benzoimidazol-2-ylmethoxy)-2-fluoro-5-i-nethoxy-benzyl]-lH-pyrrolo[2,3-b]pyridme-5- Atty. Dkt No : 039363-3303 carbonitnle,

5,6-Dichloro-2-[4-(5-chloro-lH-pyrrolo[2,3-b]pyπdin-3-ylmcthyl)-5-fIuoro-2-methoxy- phenoxymethyl]-lH-benzoimida7ole,

2-[4-(5-Cliloro-lH-pyrrolo[2,3-bJpyπdm-3-ylmethyl)-5-fluoro-2-methoxy-phenoxymethylJ-lH- benzoimidazole-5-sulfonic acid dimethylamide,

3-[4-(lH-Benzoimida7ol-2-ylmethoxy)-2-fluoro-5-methoxy-benzyl]-lII-pyrrolo[2,3-b]pyπdme-5- carboxylic acid methyl ester,

3-[4-(lH-Benzoimidazol-2-ylmethoxy)-2-fluoro-5-methoxy-benzyl]-lH-pyπ-olo[2,3-b]pyτidine-5- carboxylic acid,

2-{2,5-DifIuoro-4-[5-(2-methoxy-ethoxy)-lH-pyrrolo[2,3-b]pyridm-3-ylmethyl]-phenoxymethyl}-

1 H-benzoimidazole, 2-[4-(5-Chloro-lH-pyrrolo[2,3-b]pyπdin-3-ylmcthyl)-5-fluoro-2-methoxy-phenoxymethyl]-l -ethyl- lH-benzoimida7ole,

2-[4-(5-Chloro-lH-pyrrolo[2,3-b]ρyπdin-3-ylmethyl)-5-fluoro-2-methoxy-phenoxymethyl]-5- tπfluoromethyl- 1 H-benzoimidazole,

2-[4-(5-Chloro-lH-pyrrolo[2,3-b]pyridin-3-ylmethyl)-5-fluoro-2-methoxy-phenoxymethyl]-5-fIuoro-

1 H-benzoimidazole,

2-{2-[4-(5-Chloro-lH-pyrrolo[2,3-b]pyπdin-3-ylmethyl)-5-fluoro-2-rπethoxy-phenoxyJ-cthyl}-lH- benzoimidazole,

244-(5-Bromo-lH-pyrrolo[2,3-b]pyridin-3-ylmethyl)-5-fluoro-2-methoxy-phenoxymethyl]-lH- benzoimidazole,

2-[4-(5-Chloro-lH-pyrrolo[2,3-b]pyndm-3-ylmethyl)-5-fluoro-2-methoxy-phenoxymethylJ-5- methoxy- 1 H-benzoimidazole,

5-Chloro-2-[5-fluoro-2-methoxy-4-(5-methyl-lH-pyrrolo[2,3-b]pyridin-3-ylmethyl)-phenoxymethyl]-

1 H-bcnzoimidazole,

3-[4-(lH-Benzoimidazol-2-ylmethoxy)-2,5-difIuoro-benzyl]-lH-pyrrolo[2,3-b]pyπdme-5- cdrbonitπle,

2-[5-Fluoro-4-(5-methanesulfonyl-lH-pyrrolo[2,3-b]pyridin-3-ylmethyl)-2-methoxy- phenoxymethyl]-lH-ben7oimidazole, and all salts, prodrugs, tautomcrs, and isomers thereof Atty. Dkt. No.: 039363-3303

11. A compound having the chemical structure of Formula III,

all salts, prodrugs, tautomers, and isomers thereof, wherein:

Z₄ is N or CR¹⁴;

Z₅ is N or CR¹⁵;

Z₆ is N or CR¹⁶;

L₄ is selected from the group consisting of -(CR R")_P-NR -(CR¹ R )_q-_>

-(CR¹⁰R¹ VX-(CR¹⁰R¹ V, -(CR¹⁰R¹VC(XMCR¹⁰R¹V, -(CR¹V)_P-S(O)-(CR¹⁰R¹¹),,-, -(CR¹⁰R^{1 1}VS(O)₂-(CR¹⁰R¹V -(CR¹⁰R¹ VC(X)NR²⁵-(CR'°R' V -(CR¹⁰R¹¹)p-S(O)₂NR²⁵-(CR¹⁰R¹¹)_q-₎ -(CR¹⁰R¹¹VNR²⁵C(X)-(CR¹⁰R¹V -(CR¹⁰R¹¹VNR²⁵S(O)₂-(CR¹⁰R¹¹V, -(CR¹⁰R¹ ' VNR²⁵C(X)NR²^(CR¹⁰R¹ V and

-(CR'"R")_P-NR^/DS(O)₂NR" -(CR'"R^u)_q-, p and q are independently 0, 1, or 2 provided, however, that at least one of p and q is 0,

R^d and R^b at each occurrence are independently selected from the group consisting of hydrogen, fluoro, -OH, -NH₂, lower alkyl, lower alkoxy, lower alkylthio, mono-alkylammo, di-alkylamino, and -NR⁸R⁹, wherein the alkyl chain(s) of lower alkyl, lower alkoxy, lower alkylthio, mono-alkylamino, or di-alkylamino are optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NHi, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino, provided, however, that any substitution of the alkyl chain carbon bound to O of alkoxy, S of thioalkyl or N of mono- or di-alkylamino is fluoro, or

R⁸ and R^b combine to form a 3-7 membered monocyclic cycloalkyl or 5-7 membered monocyclic heterocycloalkyl, wherein the monocyclic cycloalkyl or monocyclic heterocycloalkyl are optionally substituted with one or more substituents selected from the group consisting of halogen, -OH, -NH₂, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylammo, and cycloalkylamino; Atty. Dkt. No.: 039363-3303

R¹ is selected from the group consisting of hydrogen, lower alkyl, cycloalkyl, heterocycloalkyl, aryl, heteroaryl, -C(O)R⁷, -C(S)R⁷, -S(O)₂R⁷, -C(O)NHR⁷, -C(S)NHR⁷, and -S(O)₂NHR⁷, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, lower alkylthio, mono-alkylamino, di-alkylammo, and -NR⁸R⁹, wherein the alkyl chain(s) of lower alkoxy, lower alkylthio, mono-alkylammo, or di-alkylamino are optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino, provided, however, that any substitution of the alkyl chain carbon bound to O of alkoxy, S of thioalkyl or N of mono- or di-alkylammo is fluoro, further provided that when R¹ is lower alkyl, any substitution on the lower alkyl carbon bound to the N of -NR¹- is fluoro, and wherein cycloalkyl, heterocycloalkyl, aryl or heteroaryl are optionally substituted with one or more substituents selected from the group consisting of halogen, -OH, -NH₂, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylammo, di-alkylamino, and cycloalkylamino;

R⁷ is selected from the group consisting of lower alkyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, lower alkylthio, mono-alkylamino, di-alkylamino, and -NR⁸R⁹, provided, however, that any substitution of the alkyl carbon bound to the N of -C(O)NHR⁷, -C(S)NHR⁷ or -S(O)₂NHR^" is fluoro, wherein the alkyl cham(s) of lower alkoxy, lower alkylthio, mono-alkylamino, or di-alkylamino are optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino, provided, however, that any substitution of the alkyl chain carbon bound to O of alkoxy, S of thioalkyl or N of mono- or di-alkylammo is fluoro, and wherein cycloalkyl, heterocycloalkyl, aryl and heteroaryl are optionally substituted with one or more substituents selected from the group consisting of halogen, -OH, -NH₂, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino, each of R⁴, R⁵, R⁶, R¹⁴, R^H, and R¹⁶, are independently selected from the group consisting of hydrogen, halogen, optionally substituted lower alkyl, optionally substituted lower alkenyl, optionally substituted lower alkynyl, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, optionally substituted heteroaryl, -CN, -NO₂, -CR^dR^bR²⁶, and -LR^:e; Atty Dkt No 039363-3303

L at each occurrence is independently selected from the group consisting of -(alk)_a-X-(alk)_b-, -(alk),-NR²⁵-(alk)_b-, -(alk)_a-C(X)-(alk)_b-, -(alk),-S(O)-(alk)_b-, -(alk).-S(O),-(alk)_b-. -(alk)_a-OC(X)-(alk)_b-, -(alk),-C(X)O-(alk)_h-₎ -(alk)_a-C(X)NR⁷⁵-(alk)_b-₎ -(aIk)_a-S(O)₂NR²⁵-(alk)_b-, -(alk)_a-NR²⁵C(X)-(alk)_b-, -(alk)_a-NR²⁵S(O)₂-(alk)_b-, -(alk)_a-NR^2<;C(X)O-(alk)_b-₍ -(alk)_a-OC(X)NR²⁵-(alk)_b-, -(alk)_a-NR²⁵C(X)NR^2:ι-(alk)_b-, and -(alk)_a-NR²⁵S(O)₂NR^2S-(alk)_b-, a and b are independently 0 or 1 , alk at each occurrence is independently Cj i alkylene or Ci ₃ alkylene substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkyl, lower alkoxy, lower alkylthio, mono-alkylamino, di-alkylamino, and -NR⁸R", wherein lower alkyl or the alkyl chain(s) of lower alkoxy, lower alkylthio, mono-alkylarmno or di-alkylammo are optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino, provided, however, that any substitution of the alkyl chain carbon bound to O of alkoxy, S of thioalkyl or N of mono- or di-alkylamino is fluoro, X at each occurrence is independently O or S, R²⁵ at each occurrence is independently selected from the group consisting of hydrogen, optionally substituted lower alkyl, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, and optionally substituted heteroaryl, R²⁶ at each occurrence is independently selected from the group consisting of hydrogen, provided, however, that hydrogen is not bound to any of S(O), S(O)₂, C(O) or C(S) of I , optionally substituted lower alkyl, optionally substituted lower alkenyl, provided, however, that when R²⁶ is optionally substituted lower alkenyl, no alkene carbon thereof is bound to N, S, O, S(O), S(O)₂, C(O) or C(S) of L, optionally substituted lower alkynyl, provided, however, that when R²⁶ is optionally substituted lower alkynyl, no alkyne carbon thereof is bound to N, S, O, S(O), S(O)₂, C(O) or C(S) of L, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, and optionally substituted heteroaryl, R¹⁰ and R^{1 1} at each occurrence are independently selected from the group consisting of hydrogen, fluoro, lower alkyl, and lower alkyl optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted low er alkylthio, mono-alkylamino, di- alkylamino, and cycloalkylamino, or any two of R¹⁰ and R^{1 1} on the same or adjacent carbon atoms combine to form a 3-7 membered monocyclic cycloalkyl or 5-7 membered monocyclic heterocycloalkyl, and any others of R¹⁰ and R^{1 1} are independently selected from the group consisting of hydrogen, fluoro, lower alkyl, and lower alkyl optionally subslituted with one or more substituents selected from the group Atty Dkt No 039363-3303 consisting of fluoro, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylammo, and wherein the monocyclic cycloalkyl or monocyclic heterocycloalkyl are optionally substituted with one or more substituents selected from the group consisting of halogen, -OH, -NH₂ lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio. fluoro substituted lower alkylthio, mono-alkylamino, di-alkylammo, and cycloalkylammo,

R⁸ and R⁹ combine with the nitrogen to which they are attached to form a 5-7 membered heterocycloalkyl optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, and fluoro substituted lower alkylthio,

R¹⁷ is selected from the group consisting of hydrogen, halogen, optionally substituted lower alkyl and -OR¹⁸, and

R¹⁸ is hydrogen or optionally substituted lower alkyl,

R⁸⁰ is Ci ₃ alkyl or C_{3 5} cycloalkyl, wherein C] ₃ alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro and C_{3 5} cycloalkyl, and

R⁸' is selected from the group consisting ot optionally substituted aryl, optionally substituted hcteroaryl, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, C_{2 4} alkyl, fluoro substituted C_{2 4} alkyl, and -(CH₂CH₂O)_1nR⁷', m is 1 , 2, or 3, and

R⁷' Is C] ₃ alkyl or fluoro substituted C_{1 3} alkyl, provided, however, that the compound is not

Atty. Dkt. No.: 039363-3303

12. The compound of Claim 11 having the chemical structure of Formula Ilia,

all salts, prodrugs, tautomers, and isomers thereof, wherein:

A) is -O-, -CR^4UR⁴ '-, -C(O)- or -NR" -; Z₁₄ is N or CR⁵⁴;

Z₁₅ is N or CR I⁵⁵⁵⁵;;

Z₁₆ Is N Or CR¹ ;

Cy is selected from the group consisting of aryl, heteroaryl, cycloalkyl, and heterocycloalkyl; Atty Dkt No 039363-3303

L_3a is selected from the group consisting of -NR⁴⁸-, -S-, -O-, -NR⁴⁸CH(R⁴⁹)-, -SCH(R⁴⁹)-, -OCII(R⁴⁹)-, -C(O)NR*-, -S(O)₂NR⁴⁸-, -CH(R⁴⁹)NR⁴\ -CH(R⁴⁹)O-. -CH(R⁴⁹)S-. -NR⁴⁸C(O)-, and -NR¹⁸S(O)₂-, R^ω is C, ₃ alkyl or C_{3 5} cycloalkyl, wherein C_{1 3} alky] is optionally substituted v» ith one or more substituents selected from the group consisting of fluoro and C_{3 5} cycloalkyl, R¹⁰⁰ is selected from the group consisting of hydrogen, -OH, -NH₁, -CN, -NO₂, -C(O)OH, -S(O)₂NH₂, -C(O)NH₂, -OR⁵⁷, -SR⁵⁷, -NR⁴⁸R⁵⁷, -NR⁴⁸C(O)R⁵⁷, -NR⁴⁸S(O)₂R⁵⁷, -S(O)R^5", -S(O)₂R⁵⁷, -C(O)R⁵⁷, -C(O)OR⁵⁷, -C(O)NR⁴⁸R^r, -S(O)₂NR⁴⁸R⁵⁷, halogen, lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein lower alkyl is optionally substituted w ith one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, C(O)OH, -C(O)NH₂, -OR⁵⁷, -SR⁵⁷, -NR⁴⁸R⁵⁷, -C(O)OR⁵⁷, -C(O)NR⁴⁸R⁵⁷, cycloalkyl, heterocyclodlkyl, aryl, and heteroaryl, and wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaryl as R¹⁰⁰, or as substituents of lower alkyl, are optionally substituted with one or more independent substituents R¹⁰¹,

R^!01 at each occurrence is independently selected from the group consisting of -OH, -NH₂, -CN, -NO₂, -C(O)OH, -S(O)₂NH₂, -C(O)NH₂, -OR⁵⁷, -SR⁵⁷, -NR⁴⁸R⁵⁷, -NR⁴⁸C(O)R⁵⁷, -NR⁴⁸S(O)₂R⁵⁷, -S(O)R⁵⁷, -S(O)₂R⁵⁷, -C(O)R⁵⁷, -C(O)OR⁵⁷, -C(O)NR⁴⁸R⁵⁷, -S(O)₂NR⁴⁸R⁵⁷, halogen, lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, C(O)OH, -C(O)NH₂, -OR⁵⁷, -SR⁵⁷, -NR⁴⁸R⁵⁷, -C(O)OR⁵⁷, -C(O)NR⁴³R⁵⁷, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, and wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaryl as R¹⁰¹, or as substituents of lower alkyl, are optionally substituted with one or more substituents selected from the group consisting of -OH, -NH₂, -CN, -NO₂, -C(O)OH -S(O)₂NH₂, -C(O)NH₂, -OR⁵⁸, -SR⁵⁸, -NR⁴⁸R⁵⁸, -NR⁴⁸C(O)R⁵⁸, -NR⁴⁸S(O)₂R⁵⁸, -S(O)R⁵⁸, -S(O)₂R⁵⁸, -C(O)R⁵⁸, -C(O)OR⁵⁸, -C(O)NR⁴⁸R⁵⁸, -S(O)₂NR⁴⁸R⁵⁸, halogen, lower alkyl, fluoro substituted lower alkyl, and cycloalkylamino,

R⁵⁴ and R⁵⁵ are independently selected from the group consisting of hydrogen, halogen, lower alkyl and lower alkoxy, wherein the alkyl chain of lower alkyl or lower alkoxy is optionally substituted with fluoro, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy. lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino or cycloalkylamino, provided, however, that any substitution on the alkyl carbon bound to the -O- of lower alkoxy is fluoro, R⁵⁶ is selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy, R⁵⁷ at each occurrence is independently selected from the group consisting of lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, lower alkoxy, Atty. Dkt. No.: 039363-3303

Ωuoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono- alkylamino, di-alkylamino, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, provided, however, that any substitution of the alkyl carbon bound to O, S, or N of -OR⁵⁷, -SR⁵⁷, -NR⁴⁸R⁵⁷, -C(O)OR⁵⁷, -C(O)NR⁴⁸R", or -S(O)₂NR⁴⁸R⁵⁷ is fluoro, cycloalkyl, heterocycloalkyl, aryl or heteroaryl, and wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaryl as R⁵⁷ or as substituents of lower alkyl are optionally substituted with one or more substituents selected from the group consisting of -OH, -NH₂, -CN, -NO₂, -C(O)OH, -S(O)₂NH₂, -C(O)NH₂, -OR⁵⁸, -SR⁵⁸, -NR⁴⁸R⁵⁸, -NR⁴⁸C(O)R⁵⁸, -NR⁴⁸S(O)₂R⁵⁸, -S(O)₂R⁵⁸, -C(O)R⁵⁸, -C(O)OR⁵⁸, -C(O)NR⁴⁸R⁵⁸, -S(O)₂NR⁴⁸R⁵⁸, halogen, lower alkyl, fluoro substituted lower alkyl, and cycloalkylamino;

R⁵⁸ at each occurrence is independently selected from the group consisting of lower alkyl, heterocycloalkyl and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono- alkylamino, di-alkylamino, and cycloalkylamino, provided, however, thai any substitution of the alkyl carbon bound to O, S, or N of -OR⁵⁸, -SR⁵⁸, -NR⁴⁸R⁵⁸, -C(O)OR⁵⁸, -C(O)NR⁴⁸R⁵⁸, or -S(O)₂NR⁴⁸R⁵⁸ is fluoro, and wherein heterocycloalkyl and heteroaryl are optionally substituted with one or more substituents selected from the group consisting of halogen, -CN, lower alkyl, fluoro substituted lower alkyl, lower alkoxy and fluoro substituted lower alkoxy;

R⁴⁸ at each occurrence is independently hydrogen or lower alkyl;

R⁴⁹ is selected from the group consisting of hydrogen, lower alkyl, and fluoro substituted lower alkyl; and t is O, 1, 2, or 3.

13. The compound of Claim 12 wherein A₁ is -CR⁴⁰R⁴¹- or -C(O)-.

14. The compound of Claim 13 wherein L_Ja is -NR⁴⁸CH(R⁴⁹)-, -SCH(R⁴⁹)-, or -OCH(R⁴⁹)-.

15. The compound of Claim 14 wherein R^S4 and R⁵⁵ are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy.

16. The compound of Claim 15, wherein:

R^lϋϋ is selected from the group consisting of hydrogen, -OH, -NH₂, -CN, -NO₂, -C(O)OH, -S(O)₂NH₂, -C(O)NH₂, -OR⁵⁷, -SR⁵⁷, -NR⁴⁸R⁵⁷, -NR⁴⁸C(O)R⁵⁷, -NR⁴⁸S(O)₂R⁵⁷, -S(O)R⁵⁷, -S(O)₂R⁵⁷, -C(O)R^S7, -C(O)OR⁵⁷, -C(O)NR⁴⁸R⁵⁷, -S(O)₂NR⁴⁸R⁵⁷, halogen, lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, lower alkoxy, Atty. Dkt. No.: 039363-3303 fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono- alkylamino, di-alkylamino, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, and wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaryl as R¹⁰⁰ or as substituents of lower alkyl are optionally substituted with one or more substituents selected from the group consisting of -OH₁ -NH₂, -CN, -NO₂, -S(O)₂NH₂, -C(O)NH₂, -OR⁵⁸, -SR⁵⁸, -NHR⁵⁸, -NR^4SR^5S, -NR⁴⁸C(O)R⁵⁸, -NR⁴⁸S(O)₂R⁵⁸, -S(O)₂R⁵⁸, -S(O)₂NR⁴⁸R⁵⁸, -C(O)R⁵⁸, -C(O)NR⁴⁸R⁵⁸, halogen, lower alkyl, fluoro substituted lower alkyl, and cycloalkylamino.

17. The compound of Claim 16, wherein A) is -C(O)-.

18. The compound of claim 17 wherein L₃, is -OCH(R⁴⁹)-.

19. The compound of claim 18 wherein: Z₁₄ is CR⁵⁴;

Z₁₅ is CR⁵⁵;

Z₁₆ Js CR⁵⁶;

R¹⁰⁰ is selected from the group consisting of hydrogen, -CN, -C(O)OH, -C(O)OR⁵⁷, -NR⁴⁸R⁵⁷, -OR⁵⁷, -S(O)₂R⁵⁷, fluoro, chloro, bromo, lower alkyl, fluoro substituted lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl or heteroaryl are optionally substituted with one or more substituents selected from the group consisting of halogen, lower alkyl, fluoro substituted lower alkyl, -NR⁴⁸R⁵⁸, -OR⁵⁸ and -S(O)₂R⁵⁸; and

20. The compound of claim 11, wherein the compound is selected from the group consisting of:

[3-(4-Chloro-benzyloxy)-2-(2-fluoro-ethoxy)-phenyl]-(lH-pyrrolo[2,3-b]pyridin-3-yl)-methanone,

[3-(4-Chloro-2-fluoro-benzyloxy)-2-(2,2-difluoro-ethoxy)-phenyl]-(lH-pyrrolo[2,3-b]pyridin-3-yl)- methanone,

[3-(4-Chloro-2-fluoro-benzyloxy)-2-cyclopropylmethoxy-phenyl]-(lH-pyrrolo[2,3-b]pyridin-3-yl)- methanone,

[2-Ethoxy-3-(6-methyl-pyridin-2-ylmethoxy)-phenyl]-(lH-pyrrolo[2,3-b]pyridin-3-yl)-methanone, Atty. Dkt. No.: 039363-3303

[3-(4-Chloro-2-fluoro-benzyloxy)-2-ethoxy-phenyl]-(lH-pyrrolo[2,3-b]pyridin-3-yl)-methanone,

[3-(2,4-Dimethyl-thiazol-5-ylmethoxy)-2-ethoxy-phenyl]-(l H-pyrrolo[2,3-b]pyi-idin-3-yl)-methanone,

[3-(2, 5 -Dimethyl -2H~pyrazol-3 -ylmethoxy)-2-ethoxy-phenyl] -( 1 H-pyrrolo[2,3 -b]pyridin-3 -yl)- methanone,

[2-Ethoxy-3-(2-fluoro-benzyloxy)-phenyl]-(lH-pyrrolo[2,3-b]pyτidiπ-3-yl)-methanone,

[2-Ethoxy-3-(6-moφholin-4-yl-pyridin-3-ylmethoxy)-phenyl]-(lH-pyrrolo[2,3-b]pyridin-3-yl)- methanone,

[2-Ethoxy-3-(6-trifluoromethyl-pyridin-3-ylmethoxy)-phenyl]-(lH-pyrrolo[2,3-b]pyridin-3-yl)- methanone,

[3 -(2,4-Dichloro-benzyloxy)-2-ethoxy-phenyl] -( 1 H-pyrrolo [2,3 -b]pyridin-3-yl)-methanone,

[2-Ethoxy-3-(4-imidazol-l-yl-benzyloxy)-phenyl]-(lH-pyrrolo[2,3-b]pyridin-3-yl)-methanone,

[3-(2,4-Difluoro-benzyloxy)-2-ethoxy-phenyl]-(lH-pyrrolo[2,3-b]pyridin-3-yl)-methanone,

{2-Ethoxy-3-[l -(2-fluoro-phenyl)-ethoxy]-phenyl}-(l H-pyrrolo[2,3-b]pyridin-3-yl)-methanone,

[3-(l ,5-Dimcthyl-lH-pyrazol-3-ylmethoxy)-2-ethoxy-phenyl]-(lH-pyrrolo[2,3-b]pyridin-3-yl)- methanone,

[2-Ethoxy-3-(l-pyridin-4-yl-ethoxy)-phenyl]-(lH-pyπOlo[2,3-b]pyridin-3-yl)-methanone,

[2-Ethoxy-3-((R)-l -pyridin-4-yl-ethoxy)-phenyl]-(lH-pyrrolo[2,3-b]pyridin-3-yl)-methanone,

[2-Ethoxy-3-(2,4,6-trifluoro-benzyloxy)-phenyl]-(lH-pyrrolo[2,3-b]pyridin-3-yl)-methanone,

{3-[l-(2,4-Dichloro-phenyl)-ethoxy]-2-ethoxy-phenyl}-(lH-pyrrolo[2,3-b]pyridin-3-yl)-methanone,

[3-(4-Chloro-2-fluoro-benzyloxy)-2-(2,2,2-trifluoro-ethoxy)-phenyl]-(lH-pyπ-olo[2,3-b]pyridin-3-yl)- methanone,

(5-Chloro-lH-pyrrolo[2,3-b]pyridin-3-yl)-[2-cyclopropylmethoxy-3-(2,4-dimethyl-thiazol-5- ylmethoxy)-phenyl] -methanone,

(5-Ch]oro-lH-pyrrolo[2,3-b]pyridin-3-yl)-[2-cyclopropylmethoxy-3-(2,4,6-trifluoro-benzyloxy)- phenyl] -methanone,

(5-Chloro-lH-pyrrolo[2,3-b]pyridin-3-yl)-[2-cyclopropylmethoxy-3-(6-trifluoromethyl-pyridin-3- ylmethoxy)-phenyl] -methanone,

[3-(6-Diethylammo-pyridin-3-ylmethoxy)-2-ethoxy-phenyl]-(lH-pyrrolo[2,3-b]pyridin-3-yl)- methanone,

[2-Ethoxy-3-(6-pyrrolidin-l-yl-pyridin-3-ylmethoxy)-phenyl]-(lH-pyrrolo[2,3-b]pyridin-3-yl)- methanone, and all salts, prodrugs, tautomers, and isomers thereof. Atty. Dkt. No.: 039363-3303

21. A compound having the chemical structure of Formula IHc,

all salts, prodrugs, tautomers, and isomers thereof, wherein: A₁ is -O-, -CR⁴⁰R⁴¹-, -C(O)- or -NR⁴⁸-;

64.

Z₂₄ is N or CR

Z₂₅ is N or CR⁶⁵;

Z₂₅ is N or CR⁶⁶;

Cy is selected from the group consisting of aryl, heteroaryl, cycloalkyl, and heterocycloalkyl;

R⁸⁰ is Cu alkyl or C_3^5 cycloalkyl, wherein Ci_-3 alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro and Cv, cycloalkyl;

R¹⁰⁰ is selected from the group consisting of hydrogen, -OH, -NH₂, -CN, -NO₂, -C(O)OH, -S(O)₂NH₂, -C(O)NH₂, -OR⁵⁷, -SR⁵⁷, -NR⁴⁸R⁵⁷, -NR⁴⁸C(O)R⁵⁷, -NR⁴⁸S(O)₂R⁵⁷, -S(O)R⁵⁷, -S(O)₂R⁵⁷, -C(O)R⁵⁷, -C(O)OR⁵⁷, -C(O)NR⁴⁸R⁵⁷, -S(O)₂NR⁴⁸R⁵⁷, halogen, lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, C(O)OH, -C(O)NH₂, -OR⁵⁷, -SR⁵⁷, -NR⁴⁸R⁵⁷, -C(O)OR⁵⁷, -C(O)NR⁴⁸R⁵⁷, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, and wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaryl as R¹⁰⁰, or as substituents of lower alkyl, are optionally substituted with one or more independent substituents R¹⁰ ;

R¹⁰¹ at each occurrence is independently selected from the group consisting of -OH, -NH₂, -CN, -NO₂, -C(O)OH, -S(O)₂NH₂, -C(O)NH₂, -OR⁵⁷, -SR⁵⁷, -NR⁴⁸R⁵⁷, -NR⁴⁸C(O)R⁵⁷, -NR⁴⁸S(O)₂R⁵⁷, -S(O)R⁵⁷, -S(O)₂R⁵⁷, -C(O)R⁵⁷, -C(O)OR⁵⁷, -C(O)NR⁴⁸R⁵⁷, -S(O)₂NR⁴⁸R⁵⁷, halogen, lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, C(O)OH, -C(O)NH₂, -OR⁵⁷, -SR⁵⁷, -NR⁴⁸R⁵⁷, -C(O)OR⁵⁷, -C(O)NR⁴⁸R⁵⁷, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, and wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaryl as R¹⁰¹, or as substituents of lower alkyl, are optionally substituted with one or more substituents selected from the group consisting of -OH, -NH₂, -CN, -NO₂, -C(O)OH, -S(O)₂NH₂, -C(O)NH₂, -OR⁵⁸, -SR⁵⁸, -NR⁴⁸R⁵⁸, -NR⁴⁸C(O)R⁵⁸, -NR⁴⁸S(O)₂R⁵⁸, Atty. Dkt. No,: 039363-3303

-S(O)R⁵*, -S(O)₂R'⁸, -C(O)R⁵⁸, -C(O)OR⁵⁸, -C(O)NR⁴⁸R⁵⁸, -S(O)₂NR⁴⁸R⁵⁸, halogen, lower alkyl, fluoro substituted lower alkyl, and cycloalkylamino;

R⁶⁴, R⁶⁵ and R⁶⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl and lower alkoxy, wherein the alkyl chain of lower alkyl or lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylammo and cycloalkylamino, provided, however, that any substitution on the alkyl carbon bound to the -O- of lower alkoxy is fluoro; R⁵⁷ at each occurrence is independently selected from the group consisting of lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of iluoro, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono- alkylamino, di-alkylamino, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, provided, however, that any substitution of the alkyl carbon bound to O, S, or N of -OR⁵⁷, -SR⁵⁷, -NR⁴⁸R⁵⁷, -C(O)OR⁵⁷, -C(O)NR⁴⁸R⁵⁷, or -S(O)₂NR⁴⁸R⁵⁷ is fluoro, cycloalkyl, heterocycloalkyl, aryl or heteroaryl, and wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaryl as R⁵⁷ or as substituents of lower alkyl are optionally substituted with one or more substituents selected from the group consisting of -OH, -NH₂, -CN, -NO₂, -C(O)OH, -S(O)₂NH₂, -C(O)NH₂, -OR⁵⁸, -SR'⁸, -NR⁴⁸R⁵⁸, -NR⁴⁸C(O)R⁵⁸, -NR⁴⁸S(O)₂R⁵⁸, -S(O)₂R⁵⁸, -C(O)R⁵⁸, -C(O)OR⁵⁸, -C(O)NR⁴⁸R^'18, -S(O)₂NR⁴⁸R⁵⁸, halogen, lower alkyl, fluoro substituted lower alkyl, and cycloalkylamino,

R⁵⁸ at each occurrence is independently selected from the group consisting of lower alkyl, heterocycloalkyl and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono- alkylamino, di-alkylamino, and cycloalkylamino, provided, however, that any substitution of the alkyl carbon bound to O, S, or N of -OR⁵⁸, -SR⁵⁸, -NR⁴⁸R⁵⁸, -C(O)OR⁵⁸, -C(O)NR⁴⁸R⁵⁸, or -S(O)₂NR⁴⁸R⁵⁸ is fluoro, and wherein heterocycloalkyl and heteroaryl are optionally substituted with one or more substituents selected from the group consisting of halogen. -CN, lower alkyl, fluoro substituted lower alkyl, lower alkoxy and fluoro substituted lower alkoxy; R⁴⁸ at each occurrence is independently hydrogen or lower alkyl; R⁴⁹ is selected from the group consisting of hydrogen, lower alkyl, and fluoro substituted lower alkyl; r is O, 1 or 2; and t is O, 1 , 2, or 3, provided, however, that the compound is not Atty. Dkt. No.: 039363-3303

22. The compound of Claim 21 wherein A, is -CR⁴⁰R⁴¹- or -C(O)-.

23. The compound of Claim 22 wherein R⁶⁴, R⁶⁵ and R⁶⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy.

24. The compound of claim 23 wherein: Atty. Dkt. No.: 039363-3303

R¹⁰⁰ is selected from the group consisting of hydrogen, -OH, -NH₂, -CN, -NO₂, -C(O)OH, -S(O)₂NH₂, -C(O)NH₂, -OR", -SR⁵⁷, -NR⁴⁸R⁵⁷, -NR⁴⁸C(O)R⁵⁷, -NR⁴⁸S(O)₂R⁵⁷, -S(O)R⁵⁷, -S(O)₂R⁵⁷, -C(O)R⁵⁷, -C(O)OR⁵⁷, -C(O)NR⁴⁸R⁵⁷, -S(O)₂NR^4SR'⁷, halogen, lower alkyl, cycloalkyl, heterocycloalkyl, aryl and hetcroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono- alkylamino, di-alkylamino, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, and wherein cycloalkyl, heterocycloalkyl, aryl, or heteroaryl as R¹⁰⁰ or as substituents of lower alkyl are optionally substituted with one or more substituents selected from the group consisting of -OH, -NII₂, -CN, -NO₂, -S(O)₂NH₂, -C(O)NH₂, -OR⁵⁸, -SR^5S, -NHR⁵⁸, -NR⁴⁸R⁵⁸, -NR⁴⁸C(O)R⁵⁸, -NR⁴⁸S(O)₂R⁵⁸, -S(O)₂R⁵⁸, -S(O)₂NR⁴⁸R³⁸, -C(O)R⁵⁸, -C(O)NR⁴⁸R⁵⁸, halogen, lower alkyl, fluoro substituted lower alkyl, and cycloalkyl amino.

25. The compound of claim 24 wherein:

Z₂₄ is CR⁶⁴;

Z₂₅ is CR⁶⁵;

Z₂, is CR⁶⁶;

R¹⁰⁰ is selected from the group consisting of hydrogen, -CN, -C(O)OII, -C(O)OR⁵⁷, -NR⁴⁸R⁵⁷, -OR⁵⁷, -S(O)₂R⁵⁷, fluoro, chloro, bromo, lower alkyl, fluoro substituted lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl or heteroaryl are optionally substituted with one or more substituents selected from the group consisting of halogen, lower alkyl, fluoro substituted lower alkyl, -NR⁴⁸R⁵⁸, -OR⁵⁸ and -S(O)₂R⁵⁸; and

26. The compound of claim 21, wherein the compound is selected from the group consisting of:

[3-(4-Chloro-benzyloxy)-2-(2-fluoro-ethoxy)-phenyl]-(lH-pyrrolo[2,3-b]pyridin-3-yl)-methanone, [3-(4-Chloro-2-fluoro-benzyloxy)-2-(2,2-difluoro-ethoxy)-phenyl]-(lII-pyrrolo[2,3-b]pyridin-3-yl)- methanone,

[3-(4-Chloro-2-fluoro-benzyloxy)-2-cyclopropylmethoxy-phenyl]-(lH-pyrrolo[2,3-b]pyridin-3-yl)- methanone, Atty, Dkt No., 039363-3303

[2-Ethoxy-3-(2-pyrrolidin-l-yl-ethoxy)-phenyl]-(lH-pyrrolo[2,3-b]pyridin-3-yl)-methanone,

[2-Ethoxy-3-(6-methyl-pyridm-2-ylmethoxy)-phcnyl]-(lH-pyrrolo[2,3-b]pyridin-3-yl)-methaπone,

[3-(2,4-Dimethyl-thiazol-5-ylmethoxy)-2-ethoxy-phenyl]-(lH-pyrro]o[2,3-bJpyridiii-3-yl)-methanoπe,

[3-(2.5-Dimethyl-2H-pyrazol-3-ylmethoxy)-2-ethoxy-pheπyl]-(lH-pyrrolo[2,3-b]pyndin-3-yl)- methanone,

[2-Ethoxy-3 -(2-fluoro-benzyloxy)-phenyl] -( 1 H-pyrrolo[2,3-b]pyπdm-3 -yl)-methanone,

[2-Ethoxy-3-(6-morpholm-4-yl-pyπdin-3-ylmethoxy)-phenyl]-(lH-pyrrolo[2,3-b]pyπdin-3-yl)- methanone,

[2-Ethoxy-3-(6-tnf]uoromethyl-pyπdin-3-ylmethoxy)-phenylJ-(lH-pyrrolo[2,3-b]pyπdin-3-yl)- methanone,

[3-(2,4-Dichloro-benzyloxy)-2-ethoxy-phenyl]-(l H-pyrrolo[2,3-b]pyridin-3-yl)-methanone,

[2-Ethoxy-3-(4-imidazol-l -yl-benzyloxy)-phenyl]-(lH-pyrrolo[2,3-b]pyπdin-3-yl)-methanone,

[3-(2,4-Difluoro-ben7yloxy)-2-ethoxy-phenyl]-(lH-pyrrolo[2,3-b]pyridin-3-yl)-methanone,

{2-Ethoxy-3 -[ 1 -(2-fluoro-phenyl)-ethoxy]-phenyl } -( 1 H-pyrrolo [2,3 -b]pyπdm-3 -yl)-methanone,

[3-(l,5-Dimethyl-lH-pyrazol-3-ylmcthoxy)-2-ethoxy-phenyl]-(lH-pyrrolo[2,3-b]pyπdin-3-yl)- methanone,

[2-Ethoxy-3 -( 1 -pyridin-4-yl-ethoxy)-phenyl]-( 1 H-pyrrolo[2,3 -b]pyndin-3-yl)-methanone,

[2-Ethoxy-3-((R)-l -pyridm-4-yl-ethoxy)-phenyl]-(lH-pyrrolo[2,3-b]pyridin-3-yl)-methanone,

[2-Ethoxy-3-(2,4,6-tπfluoro-benzyloxy)-phenyl]-(lH-pyπOlo[2,3-b]pyridin-3-yl)-methanone,

{3-[ 1 -(2,4-Dichloro-phenyl)-ethoxy] -2-ethoxy-phenyl } -( 1 H-pyrrolo [2,3 -b]pyridm-3-yl)-methanone,

[3-(4-Chloro-2-fluoro-ben7yloxy)-2-(2,2,2-tnfluoro-ethoxy)-phenyl]-(lH-pyrrolo[2,3-b]pyridin-3-yl)- methanone,

(5-Chloro-lH-pyrrolo[2,3-b]pyπdm-3-yl)-[2-cyclopropylmethoxy-3-(2,4-dimethyl-thiazol-5- ylmethoxy)-phenyl] -methanone,

(5-Chloro-lH-pyrrolo[2,3-b]ρyridin-3-yl)-[2-cyclopropylmethoxy-3-(2,4,6-tπfluoro-benzyloxy)- phenyl] -methanone,

(5-Chloro-lH-pyrrolo[2,3-b]pyπdin-3-yl)-[2-cyclopropylmethoxy-3-(6-tπfluoromethyl-pyπdin-3- ylmethoxy)-phenyl] -methanone,

[3-(6-Diethylamino-pyridin-3-ylmethoxy)-2-ethoxy-phenyl]-(lH-pyrrolo[2,3-b]pyπdin-3-yl)- methanone,

[2-Ethoxy-3 -(6-pyrrolidin- 1 -yl-pyπdm-3 -ylmethoxy)-phenyl]-( 1 H-pyrrolo[2,3 -b]pyridin-3 -yl)- methanone, and all salts, prodrugs, tautomers, and isomers thereof. Atty Dkt No 039363-3303

27. Acompound having the chemical structure of Formula IV

all salts, prodrugs, tautomers, and isomers thereof, wherein Z₂ ih N or CR^π, Z₄ is N or CR¹⁴, Z₅ is N or CR¹⁵, Z₆ is N or CR¹⁶, A is selected from the group consisting of -O-, -S-, -CR"R^b-, -NR¹-, -C(O)-, -C(S)-, -S(O)-, and

-S(O)₂-

R^a and R at each occurrence are independently selected from the group consisting of hydrogen, fluoro, -OH, -NH₂, lower alkyl, lower alkoxy, lower alkylthio, mono-alkylammo, di-alkylamino, and -NR⁸R⁹, wherein the alkyl chain(s) of lower alkyl, lower alkoxy, lower alkylthio, mono-alkylamino, or di-alkylamino are optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NHn, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylammo, provided, however, that any substitution of the alkyl chain carbon bound to O of alkoxy, S of thioalkyl or N of mono- or di-alkylamino is fluoro, or

R³ and R^b combine to form a 3-7 mcmbered monocyclic cycloalkyl or 5-7 membered monocyclic heterocycloalkyl, wherein the monocyclic cycloalkyl or monocyclic heterocycloalkyl are optionally substituted with one or more substituents selected from the group consisting of halogen, -OH, -NH₂, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-dlkylamino, di-alkylammo, and cycloalkylammo,

R¹ is selected from the group consisting of hydrogen, lower alkyl, cycloalkyl, heterocycloalkyl, aryl, heteroaryl, -C(O)R⁷, -C(S)R⁷, -S(O)₂R⁷, -C(O)NHR⁷, -C(S)NHR⁷, and -S(O)₂NHR⁷, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, lower alkylthio, mono-dlkylammo, di-alkylamino, and -NR⁸R⁹, wherein the alkyl chain(s) of lower alkoxy, lower alkylthio, Atty. Dkt. No.: 039363-3303 mono-alkylamino, or di-alkylamino are optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NHi, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino, provided, however, that any substitution of the alkyl chain carbon bound to O of alkoxy, S of thioalkyl or N of mono- or di-alkylamino is fluoro, further provided that when R¹ is lower alkyl, any substitution on the lower alkyl carbon bound to the N of -NR^!- is fluoro, and wherein cycloalkyl, hetcrocycloalkyl, aryl or heteroaryl are optionally substituted with one or more substituents selected from the group consisting of halogen, -OH, -NH₂, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino;

R⁷ is selected from the group consisting of lower alkyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, lower alkylthio, mono-alkylamino, di-alkylamino, and -NR⁸R^g, provided, however, that any substitution of the alkyl carbon bound to the N of -C(O)NHR⁷, -C(S)NHR⁷ or -S(O)₂NHR⁷ is fluoro, wherein the alkyl chain(s) of lower alkoxy, lower alkylthio, mono-alkylamino, or di-alkylamino are optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NIL, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino, provided, however, that any substitution of the alkyl chain carbon bound to O of alkoxy, S of thioalkyl or N of mono- or di-alkylamino is fluoro, and wherein cycloalkyl, heterocycloalkyl, aryl and heteroaryl arc optionally substituted with one or more substituents selected from the group consisting of halogen, -OH, -NH₂, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino; each of R⁴, R^s, R⁶, R¹², R¹⁴, R¹⁵, and R¹⁶, are independently selected from the group consisting of hydrogen, halogen, optionally substituted lower alkyl, optionally substituted lower alkenyl, optionally substituted lower alkynyl, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, optionally substituted heteroaryl, -CN, -NO₂, -CR^aR^bR²⁶, and -LR²⁶;

L at each occurrence is independently selected from the group consisting of -(alk)_a-X-(alk)_b-, -(alk)_a-NR²⁵-(alk)_b-, -(alk)_a-C(X)-(alk)_b-, -(alk)_a-S(O)-(alk)_b-, -(alk)_a-S(O)₂-(alk)_b-, -(alk)_a-OC(X)-(alk)_b-, -(alk)_a-C(X)O-(alk)_b-, -(alk)_a-C(X)NR²⁵-(alk)_b-, -(alk)_a-S(O)₂NR²⁵-(alk)_b-, -(alk)_a-NR²⁵C(X)-(alk)_b-, -(alk)_a-NR²⁵S(O)₂-(alk)_b-, -(alk)_a-NR²⁵C(X)O-(alk)_b-, -(alk)_a-OC(X)NR²⁵-(alk)_b-, -(alk)_a-NR²⁵C(X)NR²⁵-(alk)_b-, and -(alk)_a-NR²⁵S(O)₂NR²⁵-(alk)_b-; Atty Dkt No 039363-3303 a and b are independently 0 or 1 , alk at each occurrence is independently Ci ₃ alkylene or Cj ₃ alkylene substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkyl, lower alkoxy, lower alkylthio, mono-alkylamino, di-alkylammo, and -NR⁸R⁹, wherein lower alkyl or the alkyl chain(s>) of lower alkoxy, lower alkylthio, mono-alkylamino or di-alkylamino are optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₇, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylammo, di-alkylammo and cycloalkylammo, provided, however, that any substitution of the alkyl chain carbon bound to O of alkoxy, S of thioalkyl or N of mono- or di-alkylammo is fluoro,

X at each occurrence is independently O or S,

R²⁵ at each occurrence is independently selected from the group consisting of hydrogen, optionally substituted lower alkyl, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, and optionally substituted heteroaryl,

R²⁶ at each occurrence is independently selected from the group consisting of hydrogen, provided, however, that hydrogen is not bound to any of S(O), S(O)₂, C(O) or C(S) of L, optionally substituted lower alkyl, optionally substituted lower alkenyl, provided, however, that when R²⁶ is optionally substituted lower alkenyl, no alkene carbon thereof is bound to N, S, O, S(O), S(O)₂, C(O) or C(S) of L, optionally substituted lower alkynyl, provided, however, that when R²⁶ is optionally substituted lower alkynyl, no alkyne carbon thereof is bound to N, S, O, S(O), S(O)₂, C(O) or C(S) of L, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, and optionally substituted heteroaryl,

R¹⁰ and R¹¹ at each occurrence are independently selected from the group consisting of hydrogen, fluoro, lower alkyl, and lower alkyl optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylammo, di- alkylammo, and cycloalkylammo, or any two of R¹⁰ and R¹' on the same or adjacent carbon atoms combine to form a 3-7 membered monocyclic cycloalkyl or 5-7 membered monocyclic heterocycloalkyl, and any others of R^lϋ and R^u are independently selected from the group consisting of hydrogen fluoro, lower alkyl, and lower alkyl optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted low er alkylthio, mono-alkylammo, di-alkylammo, and cycloalkylammo, and wherein the monocyclic cycloalkyl or monocyclic heterocycloalkyl are optionally substituted with one or more substituents selected from the group consisting of halogen, -OH, -NH₂, lower alkyl, fluoro substituted lower alkyl lower alkoxy, fluoro Atty. Dkt. No.: 039363-3303 substituted lower alkoxy, tower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino;

R⁸ and R⁹ combine with the nitrogen to which they are attached to form a 5-7 membered heterocycloalkyl optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, and fluoro substituted lower alkylthio;

R¹⁷ is selected from the group consisting of hydrogen, halogen, optionally substituted lower alkyl and -OR¹⁸; and

R¹⁸ is hydrogen or optionally substituted lower alkyl;

R⁹⁰ is C₂-_t alkyl, fluoro substituted C₂.₄ alkyl, or -(CH₂CH₂O)_1nR⁹¹; m is 1, 2, or 3; and

R¹" is C i_₃ alkyl or fluoro substituted C₁.₃ alkyl, provided, however, the compound is not

Atty. Dkt. No.: 039363-3303

28. The compound of Claim 27 having the chemical structure of Formula IVb,

all salts, prodrugs, tautomers, and isomers thereof, wherein:

A₁ is -O-, -CR⁴⁰R⁴¹-, -C(O)- or -NR⁴⁸-;

Z₃₂ is N or CR⁷²;

Z₃₄ is N or CR⁷⁴;

Z₃₅ is N or CR⁷⁵;

Z₃₆ is N or CR⁷⁶;

R¹⁰⁰ is selected from the group consisting of hydrogen, -OH, -NH₂, -CN, -NO₂, -C(O)OH, -S(O)₂NH₂, -C(O)NH₂, -OR⁵⁷, -SR⁵⁷, -NR⁴⁸R⁵⁷, -NR⁴⁸C(O)R⁵⁷, -NR⁴⁸S(O)₂R⁵⁷, -S(O)R⁵⁷, -S(O)₂R⁵⁷, -C(O)R⁵⁷, -C(O)OR⁵⁷, -C(O)NR⁴⁸R⁵⁷, -S(O)₂NR⁴⁸R⁵⁷, halogen, lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, C(O)OII, -C(O)NH₂, -OR⁵⁷, -SR⁵⁷, -NR⁴⁸R⁵⁷, -C(O)OR⁵⁷, -C(O)NR⁴⁸R⁵⁷, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, and wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaryl as R¹⁰⁰, or as substituents of lower alkyl, are optionally substituted with one or more independent substituents R^{ι n ι};

R⁷², R⁷⁴, R⁷⁵, and R⁷⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl and lower alkoxy, wherein the alkyl chain of lower alkyl or lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino, provided, however, that any substitution on the alkyl carbon bound to the -O- of lower alkoxy is fluoro; R'ⁿ is C_2-4 alkyl, fluoro substituted C_1A alkyl, or -(CH₂CH₂O)₁₁₁R⁹¹; m is 1 , 2, or 3; and R⁹¹ is Cj.₃ alkyl or fluoro substituted Cu alkyl.

29. The compound of Claim 28 wherein A, is -CR⁴⁰R⁴¹- or -C(O)-. Atty Dkt No 039363-3303

30. The compound of Claim 29 wherein R⁷², R⁷⁴, R^7S and R⁷⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy.

31. The compound of claim 30 wherein^*

R¹⁰⁰ is selected from the group consisting of hydrogen, -OH, -NH₂, -CN, -NO₂, -C(O)OH, -S(O),NH,, -C(O)NII₂, -OR⁵⁷, -SR⁵⁷, -NR⁴⁸R⁵⁷, -NR⁴⁸C(O)R⁵⁷, -NR⁴⁸S(O)₂R⁵⁷, -S(O)R", -S(O)₂R⁵⁷, -C(O)R⁵⁷, -C(O)OR⁵⁷, -C(O)NR⁴⁸R⁵⁷, -S(O)₂NR⁴⁸R^, halogen, lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono- alkylamino, di-alkylammo, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, and wherein cycloalkyl, heterocycloalkyl, aryl, or heteroaryl as R¹⁰⁰ or as substituents of lower alkyl are optionally substituted with one or more substituents selected from the group consisting of -OH, -NH₂, -CN, -NO₂, -S(O)₂NII₂, -C(O)NH₂, -OR⁵⁸, -SR^5S, -NHR⁵⁸, -NR⁴⁸R⁵⁸, -NR⁴⁸C(O)R⁵⁸, -NR⁴⁸S(O)₂R⁵⁸, -S(O)₂R⁵⁸, -S(O)₂NR⁴⁸R⁵⁸, -C(O)R⁵⁸, -C(O)NR⁴⁸R⁵⁸, halogen, lower alkyl, fluoro substituted lower alkyl, and cycloalkylammo.

32. The compound of claim 31 wherein:

Z₁₂ is CR⁷²;

Z₁₄ is CR⁷⁴;

Z₃₅ is CR⁷⁵,

Z₃₆ is CR⁷⁶, and

R¹⁰⁰ is selected from the group consisting of hydrogen, -CN, -C(O)OH, -C(O)OR⁵⁷, -NR⁴⁸R⁵⁷, -OR⁵⁷, -S(O)₂R⁵⁷, fluoro, chloro, bromo, lower alkyl, fluoro substituted lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl or heteroaryl are optionally substituted with one or more substituents selected from the group consisting of halogen, lower alkyl, fluoro substituted lower alkyl, -NR⁴⁸R⁵⁸, -OR⁵⁸ and -S(O)₂R⁵⁸.

33. The compound of claim 27, wherein the compound is selected from the group consisting of:

3-[2-Chloro-6-fluoro-3-(2,2,2-tπfluoro-ethoxy)-benzyl]-lH-pyrrolo[2,3-b]pyπdine, [2-Chloro-6-fluoro-3-(2,2,2-tπfluoro-ethoxy)-ρhenyl]-(5-methoxy-l H-pyrrolof2,3-b]p>τidin-3-yl)- methanone,

[2-Chloro-6-fluoro-3-(2,2,2-tπfluoro-ethoxy)-phenyl]-(l H-pyrrolo[2,3-b]pyridin-3-yl)-methanone, [2,6-Dichloro-3-(2_>2,2-tπfluoro-ethoxy)-phenyl]-[5-(l -methyl-lH-pyrazol-4-yl)-l H-pyrrolo[2,3- b]pyridm-3-yl]-methanone, Atty Dkt No 039363-3303

3-[2,6-Dichloro-3-(2,2,2-tnfluoro-ethoxy)-benzyl]-5-mcthoxy-lH-ρyrrolo[2,3-b]pyπdine,

[2,6-Dichloro-3-(2,2,2-trifluoro-ethoxy)-phenyl]-(5-methoxy-lH-pyrrolo[2,3-b]pyridiπ-3-yl)- methanone,

5-Chloro-3-[2-chloro-6-fluoro-3-(2-methoxy-ethoxy)-ben7yl]-lH-pyrrolo[2,3-b]pyndiπe,

3-[2-Chloro-6-fluoro-3-(2-methoxy-ethoxy)-benzyl]-l H-pyrrolo[2,3-b]pyπdine,

[2-Chloro-6-fluoro-3-(2-methoxy-ethoxy)-phenyl]-(5-chloro-lH-pyrrolo[2,3-b]pyπdin-3-yl)- methanone,

[2-Chloro-6-fluoro-3-(2-methoxy-ethoxy)-phenyl]-(lH-pyrrolo[2,3-b]pyτidin-3-yl)-methanone, and all salts, prodrugs, tautomers, and isomers thereof

34. A composition comprising a pharmaceutically acceptable carrier, and a compound according to any of Claims 1-33

35. A method for treating a subject suffering from or at risk of a c-frns, c-kit, HGK, TrkA, and/or TrkB mediated disease or condition, comprising administering to the subject an effective amount of a compound of any of Claims 1-33, or a composition of Claim 34

36. The method of Claim 35, wherein the disease or condition is selected from the group consisting of mast cell tumors, small cell lung cancer, testicular cancer, gastrointestinal stromal tumors, glioblastoma, astrocytoma, neuroblastoma, carcinomas of the female genital tract, sarcomas of neuroectodermal origin, colorectal carcinoma, carcinoma m situ, Schwann cell neoplasia associated with neurofibromatosis, Wilms tumor, acute myeloid leukemia, acute lymphocytic leukemia, chronic myelogenous leukemia, multiple myeloma, mastocytosis, melanoma, breast cancer, ovarian cancer, prostate cancer, pancreatic cancer, canme mast cell tumors, myelofibrosis, metastasis of cancer to bone or other tissues, hypertrophy, asthma, rheumatoid arthritis, allergic rhinitis, multiple sclerosis, osteoarthritis, inflammatory bowel syndrome, transplant rejection, systemic lupus erythematosis, psoriasis, ulcerative colitis, Crohn's disease, chronic obstructive pulmonary disease, emphysema, Kawasaki's Disease, hemophagocytic syndrome (macrophage activation syndrome), multicentric reticulohistiocytosis, atherosclerosis, Type I diabetes, Type II diabetes, insulin resistance, obesity, diabetic retinopathy, macular degeneration, hyperglycemia, obesity, lipolysis, hypereosmophiha, osteoporosis, increased risk of fracture, Paget's disease, hypercalcemia, infection-mediated osteolysis (e g osteomyelitis), pen-prosthetic or wear-debπs-mediated osteolysis, endometriosis, glomerulonephritis, interstitial nephritis, Lupus nephritis, tubular necrosis, diabetic nephropathy, stroke, Alzheimer's disease, Parkinson's disease, inflammatory pain, neuropathic pam, chronic pain and bone pam Atty Dkt No 039363-3303

37. A kit comprising a compound according to any of Claims 1-33 or a composition according to Claim 34

38. The kit of Claim 37, wherein the compound or composition is approved for a medical indication selected from the group consisting of mast cell tumors, small cell lung cancer, testicular cancer, gastrointestinal stromal tumors, glioblastoma, astrocytoma, neuroblastoma, carcinomas of the female genital tract, sarcomas of neuroectodermal origin, colorectal carcinoma, carcinoma in situ, Schwann cell neoplasm associated with neurofibromatosis, Wilms tumor, acute myeloid leukemia, acute lymphocytic leukemia, chronic myelogenous leukemia, multiple myeloma, mastocytosis, melanoma, breast cancer, ovaπan cancer, prostate cancer, pancreatic cancer, canine mast cell tumors, myelofibrosis, metastasis of cancer to bone or other tissues, hypertrophy, asthma, rheumatoid arthritis, allergic rhinitis, multiple sclerosis, osteoarthritis, inflammatory bowel syndrome, transplant rejection, systemic lupus erythematosa, psoriasis, ulcerative colitis, Crohn's disease, chronic obstructive pulmonary disease, emphysema, Kawasaki's Disease, hemophagocytic syndrome (macrophage activation syndrome), multicentric reticulohistiocytosis, atherosclerosis, Type I diabetes, Type II diabetes, insulin resistance, obesity, diabetic retinopathy, macular degeneration, hyperglycemia, obesity, lipolysis, hypereosmophilia, osteoporosis, increased πsk of fracture, Paget's disease, hypercalcemia, infection-mediated osteolysis (e g osteomyelitis), pen-prosthetic or wear-debns- mediated osteolysis, endometriosis, glomerulonephritis, interstitial nephritis, Lupus nephritis, tubular necrosis, diabetic nephropathy, stroke, Alzheimer's disease, Parkinson's disease, inflammatory pam, neuropathic pam, chronic pam, and bone pain

39. A method for treating a subject suffering from or at πsk of a c-fms mediated disease or condition selected from the group consisting of osteoarthritis, inflammatory bowel syndrome, ulcerative colitis, Crohn's disease, Kawasaki's Disease, hemophagocytic syndrome, multicentric reticulohistiocytosis, Type I diabetes, Type II diabetes, obesity, Paget's disease, osteomyelitis, peπ- prosthetic or wcar-debπs-mediated osteolysis, endometriosis, diabetic nephropathy, multiple sclerosis, stroke, Alzheimer's disease and Parkinson's disease, inflammatory pain, chronic pam, bone pain, prostate cancer, melanoma, glioblastoma multiforme, metastasis of tumors to tissues other than bone, and myelofibrosis comprising administering to the subject an effective amount of a compound of any of Formulae I, Ia, Ib, Ic, Id, Ie, If, Ig, Ih or Ii

40. The method of Claim 39, wherein the c-fms mediated disease or condition selected from the group consisting of inflammatory bowel syndrome, ulcerative colitis, Crohn's disease, Type I diabetes, Type II diabetes, Paget's disease, diabetic nephropathy, multiple sclerosis, stroke, Alzheimer's disease and Parkinson's disease, inflammatory pain, chronic pam, bone pain, prostate cancer, and metastasis of tumors to tissues other than bone