WO2008070927A1 - Multimeric fc receptor polypeptides including a modified fc domain - Google Patents
Multimeric fc receptor polypeptides including a modified fc domain Download PDFInfo
- Publication number
- WO2008070927A1 WO2008070927A1 PCT/AU2007/001934 AU2007001934W WO2008070927A1 WO 2008070927 A1 WO2008070927 A1 WO 2008070927A1 AU 2007001934 W AU2007001934 W AU 2007001934W WO 2008070927 A1 WO2008070927 A1 WO 2008070927A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- rsfcγriia
- protein
- dimer
- binding
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P13/00—Drugs for disorders of the urinary system
- A61P13/12—Drugs for disorders of the urinary system of the kidneys
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
- A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/06—Immunosuppressants, e.g. drugs for graft rejection
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
- A61P7/02—Antithrombotic agents; Anticoagulants; Platelet aggregation inhibitors
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
- A61P7/04—Antihaemorrhagics; Procoagulants; Haemostatic agents; Antifibrinolytic agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/70503—Immunoglobulin superfamily
- C07K14/70535—Fc-receptors, e.g. CD16, CD32, CD64 (CD2314/705F)
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
- C07K7/04—Linear peptides containing only normal peptide links
- C07K7/06—Linear peptides containing only normal peptide links having 5 to 11 amino acids
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/52—Constant or Fc region; Isotype
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/30—Non-immunoglobulin-derived peptide or protein having an immunoglobulin constant or Fc region, or a fragment thereof, attached thereto
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/35—Fusion polypeptide containing a fusion for enhanced stability/folding during expression, e.g. fusions with chaperones or thioredoxin
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/70—Fusion polypeptide containing domain for protein-protein interaction
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/70—Fusion polypeptide containing domain for protein-protein interaction
- C07K2319/74—Fusion polypeptide containing domain for protein-protein interaction containing a fusion for binding to a cell surface receptor
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y10—TECHNICAL SUBJECTS COVERED BY FORMER USPC
- Y10S—TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y10S530/00—Chemistry: natural resins or derivatives; peptides or proteins; lignins or reaction products thereof
- Y10S530/868—Chemistry: natural resins or derivatives; peptides or proteins; lignins or reaction products thereof involving autoimmunity, allergy, immediate hypersensitivity, delayed hypersensitivity, immunosuppression, or immunotolerance
Definitions
- the present invention relates to a soluble multimeric Fc receptor polypeptide and protein able to inhibit leukocyte Fc ⁇ receptors (Fc ⁇ R) and immunoglobulin G (IgG) interactions.
- Fc ⁇ R leukocyte Fc ⁇ receptors
- IgG immunoglobulin G
- Such a polypeptide and protein is useful in the treatment of inflammatory diseases, particularly immune complex-mediated inflammatory diseases such as rheumatoid arthritis (RA), immune thrombocytopenic purpura (ITP) and systemic lupus erythematosus (SLE).
- RA autoimmune and other inflammatory diseases
- SLE SLE
- TNF ⁇ tumour necrosis factor- ⁇
- IL-I ⁇ interleukin l ⁇
- MAb monoclonal antibody
- Fc receptors play pivotal roles in immunoglobulin-based effector systems
- inhibition of FcR function may provide the basis of effective therapy for a variety of diseases.
- Fc ⁇ receptors are pivotal to effector systems for IgG
- targeting the interaction between leukocyte Fc ⁇ Rs and antibodies provides a new opportunity for therapeutic intervention in RA (Nabbe et ah, 2003).
- One approach of achieving such an intervention which is of interest to the present applicant is the use of a soluble form of an Fc ⁇ R to act as a "decoy" to prevent leukocyte activation by antibodies.
- Fc receptors are leukocyte surface glycoproteins that specifically bind the Fc portion of antibodies.
- the receptors for IgG, that is Fc ⁇ R are the most widespread and diverse, the major types being Fc ⁇ RI (CD64), Fc ⁇ RII (CD32) and Fc ⁇ RIII (CDl 6).
- Immune complexes (IC) that are formed in vivo in normal immune responses, and those seen in the pathology of autoimmune diseases such as RA, can simultaneously engage many FcR.
- activated macrophages, neutrophils, eosinophils and mast cells can express Fc ⁇ RI, Fc ⁇ RIIa, Fc ⁇ RIIb and Fc ⁇ RIII (Takai, 2002).
- the Fc ⁇ RIIa is the major initiator of IC-mediated inflammation and, while all of the Fc ⁇ R types engage the lower hinge region of the IgG Fc domain and the CH2 domains such that any soluble Fc ⁇ R decoy polypeptide might inhibit the binding of IgG to all classes of Fc ⁇ R, the present applicant has realised that since Fc ⁇ RIIa shows the widest binding specificity and highest selectivity for avid IgG immune complex binding, the development and investigation of a soluble Fc ⁇ RIIa offers the greatest potential.
- rsFc ⁇ RIIa monomer a simple recombinant soluble Fc ⁇ RIIa polypeptide (rsFc ⁇ RIIa monomer), consisting of Fc ⁇ RIIa ectodomains (Ierino et ah, 1993a), is clearly able to inhibit IC-mediated inflammation.
- the rsFc ⁇ RIIa was tested using the Arthus reaction, wherein immune complexes are formed in the dermis by the passive administration of antibody and antigen (Pflum et al., 1979), which is a model of vasculitis (an extra articular complication in arthritis) and also occurs in SLE.
- the present applicant proposes to use multimeric forms of the rsFc ⁇ RIIa decoy, and has since found, surprisingly, that not only could such multimeric forms be successfully expressed, they exhibit increased selectivity for immune complexes.
- Such multimeric rsFc ⁇ RIIa polypeptides therefore show considerable promise for the treatment of IC- mediated inflammatory disease such as RA and SLE.
- the present invention provides a soluble multimeric polypeptide able to inhibit interaction of leukocyte Fc ⁇ receptors (Fc ⁇ R) and immunoglobulin G (IgG), said polypeptide comprising two or more Fc binding regions linked in a head to tail arrangement, at least one of which is derived from an Fc ⁇ R type receptor, and an Fc domain of an immunoglobulin which has been modified to reduce or prevent binding to said Fc binding regions and/ or to alter effector function.
- Fc ⁇ R leukocyte Fc ⁇ receptors
- IgG immunoglobulin G
- the polypeptide is a multimer of an Fc binding region derived from an Fc ⁇ RII type receptor, particularly Fc ⁇ RIIa.
- an Fc ⁇ RII type receptor particularly Fc ⁇ RIIa.
- Such a molecule may be considered to be a homomultimer, and one especially preferred molecule of this kind is a homodimer of an Fc binding region derived from an Fc ⁇ RII type receptor.
- the present invention also contemplates that the molecule may be a multimer of an Fc binding region derived from an Fc ⁇ R type receptor (e.g. an Fc ⁇ RII type receptor) and an Fc binding region from another source (e.g. an Fc binding region from another Fc receptor type or a synthetic Fc binding polypeptide).
- a molecule of this kind may be considered to be a heteromultimer, and one especially preferred molecule of this kind is a heterodimer of an Fc binding region derived from an Fc ⁇ RII type receptor and an Fc binding region derived from an Fc ⁇ RIII type receptor.
- the Fc binding regions may be linked through a peptide bond or via a short linker sequence (e.g. a single amino acid or a short peptide of, for example, 2 to 20 amino acids in length).
- a short linker sequence e.g. a single amino acid or a short peptide of, for example, 2 to 20 amino acids in length.
- the present invention provides a soluble multimeric protein comprising a polypeptide according to the first aspect.
- the present invention provides a polynucleotide molecule comprising a nucleotide sequence encoding a polypeptide according to the first aspect or a protein according to the second aspect.
- the polynucleotide molecule may consist in an expression cassette or expression vector (e.g. a plasmid for introduction into a bacterial host cell, or a viral vector such as a baculovirus vector for transfection of an insect host cell, or a plasmid or viral vector such as a lentivirus for transfection of a mammalian host cell).
- an expression cassette or expression vector e.g. a plasmid for introduction into a bacterial host cell, or a viral vector such as a baculovirus vector for transfection of an insect host cell, or a plasmid or viral vector such as a lentivirus for transfection of a mammalian host cell.
- the present invention provides a recombinant host cell comprising a polynucleotide molecule according to the third aspect.
- the present invention provides a method for producing a polypeptide or protein, the method comprising the steps of;
- the present invention provides a method of treating a subject for an inflammatory disease, said method comprising administering to said subject a polypeptide according to the first aspect or a protein according to the second aspect, optionally in combination with a pharmaceutically- or veterinary- acceptable carrier or excipient.
- Figure 1 provides the nucleotide sequence (and translated amino acid sequence) for a head to tail homodimer construct of two Fc ⁇ RIIa extracellular regions each comprising both Fc ⁇ RIIa ectodomains, namely ectodomains 1 and 2.
- the Fc ⁇ RIIa ectodomains 1 and 2 consist of amino acids 1 to 174 of the Fc ⁇ RIIa polypeptide sequence with amino acids 1 to 88 comprising domain 1 and amino acids 89 to 174 comprising domain 2 (Hibbs et ah, 1988; Homo sapiens Fc fragment of IgG, low affinity Ha receptor (CD32) (FCGR2A), mRNA, ACCESSION NM_021642; and Powell et al., 1999).
- amino acids 1 to 182 are derived from the extracellular region of Fc ⁇ RIIa, of which amino acids 1 to 174 comprise the
- Fc ⁇ RIIa ectodomains 1 and 2 and amino acids 175 to 182 comprise the membrane proximal stalk (which in Fc ⁇ RIIa links the ectodomains 1 and 2 to the transmembrane sequence).
- the first of the Fc ⁇ RIIa extracellular regions comprising the dimer therefore consists of amino acids 1 to 182 and the second of the Fc ⁇ RIIa extracellular regions consists of amino acids 184 to 362
- Figure 2 shows a Western Blot analysis of recombinant soluble (rs) multimeric forms of Fc ⁇ RIIa expressed from the nucleotide sequence shown in Figure 1.
- the rsFc ⁇ RIIa dimer was substantially stable with only a small amount of rsFc ⁇ RIIa monomer breakdown product evident.
- the rsFc ⁇ RIIa trimer and tetramer forms were unstable, being substantially degraded to the rsFc ⁇ RIIa dimer form. This degradation may be avoided by the use of protease inhibitors during production or by otherwise modifying the sequence of the multimer forms so as to remove cleavage site(s).
- Figure 3 shows a Coomassie-stained SDS-PAGE (12% acrylamide gel, under non- reducing conditions) of fractions collected from the purification of rsFc ⁇ RIIa monomer (expressed from mammalian cells) having the expected size of -30 IcDa (a), and rsFc ⁇ RIIa dimer having the expected size of -50 kDa (b).
- Figure 4 graphically shows the equilibrium binding responses of rsFc ⁇ RIIa monomer to immobilised (a) IgG monomer (Sandoglobulin) and (b) the model immune complex, heat-aggregated IgG (HAGG).
- Figure 5 graphically shows the equilibrium binding responses of rsFc ⁇ RIIa dimer to immobilised (a) IgG monomer (Sandoglobulin) and (b) the model immune complex, HAGG.
- Figure 6 provides a plot of rsFc ⁇ RIIa monomer (a) and rsFc ⁇ RIIa dimer expressed from the nucleotide sequence of Figure 1 (b) binding to immobilised human IgG monomer (Sandoglobulin) following prior reaction in solution with human IgG monomer (Sandoglobulin) and dimer-IgG (Wright et al., 1980), as determined using a standard BIAcore assay protocol.
- Figure 7 provides plots of (a) the inhibition of dimer-IgG (Wright et ah, 1980) binding to human neutrophils (volunteer V5) by purified rsFc ⁇ RIIa monomer and rsFc ⁇ RIIa dimer calculated as a percentage of the uninhibited dimer-IgG binding activity and (b) the inhibition of dimer-IgG binding to human neutrophils (volunteer Vl) by purified rsFc ⁇ RIIa dimer (expressed from the nucleotide sequence of Figure 1) calculated as a percentage of dimer-IgG binding dimer.
- Figure 8 provides at (a), a plot of immune-complex (dimer-IgG) stimulated TNF secretion from 24 hour differentiated human MDMs (volunteer V5) in the absence and presence of rsFc ⁇ RIIa dimer (in supernatant at 2.5 ⁇ g/ml); while at (b), provides a plot of immune-complex (dimer-IgG) stimulated TNF secretion from 24 hour differentiated human MDMs (volunteer Vl), in the absence and presence of rsFc ⁇ RIIa dimer (2.5 ⁇ g/ml).
- Figure 9 provides a plot of immune-complex (HAGG) stimulated activation of human platelets, as measured by the mean fluorescence intensity (MFI) of P- selectin expression in the absence and presence of rsFc ⁇ RIIa dimer (30 ⁇ g/ml).
- MFI mean fluorescence intensity
- Figure 10 provides results from the analysis of the rsFc ⁇ RIIa dimer isolated from stably transfected CHO-S cells by SDS-PAGE under (a) non-reducing and (b) reducing conditions, (c) Western blotting using an anti-Fc ⁇ RIIa antibody, and (d) HPLC.
- the rsFc ⁇ RIIa dimer migrates as a single band at the expected molecular weight ( ⁇ 50 kD), reacts with anti-Fc ⁇ RIIa antibody and was >96% pure as determined by HPLC analysis.
- Figure 11 provides a plot of immune-complex (HAGG) binding to cell surface- expressed human Fc ⁇ RIIb (on the murine B lymphoma cell line IIA1.6) in the presence of either rsFc ⁇ RIIa monomer or rsFc ⁇ RIIa dimer.
- Figure 12 provides a plot of activated platelets (positive for both CD41 and CD62P) after treatment with HAGG in the presence of rsFc ⁇ RIIa monomer or rsFc ⁇ RIIa dimer (expressed from the nucleotide sequence of Figure 1), as a percentage of activated platelets following treatment with HAGG alone.
- Figure 13 provides a plot of TNF- ⁇ release from MC/ 9 cells after incubation with OVA immune complexes in the presence of rsFc ⁇ RIIa monomer or rsFc ⁇ RIIa dimer, as a percentage of TNF- ⁇ released in the presence of OVA immune complexes alone.
- Figure 14 shows Western blot analysis of rsFc ⁇ RIIa fusion proteins.
- HSA human serum albumin
- Figure 15 provides the results of a HAGG-capture ELISA with rsFc ⁇ RIIa monomer and rsFc ⁇ RIIa dimer fusions,
- Fc ⁇ RIIa monomer standard Panet ah, 1999
- protein from cells transfected with rsFc ⁇ RIIa monomer construct transfection 426 (monomer)
- protein from cells transfected with rsFc ⁇ RIIa monomer fusion to IgG-Fc ⁇ l (L234A, L235A) construct (monomer-Fc)
- protein from cells transfected with rsFc ⁇ RIIa monomer fusion to HSA construct HSA construct
- rsFc ⁇ RIIa dimer standard starting at 0.5 ⁇ g/ml (dimer std); supernatant from cells transfected with rsFc ⁇ RIIa dimer
- Figure 16 provides results obtained from a CAPTURE-TAG ELISA on rsFc ⁇ RIIa monomer and rsFc ⁇ RIIa dimer fusion proteins to confirm the presence of epitopes that establish that the receptor is properly folded.
- A rsFc ⁇ RIIa monomer standard starting at 0.75 ⁇ g/ml (monomer std); supernatant from cells transfected with rsFc ⁇ RIIa monomer (transfection 426 (monomer)); supernatant from cells transfected with rsFc ⁇ RIIa monomer fusion to IgG-Fc ⁇ l (L234A, L235 A) (monomer-Fc); and supernatant from cells transfected with rsFc ⁇ RIIa monomer fusion to HSA (HSA-monomer);
- B rsFc ⁇ RIIa dimer standard ( prepared in-house) starting at 0.5 ⁇ g/ml); supernatant from cells transfected
- Figure 17 provides a schematic diagram of (a) rsFc ⁇ RIIa monomer; (b) rsFc ⁇ RIIa dimer; (c) a dimer of a rsFc ⁇ RIIa monomer fusion to IgG-Fc ⁇ l (L234A, L235A), wherein the dimerisation is effected through the Fc domains of the rsFc ⁇ RIIa monomer fusion polypeptides, providing a molecule having two Fc binding regions (i.e.
- a protein that is dimeric for the Fc binding region or, otherwise, has a "valency of two” a dimer of rsFc ⁇ RIIa dimer fusion to IgG-Fc ⁇ l (L234A, L235A), wherein dimerisation is effected through the two Fc domains of the rsFc ⁇ RIIa dimer fusion polypeptides, providing a molecule having four Fc binding regions (i.e. a protein that is tetrameric for the Fc binding region or, otherwise, has a "valency of four"); (e) rsFc ⁇ RIIa monomer fusion to HSA; and (f) rsFc ⁇ RIIa dimer fusion to HSA.
- Dl and D2 refers to, respectively, ectodomains 1 and 2, the solid bar shown adjacent to D2 represents a linker sequence, the dark loop at the top of the dimerised Fc domains in (c) and (d) represents disulphide linkages, and He refers to a His tag);
- Figure 18 shows the effect of the rsFc ⁇ RIIa dimer (with no fusion partner) in a mouse model of arthritis. Mice treated with arthritogenic anti-collagen antibody in the absence (black square) and presence of the Fc ⁇ RIIa dimer (white diamond);
- Figure 19 provides the amino acid sequence of an embodiment of the present invention, namely an rsFc ⁇ RIIa dimer fusion to an Fc domain derived from IgG2a (this fusion protein is hereinafter referred to as the D2 protein);
- Figure 20 provides the nucleotide sequence encoding the D2 protein of Figure 19;
- Figure 21 illustrates the plasmid used to express the nucleotide sequence (encoding the D2 protein) of Figure 20;
- Figure 22 shows an analysis of the purified D2 protein of Figure 19 by SDS-PAGE (panel A) and by Western blot (panel B);
- Figure 23 shows the effect of the D2 protein (of Figure 19) on TNF- ⁇ release in a MC/ 9 mast cell assay;
- Figure 24 shows the effect of the D2 protein (of Figure 19) on human neutrophil activation
- Figure 25 shows the effect of the D2 protein (of Figure 19) on human platelet activation.
- the present invention provides a soluble multimeric polypeptide and protein able to inhibit interaction of leukocyte Fc ⁇ receptors (Fc ⁇ R) and immunoglobulin G (IgG) which comprises two or more Fc binding regions, one of which is essentially derived from an Fc ⁇ R type receptor.
- Fc ⁇ R leukocyte Fc ⁇ receptors
- IgG immunoglobulin G
- Such a polypeptide and protein offers an increase in selectivity for immune complexes over that previously observed with soluble monomeric polypeptides such as rsFc ⁇ RII monomer, and thereby provides considerable promise as a "decoy" molecule for the treatment of IC-mediated inflammatory disease such as RA and SLE.
- the present invention therefore provides a soluble multimeric polypeptide able to inhibit interaction of leukocyte Fc ⁇ receptors (Fc ⁇ R) and immunoglobulin G (IgG), said polypeptide comprising two or more Fc binding regions linked in a head to tail arrangement, at least one of which is derived from an Fc ⁇ R type receptor, and an Fc domain of an immunoglobulin which has been modified to reduce or prevent binding to the said Fc binding regions and/ or to alter effector function.
- Fc ⁇ R leukocyte Fc ⁇ receptors
- IgG immunoglobulin G
- the term "soluble" indicates that the polypeptide (or protein) is not bound to a cellular membrane, and is, accordingly, characterised by the absence or functional disruption of all or a substantial part of the transmembrane (i.e. lipophilic) domain, so that the polypeptide (or protein) is devoid of any membrane anchoring function.
- the cytoplasmic domains may also be absent.
- Fc binding region refers to any part or parts of an Fc receptor that is able to bind with an Fc domain of an immunoglobulin (e.g. an Fc fragment produced by papain hydrolysis of an immunoglobulin) including genetically modified versions thereof, as well as synthetic Fc binding polypeptides.
- an immunoglobulin e.g. an Fc fragment produced by papain hydrolysis of an immunoglobulin
- the at least one Fc binding region derived from an Fc ⁇ R type receptor may be derived, for example, from an Fc ⁇ R having low affinity for IgG, that is an affinity for IgG of less than 5 x 10 7 M' 1 .
- Such low affinity receptors include Fc ⁇ RII type receptors (e.g. Fc ⁇ RIIa including the polymorphic variants, Fc ⁇ RIIa-H131 and Fc ⁇ RIIa-R131 (Stuart et al, 1987; Brooks et al, 1989; Seki et al, 1989), Fc ⁇ RIIb and Fc ⁇ RIIc), Fc ⁇ RIII type receptors (e.g.
- Fc ⁇ RIIIa and Fc ⁇ RIIIb truncated forms of Fc ⁇ RI type receptors (e.g. Fc ⁇ RIa and Fc ⁇ RIb) such as truncated polypeptides comprising the first and second of the three ectodomains of an Fc ⁇ RI receptor (Hulett et al, 1991; Hulett et al, 1998), and genetically modified versions of Fc ⁇ R which normally have high affinity for IgG but by virtue of the modifications (e.g. one or more amino acid substitution(s), deletion(s) and/or addition(s)) show a reduced affinity for IgG of less than 5 x 10 7 M" 1 ).
- modifications e.g. one or more amino acid substitution(s), deletion(s) and/or addition(s)
- the polypeptide is a homomultimer of an Fc binding region derived from an Fc ⁇ R receptor such as a low affinity Fc ⁇ R.
- a suitable Fc binding region consists of all or an Fc binding part or parts of one or more ectodomains of an Fc ⁇ R receptor.
- Persons skilled in the art will be able to readily identify Fc binding ectodomains of Fc ⁇ R receptors since these domains belong to the IgG domain superfamily (Hulett et al., 1994, Hulett et al, 1995, Hulett et al, 1998, and Tamm et al, 1996) and are typically characterised by "a tryptophan sandwich" (e.g.
- residues W90 and W113 of Fc ⁇ RIIa) and other residues e.g. in Fc ⁇ RIIa; residues of the ectodomain 1 and ectodomain 2 linker, and the BC (W113-V119), C 1 E (F132-P137) and FG (G159-Y160) loops of ectodomain 2 (Hulett et al, 1994)).
- the polypeptide is a homomultimer of an Fc binding region of FcyRIIa.
- a suitable Fc binding region from Fc ⁇ RIIa consists of all or an Fc binding part or parts of the ectodomains 1 and 2 of Fc ⁇ RIIa.
- the Fc ⁇ RIIa ectodomains 1 and 2 are found within amino acids 1 to 172 of the Fc ⁇ RIIa amino acid sequence (Hibbs et al, 1988, and ACCESSION NM_021642).
- An example of an Fc binding part of the Fc ⁇ RIIa ectodomains 1 and 2 is a fragment comprising amino acids 90 to 174 of the Fc ⁇ RIIa amino acid sequence, which includes residues of the ectodomain 1 and ectodomain 2 linker and BC (W113-V119), CE (F132-P137) and FG (G159-Y160) loops of ectodomain 2.
- X-ray crystallography studies has revealed that within this fragment, amino acids 113-116, 129, 131, 133, 134, 155, 156 and 158-160 make important contributions to the fragment surface that is able to bind to the Fc domain of IgG (International patent specification no WO 2005/075512).
- the polypeptide may also be a heteromultimer of an Fc binding region derived from an Fc ⁇ RII type receptor and an Fc binding region from another source (e.g. an Fc binding region from another Fc receptor type such as another Fc ⁇ R type or an Fc binding region from other immunoglobulin receptors such as receptors for IgA and IgE).
- Fc binding region derived from an Fc ⁇ RII type receptor
- Fc ⁇ RIII type receptor e.g. an Fc binding region from another Fc receptor type such as another Fc ⁇ R type
- an Fc binding region from other immunoglobulin receptors such as receptors for IgA and IgE.
- One especially preferred molecule of this kind is a heterodimer of an Fc binding region derived from an Fc ⁇ RII type receptor (particularly, Fc ⁇ RIIa) and an Fc binding region derived from an Fc ⁇ RIII type receptor.
- Fc binding regions considered as having been "derived from" a particular Fc receptor include Fc binding regions having an amino acid sequence which is equivalent to that of an Fc receptor as well as Fc binding regions which include one or more amino acid modification(s) of the sequence of the Fc binding region as found in an Fc receptor.
- amino acid modification(s) may include amino acid substitution(s), deletion(s), addition(s) or a combination of any of those modifications, and may alter the biological activity of the Fc binding region relative to that of an Fc receptor (e.g. the amino acid modification(s) may enhance selectivity or affinity for immune complexes; such modifications at amino acids 133, 134, 158-161 are described in International patent specification no WO 96/08512).
- Fc binding regions derived from a particular Fc receptor may include one or more amino acid modification(s) which do not substantially alter the biological activity of the Fc binding region relative to that of an Fc receptor.
- Amino acid modification(s) of this kind will typically comprise conservative amino acid substitution(s).
- Exemplary conservative amino acid substitutions are provided in Table 1 below. Particular conservative amino acid substitutions envisaged are: G, A, V, I, L, M; D, E, N, Q; S, C, T; K, R, H: and P, N ⁇ -alkylamino acids.
- conservative amino acid substitutions will be selected on the basis that they do not have any substantial effect on (a) the structure of the polypeptide backbone of the Fc binding region at the site of the substitution, (b) the charge or hydrophobicity of the polypeptide at the site of the substitution, and/ or (c) the bulk of the amino acid side chain at the site of the substitution.
- the Fc binding region may also include an amino acid or amino acids not encoded by the genetic code, such as ⁇ - carboxyglutamic acid and hydroxyproline and D-amino acids.
- the Fc binding regions are preferably linked through a peptide bond or via a short linker sequence (e.g. a single amino acid or a short peptide of, for example, 2 to 20 amino acids in length). However, it may in certain circumstances be preferable or desirable to link the Fc binding regions through other suitable linkage means (e.g. by chemical cross-linking).
- a short linker sequence e.g. a single amino acid or a short peptide of, for example, 2 to 20 amino acids in length.
- suitable linkage means e.g. by chemical cross-linking.
- the Fc binding regions of the polypeptide of the present invention are linked in a "head to tail” arrangement. That is, the C-terminal ("tail") of a first Fc binding region will be linked to the N-terminal ("head") of a second Fc binding region in a tandem manner. There is at least two Fc binding regions, typically 2 to 4 Fc binding regions, linked in this manner, however the polypeptide may have up to 10 or more (e.g. 20) Fc binding regions linked in a head to tail arrangement.
- the Fc binding regions will typically be linked through a peptide bond or via a short linker sequence (e.g.
- Suitable short linker sequences may be short random sequences or may comprise short non-Fc binding region fragments of Fc ⁇ R (e.g. short fragments of 20 or fewer amino acids from the proximal region of the membrane stalk of Fc ⁇ R).
- the linker sequence may be a synthetic linker sequence such as, for example, GGGGSGGGGS (SEQ ID NO: 4) which has a low susceptibility to proteolysis.
- Such a linker sequence may be provided in the form of 2 to 5 tandem "Gly4Ser" units. Linking the Fc binding regions through a peptide bond or a short linker sequence allows for the production of the polypeptide using recombinant expression systems.
- the polypeptide comprises two to four Fc binding regions derived from Fc ⁇ RIIa linked in a head to tail arrangement.
- the polypeptide comprises two Fc binding regions from Fc ⁇ RIIa linked in a head to tail arrangement.
- the polypeptide comprises two Fc ⁇ RIIa extracellular regions each comprising ectodomains 1 and 2, wherein said extracellular regions are linked in a head to tail arrangement through a linker comprising 1 to 20 amino acids.
- the Fc binding regions within the polypeptide are linked through a peptide linker constituting the membrane proximal stalk region of Fc ⁇ RIIa, which is represented by the sequence
- PSMGSSSP (SEQ ID NO: 7).
- Equivalent linkers that adopt a similar secondary structure are also useful, including equivalents that incorporate conservative amino acid substitutions. Further, truncations and extensions of this amino acid sequence, having one or two fewer or additional amino acids, are also useful.
- Suitable linkers generally are those that permit the multimeric polypeptide to adopt a structure in which each Fc binding region can participate in the binding of an Fc domain-bearing molecule. In this manner, the linker permits, for example, a polypeptide comprising two linked Fc binding regions to bind a greater quantity of Fc domain-bearing molecules than are bound by a corresponding monomer.
- the selection of linkers suitable to this end can be made based on simple binding experiments, as exemplified herein.
- the polypeptide of the present invention may further comprise a carrier protein (i.e. such that the polypeptide is a "fusion" of the carrier protein and said two or more linked Fc binding regions and modified Fc domain).
- the carrier protein may be any suitable carrier protein well known to persons skilled in the art, but preferably, is human serum albumin (HSA) or another carrier protein commonly used to improve bioavailability (i.e. through increasing the serum half life of the polypeptide when administered to a subject).
- HSA human serum albumin
- the carrier protein can be fused to the polypeptide by expressing the polypeptide as a fusion protein with the said carrier protein in accordance with any of the methods well known to persons skilled in the art.
- the polypeptide of the present invention may further comprise other useful linked molecules, for example, ethylene glycol (i.e. to produce a PEGylated polypeptide) to improve bioavailability, complement regulating molecules such a CD46, CD55 and CD59, cytokines (e.g. to enable delivery of cytokines to sites of inflammation) and cytokine receptors.
- ethylene glycol i.e. to produce a PEGylated polypeptide
- complement regulating molecules such as CD46, CD55 and CD59
- cytokines e.g. to enable delivery of cytokines to sites of inflammation
- cytokine receptors e.g. to enable delivery of cytokines to sites of inflammation
- the polypeptide of the present invention comprises an Fc domain of an immunoglobulin.
- This Fc domain is capable of binding to another Fc domain (i.e. to form a dimer) and thereby provides a means of linking two or more polypeptides according to the invention to form a protein.
- a protein can be produced which comprises at least four Fc binding regions (in other words, a soluble multimeric protein comprising four or more Fc binding regions).
- the Fc domain may be selected from any immunoglobulin (e.g. an IgG such as IgG 1 , IgG2a or IgG4).
- the IgG4 Fc domain in the wild type form, has relatively low affinity for Fc ⁇ RII receptors, and may therefore be used in the polypeptide of the invention without modification to avoid self-annealing to the linked Fc binding regions (i.e. derived from an Fc ⁇ RII type receptor) of the polypeptide. More desirably, however, the selected Fc domain is modified (e.g. by amino acid substitution(s) at residues critical for binding with Fc receptors) to prevent self- annealing (i.e.
- the modified Fc domain preferably shows a reduced affinity for binding endogenous Fc receptors other than neonatal Fc receptors (FcRn), including, for example, Fc ⁇ RI, Fc ⁇ RII and Fc ⁇ RIII).
- FcRn neonatal Fc receptors
- the selected Fc domain is desirably modified to alter effector function, such as to reduce complement binding and/ or to reduce or abolish complement dependent cytotoxicity (CDC).
- any one or more of the amino acids at positions 234, 235, 236, 237, 297, 318, 320 and 322 can be modified (e.g. by amino acid substitution) to alter affinity for an effector ligand, such as an Fc receptor or the Cl component of complement (Winter et al. in US Patent Nos 5,624,821 and 5,648,260).
- amino acids at positions 329, 331 and 322 can be modified (e.g. by amino acid substitution) to alter CIq binding and/or reduce or abolish CDC (as described, for instance, by Idusogie et al. in US Patent No 6,194,551), and/or to reduce or abolish antibody- dependent cell mediated cytotoxicity (ADCC).
- amino acid substitution e.g. by amino acid substitution
- the Fc domain is derived from IgG 1 (Wines et al., 2000) and comprises amino acid modification at amino acid 234 and/ or 235, namely Leu 234 and/ or Leu 235 .
- These leucine residues are within the lower hinge region of IgG 1 where the Fc receptor engages with the Fc domain.
- One or both of the leucine residues may be substituted or deleted to prevent Fc receptor engagement (i.e. binding); for example, one or both of Leu 234 and Leu 235 may be substituted with alanine (i.e. L234A and/ or L235A) or another suitable amino acid(s) (Wines et al, 2000).
- the Fc domain is derived from IgG2a and comprises amino acid modification at any one or more of amino acids 235, 318, 320 and 322, namely LeU 23S , GIu 318 , Lys 320 and Lys 322 .
- Leu 235 is substituted with glutamate and GIu 318 , Lys 320 and Lys 322 are substituted with alanine.
- the Fc domain is derived from IgG4, including human IgG4, and comprises amino acid modification at any one more of amino acids 228, 233, 234, 235 and 236.
- the amino acid modifications in the IgG4 Fc domain introduce Pro 228 , Pro 233 , VaI 234 , Ala 235 , and a deletion of 236 (i.e. Del 236 ).
- the present invention provides a soluble multimeric protein comprising a polypeptide according to the first aspect.
- the present invention provides a polynucleotide molecule comprising a nucleotide sequence encoding a polypeptide according to the first aspect or a protein according to the second aspect.
- the polynucleotide molecule may consist in an expression cassette or expression vector (e.g. a plasmid for introduction into a bacterial host cell, or a viral vector such as a baculovirus vector for transf ection of an insect host cell, or a plasmid or viral vector such as a lentivirus for transf ection of a mammalian host cell).
- an expression cassette or expression vector e.g. a plasmid for introduction into a bacterial host cell, or a viral vector such as a baculovirus vector for transf ection of an insect host cell, or a plasmid or viral vector such as a lentivirus for transf ection of a mammalian host cell.
- a soluble multimeric protein comprising a dimer of a polypeptide according to the present invention
- the encoding polynucleotide molecule will, upon expression in a host cell, yield a single chain of the fusion polypeptide, which then will yield the desired multimeric protein as a product of host cell secretion.
- the present invention provides a recombinant host cell comprising a polynucleotide molecule according to the third aspect.
- the recombinant host cell may be selected from bacterial cells such as E. coli, yeast cells such as P. pasto ⁇ s, insect cells such as Spodoptera Sf9 cells, mammalian cells such as Chinese hamster ovary (CHO), monkey kidney (COS) cells and human embryonic kidney 293 (HEK 293) cells, and plant cells.
- bacterial cells such as E. coli
- yeast cells such as P. pasto ⁇ s
- insect cells such as Spodoptera Sf9 cells
- mammalian cells such as Chinese hamster ovary (CHO), monkey kidney (COS) cells and human embryonic kidney 293 (HEK 293) cells, and plant cells.
- the present invention provides a method for producing a polypeptide or protein, the method comprising the steps of;
- polypeptide or protein may be isolated using any of the methods well known to persons skilled in the art.
- the polypeptide or protein may be readily isolated using metal affinity chromatography techniques or using immobilised IgG or Heat-aggregated IgG (HAGG) chromatography techniques.
- the present invention provides a method of treating a subject for an inflammatory disease, said method comprising administering to said subject a polypeptide according to the first aspect or a protein according to the second aspect, optionally in combination with a pharmaceutically- or veterinary- acceptable carrier or excipient.
- the method is suitable for treatment of inflammatory diseases such as IC- mediated inflammatory diseases including RA, ITP, SLE, glomerulonephritis and heparin-induced thrombocytopenia thrombosis syndrome (HITTS).
- IC- mediated inflammatory diseases including RA, ITP, SLE, glomerulonephritis and heparin-induced thrombocytopenia thrombosis syndrome (HITTS).
- the subject will typically be a human, but the method of the sixth aspect may also be suitable for use with other animal subjects such as livestock (e.g. racing horses) and companion animals.
- pharmaceutically- or veterinary-acceptable carrier or excipient is intended to refer to any pharmaceutically- or veterinary-acceptable solvent, suspending agent or vehicle for delivering the polypeptide or protein of the present invention to the subject.
- the polypeptide or protein may be administered to the subject through any of the routes well known to persons skilled in the art, in particular intravenous (iv) administration, intradermal (id) administration and subcutaneous (sc) administration and oral and nasal administration.
- iv intravenous
- id intradermal
- sc subcutaneous
- oral and nasal administration the administration may be achieved through injection or by a catheter inserted below the skin.
- subcutaneous administration may be achieved through sustained release implant compositions or injectable depot-forming compositions.
- the polypeptide or protein will be administered at a dose in the range of 0.5 to 15 mg/kg body weight of the subject per day.
- an "effective dose” i.e. a dose amount that will be effective in treating an inflammatory disease
- the amount of an "effective dose” will vary according to a number of factors including the age and general health of the subject and the severity of the inflammatory disease to be treated. It is well within the skill of persons skilled in the art to identify or optimise an appropriate effective dose amount for each particular subject.
- composition comprising a polypeptide according to the first aspect or a protein according to the second aspect, optionally in combination with a pharmaceutically- or veterinary -acceptable carrier or excipient, and the use of a polypeptide according to the first aspect or a protein according to the second aspect in the manufacture of a medicament for the treatment of an inflammatory disease.
- polypeptide and protein of the present invention are also useful in applications other than the treatment of a subject for an inflammatory disease. That is, they can be used in diagnostic assays for detecting circulating immune complexes (IC) associated with the pathology of autoimmune diseases such as RA and SLE, wherein the polypeptide or protein can be used in a step of "capturing" IC (e.g. by binding the polypeptide or protein to a suitable substrate such as an ELISA plate) in place of the typical precipitation step (with polyethylene glycol) employed in such assays. After capturing IC from a sample (e.g.
- the captured IC can be detected by using the polypeptide or protein of the present invention in a form whereby it is linked to a molecule which might serve as a marker or reporter (e.g. radio-labelled molecules, chemiluminescent molecules, bioluminescent molecules, fluorescent molecules or enzymes such as horseradish peroxidase which can generate detectable signals).
- a marker or reporter e.g. radio-labelled molecules, chemiluminescent molecules, bioluminescent molecules, fluorescent molecules or enzymes such as horseradish peroxidase which can generate detectable signals.
- the captured IC could be detected or "probed” using antibodies specific for certain autoantigens (e.g.
- IC captured by the polypeptide or protein of the present invention bound to a suitable substrate could be detected or "probed” using antibodies specific for certain antigens of infectious pathogens (e.g. bacteria such as Staphylococcus and Streptococcus, parasites such as P.
- infectious pathogens e.g. bacteria such as Staphylococcus and Streptococcus, parasites such as P.
- falciparum malaria
- viruses such as hepatitis C virus (HCV), Epstein-Barr virus (EBV), human immunodeficiency virus (HFV) and arbovirus causative of Dengue fever
- HCV hepatitis C virus
- EBV Epstein-Barr virus
- HBV human immunodeficiency virus
- arbovirus causative of Dengue fever arbovirus causative of Dengue fever
- polypeptide and protein of the present invention are also useful in various bioassays wherein they can usefully inhibit the release of tumour necrosis factor (TNF) from cells including macrophages, dendritic cells (DC) and neutrophils.
- TNF tumour necrosis factor
- DC dendritic cells
- neutrophils neutrophils
- the polypeptide or protein when linked to a molecule which might serve as a marker or reporter such as those mentioned above, the polypeptide or protein can be used in in vivo imaging of sites of inflammation.
- polypeptide and protein of the present invention are useful for the removal of circulating IC associated with IC-mediated inflammatory diseases, wherein the polypeptide or protein is bound to a suitable substrate such as an inert bead, fibre or other surface and exposed to a biological fluid (particularly blood) from a subject containing IC complexes such that IC are captured and subsequently removed from the biological fluid.
- a suitable substrate such as an inert bead, fibre or other surface
- a biological fluid particularly blood
- the treated biological fluid which is substantially depleted of IC, can then be returned to the subject from which it was obtained.
- the Fc binding region comprising the ectodomains 1 and 2 of human Fc ⁇ RIIa were amplified by using the thermostable polymerase Pwo (Roche), the clone Hu3.0 (Hibbs et al, 1988, ACCESSION NM_021642) as cDNA template and the primers oBWIO GTAGCTCCCCCAAAGGCTG (SEQ ID NO: 1) and oBWll CTACCCGGGTGAAGAGCTGCCCATG (SEQ ID NO: 2).
- the half SnaBl all DNA modifying enzymes were from New England Biolabs) and Smal sites are underlined.
- the blunt PCR product was ligated using T4 DNA ligase into the vector pPIC9 (Invitrogen, Life Technologies) at the EcoRI site filled in with Klenoi ⁇ fragment of DNA polymerase I yielding the vector pBAR14.
- T4 DNA ligase into the vector pPIC9 (Invitrogen, Life Technologies) at the EcoRI site filled in with Klenoi ⁇ fragment of DNA polymerase I yielding the vector pBAR14.
- pBAR28 encoding the tandem ectodomains of Fc ⁇ RIIa
- pBAR14 was digested with Sn ⁇ BI into which site the SnaBl/ Smal fragment of pBAR14 was ligated.
- a baculovirus vector for expressing Fc ⁇ RIIa multimerised ectodomains was constructed as follows: The fragment encoding the Fc ⁇ RIIa leader sequence and ectodomains 1 and 2 were obtained from pVL-1392 (Powell et al, 1999, and Maxwell et al, 1999) by digest with EcoRI and Xbal, and then ligated into the EcoRl/Xbal sites of modified pBACPAK9 (Invitrogen Life Tech) in which the B ⁇ mHI site in the multiple cloning site had first been eliminated by digest with BatnHl, filling in using Klenoi ⁇ fragment of DNA polymerase and re-ligation.
- vector pBAR69 was digested with BarnHl to which was ligated the B ⁇ mHI fragment of pBAR28 yielding vectors pBAR71, pBAR72 and pBAR73 encoding rsFc ⁇ RIIa dimer, trimer and tetramer respectively. Insert sizes were defined by EcoRI/ Xbal digest and the correct orientation of the multimerising BamHl fragment was screened by Pvu ⁇ l digest using standard protocols.
- the mammalian expression vectors encoding Fc ⁇ RIIa monomer and dimer were produced as follows: The Fc ⁇ RIIa cDNA clone Hu3.0 (Hibbs et al, 1988, and DEFINITION: Homo sapiens Fc fragment of IgG, low affinity Ha, receptor (CD32)(FCGR2A), mRNA, ACCESSION NM_021642) was amplified using accuprime Pfic PCR (Invitrogen, Life Technologies) and cloned into the GatewayTM vector pDONRTM221 (Invitrogen, Life Technologies) using the BP clonaseTM reaction according to the manufacturer's instructions (Invitrogen Life Tech) yielding pNB6. PCR using polymerase accuprime Pfic of pNB6 with the primers oBWll and oBW302
- TCTCATCACCACCATCACCACGTCTAGACCCAGCTTTCTTGTACAAAG (SEQ ID NO: 3)
- digest with Smal and ligation with T4 ligase yielded pB AR390 encoding the rsFc ⁇ RIIa with C-terminal hexahistidine tag.
- Digestion of pBAR390 with B ⁇ mHI and ligation of the B ⁇ mHI fragment of pBAR28 yielded vector pBAR397, encoding rsFc ⁇ RIIa dimer.
- Pvu II digest was then used to screen for the orientation of the dimerising BamHl fragment and sequencing with ABI BigDye3.1 (Applied Biosytems) confirmed the target sequence.
- the Gateway LR clonase reaction (Invitrogen, Life Technologies) was then used to transfer the Fc ⁇ RIIa monomer (pBAR390) or dimer (pBAR397) into GatewayTM reading frame- A cassette (Invitrogen, Life Technologies) adapted expression vector pAPEX3P (Evans et al, 1995, and Christiansen et al, 1996) to give the expression vectors pBAR426 and pBAR427.
- Gateway LR clonase reaction was used to transfer the Fc ⁇ RIIa monomer (pBAR390) or dimer (pBAR397) into GatewayTM reading frame- A cassette (Invitrogen, Life Technologies) adapted expression vector pIRESneo (Clontech).
- Figure 1 shows the polynucleotide sequence (and translated amino acid sequence) for the "head to tail" dimer construct of Fc ⁇ RIIa within pB AR397 used to construct the expression vector pB AR427. The two repeats are shown as amino acids 1 to 174 (i.e. the first Fc binding region) and 184 to 362 (i.e.
- rsFc ⁇ RIIa recombinant soluble Fc ⁇ RIIa
- dimer polypeptides in HEK 293E cells was performed by rransfection with 5 ⁇ g of plasmid DNA (pBAR426, pBAR427) in 10cm 2 wells and Lipofectamine 2000 reagent (Invitrogen, Life Technologies) or Transit reagent (BioRad Laboratories) according to the manufacturer's instructions. After 48 hours, the transfected cells were then selected by incubation in 4 ⁇ g/ml puromycin. Puromycin selected cells were then grown in 1% FCS supplemented CD293 media (Invitrogen, Life Technologies) to stationary phase.
- the recombinant product was subsequently purified by chromatography over immobilised Nickel (Qiagen) or cobalt (Clontech) columns and further purified using Superdex 200 or Superdex G75 (Amer sham/ Pharmacia) size exclusion chromatography.
- rsFc ⁇ RIIa monomer and dimer were incubated with increasing concentrations of a solution of human IgG monomer (Sandoglobulin) and dimer- IgG (Wright et al, 1985). The amount of free receptor polypeptide was then measured by injecting over immobilised human IgG monomer in accordance with a standard BIAcore assay protocol.
- peripheral mononuclear cells were extracted from human blood (volunteer V5), positively sorted for CD14 expression using an automacs sorter (Miltenyi Biotec) and allowed to differentiate for 24 hours in the presence of M-CSF to MDMs (monocyte-derived macrophages) prior to stimulation with varying concentrations of small immune-complexes (represented by dimer-IgG), in the absence and presence of rsFc ⁇ RIIa dimer (in supernatant at 2.5 ⁇ g/ml).
- TNF secretion from the MDMs was then measured by human TNF ELISA according to manufacturers' protocol (BD Pharmingen).
- MDMs were similarly produced ex vivo from human blood (this time from volunteer Vl) and allowed to differentiate for 24 hours prior to stimulation with varying concentrations of small immune-complexes (i.e. dimer-IgG), in the absence and presence of rsFc ⁇ RIIa dimer (in supernatant at 2.5 ⁇ g/ml).
- Washed platelets were prepared by low speed centrifugation of whole blood (Thai et al, 2003) and stimulated with heat-aggregated IgG (HAGG). Activation of platelets was measured by increased surface expression of P-selectin (CD62P) by flow cytometry (Lau et al, 2004).
- one strategy for minimising proteolysis of the trimers, tetramers and larger multimers would be to eliminate or, more preferably, replace the membrane proximal stalk linker sequence linking the Fc ⁇ RIIa extracellular regions.
- the proteolytic susceptibility of membrane proximal stalk linker sequence could be reduced by one or more amino acid modifications (e.g.
- linker sequence one or more amino acid substitution(s), deletion(s) and/ or addition(s)) or by otherwise replacing that linker sequence with a synthetic linker sequence such as, for example, GGGGSGGGGS (SEQ ID NO: 4) which has a low susceptibility to proteolysis.
- Another strategy for successfully producing trimers, tetramers and larger multimers would be to link an expressed dimer polypeptide to one or more monomer or other dimer polypeptide(s) by chemical cross-linking.
- Multimers of Fc ⁇ RIIa dimers may also be produced by expressing the dimer polypeptide as a fusion protein with an Fc domain (e.g. an IgG Fc domain) which is of itself dimeric and will thus dimerise any fusion partner.
- Protein yield for purified rsFc ⁇ RIIa monomer was 3 mg/1 (construct pBAR 426) and for the rsFc ⁇ RIIa dimer, to -0.5 mg/1 (construct pBAR 427).
- Figure 3 shows Coomassie-stained SDS-PAGE (12% acrylamide gel, under non-reducing conditions) of fractions collected from the purification of rsFc ⁇ RIIa monomer and dimer.
- the rsFc ⁇ RIIa monomer had the expected size of ⁇ 30 kDa (a), while the rsFc ⁇ RIIa dimer had the expected size of ⁇ 60 kDa (b).
- the binding data best fitted a too-binding site model with affinity dissociation constants (KD) of 3.2 nM (KDI) and 100 nM (KD2) for immobilised human IgG monomer and 2.73 nM (KDI; approximated 300-fold lesser than the KD of monomeric rsFc ⁇ RIIa) and 99 nM (KD 2 ) for HAGG.
- KD affinity dissociation constants
- Washed human platelets were incubated with HAGG (10 ⁇ g/ml) in the presence and absence of rsFc ⁇ RIIa dimer at 30 ⁇ g/ml for 30 minutes. As shown in Figure 9, it was found that the activation of platelets was inhibited in the presence of the rsFc ⁇ RIIa dimer as evidenced by the lesser expression of P-selectin (CD62P).
- rsFc ⁇ RIIa dimer selectively binds small immune complexes, and selective inhibitory activity was confirmed in cell based assays using neutrophils from two donors.
- the rsFc ⁇ RIIa dimer also proved to be about 10 times more potent an inhibitor of small IgG immune complex binding than the rsFc ⁇ RIIa monomer, and in a standard platelet assay, the rsFc ⁇ RIIa dimer was observed to completely inhibit immune complex activation of platelets (i.e. rsFc ⁇ RIIa dimer is a potent inhibitor of cell activation).
- rsFc ⁇ RIIa dimer and other soluble multimeric proteins and polypeptides according to the invention show considerable promise for the treatment of IC-mediated inflammatory disease such as RA and SLE.
- Example 2 Production, purification and characterisation of rsFc ⁇ RIIa dimer polypeptide
- the Fc ⁇ RIIa dimer construct described in Example 1 was cloned into a mammalian expression vector under the control of a modified CMV promoter. Stable CHO-S transfectants were then established as follows: CHO-S cells at 90% confluency were harvested, washed three times, and 2x10 7 cells in 15 ml medium were dispensed into 10 cm petri dishes. Linearised DNA-lipofectamine 2000 complexes (1:2.5 ratio) were then incubated for 5 minutes at room temperature and added dropwise to the cells.
- cells were incubated at 37°C for 48 hours, and then plated out in limiting dilution in 96-well plates in CD-CHO medium supplemented with 600 ⁇ g/ml hygromycin B, 8 mM L-glutamine, Ix HT supplement and 50 ⁇ g/ml dextran sulfate.
- Cells were screened by standard ELISA to detect soluble Fc ⁇ RIIa protein, and the highest expressing lines were subcloned again by limiting dilution.
- One clone (#6) secreted Fc ⁇ RIIa dimer at approximately 40 mg/L and was cultured in shaker flasks at 30 0 C for optimal protein expression.
- rsFc ⁇ RIIa dimer The ability of purified rsFc ⁇ RIIa dimer to block immune complex binding to cell surface Fc ⁇ RIIb was assessed by a flow cytometric assay.
- Heat-aggregated IgG HAGG
- various concentrations of rsFc ⁇ RIIa dimer or rsFc ⁇ RIIa monomer R&D Systems, Cat # 1330-CD/CF
- IIA1.6 is a mouse B lymphoma line that lacks endogenous Fc ⁇ R expression.
- the plates were incubated for 1 hour at 4°C, washed and then stained with an anti-hlgG-FITC conjugate to detect bound HAGG. After washing, the cells were analysed on a FACS Scan flow cytometer using standard protocols.
- rsFc ⁇ RIIa dimer or rsFc ⁇ RIIa monomer were assessed by a flow cytometric assay. Heat- aggregated IgG (HAGG) was incubated with various concentrations of rsFc ⁇ RIIa dimer or rsFc ⁇ RIIa monomer (R&D Systems, Cat # 1330-CD/CF) for 1 hour at 4°C.
- the mixture was then added to 96-well plates containing 3xlO 7 human platelets, which had been previously washed and resuspended in Tyrodes/Hepes buffer supplemented with 1 mM EDTA. After a 30 minute incubation at room temperature, the cells were washed, fixed, and stained for CD62P and GPIIb (CD41) expression by standard methods and analysed on a FACS Scan flow cytometer.
- rsFc ⁇ RIIa dimer polypeptides block immune complex-induced MC/9 activation
- MC/9 is an Fc ⁇ R-positive murine mast cell line that becomes activated and releases TNF- ⁇ after exposure to immune complexes.
- the ability of rsFc ⁇ RIIa dimer or rsFc ⁇ RIIa monomer to block this activation was assessed using immune complexes consisting of ovalbumin and anti-ovalbumin antibody (OVA ICs) as a stimulus.
- OVA ICs (10 ⁇ g) were incubated with various concentrations of rsFc ⁇ RIIa dimer or rsFc ⁇ RIIa monomer (R&D Systems, Cat # 1330-CD/CF) for 1 hour at room temperature. The mixture was then added to 96- well plates containing 2xlO 5 MC/9 cells, and incubated overnight at 37°C. Supernatant was collected and the amount of TNF- ⁇ measured using a commercial ELISA kit (BD Biosciences).
- rsFc ⁇ RIIa dimer inhibits induced arthritis in human Fc ⁇ RIIa transgenic mouse model
- the activity of the rsFc ⁇ RIIa dimer was assessed in an arthritis model using the transgenic human Fc ⁇ RIIa mice described in published PCT application WO03/ 104459, incorporated herein by reference. These mice express a transgene that encodes human Fc ⁇ RIIa.
- Clinically apparent arthritic disease (determined using the standard arthritis index) is elicited in these mice at least by Day 4 following administration of a single 2mg dose of monoclonal antibody M2139 in PBS, which is an IgG2a that binds specifically to the Jl epitope of collagen II, amino acids 551-564.
- the monoclonal antibody is produced by hybridomas proven to be arthritogenic (Amirahmadi et at., Arthritis and Rheumatism, June 2005; Nandakumar et al., Arthritis Research and Therapy, May 2004).
- mice were treated using the soluble Fc ⁇ RIIa dimer shown in Figure 1, as follows: Four Fc ⁇ RIIa Tg mice were injected with 0.5mg soluble Fc ⁇ RIIa dimer, and a control group of four mice were given PBS, i.p. Two hours later, both groups were injected with 2mgs of M2139 (ip) and a bolus dose of lmg of dimer or PBS. Dimer (0.5mg/dose) was given again at both 24 and 48 hours following injection of M2139. Arthritis was scored as usual, with a maximum score possible of 12.
- Figure 10 shows the analysis of purified rsFc ⁇ RIIa material, including SDS-PAGE (under reducing and non-reducing conditions); Western blotting using an anti- Fc ⁇ RIIa antibody (R&D systems, catalogue number AF1875) and rabbit anti-goat IgG-peroxidase as the detector antibody; and HPLC.
- the polypeptide migrates as a single band at the expected molecular weight ( ⁇ 50 kD), reacts with anti- Fc ⁇ RIIa antibody and is >96% pure as determined by HPLC analysis.
- rsFc ⁇ RIIa dimer polypeptides block HAGG binding to Fc ⁇ RI ⁇ b
- rsFc ⁇ RIIa dimer polypeptides block HAGG-induced platelet activation
- the results of the platelet activation assay are shown in Figure 12.
- the percentage of activated platelets (positive for both CD41 and CD62P) after treatment with HAGG alone was defined as 100%.
- Both rsFc ⁇ RIIa dimer and rsFc ⁇ RIIa monomer were able to significantly reduce HAGG-induced CD62P upregulation.
- rsFc ⁇ RIIa dimer polypeptides block immune complex-induced MC/9 activation
- rsFc ⁇ RIIa dimer inhibits induced arthritis in human Fc ⁇ RIIa transgenic mouse model
- the rsFc ⁇ RIIa dimer was successfully expressed in CHO-S cells. Reducing and non-reducing SDS-PAGE showed that the purified rsFc ⁇ RIIa dimer was approximately 50 kDa in size, and Western blotting showed that the dimer was specifically bound by anti-Fc ⁇ RIIa antibodies.
- the rsFc ⁇ RIIa dimer was determined to be 96% pure by HPLC.
- both the rsFc ⁇ RIIa dimer and rsFc ⁇ RIIa monomer completely blocked binding of HAGG to cell surface Fc ⁇ RIIb, with the rsFc ⁇ RIIa dimer having an approximately 500-fold increased blocking efficiency than the rsFc ⁇ RIIa monomer.
- both the rsFc ⁇ RIIa dimer and rsFc ⁇ RIIa monomer significantly reduced HAGG- induced platelet activation, with the dimer showing approximately 5-fold higher efficacy than the rsFc ⁇ RIIa monomer.
- both the rsFc ⁇ RIIa dimer and rsFc ⁇ RIIa monomer suppressed mouse mast cell line (MC/ 9) activation, as measured by TNF- ⁇ release, with the dimer showing 8-fold greater efficacy than the monomer.
- rsFc ⁇ RIIa dimer ameliorated arthritis in a mouse model of induced arthritis, demonstrating in vivo effectiveness.
- Example 3 Engineering and expression of rsFc ⁇ RIIa fusion polypeptides comprising an Fc domain derived from IgGi
- Polynucleotides encoding soluble monomer Fc ⁇ RIIa or soluble dimer Fc ⁇ RIIa were independently fused to a polynucleotide encoding IgGi-Fc ⁇ l (L234A, L235A).
- the C-terminal of the soluble monomer Fc ⁇ RIIa polypeptide was operably fused to a human IgG 1 polypeptide at a position on the N-terminal side of the inter- chain disulphide bond in the lower hinge that covalently joins the two Fc portions. Fusion at this position generates a monomeric Fc ⁇ RIIa-IgGi-Fc ⁇ l (L234A, L235A) fusion protein which will dimerise with a second Fc domain due to interactions between the covalently associated Fc domains.
- the IgG hinge region is known for its flexibility, and fusion of the polypeptide comprising the Fc binding region to the N-terminal side of the inter-chain disulphide bond in the lower hinge allows considerable freedom of movement of the Fc binding region.
- the C-terminal of the soluble dimer Fc ⁇ RIIa polypeptide was operably fused to a human IgG 1 polypeptide at a position on the N-terminal side of the inter-chain disulphide bond in the lower hinge that covalently joins the two Fc portions.
- Polynucleotides encoding soluble monomer Fc ⁇ RIIa or soluble dimer Fc ⁇ RIIa were independently fused to a polynucleotide encoding human serum albumin (HSA) in an equivalent manner to that previously described in International patent specification no WO 96/08512. As disclosed in that specification, the HSA was fused to the N-terminal of the rsFc ⁇ RIIa monomer. In a similar manner, the HSA was fused to the N-terminal of the rsFc ⁇ RIIa dimer. Polynucleotides encoding the various fusion polypeptides or proteins were operably inserted into pAPEX 3P-xDEST using standard cloning techniques.
- the rsFc ⁇ RIIa monomer and dimer fusion expression vectors were transiently transfected into CHOP cells and stably transfected in 293E cells using standard methods. Transiently transfected CHOP cell supernatants were immunoprecipitated using anti-Fc ⁇ RIIa antibody 8.2 (Powell et ah, 1999) and immunoprecipitates were subjected to non-reducing SDS-PAGE (12%). Western blot analysis was then performed using standard methods and utilising rabbit anti Fc ⁇ RIIa antibody (Maxwell et ah, 1999) as a primary antibody and anti rabbit Ig-HRP as a secondary antibody.
- HAGG-capture ELISAs were performed to measure the Fc binding activity of the rsFc ⁇ RIIa fusions.
- a known Fc ⁇ RIIa monomer standard (Powell et al., 1999) (starting at 0.75 ⁇ g) and the protein from an rsFc ⁇ RIIa monomer transfected cell (transfection 426) titrated and compared with the binding of protein from cells transfected with rsFcyRIIa monomer fusion to IgG-Fc ⁇ l (L234A, L235A) (monomer-Fc) and protein from cells transfected with rsFc ⁇ RIIa monomer fusion to HSA (HSA- monomer).
- the monomeric rsFc ⁇ RIIa samples tested included a known rsFc ⁇ RIIa monomer (monomer standard starting at 0.75 ⁇ g/ml), the supernatant from rsFc ⁇ RIIa monomer transfected cell (transfection 426), the supernatant from cells transfected with rsFc ⁇ RIIa monomer fusion to IgG-Fc ⁇ l (L234A, L235A) (monomer-Fc) and the supernatant from cells transfected with rsFc ⁇ RIIa monomer fusion to HSA (HSA-monomer).
- the dimeric rsFc ⁇ RIIa samples tested included a known Fc ⁇ RIIa dimer (dimer standard starting at 0.5 ⁇ g/ml), the supernatant from rsFc ⁇ RIIa dimer transfected cell (transfection 427), the supernatant from cells transfected with rsFc ⁇ RIIa dimer fusion to IgG-Fc ⁇ l (L234A, L235A) (monomer-Fc) and the supernatant from cells transfected with rsFc ⁇ RIIa dimer fusion to HSA (HSA-monomer).
- the rsFc ⁇ RIIa monomer-IgG-Fc ⁇ l (L234A, L235A) fusion was secreted at higher levels (approximately 12 ⁇ g/ml in 293E cells) than the rsFc ⁇ RIIa dimer-IgG-Fc ⁇ l (L234A, L235A) fusion (approximately 4 ⁇ g/ml in 293E cells).
- the rsFc ⁇ RIIa dimer fusion to IgG-Fc ⁇ l was, due to dimerisation between the heavy chains of the fused Fc domains, tetrameric (or "tetravalent") for the Fc binding region, whereas rsFc ⁇ RIIa dimer fusion to HSA remains dimeric for the Fc binding region.
- rsFc ⁇ RIIa monomer fusion to IgG-Fc ⁇ l (L234A, L235A) and the rsFc ⁇ RIIa monomer fusion to HSA are both captured and detectable in this assay.
- rsFc ⁇ RIIa dimer fusion to IgG- Fc ⁇ l (L234A, L235A) and the rsFc ⁇ RIIa dimer fusion to HSA are also both captured and detectable in this assay.
- both the 8.2 epitope used to capture these receptors and the 8.7 epitope used to detect the captured receptors are intact indicating correct folding of the fusions. Discussion
- the rsFc ⁇ RIIa monomer and rsFc ⁇ RIIa dimer fusion constructs were expressed from the vector p-APEX 3P-xDST and expressed transiently in CHOP cells and stably in 293E cells.
- the expressed fusions presented as distinct proteins on Western blot with no evidence of degradation products.
- the rsFc ⁇ RIIa dimer fusion to IgG-Fc ⁇ l may show lower expression levels than its monomeric counterpart.
- the expression level of rsFc ⁇ RIIa dimer fusion to HSA was nearly equivalent to the expression level of rsFc ⁇ RIIa monomer fusion to HSA, as determined by Western blot ( Figure 14), and therefore shows considerable promise as a means for large scale production of rsFc ⁇ RIIa dimer.
- the rsFc ⁇ RIIa dimer fusions showed higher HAGG and anti-Fc ⁇ RIIa antibody 8.2 binding activity than monomeric counterparts.
- the rsFc ⁇ RIIa dimer fusions were dimeric or tetrameric (in the case of the rsFc ⁇ RIIa dimer fusion to IgG-Fc ⁇ l (L234A, L235A)) for the Fc binding region, and as a consequence, possessed a higher apparent binding affinity (avidity) because of this multi-valency. It is anticipated that tetrameric molecules may bind to immune complexes with such affinity that the binding will be substantially irreversible.
- rsFc ⁇ RIIa dimer fusion proteins were prepared using a modified murine IgG2a Fc domain as a fusion partner.
- the dimer fusion protein was designated D2.
- the activity of this protein was compared with the rsFc ⁇ RIIa dimer lacking a fusion partner (as described in Example 1 and 2), and with a rsFc ⁇ RIIa monomer fusion protein, wherein the fusion partner was the modified murine IgG2a Fc domain.
- the translated amino acid sequence (SEQ ID NO: 8) and nucleotide sequence (SEQ ID NO: 9) of the D2 protein are shown in Figures 19 and 20, respectively.
- the D2 protein comprises a dimer of a polypeptide consisting of the native Fc ⁇ RIIa signal sequence (amino acids 1-31), the extracellular domains of an
- Fc ⁇ RIIa protein amino acids 32-205
- a short linker corresponding to the Fc ⁇ RIIa membrane proximal stalk plus an additional valine residue (residues 206-214)
- a second Fc ⁇ RIIa protein (residues 215-385)
- a repeat of the membrane proximal stalk linker (residues 386-393)
- a mouse IgG2a Fc domain hinge-CH2-CH3 region
- the IgG2a Fc domain contains the following four mutations, which were introduced to reduce Fc receptor binding and complement fixation: Leu-413 to GIu (corresponding to position 235 in the EU numbering system), Glu-496 to Ala (corresponding to EU position 318), Lys-498 to Ala (corresponding to EU position 320) and Lys-500 to Ala (corresponding to EU position 322).
- the cDNA encoding the signal peptide and extracellular domains of human Fc ⁇ RIIa was amplified by PCR using a previously constructed plasmid (Fc ⁇ RIIa- d/pAPEX-dest) as a template and primers 1 and 4 as shown in Table 1.
- the mutated mouse IgG2a Fc region was amplified by PCR using a previously constructed plasmid (CD200IgG2aFc-d) as a template and primers 2 and 3 as shown in Table 2.
- the Fc ⁇ RIIa and modified mouse IgG2a Fc PCR products were then amplified by overlapping PCR using primers 1 and 2. Amplification was carried out by using platinum Pfic DNA polymerase (Invitrogen), in ImM MgSO 4 , 0.4 mM each dNTP, 20 pmol of each primer and 100 ng of template DNA under the following conditions: initial melting at 94 0 C for 5 min, followed by 30 cycles consisting of 94°C for 1.5 min, then 65 0 C for 2 min, then 72 0 C for 3min. The reactions were then held at 72 0 C for 10 min and cooled to 4°C. The reaction products were electrophoresed through 0.7% agarose gels and visualised with ethidium bromide.
- the DNA band of interest was excised and purified from agarose gel by using QIAquick Gel Extraction Kit (Qiagen). This purified PCR product was digested with Nhel and Agel restriction enzymes and purified using the Qiaquick PCR Purification Kit (Qiagen). The fragment was then ligated by T4 DNA ligase into the pMPG expression plasmid that had been similarly digested with Nhel and Agel. The ligation reaction (5 ⁇ l) was then transformed into 50 ⁇ l of competent Escherichia coli DH5a cells (Invitrogen) according to the manufacturer's instructions.
- pMPG-D2 Fc ⁇ RIIa-IgG2aFc plasmid DNA was isolated from a large culture of E.coli using a plasmid Maxi kit (Qiagen), linearised by Xbal, and purified by using QIAGEN tips.
- CHO-S cells growing in serum-free chemically defined medium were transfected with the linearised plasmid using Lipofectamine 2000 reagent. After 48 hours, the cells were transferred into 96-well plates at different concentrations (10000, 5000, or 2000 cells/ well) in medium containing 600 ⁇ g/ml of hygromycin B.
- Drug-resistant oligoclones were screened by ELISA as follows: 96-well plates were coated with 100 ⁇ l of goat anti-mouse IgGFc (Sigma) and incubated overnight at 4 0 C. The wells were washed and blocked with 200 ⁇ l of 2% BSA in PBST at room temperature for 1 hour. After washing, 100 ⁇ l samples were diluted with 1% BSA in PBST, added to the wells, incubated for 1 hour, washed and then incubated with HRP-conjugated goat anti-mouse IgG (Fc specific) (Sigma) for 1 hour at room temperature. The wells were washed and TMB substrate added and incubated for 3 to 5 min at room temperature.
- Fc specific HRP-conjugated goat anti-mouse IgG
- the membrane was blocked for 1 hr in 5% skim milk in PBS/ 0.1% Tween-20 and incubated for 1 hr with 0.2 ⁇ g/ml goat anti-human Fc ⁇ RIIa antibody (R&D Systems) and 1 hr with HRP-conjugated rabbit anti-goat IgG (whole molecule from Sigma), then developed using TMB substrate (Vector Laboratories Inc).
- a second limiting dilution was performed at lower different concentrations (0.25, and 0.5 cell/ well) in medium containing 600 ⁇ g/ml of hygromycin B. After 2 to 3 weeks, the drug- resistant clones were again assessed for recombinant protein production by ELISA and tested by Western blot.
- CHO transfectants were grown in shaker flasks at 37 0 C. When the cells reached a density of 1.5 to 2xlO 6 cells/ ml, they were incubated at 3O 0 C for 7 to 10 days with constant agitation. Supernatant was collected, centrifuged at 3000 x g for 30 min at 4°C, and filtered through a series of different autoclaved membrane filter pore sizes (5.0 to 0.2 ⁇ m). Tangential flow filtration (Millipore) using a Bio Max 10 membrane was used to concentrate the supernatant and perform buffer exchange into 20 mM Na-P/148 mM NaCl, pH 7.8.
- the material was then diluted 9-fold with binding buffer (20 mM Na-P & 3 M NaCl, pH 7.8) and loaded onto a Protein A column (GE Heathcare) at 4 ml/min overnight at 4°C.
- the column was washed with binding buffer (20 volumes at 5 ml/min), and protein eluted with 0.1 M citric acid pH 4.0 at 2 ml/min.
- Eluted material was pH adjusted to neutral and dialysed against 4 L of 10 mM Na-P, pH 6.0 at 4°C overnight. It was then loaded onto a macro-prep 40 ⁇ m ceramic hydroxyapatite type II (CHT II) column, (Bio- Rad).
- CHT II ceramic hydroxyapatite type II
- the protein was eluted with 10 mM Na-P, 500 mM NaCl, pH 6.0 (all manipulations at a flow rate of 5 ml/min. The eluted material was then dialysed against 3 X 4 L of PBS, pH 7.4 at 4 0 C.
- FIG. 22A shows the SDS-PAGE analysis of the final purified material.
- Western blot analysis is shown in Figure 22B. D2 protein blocks immune complex induced MC/9 mast cell activation
- the D2 protein was tested for the ability to block immune complex-mediated activation of Fc ⁇ receptors in a MC/9 mast cell assay.
- MC/9 is an Fc ⁇ R-positive murine mast cell line that becomes activated and releases TNF- ⁇ after exposure to immune complexes.
- 10 ⁇ g of ovalbumin-anti-ovalbumin immune complexes (OVA ICs) were incubated with purified D2 for 1 hour at room temperature.
- OVA ICs were also incubated with purified BIF (a variant of D2 lacking an Fc tag as described in Examples 1 and 2) and purified M2 protein (a variant of D2 that contains only a single Fc ⁇ RIIa subunit fused to the modified IgG2a Fc domain).
- the mixture was then added to 96-well plates containing 2XlO 5 MC/9 cells, and incubated overnight at 37°C. Supernatant was collected and the amount of TNF- ⁇ measured by commercial ELISA kit. The results are shown in Figure 23, where the amount of TNF- ⁇ released in the absence of treatment has been defined as 100%.
- the D2 and M2 proteins and rsFc ⁇ RIIa dimer polypeptide completely suppress OVA IC-mediated activation.
- the D2 protein is 3-fold more potent than the non-Fc tagged dimer, and 12-fold more potent than Fc-tagged monomer (M2).
- D2 protein blocks immune complex mediated activation ofFc ⁇ R in a neutrophil activation assay
- the D2 protein was also tested for the ability to block immune complex-mediated activation of Fc ⁇ receptors in a neutrophil activation assay. Resting human neutrophils express both Fc ⁇ RIIa and Fc ⁇ RIIIb and rapidly lose cell surface expression of L-selectin (CD62L) upon activation by immune complexes. OVA ICs (100 ⁇ g/ml) were incubated either alone or with titrated amount of purified D2, M2 or BIF for 1 hour on ice. The mixture was then added to 96-well plates containing 2xlO 5 /well human neutrophils, which had been purified from peripheral blood by dextran sedimentation and Ficoll density gradient centrifugation.
- D2 protein blocks immune complex mediated activation ofFc ⁇ R in a platelet activation assay
- D2 protein was tested for the ability to block immune complex- mediated activation of Fc ⁇ receptors in a platelet activation assay.
- Heat aggregated IgG (HAGG) was incubated with various concentrations of D2 protein (or M2 or BIF) for 1 hour at 4°C. The mixture was then added to 96- well plates containing 3xlO 7 human platelets, which had been previously washed and resuspended in Tyrodes/Hepes buffer supplemented with 1 mM EDTA.
- the D2 protein comprises the extracellular domain of two head to tail Fc ⁇ RIIa proteins fused to the murine IgG2a Fc domain, which is mutated at four amino acids to reduce Fc receptor binding and complement fixation.
- the D2 protein effectively blocked the immune complex mediated activation of MC/ 9 mast cells, and immune complex mediated activation of Fc ⁇ R in both a neutrophil activation assay and a platelet activation assay.
- Such Fc binding dimer fusion proteins may accordingly be effective inhibitors of immune complex-mediated diseases in vivo.
- Fc binding region of Fc ⁇ RIIa and Fc ⁇ RIII may be independently PCR amplified from cDNA template using appropriate primers as described in
- Example 1 The regions amplified would encompass the known characteristic residues and motifs of Fc binding regions such as residues of the ectodomain 1 and ectodomain 2 linker (i.e. the Dl /D2 junction), and the BC, C 1 E and FG loops.
- the polynucleotide sequences for these Fc binding regions are well known to persons skilled in the art.
- Blunt-ended PCR products can be ligated using T4 DNA ligase into the vector pPIC9 (Invitrogen, Life Technologies) at the EcoRI site filled in with Klenow fragment of DNA polymerase I.
- An operably fused Fc ⁇ RIIa-Fc ⁇ RIII heterodimeric polynucleotide may be created from these amplified products using similar PCR and cloning techniques as those described in Example 1. Insert size and orientation may be confirmed by analytical restriction enzyme digestion or DNA sequencing.
- the operably fused Fc ⁇ RIIa-Fc ⁇ RIII heterodimeric polynucleotide can be cloned into various expression vectors.
- the Fc ⁇ RIIa-Fc ⁇ RIII heterodimeric polynucleotide may be ligated into the EcoRI/ Xbal sites of modified pBACPAK9 (Invitrogen Life Tech) in which the BamHl site in the multiple cloning site had first been eliminated by digest with BamHl, filling in using Klenow fragment of DNA polymerase and re-ligation. Insert sizes may be defined by EcoRl/ Xbal digest and the correct orientation of the multimerising B ⁇ raHI fragment can be screened by Pvu ⁇ l digest using standard protocols.
- the Fc ⁇ RIIa-Fc ⁇ RIII heterodimeric polynucleotide can be cloned into mammalian expression vectors.
- the Gateway LR clonase reaction (Invitrogen, Life Technologies) may be used to transfer operationally fused multimeric Fc receptor polynucleotide fragments into GatewayTM reading frame-A cassette (Invitrogen, Life Technologies) adapted expression vector pAPEX3P (Evans et al, 1995, and Christiansen et al, 1996) to give mammalian expression vectors expressing the fused Fc receptor multimers.
- Gateway LR clonase reaction can be used to transfer the operationally fused multimeric Fc receptor polynucleotide fragments into GatewayTM reading frame- A cassette (Invitrogen, Life Technologies) adapted expression vector pIRESneo (Clontech).
- Multimerisation of Fc binding regions generates molecules having higher avidity interactions with Fc domains. Each monomer in the multimer is able to separately interact with the Fc domain of immunoglobulins to give higher avidities.
- Multimers containing Fc binding domains derived from different Fc receptors may be generated. For example, multimers could be formed from combinations of the Fc binding regions of Fc ⁇ RI, Fg ⁇ RIIa, Fc ⁇ RIIb, Fc ⁇ RIIIa, Fc ⁇ RIIIb, Fc ⁇ RI and Fc ⁇ RI. Heterodimers could also be formed from combinations of these Fc binding regions.
- Fc ⁇ RIIa-Fc ⁇ RIII, Fc ⁇ RIIa- Fc ⁇ RI, and Fc ⁇ RI-Fc ⁇ RIII heterodimers could be formed, as well as heterodimers consisting of other combinations of Fc binding regions.
- the Fc binding domains of a number of Fc receptors have been defined by mutagenesis or crystallography (IgG and Fc ⁇ R: Maxwell et al. 1999, Radaev et al, 2001, Sondermann et al, 2000, Hulett et al, 1988, Hulett et al, 1991, Hulett et al, 1994, Hulett et al, 1995; IgE and Fc ⁇ RI: Garman et al, 2000; IgA and Fc ⁇ RI interactions: Wines et al, 2001, Herr et al, 2003). Further, comparisons of similar FcR sequences and comparative analysis of Fc receptor structures have been made (Sondermann et al, 2001).
- Such sequences could include the loops of the first extracellular domain of Fc ⁇ RI of CD89 that are known to interact with IgA, such loops would include the BC, CE and FG loops of domain 1.
- Important residues include amino acids 35, 52 and 81-86 (Wines et ah, 2001, Herr et al, 2003). In this way, receptor polypeptides and proteins containing segments capable of interacting with different classes of immunoglobulins are possible.
- Garman SC et al 2000. Structure of the Fc fragment of human IgE bound to its high-affinity receptor Fc epsilonRI alpha. Nature 406(6793) :259-66. 10. Herr AB et al, 2003. Insights into IgA-mediated immune responses from the crystal structures of human FcalphaRI and its complex with IgAl-Fc. Nature 423(6940) :614-20.
- the IgG Fc contains distinct Fc receptor (FcR) binding sites: the leukocyte receptors Fc gamma RI and Fc gamma RIIa bind to a region in the Fc distinct from that recognized by neonatal FcR and protein A. J. Immunol. 164:5313-8
Abstract
Description
Claims
Priority Applications (7)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
BRPI0721078-7A2A BRPI0721078A2 (en) | 2006-12-13 | 2007-12-13 | MULTIMERIC Fc RECEIVER POLYPEPTIDES INCLUDING A MODIFIED Fc DOMAIN |
JP2009540549A JP2010512154A (en) | 2006-12-13 | 2007-12-13 | Multimeric Fc receptor polypeptide comprising a modified Fc domain |
AU2007332085A AU2007332085A1 (en) | 2006-12-13 | 2007-12-13 | Multimeric Fc receptor polypeptides including a modified Fc domain |
CNA2007800444602A CN101611052A (en) | 2006-12-13 | 2007-12-13 | The Multimeric Fc receptor polypeptides that comprises the Fc structural domain of modification |
US12/518,907 US20100112080A1 (en) | 2005-12-13 | 2007-12-13 | MULTIMERIC Fc RECEPTOR POLYPEPTIDES INCLUDING A MODIFIED Fc DOMAIN |
EP07845376A EP2099819A4 (en) | 2006-12-13 | 2007-12-13 | Multimeric fc receptor polypeptides including a modified fc domain |
CA002671732A CA2671732A1 (en) | 2006-12-13 | 2007-12-13 | Multimeric fc receptor polypeptides including a modified fc domain |
Applications Claiming Priority (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AUPCT/AU2006/001890 | 2006-12-13 | ||
PCT/AU2006/001890 WO2007068047A1 (en) | 2005-12-13 | 2006-12-13 | Multimeric fc receptor polypeptides |
US11/762,664 US8354109B2 (en) | 2005-12-13 | 2007-06-13 | Multimeric Fc receptor polypeptides |
US11/762,664 | 2007-06-13 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2008070927A1 true WO2008070927A1 (en) | 2008-06-19 |
Family
ID=40961582
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/AU2007/001934 WO2008070927A1 (en) | 2005-12-13 | 2007-12-13 | Multimeric fc receptor polypeptides including a modified fc domain |
Country Status (6)
Country | Link |
---|---|
EP (1) | EP2099819A4 (en) |
JP (1) | JP2010512154A (en) |
BR (1) | BRPI0721078A2 (en) |
CA (1) | CA2671732A1 (en) |
RU (1) | RU2009126545A (en) |
WO (1) | WO2008070927A1 (en) |
Cited By (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP2492689A1 (en) * | 2011-02-22 | 2012-08-29 | Bernhard-Nocht-Institut für Tropenmedizin | Detection of antibodies using an improved immune complex (IC) ELISA |
CN102718836A (en) * | 2009-04-24 | 2012-10-10 | 上海交通大学医学院附属瑞金医院 | Short peptide, immune inhibitor containing the same and application thereof |
CN103911387A (en) * | 2013-01-08 | 2014-07-09 | 深圳先进技术研究院 | Eukaryotic expression vector containing mouse IgG2a Fc label, and its construction method |
WO2022253272A1 (en) * | 2021-06-01 | 2022-12-08 | Virogin Biotech Canada Ltd. | Multivalent recombinant ace2 and uses thereof |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR101685532B1 (en) * | 2016-04-26 | 2016-12-13 | 한국프라임제약주식회사 | A VEGFR fusion protein |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2004062619A2 (en) * | 2003-01-13 | 2004-07-29 | Macrogenics, Inc. | SOLUBLE FcϜR FUSION PROTEINS AND METHODS OF USE THEREOF |
WO2005075512A1 (en) * | 2004-02-10 | 2005-08-18 | The Austin Research Institute | Crystal structures and models for fc receptors and uses thereof in the design or identification of fc receptor modulator compounds |
WO2007068047A1 (en) * | 2005-12-13 | 2007-06-21 | Trillium Therapeutics Inc | Multimeric fc receptor polypeptides |
Family Cites Families (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR100453877B1 (en) * | 2001-07-26 | 2004-10-20 | 메덱스젠 주식회사 | METHOD OF MANUFACTURING Ig-FUSION PROTEINS BY CONCATAMERIZATION, TNFR/Fc FUSION PROTEINS MANUFACTURED BY THE METHOD, DNA CODING THE PROTEINS, VECTORS INCLUDING THE DNA, AND CELLS TRANSFORMED BY THE VECTOR |
-
2007
- 2007-12-13 JP JP2009540549A patent/JP2010512154A/en active Pending
- 2007-12-13 RU RU2009126545/10A patent/RU2009126545A/en not_active Application Discontinuation
- 2007-12-13 CA CA002671732A patent/CA2671732A1/en not_active Abandoned
- 2007-12-13 EP EP07845376A patent/EP2099819A4/en not_active Withdrawn
- 2007-12-13 BR BRPI0721078-7A2A patent/BRPI0721078A2/en not_active Application Discontinuation
- 2007-12-13 WO PCT/AU2007/001934 patent/WO2008070927A1/en active Application Filing
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2004062619A2 (en) * | 2003-01-13 | 2004-07-29 | Macrogenics, Inc. | SOLUBLE FcϜR FUSION PROTEINS AND METHODS OF USE THEREOF |
WO2005075512A1 (en) * | 2004-02-10 | 2005-08-18 | The Austin Research Institute | Crystal structures and models for fc receptors and uses thereof in the design or identification of fc receptor modulator compounds |
WO2007068047A1 (en) * | 2005-12-13 | 2007-06-21 | Trillium Therapeutics Inc | Multimeric fc receptor polypeptides |
Non-Patent Citations (5)
Title |
---|
HARRISON P.T. AND ALLEN J.M.: "High affinity IgG binding by FcgammaRI(CD64) is modulated by two distinct IgSF domains and the transmembrane domain of the receptor", PROTEIN ENGINEERING, vol. 11, no. 3, 1998, pages 225 - 232, XP003014119 * |
KERSHAW M.H. ET AL.: "Redirected Cytotoxic Effector Function", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 271, no. 35, 1996, pages 21214 - 21220, XP003014118 * |
KRAGH-HANSEN U. ET AL.: "Practical Aspects of the Ligand-Binding and Enzymatic Properties of Human Serum Albumin", BIOLOGICAL AND PHARMACEUTICAL BULLETIN, vol. 25, no. 6, 2002, pages 695 - 704, XP002430540 * |
LI P. ET AL.: "Recombinant CD16A-Ig forms a homodimer and cross-blocks the ligand binding functions of neutrophil and monocyte Fcgamma receptors", MOLECULAR IMMUNOLOGY, vol. 38, no. 7, 2001, pages 527 - 538, XP002995781 * |
See also references of EP2099819A4 * |
Cited By (9)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102718836A (en) * | 2009-04-24 | 2012-10-10 | 上海交通大学医学院附属瑞金医院 | Short peptide, immune inhibitor containing the same and application thereof |
CN102718836B (en) * | 2009-04-24 | 2014-04-16 | 上海交通大学医学院附属瑞金医院 | Short peptide, immune inhibitor containing the same and application thereof |
EP2492689A1 (en) * | 2011-02-22 | 2012-08-29 | Bernhard-Nocht-Institut für Tropenmedizin | Detection of antibodies using an improved immune complex (IC) ELISA |
WO2012113801A1 (en) * | 2011-02-22 | 2012-08-30 | Bernhard-Nocht-Institut Fuer Tropenmedizin | Detection of antibodies using an improved immune complex (ic) elisa |
CN103460048A (en) * | 2011-02-22 | 2013-12-18 | 伯恩哈德-诺策热带医学研究所 | Detection of antibodies using an improved immune complex (IC) ELISA |
US20140080120A1 (en) * | 2011-02-22 | 2014-03-20 | Bernhard-Nocht-Institut Fuer Tropenmedizin | Detection of antibodies using an improved immune complex (ic) elisa |
US9945846B2 (en) * | 2011-02-22 | 2018-04-17 | Bernhardt-Nocht-Institut Fuer Tropenmedizin | Detection of antibodies using an improved immune complex (IC) ELISA |
CN103911387A (en) * | 2013-01-08 | 2014-07-09 | 深圳先进技术研究院 | Eukaryotic expression vector containing mouse IgG2a Fc label, and its construction method |
WO2022253272A1 (en) * | 2021-06-01 | 2022-12-08 | Virogin Biotech Canada Ltd. | Multivalent recombinant ace2 and uses thereof |
Also Published As
Publication number | Publication date |
---|---|
RU2009126545A (en) | 2011-01-20 |
JP2010512154A (en) | 2010-04-22 |
BRPI0721078A2 (en) | 2014-10-07 |
EP2099819A1 (en) | 2009-09-16 |
EP2099819A4 (en) | 2010-03-17 |
CA2671732A1 (en) | 2008-06-19 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US8729247B2 (en) | Multimeric Fc receptor polypeptides | |
EP1960427B1 (en) | Multimeric fc receptor polypeptides | |
Chang et al. | A general method for facilitating heterodimeric pairing between two proteins: application to expression of alpha and beta T-cell receptor extracellular segments. | |
JP6228971B2 (en) | CTLA-4 variant | |
EP3737701A1 (en) | Transferrin receptor-binding polypeptides and uses thereof | |
US20130011401A1 (en) | Soluble proteins for use as therapeutics | |
US20230227584A1 (en) | Bispecific antibodies comprising a modified c-terminal crossfab fragment | |
AU2018369639A1 (en) | D-domain containing polypeptides and uses thereof | |
JP2015501147A (en) | CD40L-specific Tn3-derived scaffold and method of use thereof | |
US11414496B2 (en) | Anti-CD38 binding domains | |
AU2007332085A1 (en) | Multimeric Fc receptor polypeptides including a modified Fc domain | |
KR20230020022A (en) | Ctla-4 variant immunomodulatory proteins and uses thereof | |
KR20200098512A (en) | Variants with Fc fragments with increased affinity for FcRn and increased affinity for at least one Fc fragment receptor | |
AU2020262424B2 (en) | CD80 variant proteins and uses thereof | |
EP2099819A1 (en) | Multimeric fc receptor polypeptides including a modified fc domain | |
Fridman et al. | Structure and expression of Fc receptors (FcR) | |
TW202413409A (en) | Multi-domain binding molecules | |
WO2023081959A1 (en) | Immunotherapeutic proteins comprising an fc region component with a mutation at position 429 | |
Jazayeri et al. | Half‐Life Extension by Fusion to the Fc Region | |
Fridman et al. | Cell-mediated effects of immunoglobulins | |
WO2024038198A1 (en) | Multi-domain binding molecules |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
WWE | Wipo information: entry into national phase |
Ref document number: 200780044460.2 Country of ref document: CN |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2007845376 Country of ref document: EP |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 07845376 Country of ref document: EP Kind code of ref document: A1 |
|
WWE | Wipo information: entry into national phase |
Ref document number: 576998 Country of ref document: NZ |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2007332085 Country of ref document: AU |
|
WWE | Wipo information: entry into national phase |
Ref document number: 1018/MUMNP/2009 Country of ref document: IN |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2671732 Country of ref document: CA |
|
ENP | Entry into the national phase |
Ref document number: 2007332085 Country of ref document: AU Date of ref document: 20071213 Kind code of ref document: A |
|
ENP | Entry into the national phase |
Ref document number: 2009540549 Country of ref document: JP Kind code of ref document: A |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
ENP | Entry into the national phase |
Ref document number: 2009126545 Country of ref document: RU Kind code of ref document: A |
|
WWE | Wipo information: entry into national phase |
Ref document number: 12518907 Country of ref document: US |
|
ENP | Entry into the national phase |
Ref document number: PI0721078 Country of ref document: BR Kind code of ref document: A2 Effective date: 20090615 |