WO2008075148A2 - Tricyclic inhibitors of carbonic anhydrase - Google Patents

Abstract

The invention relates to compounds of formula (I) and to pharmaceutically acceptable salts and solvates thereof, wherein R1, R2 and R3 are as defined herein. The invention also relates to methods of treating glaucoma, ocular hypertension, age-related macular degeneration, diabetic macular edema, diabetic retinopathy, hypertensive retinopathy, retinal vasculopathies and intraocular pressure in mammals by administering the compounds of formula (I), and to pharmaceutical compositions which contain the compounds of formula (I) for such treatments. The invention also relates to methods of preparing the compounds of formula (I).

Description

TRICYCLIC INHIBITORS OF CARBONIC ANHYDRASE

Field of the Invention The present invention relates to heterocycles of formula I:

wherein R¹, R² and R³ are as defined herein. . Methods for their preparation, pharmaceutical compositions containing these compounds, and methods of using these compounds and compositions for inhibiting carbonic anhydrase, and thereby lowering intraocular pressure and treating glaucoma are also provided.

Background of the Invention

Glaucoma is a disease of the eye characterized by a progressive loss of visual field due to irreversible damage to the optic nerve to the point where, if untreated, may result in total blindness. This loss of visual field, in one form of primary open angle glaucoma, or POAG, is associated with a sustained increase in the intraocular pressure (lOP) of the diseased eye. Moreover, elevated intraocular pressure without visual field loss is thought to be indicative of the early stages of this form of POAG.

There are a number of therapies that target reducing the elevated IOP associated with this form of POAG. The most common are the topical administration of a beta adrenergic antagonist or a muscarinic agonist. These treatments, while effective in lowering IOP, can also produce significant undesirable side effects. Another treatment of POAG is the systemic administration of carbonic anhydrase inhibitors. For example, U.S. Patent Nos. 5,679,670, 4,797,413, 4,847,289 and 4,731 ,368 disclose topically dosed thiophene sulfonamides which lower IOP by inhibiting carbonic anhydrase. However, these compounds may also bring about unwanted side effects, such as nausea, dyspepsia, fatigue and metabolic acidosis. Dorzolamide is another carbonic anhydrase inhibitor that is used to treat increased pressure in the eye caused by open- angle glaucoma. The compounds of the present invention are heterocycles which inhibit carbonic anhydrase activity, and are thereby useful for lowering intraocular pressure and treating glaucoma, without producing significant systemic side effects when delivered topically to the eye.

Summary of the Invention

In one aspect according to the invention, there is provided a compound of formula I:

I wherein X is O or NR⁴; R¹ and R² are each independently H or (CrC₆)alkyl; R³ is H, (d- C₆)alkyl; (Ci-C₆)alkyl-NHC(=NH)NH₂, (Ci-C₆)alkyl-C(=O)NH₂, (Ci-C₆)alkyi-C(=O)OH, (C_rC₆)alkyl-SH, (Ci-C₆)alkyl-C(=O)NH₂, (C_rC₆)alkyl-imidazolyl, (Ci-C₆)alkyl-NH₂, (C₁- C₆)alkyl-S-CH₃, (Ci-C₆)alkyl (C₆-Cio)aryl, (C_rC₆)alkyl-OH, (C_rC₆)alkyl indolyl or (C_r C₆)alkyl (C₆-C₁₀)aryl-OH; and R⁴ is H or (d-CβJalkyl; or a pharmaceutically acceptable salt or solvate thereof.

In another aspect of the invention, there is provided a compound selected from the group consisting of:

or a pharmaceutically acceptable salt or solvate thereof.

In yet another aspect of the invention, there is provided one or more compounds as disclosed above for use as a medicament, or for the preparation of a medicament for treating glaucoma or ocular hypertension.

In still another aspect of the invention, there is provided a pharmaceutical composition comprising a pharmaceutically acceptable carrier and a pharmaceutically effective amount of one or more compounds as disclosed above.

In another aspect of the inveniton, there is provided a pharmaceutical composition as disclosed above in a suitable form for topical administration.

In yet another aspect of the invention, there is provided a pharmaceutical composition as disclosed above for the treatment of glaucoma and ocular hypertension, and wherein the compound of formula I is administered as a solution, suspension or emulsion in an ophthalmically acceptable vehicle.

In another aspect of the invention, there is provided a method for treating glaucoma or ocular hypertension, wherein the method comprises contacting an effective intraocular pressure reducing amount of a pharmaceutical composition as disclose - A - above with the eye in order to reduce eye pressure and to maintain the pressure at a reduced level.

In still another aspect of the invention, there is provided a method for treating eye disorders in a patient in need thereof comprising administering a therapeutically effective amount of a carbonic anhydrase inhibitor according to any one or more of the compounds as disclosed above, wherein the compound(s) is (are) able to release nitric oxide.

In yet another aspect of the invention, there is provided a method as disclosed above wherein said eye disorder is selected from glaucoma, ocular hypertension, age- related macular degeneration, diabetic macular edema, diabetic retinopathy, hypertensive retinopathy and retinal vasculopathies.

In another aspect of the invention, there is provided a method as disclosed above wherein said carbonic anhydrase inhibitor is a compound having an inhibition constant

(K₁) against the isoenzyme CAM in the range of 0.01 to 200 nM, or wherein said carnbonic anhydrase inhibitor able to release nitric oxide is a compound having an EC₅₀ value in the range of 1 to 50 μM.

In still another aspect of the invention, there is provided a method for the treatment of glaucoma, ocular hypertension, age-related macular degeneration, diabetic macular edema, diabetic retinopathy, hypertensive retinopathy and retinal vasculopathies comprising administering one or more compounds as disclosed above.

In yet another aspect of the invention, there is provided a method for the treatment of glaucoma, ocular hypertension, age-related macular degeneration, diabetic macular edema, diabetic retinopathy, hypertensive retinopathy and retinal vasculopathies comprising administering a pharmaceutical composition as disclosed above. Definitions

As used herein, the terms "comprising" and "including" are used in their open, non-limiting sense.

As used herein, the term "substituted," means that the specified group or moiety bears one or more substituents. The term "unsubstituted," means that the specified group bears no substituents. As used herein, the term "optionally substituted" means that the specified group is unsubstituted or is substituted by one or more substituents.

As used herein, the terms "treat," "treating" or "treatment" includes preventative (e.g., prophylactic) and palliative treatment. As used herein, the term "pharmaceutically acceptable" means the carrier, diluent, excipients and/or salt must be compatible with the other ingredients of the formulation and not deleterious to the recipient thereof.

As used herein, the term "alkyl" means a straight or branched chain saturated hydrocarbon. Exemplary alkyl groups include but are not limited to methyl, ethyl, propyl, isopropyl, n-butyl, sec-butyl, tert-butyl, pentyl, isopentyl, neopentyl, tert-pentyl, 1- methylbutyl, 2-methylbutyl, 3-methylbutyl, hexyl, isohexyl, heptyl, octyl and the like.

As used herein, the term "alkenyl" means a straight or branched chain hydrocarbon having at least one double bond, i.e., a C=C. Exemplary alkenyl groups include but are not limited to vinyl, propenyl, butenyl, pentenyl, hexenyl, heptenyl, octenyl and the like.

As used herein, the term "alkynyl" means a straight or branched chain hydrocarbon having at least one triple bond, i.e., a CΞC. Exemplary alkynyl groups include but are not limited to acetylenyl, propargyl, butynyl, pentynyl, hexynyl, heptynyl, octynyl and the like. As used herein, the term "cycloalkyl" means a cyclic saturated hydrocarbon.

Exemplary cycloalkyl groups include but are not limited to cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl and the like.

As used herein, the term "cycloalkenyl" means a cyclic hydrocarbon having at least one double bond, i.e., a C=C. Exemplary cycloalkenyl groups include but are not limited to cyclopropenyl, cyclobutenyl, cyclopentenyl, cyclohexenyl, cycloheptenyl, cyclooctenyl and the like.

As used herein, the term "cycloalkynyl" means a cyclic hydrocarbon having at least one triple bond, i.e., a CΞC. Exemplary cycloalkynyl groups include but are not limited to cyclohexynyl, cycloheptynyl, cyclooctynyl and the like. As used herein, the term "alkoxy" means a straight or branched chain saturated alkyl group bonded through oxygen. Exemplary alkoxy groups include but are not limited to methoxy, ethoxy, propoxy, isopropoxy, butoxy, isobutoxy, tert-butoxy, pentoxy, isopentoxy, neopentoxy, tert-pentoxy, hexoxy, isohexoxy, heptoxy, octoxy and the like.

As used herein, the term "alkylene" means a straight chain or branched chain saturated hydrocarbon wherein a hydrogen atom is removed from each of the terminal carbons. Exemplary alkylene groups include but are not limited to methylene, ethylene, propylene, butylene, pentylene, hexylene, heptylene and the like.

As used herein, the term "cycloalkylaryl" and "(CH₂)t(C3-Ci2)cycloalkyl(C₆- Cio)aryl" includes linear and/or fused ring systems such as 2,3-didydro-1 H-indene, 2- methyl-2,3-didydro-1 H-indene, 1 ,2,3,4-tetrahydronaphthalene, 2-methyl-1 ,2,3,4- tetrahydronaphthalene, 1-cyclopentylbenzene, 1-(2-methylcyclopentyl)benzene, 1-(3- methylcyclopentyl)benzene, 1-cyclohexylbenzene, 1-(2-methylcyclohexyl)benzene, 1-(3- methylcyclohexyl)benzene, 1-(4-methylcyclohexyl)benzene, and the like,

As used herein, the term "halo" or "halogen" means fluoro, chloro, bromo or iodo. As used herein, the term "aryl" means an organic radical derived from an aromatic hydrocarbon by removal of hydrogen. Exemplary aryl groups include but are not limited to phenyl, biphenyl, naphthyl, and the like.

As used herein, the terms "heterocyclic" and "heterocyclyl" means an aromatic or non-aromatic cyclic group containing one to four heteroatoms each independently selected from O, S and N, wherein each group has from 3 to 10 atoms in its ring system. Non-aromatic heterocyclic groups include groups having only 3 atoms in their ring system, whereas aromatic heterocyclic groups have at least 5 atoms in their ring system.

Heterocyclic groups include fused ring systems such as benzo-fused rings and the like.

An exemplary 3 membered heterocyclic group is aziridine; 4 membered heterocyclic group is azetidinyl (derived from azetidine); 5 membered heterocyclic group is thiazolyl; 7 membered ring heterocyclic group is azepinyl; and a 10 membered heterocyclic group is quinolinyl.

Examples of non-aromatic heterocyclic groups include but are not limited to pyrrolidinyl, tetrahydrofuranyl, dihydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, dihydropyranyl, tetrahydrothiopyranyl, piperidino, morpholino, thiomorpholino, thioxanyl, piperazinyl, azetidinyl, oxetanyl, thietanyl, homopiperidinyl, oxepanyl, thiepanyl, oxazepinyl, diazepinyl, thiazepinyl, 1 ,2,3,6-tetrahydropyridinyl, 2-pyrrolinyl, 3-pyrrolinyl, indolinyl, 2H-pyranyl, 4H-pyranyl, dioxanyl, 1 ,3-dioxolanyl, pyrazolinyl, dithianyl, dithiolanyl, dihydropyranyl, dihydrothienyl, dihydrofuranyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, 3-azabicyclo[3.1.0]hexanyl, 3-azabicyclo[4.1.0]heptanyl, 3H-indolyl and quinolizinyl.

Examples of aromatic heterocyclic (heteroaryl) groups include but are not limited to pyridinyl, imidazolyl, pyrimidinyl, pyrazolyl, triazolyl, pyrazinyl, tetrazolyl, furyl, thienyl, isoxazolyl, thiazolyl, oxazolyl, isothiazolyl, pyrrolyl, quinolinyl, isoquinolinyl, indolyl, benzimidazolyl, benzofuranyl, cinnolinyl, indazolyl, indolizinyl, phthalazinyl, pyridazinyl, triazinyl, isoindolyl, pteridinyl, purinyl, oxadiazolyl, thiadiazolyl, furazanyl, benzofurazanyl, benzothiophenyl, benzothiazolyl, benzoxazolyl, quinazolinyl, quinoxalinyl, naphthyridinyl, and furopyridinyl.

The foregoing groups may be C-attached or N-attached where such is possible. For instance, a group derived from pyrrole may be pyrrol-1-yl (N-attached) or pyrrol-3-yl (C-attached). Further, a group derived from imidazole may be imidazol-1-yl (N-attached) or imidazol-3-yl (C-attached). Heterocyclic groups may be optionally substituted on any ring carbon, sulfur or nitrogen atom(s) by one to two oxygens (oxo), per ring. An example of a heterocyclic group wherein 2 ring carbon atoms are substituted with oxo moieties is 1 ,1-dioxo-thiomorpholinyl.

Exemplary five to six membered heterocyclic aromatic rings having one or two heteroatoms selected independently from oxygen, nitrogen and sulfur include but are not limited to isothiazolyl, pyridinyl, pyridiazinyl, pyrimidinyl, pyrazinyl and the like.

Exemplary partially saturated, fully saturated or fully unsaturated five to eight membered heterocyclic rings having one to four heteroatoms selected independently from oxygen, sulfur and nitrogen include but are not limited to 3H-1 ,2-oxathiolyl, 1 ,2,3- oxadizaolyl, 1 ,2,4-oxadiazolyl, 1 ,2,5-oxadiazolyl and the like. Further exemplary five membered rings are furyl, thienyl, 2H-pyrrolyl, 3H-pyrroyl, pyrrolyl, 2-pyrrolinyl, 3- pyrrolinyl, pyrrolidinyl, 1 ,3-dioxolanyl, oxazolyl, thiazolyl, thiazolyl, imidazolyl, 2H- imidazolyl, 2-imidazolinyl, imidazolidinyl, pyrazolyl, 2-pyrazolinyl, pyrazolinyl, isoxazolyl, isothiazolyl, 1 ,2-dithiolyl, 1 ,3-dithiolyl, 3H-1 ,2-oxathiolyl, 1 ,2,3-oxadizaolyl, 1 ,2,4- oxadiazolyl, 1 ,2,5-oxadiazolyl, 1 ,3,4-oxadiazolyl, 1 ,2,3-triazolyl, 1 ,2,4-trizaolyl, 1 ,3,4- thiadiazolyl, 1 ,2,3,4-oxatriazolyl, 1 ,2,3,5-oxatrizaolyl, 3H-1 ,2,3-dioxazolyl, 1 ,2,4- dioxazolyl, 1 ,3,2-dioxazolyl, 1 ,3,4-dioxazolyl, 5H-1 ,2,5-oxathiazolyl and 1 ,3-oxathiolyl. Further exemplary six member rings are 2H-pyranyl, 4H-pyranyl, pyridinyl, piperidinyl, 1 ,2-dioxinyl, 1 ,3-dioxinyl, 1 ,4-dioxanyl, morpholinyl, 1 ,4-dithianyl, thiomorpholinyl, pyridazinyl, pyrimidinyl, pyrazinyl, piperazinyl, 1 ,3,5-triazinyl, 1 ,2,4-triazinyl, 1 ,2,3- trizainyl, 1 ,3,5-trithianyl, 4H-1 ,2-oxazinyl, 2H-1 ,3-oxazinyl, 6H-1 ,3-oxazinyl, 6H-1.2- oxazinyl, 1 ,4-oxazinyl, 2H-1 ,2-oxazinyl, 4H-1 ,4-oxazinyl, 1 ,2,5-oxathiazinyl, 1 ,4-oxazinyl, o-isoxazinyl, p-isoxazinyl, 1 ,2,5-oxathiazinyl, 1 ,2,6-oxathiazinyl, 1 ,4,2-oxadiazinyl and 1 ,3,5,2-oxadiazinyl. Further exemplary seven membered rings are azepinyl, oxepinyl, thiepinyl and 1 ,2,4-diazepinyl. Further exemplary eight membered rings are cyclooctyl, cyclooctenyl and cyclooctadienyl.

Exemplary bicyclic rings are composed of two fused partially saturated, fully saturated or fully unsaturated five or six membered rings, taken independently, optionally having one to four heteroatoms selected independently from nitrogen, sulfur and oxygen are indolizinyl, indolyl, isoindolyl, 3H-indolyl, 1 H-isoindolyl, indolinyl, cyclopenta(b)pyridinyl, pyrano(3,4-b)pyrrolyl, benzofuryl, isobenzofuryl, benzo(b)thienyl, benzo(c)thienyl, 1 H-indazolyl, indoxazinyl, benzoxazolyl, anthranilyl, benzimidazolyi, benzthiazolyl, purinyl, 4Hquinolizinyl, quinolinyl, isoquinolinyl, cinnolinyl, phthalazinyl, quinazolinyl, quinoxalinyl, 1 ,8-naphthyridinyl, pteridinyl, indenyl, isoindenyl, naphthyl, tetralinyl, decalinyl, 2H-1-benzopyranyl, pyrido(3,4-b)-pyridinyl, pyrido(3,2-b)-pyridinyl, pyrido(4,3-b)-pyridinyl, 2H-1 ,3-benzoxazinyl, 2H-1 ,4-benzoxazinyl, 1 H-2,3-benzoxazinyl, 4H-3, 1-benzoxazinyl, 2H-1 ,2-benzoxazinyl and 4H-1 ,4-benzoxazinyl. Exemplary 3-10 membered heterocyclyl groups include but are not limited to oxetane, azetidine, tetrahydrofuran, pyrrolidine, 2,5-dihydro-1 H-pyrrole, 1 ,3-dioxalane, isoxazolidine, oxazolidine, pyrazolidine, imidazolidine, pyrrolidin-2-one, tetrahydrothiophene-1 ,1 -dioxide, pyrrolidine-2,5-dione, tetrahydro-2H-pyran, piperidine, 1 ,2,3,6-tetrahydropyridine, 1 ,4-dioxane, morpholine, piperazine, thiomorpholine, piperidin-2-one, piperidin-4-one, thiomorpholine-1 ,1 -dioxide, 1 ,3-oxazinan-2-one, morpholin-3-one, piperazine-2-one, azepane, 1 ,4-oxazepane, 1 ,4-diazepane, azepan-2- one, 1 ,4-diazepan-5-one, quinuclidine, 2-aza-bicyclo[2.2.1]heptane, 8-aza- bicyclo[3.2.1]octane, 5-oxa-2-aza-bicyclo[2.2.1]heptane, 2-oxa-5-aza- bicyclo[2.2.1]heptan-3-one, 2-oxa-5-aza-bicyclo[2.2.2]octan-3-one, 1-methyl-5,6- pyrrolyl-7-oxa-bicyclo[2.2.1]heptane, 6-aza-bicyclo[3.2.1]octane, 3,8-diaza- bicyclo[3.2.1]octan-2-one, 2,2-dimethyl-tetrahydro-3aH-[1 ,3]dioxolo[4,5-c]pyrrole, 3,3- cyclohexylpyrrolidine, 1 ,5-diaxo-9-azaspiro[5.5]undecane, octahydro-1 H-isoιndole, \ decahydroquinoline, decahydroisoquinoline, octahydropyrrolo[1 ,2a]pyrazine, octahydro'1 H-pyrido[1 ,2a]pyrazine, octahydropyrrolo[3,4-c]pyridine-3-one, decahydropyrazino[1 ,2-a]azepine, furan, 1 H-pyrrole, isoxazole, oxazole, 1 H-pyrazole, 1 H-imidazole, thiazole, 1 ,2,4-oxadiazole, 1 ,3,4-oxadiazole, 4H-1 ,2,4-triazole, 1 H- tetrazole, pyridine, pyridazine, pyrimidine, pyrazine, pyridine-2(1 H)-one, 1 ,4,5,6- tetrahydrocyclopenta[c]pyrazole, 6,7-dihydro-5H-pyrrolo[2,1-c][1 ,2,4]triazole, 2,3- dihydroimidazo[2,1-b]thiazole, imidazo[2,1-b][1 ,3,4-c]pyridine, 4,5,6,7-tetrahydro-3H- imidazo[4,5-c]pyridine, 5,6,7,8-tetrahydroimidazo[1 ,5-a]pyrazine, 4,5,6,7- tetrahydrothiazole[5,4-c]pyridine, 5,6,7,8-tetrahydro-[1 ,2,4]triazolo[4,3-a]pyrazine, quinoline, isoquinoline, 2,3-dihydrobenzofuran, 5,6,7,8-tetrahydroquinoline, 3,4-dihydro- 1 H-isochromene, 1 ,2,3,4-tetrahydroisoquinoline, 4H-benzo[d][1 ,3]dioxane, 5,6,7,8- tetrahydropyrido[3,4-d]pyrimidine, benzofuran, 1 H-indole, benzo[d]oxazole, 1 H- benzo[d]imidazole, H-imidazo[1 ,2-a]pyridine, imidazo[1 ,2-a]pyrimidine, 5,6,7,8- tetrahydroimidazo[1 ,5-a]pyrazine-3(2H)-one, 2,3,4,5-tetrahydro-1 H-benzo[d]azepine, 2,3,4,5-tetrahydrobenzo[f][1 ,4]oxazepine, 5,6,7,8-tetrahydro-4H-isoxazolo[4,3-d]azepine and6,7,8,9-tetrahydro-2H-[1 ,2,4]triazolo[4,3-g][1 ,4]diazepin-3(5H)-one.

It is to be understood that if a carbocyclic or heterocyclic moiety may be bonded or otherwise attached to a designated substrate, through differing ring atoms without denoting a specific point of attachment, then all possible points are intended, whether through a carbon atom or, for example, a trivalent nitrogen atom. For example, the term "pyridyl" means 2-, 3-, or 4-pyridyl, the term "thienyl" means 2-, or 3-thienyl, and so forth.

Pharmaceutically acceptable salts of the compounds of the invention include the acid addition and base salts (including disalts) thereof. Suitable acid addition salts are formed from acids which form non-toxic salts.

Examples include the acetate, aspartate, benzoate, besylate, bicarbonate/carbonate, bisulphate/sulphate, borate, camsylate, citrate, edisylate, esylate, formate, fumarate, gluceptate, gluconate, glucuronate, hexafluorophosphate, hibenzate, hydrochloride/chloride, hydrobromide/bromide, hydroiodide/iodide, isethionate, lactate, malate, maleate, malonate, mesylate, methyisulphate, naphthylate, 2-napsylate, nicotinate, nitrate, orotate, oxalate, palmitate, pamoate, phosphate/hydrogen phosphate/dihydrogen phosphate, saccharate, stearate, succinate, tartrate, tosylate and trifluoroacetate salts.

Suitable base salts are formed from bases which form non-toxic salts. Examples include the aluminium, arginine, benzathine, calcium, choline, diethylamine, diolamine, glycine, lysine, magnesium, meglumine, olamine, potassium, sodium, tromethamine and zinc salts. For a review on suitable salts, see "Handbook of Pharmaceutical Salts: Properties, Selection, and Use" by Stahl and Wermuth (Wiley-VCH, Weinheim, Germany, 2002).

A pharmaceutically acceptable salt of a compound of the invention may be readily prepared by mixing together solutions of a compound of the invention and the desired acid or base, as appropriate. The salt may precipitate from solution and be collected by filtration or may be recovered by evaporation of the solvent. The degree of ionization in the salt may vary from completely ionized to almost non-ionized.

The compounds of the invention may exist in both unsolvated and solvated forms. The term 'solvate' is used herein to describe a molecular complex comprising a compound of the invention and one or more pharmaceutically acceptable solvent molecules, for example, ethanol, water and the like. The term 'hydrate' is included within the meaning of the term "solvate" and is frequently used when the solvent is water. Pharmaceutically acceptable solvates in accordance with the invention include solvates (hydrates) wherein the solvent of crystallization may be isotopically substituted, e.g. D₂O, de-acetone, d₆-DMSO.

The compounds of the invention which are complexes, such as clathrates and drug-host inclusion complexes are within the scope of the invention. In contrast to the aforementioned solvates, the drug and host are present in stoichiometric or non- stoichiometric amounts. Also included are complexes containing two or more organic and/or inorganic components which may be in stoichiometric or non-stoichiometric amounts. The resulting complexes may be ionized, partially ionized, or non-ionized. For a review of such complexes, see J Pharm Sci, 64 (8), 1269-1288 by Haleblian (August 1975). The compounds of the invention include all compounds of the invention, polymorphs and isomers thereof, including optical, geometric and tautomeric isomers as hereinafter defined and isotopically-labeled compounds. The compounds of the invention containing one or more asymmetric carbon atoms may exist as two or more stereoisomers. Where a compound contains an alkenyl or alkenylene group, geometric cis/trans (or ZIE) isomers are possible. Where the compound contains, for example, a keto or oxime group or an aromatic moiety, tautomeric isomerism ('tautomerism') can occur. It follows that a single compound may exhibit more than one type of isomerism.

All stereoisomers, geometric isomers and tautomeric forms of the compounds of the invention are included within the scope of the invention, including compounds exhibiting more than one type of isomerism, and mixtures of one or more thereof. Also included are acid addition or base salts wherein the counterion is optically active, for example, D-lactate or L-lysine, or racemic, for example, DL-tartrate or DL-arginine.

Cis/trans isomers may be separated by conventional techniques well known to those skilled in the art, for example, chromatography and fractional crystallization.

Conventional techniques for the preparation/isolation of individual enantiomers include chiral synthesis from a suitable optically pure precursor or resolution of the racemate (or the racemate of a salt or derivative) using, for example, chiral high pressure liquid chromatography (HPLC).

Alternatively, the racemate (or a racemic precursor) may be reacted with a suitable optically active compound, for example, an alcohol, or, in the case where the compound of the invention contains an acidic or basic moiety, an acid or base such as tartaric acid or 1-phenylethylamine. The resulting diastereomeric mixture may be separated by chromatography and/or fractional crystallization and one or both of the diastereoisomers converted to the corresponding pure enantiomer(s) by means well known to a skilled person. Chiral compounds of the invention (and chiral precursors thereof) may be obtained in enantiomerically-enriched form using chromatography, typically HPLC, on an asymmetric resin with a mobile phase consisting of a hydrocarbon, typically heptane or hexane, containing from 0 to 50% isopropanol, typically from 2 to 20%, and from 0 to 5% of an alkylamine, typically 0.1% diethylamine. Concentration of the eluate affords the enriched mixture. Mixtures of stereoisomers may be separated by conventional techniques known to those skilled in the art [see, for example, "Stereochemistry of Organic Compounds" by E. L Eliel (Wiley, New York, 1994)].

The invention includes all pharmaceutically acceptable isotopically-labeled compounds of the invention, wherein one or more atoms are replaced by atoms having the same atomic number, but an atomic mass or mass number different from the atomic mass or mass number usually found in nature.

Examples of isotopes suitable for inclusion in the compounds of the invention include isotopes of hydrogen, such as ²H and ³H, carbon, such as ¹¹C, ¹³C and ¹⁴C, chlorine, such as ³⁶CI, fluorine, such as ¹⁸F, iodine, such as ¹²³I and ¹²⁵I, nitrogen, such as ¹³N and ¹⁵N, oxygen, such as ¹⁵O, ¹⁷O and ¹⁸O, phosphorus, such as ³²P, and sulphur, such as ³⁵S.

Certain isotopically-labelled compounds of the invention, for example those incorporating a radioactive isotope, are useful in drug and/or substrate tissue distribution studies. The radioactive isotopes tritium, i.e., ³H, and carbon-14, i.e., ¹⁴C, are particularly useful for this purpose in view of their ease of incorporation and ready means of detection.

Substitution with heavier isotopes such as deuterium, i.e., ²H, may afford certain therapeutic advantages resulting from greater metabolic stability, for example, increased in vivo half-life or reduced dosage requirements, and hence may be preferred in some circumstances.

Substitution with positron emitting isotopes, such as ¹¹C, ¹⁸F, ¹⁵O and ¹³N, can be useful in Positron Emission Topography (PET) studies for examining substrate receptor occupancy. Isotopically-labeled compounds of the invention can generally be prepared by conventional techniques known to those skilled in the art or by processes analogous to those described in the accompanying Examples and Preparations using an appropriate isotopically-labeled reagents in place of the non-labeled reagent previously employed.

As used herein, the expressions "reaction-inert solvent" and "inert solvent" refers to a solvent which does not interact with starting materials, reagents, intermediates or products in a manner which adversely affects the yield of the desired product. The parenthetical negative or positive sign used herein in the nomenclature denotes the direction plane polarized light is rotated by the particular stereoisomer.

One of ordinary skill will recognize that certain compounds of the invention may contain one or more atoms which may be in a particular stereochemical or geometric configuration, giving rise to stereoisomers and configurational isomers. All such isomers and mixtures thereof are included in the invention. Solvates (hydrates) of the compounds of the invention are also included.

Other features and advantages will be apparent from the specification and claims which describe the invention. Detailed Description of the Invention

In general, the compounds of the invention may be prepared by processes known in the chemical arts, particularly in light of the description contained herein. Certain processes for the manufacture of the compounds of the invention are provided as further features of the invention and are illustrated in the reaction schemes provided below and in the experimental section. The use of various protecting groups in these reactions are also well known and are exemplified in Protective Groups In Organic

Synthesis, Second Edition, T.W. Greene and P. G. M. Wuts, John Wiley and Sons, Inc.

1991 , pages 227-229, which is hereby incorporated by reference in its entirety for all purposes. Scheme 1

In scheme 1 , methyl 2-acetamidoacrylate (1 ) is treated with MeI and Ag₂O in DMF provides the intermediate methyl 2-acetamidoacrylate (2). Michael addition of (2) with thiophen-2-thiol in THF in presence of Et^N provides the 1 ,4 addition product (3). Hydrolysis of (3) using 6N HCI provides the acid (4) which is subsequently protected using methyl chloroformate to afford Λ/-(methoxycarbonyl)-Λ/-methyl-S-2-thienylcysteine (5). Cyclization of (5) is carried out by formation of the acid chloride followed by treatment with TiCI₄ which provides the cyclized intermediate (6). Treatment of (6) with chlorosulfonic acid followed by treatment of the resulting sulfonyl chloride with NH₃ in MeOH provides the sulfonamide intermediate (7). Deprotection of the amino group by treatment of (7) with 5% HBr in acetic acid provides the amino intermediate (8). Reductive amination of (8) with an amino acid derivatized aldehyde in presence of NaBHaCN provides the intermediate (9), which are generally produced as a mixture of diasteromers. Other amino acid derivativized aldehydes including natural and synthetic alpha amino acid derivatized aldehydes and natural and synthetic beta amino acid derivatized aldehydes ultimately provides a tricyclic system having a 6 or 7 membered ring, respectively. (For the preparation of other amino acid derivatized aldedhydes see: Chemical & Pharmaceutical Bulletin (2002), 50(2), 239-252; Journal of Medicinal Chemistry (1989), 32(8), 1886-90; Heterocycles (2003), 60(4), 791-798). BOC de- protection of (10) using TFA in CH₂CI₂ provides the intermediate amino compound which subsequently undergoes an intramolecular reductive amination in THF in presence of NaBH(OAc)₃, to afford the tricyclic intermediate (10), generated as a mixture of two isomers. Finally, oxidation of the sulfide using N-methylmorpholine-N- oxide in the presence of a catalytic amount of OsO₄ provides the product tricyclic system as a mixture of isomers (11 , trans and 11 , cis) which may be isolated by silical gel column chromatography or by HPLC.

Scheme Il

Oxone, H₂O, U*0

NaBH₄, EtOH MeOH _κ S H₂SO₄, -5⁰C 90% yield * 79% yield ) 87% yield

^J21 OH 22 OH 23

1 CISO₃H, SOCI₂, 78%

2 NH₄OH, THF, 71% THF _^

30 31

In scheme II, intermediate (21 ) is prepared according to J. Org. Chem., (1993), 58 (7), 1672-1679. This ketone is treated with NaBH₄ in EtOH to provide the alcohol intermediate (22). Oxidation of (22) using Oxone in MeOH/H20 provides sulfone (23). Dehydration using H₂SO₄ provides the olefin intermediate (24). Epoxidization of (24) using m-CPBA provides intermediate (25). Epoxide ring-opening using NaN₃ provides intermediate azido alcohol (26) which is converted to intermediate (27) by treatment with methyl bromoacetate in DMF in the presence of CS₂CO₃. Reduction of the azide with Pd/C catalyzed hydrogenation and spontaneous cyclization provides the tricyclic intermediate (28). Treatment of (28) with chlorosulfonic acid and thionyl chloride followed by exposure to NH₄OH provides the intermediate sulfonamide (29). Reduction of (29) with BHa-SMe₂ in THF and subsequent isolation by silica gel column chromatography or HPLC provides the tricyclic products (30) and (31). The utility of the compounds of the invention as medical agents for the reduction of intraocular pressure and accordingly to treat glaucoma is demonstrated by the activity of the compounds in conventional assays, including the in vivo assay and a receptor binding assay. Such assays also provide a means whereby the activities of the compounds can be compared to each other and with the activities of other known compounds. The results of these comparisons are useful for determining dosage levels in mammals, including humans, for the treatment of such diseases.

The compounds of the invention intended for pharmaceutical use may be administered as crystalline or amorphous products. They may be obtained, for example, as solid plugs, powders, or films by methods such as precipitation, crystallization, freeze drying, spray drying, or evaporative drying. Microwave or radio frequency drying may be used for this purpose.

The compounds of the invention intended for pharmaceutical use may be administered alone or in combination with one or more other compounds of the invention or in combination with one or more other drugs (or as any combination thereof). Generally, they will be administered as a formulation in association with one or more pharmaceutically acceptable excipients. The term "excipient" is used herein to describe any ingredient other than the compound(s) of the invention. The choice of excipient will to a large extent depend on factors such as the particular mode of administration, the effect of the excipient on solubility and stability, and the nature of the dosage form.

Pharmaceutical compositions suitable for the delivery of compounds of the present invention and methods for their preparation will be readily apparent to those skilled in the art. Such compositions and methods for their preparation may be found, for example, in 'Remington's Pharmaceutical Sciences', 19th Edition (Mack Publishing

Company, 1995).]

The compounds of the invention may be administered orally. Oral administration may involve swallowing, so that the compound enters the gastrointestinal tract, or buccal or sublingual administration may be employed by which the compound enters the blood stream directly from the mouth.

Formulations suitable for oral administration include solid formulations, such as tablets, capsules containing particulates, liquids, or powders; lozenges (including liquid- filled), chews; multi- and nano-particulates; gels, solid solution, liposome, films (including muco-adhesive), ovules, sprays and liquid formulations.

Liquid formulations include suspensions, solutions, syrups and elixirs. Such formulations may be employed as fillers in soft or hard capsules and typically comprise a carrier, for example, water, ethanol, polyethylene glycol, propylene glycol, methylcellulose, or a suitable oil, and one or more emulsifying agents and/or suspending agents. Liquid formulations may also be prepared by the reconstitution of a solid, for example, from a sachet.

The compounds of the invention may also be used in fast-dissolving, fast- disintegrating dosage forms such as those described in Expert Opinion in Therapeutic Patents, 11 (6), 981-986 by Liang and Chen (2001 ).

For tablet dosage forms, depending on dose, the drug may make up from 1 wt% to 80 wt% of the dosage form, more typically from 5 wt% to 60 wt% of the dosage form. In addition to the drug, tablets generally contain a disintegrant. Examples of disintegrants include sodium starch glycolate, sodium carboxymethyl cellulose, calcium carboxymethyl cellulose, croscarmellose sodium, crospovidone, polyvinylpyrrolidone, methyl cellulose, microcrystalline cellulose, lower alkyl-substituted hydroxypropyl cellulose, starch, pregelatinised starch and sodium alginate. Generally, the disintegrant will comprise from 1 wt% to 25 wt%, preferably from 5 wt% to 20 wt% of the dosage form.

Binders are generally used to impart cohesive qualities to a tablet formulation. Suitable binders include microcrystalline cellulose, gelatin, sugars, polyethylene glycol, natural and synthetic gums, polyvinylpyrrolidone, pregelatinised starch, hydroxypropyl cellulose and hydroxypropyl methylcellulose. Tablets may also contain diluents, such as lactose (monohydrate, spray-dried monohydrate, anhydrous and the like), mannitol, xylitol, dextrose, sucrose, sorbitol, microcrystalline cellulose, starch and dibasic calcium phosphate dihydrate.

Tablets may also optionally comprise surface active agents, such as sodium lauryl sulfate and polysorbate 80, and glidants such as silicon dioxide and talc. When present, surface active agents may comprise from 0.2 wt% to 5 wt% of the tablet, and glidants may comprise from 0.2 wt% to 1 wt% of the tablet. Tablets also generally contain lubricants such as magnesium stearate, calcium stearate, zinc stearate, sodium stearyl fumarate, and mixtures of magnesium stearate with sodium lauryl sulphate. Lubricants generally comprise from 0.25 wt% to 10 wt%, preferably from 0.5 wt% to 3 wt% of the tablet. Other possible ingredients include anti-oxidants, colourants, flavouring agents, preservatives and taste-masking agents.

Exemplary tablets contain up to about 80% drug, from about 10 wt% to about 90 wt% binder, from about 0 wt% to about 85 wt% diluent, from about 2 wt% to about 10 wt% disintegrant, and from about 0.25 wt% to about 10 wt% lubricant. Tablet blends may be compressed directly or by roller to form tablets. Tablet blends or portions of blends may alternatively be wet-, dry-, or melt-granulated, melt congealed, or extruded before tabletting. The final formulation may comprise one or more layers and may be coated or uncoated; it may even be encapsulated. The formulation of tablets is discussed in "Pharmaceutical Dosage Forms: Tablets, Vol. 1 ", by H. Lieberman and L. Lachman, Marcel Dekker, N.Y., N.Y., 1980 (ISBN 0-8247-6918- X).

The foregoing formulations for the various types of administration may be formulated to be immediate and/or modified release. Modified release formulations include delayed-, sustained-, pulsed-, controlled-, targeted and programmed release. Suitable modified release formulations for the purposes of the invention are described in US Patent No. 6,106,864. Details of other suitable release technologies such as high energy dispersions and osmotic and coated particles are to be found in Verma et al, Pharmaceutical Technology On-line, 25(2), 1 -14 (2001 ). The use of chewing gum to achieve controlled release is described in WO 00/35298. The compounds of the invention may also be administered directly into the blood stream, into muscle, or into an internal organ. Suitable means for parenteral administration include intravenous, intraarterial, intraperitoneal, intrathecal, intraventricular, intraurethral, intrasternal, intracranial, intramuscular and subcutaneous. Suitable devices for parenteral administration include needle (including microneedle) injectors, needle-free injectors and infusion techniques.

Parenteral formulations are typically aqueous solutions which may contain excipients such as salts, carbohydrates and buffering agents (preferably to a pH of 3 to 9), but, for some applications, they may be more suitably formulated as a sterile nonaqueous solution or as a dried form to be used in conjunction with a suitable vehicle such as sterile, pyrogen-free water.

The preparation of parenteral formulations under sterile conditions, for example, by lyophilisation, may readily be accomplished using standard pharmaceutical techniques well known to those skilled in the art.

The solubility of compounds of the invention used in the preparation of parenteral solutions may be increased by the use of appropriate formulation techniques, such as the incorporation of solubility-enhancing agents. Formulations for parenteral administration may be formulated to be immediate and/or modified release. Thus, compounds of the invention may be formulated as a solid, semi-solid, or thixotropic liquid for administration as an implanted depot providing modified release of the active compound. Examples of such formulations include drug- coated stents and PGLA [define] microspheres. The compounds of the invention may also be administered topically to the skin or mucosa, that is, dermally or transdermally. Typical formulations for this purpose include gels, hydrogels, lotions, solutions, creams, ointments, dusting powders, dressings, foams, films, skin patches, wafers, implants, sponges, fibres, bandages and microemulsions. Liposomes may also be used. Typical carriers include alcohol, water, mineral oil, liquid petrolatum, white petrolatum, glycerin, polyethylene glycol and propylene glycol. Penetration enhancers may be incorporated [see, for example, J Pharm Sci, 88 (10), 955-958 by Finnin and Morgan (October 1999).]

Other means of topical administration include delivery by electroporation, iontophoresis, phonophoresis, sonophoresis and microneedle or needle-free (e.g. Powderject™, Bioject™, etc.) injection.

The compounds of the invention can also be administered intranasally or by inhalation, typically in the form of a dry powder (either alone, as a mixture, for example, in a dry blend with lactose, or as a mixed component particle, for example, mixed with phospholipids, such as phosphatidylcholine) from a dry powder inhaler or as an aerosol spray from a pressurized container, pump, spray, atomizer (preferably an atomizer using electrohydrodynamics to produce a fine mist), or nebuliser, with or without the use of a suitable propellant, such as 1 ,1 ,1 ,2-tetrafluoroethane or 1 ,1 ,1 ,2,3,3,3- heptafluoropropane. For intranasal use, the powder may comprise a bioadhesive agent, for example, chitosan or cyclodextrin.

The pressurized container, pump, spray, atomizer, or nebuliser contains a solution or suspension of the compound(s) of the invention comprising, for example, ethanol, aqueous ethanol, or a suitable alternative agent for dispersing, solubilising, or extending release of the active, a propellant(s) as solvent and an optional surfactant, such as sorbitan trioleate, oleic acid, or an oligolactic acid.

Prior to use in a dry powder or suspension formulation, the drug product is micronised to a size suitable for delivery by inhalation (typically less than 5 microns). This may be achieved by any appropriate comminuting method, such as spiral jet milling, fluid bed jet milling, supercritical fluid processing to form nanoparticles, high pressure homogenization, or spray drying.

Capsules (made, for example, from gelatin or HPMC), blisters and cartridges for use in an inhaler or insufflator may be formulated to contain a powder mix of the compound of the invention, a suitable powder base such as lactose or starch and a performance modifier such as l-leucine, mannitol, or magnesium stearate. The lactose may be anhydrous or in the form of the monohydrate, preferably the latter. Other suitable excipients include dextran, glucose, maltose, sorbitol, xylitol, fructose, sucrose and trehalose. A suitable solution formulation for use in an atomizer using electrohydrodynamics to produce a fine mist may contain from 1 μg to 20 mg of the compound of the invention per actuation and the actuation volume may vary from 1 μl to 100 μl. A typical formulation may comprise a compound of the invention, propylene glycol, sterile water, ethanol and sodium chloride. Alternative solvents which may be used instead of propylene glycol include glycerol and polyethylene glycol.

Suitable flavors, such as menthol and levomenthol, or sweeteners, such as saccharin or saccharin sodium, may be added to those formulations of the invention intended for inhaled/intranasal administration.

Formulations for inhaled/intranasal administration may be formulated to be immediate and/or modified release using, for example, poly(DL-lactic-coglycolic acid

(PGLA). Modified release formulations include delayed-, sustained-, pulsed-, controlled-

, targeted and programmed release. The compounds of the invention may be administered rectally or vaginally, for example, in the form of a suppository, pessary, or enema. Cocoa butter is a traditional suppository base, but various alternatives may be used as appropriate.

The compounds of the invention may also be administered directly to the eye or ear, typically in the form of drops of a micronised suspension or solution in isotonic, pH- adjusted, sterile saline. Other formulations suitable for ocular and aural administration include ointments, biodegradable (e.g. absorbable gel sponges, collagen) and nonbiodegradable (e.g. silicone) implants, wafers, lenses and particulate or vesicular systems, such as niosomes or liposomes. A polymer such as crossed-linked polyacrylic acid, polyvinylalcohol, hyaluronic acid; a cellulosic polymer, for example, hydroxypropylmethylcellulose, hydroxyethylcellulose, or methyl cellulose; or a heteropolysaccharide polymer, for example, gelan gum, may be incorporated together with a preservative, such as benzalkonium chloride. Such formulations may also be delivered by iontophoresis. The compounds of the invention can be incorporated into various types of ophthalmic formulations for delivery to the eye. These compounds may be combined with ophthalmologically acceptable preservatives, surfactants, viscosity enhancers, penetration enhancers, buffers, sodium chloride and water to form an aqueous, sterile ophthalmic suspensions or solutions. In order to prepare sterile ophthalmic ointment formulations, the active ingredient is combined with a preservative in an appropriate vehicle, such as, mineral oil, liquid lanolin, or white petrolatum. Sterile ophthalmic gel formulations may be prepared by suspending the active ingredient in a hydrophilic base prepared from the combination of, for example, carbopol-940 or the like according to the published formulations for analogous ophthalmic preparations; preservatives and tonicity agents can be incorporated. Ophthalmic solution formulations may be prepared by dissolving the active ingredient in a physiologically acceptable isotonic aqueous buffer. Further, the ophthalmic solution may include an ophthalmologically acceptable surfactant to assist in dissolving the active ingredient. Furthermore, the ophthalmic solution may contain a thickener such as hydroxymethylcellulose, hydroxyethylcellulose, hydroxypropylmethylcellulose, methyl-cellulose, polyvinylpyrrolidone, or the like to improve the retention of the medicament in the conjunctival sac. The compounds of the invention are preferably formulated as topical ophthalmic suspensions or solutions, with a pH of about 4.5 to 7.8. The compounds will normally be contained in these formulations in an amount of 01 % to 10% by weight, but preferably in an amount of 0.25% to 5.0% by weight. Thus, for topical presentation 1 to 3 drops of these formulations would be delivered to the surface of the eye 1 to 4 times a day according to the routine discretion of a skilled clinician.

The compounds of the invention may be combined with soluble macromolecular entities, such as cyclodextrin and suitable derivatives thereof or polyethylene glycol- containing polymers, in order to improve their solubility, dissolution rate, taste-masking, bioavailability and/or stability for use in any of the aforementioned modes of administration.

Drug-cyclodextrin complexes, for example, are found to be generally useful for most dosage forms and administration routes. Both inclusion and non-inclusion complexes may be used. As an alternative to direct complexation with the drug, the cyclodextrin may be used as an auxiliary additive, i.e. as a carrier, diluent, or solubiliser. Most commonly used for these purposes are alpha-, beta- and gamma-cyclodextrins, examples of which may be found in International Patent Applications Nos. WO 91/11172, WO 94/02518 and WO 98/55148.

Dosage ranges are based on an average human subject having a weight of about 65 kg to 70 kg. The physician will readily be able to determine doses for subjects whose weight falls outside this range, such as infants and the elderly. Depending on the disease and condition of the patient, the term "treatment" as used herein may include one or more of curative, palliative and prophylactic treatment.

The ability of the compounds of the invention to reduce intraocular pressure may be measured using the assay described below.

The following non-limiting preparations and Examples illustrate the preparation of the compounds of the invention. Examples

In the examples described below, unless otherwise indicated, all temperatures are set forth in degrees Celsius and all parts and percentages are by weight. Reagents may be purchased from commercial suppliers, such as Sigma-Aldrich Chemical

Company, Acros Organics, or Lancaster Synthesis Ltd. and may be used without further purification unless otherwise indicated. Tetrahydrofuran (THF), methylene chloride (CH₂CI₂ or DCM), N, N-dimethylacetamide (DMA), acetonitrile (MeCN), and N₁N- dimethylformamide (DMF) may be purchased from Aldrich in Sure-Seal bottles and used as received. Ail solvents may be purified using standard methods known to those skilled in the . art, unless otherwise indicated. The ligand bis- (diphenylphosphino)ferrocene is abbreviated as dppf. Diethyl ether is abbreviated as Et₂O. Trifluoroacetic acid is abbreviated as TFA. Acetic acid is abbreviated as HOAc or AcOH. Coupling reagent 0-(7-azabenzotriazol-1-yl)-N,N,N',N'-tetra-methyluronium hexafluorophosphate is abbreviated as HATU. The reactions set forth below were done generally under a positive pressure of argon or nitrogen or with a drying tube, at ambient temperature (unless otherwise stated), in anhydrous solvents, and the reaction flasks were fitted with rubber septa for the introduction of substrates and reagents via syringe. Glassware was oven dried and/or heat dried. Analytical thin layer chromatography (TLC) was performed using glass-backed silica gel 60 F 254 pre-coated plates (Merck Art 5719) and eluted with appropriate solvent ratios (v/v). Reactions were assayed by TLC or LCMS and terminated as judged by the consumption of starting material. Visualization of the TLC plates was done with UV light (254 nm wavelength) or with an appropriate TLC visualizing solvent and activated with heat. Analytical HPLC performed with Waters or Agilent instruments. Flash column chromatography (Still et al., J. Org. Chem., 1978, 43, 2923) was performed using silica gel 60 (Merck Art 9385) or various MPLC systems, such as Biotage or ISCO purification system. Preparative HPLC routinely performed on Prep LC 4000 system from Water with Ultra 120 10 mm C8 column from Peeke Scientific for single compounds; combinational, solution-based samples described in detail herein. Microwave chemistry was carried out using an EmrysTM Optimizer EXP from Personal Chemistry, Inc. (now Biotage).

The compound structures in the examples below were confirmed by one or more of the following methods: proton magnetic resonance spectroscopy, mass spectroscopy, and elemental microanalysis. Proton magnetic resonance (¹H NMR) spectra were determined using a Bruker spectrometer operating at field strength of 300 or 400 megahertz (MHz). Chemical shifts are reported in parts per million (ppm, δ) downfield from an internal tetramethylsilane standard. Alternatively, ¹H NMR spectra were referenced relative to signals from residual protons in deuterated solvents as follows: CDCI₃ = 7.25 ppm; DMSOd₆ = 2.49 ppm; CD₃CN = 1.94 ppm, CD₃OD or methanol-d₄ = 3.30 ppm; CβDβ = 7.16 ppm. Peak multiplicities are designated as follows: s, singlet; d, doublet; dd, doublet of doublets; t, triplet; dt, doublet of triplets; q, quartet; br, broadened; m, multiplet. Coupling constants are given in Hertz (Hz). Mass spectra (MS) data were obtained using Agilent LC mass spectrometer with APCI or ESI ionization. High resolution MS (HRMS) were performed on an Agilent G3250AA LCMSD/TOF mass spectrometer. Elemental microanalyses were performed by Atlantic Microlab Inc. and gave results for the elements stated within ±0.4% of the theoretical values.

Preferred compounds in accordance with the invention may be prepared in manners analogous to those specifically described below.

The examples and preparations provided below further illustrate and exemplify the compounds of the present invention and methods of preparing such compounds. It is to be understood that the scope of the present invention is not limited in any way by the scope of the following examples and preparations. The skilled artisan will recognize that different acids, amines, alkyl halides, aryl halides, coupling reagents, and heterocycles may be substituted in the following descriptions to suit the preparations of a desired embodiment. The following methods may be scaled upwards or downwards to suit the amount of desired material.

Example 1 : (2S,4aS,9bR)-2,4-dimethyl-1 ,3,4,4a,5,9b-hexahydro-2H-thieno[3',2':5,6]- thiopyrano[3,4-b]pyrazine-8-sulfonamide 6,6-dioxide (11 , trans):

(2S,4aR,9bR)-2,4-dimethyl-1 ,3,4,4a,5,9b-hexahydro-2H-thieno[3',2':5,6] thiopyrano[3,4-b]pyrazine-8-sulfonamide 6,6-dioxide (11 , cis):

Preparation of methyl 2-[acetyl(methyl)amino]acrylate (2):

OMe

O "

To the solution of methyl 2-acetamido-acrylate (22.21 g, 155 mmol) and methyl iodide (44.02 g, 310 mmol) in 200 mL of DMF, was added Ag2O (35.91 g, 155 mmol).

The mixture was stirred at room temperature overnight. After filtration to remove solid, the solvent DMF and MeI was removed by evaporation under vacuum. The residue was mixed with -150 mL of EtOAc, and filtered. The filtrate was concentrated. The crude

(-26.81 g of oil containing a little DMF) was used directly for the next step. ¹H-NMR (d₆- DMSO): (two rotomers) D 6.38 & 5.71 (s & s, 1 H), 6.06 & 5.50 (s & s, 1 H), 3.77 & 3.66

(s & s, 3H), 2.93 & 3.19 (s & s, 3H), 1.84 & 2.08 (s & s, 3H). LS/MS: (APCI) 158.3

(M⁺+1 )

Preparation of methyl N-acetyl-N-methyl-S-2-thienylcysteinate (3):

To the solution of the oil obtained above and thiophene-2 -thiol (17.17 g, 148 mmol) in 160 mL of THF, was added Et3N (1.49 g, 14.8 mmol). The reaction was complete after stirring at room temperature for 1 hour. The reaction mixture was concentrated; and the residue was used directly for the next reaction. ¹H-NMR (d₆- DMSO): (two rotomers) D 7.60-7.70 (m, 1 H), 7.17-7.27 (m, 1 H), 7.00-7.12 (m, 1 H), 4.82- 4.95 & 4.63-4.73 (m & m, 1 H), 3.61 & 3.69 (s & s, 3H), 3.20-3.40 (m, 2H), 2.93 & 2.58 (s & s, 3H)₁ 2.01 & 1.93 (s & s, 3H).

Preparation of N-(methoxycarbonyl)-N-methyl-S-2-thienylcysteine (5):

The crude oil (methyl N-acetyl-N-methyl-S-2-thienylcysteinate) obtained above was mixed with 300 mL of 6N HCI. The mixture was refluxed for 2.5 hours and hydrolysis was complete to give N-methyl-S-2-thienylcysteine. While cooling in ice bath, the reaction mixture was neutralized with NaOH solution (72 g, 1.8 mol NaOH in 100 mL of water), followed by slow addition of 148 mL of 2 N Na₂CO₃. Methyl chloroformate (14.65 g, 155 mmol) was then added and the mixture was stirred for 30 minutes. After acidification with 4 N HCI, extraction workup with EtOAc and azotroped with toluene, 42.37 g of crude oily product was obtained and used directly to the next step. ¹H-NMR (d₆-DMSO): (two rotomers) G 12.6-13.4 (broad, 1 H), 7.60-7.70 (m, 1 H), 7.17-7.27 (m, 1 H), 7.00-7.12 (m, 1 H), 4.40-4.65 (m, 1 H), 3.56 & 3.63 (s & s, 3H), 3.20-3.40 (m, 2H), 2.77 & 2.78 (s & s, 3H). LC/MS: (ESI) 298.0 (M+Na⁺). Preparation of methyl methyl(4-oxo-5,6-dihydro-4H-thieno[2,3-b]thiopyran-5- yl)carbamate (6):

One-third of the product N-(methoxycarbonyl)-N-methyl-S-2-thienylcysteine obtained from above (14.10 g, -49.3 mmol according to amount of thiophene-2-thiol used) was dissolved in 160 mL of anhydrous dichloromethane containing 1.5 mL of anhydrous DMF, cooled down in ice bath. Oxalyl chloride solution in CH₂CI₂ (2M, 27 mL, 54 mmol) was added and the mixture was stirred in ice bath for 1 hour. 175 mL of TiCI₄ solution (1.0 M in CH2CI2, 175 mmol) was then added. The reaction mixture was then stirred at room temperature for 4 hours. The reaction mixture was then poured into ice/water mixture (-300 mL), and was extracted with CH₂CI₂ 3 times. The combined CH₂CI₂ phase (-1000 mL) was washed with brine one time, dried with Na₂SO₄, concentrated, and the purification on silica gel column with Hexane/EtOAc (0- 40%EtOAc gradient) afforded 4.13 g. The aqueous phase (containing the de-protected product, 5-(methylamino)-5,6-dihydro-4H-thieno[2,3-b]thiopyran-4-one) was cooled down in ice bath, neutralized with the solution of NaOH (28g, 700 mmol) in 50 mL of water and basified with 2M K₂Cθ₃, followed by addition of 3 mL of methyl chloroformate and 300 mL of MeOH. The mixture was stirred for 20 minutes and re-protection was complete. Filtered to removed solid (washing solid with extra MeOH), the filtrate was extracted with CH₂CI₂ twice (-500 mL total). The CH₂CI₂ phase was dried with Na₂SO₄, and concentrated. Column purification same as above afforded another 2.28 g of product. Together, 6.41 g of product was obtained. The 5-step yield is 51%. ¹H-NMR (d₆-DMSO): (two rotomers) D 7.44 (d, J=5.5 Hz, 1 H), 7.35 (d, J=5.3Hz, 1 H), 4.80-4.95 (m, 1 H), 3.95-4.15 (m, 1 H), 3.56 & 3.64 (s & s, 3H), 3.25-3.45 (m, 1 H), 2.86 & 2.83 (s & s, 3H). LC/MS: (APCI) 258.2 (M⁺+1 ).

Preparation of methyl [2-(aminosulfonyl)-4-oxo-5,6-dihydro-4H-thieno[2,3- b]thiopyran-5-yl]methyl-carbamate (7):

To the solution of methyl(4-oxo-5,6-dihydro-4H-thieno[2,3-b]thiopyran-5- yl)carbamate (3.80 g, 14.8 mmol) in 90 mL of CH₂CI₂ while being cooled in ice bath, was added the cold solution of chlorosulfonic acid (1.90 g, 16.3 mmol) in 10 mL of CH₂CI₂. The reaction mixture was then stirred at room temperature for 4 hours. After being cooled down in ice bath, PCI5 (4.31 g, 20.7 mmol) was added. The mixture was stirred for 3 hours and then poured into water. After extraction workup with CH₂CI₂, the sulfonylchloride obtained was dissolved in 40 mL of acetone, added to 150 mL of NH₃ solution (0.5 M in 1 ,4-dioxane) and stirred for 20 minutes. Purification with silica gel chromatography afforded 2.91 g of product. ¹H-NMR (d₆-DMSO): G 7.86 (s, 2H), 7.65 (s, 1 H), 4.85-5.00 (dd, 1 H, J1 =13.4Hz, J2=3.8Hz), 4.00-4.20 (m, 1 H), 3.64 & 3.57 (s & s, 3H), 3.35-3.50 (m, 1 H), 2.87 & 2.84 (s & s, 3H). LC/MS: (ESI) 335.0 (M⁺-I )

Preparation of 5-(methylamino)-4-oxo-5,6-dihydro-4H-thieno[2,3-b]thiopyran-2- sulfonamide (8):

Preparation of methyl [2-(aminosulfonyl)-4-oxo-5,6-dihydro-4H-thieno[2,3- b]thiopyran-5-yl]methyl-carbamate (2.58 g, 7.7 mmol) was mixed with 120 mL of 5% HBr in acetic acid and stirred for 4 days, monitored by LC/MS. After being concentrated to dryness, the residue was purified with HPLC using H2O/Acetonitrile containing 01 %

AcOH. 2.24 g product containing 0.3 equivalent of AcOH was obtained. ¹H-NMR (d₆- DMSO): D 9.32 (s, 2H), 7.85 (s, 2H), 7.63 (s, 1 H), 4.55-4.75 (m, 1 H), 3.65-3.85 (m, 2H),

2.62 (s, 3H). LC/MS: (ESI) 279.0 (M⁺+1 ).

Preparation of (2S,9bR)-2,4-dimethyl-1 ,3,4,4a,5,9b-hexahydro-2H- thieno[3',2':5,6]-thiopyrano[3,4-b]pyrazine-8-sulfonamide (10):

1.97 g of methyl [2-(aminosulfonyl)-4-oxo-5,6-dihydro-4H-thieno[2,3-b]thiopyran- 5-yl]methylcarbamate (5.86 mmol) was deprotected and purified as above. The product (5-(methylamino)-4-oxo-5,6-dihydro-4H-thieno[2,3-b]thiopyran-2-sulfonamide) obtained was mixed with L-analinal (3.04 g, 17.6 mmol) in 50 mL of EtOH, and NaBH₃CN (2.21 g, 35 mmol) was then added. The mixture was stirred for 1 hour and 45 minutes. Extraction workup and column chromatography afforded the crude mixture containing two diasteromers. This crude mixture was dissolved in 15% TFA in CH₂Cb (6 mL of TFA in 40 mL of CH₂CI₂) and stirred for 2 hours, then poured into the suspension of NaBH(OAc)₃ (20 g) in 200 mL of THF while stirring. One hour later, the reaction was quenched with 1.2 N HCI in MeOH and concentrated to dryness. HPLC purification afforded 228 mg of the tricyclic product.

Preparation of (2S,4aS,9bR)-2,4-dimethyl-1 ,3,4,4a, 5,9b-hexahydro-2H-thieno- [3',2':5,6]thiopyrano-[3,4-b]pyrazine-8-sulfonamide 6,6-dioxide (11 , trans):

(2S,4aR,9bR)-2,4-dimethyl-1 ,3,4,4a,5,9b-hexahydro-2H- thieno[3',2':5,6]thiopyrano-[3,4-b]pyrazine-8-sulfonamide 6,6-dioxide (11 , cis):

105 mg of (2S,9bR)-2,4-dimethyl-1 ,3,4,4a,5,9b-hexahydro-2H- thieno[3',2':5,6]thio-pyrano[3,4-b]pyrazine-8-sulfonamide (0.33 mmol) obtained above and N-methylmorpholine-N-oxide (154 mg, 1.32 mmol) were dissolved in 9 rπL of THF and 1 ml. of t-BuOH, followed by addition of 1.0 mL of OSO₄ solution in t-BuOH (2.5 wt%). After stirring for 15 minutes, solvent was removed and the residue was purified by HPLC multiple times. 56.7 mg of trans product and 2.1 mg of cis product were obtained. Trans: ¹H-NMR (d₆-DMSO): D 7.97 (s, 2H), 7.69 (s, 1 H), 4.05-4.20 (d, J=13.13.9, 1 H), 3.65-3.75 (d, 1 H₁ J=9.1 Hz), 3.44-3.56 (dd, 1 H, J1 =13.6Hz, J2=12.1 Hz), 2.76-2.90 (m, 1 H), 2.66-2.75 (m, 1 H), 2.35-2.50 (m, 1 H), 2.18 (s, 3H), 1.70 (t, J=11.2Hz), 0.90-0.97 (d, J=6.4Hz, 3H). LC/MS: (APCI) 352.0 (M⁺+1 ). Cis: ¹H-NMR (d₆- DMSO): D 7.61 (s, 1 H), 4.06 (s, 1H), 3.88-4.04 (t, J=12.6Hz, 1 H), 3.59-3.72 (d, J=12.9Hz, 1 H), 3.44-3.55 (d, J=11.6Hz, 1 H), 2.88 (m, 1 H), 2.39-2.46 (d, 111.1 Hz, 1 H), 2.36 (s, 3H), 1.80-1.98 (m, 1 H), 0.89-0.99 (d, J=5.0Hz, 3H). LC/MS: (APCI) 352.2 (M⁺+1)

Example 2: (2S,4aS,9bR)-2-isopropyl-4-methyl-1 ,3,4,4a,5,9b-hexahydro-2H- thieno[3',2':5,6] thiopyrano[3,4-b]pyrazine-8-sulfonamide 6,6-dioxide

(13, trans):

(2S,4aR,9bR)-2-isopropyl-4-methyl-1 ,3,4,4a,5,9b-hexahydro-2Hthieno- [3',2':5,6]thiopyrano[3,4-b]pyrazine-8-sulfonamide 6,6-dioxide (13, cis):

Preparation of tert-butyl ((1S)-1-{[[2-(aminosulfonyl)-4-oxo-5,6-dihydro-4H- thieno[2,3-b]thiopyran-5-yl]-(methyl)amino]methyl}-2-methylpropyl)carbamate (12):

To a mixture of 5-(methylamino)-4-oxo-5,6-dihydro-4H-thieno[2,3-b]thiopyran-2- sulfonamide hydrobromide (0.20 g, 0.56 mmol) in 8 mL of a 3:1 ethanol:dimethyl sulfoxide solvent was added tert-butyl [(1S)-1-formyl-2-methylpropyl]carbamate (0.43 g, 2.2 mmol). Sodium cyanoborohydride (0.14 g, 2.2 mmol) was added and the entire mixture was stirred for 1 hour. The mixture was diluted with dichloromethane (70 mL), washed with brine (3X50 mL), dried over MgSO₄, filtered, and concentrated to dryness to provide the title compound in quantitative yield. This residue was used directly for the subsequent reaction as a mixture of diastereomers. LC/MS: (ES) 464 (M⁺+1 ). Preparation of (2S,9bR)-2-isopropyl-4-methyl-1 , 3,4,4a, 5,9b-hexahydro-2H- thieno[3',2':5,6] thiopyrano[3,4-b]pyrazine-8-sulfonamide (13, trans):

A flask was charged with tert-butyl ((1 S)-1-{[[2-(aminosulfonyl)-4-oxo-5,6-dihydro- 4H-thieno[2,3-b]thiopyran-5-yl](methyl)amino]methyl}-2-methylpropyl)carbamate (0.32 g, 0.70 mmol) and while stirring, 3.4 mL of 2.4:1 dichloromethane:trifluoroacetic acid was added. After stirring for 30 minutes, the mixture was added to a separate flask containing a suspension of sodium triacetoxyborohydride (5.2 g, 24 mmol) in tetrahydrofuran (25 mL). After stirring for 30 minutes, the reaction was quenched upon addition of 10 % HCI in methanol then concentrated to dryness. The residue was treated with 30 % methanol/ dichloromethane, sonicated, solids filtered, and the filtrate concentrated to dryness to provide the title compound in quantitative yield. This residue was used directly for the subsequent reaction as a mixture of diastereomers. LC/MS: (ES) 348 (M⁺+1 )

Preparation of (2S,4aS,9bR)-2-isopropyl-4-methyl-1 ,3,4,4a,5,9b-hexahydro-2H- thieno[3',2':5,6] thiopyrano[3,4-b]pyrazine-8-sulfonamide 6,6-dioxide (13, cis):

To a mixture of (2S,9bR)-2-isopropyl-4-methyl-1 ,3,4,4a,5,9b-hexahydro-2H- thieno[3',2':5,6] thiopyrano[3,4-b]pyrazine-8-sulfonamide (0.086 g, 0.25 mmol) in tetrahydrofuran (7.4 mL) and 2-methyl-2-propanol (0.82 mL) was added A- methylmorpholine N-oxide (0.12 g, 0.99 mmol). After stirring for 10 minutes, a 2.5 % solution of osmium tetraoxide in 2-methyl-2-propanol (0.78 mL, 0.062 mmol) was added. The entire mixture was stirred for 20 minutes, filtered through celite, and concentrated to dryness. The crude residue was purified by reverse phase HPLC to provide the title compound (17 mg, 18 %). ¹H-NMR (d₆-DMSO): δ 7.67 (s, 1 H), 4.13 (d, J = 13.6 Hz, 1 H), 3.68 (d, J = 8.3 Hz, 1 H), 3.49 (t, J = 12.9 Hz, 1 H), 3.07 - 3.12 (m, 2 H), 2.77 (d, J = 10.6 Hz, 1 H), 2.20 (s, 3 H), 1.72 - 1.80 (m, 1 H), 1.46 - 1.56 (m, 1 H), 0.91 (d, J = 6.6 Hz, 3 H), 0.82 (d, J = 6.8 Hz, 3 H).

(2S,4aR,9bR)-2-isopropyl-4-methyl-1 ,3,4,4a,5,9b-hexahydro-2Hthieno[3',2':5,6] thiopyrano[3,4-b]pyrazine-8-sulfonamide 6,6-dioxide

Title compound was isolated from crude reaction mixture described in the synthesis of (2S,4aS,9bR)-2-isopropyl-4-methyl-1 ,3,4,4a,5,9b-hexahydro-2H- thieno[3',2':5,6] thiopyrano[3,4-b]pyrazine-8-sulfonamide 6,6-dioxide by reverse phase HPLC (0.60 mg, 0.64 %). ¹H-NMR (d6-DMSO): δ 7.53 (s, 1 H), 3.93 - 3.98 (m, 1 H), 3.82 - 3.90 (m, 1 H), 3.52 - 3.58 (m, 1 H), 3.39 - 3.44 (m, 1 H), 3.24 - 3.29 (m, 1 H), 2.30 (s, 1 H), 1.86 - 1.95 (m, 1 H), 1.45 - 1.51 (m, 1 H), 0.85 (d, J = 6.8 Hz, 3 H), 0.78 (d, J = 6.8 Hz, 3 H)

Example 3: (2S,4aS,9bR)-2-ethyl-4-methyl-1 ,3,4,4a, 5,9b-hexahydro-2H- thieno[3',2':5,6] thiopyrano[3,4-b]pyrazine-8-sulfonamide 6,6-dioxide (16, trans)

tert-butyl ((1S)-1-{[[2-(aminosulfonyl)-4-oxo-5,6-dihydro-4H-thieno[2,3- b]thiopyran-5-yl](methyl)amino]methyl}propyl)carbamate (14):

To a solution of N-Boc protected 2S-aminobutanal in tetrahydrofuran (5.0 mL) and dimethylsulfoxide (500 μL) was added hydrogen bromide salt of the amino ketone Dimethylsulfoxide was added to the mixture and the slurry was sonicated prior to the addition of the reducing agent. After the sodium cyanoborohydride was added the mixture was allowed to stir for 12 h at 23⁰C. LC analysis showed complete consumption of the starting aminoketone. The mixture was diluted with ethyl acetate (20 mL) and washed with deionized water (1 x 10 mL). The organic layer was then dried (Na₂SO₄), filtered and concentrated in vacuo. The crude oil was purified by flash chromatography (0-50% EtOAc/CH₂CI₂) to provide the desired compound as a 1 :1 mixture of two diastereomers (154 mg, 64 %). LC/MS: (ES) 450.0 (M⁺+1 )

(2S,4aS,9bR)-2-ethyl-4-methyl-1 ,3,4,4a,5,9b-hexahydro-2H-thieno[3',2':5,6] thiopyrano[3,4-b]pyrazine-8-sulfonamide (15):

To solution of 1 :1 diastereomeric mixture of the ketone in dichloromethane under nitrogen was added trifluoroacetic acid in one portion. The solution was allowed to stir at 23⁰C for 1.5h at which point LC analysis showed complete consumption of the starting Boc-protected amino ketone. A slurry of triacetoxyborohydride in tetrahydrofuran was prepared and the deprotected amino ketone solution was added in one portion. The solution immediately turned homogeneous and after 1 h at 23⁰C LC analysis shows complete consumption of starting material. The excess reducing agent is quenched by slow addition of methanolic hydrogen chloride (2 N, 10 ml_). The solution was concentrated to dryness then redissolved in hydrochloric acid (0.1 N, 5 mL) and acetonitrile (2 mL). The mixture was filtered through a 0.45 micron PTFE filter and purified by reverse phase HPLC (3-33% MeCN(0.1% HOAc)/H₂O(0.1% HOAc)). The fractions were collected and the solvent was removed under reduced pressure to provide a white solid (22 mg, 19%). LC/MS: (ESI) 334.0 (M+H⁺).

(2S,4aS,9bR)-2-ethyl-4-methyl-1 ,3,4,4a,5,9b-hexahydro-2H-thieno[3',2':5,6] thiopyrano[3,4-b]pyrazine-8-sulfonamide 6,6-dioxide (16, trans)

To a solution of the starting sulfonamide (20.0 mg, 0.0600 mmol) in anhydrous t- butanol (500 μL) and tetrahydrofuran (4.0 mL) was added N-morpholino oxide (17.6 mg, 0.150 mmol) in one portion. To this solution was then added a solution of osmium tetraoxide in t-butanol (376 μL, 2.5M) in one portion. The solution immediately turned pale yellow. After 15 min at 23⁰C the reaction was complete by LCMS. The solution was concentrated in vacuo and then dissolved in hydrochloric acid (1 N, 2 mL), filtered through a 0.45 micron PTFE filter and purified by reverse phase prep HPLC (2-10% MeCN(0.1 % HOAc)/H₂O(0.1 % HOAc) over 30 min). The collected product was then concentrated in vacuo and redissolved in an 0.1 % acetic acid solution and lyophilized to give the acetate salt (0.66 equiv) of the desired product as a fluffy white powder (12.2 mg, 50 %). ¹H NMR (400 MHz, DMSO-d₆) D ppm 7.99 (br. s., 2 H) 7.75 (s, 1 H) 4.19 (d, J=13.39 Hz, 1 H) 3.70 - 3.82 (m, 1 H) 3.57 (t, J=12.76 Hz, 1 H) 2.82 (d, J=11.62 Hz, 1 H) 2.67 (s, 2 H) 2.33 (s, 1 H) 2.26 (s, 3 H) 1.76 (t, J=11.49 Hz, 1 H) 1.22 - 1.46 (m, 2 H) 0.93 (t, J=7.20 Hz, 1 H). LC/MS: (ESI) 366.0 (M+H⁺). Example 4: (4aS,5S,9bR)-5-methyl-1 ,2,3,4a,5,9b- hexahydrothieno[3',2':5,6]thiopyrano-

[3,4-b][1 ,4]oxazine-8-sulfonamide 6,6-dioxide (30):

(4aR,5S,9bS)-5-methyl-1 ,2,3,4a,5,9b- hexahydrothieno[3',2':5,6]thiopyrano-

[3,4-b][1 ,4]oxazine-8-sulfonamide 6,6-dioxide (31 ):

Preparation of (6S)-6-methyl-5,6-dihydro-4H-thieno[2,3-b]thiopyran-4-ol (22):

NaBH₄ (854 mg, 22.6 mmol) was added to a mixture of (6S)-6-methyl-5,6- dihydro-4H-thieno[2,3-b]thiopyran-4-one (3.2 g, 17.0 mmol) in EtOH (58 ml_). Heated to 80⁰C for 1 h. Cooled reaction mixture to RT and removed solvent under reduced pressure. H₂O was added to the residue followed by 6N HCI to bring the pH to - 8.

Mixture was extracted with EtOAc (3 x 100 ml_), washed combined organic layers with brine (100 ml_) and dried with Na₂SO₄, filtered, concentrated under reduced pressure and recrystallized with EtOAc/Hex to obtain 3 g of (6S)-6-methyl-5,6-dihydro-4H- thieno[2,3-b]thiopyran-4-ol (90% yield) as a white solid. ¹H NMR (CHLOROFORM-d): D

7.11 (d, J=5.31 Hz, 1 H) 7.07 (d, J=5.31 Hz, 1 H) 4.90 (dd, J=9.73, 5.94 Hz, 1 H) 3.54 -

3.68 (m, 1 H) 2.44 - 2.54 (m, 1 H) 1.87 - 2.00 (m, 1 H) 1.74 (s, 1 H) 1.43 (d, J=6.82 Hz, 3

H)

Preparation of (6S)-6-methyl-5,6-dihydro-4H-thieno[2,3-b]thiopyran-4-ol 7,7- dioxide (23):

To a solution of (6S)-6-methyl-5,6-dihydro-4H-thieno[2,3-b]thiopyran-4-ol (500 mg, 2.68 mmol) in MeOH (9 ml_), an oxone (2.47 g, 4.03 mmol) solution in H₂O (13 ml_) was added dropwise via an addition funnel. The reaction mixture was stirred for 1.5 h. MeOH was removed under reduced pressure. H₂O (50 ml_) was added to the mixture and extracted with EtOAc (3 x 50 ml_). The combined org. layers were washed with brine (75 ml_), dried with Na₂SO₄, filtered, and concentrated under reduced pressure. The residue was triturated with Et₂O, the white solid was isolated and 380 mg of (6S)-6- methyl-5,6-dihydro-4H-thieno[2,3-b]thiopyran-4-ol 7,7-dioxide (79% yield) was obtained. ¹H NMR (CHLOROFORM-d): D 7.60 (d, J=5.05 Hz, 1 H) 7.19 (d, J=5.05 Hz, 1 H) 4.92 (dd, J=10.11 , 5.56 Hz, 1 H) 3.39 - 3.54 (m, 1 H) 2.49 - 2.58 (m, 1 H) 2.35 - 2.49 (m, 1 H) 1.54 (d, J=6.82 Hz, 3 H). LS/MS: (ESI) 236.0 (M⁺+18) Preparation of (6S)-6-methyl-6H-thieno[2,3-b]thiopyran 7,7-dioxide (24):

(6S)-6-methyl-5,6-dihydro-4H-thieno[2,3-b]thiopyran-4-ol 7,7-dioxide (2.60 g, 11.9 mmol) was cooled to -10°c (brine and ice mixture), and cone. H₂SO₄ (26 ml_) was added and stirred for 3 h. The reaction mixture was added to an Erlenmeyer flask of ice, diluted with H₂O (50 ml_) and was extracted with CH₂CI2 (4 x 75 ml_). The combined organic layers were washed with brine (50 ml_), dried with Na₂SO₄, filtered and concentrated under reduced pressure. The crude residue was purified by chromatography using 25 to 50% EtOAc/Hex to obtained 2.08 g of (6S)-6-methyl-6H- thieno[2,3-b]thiopyran 7,7-dioxide (87 %) as a white solid. ¹H NMR (CHLOROFORM-d): D 7.60 (d, J=5.05 Hz, 1 H) 7.03 (d, J=5.05 Hz, 1 H) 6.71 (dd, J=10.23, 2.15 Hz, 1 H) 6.07 (dd, J=10.11 , 4.04 Hz, 1 H) 3.94 - 4.04 (m, 1 H) 1.61 (d, J=7.33 Hz, 3 H). LS/MS: (ESI) 217.9 (M⁺+18)

Preparation of (2S)-2-methyl-1 a,6b-dihydro-2H-thieno[3',2':5,6]thiopyrano[3,4- b]oxirene- 3,3-dioxide (25):

(6S)-6-methy!-6H-thieno[2,3-b]thiopyran 7,7-dioxide (1.00 g, 4.99 mmol) was dissolved in CH₂CI₂ (10 imL) and Sodium Phosphate buffer (pH 8, 3 mL) and cooled to O⁰C. MCPBA (1.90 g, 11.0 mmol) was added to the solution and stirred at 0⁰C for 1 h. The reaction mixture was warmed to RT and stirred for 2 days. EtOAc (75 m!_) was added to the mixture and washed with sat. Na₂SCb (50 ml_), saturated NaHCO₃ (50 ml_), and water (50 ml_), dried with Na₂SO₄, filtered and concentrated under reduced pressure. The residue was purified by column chromatography using 25 to 60% EtOAc/Hex to obtained 680 mg of 1.5:1 diastereomeric mixture of (2S)-2-methyl-1 a,6b- dihydro-2H-thieno[3',2':5,6]thiopyrano[3,4-b]oxirene 3,3-dioxide (63% yield, 1.5 : 1 mixture of diastereomers). ¹H NMR (CHLOROFORM-d): (1.5 : 1 mixture of diastereomers) D 7.68 (d, J=5.05 Hz, 1 H major) 7.66 (d, J=5.05 Hz, 1 H minor) 7.31 (d, J=4.80 Hz, 1 H major) 7.28 (d, J=5.05 Hz, 1 H minor) 4.10 - 4.14 (m, 2 H mixture) 3.88 - 3.91 (m, 2 H mixture) 3.77 - 3.84 (m, 1 H major) 3.67 - 3.74 (m, 1 H minor) 1.79 (d, J=7.07 Hz, 3 H minor) 1.47 (d, J=7.33 Hz, 3 H major). LS/MS: (ESI) 234.0 (M⁺+18)

Preparation of (6S)-4-azido-6-methyl-5,6-dihydro-4H-thieno[2,3-b]thiopyran-5-ol 7,7-dioxide (26):

To a solution of (2S)-2-methyl-1a,6b-dihydro-2H-thieno[3',2':5,6]thiopyrano[3,4- bjoxirene 3,3-dioxide (196 mg, 0.911 mmol) in EtOH (3 ml.) and H₂O (0.75 ml_), NaN₃ (71.1 mg, 1.09 mmol) and NH₄CI (68.2 mg, 1.28 mmol) were added. The reaction mixture was heated to 80⁰C for 2.5 h and then cooled to RT and stirred for 15 h. Ice water (10 ml_) was added to the reaction mixture and then extracted with EtoAc (3 x 10 ml_). Washed the combined organic layers with saturated NaHCO₃ (10 mL) and brine (10 mL), dried with Na₂SO₄, filtered and concentrated under reduced pressure to obtain 211 mg of (6S)-4-azido-6-methyl-5,6-dihydro-4H-thieno[2,3-b]thiopyran-5-ol 7,7-dioxide (89 % yield, 1 :1 mixture of diastereomers) as a white solid. ¹H NMR (CHLOROFORM- d): (1 :1 mixture of diastereomers) D 7.74 (d, J=5.05 Hz, 1 H) 7.68 (d, J=5.05 Hz, 1 H) 7.18 (d, J=5.05 Hz, 1 H) 7.16 (d, J=5.05 Hz, 1 H) 4.74 (d, J=5.56 Hz, 1 H) 4.57 (d, J=8.59 Hz, 1 H) 4.45 - 4.51 (m, J=1.01 Hz, 1 H) 4.29 (t, J=9.60 Hz, 1 H) 3.73 - 3.82 (m, 1 H) 3.46 - 3.57 (m, 1 H) 3.19 - 3.28 (m, 1 H) 2.97 - 3.04 (m, 1 H) 1.66 (d, J=6.82 Hz, 3 H) 1.62 (d, J=7.07 Hz, 2 H). LS/MS: (ESI) 277.0 (M⁺+18) Preparation of methyl {[(6S)-4-azido-6-methyl-7,7-dioxido-5,6-dihydro-4H- thieno[2,3-b]thiopyran-5-yl]oxy}acetate (27):

To a solution of (6S)-4-azido-6-methyl-5,6-dihydro-4H-thieno[2,3-b]thiopyran-5-ol 7,7-dioxide (210 mg, 0.0.810 mmol) in DMF (3 ml_), methyl bromoacetate (0.0893 mL, 0.972 mmol), and CsCO₃ (660 mg, 2.02 mmol) were added. The reaction mixture was stirred overnight. EtOAc (30 mL) was added to the mixture was washed with H₂O (3 x 25 mL), and brine (25 mL), dried over Na₂SO₄, filtered and concentrated under reduced pressure. The residue was purified by column chromatography using 15-30% EtOAc/Hexanes and obtained 268 mg of methyl {[(6S)-4-azido-6-methyl-7,7-dioxido-5,6- dihydro-4H-thieno[2,3-b]thiopyran-5-yl]oxy}acetate (89% yield, 1.3 : 1 mixture of diastereomers) as a clear oil. ¹H NMR (CHLOROFORM-d): (1.3 : 1 mixture of diastereomers)D 7.68 (d, J=5.05 Hz, 1 H, minor) 7.66 (d, J=5.05 Hz, 1 H, major) 7.15 - 7.19 (m, 2 H, mixture) 4.71 - 4.74 (m, 2 H, mixture) 4.23 - 4.61 (m, 6 H, mixture) 3.94 - 4.02 (m, 2 H, mixture) 3.83 (s, 3 H, minor) 3.81 (s, 3 H, major) 1.70 (d, J=6.82 Hz, 3 H, minor) 1.53 (d, J=7.33 Hz, 3 H, major). LS/MS: (ESI) 349.2 (M⁺+18)

Preparation of (5S)-5-methyl-1 ,4a,5,9b-tetrahydrothieno[3',2':5,6]thiopyrano[3,4- b][1 ,4]-oxazin2(3H)-one 6,6-dioxide (28):

Pd/C (degussa, 23 mg, 10% wt) was added to a solution of methyl {[(6S)-4-azido-

6-methyl-7,7-dioxido-5,6-dihydro-4H-thieno[2,3-b]thiopyran-5-yl]oxy}acetate in MeOH (8 mL). A H2 balloon was connected to the round bottom and the reaction mixture was stirred at RT 18 h. Filtered reaction mixture through a pad of Celite. Concentrated under reduced pressure and the residue was redissolved MeOH (7 mL). Na₂CO₃ (176 mg, 1.42 mmol) was added to the solution and then heated to 50⁰C for 4 h. The reaction mixture was diluted with water (20 ml_) and extracted with EtOAc (3 x 20 mL). The combined organic layers were washed with 0.1 NHCI (20 mL) and brine (20 mL), dried with Na₂SO₄, filtered and concentrated under reduced pressure. The residue was purified by column chromatography using 20 - 75% EtOAc/Hexanes to obtain 194 mg of (5S)-5-methyl-1 ,4a,5,9b-tetrahydrothieno[3\2':5,6]thiopyrano[3,4-b][1 ,4]oxazin-2(3H)- one 6,6-dioxide (56% yield, 1 :1 mixture of diastereomers) as a white solid. ¹H NMR (CHLOROFORM-d): (1 :1 mixture of diastereomers) D 7.76 (d, J=5.05 Hz, 1 H) 7.75 (d, J=5.05 Hz, 1 H) 7.67 (d, J=6.32 Hz, 2 H) 7.22 (d, J=2.02 Hz, 1 H) 7.21 (d, J=2.02 Hz, 1 H) 4.74 (dd, J=15.66, 9.09 Hz, 2 H) 4.58 (dd, J=9.22, 3.16 Hz, 1 H) 4.42 - 4.53 (m, 3 H) 4.31 - 4.41 (m, 1 H) 4.01 (dd, J=11.12, 8.84 Hz₁ 1 H) 3.79 - 3.87 (m, 1 H) 3.57 - 3.67 (m, 1 H) 1.66 (d, J=6.82 Hz, 3 H) 1.52 (d, J=7.33 Hz, 3 H)

Preparation of (5S)-5-methyl-2-oxo-1 ,2,3,4a,5,9b-hexahydrothieno[3',2':5,6]thio- pyrano[3,4-b][1 ,4]oxazine-8-sulfonamide 6,6-dioxide (29):

(5S)-5-methyl-1 ,4a,5,9b-tetrahydrothieno[3',2':5,6]thiopyrano[3,4-b][1 ,4]oxazin- 2(3H)-one 6,6-dioxide (108 mg, 0.395 mmol) was cooled to 0⁰C and chlorosulfonic acid (0.4 mL) was slowly added the to form a dark solution. The reaction mixture was heated to 50⁰C for 4 h. After cooling to RT, SOCI₂ (0.4 mL) was added to the solution and heated to 50⁰C for 1.5 h. The reaction mixture was cooled to 0⁰C, was slowly quenched with ice. Diluted the mixture with H₂O (10 mL) and extracted with DCM (3 x 10 mL). Washed combined organic layers with brine (10 mL) and dried with Na₂SO₄, filtered, concentrated under reduced pressure to obtain 114 mg of the sulfonyl chloride (78% yield). The intermediate was dissolved in THF (1 mL) and cooled to 0⁰C and ammonium hydroxide (0.102 mL, 1.53 mmol) was added and stirred for 1 h. The reaction mixture was warmed to RT followed by the addition of H₂O (2 mL). The crude mixture was concentrated under reduced pressure and pre-loaded onto silica gel and purified by column chromatography using 50 to 90% EtOAc/Hex. 77 mg of (5S)-5-methyl-2-oxo- 1 ,2,3,4a,5,9b-hexahydrothieno[3',2':5,6]-thiopyrano[3,4-b][1 ,4]oxazine-8-sulfonamide 6,6-dioxide (71% yield, 1 :1 mixture of diastereomers) was obtained as a white solid. ¹H NMR (de-DMSO): (1 :1 mixture of diastereomers) D 9.08 (d, J=15.66 Hz, 2 H) 8.11 - 8.20 (m, 4 H) 4.83 - 4.92 (m, 2 H) 4.48 (dd, J=9.22, 2.65 Hz, 1 H) 4.33 - 4.42 (m, 1 H) 4.22 - 4.33 (m, 3 H) 4.14 - 4.22 (m, 1 H) 4.08 - 4.14 (m, 2 H) 3.95 - 4.04 (m, 1 H) 1.44 (d, J=6.82 Hz, 3 H) 1.37 (d, J=7.33 Hz, 3 H). LS/MS: (ESI) 351.0 (M⁺)

Preparation of (4aS,5S,9bR)-5-methyl-1 , 2,3,4a, 5,9b- hexahydrothieno[3',2':5,6]thio-pyrano[3,4-b][1 ,4]oxazine-8-sulfonamide 6,6-dioxide (30):

11- (4aR,5S,9bS)-5-methyl-1 ,2,3,4a,5,9b- hexahydrothieno[3',2':5,6]thiopyrano[3,4-b][1 ,4]oxazine-8-sulfonamide 6,6-dioxide (31):

(5S)-5-methyl-2-oxo-1 ,2,3,4a,5,9b-hexahydrothieno[3',2':5,6]thiopyrano[3,4- b][1 ,4]oxazine-8-sulfonamide 6,6-dioxide (75.0 mg, 0.210 mmol) was cooled to 0°C and borane dimethyl sulfide solution (0.532 ml_, 2M in THF) was added (exotherm was observed). The reaction mixture was warmed to RT and stirred for 2 h. After completion, the mixture was cooled to O⁰C and cold 1 M H₂SO₄ (1.2 ml_) was slowly added (exotherm was observed). The reaction mixture was stirred overnight until the borane-amine complex was no longer observed by LC/MS. The mixture was neutralized using 1 N NaOH to pH 7, extracted with EtOAc (3 x 8 ml_). The combined organic layers were washed with brine (5 ml_), dried over Na₂SO₄, filtered, and concentrated under reduced pressure. The crude residue was purified by column chromatography using 75- 100% EtOAc/Hexanes and obtained a 46 mg of the amine (64% yield, 1 : 1 mixture of diastereomers). The diastereomers were separated by supercritical fluid chiral chromatography using Chiralpak AD-H 4.6 x 250mm 5μ column, 40% MeOH at 140 bar, 2.5 mL/min and obtained 14 mg of (4aS,5S,9bR)-5-methyl-1 ,2,3,4a,5,9b- hexahydrothieno[3',2':5,6]thiopyrano[3,4-b][1 ,4]oxazine-8-sulfonamide 6,6-dioxide and 23 mg of (4aR,5S,9bS)-5-methyl-1 ,2,3,4a,5,9b-hexahydrothieno[3',2':5,6]thiopyrano[3,4- b][1 ,4]oxazine-8-sulfonamide 6,6-dioxide.

(4aS,5S,9bR)-5-methyl-1 ,2,3,4a,5,9b-hexahydrothieno[3',2':5,6]thiopyrano[3,4- b][1 ,4]oxazine-8-sulfonamide 6,6-dioxide (30): ¹H NMR (ACETONITRILE-d₃): D 7.74 (s, 1 H) 6.25 (S, 2 H) 4.26 (dd, J=9.35, 3.03 Hz, 1 H) 3.87 - 4.00 (m, 2 H) 3.67 - 3.81 (m, 2 H) 2.97 - 3.15 (m, 2 H) 1.41 (d, J=7.07 Hz, 3 H). LS/MS: (ESI) 339.0 (M⁺+H)

(4aR,5S,9bS)-5-methyl-1 ,2,3,4a,5,9b-hexahydrothieno[3',2':5,6]thiopyrano[3,4- b][1 ,4]oxazine-8-sulfonamide 6,6-dioxide (31 ): ¹H NMR (ACETONITRILE-dD DD 7.70 (s, 1 H) 6.23 (s, 2 H) 3.95 (dd, J=1 1.37, 2.02 Hz, 1 H) 3.84 (dd, J=5.81 , 1.01 Hz, 1 H) 3.58 - 3.77 (m, 3 H) 2.93 - 3.14 (m, 2 H) 1.46 (d, J=6.06 Hz, 3 H). LS/MS: (ESI) 339.0 (M⁺+H) Carbonic Anhydrase - Il (CA-II) Fluorimetric Assay-ICso Determination

Compounds were diluted in DMSO at the concentration of 1mM, then 50 μM and transferred to a 96-well plate for further dilutions (1 :3 dilution, 11 points) in duplicate. Highest final concentration of compound in this CA-II Fluorimetric assay is 1 μM. Assays were conducted in a final volume of 100 μl_ in 50 mM Tris/HCI (pH 7.6), 10OmM Na₂SO₄ and 0.005% Tween-20 in a 96-well black assay plate. Fluorescein diacetate was used as the substrate. Enzyme inhibition was determined by pipetting 8 μl_ of human CA-II (5nM, from Sigma-Aldrich, product # : C6165) into assay plate contained 2 μl_ of compound and 2 μl_ of substrate (10 μM) in 88 μl_ of assay buffer. The rate of the hydrolysis of fluorescein diacetate were measured spectrophotometrically at 488 nm (excitation), 538 nm (emission) and 530 nm (cutoff) using a Molecular Devices SpectraMax M2 fluorescence reader at 25°C. The IC₅₀, the inhibitor concentration resulting Jn 50% inhibition of the enzyme activity, was calculated using GraphPad Prism or similar in-house software with the IC₅₀ curve fitting using the four parameter logistic equation.

Carbonic Anhydrase - Il (CA-II) Fluorescence Polarization Tight Binding Assay K_d Determination for compounds with IC₅₀ < 2.5nM

Compounds were diluted in DMSO at the concentration of 1 mM, 50 μM then to 0.5 μM and transferred to a 96-well plate for further dilutions (1 :1.353 dilution, 11 points) in quadruple. Final compound highest concentration in CA-II K_d FP Tight Binding Assay is 0.01 μM. Assays were conducted in a final volume of 100 μl_ in 5OmM Tris/HCI (pH 7.6), 100 mM Na2SO4 and 0.005% Tween-20 in a 96-well black assay plate. Dye conjugate BODIPY®558/568-Acetazolamide (Invitrogen Corp.) was used as the tracer. Binding inhibition was determined by pipetting 8 μl_ of human CA-II (1.5 nM) into assay plate contained 2 μl_ of compound and 2 μL of tracer (2 nM) in 88 μL of assay buffer. The assay plate was incubated at room temperature for 1 hour and read in the fluorescence polarization reader (Molecular Devices, Analyst) at 524/45 nm (excitation), 595/60 nm (emission) and 561 nm (beam splitter). The K_d (i.e., dissociation constant) binding was calculated using GraphPad Prism and Morrison tight binding ligand equation.

Carbonic Anhydrase-IV (CA-IV) Fluorescence Polarization Assay-ICso Determination

Human CAIV was amplified from a human kidney cDNA library (Clonetech) using primers: 5'-ggaattccatatggcagagtcacactggtgctacgag and

5'-ccgctcgagttactaggactttatcaccgtgcgctgccc, with KOD Polymerase (Novagen). The PCR amplified product was cloned into a Ndel/ Xhol cut pET-43.1a(+) (Novagen) and transformed into Escherichia coli BL21 (DE3) (Invitrogen) cells. These cells were grown in Luria broth (LB) media (Biomyx) supplemented with 800 uM ZnCI₂ at 37⁰C until an O. D.600 of 0.7, at which point the cells were induced with 10OuM isopropyl-beta-D- thiogalactopyranoside (IPTG) for 20 hours at 20⁰C. The frozen pellet was resuspended in 50 mM 2-morpholinoethanesulfonic acid (MES) at pH 6.0, 100 mM NaCI, 800 μM ZnCI₂ and EDTA-Free protease inhibitors (Roche). The cells were lysed with a microfluidizer, the lysate was spun at 40,000 rpm for 45 minutes at 4°C, and the soluble fraction was dialyzed overnight at 4°C in 50 mM MES pH 6.0, and 100 mM NaCI. The soluble fraction was then put over a 100 mL SP-Sepharose High Performance (GE Healthcare) column and eluted with a 50 mM MES pH 6.0, 750 mM NaCI gradient. The peak fractions were then concentrated, via an Amicon Ultra-4 10,000 MWCO (Millipore) spin column to 2.0 mL and loaded onto a Sephacryl S-100 High Resolution (GE Healthcare) column in 25 mM tris(hydroxymethyl)aminomethane hydrochloride (Tris- HCI) pH 7.0, and 100 mM NaCI. The peak fractions were then concentrated, via an Amicon Ultra-4 10,000 MWCO (Millipore) spin column, to 7.0 mg/mL and left exposed at room temperature overnight. Fully-oxidized protein was characterized by performing an Ellman's Assay, utilizing Pierce reagents, and non-reducing SDS-PAGE. The specific activity was confirmed with literature inhibitors (IC₅₀ for acetazolamide (120 nM), ethoxzolamide (88 nM), dorzolamide (43 nM) and brinzolamide (45 nM); as reported in Innocenti, A.; et al, Bioorg. Med. Chem. Lett. 2005, 15, 1149-1 154 and Supuran, C.T.; et al. Carbonic Anhydrase Inhibitors. Med. Res. Rev. 2003, 23, 146-189).

Carbonic Anhydrase - IX (CA-IX) Fluorescence Polarization Assay - IC₅₀ Determination

Compounds were diluted in DMSO at the concentration of 1 mM, then to 250 μM and transferred to a 96-well plate for further dilutions (1 :3 dilution, 11 points) in duplicate. Final compound highest concentration in CA-IV FP assay is 5 μM. Assays were conducted in a final volume of 100 μl_ in 50 mM Tris/HCI (pH 7.6), 100 mM Na₂SO₄ and 0.005% Tween-20 in a 96-well black assay plate. BODIPY®558/568-Acetazolamide was used as the tracer. Binding inhibition was determined by pipetting 8 μl_ of human CA-IV (25 nM) into assay plate contained 2 μl_ of compound and 2 μl_ of tracer (2 nM) in 88 μl_ of assay buffer. The assay plate was incubated at room temperature for 30 minutes and read in the fluorescence polarization reader (Molecular Devices, Analyst) at 524/45 nm (excitation), 595/60 nm (emission) and 561 nm (beam splitter). The IC₅₀, was calculated using GraphPad Prism or similar in-house software with the IC₅₀ curve fitting using the four parameter logistic equation.

Carbonic Anhydrase - IX (CA-IX) Fluorescence Polarization Assay-IC₅₀ Determination

Compounds were diluted in DMSO at the concentration of 1 mM, then 50 μM and transferred to a 96-well plate for further dilutions (1 :3 dilution, 11 points) in duplicate. Final compound highest concentration in CA-IX FP assay is 1 μM. Assays were conducted in a final volume of 100 μl_ in 50 mM Tris/HCI (pH 7.6), 100 mM Na₂SO₄ and 0.005% Tween-20 in a 96-well black assay plate. BODIPY®558/568-Acetazolamide was used as the tracer. Binding inhibition was determined by pipetting 8 μL of human CA-IX (8 nM, R&D Systems Inc. Cat# 2188-CA-010) into assay plate contained 2 μL of compound and 2 μl_ of tracer (2 nM) in 88 μL of assay buffer. The assay plate was incubated at room temperature for 30 minutes and read in the fluorescence polarization reader (Molecular Devices, Analyst) at 524/45 nm (excitation), 595/60 nm (emission) and 561 nm (bean splitter). The IC₅₀ was calculated using GraphPad Prism or similar in-house software with the IC₅₀ curve fitting using the four parameter logistic equation.

Carbonic Anhydrase - XII (CA-XII) Fluorimetric Assay— IC₅₀ Determination

Human CAXII was amplified from a human kidney cDNA library (Clonetech) using primers: 5'-ggaattccatatgaagtggacttattttggtcctgat and 5'- cccaagcttttactaggagaaggaggtgtataccagcct, with KOD Polymerase (Novagen). The PCR amplified product was cloned into a Ndel/ Hindlll cut pET-43.1a(+) and transformed into Escherichia coli AD494 (DE3) (Novagen) cells. The cells were grown in LB (Biomyx) supplemented with 800 μM ZnCI₂ at 37°C until an O. D.600 of 0.7, at which point the cells were induced with 100 μM IPTG for 20 hours at 20°C. The frozen pellet was resuspended in 50 mM MES pH 6.0, 10OmM NaCI, 800 μM ZnCI₂ and EDTA-Free protease inhibitors (Roche). The cells were lysed with a microfluidizer, and the lysate was spun at 40,000rpm for 45 minutes at 4°C. The soluble fraction was then put over a 100 mL SP-Sepharose High Performance (GE Healthcare) column and eluted with a 50 mM MES pH 6.0, 750 mM NaCI gradient. The peak fractions were then dialyzed overnight in 10 mM ThS-SO₄ pH 7.3, concentrated, via an Amicon Ultra-4 10,000 MWCO (Millipore) spin column, to 7.0 mg/rπL and characterized by non-reducing SDS- PAGE. The specific activity was confirmed with literature inhibitors (IC₅₀ for acetazolamide (42 nM), ethoxzolamide (17 nM), dorzolamide (14 nM) and brinzolamide (17 nM), as reported in VuIIo, D.; et al. Bioorg. Med. Chem. Lett. 2005, 15, 963-969).

Compounds were diluted in DMSO at the concentration of 1 mM, then 50 μM and transferred to a 96-well plate for further dilutions (1 :3 dilution, 11 points) in duplicate. Final compound highest concentration in CA-XII Fluorimetric assay is 1 μM. Assays were conducted in a final volume of 100 μL in 50 mM Tris/HCI (pH 7.6), 100 mM Na₂SO₄ and 0.005% Tween-20 in a 96-well black assay plate. Fluorescein diacetate was used as the substrate. Enzyme inhibition was determined by pipetting 8 μL of human CA-XII (5OnM) into assay plate contained 2 μL of compound and 2 μL of substrate (10 μM) in 88 μL of assay buffer. The rate of the hydrolysis of fluorescein diacetate were measured spectrophotometrically at 488 nm (excitation), 538 nm (emission) and 530 nm (cutoff) using a Molecular Devices SpectraMax M2 fluorescence reader at 25°C. The IC₅₀ was calculated using GraphPad Prism or similar in-house software with the IC₅₀ curve fitting using the four parameter logistic equation.

While the invention has been illustrated by reference to specific and preferred embodiments, those skilled in the art will recognize that variations and modifications may be made through routine experimentation and practice of the invention. Thus, the invention is intended not to be limited by the foregoing description, but to be defined by the appended claims and their equivalents.

Claims

We Claim:

1. A compound of formula I:

wherein:

X is O or NR⁴;

R¹ and R² are each independently H or (Ci-C₆)alkyl;

R³ is H, (CrCβ)alkyl; (Ci-C₆)alkyl-NHC(=NH)NH₂, (Ci-C₆)alkyl-C(=O)NH₂, (C₁- C₆)alkyl-C(=O)OH, (Ci-C₆)alkyl-SH, (CrC₆)alkyl-C(=O)NH₂, (C_rC₆)alkyl-imidazolyl, (C₁- C₆)alkyl-NH₂, (C₁-C₆JaIk^-S-CH₃, (C_rC₆)alkyl (C₆-C₁₀)aryl, (C_rC₆)alkyl-OH, (C_rC₆)alkyl indolyl or (d-CeJalkyl (C₆-C₁₀)aryl-OH; and

R⁴ is H or (C_rC₆)alkyl; or a pharmaceutically acceptable salt or solvate thereof.

2. A compound selected from the group consisting of:

or a pharmaceutically acceptable salt or solvate thereof.

3. A compound selected from the group consisting of:

or a pharmaceutically acceptable salt or solvate thereof.

4. A compound according to any one of claims 1 to 3 for use as a medicament.

5. The use of a compound according to any one of claims 1 to 3 for the preparation of a medicament for treating glaucoma or ocular hypertension.

6. A pharmaceutical composition comprising a pharmaceutically acceptable carrier and a pharmaceutically effective amount of a compound according to any one of claims

1 to 3.

7 A pharmaceutical composition according to claim 6 in a suitable form for topical administration.

8. A pharmaceutical composition according to claim 6 for the treatment of glaucoma and ocular hypertension.

9. A pharmaceutical composition according to claim 6, wherein the compound of formula I is administered as a solution, suspension or emulsion in an ophthalmically acceptable vehicle.

10. A method for treating glaucoma or ocular hypertension, wherein the method comprises contacting an effective intraocular pressure reducing amount of a pharmaceutical composition according to claim 6, with the eye in order to reduce eye pressure and to maintain the pressure at a reduced level.

11. A method for treating eye disorders in a patient in need thereof comprising administering a therapeutically effective amount of a carbonic anhydrase inhibitor according to any one of claims 1 to 3 able to release nitric oxide.

12. A method according to claim 11 wherein said eye disorder is selected from glaucoma, ocular hypertension, age-related macular degeneration, diabetic macular edema, diabetic retinopathy, hypertensive retinopathy and retinal vasculopathies.

13. A method according to claim 11 wherein said carbonic anhydrase inhibitor is a compound having an inhibition constant (K₁) against the isoenzyme CAN in the range of

0.01 to 20O nM.

14. A method according to claim 11 wherein said carbonic anhydrase inhibitor able to release nitric oxide is a compound having an EC₅₀ value in the range of 1 to 50 μM.

15. A method for the treatment of glaucoma, ocular hypertension, age-related macular degeneration, diabetic macular edema, diabetic retinopathy, hypertensive retinopathy and retinal vasculopathies comprising administering a compound according to claim 1.

16. A method for the treatment of glaucoma, ocular hypertension, age-related macular degeneration, diabetic macular edema, diabetic retinopathy, hypertensive retinopathy and retinal vasculopathies comprising administering a pharmaceutical composition according to any one of claims 6 to 9.