WO2008076434A2 - Prédiction d'une réponse à la rispéridone - Google Patents

Prédiction d'une réponse à la rispéridone Download PDF

Info

Publication number
WO2008076434A2
WO2008076434A2 PCT/US2007/025858 US2007025858W WO2008076434A2 WO 2008076434 A2 WO2008076434 A2 WO 2008076434A2 US 2007025858 W US2007025858 W US 2007025858W WO 2008076434 A2 WO2008076434 A2 WO 2008076434A2
Authority
WO
WIPO (PCT)
Prior art keywords
seq
polymorphisms
genotype
arg492
patient
Prior art date
Application number
PCT/US2007/025858
Other languages
English (en)
Other versions
WO2008076434A3 (fr
Inventor
Maria Arranz
Original Assignee
Theragenetics
Decloux, Amy
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from GB0625194A external-priority patent/GB0625194D0/en
Priority claimed from GB0625193A external-priority patent/GB0625193D0/en
Priority claimed from GB0713281A external-priority patent/GB0713281D0/en
Application filed by Theragenetics, Decloux, Amy filed Critical Theragenetics
Publication of WO2008076434A2 publication Critical patent/WO2008076434A2/fr
Publication of WO2008076434A3 publication Critical patent/WO2008076434A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Definitions

  • the invention relates generally to the relative effect of specific genetic polymorphisms in predicting the clinical outcome of risperidone therapy in patients suffering from a psychiatric disease such as schizophrenia.
  • Psychiatric disorders include anxiety disorders, such as obsessive-compulsive disorder, social phobia, or agoraphobia; eating disorders, including anorexia and bulimia; mood disorders, including manic depression (bipolar disorder); cognitive disorders such as dementias; personality disorders and substance abuse-related disorders; and psychotic disorders, such as schizophrenia and delusional disorders. In general, such disorders are amenable to therapy.
  • response to drug therapy is measured by a scoring system based on scales which assess a variety of symptoms displayed by psychiatric patients.
  • rating scales used for the measuring of the symptoms and severity of disorders in psychiatry. Examples include the Hamilton Depression Rating Scale (Ham-D), Montgomery-Asberg Depression Rating Scale (MADRS), Young Mania Rating Scale, Hamilton Anxiety Rating Scale (Ham-A), Yale-Brown Obsessive-Compulsive Scale (Y-BOCS), Positive and Negative Syndrome Scale (PANSS) Global Assesment of Functioning (GAF) and Clinical Global Impression (CGI) scales.
  • Ham-D Hamilton Depression Rating Scale
  • MADRS Montgomery-Asberg Depression Rating Scale
  • Young Mania Rating Scale Hamilton Anxiety Rating Scale
  • Ham-A Hamilton Anxiety Rating Scale
  • Y-BOCS Yale-Brown Obsessive-Compulsive Scale
  • PANSS Positive and Negative Syndrome Scale
  • GAF
  • PANSS and GAF can be used to assess schizophrenic disorders, and other psychotic conditions.
  • Positive and Negative Syndrome Scale PANSS
  • the PANSS originated as a rigorously operationalised method for evaluating positive, negative, and other symptom dimensions in schizophrenia.
  • the PANSS measurement is derived from behavioural information observed during the interview plus a clinical interview and reports by primary care hospital staff or reports by family members.
  • the ratings provide summary scores on a 7-item positive scale, a 7-item negative scale and a 16-item general psychopathology scale.
  • the added scores provide a PANSS Total Score.
  • the PANSS ratings should be based on the totality of information pertaining to a specified period, normally identified as the previous week.
  • Each of the 30 items is accompanied by a specific definition as well as detailed anchoring criteria for all seven rating points. These seven points represent increasing levels of psychopathology, as follows: absent; minimal; mild; moderate; moderate severe; severe; extreme.
  • a physician first considers whether a symptom is at all present, as judging by the item definition. If the item is present the physicain must determine its severity by reference to the particular criteria for the anchoring points. The highest applicable rating point is always assigned, even if the patient meets criteria for lower ratings as well.
  • the rating points minimal to extreme correspond to incremental levels of symptom severity. They are keyed to the prominence of symptoms, their frequency during the observation phase, and above all their disruptive impact on daily living.
  • GAF Global Assesment of Functioning
  • the reporting of overall function on Axis V (5) of the Diagnostic and Statistical Manual of Mental Disorders is performed using the Global Assessment of Functioning (GAF) Scale.
  • GAF Global Assessment of Functioning
  • the GAF scale may be particularly useful in tracking the clinical progress of individuals in global terms, using a single measure.
  • the GAF scale is to be rated with respect only to psychological and occupational functioning.
  • the present invention is directed to identifying the relative contributions of genetic polymorphism(s) in a gene or a plurality of genes, to the variability displayed by patients in response to treatment with psychotic drugs, in particular risperidone.
  • Risperidone is an antipsychotic drug that is well known to those in the art. It is also known as 4-[2-[4-(6-fluorobenzo[d]isoxazol-3-yl)-l-piperidyl]ethyl]-3-methyl- 2,6- diazabicyclo[4.4.0]deca-l,3-dien-5-one . The skilled person appreciates that functional equivalents of risperidone are encompassed by the invention.
  • the method according to the invention encompasses genesencoding drug-targeted neurotransmitter receptors, transporters and metabolic enzymes.
  • the products and methods encompassed by the genetic polymorphisms identified herein as contributing to the clinical outcome of risperidone therapy can facilitate the improvement of antipsychotic treatment.
  • Risperidone is ineffective, or has sub-optimal efficacy, in treating a significant proportion of individuals with psychotic disorders, and thus a means to determine which patients are likely to benefit from risperidone treatment is desirable.
  • the present inventors have surprisingly discovered that the presence of specific genetic variations (polymorphism(s)) and combinations thereof, is informative regarding the sensitivity of a patient to risperidone.
  • the present invention provides a method for determining the likelihood that a patient will display a response to treatment with risperidone, based on the patient's genotype.
  • a method for determining the likelihood of response to risperidone in a patient which comprises assessing the genotype of the patient.
  • genetic polymorphisms are analysed in a plurality of genes comprising one or more genes selected from the group consisting of DRD2, ADRAlA, and 5-HTT, CYP2D6, 5-HT1A, 5-HT2A, DRD4, COMT, NRGl, ChAT, Ml and 5-HT2C.
  • Particularly useful combinations of genes are set forth below.
  • algorithms may be used to predict responsiveness based on polymorphisms present in a plurality of genes comprising one or more genes selected from the foregoing group.
  • genes and polymorphisms selected, as well as algorithms eventually used to analyse the polymorphisms can be seleced based on the information available on the patient to be tested and the available data concerning association of particular polymorphisms with responsiveness to risperidone. Examples are given below.
  • the method further comprises detecting one or more polymorphisms in a plurality of genes comprising one, two, three, four or all five of the following genes of the patient: ADRAlA, CYP2D6, 5-HT1A, 5-HT2A and 5- HT2C. This method is effective in predicting reposnsiveness to risperidone.
  • the polymorphisms detected in ADRAlA include the allelic forms encoding Arg492Cys polymorphism, where there is a genetic variation in the ADRAlA gene which expresses a polypeptide which encodes a cysteine at codon number 492, as opposed to the wild type arginine. Further there is a genetic variation in ADRAlA upstream of the coding region (-6274C/T).
  • the polymorphisms detected in DRD2 include the allelic forms of Taq I A2/A1, where there is a genetic variation in the DRD2 gene consisting of a T allele as opposed to the wild type (C).
  • the polymorphisms detected in 5-HTT include the allelic forms of 2630 T/C.
  • the polymorphisms detected in CYP2D6 include the allelic forms *4 extensive metabolizer (EM) or poor metabolizer (PM) and/or the polymorphisms detected in 5-HT1A include the allelic forms of -1018-C/G, and/or the polymorphisms detected in 5-HT2A include the allelic forms of -1438-G/A, and/or the polymorphisms detected in 5-HT2C include allelic forms at the loci encoding Cys23Ser.
  • the detected allelic forms of the polymorphisms consist of the allelic forms encoding Arg492Cys of ADRAlA, the allelic forms of Taq I A2/A1 of DRD2, and the allelic forms of 2630 T/C in 5-HTT.
  • the allelic forms of the polymorphisms detected consist of the allelic forms encoding Arg492Cys of ADRAlA, the allelic forms of Taq I A2/A1 of DRD2, the allelic forms of 2630 T/C in 5-HTT, the allelic forms of *4 EM/PM of CYP2D6, the allelic forms of -1018-C/G in 5-HT1A, the allelic forms of -1438-G/A in 5-HT2A, and the allelic forms at the loci encoding Cys23Ser in 5- HT2C. Variation of the foregoing loci from wild-type is informative of likelihood of response to risperidone treatment in a patient.
  • At least three polymorphisms in three different genes should be assayed, preferably including at least one polymorphism from the group set forth above.
  • at least two polymorphisms from the group set forth above are assayed, and more preferably at least three.
  • different polymorphisms in the same genes can be substituted.
  • a method of determining the likelihood of a response to risperidone treatment in a patient by detecting one or more polymorphisms in one, two or all three of the following genes of the patient: ADRAlA, DRD2 and DRD4.
  • the method further comprises detecting the allelic forms of one or more polymorphisms in one, two or three of the following genes of the patient: 5-HT1A, CYP2D6, and 5-HT2A. This following method is more consistent than the method of the first example.
  • the polymorphisms detected in ADRAlA include the allelic forms encoding Arg492/Cys
  • the polymorphisms detected in DRD2 include the allelic forms of Taq I A2/A1
  • the polymorphisms detected in DRD4 include the allelic forms of -521 C/T.
  • the polymorphisms detected in 5-HT1A include the allelic forms of -1018 C/G
  • the polymorphisms detected in CTP2D6 include the allelic forms of *4 A/G (rs3892097)
  • the polymorphisms detected in 5-HT2A include the allelic forms ofrs6313 102 T/C.
  • the allelic forms of the polymorphisms detected consist of the allelic forms encoding Arg492/Cys of ADRAlA, the allelic forms of Taq I A2/A1 of DRD2, and the allelic forms of -521 C/T in DRD4.
  • the allelic forms of the polymorphisms detected consist of the allelic forms encoding Arg492/Cys of ADRAlA, the allelic forms of Taq I A2/A1 of DRD2, the allelic forms of -521 C/T in DRD4, the allelic forms of - 1018 C/G in 5- HTlA, the allelic forms of *4 extensive metabolizer (EM) or poor metabolizer (PM) in CYP2D6 and allelic forms of 102 T/C in 5-HT2A.
  • EM extensive metabolizer
  • PM poor metabolizer
  • Detecting the polymorphisms preferably further includes determining the copy number of the wild type allele with respect to each polymorphism.
  • General responsiveness to risperidone treatment can be assessed clinnically, for example by applying the PANSS Total score and/or the GAF scale.
  • the following algorithms correlate with assessment of effectiveeness by measuring general response.
  • LoR [1-( +11.853 -22.636Al -22.231A2 -1.947B1 +1.415C1 -0.486D1+2.513E1 - 0.24E2 +4.623F1 +1.461F2 +4.71G1 +0.028G2- 3.989Hl)]
  • Al 5-HTT 2630-T/T genotype
  • A2 5-HTT 2630-T/C genotype
  • Bl D2 Taq I A2/A2 genotype
  • B2 D2 Taq I A2/A1 genotype
  • Cl ⁇ l A Arg492/Arg492 genotype
  • C2 ⁇ lA Arg492/Cys genotype
  • Dl ⁇ l A -6274-C/C genotype
  • El CYP2D6*4 EM/EM genotype
  • E2 CYPD6*4 EM/EM/
  • the 5-HT2C gene is in the X chromosome; so homozygotes (females) and hemizygotes (males) for Cys23, and heterozygotes Cys23/Ser23 (only females could be heterozygotes) were grouped together for simplicity).
  • the sequences of the polymorphic genotypes in this algorithm are listed in Table IA below.
  • the response is determined to be beneficial, if there is an improvement of 20 points or more in the GAF scales, or at least a 30% decrease in PANSS values after risperidone treatment in the patient.
  • Posititve symptoms can be assessed clinically using, for instance, the PANSS positive scale. A reduction of at least 30% in positive PANSS scores is indicative of an improvement in positive symptoms.
  • Predictions of rsponsiveness as measured by the PANSS positive scale can be made by detecting the allelic forms of one or more polymorphisms in one, two, three, or all four of the following genes of the patient: COMT, DRD2, DRD4, and 5-HT2C.
  • the one or more polymorphisms in COMT includes Vall58Met
  • the one or more polymorphisms in DRD2 includes Taq I A1/A2
  • the one or more polymorphisms in DRD4 includes -521 C/T
  • the one or more polymorphisms in 5-HT2C includes -145964 A/C.
  • allelic forms of the polymorphisms detected consist of the Vall58/MetMet polymorphism in COMT, the Taq I A2/A2 in D2, the -521 C/T polymorphism in D4, and the - 145964 A/C polymorphism in 5-HT2C.
  • detecting the allelic forms of the polymorphisms further includes determining the copy number of the wild type allele with respect to each polymorphism.
  • Table 1C The sequences of the polymorphic genotypes in this algorithm are listed in Table 1C below.
  • Negative symptoms can be assessed clinically using, for instance the PANSS negative scale. A reduction of at least 30% in negative PANSS scores is indicative of an improvement in negative symptoms.
  • Prdictions of responsiveness as measured by the PANSS negative scale can be made by detecting one or more polymorphisms in one, two, three or four of the following genes of said patient: 5-HT2C, ChAT, Ml and NRGl .
  • the one or more polymorphisms in 5-HT2C comprises -145964 A/C
  • the one or more polymorphisms in ChAT comprises rsl 880676 G/A
  • the one or more polymorphisms in Ml comprises -12064 T/C
  • the one or more polymorphisms in NRGl comprises SNP8NRG221533 C/T.
  • allelic forms of the polymorphisms detected consist of the 145964 A/C polymorphism in 5-HT2C, the rsl 880676 G/A polymorphism in ChAT, the -12064 T/C polymorphism in Ml, and the SNP8NRG221533 C/T polymorphism in NRGl .
  • detecting the allelic forms of the polymorphisms further includes determining the copy number of the wild type allele with respect to each polymorphism.
  • Table ID The sequences of the polymorphic genotypes in this algorithm are listed in Table ID below.
  • General Psychopathology symptoms can be asessed clinically using, for instance the PANSS general pychopathology subscale. A reduction of at least 30% is indicative of an improvement in general pychopathology symptoms.
  • Predictions of responsiveness as measured by the PANSS general psychathology subscale can be made by detecting one or more polymorphisms in a plurality of genes comprising one, two or three of the following genes of the patient: ChAT, 5-HT2A and NRGl.
  • the one or more polymorphisms in ChAT comprises G/A
  • the one or more polymorphisms in 5- HT2A comprises rs6313 102 T/C
  • the one or more polymorphisms in NRGl comprises SNP8NRG221533 C/T.
  • allelic forms of the polymorphisms detected consist of the G/A polymorphism in ChAT, the rs6313 102 T/C polymorphism in 5HT2A and the SNP8NRG221533 C/T polymorphism of NRGl.
  • detecting the polymorphisms further includes determining the copy number of the wild type allele with respect to each polymorphism.
  • the sequences of the polymorphic genotypes in this algorithm are listed in Table IE below.
  • nucleotide sequences encoding any of the above polymorphisms as described herein.
  • nucleic acids comprising the allelic forms encoding Arg492Cys and -6274 T/C of ADRAl A, the allelic forms of Taq I A2/A1 of DRD2, the allelic forms of 2630 T/C in 5-HTT, the allelic forms of *4 EM/PM of CYP2D6, the allelic forms of -1018-C/G in 5-HT1A, the allelic forms of - 1438-G/A in 5-HT2A, the allelic forms at the loci encoding Cys23Ser in 5-HT2C, the allelic forms of -521 C/T in DDR4, the allelic forms of rs6313 102 T/C in 5-HT2A, the VaIl 58Met polymorphism in COMT, the -145964 A/C polymorphism in 5-HT2C, the rs 1880676 G/
  • kits for determining a genotype of an individual which comprises one or more oligonucleotides that enable detection of a combination of polymorphisms described herein.
  • the genotype of the polymorphisms listed in Tables 1 A-IE can be detected using the oligonucleotides listed in Table 2.
  • ADRA1A Arg492Cys also described as Arg347Cys
  • Allele 1 AGA TGT GGC CGG AAT GCA GAG (SEQ ID NO:1 1 )
  • Allele 2 GAG ATG TGG CCG GAA TGC AGA A (SEQ ID NO: 12)
  • Common CATACCTACTGTGCTCAGTGCTTCAT (SEQ ID NO:13)
  • Probe 2 VIC - TCT TTA TTT TaC CAA ATA TCA T - MGB (SEQ ID NO:47)
  • the procedure for detecting the allelic forms of the polymorphisms is preferably, but not limited to, a procedure selected from the group of: DNA sequencing, allele-specific amplification, and allele-specif ⁇ c primer extension.
  • any procedure for detecting the allelic forms of the polymorphisms is encompassed by the invention, including, but preferably not limited to, single strand conformation polymorphism (SSCP), denaturing gradient gel electrophoresis (DGGE) or temperature gradient gel electrophoresis analysis (TGGE), mismatch cleavage analysis, cleavage-fragment- length polymorphism analysis (CFLP), denaturing high pressure liquid chromatography (dHPLC), chemical cleavage of mismatch (CCM), Enzymatic cleavage of mismatch (ECM), UNG-mediated T Scan, direct sequencing, DNA chip resequencing, and PyrosequencingTM.
  • SSCP single strand conformation polymorphism
  • DGGE denaturing gradient gel electrophoresis
  • TGGE temperature gradient gel electrophoresis analysis
  • mismatch cleavage analysis cleavage-fragment- length polymorphism analysis
  • CFLP denaturing high pressure liquid chromatography
  • CCM chemical cle
  • kits for determining a genotype of an individual which comprises one or more oligonucleotides that enable detection of one or more or all of the following genotypesgenotypes at the following polymorphisms selected from the group consisting of: 5-HTT 2630-T/T genotype, 5-HTT 2630-T/C genotype, D2 Taq I A2/A2 genotype, D2 Taq I A2/A1 genotype, ⁇ lA Arg492/Arg492 genotype and ⁇ lA Arg492/Cys genotype.
  • the oligonucleotides of the kit comprise oligonucleotides with the following sequences: SEQ ID NO-.38, SEQ ID NO:39, SEQ ID NO:20, SEQ ID NO:21 , SEQ ID NO:3, and SEQ ID NO:4.
  • kits for determining a genotype of an individual which comprises one or more oligonucleotides that enable detection of one or more or all of the following genotypes at the following polymorphisms selected from the group consisting of: 5-HTT 2630-T/C genotype, D2 Taql A2/A2 genotype, D2 Taql A2/A1 genotype, ⁇ lA Arg492/Arg492 genotype, ⁇ lA Arg492/Cys genotype, ⁇ lA -6274-C/C genotype, CYP2D6*4 EM/EM genotype, CYPD6*4 EM/PM genotype, 5-HT1A -1018-C/C genotype, 5-HT1A -1018-C/G genotype, 5-HT2A -1438-G/G genotype, 5-HT2A -1438-G/A genotype, and 5- HT2C Cys23Ser/Cys23Ser or Cys23Ser genotypes.
  • the oligonucleotides of the kit comprise oligonucleotides with the following sequences: SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:34 and SEQ ID NO:35.
  • kits for determining a genotype of an individual which comprises one or more oligonucleotides that enable detection of one or more or all of the following genotypes at the following polymorphisms selected from the group consisting of: ⁇ lA Arg492/Arg492, ⁇ lA Arg492/Cys, D2 Taq I A2/A2, D4 -521 C/C and D4 -521 C/T.
  • the oligonucleotides of the kit comprise oligonucleotides with the following sequences: SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:24 and SEQ ID NO:25.
  • kits for determining a genotype of an individual which comprises one or more oligonucleotides that enable detection of one or more or all of the following genotypes at the following polymorphisms selected from the group consisting of: ⁇ l A Arg492/Arg492, ⁇ l A Arg492/Cys, D2 Taq I A2/A2, D4 -521 C/C and D4 -521 C/T, 5-HT1A -1018 C/C, 5-HT1A -1018 C/G, CYP2D6*4 A/A, CYP2D6*4 AJG, 5-HT2A 102 T/T, and 5-HT2A 102 T/C.
  • the oligonucleotides of the kit comprise oligonucleotides with the following sequences: SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO:28 and SEQ ID NO:29.
  • kits for determining a genotype of an individual which comprises one or more oligonucleotides that enable detection of one or more or all of the following genotypes at the following polymorphisms selected from the group consisting of: COMT rs4680
  • the oligonucleotides of the kit comprise oligonucleotides with the following sequences: SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:32 and SEQ ID NO:33.
  • kits for determining a genotype of an individual which comprises one or more oligonucleotides that enable detection of one or more or all of the following genotypes at the following polymorphisms selected from the group consisting of: 5-HT2C -145964 A/A, ChAT rs 1880676 G/G, ChAT rsl880676 G/A, Ml -12064 T/T, Ml -12064 T/C, NRGl
  • the oligonucleotides of the kit comprise oligonucleotides with the following sequences: SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:11, SEQ ID NO: 12, SEQ ID NO:13, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46 and SEQ ID NO:47.
  • kits for determining a genotype of an individual which comprises one or more oligonucleotides that enable detection of one or more or all of the following genotypes at the following polymorphisms selected from the group consisting of: ChAT rsl880676 G/G, ChAT rsl880676 G/A, 5-HT2A 102 T/T, 5-HT2A 102 T/C, NRGl SNP8NRG221533 C/C, and NRGl SNP8NRG221533 C/T.
  • the oligonucleotides of the kit comprise oligonucleotides with the following sequences: SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47.
  • Psychosis Patients suffering from psychosis have impaired reality testing; that is, they are unable to distinguish personal, subjective experience from the reality of the external world. They experience hallucinations and/or delusions that they believe are real, and may behave and communicate in an inappropriate and incoherent fashion. Psychosis may appear as a symptom of a number of mental disorders and it is the defining feature of schizophrenia, schizophreniform disorder, schizoaffective disorder, delusional disorder, and the psychotic disorders (i.e., brief psychotic disorder, shared psychotic disorder, psychotic disorder due to a general medical condition, and substance-induced psychotic disorder). Functional causes of psychosis also include "mood disorders such as bipolar disorder (manic depression) and severe clinical depression.
  • schizophrenia is intended to include the group of mental disorders characterized by disruptions in thinking and perception.
  • schizophrenia is commonly marked by "positive symptoms” such as auditory hallucinations (especially hearing voices), disorganized thought processes and delusions as well as “negative symptoms” which include affective flattening, alogia, avolition, and anhedonia.
  • the positive symptoms of schizophrenia refer to a class of symptoms of schizophrenia characterised by hallucinations (sensory perception in the absence of external stimuli) which may occur in any of the five senses, although tend to be auditory. They are a common feature of psychosis and are prominent and often distressing. Positve symptoms also include delusional or paranoid false beliefs that are usually incomprehensible in terms of normal mental processes yet held with conviction by the patient. Thought disorder describes an underlying disturbance to conscious thought and is classified largely by its effects on speech and writing.
  • the negative symptoms of schizophrenia refer to a class of symptoms of schizophrenia which can be considered to reflect a 'loss' in functional, directed thought or activity.
  • Negative symptoms of schizophrenia are well known in the art, and include affective flattening (characterized by, for example, an immobile and/or unresponsive facial expression, poor eye contact and reduced body language), alogia ('poverty of speech' or brief, laconic and/or empty replies), avolition (characterized by a reduced or absent ability to initiate and carry out goal-directed activities), anhedonia (loss of interest or pleasure), social withdrawal, apathy and other negative symptoms known to those of skill in the art.
  • the symptoms and general functioning of patients with schizophrenia are assessed using a variety of published rating scales. Ratings may be made in term sof overall symptoms or in terms of level of functioning, or in terms of specific symptom groups.
  • the negative symptoms of schizophrenia may be assessed using any methodology known in the art including, but not limited to, the Brief Psychiatric Rating Scale (BPRS), the Positive and Negative Syndrome Scale (PANSS), the Rorschach Schizophrenia Index (SCZI), and the Scale for the Assessment of Negative Symptoms (SANS).
  • BPRS Brief Psychiatric Rating Scale
  • PANSS Positive and Negative Syndrome Scale
  • SCZI Rorschach Schizophrenia Index
  • SANS Scale for the Assessment of Negative Symptoms
  • Some of these methods may also be used to assess positive symptoms (e.g., BPRS and PANSS), although methods for specifically assessing positive symptoms are also available (e.g., the Scale for the Assessment of Positive Symptoms, or SAPS).
  • General symptoms of psychopathology associated with psychotic illness such as somatic concerm anxiety, guilt feelings, tension
  • may also be assessed e.g. by the PANSS scale).
  • the symptoms or symptom classes/subgroups of psychosis may be assessed separately e.g., as individual scale items, or as subscales, (e.g., negative symptom scale of PANSS, positive symptom scale of PANSS, general psychopathology scale of PANSS,) or combined to give a total overall assessment of symptoms (e.g. Total PANSS score).
  • subscales e.g., negative symptom scale of PANSS, positive symptom scale of PANSS, general psychopathology scale of PANSS, or combined to give a total overall assessment of symptoms (e.g. Total PANSS score).
  • An overall assessment of symptoms and functionaing may be obtained by other scales including but not limited to the GAF (Global assessment of Functioning scale) and the CGI (Clinnical Global Impression scale).
  • the terms "response to risperidone treatment” includes pharmacological effectiveness.
  • Pharmacological effectiveness refers to the ability of the treatment to result in a desired biological effect in the patient..
  • risperidone treatment refers to a course of treatment encompassing administration of risperidone to a patient in therapeutically effective amount(s) over a time period. .
  • the time period is three months or more, up to and including, 6 months, a year, three years or longer. However the time period can also be shorter than three months.
  • All the methods of treating described herein include administration of risperidone or a risperidone related molecule- by any method known to those skilled in the art including subcutaneous, intramuscular, intradermal, transdermal, intraperitoneal, intravenous, intranasal, intrathecal, intraocular, or oral routes of administration.
  • a psychotic patient's response to risperidone treatment response was assessed prospectively using the PANSS and GAF scales.
  • a "positive response to risperidone treatment” means a reduction in the symptoms of the psychotic disease, and in one embodiment is evidenced by an improvement of at least 20 points or more in the GAF scales, or at least 30% decrease in PANSS values after risperidone treatment.
  • a positive response may also encompasses an improvement in specific symptoms of a psychotic disease. This may include-an improvement in positive symptoms, and/or negative symptoms and/or a general psychopathology symptoms response. The more positive the response, the more the symptoms are reduced. These pateints are classified as "Responders".
  • a negative response to risperidone treatment means the treatment provides no reduction of the assessed symptoms of the psychotic disease, or causes an increase in the symptoms of the psychotic disease being treated. The more negative the response, the more the symptoms are increased. These patients are classified as “nonresponders”.
  • a patient may be an overall responder as measured by GAF or PANSS total score, but may still, for example, be a negative symptom non-responder if the improvement in the negative symptoms to risperidone treatment fails to meet the response criteria.
  • the phrase "likelihood of a response" to risperidone treatment means the probability that a patient will display the response after risperidone treatment.
  • Probability can be measured in terms of percentage, ranging from 0 to 100%: if the percentage is low, then there is a low likelihood that the patient will have the response of interest, and conversely, where the percentage is high, there is a higher likelihood or probability that the patient will display the response of interest.
  • Expression of psychotic diseases is multifactorial, hence it is unlikely to achieve a probability of 100% based on hereditary factors alone. Accordingly, the phrase "determining the likelihood of a response" to risperidone provides an approximate probability that a patient with a particular genotype at specific polymorphic loci will display the response to risperidone being measured.
  • the phrase: "Improvement in negative symptoms" corresponds to at least a 30% decrease in negative PANSS scores
  • the phrase: "Improvement in general psychopathology symptoms” corresponds to at least 30% decrease in general psychopathology PANSS scores.
  • the term "genotype” in the context of this invention refers to the particular allelic forms of a gene, which can be defined by the particular nucleotide(s) present in a nucleic acid sequence at a particular site(s).
  • polymorphism refers to one specific form of a gene in a population, the specific form differing from other forms of the same gene in the sequence of at least one, and frequently more than one, variations from wild type within the sequence of the gene.
  • sequences at these sites of variation within a gene that differ between alleles of the gene are termed “gene sequence polymorphisms” or “polymorphisms” or “variants” or “allelic variants”.
  • Other terms known in the art to be equivalent include mutation and polymorphism.
  • the polymorphisms may be single or multiple base changes, including without limitation insertions, deletions, or substitutions, or may be a variable number of sequence repeats.
  • the term "Allele” refers to normal alleles of a locus as well as alleles of the gene carrying variations that affect responsiveness to risperidone.
  • the polymorphisms are selected from the group consisting of the polymorphisms listed in Table 1.
  • nucleic acid e.g., an RNA, DNA or a mixed polymer
  • An “isolated” or “substantially pure” nucleic acid is one which is substantially separated from other cellular components which naturally accompany a native human sequence or protein, e.g., ribosomes, polymerases, many other human genome sequences and proteins.
  • the term embraces a nucleic acid sequence or protein which has been removed from its naturally occurring environment, and includes recombinant or cloned DNA isolates and chemically synthesized analogs or analogs biologically synthesized by heterologous systems.
  • Encode A polynucleotide is said to “encode” a polypeptide if, in its native state or when manipulated by methods well known to those skilled in the art, it can be transcribed and/or translated to produce the mRNA for and/or the polypeptide or a fragment thereof.
  • the anti-sense strand is the complement of such a nucleic acid, and the encoding sequence can be deduced there from.
  • promoter sequence or "promoter” defines a single strand of a nucleic acid sequence that is specifically recognized by an RNA polymerase that binds to a recognized sequence and initiates the process of transcription by which an RNA transcript is produced.
  • any promoter sequence may be employed for which there is a known and available polymerase that is capable of recognizing the initiation sequence.
  • Known and useful promoters are those that are recognized by certain bacteriophage polymerases, such as bacteriophage T3, T7 or SP6.
  • label refers to a composition capable of producing a detectable signal indicative of the presence of the target polynucleotide in an assay sample. Suitable labels include radioisotopes, nucleotide chromophores, enzymes, substrates, fluorescent molecules, chemiluminescent moieties, magnetic particles, bioluminescent moieties, and the like. As such, a label is any composition detectable by spectroscopic, photochemical, biochemical, immunochemical, electrical, optical or chemical means.
  • support refers to conventional supports such as beads, particles, dipsticks, fibers, filters, membranes and silane or silicate supports such as glass slides.
  • a "microarray” is a linear or two-dimensional array of preferably discrete regions, each having a defined area, formed on the surface of a solid support.
  • the density of the discrete regions on a microarray is determined by the total numbers of target polynucleotides to be detected on the surface of a single solid phase support, preferably at least about 50/cm , more preferably at least about 100/cm even more preferably at least about 500/ cm 2 , and still more preferably at least about 1,000/cm 2 .
  • a DNA microarray is an array of oligonucleotide primers placed on a chip or other surfaces used to amplify or clone target polynucleotides.
  • sample refers to a sample of tissue or fluid isolated from an individual, including but not limited to, for example, blood, plasma, serum, tumor biopsy, urine, stool, sputum, spinal fluid, pleural fluid, nipple aspirates, lymph fluid, the external sections of the skin, respiratory, intestinal, and genitourinary tracts, tears, saliva, milk, cells (including but not limited to blood cells), organs, and also samples of in vitro cell culture constituent.
  • amplify is used in the broad sense to mean creating an amplification product which may include, for example, additional target molecules, or target-like molecules or molecules complementary to the target molecule, which molecules are created by virtue of the presence of the target molecule in the sample.
  • an amplification product can be made enzymatically with DNA or RNA polymerases or reverse transcriptases. Any of several techniques that increase the number of copies of a nucleic acid molecule.
  • a preferred example of amplification is the polymerase chain reaction (PCR), in which a sample containing the nucleic acid is contacted with a pair of oligonucleotide primers under conditions that allow for the hybridization of the primers to nucleic acid in the sample.
  • the primers are extended under suitable conditions, dissociated from the template, and then re-annealed, extended, and dissociated to amplify the number of copies of the nucleic acid.
  • the amplification products (called "amplicons”) can be further processed, manipulated, or characterized by (without limitation) electrophoresis, restriction endonuclease digestion, hybridization, nucleic acid sequencing, ligation, or other techniques of molecular biology.
  • amplification examples include strand displacement amplification, as disclosed in U.S. Pat. No. 5,744,311 ; transcription-free isothermal amplification, as disclosed in U.S. Pat. No. 6,033,881; repair chain reaction amplification, as disclosed in WO 90/01069; IiGAFe chain reaction amplification, as disclosed in European Patent Appl. 320 308; gap filling IiGAFe chain reaction amplification, as disclosed in U.S. Pat. No. 5,427,930; and RNA transcription-free amplification, as disclosed in U.S. Pat. No. 6,025,134.
  • primer refers to an oligonucleotide which is capable of acting as a point of initiation of polynucleotide synthesis along a complementary strand when placed under conditions in which synthesis of a primer extension product which is complementary to a polynucleotide is catalyzed.
  • Such conditions include the presence of four different nucleotide triphosphates or nucleoside analogs and one or more agents for polymerization such as DNA polymerase and/or reverse transcriptase, in an appropriate buffer ("buffer” includes substituents which are cofactors, or which affect pH, ionic strength, etc.), and at a suitable temperature.
  • a primer must be sufficiently long to prime the synthesis of extension products in the presence of an agent for polymerase.
  • a typical primer contains at least 5 nucleotides in length of a sequence substantially complementary to the target sequence, but somewhat longer primers are preferred. Usually primers contain about 15-26 nucleotides, but longer primers may also be used.
  • a primer will always contain a sequence substantially complementary to the target sequence, that is the specific sequence to be amplified, to which it can anneal.
  • a primer may, optionally, also comprise a promoter sequence. Primers are useful to amplify sequences from the region of the polymorphism and are preferably complementary to, and hybridize specifically to, sequences that flank one or more polymorphisms in a gene.
  • probes generated by amplification may be sequenced directly or may be cloned prior to sequence analysis.
  • a method for the direct cloning and sequence analysis of enzymatically amplified genomic segments has been described by Scharf et al., 1986.
  • the term "probe” refers to a molecule which can detectably distinguish between target molecules differing in structure, such as allelic variants. Detection can be accomplished in a variety of different ways but preferably is based on detection of specific binding. Examples of such specific binding include antibody binding and nucleic acid probe hybridization.
  • probes can include enzyme substrates, antibodies and antibody fragments, and preferably nucleic acid hybridization probes.
  • Polynucleotide Probes Polynucleotide Polymorphisms associated with genotypes which contribute to the sensitivity of a patient's response to risperidone treatment can be detected by hybridization with a polynucleotide probe which forms a stable hybrid with that of the target sequence, under stringent to moderately stringent hybridization and wash conditions. If it is expected that the probes will be perfectly complementary to the target sequence, high stringency conditions will be used. Hybridization stringency may be lessened if some mismatching is expected, for example, if variants are expected with the result that the probe will not be completely complementary. Conditions are chosen which rule out nonspecific/adventitious bindings, that is, which minimize noise.
  • Probes comprising synthetic oligonucleotides or other polynucleotides of the present invention may be derived from naturally occurring or recombinant single- or double-stranded polynucleotides, or be chemically synthesized. Probes may also be labeled by nick translation, Klenow fill- in reaction, or other methods known in the art.
  • gene as used herein is a polynucleotide which may include coding sequences, intervening sequences and regulatory elements controlling transcription and/or translation.
  • gene as used herein is intended to encompass all allelic variations of the gene's DNA sequence. Genes of the invention refer to those genes that are likely to be expressed in normal tissue, certain alleles of which contribute to a patient's response to risperidone.
  • a gene encompasses a polynucleotide which encodes a polypeptide, fragment, homolog or variant, including, e.g., protein fusions or deletions or insertions.
  • the nucleic acids of the present invention will possess a sequence which is either derived from, or has substantial homology with a natural encoding gene which contributes to a patient's response to risperidone, or a portion thereof.
  • Genes of the invention include normal alleles of the gene encoding polymorphisms that contribute to a patient's sensitivity to risperidone, including silent alleles having no effect on the amino acid sequence of the gene's encoded polypeptide as well as alleles leading to amino acid sequence variants of the encoded polypeptide that do not substantially affect its function or its contribution to responsiveness to risperidone therapy. These terms also include alleles having one or more mutations which affect the function of the encoded polypeptides and it's contribution to responsiveness to risperidone therapy.
  • the polynucleotide compositions of this invention include RNA, cDNA, genomic DNA, synthetic forms, and mixed polymers, both sense and antisense strands, and may be chemically or biochemically modified or may contain non-natural or derivatized nucleotide bases, as will be readily appreciated by those skilled in the art.
  • Such modifications include, for example, labels, methylation, substitution of one or more of the naturally occurring nucleotides with an analog, internucleotide modifications such as uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoramidates, carbamates, etc.), charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.), pendent moieties (e.g., polypeptides), intercalators (e.g., acridine, psoralen, etc.), chelators, alkylators, and modified linkages (e.g., alpha anomeric nucleic acids, etc.).
  • uncharged linkages e.g., methyl phosphonates, phosphotriesters, phosphoramidates, carbamates, etc.
  • charged linkages e.g., phosphorothioates, phosphorodithioates, etc.
  • pendent moieties
  • the present invention provides recombinant nucleic acids comprising all or part of a gene encoding a polymorphism contributing to the sensitivity of a patient's response to risperidone treatment.
  • the recombinant construct may be capable of replicating autonomously in a host cell. Alternatively, the recombinant construct may become integrated into the chromosomal DNA of the host cell.
  • Such a recombinant polynucleotide comprises a polynucleotide of genomic, cDNA, semi-synthetic, or synthetic origin which, by virtue of its origin or manipulation, 1) is not associated with all or a portion of a polynucleotide with which it is associated in nature; 2) is linked to a polynucleotide other than that to which it is linked in nature; or 3) does not occur in nature.
  • nucleic acid according to the invention includes RNA, reference to the sequence shown should be construed as reference to the RNA equivalent, with U substituted for T.
  • nucleic acids comprising sequences otherwise not naturally occurring are provided by this invention.
  • wild-type sequence may be employed, it will often be altered, e.g., by deletion, substitution or insertion.
  • cDNA or genomic libraries of various types may be screened as natural sources of the nucleic acids of the present invention, or such nucleic acids may be provided by amplification of sequences resident in genomic DNA or other natural sources, e.g., by PCR.
  • the choice of cDNA libraries normally corresponds to a tissue source which is abundant in mRNA for the desired proteins. Phage libraries are normally preferred, but other types of libraries may be used. Clones of a library are spread onto plates, transferred to a substrate for screening, denatured and probed for the presence of desired sequences.
  • nucleic acid or fragment thereof is “substantially homologous" ("or substantially similar") to another if, when optimally aligned (with appropriate nucleotide insertions or deletions) with the other nucleic acid (or its complementary strand), there is nucleotide sequence identity in at least about 60% of the nucleotide bases, usually at least about 70%, more usually at least about 80%, preferably at least about 90%, and more preferably at least about 95-98% of the nucleotide bases. To determine homology between two different nucleic acids, the percent homology is to be determined using the BLASTN program "BLAST 2 sequences".
  • NCBI National Center for Biotechnology Information
  • “Kit” refers to a combination of physical elements, e.g., probes, including without limitation specific primers, labeled nucleic acid probes, antibodies, protein-capture agent(s), reagent(s), instruction sheet(s) and other elements useful to practice the invention, in particular identify the alleles present in a polymorphism.
  • probes and/or primers can be provided in one or more containers or in an array or microarray device.
  • An allele associated with a response to risperidone treatment can be detected by any of a variety of available techniques, including: 1) performing a hybridization reaction between a nucleic acid sample and a probe that is capable of hybridizing to the allele; 2) sequencing at least a portion of the allele; or 3) determining the electrophoretic mobility of the allele or fragments thereof (e.g., fragments generated by endonuclease digestion).
  • the allele can optionally be subjected to an amplification step prior to performance of the detection step.
  • Preferred amplification methods are selected from the group consisting of: the polymerase chain reaction (PCR), the IiGAFe chain reaction (LCR), strand displacement amplification (SDA), cloning, and variations of the above (e.g. RT-PCR and allele specific amplification).
  • Oligonucleotides necessary for amplification may be selected for example, from within the gene loci containing the polymorphism of intererst, either flanking the polymorphism of interest (as required for PCR amplification) or directly overlapping the polymorphism of interest (as in allele specific oligonucleotide (ASO) hybridization).
  • the sample is hybridized with a set of primers, which hybridize 5' and 3 1 in a sense or antisense sequence to the allele of interest, and is subjected to a PCR amplification.
  • the dot-blotting method requires the binding of the PCR amplified target DNA sequence to a nylon membrane.
  • the DNA fixed to the membrane is then hybridized to the allele specific oligonucleotide probes that are 5' end-labelled with either 32P- labelled deoxynucleoside triphosphates, biotin, horseradish peroxidase or a fluorescent marker.
  • a panel of ASO probes is required that needs to be adapted to the mutations found in the ethnic group of the individual, which is tested.
  • two oligonucleotide probes are required for each mutation: one complimentary to the mutant DNA sequence and the other complimentary to the normal gene sequence at the same position.
  • the patient's genotype is determined by analysis of the presence or absence of the hybridisation signal of both the mutation specific and normal probe.
  • the technique is used with great success for investigation of populations with just one common mutation and a small number of rare ones.
  • this method is not adapted to screening populations carrying a large number of different mutations since each mutation requires a separate hybridization and washing step.
  • the reverse dot-blotting technique allows several mutations to be tested in a single hybridization reaction.
  • unlabelled ASO probes specific to various mutations and to the normal DNA sequence, are bound to a nylon membrane strips in the form of dots or slots.
  • a labelled amplified genomic DNA is then hybridized to the filter. This procedure may require the use of several filters, the first one corresponds to the more frequent mutations observed in the patient's ethnic and the others to less frequent abnormalities.
  • An allele of interest may also be detected indirectly, e.g. by analyzing the protein product encoded by the DNA.
  • the protein can be detected by any of a variety of protein detection methods. Such methods include immunodetection and biochemical tests, such as size fractionation, where the protein has a change in apparent molecular weight either through truncation, elongation, altered folding or altered post-translational modifications.
  • immunodetectin methods include enzyme linked immunosorbent assays (ELISA), radioimmunoassays (RIA), immunoradiometric assays (IRMA) and immunoenzymatic assays (IEMA), including sandwich assays using monoclonal and/or polyclonal antibodies.
  • ELISA enzyme linked immunosorbent assays
  • RIA radioimmunoassays
  • IRMA immunoradiometric assays
  • IEMA immunoenzymatic assays
  • the present invention is useful in a diagnostic product to detect the presence of risperidone sensitive allele(s). Accordingly, the invention encompasses the use of diagnostic kits based on a variety of methodologies, e.g., sequence, chip, mass- spectroscopy, which are capable of finding allelic sequences indicative of the polymorphic genotypes described herein, e.g. Table 1.
  • the invention also provides an article of manufacturing comprising packaging material and a pharmaceutical agent contained within the packaging material, wherein the pharmaceutical agent comprises means for detecting the presence of one or more genotypes of a polymorphism associated with a risperidone response, and packaging material comprises a label or package insert which indicates that the detection means can be used to identify a candidate subject suitable for treatment of a psychiatric disease such as schizophrenia with risperidone.
  • the present invention therefore also provides predictive and prognostic kits comprising degenerate primers to amplify polymorphic genotypes associated with a response to risperidone in a patient and instructions comprising an amplification protocol and analysis of the results.
  • the kit may alternatively also comprise buffers, enzymes, and containers for performing the amplification and analysis of the amplification products.
  • the kit may also be a component of a screening or prognostic kit comprising other tools such as DNA microarrays.
  • the kit also provides one or more control templates, such as nucleic acids isolated from normal tissue sample, and/or a series of samples representing different polymorphisms in the same gene or in different genes associated with a response to risperidone.
  • the kit may also include instructions for use of the kit to amplify specific targets on a solid support.
  • the kit contains a prepared solid support having a set of primers already fixed on the solid support, e.g. for amplifying a particular set of target polynucleotides
  • the kit also includes reagents necessary for conducting a PCR on a solid support, for example using an in situ-type or solid phase type PCR procedure where the support is capable of PCR amplification using an in situ-type PCR machine.
  • the PCR reagents, included in the kit include the usual PCR buffers, a thermostable polymerase (e.g. Taq DNA polymerase), nucleotides (e.g. dNTPs), and other components and labeling molecules (e.g. for direct or indirect labeling).
  • the kits can be assembled to support practice of the PCR amplification method using immobilized primers alone or, alternatively, together with solution phase primers.
  • the kit provides two or more primer pairs, each pair capable of amplifying a different region of a gene associated with risperidone response and/or multiple polymorphisms from a plurality of genes, thereby providing a kit for analysis of expression of several gene polymorphisms in a biological sample in one reaction or several parallel reactions.
  • Primers in the kits may be labeled, for example fluorescently labeled, to facilitate detection of the amplification products and consequent analysis of the nucleic acid variances.
  • a combination kit will therefore comprise of primers capable of amplifying different segments of a single gene.
  • the primers may be differentially labeled, for example using different fluorescent labels, so as to differentiate between the variances.
  • the primers contained within the kit may include those listed in Table 2, and various subcombinations thereof.
  • the invention provides a method for selecting a treatment for a patient affected by a psychotic disease by determining the genotype of at least one polymorphism in the patient.
  • the genotype of a plurality of polymorphisms in the patient is determined, whereby a plurality may include variances from one, two, three or more gene loci. For even greater specificity, an analysis of a second subset of polymorphisms associated with a response to risperidone is undertaken.
  • the presence of at least one allelic variation from wild type in a polymorphism associated with risperidone treatment is indicative that the treatment will be effective or otherwise beneficial (or more likely to be beneficial) in the patient.
  • Stating that the treatment will be effective means that the probability of beneficial therapeutic effect is greater than in a person not having the above referenced genotype variation.
  • Table IA-E is a partial list of DNA sequence polymorphisms in genes relevant to the methods described in the present invention. These polymorphisms were identified by the inventors in studies of biological samples from patients with psychotic disorders who benefited from risperidone therapy.
  • a "population" refers to a defined group of individuals or a group of individuals with a particular disease or condition or individuals that may be treated with a specific drug identified by, but not limited to geographic, ethnic, race, gender, and/or cultural indices.
  • a population will preferably encompass at least ten thousand, one hundred thousand, one million, ten million, or more individuals, with the larger numbers being more preferable.
  • the population refers to individuals with a specific disease or condition that may be treated with a specific drug.
  • the mathematical algorithms were calculated using information of individual genetic association studies performed on clinical samples. After gathering information on which genetic polymorphisms may be associated with treatment variability, a mathematical algorithm was produced by logistic regression that allocates a predictive value or coefficient to each relevant genetic polymorphism according to their contribution to response variability. The prediction score was obtained by multiplying the coefficients by the genotypes present in an individual. The resulting value gives an indication of the likelihood of response.
  • Risperidone clinical sample 124 subjects (99 with schizophrenia or schizo- affective disorder, 12 with bipolar disorder, 3 with major depression and 10 with atypical psychosis) were recruited in Navarra (Northern Spain) and were of Basque and Spanish origin. All subjects were treated with the antipsychotic risperidone for a minimum of 3 months. Treatment response was assessed prospectively using the PANSS(2) and GAF scales. Improvement of 20 points or more in the GAF scales, or at least a 30% decrease in PANSS values on risperidone treatment was considered as the threshold for response.
  • Polymorphisms of interest were genotyped using PCR amplification using the primers and conditions described in Table 2.
  • the skilled person understands that the conditions and protocols used for the detection of the predictive polymorphisms are not relevant to the invention and can be easily modified and adapted to accommodate the systems/technology available in most laboratories.
  • the clinical samples were genotyped for all the polymorphisms of interest listed in Table 1. This information was then combined to produce a predictive algorithm for risperidone as follows: Logistic regression was calculated considering response to risperidone treatment as the predicted bimodal (response or non-response) variable. For algorithms predicting improvement in overall positive, negative or general psychopathology symptoms, bimodal variables based on an at least 30% decrease in overall positive, negative or general psychopathology symptoms were created respectively. Logistic regression was then calculated using the appropriate response variable. After performing logistic regression analyses, an algorithm was produced in which the genotypes of the predictor polymorphisms were multiplied by a coefficient according to their contribution to response variability. The equation algorithm is described below:
  • Example 4 Equation algorithm for genetic prediction of response to risperidone, as assessed on the GAF scale
  • the result of the logistic regression is a probability (%) of the likelihood of response or non-response. For example, a value of 0.2 will indicate a 20% chance of responding (showing an increase of at least 20 GAF score points) to treatment with risperidone.
  • a- Variable(s) entered on step 1 alaargcy, d2taqa, htt18729.
  • A2 5-HTT 2630-T/C genotype
  • E2 CYPD6*4 EM/PM genotype
  • Gl 5-HT2A -1438-G/G genotype
  • G2 5-HT2A -1438-G/A genotype
  • Hl 5-HT2C Cys23Ser/Cys23Ser or Cys23Ser genotypes
  • Step 1 Risperidone response responder 16 6 72.7 (20 points GAS) non-responder 3 18 85.7
  • cut value in table 0.50 (i.e. the probability of a positive response of 50% was used to distinguish likely responders from likely non-responders)
  • Example 6 Using a strategy encompassing a combination of information in polymorphisms/genes that had shown association with response to risperidone treatment the algorithms for the prediction of risperidone response (as measured by GAF scales) detailed in the above examples were developed. Additional genotyping in the samples has been performed and new algorithms have been formulated as described below. The algorithms differ from the core and extended algorithms described in Examples 1-5, in the combination of polymorphisms (although there may be some polymorphisms common to both) and in the weighting given to each polymorphism.
  • the mathematical algorithms were calculated using information of individual genetic association studies performed on clinical samples. After gathering information on which genetic polymorphisms may be associated with treatment variability, a mathematical algorithm was produced by logistic regression that allocates a predictive value or coefficient to each relevant genetic polymorphism according to their contribution to response variability. The prediction score was obtained by multiplying the coefficients by the genotypes present in an individual. The resulting value gives an indication of the likelihood of response.
  • Risperidone clinical sample 124 subjects (99 with schizophrenia or schizo- affective disorder, 12 with bipolar disorder, 3 with major depression and 10 with atypical psychosis) were recruited in Navarra (Northern Spain) and were of Basque and Spanish origin. All subjects were treated with the antipsychotic risperidone for a minimum of 3 months. Treatment response was assessed prospectively using the PANSS and GAF scales. Improvement of 20 points or more in the GAF scales, or at least 30% decrease in PANSS values after risperidone treatment was considered as the threshold for response or improvement in specific symptomatology (positive, negative or general).
  • a core algorithm including the most reliable combination of genes
  • an extended algorithm including additional SNPs that may give an improved prediction level
  • determining the likelihood of general response as measured by GAF and PANSS, two response measurement scales that measure different outcomes
  • the cut value is .500
  • step 1 Variable(s) entered on step 1: alaargcy, d2taqa, d4c521t.
  • Al Alpha- IA adrenergic receptor rsl048101 Arg492/Arg492
  • A2 Alpha- IA adrenergic receptor rs 1048101 Arg492/Cys
  • Classification Table 1 a The cut value is .500
  • step 1 Variable(s) entered on step 1 : alaargcy, d2taqa, d4c521t.
  • LoR [1 - (-0.615 - 0.723A1 -0.917A2 + 0.890B1 -0.961 C1 +1.057C2 )]
  • Al Alpha-lA adrenergic receptor rslO48101 Arg492/Arg492
  • A2 Alpha- IA adrenergic receptor rsl048101 Arg492/Cys
  • a- Variable(s) entered on step 1 alaargcy, d2taqa, d4c521t, ht1a1018, PGcyp2d64, ht2aw.
  • LoR [1 - (-5.381 + 2.831A1 - 0.542A2 + 1.904B1 -0.310C1 + 2.160C2 + 22.479D1 + 1.68D2 - 19.014El + 0.424E2 + 1.347F1 + 2.166F2)]
  • A2 Alpha- IA adrenergic receptor rsl048101 Arg492/Cys
  • D2 Serotonin receptor IA (5-HT1A) rs6295 -1018 C/G
  • F2 Serotonin receptor 2 A (5-HT2A) rs6313102 T/C
  • the cut value is .500
  • step 1 Variable(s) entered on step 1 : alaargcy, d2taqa, d4c521t, ht1a1018, PGcyp2d64, ht2aw.
  • LoR [1 - (-0.185 -1.07Al -1.494A2 + 0.798B1 -0.301C1 + 0.81C2 + 1.982D1 + 0.527D2 - 21.389E1 + 0.409E2 - 2.566F1 - 0.627F2)]
  • Positive predictive value (PPV) 74.1%
  • Negative predictive value (NPV) 71.4%
  • Al Alpha-1 A adrenergic receptor rsl048101 Arg492/Arg492
  • A2 Alpha- IA adrenergic receptor rs 1048101 Arg492/Cys
  • D2 Serotonin receptor IA (5-HT1A) rs6295 -1018 C/G
  • E2 CYP2D6*4 rs3892097 A/G
  • the cut value is .500
  • a- Variable(s) entered on step 1 ht2c4757n, chatch ⁇ , m1tsp45i, nrg1533.
  • LoR [1- (-0.076 + 1.451 Al + 3.576B1 + 2.944B2 - 0.309C1 -1.17C2 -2.321D1 1.931D2)]
  • Negative predictive value (NPV) 84.7%
  • Al Serotonin receptor 2C (5-HT2C) rs475717 -145964
  • A/A Bl Choline Acetyltransferase ChAT rs 1880676
  • G/G B2 Choline Acetyltransferase ChAT rsl 880676
  • G/A Cl Muscarinic receptor Ml rsl2295208 -12064 T/T
  • C2 Muscarinic receptor Ml rsl 2295208 -12064 T/C
  • Dl Neuregulin 1 (NRGl) SNP8NRG221533
  • C/C D2 Neuregulin 1 (NRGl) SNP8NRG221533 C/T
  • Classification Table 1 a The cut value is .500
  • WaId is the calculated coefficient
  • LoR [I - (0.512 + 0.196Al -1.053A2 -1.183B1 + 0.407B2 + 1.364C1 + 0.54C2)]
  • HTRlA 5-hydroxytryptamine (serotonin) receptor IA
  • NC_000005 c63293302 -63292034
  • NC_000005 c63293302 -63292034
  • HTR2A 5-hydroxytryptamine (serotonin) receptor 2A
  • HTR2C 5-hydroxytryptamine (serotonin) receptor 2C
  • HTR2C 5-hydroxytryptamine receptor 2C
  • SLC6A4 solute carrier family 6 (neurotransmitter transporter, serotonin), member 4
  • alpha IA ADRAlA adrenergic, alpha- IA-, receptor
  • DRD2 dopamine receptor D2
  • D2 dopamine receptor D2
  • transcript variant 1 mRNA
  • DRD4 dopamine receptor
  • D4 dopamine receptor D4
  • mRNA RNA
  • NM_020549 2485 bp mRNA linear PRI 09-DEC-2007
  • CHAT choline acetyltransferase

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Pathology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

De manière générale, l'invention concerne l'effet relatif de polymorphismes génétiques spécifiques dans la prédiction du résultat clinique d'un traitement à la rispéridone chez des patients souffrant d'une maladie psychiatrique telle que la schizophrénie.
PCT/US2007/025858 2006-12-18 2007-12-18 Prédiction d'une réponse à la rispéridone WO2008076434A2 (fr)

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
GBGB0625193.8 2006-12-18
GB0625194A GB0625194D0 (en) 2006-12-18 2006-12-18 Methods
GBGB0625194.6 2006-12-18
GB0625193A GB0625193D0 (en) 2006-12-18 2006-12-18 Methods
GB0713281A GB0713281D0 (en) 2007-07-09 2007-07-09 Methods
GBGB0713281.4 2007-07-09

Publications (2)

Publication Number Publication Date
WO2008076434A2 true WO2008076434A2 (fr) 2008-06-26
WO2008076434A3 WO2008076434A3 (fr) 2008-12-11

Family

ID=39536920

Family Applications (2)

Application Number Title Priority Date Filing Date
PCT/US2007/025858 WO2008076434A2 (fr) 2006-12-18 2007-12-18 Prédiction d'une réponse à la rispéridone
PCT/US2007/025940 WO2008076449A2 (fr) 2006-12-18 2007-12-18 Prévision d'une réponse à l'olanzapine

Family Applications After (1)

Application Number Title Priority Date Filing Date
PCT/US2007/025940 WO2008076449A2 (fr) 2006-12-18 2007-12-18 Prévision d'une réponse à l'olanzapine

Country Status (1)

Country Link
WO (2) WO2008076434A2 (fr)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010096117A2 (fr) 2008-10-29 2010-08-26 Janssen Pharmaceutica Nv Procédés de traitement d’une psychose et de la schizophrénie basés sur des polymorphismes du gène erbb4
EP2585824A2 (fr) * 2010-04-22 2013-05-01 Kenber, LLC Analyse du risque génétique dans le syndrome du déficit de récompense
CN104946735A (zh) * 2014-03-31 2015-09-30 湖北维达健基因技术有限公司 试剂盒及确定待测dna样本预定snp位点的基因型的方法

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7932042B1 (en) 2010-10-13 2011-04-26 Suregene, Llc Methods and compositions for the treatment of psychotic disorders through the identification of the olanzapine poor response predictor genetic signature
CN110643689A (zh) * 2019-10-29 2020-01-03 陕西佰美基因股份有限公司 一种检测HTR2A基因rs6313位点的TaqMan探针实时荧光PCR方法及其引物探针组合

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030170176A1 (en) * 2001-03-14 2003-09-11 Mcgill University Individualization of therapy with antipsychotics
WO2004074456A2 (fr) * 2003-02-20 2004-09-02 Mayo Foundation For Medical Education And Research Methodes de selection de medications
WO2005007871A2 (fr) * 2003-07-08 2005-01-27 The Regents Of The University Of California Marqueur genetique de reponse a des antipsychotiques atypiques et a des antidepresseurs et leurs methodes d'utilisation

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030170176A1 (en) * 2001-03-14 2003-09-11 Mcgill University Individualization of therapy with antipsychotics
WO2004074456A2 (fr) * 2003-02-20 2004-09-02 Mayo Foundation For Medical Education And Research Methodes de selection de medications
WO2005007871A2 (fr) * 2003-07-08 2005-01-27 The Regents Of The University Of California Marqueur genetique de reponse a des antipsychotiques atypiques et a des antidepresseurs et leurs methodes d'utilisation

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010096117A2 (fr) 2008-10-29 2010-08-26 Janssen Pharmaceutica Nv Procédés de traitement d’une psychose et de la schizophrénie basés sur des polymorphismes du gène erbb4
EP2347015A2 (fr) * 2008-10-29 2011-07-27 Janssen Pharmaceutica, N.V. Procédés de traitement d'une psychose et de la schizophrénie basés sur des polymorphismes du gène erbb4
JP2012507297A (ja) * 2008-10-29 2012-03-29 ジヤンセン・フアーマシユーチカ・ナームローゼ・フエンノートシヤツプ Ｅｒｂｂ４遺伝子の多型に基づく精神病及び統合失調症の治療法
EP2347015A4 (fr) * 2008-10-29 2012-12-19 Janssen Pharmaceutica Nv Procédés de traitement d'une psychose et de la schizophrénie basés sur des polymorphismes du gène erbb4
EP2585824A2 (fr) * 2010-04-22 2013-05-01 Kenber, LLC Analyse du risque génétique dans le syndrome du déficit de récompense
EP2585824A4 (fr) * 2010-04-22 2014-01-01 Kenber Llc Analyse du risque génétique dans le syndrome du déficit de récompense
CN104946735A (zh) * 2014-03-31 2015-09-30 湖北维达健基因技术有限公司 试剂盒及确定待测dna样本预定snp位点的基因型的方法

Also Published As

Publication number Publication date
WO2008076449A3 (fr) 2008-12-24
WO2008076449A2 (fr) 2008-06-26
WO2008076434A3 (fr) 2008-12-11

Similar Documents

Publication Publication Date Title
KR101723357B1 (ko) 민감성 피부 타입 유전자 다형성 마커 및 이의 용도
US20110287417A1 (en) Predicting a response to risperidone
WO2008076434A2 (fr) Prédiction d'une réponse à la rispéridone

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 07863059

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase in:

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 07863059

Country of ref document: EP

Kind code of ref document: A2