JP2010512154A - Multimeric Fc receptor polypeptide comprising a modified Fc domain - Google Patents

Abstract

Disclosed are soluble multimeric polypeptides or proteins capable of inhibiting the interaction of leukocyte Fcγ receptor (FcγR) and immunoglobulin G (IgG). The protein or polypeptide comprises two or more Fc binding regions bound in a head-to-tail configuration, at least one of which is derived from an FcγR type receptor and reduces binding to the Fc binding region or Included in the Fc domain of an immunoglobulin that has been modified to inhibit and / or alter effector function. Also described are polynucleotide molecules encoding the polypeptide or protein and their use in methods of treating a subject for immune complex (IC) mediated inflammatory diseases.

Description

The present invention relates to leukocyte Fcγ receptor (FcγR) and immunoglobulin G (IgG).
It relates to soluble multimeric Fc receptor polypeptides and proteins capable of inhibiting interactions. Such polypeptides and proteins are useful for the treatment of inflammatory diseases, particularly immune complex-mediated inflammatory diseases such as rheumatoid arthritis (RA), immune thrombocytopenic purpura (ITP) and systemic lupus erythematosus (SLE). It is.

Incorporation by Reference This patent application:
-PCT / AU2006 / 001890 title "multimeric Fc receptor polypeptide" filed December 13, 2006, and-US11 / 762,664 title "multimeric Fc receptor polypeptide" 20
Claims priority from application filed on June 13, 2007.
The entire contents of these patent applications are included in this disclosure by reference.

Treatment of autoimmune diseases and other inflammatory diseases such as RA and SLE is a major understanding of the molecules involved in the immune system, with major inflammatory molecules such as tumor necrosis factor-α (TNFα) and interleukin 1β (IL-1β) A new and exciting aspect has been entered that allows specific inhibition of. For example, recent studies have shown that antibodies can play a powerful role in the pathogenesis of RA, and anti-CD20 monoclonal antibodies (MAbs) for erasing antibody-producing B cells in human clinical trials.
A positive response to the use of therapy has generated strong evidence for an important role of antibodies in RA (Emery et al., 2001). Because the Fc receptor (FcR) plays a central role in immunoglobulin-based effector systems,
Inhibition of FcR function may provide the basis for effective therapies for various diseases. Furthermore, targeting the interaction between leukocyte FcγRs and antibodies opens up new opportunities for therapeutic intervention in RA, since the Fcγ receptor (FcγR) is central to the effector system for IgG. Provided (Nabbe et al., 2003)
. One way to achieve such intervention, which is the applicant's objective, is to use a soluble form of FcγR that acts as a “bait” to prevent leukocyte activation by antibodies.

The Fc receptor (FcR) is a leukocyte surface glycoprotein that specifically binds the Fc portion of an antibody. The receptor for IgG is FcγR, the most extensive and diverse, with the main types being FcγRI (CD64), FcγRII (CD32) and Fcγ.
RIII (CD16). The immune complex (IC) formed in vivo with a normal immune response, and those found in the pathology of autoimmune diseases such as RA, can involve multiple FcRs simultaneously. For example, in humans, activated macrophages, neutrophils, eosinophils and mast cells can express FcγRI, FcγRIIa, FcγRIIb and FcγRIII (Takai, 2002). However, of these, FcγRIIa is a major trigger for IC-mediated inflammation, and
Since all of the FcγR types are involved in the lower hinge region of the IgG Fc domain and the CH2 domain, any soluble FcγR decoy polypeptide can be used in all classes of F
Although it is possible to inhibit the binding of IgG to cγR, Applicants have developed and studied soluble FcγRIIa as FcγRIIa exhibits the broadest binding specificity and highest selectivity for binding active IgG immune complex binding. I understand that it offers potential.

Indeed, previous studies have shown that the FcγRIIa ectodomain (Ierino)
Et al., 1993a) a simple recombinant soluble FcγRIIa polypeptide (r
sFcγRIIa monomer) can clearly inhibit IC-mediated inflammation. In these studies, rsFcγRIIa forms an immune complex in the dermis by passive administration of antibodies and antigens (Pflum et al., 1979).
hus) reaction, which is a model of vasculitis (extraarticular complications in arthritis) and also occurs in SLE. rsFcγRIIa monomer inhibits inflammation and neutrophil infiltration when co-administered with antibody and antigen, while a relatively low level of selectivity for immune complexes requires large amounts of rsFcγRIIa monomer Was found to be. In order to overcome this problem, Applicants have identified rsFcγ.
Proposed to use RIIa decoy multimeric forms and surprisingly found that not only were they able to successfully express such multimeric forms, but they also showed increased selectivity for immune complexes. ing. Such multimeric rsFcγRIIa polypeptides thus show significant promise for the treatment of IC-mediated inflammatory diseases such as RA and SLE.

Problems to be Solved by the Invention and Means for Solving the Problems

Accordingly, in a first aspect, the present invention provides a soluble multimeric polypeptide capable of inhibiting the interaction of leukocyte Fcγ receptor (FcγR) and immunoglobulin G (IgG), said polypeptide binding in a head-to-tail configuration. Two or more Fc binding regions, at least one of which is modified to reduce or inhibit binding to the FcγR type receptor and said Fc binding region and / or to alter effector function Derived from the Fc domain of an immunoglobulin.

Preferably, the polypeptide is a multimer of Fc binding regions derived from FcγRII type receptors, in particular FcγRIIa. Such molecules can be considered to be homomultimers, and one particularly preferred molecule of this type is a homodimer of the Fc binding region derived from the FcγRII type receptor. However, the present invention also provides that the molecule is derived from an FcγR type receptor (eg, FcγRII type receptor) and an Fc binding region from another source (eg, an Fc binding region from another Fc receptor type or It is also contemplated that it can be a multimer of (synthetic Fc binding polypeptides). This type of molecule can be considered to be a heteromultimer, and one particularly preferred molecule of this type is a heterologous Fc binding region derived from an FcγRII type receptor and an Fc binding region derived from an FcγRIII type receptor. It is a dimer.

The Fc binding region can be linked via a peptide bond or via a short linker sequence (eg 1 amino acid or a short peptide, eg 2 to 20 amino acids in length).

In a second aspect, the present invention provides a soluble multimeric protein comprising the polypeptide of the first aspect.

In a third aspect, the present invention provides a polynucleotide molecule comprising a nucleotide sequence encoding a polypeptide according to the first aspect or a protein according to the second aspect.

The polynucleotide molecule may be an expression cassette or expression vector (eg, a plasmid for introduction into a bacterial host cell, or a viral vector such as a baculovirus vector for transfection of an insect host cell, or for transfection of a mammalian host cell. Viral vectors such as plasmids or lentiviruses).

Accordingly, in a fourth aspect, the present invention provides a recombinant host cell comprising a polynucleotide molecule according to the third aspect.

In a fifth aspect, the invention provides:
(I) providing a recombinant host cell comprising a polynucleotide molecule according to the third aspect;
(Ii) culturing the host cell in a suitable medium and under conditions suitable for the expression of the polypeptide or protein; and (iii) the polypeptide or protein from the culture and optionally from the culture medium. A method for producing a polypeptide or protein comprising the step of isolating is provided.

In a sixth aspect, the invention is a method of treating a subject for an inflammatory disease comprising:
Administering the polypeptide of the first aspect or the protein of the second aspect to the subject, optionally in combination with a pharmaceutically or veterinarily acceptable carrier or additive, The method is provided.

FIG. 1 provides the nucleotide sequence (and translated amino acid sequence) of two FcγRIIa extracellular region head-to-tail homodimeric constructs that contain both FcγRIIa ectodomains, ie, ectodomains 1 and 2, respectively. . FcγRIIa ectodomains 1 and 2 consist of amino acids 1 to 174 of the FcγRIIa polypeptide sequence comprising amino acids 1 to 88 comprising domain 1 and amino acids 89 to 174 comprising domain 2 (Hibbs et al., 1988; Homo sapiens) IgG Fc fragment, low affinity IIa receptor (CD32) (FCGR2A), mRNA, accession number (ACCESSION NM) — 021642; and Powell et al., 1999). In the figure, amino acids 1 to 182 are derived from the extracellular region of FcγRIIa, of which amino acids 1 to 174 include FcγRIIa ectodomains 1 and 2, and amino acids 175 to 182 include the membrane stalk (external domain 1 and 2 to the transmembrane sequence). The first of the FcγRIIa extracellular region containing the dimer thus consists of amino acids 1 to 182 and the second of the FcγRIIa extracellular region consists of amino acids 184 to 362 (corresponding to amino acids 3 to 182 of FcγRIIa). Underlined amino acids represent non-FcγRIIa linker amino acid residues, while bold amino acids indicate a C-terminal His ₆ tag. FIG. 2 shows a Western blot analysis of recombinant soluble (rs) multimeric forms of FcγRIIa expressed from the nucleotide sequence shown in FIG. The rsFcγRIIa dimer was substantially stable and only a small amount of rsFcγRIIa monomer degradation product was observed. On the other hand, the rsFcγRIIa trimer and tetramer forms were unstable and substantially degraded to the rsFcγRIIa dimer form. This degradation can be avoided by the use of protease inhibitors during manufacture or by altering the multimeric form of the sequence to eliminate the cleavage site separately. FIG. 3 shows fractions recovered from purification of rsFcγRIIa monomer (expressed from mammalian cells) with an expected size of ˜30 kDa (a) and rsFcγRIIa dimer with an expected size of ˜50 kDa (b). Shows Coomassie-stained SDS-PAGE (12% acrylamide gel, under non-reducing conditions). FIG. 4 schematically shows the equilibrium binding reaction of rsFcγRIIa monomer to immobilized (a) IgG monomer (Sandglobulin) and (b) heat-aggregated IgG (HAGG) of a model immune complex. . FIG. 5 schematically shows the equilibrium binding reaction of rsFcγRIIa dimer to immobilized (a) IgG monomer (Sandglobulin) and (b) model immune complex to HAGG. FIG. 6 shows after a previous reaction in solution with human IgG monomer (Sandglobulin) and dimer-IgG (Wright et al., 1980) as measured using standard BIAcore assay procedures. 2 shows a plot of rsFcγRIIa monomer (a) and rsFcγRIIa dimer (b) expressed from the nucleotide sequence of FIG. 1 bound to immobilized human IgG monomer (Sandglobulin). FIG. 7 shows (a) dimer-IgG (right) with human neutrophils (volunteer V5) with purified rsFcγRIIa monomer and rsFcγRIIa dimer, calculated as a percentage of non-inhibited dimer-IgG binding activity. (Wright) et al., 1980) Inhibition of binding and (b) human neutrophils by purified rsFcγRIIa dimer (expressed from the nucleotide sequence of FIG. 1) calculated as a percentage of the dimer-IgG binding dimer. FIG. 6 shows a plot of inhibition of dimer-IgG binding with (volunteer V1). FIG. 7 shows (a) dimer-IgG (right) with human neutrophils (volunteer V5) with purified rsFcγRIIa monomer and rsFcγRIIa dimer, calculated as a percentage of non-inhibited dimer-IgG binding activity. (Wright) et al., 1980) Inhibition of binding and (b) human neutrophils by purified rsFcγRIIa dimer (expressed from the nucleotide sequence of FIG. 1) calculated as a percentage of the dimer-IgG binding dimer. FIG. 6 shows a plot of inhibition of dimer-IgG binding with (volunteer V1). FIG. 8 shows immune complexes (dimers) from 24-hour differentiated human MDM (volunteer V5) in the absence and presence of rsFcγRIIa dimer (at 2.5 μg / ml in the supernatant) in (a). Body-IgG) shows a plot of stimulated TNF secretion; while (b) shows immune complexes from 24-hour differentiated human MDM (volunteer V1) in the absence and presence of rsFcγRIIa dimer (2.5 μg / ml) (Dimer-IgG) Plot of stimulated TNF secretion is shown. FIG. 9 shows a plot of immune complex (HAGG) stimulated activation of human platelets measured by mean fluorescence intensity (MFI) of P-selectin expression in the absence and presence of rsFcγRIIa dimer (30 μg / ml). Show. FIG. 10 uses (a) non-reducing and (b) SDS-PAGE under reducing conditions of rsFcγRIIa dimers isolated from stably transfected CHO-S cells, (c) using anti-FcγRIIa antibodies. The analysis result by Western blotting and (d) HPLC is shown. The rsFcγRIIa dimer migrated as a single band at the expected molecular weight (˜50 kD), reacted with anti-FcγRIIa antibody, and was> 96% pure as determined by HPLC analysis. FIG. 11 shows a plot of immune complex (HAGG) binding to cell surface expressed human FcγRIIb (on mouse B lymphoma cell line IIA1.6) in the presence of either rsFcγRIIa monomer or rsFcγRIIa dimer. Show. FIG. 12 shows the activity after treatment with HAGG in the presence of rsFcγRIIa monomer or rsFcγRIIa dimer (expressed from the nucleotide sequence of FIG. 1) as a percentage of activated platelets after treatment with HAGG alone. Plots of platelet platelets (positive for both CD41 and CD62P) are shown. FIG. 13 shows that MC / 9 cells after incubation with OVA immune complex in the presence of rsFcγRIIa monomer or rsFcγRIIa dimer as a percentage of TNF- (released in the presence of OVA immune complex alone. Shows a plot of TNF- (release from. FIG. 14 shows Western blot analysis of rsFcγRIIa fusion protein. (1) rsFcγRIIa monomer; (2) rsFcγRIIa dimer; (3) rsFcγRIIa monomer fused with IgG ₁ -Fcγ1 (L234A, L235A); (4) fused with IgG ₁ -Fcγ1 (L234A, L235A) (5) rsFcγRIIa monomer fused with human serum albumin (HSA); (6) rsFcγRIIa dimer fused with HSA; (7) purified rsFcγRIIa monomer standard; and (8) purification rsFcγRIIa dimer standard. FIG. 15 shows the results of a HAGG capture ELISA using rsFcγRIIa monomer and rsFcγRIIa dimer fusion. (A) FcγRIIa monomer standard starting at 0.75 μg / ml (monomer standard) (Powell et al., 1999); rsFcγRIIa monomer construct (transfection 426 (monomer)) Protein from cells transfected with rsFcγRIIa monomer fusion (monomer-Fc) with IgG-Fcγ1 (L234A, L235A) construct; and rsFcγRIIa single amount with HSA construct Protein derived from cells transfected with a fusion (HSA-monomer); (b) rsFcγRIIa dimer standard starting at 0.5 μg / ml (dimer standard); rsFcγRIIa dimer (transfection) 427 (dimer) Supernatant derived from cells transfected with rsFcγRIIa dimer fusion (dimer-Fc) with IgG-Fcγ1 (L234A, L235A); and HSA Supernatant from cells transfected with the rsFcγRIIa dimer fusion (HSA-dimer). FIG. 16 shows the results obtained from the capture tag ELISA for rsFcγRIIa monomer and rsFcγRIIa dimer fusion protein to confirm the presence of an epitope that establishes that the receptor is properly folded. (A) rsFcγRIIa monomer standard starting at 0.75 μg / ml (monomer standard); supernatant from cells transfected with rsFcγRIIa monomer (transfection 426 (monomer)); IgG − Supernatant from cells transfected with rsFcγRIIa monomer fusion (monomer-Fc) with Fcγ1 (L234A, L235A); and rsFcγRIIa monomer fusion with HSA (HSA-monomer) Supernatant from cells transfected; (B) transfected with rsFcγRIIa dimer standard (self-made) starting at 0.5 μg / ml; FcγRIIa dimer (transfection 427 (dimer)) Cell-derived supernatant; rsFcγRIIa dimer fusion IgG-Fcγ1 (L 234A, L235A) (dimer-Fc) derived from cells transfected; and rsFcγRIIa dimer fusion with HSA (HSA-dimer) derived from cells transfected Kiyoshi. FIG. 17 shows (a) rsFc (RIIa monomer; (b) rsFcγRIIa dimer; (c) dimerization occurs via the Fc domain of the rsFcγRIIa monomer fusion polypeptide. A dimer of an rsFcγRIIa monomer fusion with IgG-Fcγ1 (L234A, L235A), giving a molecule having a (ie a protein that is dimeric or “bivalent” for the Fc binding region); (d ) Dimerization occurs through the two Fc domains of the rsFcγRIIa dimer fusion polypeptide and has four Fc binding regions (ie, is tetrameric or has “tetravalent” Fc binding regions) A dimer of an rsFcγRIIa dimer fusion with IgG-Fcγ1 (L234A, L235A) giving (protein); (e) HSA (F) Schematic representation of rsFcγRIIa dimer fusion with HSA, where D1 and D2 refer to ectodomains 1 and 2, respectively, adjacent to D2 The bar represents the linker sequence, (c) and (d) the gray loop above the dimerized Fc domain represents the disulfide bond, and H ₆ refers to the His tag). FIG. 18 shows the effect of rsFcγRIIa dimer (no fusion partner) in a mouse model of arthritis. Mice treated with arthritis-inducing anti-collagen antibodies in the absence (black squares) and presence (white squares) of FcγRIIa dimers. FIG. 19 shows the amino acid sequence of one embodiment of the present invention, ie, an rsFcγRIIa dimer fusion with an Fc domain derived from IgG2a (this fusion protein is hereinafter referred to as D2 protein). FIG. 20 shows the nucleotide sequence encoding the D2 protein of FIG. FIG. 21 illustrates the plasmid used to express the nucleotide sequence of FIG. 20 (encoding D2 protein). FIG. 22 shows analysis of the purified D2 protein of FIG. 19 by SDS-PAGE (FIG. A) and by Western blot (FIG. B). FIG. 23 shows the effect of D2 protein (of FIG. 19) on TNF-α release in the MC / 9 mast cell assay. FIG. 24 shows the effect of D2 protein (of FIG. 19) on human neutrophil activation. and FIG. 25 shows the effect of D2 protein (of FIG. 19) on human platelet activation.

The present invention relates to leukocyte Fcγ receptor (FcγR) and immunoglobulin G (Ig), comprising two or more Fc binding regions, one of which is essentially derived from an FcγR type receptor.
Soluble multimeric polypeptides and proteins capable of inhibiting the interaction of G) are provided. Such polypeptides and proteins provide increased selectivity for immune complexes than previously observed with soluble monomeric polypeptides such as rsFcγRII monomer, and thereby IC-mediated inflammation such as RA and SLE. Offers significant promise as a “bait” molecule for the treatment of sexually transmitted diseases.

In a first aspect, the invention thus provides a soluble multimeric polypeptide capable of inhibiting the interaction of leukocyte Fcγ receptor (FcγR) and immunoglobulin G (IgG), said polypeptide bound in a head-to-tail configuration. Comprises two or more Fc binding regions, at least one of which is modified to reduce or inhibit binding to FcγR-type receptor and said Fc binding region and / or to alter effector function Derived from the Fc domain of an immunoglobulin.

As used herein, the term “soluble” is characterized by the absence or functional disruption of all or a substantial portion of the transmembrane (ie, lipophilic) domain where the polypeptide (or protein) is not associated with the cell membrane. Thus indicating that the polypeptide (or protein) has no membrane binding function. The cytoplasmic domain can also be absent.

As used herein, the term “Fc binding region” can bind to an Fc domain of an immunoglobulin (eg, an Fc fragment generated by immunoglobulin papain hydrolysis),
Refers to any one or more portions of Fc receptors, including genetically modified and synthetic Fc binding polypeptides.

At least one Fc binding region derived from an FcγR-type receptor is, for example, Ig
It can be derived from FcγR which has a low affinity for G, ie an affinity for IgG of less than 5 × 10 ⁷ M ⁻¹ . Such low affinity receptors are FcγRII type receptors (eg, polymorphic variants FcγRIIa-H131 and FcγRIIa-R13).
FcγRIIa containing 1 (Stuart et al., 1987; Brooks et al., 1989; Seki et al., 1989), FcγRI
Ib and FcγRIIc), FcγRIII type receptors (eg FcγRIII)
Cleavage of FcγRI-type receptors such as a and FcγRIIIb), a cleavage polypeptide comprising the first and second of the three outer domains of the FcγRI receptor (Hulett et al., 1991; Hewlett et al., 1998) Forms (eg FcγRIa and FcγRIb), and usually 5 × 10 ⁷ M ⁻ for IgG with high affinity for IgG but due to modifications (eg one or more amino acid substitutions, deletions and / or additions) F exhibiting reduced affinity of less than ¹
a genetically modified form of cγR).

Preferably, the polypeptide is a homomultimer of an Fc binding region derived from an FcγR receptor, such as a low affinity FcγR. Suitable Fc binding regions consist of all or one Fc binding portion of one or more ectodomains of the FcγR receptor. One skilled in the art can readily identify the Fc-binding ectodomain of the FcγR receptor. Because these domains belong to the IgG domain superfamily (Hulet
t) et al., 1994, Hewlett et al., 1995, Hewlett et al., 1998, and Tamm et al., 1996) and typically “tryptophan sandwiches” (eg, residues W90 and W113 of FcγRIIa) and other residues (Eg in FcγRIIa; ectodomain 1
And ectodomain 2 linker residues, and BC of ectodomain 2 (W113-
V119), C′E (F132-P137) and FG (G159-Y160) loops (Hulett et al., 1994)).

More preferably, the polypeptide is a homomultimer of the Fc binding region of FcγRIIa. A suitable Fc binding region derived from FcγRIIa consists of all or one Fc binding portion of ectodomains 1 and 2 of FcγRIIa. FcγRIIa
External domains 1 and 2 are amino acids 1 to 172 of the FcγRIIa amino acid sequence.
(Hibbs et al., 1988, and accession number (ACCE)
SSIONNM) _021642). FcγRIIa ectodomain 1 and 2 F
An example of a c-binding moiety is a fragment comprising amino acids 90 to 174 of the FcγRIIa amino acid sequence, the residues of the ectodomain 1 and ectodomain 2 linkers and the ectodomain 2 BC (W113-V119), C′E (F132— P137) and FG
(G159-Y160) including a loop. X-ray crystallography studies have shown that within this fragment amino acids 113-116, 129, 131, 133, 134, 155, 156 and 15
It has been clarified that 8-160 makes an important contribution to the surface of a fragment capable of binding to the Fc domain of IgG (International Publication WO2005 / 075512).

The polypeptide also has an Fc binding region derived from an FcγRII type receptor and an Fc binding region derived from another source (eg, an Fc binding region derived from another Fc receptor type such as another FcγR type, or against IgA and IgE). Heteromultimers of Fc-binding regions from other immunoglobulin receptors such as receptors. One particularly preferred molecule of this type is the FcγRII type receptor (particularly FcγRII).
It is a heterodimer of an Fc binding region derived from a) and an Fc binding region derived from an FcγRIII type receptor.

An Fc binding region that is considered to be “derived from” a particular Fc receptor includes an Fc binding region having an amino acid sequence that is equivalent to the amino acid sequence of the Fc receptor, and a sequence of the Fc binding region found in the Fc receptor Comprising an Fc binding region comprising one or more amino acid modifications. Such amino acid modifications may include amino acid substitutions, deletions, additions or any combination of these modifications and may alter the biological activity of the Fc binding region as compared to the biological activity of the Fc receptor (eg, Amino acid modifications can improve selectivity or affinity for immune complexes; such modifications at amino acids 133, 134, 158-161 are described in WO 96/08512). On the other hand, the Fc-binding region derived from a specific Fc receptor can be compared with the Fc receptor biological activity.
One or more amino acid modifications that do not substantially alter the biological activity of the binding region may be included.
This type of amino acid modification typically includes conservative amino acid substitutions. Typical conservative amino acid substitutions are shown in Table 1 below. Possible specific conservative amino acid substitutions are:
G, A, V, I, L, M; D, E, N, Q; S, C, T; K, R, H: and P,
Nα-alkyl amino acids. In general, conservative amino acid substitutions are (a) the structure of the polypeptide backbone of the Fc binding region at the site of substitution, (b) the charge or hydrophobicity of the polypeptide at the site of substitution, and / or (c). The selection is based on having no substantial effect on the amino acid side chain bulk at the site of substitution. Where an Fc binding region comprising one or more conservative amino acid substitutions is prepared synthetically, the Fc binding region is also one or more not encoded by the genetic code, such as γ-carboxyglutamate and hydroxyproline and D-amino acids. It can contain amino acids.
* Indicates a preferred conservative substitution

The Fc binding region is preferably linked via a peptide bond or via a short linker sequence (eg 1 amino acid or a short peptide, eg 2 to 20 amino acids in length). However, in some circumstances it may be preferable or desirable to link the Fc binding region via other suitable binding means (eg, by chemical cross-linking).

The Fc binding regions of the polypeptides of the invention are linked in a “head to tail” configuration. That is, the C-terminus (“tail”) of the first Fc binding region binds in series with the N-terminus (“head”) of the second Fc binding region. At least 2 combined in this way
There are two Fc binding regions, typically two to four Fc binding regions, but the polypeptide has up to 10 or more (eg 20) Fs bound in a head-to-tail configuration.
It may have a c-bond region. The Fc binding region is typically via a peptide bond or a short linker sequence (eg 1 amino acid or, eg 2 to 20 amino acids in length, or more preferably 2 to 15 amino acids in length, 2 to 10 amino acids, 2 to 8 amino acids in length, or very preferably a short peptide of 2 to 5 amino acids in length). A suitable short linker sequence may be a short random sequence or may comprise a short non-Fc binding region fragment of FcγR (eg, a short fragment of 20 amino acids or less derived from the flanking region of the FcγR membrane pedicle). The linker sequence is, for example, GGGGSGGGGG, which is less sensitive to proteolysis.
It can be a synthetic linker sequence such as S (SEQ ID NO: 4). Such linker sequences can be provided in the form of 2 to 5 tandem “Gly4Ser” units. Connecting the Fc binding region via a peptide bond or a short linker sequence allows for the production of the polypeptide using a recombinant expression system.

Thus, in a first particularly preferred embodiment of the polypeptide according to the invention, the polypeptide comprises 2 to 4 Fc binding regions from FcγRIIa bound in a head-to-tail configuration.

In a second particularly preferred embodiment of the polypeptide according to the invention, the polypeptide comprises two Fc binding regions from FcγRIIa bound in a head-to-tail configuration.

And in a third particularly preferred embodiment of the polypeptide according to the invention, the polypeptide comprises two FcγRIIa extracellular regions comprising ectodomains 1 and 2, respectively, wherein said extracellular region is 1 Are linked in a head-to-tail configuration via a linker comprising 20 to 20 amino acids.

In some embodiments of the invention, the Fc binding region within the polypeptide comprises the sequence PSMG.
It binds via a peptide linker constituting the membrane adjacent stalk region of FcγRIIa represented by SSSP (SEQ ID NO: 7). Equivalent linkers with similar secondary structure, including equivalents incorporating conservative amino acid substitutions, are also useful. 1 or 2
Cleavage and extension of this amino acid sequence with fewer or additional amino acids is also useful.

Suitable linkers are generally those that allow the multimeric polypeptide to adopt a structure in which each Fc binding region can participate in the binding of molecules with an Fc domain. In this way, the linker allows, for example, a polypeptide comprising two linked Fc binding regions to bind a larger amount of a molecule with an Fc domain than is bound by the corresponding monomer. Selection of a suitable linker for this purpose can be performed based on simple binding experiments, as exemplified herein.

The polypeptides of the present invention may further comprise a carrier protein (ie, the polypeptide is a “fusion” of the carrier protein and the two or more bound Fc binding regions and modified Fc domains). The carrier protein can be any suitable carrier protein well known to those skilled in the art, but is preferably human serum albumin (HSA) or another carrier protein commonly used to improve bioavailability. (Ie, by increasing the serum half-life of the polypeptide when administered to a subject). Conveniently, the carrier protein can be fused to the polypeptide by expressing the polypeptide as a fusion protein with the carrier protein according to any method well known to those skilled in the art.

The polypeptides of the present invention may further comprise other useful binding molecules such as ethylene glycol to improve bioavailability (ie to produce PEGylated polypeptides), complement regulatory molecules such as CD46, CD55 and CD59, cytokines ( For example to allow delivery of cytokines to the site of inflammation) and cytokine receptors.

The polypeptides of the present invention comprise an immunoglobulin Fc domain. This Fc domain can bind (ie, form a dimer) with another Fc domain, and thereby provide a means to bind two or more polypeptides according to the present invention to form a protein.

Thus, for example, a fusion with an Fc domain that can bind to another Fc domain that may be the same or different and is itself fused to another polypeptide comprising two or more linked Fc binding regions. Two or more combined F
By using a polypeptide that includes a c-binding region, a protein that includes at least four Fc-binding regions (ie, a soluble multimeric protein that includes four or more Fc-binding regions) can be generated.

The Fc domain can be selected from any immunoglobulin (eg, IgG such as IgG ₁ , IgG2a or IgG4). In the wild type, the IgG4 Fc domain has a relatively low affinity for the FcγRII receptor, and thus to avoid self-annealing with the bound Fc binding region of the polypeptide (ie derived from the FcγRII type receptor). It can be used in the polypeptides of the invention without modification. More preferably, however, the selected Fc domain is (in order to prevent self-annealing of the Fc domain with a bound Fc binding region (ie, “self-binding”)) (
Have been modified (eg, by amino acid substitutions at residues critical for binding to the Fc receptor), and preferably modified to prevent binding to the Fc receptor in vivo (ie, the modified Fc domain is Preferably, the neonatal Fc receptor (Fc
Rn) shows reduced affinity for binding of endogenous Fc receptors including, for example, FcγRI, FcγRII and FcγRIII). In addition, the selected F
The c domain is desirably modified to alter effector function, eg, to reduce complement binding, and / or to reduce or eliminate complement dependent cytotoxicity (CDC). Such modifications include, for example, a series of mutations I
It has been extensively described by Clark and co-workers who have designed and described gG1, IgG2 and IgG4 Fc domains and their FcγR binding properties (Armor et al., included in this disclosure by reference).
1999; Armour et al.). For example, 234, 235, 236,
Any one or more of amino acids at positions 237, 297, 318, 320 and 322 may be modified to change affinity for effector ligands such as the Fc receptor or the C1 component of complement (eg, by amino acid substitution). (Winter et al. US Pat. Nos. 5,624,821 and 5,64).
No. 8,260). Also, one or more of the amino acids at positions 329, 331, and 322 may alter C1q binding (eg, by amino acid substitution) and / or reduce or eliminate CDC (eg, by Idusogie et al. US Pat. And / or can be modified to reduce or eliminate antibody-dependent cell-mediated cytotoxicity (ADCC).

In one particularly preferred modified Fc domain, the Fc domain is derived from IgG ₁ (Wines et al., 2000) and amino acids 234 and / or 23
5, ie, Leu ²³⁴ and / or Leu ²³⁵ contain amino acid modifications. These leucine residues are IgG ₁ that the Fc receptor engages with the Fc domain.
In the lower hinge region. One or both of the leucine residues can be substituted or deleted to prevent Fc receptor engagement (ie binding); for example, Leu ²
One or both of ³⁴ and Leu ²³⁵ can be substituted with alanine (ie L234A and / or L235A) or another suitable amino acid (Wines
s) et al., 2000).

In another particularly preferred modified Fc domain, the Fc domain is derived from IgG2a,
And amino acids ²³⁵ , 318, 320 and 322, ie Leu ²³⁵ , Gl
Any one or more of u ³¹⁸ , Lys ³²⁰ and Lys ³²² contain amino acid modifications. Preferably, Leu ²³⁵ is replaced with glutamic acid, and Glu ³¹⁸ , Lys ³²⁰ and Lys ³²² are replaced with alanine.

In another particularly preferred modified Fc domain, the Fc domain comprises human IgG4 containing I
Derived from gG4 and contains an amino acid modification at any one of amino acids 228, 233, 234, 235 and 236. Preferably, the amino acid modifications in the IgG4 Fc domain are Pro ²²⁸ , Pro ²³³ , Val ²³⁴ , Ala ²³⁵ , and 23
Introduce 6 deletions (ie Del ²³⁶ ).

In a second aspect, the present invention provides a soluble multimeric protein comprising the polypeptide of the first aspect.

In a third aspect, the present invention provides a polynucleotide molecule comprising a nucleotide sequence encoding a polypeptide according to the first aspect or a protein according to the second aspect.

The polynucleotide molecule may be an expression cassette or expression vector (eg, a plasmid for introduction into a bacterial host cell, or a viral vector such as a baculovirus vector for transfection of an insect host cell, or for transfection of a mammalian host cell. Viral vectors such as plasmids or lentiviruses).

For soluble multimeric proteins comprising dimers of the polypeptides described in the present invention, one skilled in the art will recognize that the encoded polynucleotide molecule is upon expression in a host cell.
It is understood that a single chain of the fusion polypeptide is provided, which in turn provides the desired multimeric protein as a product of host cell secretion.

In a fourth aspect, the present invention provides a recombinant host cell comprising a polynucleotide molecule according to the third aspect.

Recombinant host cells include bacterial cells such as E. coli, yeast cells such as methanol-utilizing yeast (P. pastoris), and Spodopte.
ra) may be selected from insect cells such as Sf9 cells, mammalian cells such as Chinese hamster ovary (CHO), monkey kidney (COS) cells and human embryonic kidney 293 (HEK293) cells, and plant cells.

In a fifth aspect, the invention provides:
(I) providing a recombinant host cell comprising a polynucleotide molecule according to the fourth aspect;
(Ii) culturing the host cell in a suitable culture medium and under conditions suitable for expression of the polypeptide or protein; and (iii) culturing the polypeptide or protein from the culture and optionally the culture medium. A method for producing a polypeptide or protein comprising the step of isolating from is provided.

The polypeptide or protein may be isolated using any method well known to those skilled in the art. For example, the polypeptide or protein may be synthesized using metal affinity chromatography methods, or immobilized IgG or heat-aggregated IgG (HAGG
) Can be easily isolated using chromatographic methods.

In a sixth aspect, the invention is a method of treating a subject for an inflammatory disease comprising:
Administering the polypeptide of the first aspect or the protein of the second aspect to the subject, optionally in combination with a pharmaceutically or veterinarily acceptable carrier or additive, The method is provided.

The method is suitable for the treatment of inflammatory diseases such as RA, ITP, SLE, glomerulonephritis and IC-mediated inflammatory diseases including heparin-induced thrombocytopenia syndrome (HITTS).

The subject is typically a human, but the method of the sixth aspect may also be suitable for use with other animal subjects such as livestock (eg, racehorses) and companion animals.

The term “pharmaceutically or veterinary acceptable carrier or additive” refers to any pharmaceutically or veterinary acceptable solvent for delivering a polypeptide or protein of the invention to a subject. , Intended to refer to a suspension or medium.

The polypeptide or protein is delivered to the subject via any route well known to those skilled in the art, particularly intravenous (iv), intradermal (id) and subcutaneous (sc) administration, as well as oral and nasal administration. Can be administered. For subcutaneous administration, administration can be accomplished via injection or by a catheter inserted subcutaneously. Alternatively, subcutaneous administration can be accomplished via sustained release implant compositions or injectable depot forming compositions.

Typically, the polypeptide or protein is 0.5 to 15 m per day
Administered in doses ranging from g / kg subject body weight. The person skilled in the art, however, does not “effective amount” (
That is, it is understood that the amount of dose effective) in treating an inflammatory disease will vary according to several factors including the age and general health of the subject and the severity of the inflammatory disease to be treated. It is well within the ability of those skilled in the art to identify or optimize an appropriate effective amount for each particular subject.

In another aspect of the invention, a composition comprising a polypeptide according to the first aspect or a protein according to the second aspect, optionally in combination with a pharmaceutically or veterinary acceptable carrier or additive. And the use of the polypeptide according to the first aspect or the protein according to the second aspect in the manufacture of a medicament for the treatment of inflammatory diseases.

Furthermore, the polypeptides and proteins of the invention are also useful for uses other than the treatment of subjects for inflammatory diseases. That is, they can be used in diagnostic assays to detect circulating immune complexes (ICs) associated with the pathology of autoimmune diseases such as RA and SLE, where the polypeptide or protein is used in such assays. Instead of the typical precipitation step (using polyethylene glycol), it can be used for the IC “capture” step (eg by binding of a polypeptide or protein to a suitable substrate such as an ELISA plate). After capturing the IC from the sample to be analyzed (eg, serum or synovial fluid sample from the subject), the captured IC
The polypeptide or protein of the present invention can be a marker or reporter (which can produce a detectable signal, eg, a radiolabeled molecule, a chemiluminescent molecule,
It can be detected by use in a form bound to a molecule that can act as a bioluminescent molecule, a fluorescent molecule or an enzyme such as horseradish peroxidase). Alternatively, the captured IC can be used to measure specific autoantigen levels in circulating IC, such as citrulline in RA, D in SLE
NA, La / SS-B in Sjogren's syndrome, and DNA in scleroderma
Antibodies specific for topoisomerase I) can be detected or “probed”, which may allow the development of assays for autoimmune diseases with improved diagnostic or prognostic results. Furthermore, in a similar manner, IC captured by a polypeptide or protein of the present invention bound to a suitable substrate can be expressed as an infectious agent (
For example, bacteria such as staphylococci and streptococci, P. falciparum (P.f
parasites (alciparum) (malaria), and hepatitis C virus (H
CV), Epstein-Barr virus (EBV), human immunodeficiency virus (HIV)
) And viruses such as dengue-causing arboviruses) can be detected or “probed” using antibodies specific for specific antigens, identifying pathogens of infectious diseases,
Provides information useful for disease prognosis and / or management of infectious diseases.

In addition, the polypeptides and proteins of the present invention are also useful in a variety of bioassays, in which tumor necrosis factor (TNF) release from cells including macrophages, dendritic cells (DCs) and neutrophils Can inhibit. Furthermore, when coupled to a molecule that can act as a marker or reporter such as those described above, the polypeptide or protein can be used for in vivo imaging of inflammatory sites.

Furthermore, the polypeptides and proteins of the present invention are useful for the removal of circulating IC associated with IC-mediated inflammatory diseases, where the polypeptides or proteins are suitable substrates such as inert beads, fibers or other surfaces. And is exposed to bodily fluids (especially blood) from a subject containing the IC complex, so that the IC is captured and subsequently removed from the bodily fluid. The treated body fluid is substantially depleted of IC and can then be returned to the subject from which the body fluid was obtained.

In order that the nature of the present invention may be more clearly understood, preferred forms thereof will now be described with reference to the following non-limiting examples.

Production, Purification and Characterization of FcR Multimeric Polypeptides Materials and Methods Construction of FcγRIIa Multimer Expression Vectors Fc binding region comprising the external domains 1 and 2 of human FcγRIIa was synthesized from a thermostable polymerase Pwo (Roche), Clone Hu3.0 (Hives (
Hibbs) et al., 1988, Accession Number (ACCESSION NM) _021642
) As a cDNA template and primer oBW10 GTA GCTCCCCCAAA
Amplification was performed by using GGCTG (SEQ ID NO: 1) and oBW11 CTA CCCGGG TGAAGAGCTGCCCATG (SEQ ID NO: 2). Half of the SnaBI site (all DNA
The modified enzyme is New England Biolabs (New England Bi).
olabs)) and SmaI sites are underlined. The blunt-ended PCR product was transformed into vector pPIC9 (Invitrogen, Life Technology, using T4 DNA ligase.
s)) with Eco filled with DNA polymerase I Klenow fragment
Ligation was performed at the RI site to prepare vector pBAR14. FcγRII
To create a vector pBAR28 encoding a tandem ectodomain of a
pBAR14 is digested with SnaBI, and pBAR14 SnaBI / Sm
The aI fragment was ligated.

A baculovirus vector for expressing the FcγRIIa multimerized ectodomain was constructed as follows: The fragment encoding the FcγRIIa leader sequence and ectodomains 1 and 2 was pVL-1392 (Powell et al., 1
999, and Maxwell et al., 1999) by digestion with EcoRI and XbaI, and then multiple cloning sites Ba
Modified pBACP in which the mHI site was first removed by digestion with BamHI and filled in with the Klenow fragment of DNA polymerase and religation
AK9 (Invitrogen Life Tec
h)) to the EcoRI / XbaI site. The vector pBAR69 of this construct was digested with BamHI and the BamHI fragment of pBAR28 was ligated, resulting in vectors pBAR71, pBAR72 and pBAR73 encoding rsFcγRIIa dimer, trimer and tetramer, respectively. Insert size is determined by EcoRI / XbaI digestion and multimerized BamHI
The correct orientation of the fragments was screened using standard procedures by PvuII digestion.

A mammalian expression vector encoding FcγRIIa monomer and dimer was generated as follows: FcγRIIa cDNA clone Hu3.0 (Hibbs)
Et al., 1988, and DEFINITION: Human (Homo sapi)
ens) IgG Fc fragment, low affinity IIa, receptor (CD32) (FCGR2A
), MRNA, accession number (ACCESSION NM) _021642) using Accuprime Pfx PCR (Invitrogen, Life Technologies) and Gateway ™ vector pDO
Cloning into NR (TM) 221 (Invitrogen Life Technologies) using the BP Clonase (TM) reaction (Invitrogen LifeTech) according to the instruction manual yielded pNB6. Primers oBW11 and oBW302 TCT CATCACCACCATCAC using the pNB6 polymerase AccuPrime Pfx
PCR with CAC GTCTAGACCCAGCTTTCTTGTACAAAG (SEQ ID NO: 3), digestion with SmaI and ligation with T4 ligase resulted in pBAR390 encoding rsFcγRIIa with a C-terminal hexahistidine tag. pBAR390B
Digestion with amHI and ligation of the BamHI fragment of pBAR28 is rs
The vector pBAR397 encoding the FcγRIIa dimer was generated. PvuII
Digestion is then used to screen the orientation of the dimerized BamHI fragment and ABIBigDye 3.1 (Applied Biosystems (Applied Biosystems)).
Biosystems)) and the target sequence was confirmed. The expression vector pAPEX3P to which the gateway LR clonase reaction (Invitrogen Life Technologies) was then applied and the FcγRIIa monomer (pBAR390) or dimer (pBAR397) was applied to the Gateway reading frame A cassette (Invitrogen Life Technologies) ( Evans (
Evans et al., 1995, and Christiansensen
) Et al., 1996), resulting in the expression vectors pBAR426 and pBAR427. Similarly, using the gateway LR clonase reaction, FcγRIIa monomer (pBAR390) or dimer (pBAR397) is converted to gateway (Gat
eway) Expression vector pIRESneo (Clontech (Clon) Co., Ltd.) using a reading frame A cassette (Invitrogen Life Technologies)
tech)). FIG. 1 shows the polynucleotide sequence (and translated amino acid sequence) for the FcγRIIa “head-to-tail” dimer construct in pBAR397 used to construct the expression vector pBAR427. 2
Two repeats are shown as amino acids 1 to 174 (ie, the first Fc binding region) and 184 to 362 (ie, the second Fc binding region), and the short (8 amino acid sequence; residue 175) of the FcγRIIa membrane flanks 182) linked via an additional valine residue in addition to the fragment (residue 183 underlined in FIG. 1). Amino acids −31 to −1 in the sequence shown in FIG. 1 represent the natural leader sequence of FcγRIIa.

Generation of rsFcγRIIa monomer and dimer polypeptide Recombinant soluble FcγRIIa (rsFcγRIIa) monomer and dimer polypeptide expression in HEK293E cells was expressed in 5 μg of plasmid DNA (pB
AR426, pBAR427) is placed in a 10 cm ² well and Lipofectamine 2000 reagent (Invitrogen Life Technologies)
n, Life Technologies)) or transit (Transi)
t) Reagent (BioRad Laboratories, Inc. (BioRad Laboratories)
es)) was performed according to the instructions by transfection. After 48 hours, the transfected cells were then selected by incubation in 4 μg / ml puromycin. Puromycin-selected cells were then grown to stationary phase in CD293 medium supplemented with 1% FCS (Invitrogen Life Technologies). The recombinant product is then immobilized nickel (Qiagen) or cobalt (Clontech)
Purified by column chromatography and superdex (S
further purification using upperdex 200 or Superdex G75 (Amersham / Pharmacia) size exclusion chromatography.

Comparison of affinity measurements of rsFcγRIIa monomer and dimer polypeptide For purified rsFcγRIIa monomer and dimer using standard BIAcore assay procedure (Wines et al., 2001; Wines et al., 2003) Affinity measurements were performed; rsFcγRIIa monomer or dimer at various concentrations with immobilized human IgG monomer (sand globulin (San globulin (San
dogbululin), Novartis) or thermal aggregation I
gG (HAGG, Wines et al., 1988; Wines)
And the like, 2003) for 60 minutes, after which time the surface was regenerated (Wines (Wi
nes) et al., 2003). By immobilizing human IgG monomer on the biosensor surface, it becomes a multivalent array that mimics immune complexes.

Comparison of Inhibitory Activity of rsFcγRIIa Monomer and Dimer Polypeptide Purified rsFcγRIIa monomer and dimer were synthesized from human IgG monomer (Sandglobulin) and dimer-IgG (Wri
ght) et al., 1985). The amount of free receptor polypeptide was then measured by injecting into immobilized human IgG monomer according to standard BIAcore assay procedures.

Inhibition of immune complex binding to human cells by rsFcγRIIa monomer and dimer polypeptide Binding of small immune complexes (represented by dimer-IgG) to human neutrophils (volunteers V1 and V5) Was measured by flow cytometric analysis in the absence and presence of purified rsFcγRIIa monomer and dimer polypeptide (
“Immunology Current Protocol” (Current Protocols in I
mnology, Wiley Interscience, Inc.
rscience)).

RsFc of TNF secretion from immune complex stimulated MDM (monocyte-derived macrophages)
Inhibition by γRIIa monomer and dimer polypeptide In a first experiment, peripheral mononuclear cells were extracted from human blood (volunteer V5) and CD
Positive selection for 14 expression using an automacs sorter (Miltenyi Biotec), and 2
Differentiation into MDM (monocyte-derived macrophages) in the presence of M-CSF for 4 hours, followed by rs with various concentrations of small immune complexes (typified by dimer-IgG)
Stimulation was in the absence and presence of FcγRIIa dimer (2.5 μg / ml in the supernatant). TNF secretion from MDM was then measured by human TNF ELISA according to the instructions (BD Pharmingen (BD Pharmingen
)). In a second experiment, MDM was also made ex vivo from human blood (this time from volunteer V1) and allowed to differentiate for 24 hours, after which it was injected with various concentrations of small immune complexes (ie, dimer-IgG). Stimulated in the absence and presence of rsFcγRIIa dimer (2.5 μg / ml in the supernatant).

Inhibition of platelet immune complex activation by rsFcγRIIa dimer polypeptide Washed platelets were prepared by low-speed centrifugation of whole blood (Thai et al., 2
003) and heat-aggregated IgG (HAGG). Platelet activation was measured by flow cytometry by increasing the surface expression of P-selectin (CD62P) (Lau et al., 2004).

Results Expression of rsFcγRIIa monomer and multimeric polypeptide from insect cells Western blot analysis of infected cell supernatants demonstrated successful production of recombinant soluble FcγRIIa dimeric and trimeric forms (FIG. 2). Some trimer polypeptide was detected, but it was roughly cleaved to the dimer form, and no tetramer was detected and was roughly cleaved to yield the dimer form. Since the FcγRIIa dimer was essentially the most stable, it was further characterized and developed in a mammalian expression system (
That is, HEK293E cells).

However, since natural FcγRIIa can be detached from the surface of leukocytes by proteolysis (Astier et al., 1994), one strategy to minimize proteolysis of trimers, tetramers and larger multimers FcγRI
The membrane adjacent stem linker sequence that binds the Ia extracellular region will be deleted or more preferably replaced. For example, proteolytic susceptibility of the membrane flanking stalk linker sequence may be due to one or more amino acid modifications (eg, one or more amino acid substitutions, deletions and / or additions) or to linker sequences, eg, against proteolysis. Can be reduced by substitution with a synthetic linker sequence such as GGGGSGGGGS (SEQ ID NO: 4), which is less sensitive.

Another strategy for successful production of trimers, tetramers, and larger multimers is to combine an expressed dimeric polypeptide with one or more monomers or another dimeric polypeptide. , By chemical crosslinking. Multimers of FcγRIIa dimers also express dimeric polypeptides as fusion proteins with Fc domains (eg, IgG Fc domains) that are themselves dimers and dimerize any fusion partner. Can be produced.

Expression of rsFcγRIIa monomer and dimer polypeptide from mammalian cells Protein yields were 3 mg / l for rsFcγRIIa monomer (construct pBAR426) and ˜0.5 mg for rsFcγRIIa dimer.
/ Construction (construct pBAR427). FIG. 3 shows rsFcγRII.
a Coomassie fraction collected from monomer and dimer purification
) Stained SDS-PAGE (12% acrylamide gel, under non-reducing conditions). r
The sFcγRIIa monomer has an expected size of ˜30 kDa (a), whereas rsF
The cγRIIa dimer had an expected size of ˜60 kDa (b).

Comparison of affinity measurements of rsFcγRIIa monomer and dimer polypeptide The results of the assay are shown in FIGS. The assay showed that the rsFcγRIIa monomer has one binding site with an affinity dissociation constant (K _D ) of 1.7 μM for human IgG monomer and 1.05 μM for HAGG. rsF
In the case of the cγRIIa dimer, the binding data is for the immobilized human IgG monomer.
2 nM (K _D1 ) and 100 nM (K _D2 ), and 2.73 nM for HAGG
(K _D1 ; about 300 times smaller than the K _{D of} monomeric rsFcγRIIa) and 99 nM
It best fits the two binding site model with an affinity dissociation constant (K _D ) of (K _D2 ).

Comparison of Inhibitory Activity of rsFcγRIIa Monomer and Dimer Polypeptide Experiments performed to compare the inhibitory activity of rsFcγRIIa monomer and dimer polypeptide were performed in solution using rsFcγRIIa monomer (FIG. 6a). Is human IgG
It has been shown that it does not distinguish between monomers and small immune complexes (ie represented by dimer-IgG). In contrast, the rsFcγRIIa dimer in solution (FIG. 6b) is
It selectively binds immune complexes that are smaller than human IgG monomers (ie, dimer-IgG).

Inhibition of immune complex binding to human cells by rsFcγRIIa monomer and dimer polypeptide The results of the inhibition assay are shown in FIGS. 7a and 7b, and they show a small immune complex (ie, dimer-IgG). For inhibiting from binding to human neutrophils, rsFc (RIIa dimer (IC ₅₀ = 1.1 μg / ml) was reduced to rsFc (RIIa
It indicates that the activity is 10 times higher than that of the monomer (IC ₅₀ = 10.5 μg / ml). Furthermore, the results show that inhibition by the rsFcγRIIa dimer from binding of small immune complexes (dimer-IgG) to human neutrophils is reproducible with neutrophils from two separate individuals and IC ₅₀ was 0.9-1.1 μg / ml.

RsFc of TNF secretion from immune complex stimulated MDM (monocyte-derived macrophages)
Inhibition results with γRIIa monomer and dimer polypeptide are shown in FIGS. 8a and 8b. The rsFcγRIIa dimer appeared to inhibit immune complex (ie dimer-IgG) stimulated TNF secretion from 24-hour differentiated human MDM.

Inhibition of platelet immune complex activation by rsFcγRIIa dimer polypeptide Washed human platelets with HAGG (10 μg / ml) and rsFcγRIIa
Incubated for 30 minutes in the presence and absence of 30 μg / ml dimer. As shown in FIG. 9, less expression of P-selectin (CD62P) provided evidence and it was found that platelet activation was inhibited in the presence of rsFc (RIIa dimer.

Discussion Monomeric (rsFcγRIIa monomer) and dimeric (rsFcγRIIa dimer) forms of recombinant soluble FcγRIIa were successfully expressed in HEK293E cells. The BIAcore equilibrium binding assay shows that the rsFcγRIIa dimer is immobilized Ig
G One RsFcganmaRIIa monomer in the interaction with (sand globulin (Sandoglobulin)) having a 300-fold greater binding activity than monomeric receptors with respect to (i.e. immobilized IgG is K _D ~1μM rsFcγRIIa two The mer is K _D -3 nM). Competition experiments with BIAcore also demonstrate that the rsFcγRIIa dimer selectively binds small immune complexes and confirms selective inhibitory activity in cell-based assays using neutrophils from two donors It was done. The rsFcγRIIa dimer has also proven to be about 10 times more potent inhibitor of IgG immune complex binding than the rsFcγRIIa monomer, and in standard platelet assays, the rsFcγRIIa dimer is platelet immune complex activity. It was observed to completely inhibit activation (ie rsFcγRIIa dimer is a potent inhibitor of cell activation). Therefore, rsF according to the present invention
cγRIIa dimers and other soluble multimeric proteins and polypeptides are R
There appears to be significant promise for the treatment of IC-mediated inflammatory diseases such as A and SLE.

Production, purification and characterization of rsFcγRIIa dimer polypeptide Materials and methods Production of rsFcγRIIa dimer polypeptide Cloning the Fc (RIIa dimer construct described in Example 1 into a mammalian expression vector under the control of a modified CMV promoter Stable CHO-S transformants were then established as follows: 90% confluent CHO-S cells were harvested, washed 3 times, and 15 ml medium containing 2 × 10 ⁷ cells was dispensed into 10 cm dishes. Linearized DNA-Lipofectamine 2000 complex (ratio 1: 2.5) was then incubated for 5 minutes at room temperature and added dropwise to the cells, followed by incubation of the cells at 37 ° C. for 48 hours. And then in a 96-well plate with limiting dilution, 6
Seeded in CD-CHO medium supplemented with 00 μg / ml hygromycin B, 8 mM L-glutamine, 1 × HT supplement and 50 μg / ml dextran sulfate. Cells were screened by standard ELISA to detect soluble FcγRIIa protein, and the highest expression strain was subcloned again by limiting dilution. One clone (# 6) secreted FcγRIIa dimer at approximately 40 mg / L and was cultured for optimal protein expression at 30 ° C. in shake flasks.

The supernatant containing the rsFcγRIIa dimer was concentrated by tangential flow filtration and exchanged into 20 mM sodium phosphate pH 7.4 buffer. The sample was then diluted 4-fold with 20 mM sodium phosphate and 0.5 M sodium chloride and a HisTrapFF 2 × 5 ml column (GE Healthcare (GE Health)
care)), 20 mM sodium phosphate, 0.5 M sodium chloride pH
Elute with 7.4 and 100 mM imidazole. The eluted material was dialyzed and purified by ion exchange chromatography using a 25 ml QFF column (GE Healthcare) and eluted with 150 mM sodium chloride. The purified material was then dialyzed into phosphate buffered saline.

Blocking HAGG binding to FcγRIIb with rsFcγRIIa dimer polypeptide The ability of purified rsFcγRIIa dimer to block immune complex binding to cell surface FcγRIIb was assessed by flow cytometry assay. Thermal aggregation I
gG (HAGG) with various concentrations of rsFcγRIIa dimer or rsFcγ
RIIa monomer (R & D Systems, part number 1330)
-CD / CF) for 1 hour at 4 ° C. These mixtures are then
They were added to a 96 well plate containing 10 ⁵ IIA1.6 cells transfected with human FcγRIIb (IIA1.6 is a mouse B lymphoma line lacking endogenous FcγR expression). Plates were incubated for 1 hour at 4 ° C., washed, and then stained with anti-hIgG-FITC complex to detect bound HAGG. After washing, the cells were analyzed on a FACS scan flow cytometer using standard procedures.

Blocking HAGG-induced platelet activation with rsFcγRIIa dimer polypeptide Exposure of platelets to HAGG results in Fc (RIIa-mediated activation, leading to upregulation of P-selectin (CD62P).
The ability of RIIa dimers or rsFcγRIIa monomers to block this activation was assessed by flow cytometry assay. Thermal aggregation IgG (HAGG)
At various concentrations of rsFcγRIIa dimer or rsFcγRIIa monomer (
Incubated with R & D Systems (product number 1330-CD / CF) for 1 hour at 4 ° C. The mixture is then prewashed and 1 mM
EDTA added Tyrode / Hepes buffer was added to a 96 well plate containing 3 × 10 ⁷ human platelets resuspended in Tyrodes / Hepes buffer. After incubation for 30 minutes at room temperature, the cells are washed, fixed, and CD62P and GPII
b (CD41) expression was stained by standard methods and analyzed on a FACS scan flow cytometer.

rsFcγRIIa dimeric polypeptide blocks immune complex-induced MC / 9 activation MC / 9 is activated after exposure to immune complex and releases TNF-α
It is a γR positive mouse mast cell line. rsFc (RIIa dimer or rsFcγR
The ability of the IIa monomer to block this activation was assessed using an immune complex consisting of ovalbumin and anti-ovalbumin antibody (OVA IC) as a stimulant. OVA IC (10 μg) was incubated with various concentrations of rsFcγRIIa dimer or rsFcγRIIa monomer (R & D Systems, Part No. 1330-CD / CF) for 1 hour at room temperature. The mixture is then added to a 96 well plate containing 2 × 10 ⁵ MC / 9 cells and overnight at 37 ° C.
Incubated at The supernatant is collected, and the amount of TNF-α is measured using a commercial ELIS
Measurement was performed using an A kit (BD Biosciences).

The rsFcγRIIa dimer inhibits induced arthritis in the human FcγRIIa transgenic mouse model. The activity of the rsFcγRIIa dimer is described in the published P
Transgenic human FcγRI described in CT application WO03 / 104459
Evaluation was made in an arthritis model using Ia mice. These mice are human FcγRI
A transgene encoding Ia is expressed.

Clinically apparent arthritis (determined using the standard arthritis index) is induced in these mice by at least 4 days after administration of a single 2 mg dose of PBS containing monoclonal antibody M2139, which is amino acids 551-564 of collagen II. J1
IgG2a that specifically binds to an epitope. The monoclonal antibodies are produced by hybridomas that have been shown to be arthritic (Amirahmadi et al., Arthritis and Rheumat).
ism, June 2005; Nandakumar et al., A
rhtritis Research and Therapy, May 2004)
.

Mice were treated with the soluble FcγRIIa dimer shown in FIG. 1 as follows:
Four FcγRIIa Tg mice were injected with 0.5 mg soluble FcγRIIa dimer, and 4 mice were injected with PBS i. p. Administered. Two hours later, both groups were injected with 2 mg of M2139 (ip) and given a bolus of 1 mg of dimer or PBS. The dimer (0.5 mg / dose) was administered again at both 24 and 48 hours after injection of M2139. Scoring arthritis as usual, the highest possible score is 1
Two points. 0 to 3 points on each of 4 legs (0 = normal; 1 = onset joint, erythema, mild swelling; 2
= 2 or more affected joints, ankle / wrist swelling; 3 = all joints onset, loss of mobility / rigidity, marked erythema and edema).

Results Production of rsFcγRIIa Dimeric Polypeptide FIG. 10 detects SDS-PAGE (under reducing and non-reducing conditions); anti-FcγRIIa antibody ((R & D systems, part number AF1875) and rabbit anti-goat IgG-peroxidase Figure 2 shows analysis of purified rsFcγRIIa material, including Western blotting used as an antibody; and HPLC.
The polypeptide migrates as a single band at the expected molecular weight (˜50 kD), and anti-FcγR
Reacts with the IIa antibody and is> 96% pure as determined by HPLC analysis.

The rsFcγRIIa dimer polypeptide blocks FAG (HAGG binding to RIIb) The results of the HAGG binding assay are shown in FIG. Could block completely, but rsFcγRIIa dimer (IC50 = 3.9)
ng / ml) is 500 more than monomeric protein (IC50 = 2082 ng / ml)
It was more powerful than twice.

The rsFc (RIIa dimer polypeptide blocks HAGG-induced platelet activation The results of the platelet activation assay are shown in Figure 12. Activated platelets (positive for both CD41 and CD62P after treatment with HAGG alone) ) Was defined as 100%, both rsFcγRIIa dimer and rsFcγRIIa monomer were
G-induced CD62P upregulation could be significantly reduced. By titration, the rsFcγRIIa dimer (IC50 = 3.9 μg / ml) was reduced to rsFc (R
It was revealed to be 5 times more potent than the IIa monomer (IC50 = 20.9 μg / ml).

The rsFcγRIIa dimer polypeptide blocks immune complex-induced MC / 9 activation. The results of the MC / 9 activation assay are shown in FIG. The amount of TNF-α released after incubation with OVAIC alone was defined as 100%. Both rsFcγRIIa dimers and rsFcγRIIa monomers are induced by immune complexes.
F-α release could be completely suppressed. By titration, the rsFcγRIIa dimer (IC
50 = 2.1 μg / ml) is rsFcγRIIa monomer (IC50 = 17.7 μg)
/ Ml) was found to be 8 times more potent.

The rsFcγRIIa dimer inhibits induced arthritis in the human FcγRIIa transgenic mouse model As shown in FIG. The second study confirmed a dimer-mediated reduction in arthritis score, but not as dramatically.

Discussion The rsFcγRIIa dimer was successfully expressed in CHO-S cells. Reduced and non-reduced SDS-PAGE indicates that the purified rsFcγRIIa dimer is approximately 50k in size.
Da was shown and Western blotting showed that the dimer was anti-Fc (
It was shown that it was specifically bound by RIIa antibody. The rsFcγRIIa dimer was determined to be 96% pure by HPLC.

Both the rsFcγRIIa dimer and rsFc (RIIa monomer completely blocked the binding of HAGG to cell surface FcγRIIb, and the rsFcγRIIa dimer had a blocking efficiency about 500 times higher than the rsFcγRIIa monomer.
Similarly, both rsFcγRIIa dimer and rsFcγRIIa monomer are H
AGG-induced platelet activation can be significantly reduced and the dimer is rsFcγRIIa
It was about 5 times more potent than the monomer. Furthermore, both rsFcγRIIa dimer and rsFcγRIIa monomer inhibit mouse mast cell line (MC / 9) activation measured by TNF-α release, and the dimer is 8 times higher than the monomer Efficacy was shown.

Importantly, the rsFcγRIIa dimer restored arthritis in a murine model of induced arthritis and demonstrated in vivo efficacy.

Independently rsFcγRIIa fusion polypeptide of design and expression materials and methods rsFcγRIIa fusion expression vectors Construction of soluble monomeric FcγRIIa or soluble dimer FcγRIIa encoding polynucleotides comprising IgG ₁ from Fc domain, IgG ₁ -Fcγ1 the Fused with the encoding polynucleotide (L234A, L235A).

The C-terminus of the soluble monomeric FcγRIIa polypeptide was operably fused with the human IgG ₁ polypeptide at the N-terminal position of the interchain disulfide bond of the lower hinge that covalently links the two Fc moieties. Fusion at this position is a monomeric FcγRIIa that dimerizes with a second Fc domain for interaction between covalently bound Fc domains.
-IgG ₁ -Fcγ1 (L234A, L235A) produce a fusion protein. Ig
The G hinge region is known for its flexibility, and fusion of a polypeptide containing an Fc binding region on the N-terminal side of the interchain disulfide bond of the lower hinge allows considerable freedom of movement of the Fc binding region. .

Similarly, the C-terminus of the soluble dimeric FcγRIIa polypeptide is positioned at the N-terminal position of the interchain disulfide bond of the lower hinge that covalently binds the two Fc moieties.
It was operably fused to a G ₁ polypeptide.

A polynucleotide encoding a soluble monomeric FcγRIIa or a soluble dimeric FcγRIIa is independently described in a polynucleotide encoding human serum albumin (HSA) and a previous international patent specification WO 96/08512. Fused in the same way. As disclosed in that specification, HSA is converted to rsFcγRIIa.
Fused to the N-terminus of the monomer. In a similar manner, HSA was fused to the N-terminus of the rsFcγRIIa dimer.

Polynucleotides encoding various fusion polypeptides or proteins were operably inserted into pAPEX3P-xDEST using standard cloning methods.

Purification of rsFcγRIIa monomer and rsFcγRIIa dimer fusion The rsFcγRIIa monomer and dimer fusion expression vector is transiently transfected into CHOP cells and stably transfected into 293E cells using standard methods did. Transiently transfected CHOP cell supernatants were immunoprecipitated with anti-FcγRIIa antibody 8.2 (Powell et al., 1999) and the immunoprecipitates in non-reducing SDS-PAGE (12%) Provided.
Western blot analysis was then performed using standard methods and rabbit anti-FcγRI
It was performed using the Ia antibody (Maxwell et al., 1999) as the primary antibody and anti-rabbit Ig-HRP as the secondary antibody.

HAGG capture ELISA for detection of rsFcγRIIa fusion in transfected CHOP cell supernatant
A HAGG capture ELISA was performed to measure the Fc binding activity of the rsFcγRIIa fusion. To measure the binding activity of the rsFcγRIIa monomer fusion, a known FcγRIIa monomer standard (Powell et al., 1999) (
The protein from rsFcγRIIa monomer transfected cells (transfection 426) was titrated and I
rsFcγRIIa monomer fusion with gG-Fcγ1 (L234A, L235A)
Compare with binding of protein from cells transfected with (monomer-Fc) and with binding of protein from cells transfected with rsFcγRIIa monomer fusion with HSA (HSA-monomer) did.

To measure the binding activity of the rsFcγRIIa dimer fusion, a known FcγR
IIa dimer standard (starting at 0.5 μg / ml) and protein from cells transfected with rsFcγRIIa dimer (transfection 427
) Were titrated and the rsFcγRIIa dimer fusion with IgG-Fcγ1 (
L234A, L235A) (dimer-Fc) compared to the binding of proteins from cells transfected and proteins from cells transfected with rsFcγRIIa dimer fusion (HSA-dimer) with HSA Compared to the binding.

Capture tag ELISA for detection of rsFcγRIIa fusion in transfected CHOP cell supernatant
Plates were coated with anti-FcγRIIa antibody 8.2 using standard ELISA methods. The rsFcγRIIa fusion was added to the wells and contacted with the 8.2 antibody. The secondary antibody was anti-FcγRIIa antibody 8.7-HRP (Powell
) Et al., 1999; Ierino et al., 1993a), which is specific for an FcγRIIa epitope distinct from antibody 8.2.

The monomeric rsFcγRIIa samples tested were known rsFcγRIIa monomer (starting at 0.75 μg / ml monomer standard), supernatant from cells transfected with rsFcγRIIa monomer (transfection 426), IgG- Fcγ
RsFcγRIIa monomer fusion with 1 (L234A, L235A) (monomer-F
c) supernatant from cells transfected with, and rsFcγR with HSA
Supernatant from cells transfected with IIa monomer fusion (HSA-monomer) was included.

Dimeric rsFcγRIIa samples tested were known FcγRIIa dimer (started at 0.5 μg / ml dimer standard), supernatant from cells transfected with rsFcγRIIa dimer (transfection 427), IgG- Supernatant from cells transfected with rsFcγRIIa dimer fusion (L234A, L235A) (monomer-Fc) with Fcγ1 and rsFcγRIIa with HSA
Supernatant from cells transfected with dimer fusion (HSA-monomer) was included.

Results Expression of rsFcγRIIa monomer and dimer fusion Based on the activity of purified rsFcγRIIa monomer and rsFcγRIIa dimer, the rsFcγRIIa monomer-IgG-Fcγ1 (L234A, L235A) fusion was transformed into rsFcγRIIa dimer- IgG-Fcγ1 (L234A, L235A)
Secreted at a higher level (about 12 μg / ml in 293E cells) than the fusion (about 4 μg / ml in 293E cells).

As shown in FIG. 14, Western blot analysis indicated that the fusion proteins were present at the expected molecular weight size in the supernatant, and that they were successfully produced as distinguishable proteins with no evidence of degradation products. .

HAGG capture ELISA for detection of rsFcγRIIa fusion in transfected CHOP cell supernatant
As shown in FIG. 15 (a), the rsFcγRIIa monomer fusion (L234A, L235A) (monomer-Fc) with IgG-Fcγ1 bound detectably in the assay,
On the other hand, it was observed that the rsFcγRIIa monomer fusion with HSA (HSA-monomer) was insufficiently bound. This result shows that rsFcγRI with IgG-Fcγ1.
The Ia monomer fusion (L234A, L235A) dimerizes (of the Fc binding region) as a result of dimerization between the heavy chains of the fused Fc domain, while rsFcγR with HSA
The IIa monomer fusion can be explained by the fact that it remains monomeric for the Fc binding region.

As shown in FIG. 15 (b), rsFcγRIIa with purified IgG-Fcγ1
Dimer fusion (L234A, L235A) (dimer-Fc) shows similar binding activity as the dimer standard and rsFcγRIIa dimer fusion with HSA (HSA-monomer) is detected It had possible but lower binding activity. In this case, IgG-
While the rsFcγRIIa dimer fusion with Fcγ1 (L234A, L235A) was a tetramer (or “tetravalent”) for the Fc binding region due to dimerization between the heavy chains of the fusion Fc domain, The rsFcγRIIa dimer fusion with HSA remains a dimer for the Fc binding region.

Capture tag ELISA for detection of rsFcγRIIa fusion in transfected CHOP cell supernatant
As shown in FIG. 16 (a), both the rsFcγRIIa monomer fusion with IgG-Fcγ1 (L234A, L235A) and the rsFcγRIIa monomer fusion with HSA are captured and detectable in this assay. As shown in FIG. 16 (b), the rsFcγRIIa dimer fusion with IgG-Fcγ1 (L234A, L2
35A) and the rsFcγRIIa dimer fusion with HSA are both captured and detectable in this assay. Apparently, both the 8.2 epitope used to capture these receptors and the 8.7 epitope used to detect the captured receptors are unchanged, and the correct folding of the fusion Indicates.

Discussion The rsFcγRIIa monomer and rsFcγRIIa dimer fusion construct was expressed from the vector p-APEX3P-xDST and was transiently expressed in CHOP cells and stably in 293E cells. The expressed fusion appeared as a clear protein on the Western blot and there was no evidence of degradation products.

RsFcγRIIa dimer fusion with IgG-Fcγ1 (L234A, L235
A) may show a lower expression level than the corresponding monomer. However, r with HSA
The expression level of the sFcγRIIa dimer fusion is approximately equivalent to the expression level of the rsFcγRIIa monomer fusion with HSA as measured by Western blot (FIG. 14), and thus large scale production of the rsFcγRIIa dimer. It shows considerable promise as a means. Interestingly, the rsFcγRIIa dimer fusion showed higher HAGG and anti-FcγRIIa antibody 8.2 binding activity than the corresponding monomer. As described above, this is the case where the rsFcγRIIa dimer fusion is a dimer or tetramer (if rsFcγRIIa dimer fusion with IgG-Fcγ1 (L234A, L235A)) and results for the Fc binding region As explained by the fact that it has a higher apparent binding affinity (binding activity) due to this multivalent nature. It is expected that the tetrameric molecule can bind to the immune complex with a high affinity that makes binding substantially irreversible.

Design and Expression of an rsFcγRIIa Fusion Polypeptide Containing an Fc Domain Derived from IgG2a In this example, the rsFcγRIIa dimer fusion protein is expressed as
Prepared using the G2aFc domain as a fusion partner. The dimer fusion protein was designated as D2. The activity of this protein is linked to rsFcγ lacking a fusion partner.
Compared to the RIIa dimer (as described in Examples 1 and 2) and to the rsFcγRIIa monomer fusion protein whose fusion partner is the modified mouse IgG2aFc domain.

Design of Recombinant Soluble D2FcγRIIaFc (D2) Protein The translated amino acid sequence (SEQ ID NO: 8) and nucleotide sequence (SEQ ID NO: 9) of the D2 protein are shown in FIGS. 19 and 20, respectively. The D2 protein contains an additional valine residue (residue 206) in addition to the native FcγRIIa signal sequence (amino acids 1-31), the extracellular domain of the FcγRIIa protein (amino acids 32-205), a short linker corresponding to the FcγRIIa membrane adjacent stalk. -214), second Fcγ
RIIa protein (residues 215-385), one repeat of the membrane adjacent stalk linker (residues 386-393) and mouse IgG2aFc domain (hinge-CH2-CH3)
A dimer of a polypeptide consisting of the region (residues 394-625). IgG2a
The Fc domain contains the following four mutations, which were introduced to reduce Fc receptor binding and complement binding: Leu-413 to Glu (corresponding to position 235 in the EU numbering system), Glu-496 To Ala (equivalent to EU position 318), Ly
From s-498 to Ala (equivalent to EU position 320) and from Lys-500 to Ala
To (equivalent to EU 322).

Construction of D2 expression vector cD encoding human FcγRIIa signal peptide and extracellular domain
NA was previously constructed plasmid (FcγRIIa-d / pAPEX-des
PCR using t) as a template and primers 1 and 4 shown in Table 1
Amplified by The mutant mouse IgG2aFc region was amplified by PCR using a previously constructed plasmid (CD200IgG2aFc-d) as a template and using primers 2 and 3 shown in Table 2.

The FcγRIIa and modified mouse IgG2a Fc PCR products were then amplified using primers 1 and 2 by overlapping PCR. Amplification was performed under the following conditions by using platinum Pfx DNA polymerase (Invitrogen), 1 mM MgSO ₄ , 0.4 mM each dNTP, 20 pmol each primer and 100 ng template DNA: initial thawing. 30 cycles consisting of 94 ° C for 5 minutes, then 94 ° C for 1.5 minutes, then 65 ° C for 2 minutes, then 72 ° C for 3 minutes. The reaction was then kept at 72 ° C. for 10 minutes and cooled to 4 ° C. The reaction product was electrophoresed on a 0.7% agarose gel and visualized with ethidium bromide. The DNA band of interest was excised and purified from an agarose gel by using a QIAquick gel extraction kit (Qiagen). The purified PCR product was digested with NheI and AgeI restriction enzymes and purified using the Qiaquick PCR purification kit (Qiagen). The fragment was then ligated by T4 DNA ligase into a pMPG expression plasmid that was similarly digested with NheI and AgeI. The ligation reaction (5 μl) was then transformed into 50 μl of competent Escherichia coli DH5α cells (Invitrogen) according to the instructions. Transformants were plated on LB agar plates containing 100 μg / ml ampicillin and then incubated at 37 ° C. for 16 hours. Plasmid DNA was purified from a small scale E. coli culture by mini-prep and the DNA sequence was confirmed. A diagram of the resulting expression plasmid pMPG-D2FcγRIIA-IgG2aFc is shown in FIG.

Generation of CHO clones expressing D2 The pMPG-D2 FcγRIIa-IgG2aFc plasmid DNA was isolated from a large culture of E. coli using the plasmid Maxi kit (Qiagen) and directly purified by XbaI. Chained and purified using Qiagen chips. CHO-S cells grown in serum-free chemically defined medium were transfected with the linearized plasmid using Lipofectamine 2000 reagent. After 48 hours, cells were transferred to 96-well plates at different concentrations (10000, 5000, or 2000 cells / well) into media containing 600 μg / ml hygromycin B. Drug resistant oligoclones were screened by ELISA as follows: 96 well plates were coated with 100 μl goat anti-mouse IgG Fc (Sigma) and incubated overnight at 4 ° C. Wells were washed and blocked with PBST containing 200 μl 2% BSA for 1 hour at room temperature. After washing, 100 μl of sample was diluted with PBST containing 1% BSA, added to the wells, incubated for 1 hour, washed and then washed with HRP-conjugated goat anti-mouse IgG (Fc specific) (Sigma) for 1 hour at room temperature And incubated. Wells were washed and TMB substrate was added and incubated for 3-5 minutes at room temperature. Absorbance was measured at 450 nm and a standard curve was generated using known amounts of purified mouse IgG or D2FcγRIIa-IgG2aFc. Supernatant samples were also analyzed by SDS-PAGE and Western blotting. For SDS-PAGE, samples were resuspended in sample buffer with or without 2-ME and heated at 95 ° C. for 10 minutes and cooled on ice. Samples were then separated on an 8% SDS-PAGE gel. The gel was then stained with Coomassie Blue according to the instructions. For Western blotting, samples were prepared as described above and separated by SDS-PAGE and then transferred to an ImmunoBlot PVDF membrane (Bio-Rad) for 1 hour at 100V. Membranes were blocked with PBS / 0.1% Tween-20 containing 5% skim milk for 1 hour and 0.2 hours with 0.2 (g / ml goat anti-human FcγRIIa antibody (R & D Systems) , And HRP-conjugated rabbit anti-goat IgG (Sigma complete molecule) for 1 hour, then developed with TMB substrate (Vector Laboratories Inc.) The second limiting dilution was lower. Performed in media containing 600 μg / ml hygromycin B at different concentrations (0.25 and 0.5 cells / well) After 2 to 3 weeks, drug resistant clones were again evaluated by ELISA for recombinant protein production. And by Western blot.

Purification of D2 protein CHO transformants were grown at 37 ° C in shake flasks. When the cells reached a density of 1.5 to 2 × 10 ⁶ cells / ml, they were incubated at 30 ° C. for 7 to 10 days with continuous stirring. The supernatant was collected, centrifuged at 3000 × g for 30 minutes at 4 ° C., and filtered through a series of different autoclaved membrane filter pore sizes (5.0 to 0.2 μm). The supernatant was concentrated using tangential flow filtration (Millipore) using a BioMax 10 membrane and buffer exchange to 20 mM Na-P / 148 mM NaCl, pH 7.8 was performed. The material was then diluted 9-fold with binding buffer (20 mM Na-P & 3M NaCl, pH 7.8) and loaded onto a Protein A column (GE Healthcare) 4 ml / min overnight at 4 ° C. The column was washed with binding buffer (20 volumes at 5 ml / min) and protein was eluted with 0.1 M citrate pH 4.0 at 2 ml / min. The eluted material was pH adjusted to neutral and dialyzed overnight at 4 ° C. against 4 L of 10 mM Na-P, pH 6.0. It was then loaded onto a macroprep 40 μm ceramic hydroxyapatite type II (CHTII) column (Bio-Rad). After washing the column with binding buffer, the protein was eluted with 10 mM Na-P, 500 mM NaCl, pH 6.0 (all operations at a flow rate of 5 ml / min. The eluted material was then washed against 3 × 4 L PBS, pH 7.4. And dialyzed at 4 ° C. Protein concentration was measured by absorption at 280 nM (extinction coefficient 1.34), Figure 22A shows SDS-PAGE analysis of the final purified material, Western blot analysis is shown in Figure 22B.

D2 protein blocks immune complex-induced MC / 9 mast cell activation The D2 protein was tested in the MC / 9 mast cell assay for the ability to block immune complex-mediated activation of Fcγ receptors. MC / 9 is an FcγR positive mouse mast cell line that is activated and releases TNF-α after exposure to immune complexes. Ovalbumin-anti-ovalbumin antibody immune complex (OVA IC) 10 (g was incubated with purified D2 for 1 hour at room temperature. OVA IC also lacks purified BIF (as described in Examples 1 and 2 lacking the Fc tag). D2 variant) and purified M2 protein (D2 variant containing only one FcγRIIa subunit fused to a modified IgG2aFc domain) The mixture was then transferred to a 96 well plate containing 2 × 10 ⁵ MC / 9 cells. In addition, and incubated overnight at 37 ° C. The supernatant was collected and the amount of TNF-α was measured by a commercial ELISA kit, the results are shown in FIG, where it was released in the absence of treatment. The amount of TNF-α is defined as 100% D2 and M2 proteins and rsFcγRIIa dimer The polypeptide completely suppresses OVA IC-mediated activation, but the D2 protein is 3 times more potent than the non-Fc tagged dimer and 12 times more than the Fc tagged monomer (M2) Powerful.

D2 protein blocks immune complex-mediated activation of FcγR in neutrophil activation assay D2 protein also tested in neutrophil activation assay for ability to block immune complex-mediated activation of Fcγ receptor did. Resting human neutrophils express both FcγRIIa and FcγRIIIb and rapidly lose cell surface expression of L-selectin (CD62L) upon activation by immune complexes. OVA IC (100 μg / ml) was incubated on ice for 1 hour alone or with titrated amounts of purified D2, M2 or BIF. The mixture was then added to a 96 well plate containing 2 × 10 ⁵ / well of human neutrophils purified from peripheral blood by dextran sedimentation and Ficoll density gradient centrifugation. Plates were incubated for 15 minutes at 37 ° C. and the reaction was stopped by the addition of an equal volume of ice-cold buffer followed by 5 minutes on ice. The level of CD62L on the neutrophil cell surface was measured by flow cytometry. The results are shown in FIG. 24, where the percentage of cells expressing CD62L in the presence of OVA IC alone is defined as 100% activation, and the percentage of untreated cells expressing CD62L is 0% activity. It is stipulated. BIF and M2 proteins showed similar inhibitory activity. The D2 protein, however, is about 6 times more potent.

D2 protein blocks immune complex mediated activation of FcγR in platelet activation assay In addition, D2 protein was tested in the platelet activation assay for the ability to block immune complex mediated activation of Fcγ receptor. Exposure of platelets to a typical immune complex, heat-aggregated IgG (HAGG), results in FcγRIIa-mediated activation, leading to upregulation of P-selectin (CD62P). Heat-aggregated IgG (HAGG) was incubated with various concentrations of D2 protein (or M2 or BIF) for 1 hour at 4 ° C. The mixture was then added to a 96 well plate containing 3 × 10 ⁷ human platelets that had been pre-washed and resuspended in Tyrodes / Hepes buffer with 1 mM EDTA. After incubation for 30 minutes at room temperature, cells were washed, fixed, and stained by standard methods for CD62P and GPIIb (CD41) expression and analyzed on a FACS scan flow cytometer. The results of the activation assay are shown in FIG. The percentage of activated platelets (positive for both CD41 and CD62P) after treatment with HAGG alone was defined as 100%. BIF and M2 proteins showed similar inhibitory activity. The D2 protein, however, is about 3 times more potent.

DISCUSSION The D2 protein contains two head-to-tail extracellular domains of the FcγRIIa protein fused to a mouse IgG2aFc domain mutated at 4 amino acids to reduce Fc receptor binding and complement fixation. D2 protein effectively blocks immune complex-mediated activation of MC / 9 mast cells and effectively blocks immune complex-mediated activation of FcγR in both neutrophil and platelet activation assays did. Such Fc-binding dimer fusion proteins can therefore be effective inhibitors of immune complex-mediated diseases in vivo.

Design and Expression of Heterodimeric Fc Receptor Polypeptide Materials and Methods Construction of FcγRIIa-FcγRIII Heterodimeric Expression Vectors FcγRIIa and FcγRIII Fc binding regions are derived from cDNA templates using appropriate primers as described in Example 1. Can be PCR amplified independently. The amplified region contains residues from the ectodomain 1 and ectodomain 2 linkers (ie, D1 / D2 junctions) and known characteristic residues and motifs of the Fc binding region, such as BC, C′E and FG loops. Include. Polynucleotide sequences for these Fc binding regions are well known to those skilled in the art.

  Blunt end PCR products can be ligated into the vector pPIC9 (Invitrogen, Life Technologies) with T4 DNA ligase at the EcoRI site embedded in the Klenow fragment of DNA polymerase. Operatively fused FcγRIIa-FcγRIII heterodimeric polynucleotides can be made from these amplification products using PCR and cloning methods similar to those described in Example 1. Insert size and orientation can be confirmed by analytical restriction enzyme digestion or DNA sequencing.

  The operably fused FcγRIIa-FcγRIII heterodimeric polynucleotide can be cloned into a variety of expression vectors. For example, FcγRIIa-FcγRIII heterodimeric polynucleotides are modified pBACPAK9 (Invitrogen®) in which the BamHI site of the multiple cloning site was first removed by digestion with BamHI and filled in with Klenow fragment of DNA polymerase I and religation. It can be ligated to the EcoRI / XbaI site of LifeTech (Invitrogen Life Tech). The insert size is determined by EcoRI / XbaI digestion and the correct orientation of the multimerized BamHI fragment can be screened using standard procedures by PvuII digestion.

  Alternatively, the FcγRIIa-FcγRIII heterodimeric polynucleotide can be cloned into a mammalian expression vector. For example, using the Gateway LR Clonase reaction (Invitrogen, Life Technologies), an optionally fused multimeric Fc receptor polynucleotide fragment can be converted into a Gateway ™ Reading Frame A cassette ( Introducing into an expression vector pAPEX3P (Evans et al., 1995, and Christiansen et al., 1996) to which Invitrogen Life Technologies is applied, to provide a mammalian expression vector that expresses a fused Fc receptor multimer Can do. Similarly, the expression vector pIRESneo (Clontech) applying Gateway LR clonase reaction, optionally fused multimeric Fc receptor polynucleotide fragment, and Gateway Reading Frame A cassette (Invitrogen Life Technologies). Can be used to introduce

Discussion Multimerization of the Fc binding region results in a molecule with a higher binding activity interaction with the Fc domain. Each monomer in the multimer can interact separately with the Fc domain of an immunoglobulin, resulting in higher binding activity. Multimers containing Fc binding domains derived from different Fc receptors can be made. For example, multimers can be formed from combinations of FcγRI, FgγRIIa, FcγRIIb, FcγRIIIa, FcγRIIIb, Fc (RI and Fc (RI Fc binding regions. Heterodimers are also formed from combinations of these Fc binding regions. For example, FcγRIIa-FcγRIII, FcγRIIa-FcγRI, and FcγRI-FcγRIII heterodimers, and heterodimers composed of other combinations of Fc binding regions can be formed.

  Fc binding domains of several Fc receptors have been defined by mutagenesis or crystallography (IgG and FcγR: Maxwell et al. 1999, Radaev et al., 2001, Sondermann et al., 2000, Hewlett, et al., 1988, Hewlett et al., 1991, Hewlett et al., 1994, Hewlett et al., 1995; IgE and Fc (RI: Garman et al., 2000; IgA and FcαRI interaction: Wines et al., 2001 Herr et al., 2003) In addition, comparisons of similar FcR sequences and Fc receptor structures have been performed (Sondermann et al., 2001). Related clear defined segments of Fc receptors show that they can interact with their ligands, and crystallographic analysis shows this in International Patent Specification WO 2006/133486 for FcγRIIa and IgG interactions. , Compared with crystal analysis of FcγRIII and IgG (Radaev et al. 2001, Sonderman et al., 2001).

  Obviously, these data, together with other Fc receptor mutagenesis experiments, show segments derived from the junction region between ectodomain 1 and ectodomain 2 of these related Fc receptors, and other The segments from the BC, C′E and FG loops of the second domain of the receptor are shown to interact with their respective ligands. Incorporation of such Fc binding regions into other polypeptides can confer specificity for the immunoglobulin type of the new polypeptide. To this end, Hulett et al., 1991, Hewlett et al., 1995, and Maxwell et al., 1999, added an IgG binding region to a protein that would otherwise not bind IgG. Demonstrates having acquired sex. Similarly, as previously described in International Patent Specification No. WO 96/08512, the insertion of a series of IgE binding sequences into a protein that cannot bind IgE has resulted in a protein chimera with IgE specificity. Has been observed. Thus, in a similar manner, inclusion of an Fc binding region that interacts with IgG from FcγRI or FcγRIII into a polypeptide or protein can confer IgG binding function to that polypeptide or protein, or similarly Inclusion of an Fc binding region that interacts with IgA from CD89 or FcαRI into a polypeptide or protein is predicted to be able to confer IgA binding function to the polypeptide or protein. Such a sequence can include a loop of the first extracellular domain of FcαRI of CD89 known to interact with IgA, such loop being BC, C′E and FG of domain 1. Includes loops. Important residues include amino acids 35, 52 and 81-86 (Wines et al., 2001, Herr et al., 2003). In this way, receptor polypeptides and proteins containing segments capable of interacting with different classes of immunoglobulins are possible.

  Throughout this specification, the word “comprising”, or variations such as third person or present participle means the inclusion of one element, integer or step, or group of elements, integers or steps, but any optional It is understood that it does not mean the exclusion of one other element, integer or step, or a group of elements, integers or steps.

  All documents mentioned in this specification are included in this disclosure by reference. Any discussion of documents, laws, materials, instruments, items, etc. contained herein is solely for the purpose of providing the context of the present invention. Any or all of these matters form part of the prior art basis or are common general knowledge in the fields related to the present invention that existed prior to the priority date of each claim of this application in Australia or elsewhere. Is not taken into account.

Those skilled in the art will appreciate that numerous variations and / or modifications can be made to the invention without departing from the broadly described concept or scope of the invention as shown in the specific embodiments. This embodiment is therefore considered to be illustrative in all respects and not restrictive.
Reference 1. Amil Ahmadi SF and others & Raleigh MJ. 2005. “Arthrritogenic anti-type II collagen antibodies are pathogenic” (Amirahmadi SF et al. & Rowley MJ. 2005. Arthritogenic anti-type II collagen antibodies are pathogenic) for cartilage-derived chondrocytes independent of inflammatory cells.) Arthritis Rheum. 52 (6): 1897-906.
2. Armor KL and others & Clark MR. 2003. “Difference in binding of human IgG wild type and mutant antibody to human FcγRIIa and FcγRIIb receptors” (Armour KL et al. & Clark MR. 2003. Differential binding to human FcgammaRIIa and FcgammaRIIb receptors by human IgG wildtype and mutant antibodies.) Mol Immunol. 40 (9): 585-93.
3. Armor KL and others & Clark MR. 2002. “Contrasting IgG-binding interactions of human and herpes simplex virus Fc receptors.” Biochem Soc Trans. 30 (4): 495-500.
4). Astia A and others & D Hanau. 1994. “Human epidermal Langerhans cells secrete a soluble receptor for IgG (FcγRII / CD32) that inhibits binding of immune complexes to FcγR + cells” (Astier A et al. & D Hanau. 1994. Human epidermal Langerhans cells secrete a soluble receptor for IgG (Fc gamma RII / CD32) that inhibits the binding of immune complexes to Fc gamma R + cells.) J Immunol. 152 (1): 201.
5). Brooks D and others & Lovech J. 1989. “Human IgG FcRII (
CD32) structure and expression. Functional heterogeneity is encoded by alternatively spliced products of multiple genes ”(Brooks D et al. & Ravetch J. 1989. Struct
ure and expression of human IgG FcRII (CD32). Functional heterogeneity is
encoded by the alternatively spliced products of multiple genes.) J Exp
Med. 170: 1369-1385.
6). Christiansen D and others & BE Loveland. 1996. “Design of recombinant soluble CD46: inhibitors of complement activation” (Christiansen D et al. & BE
Loveland. 1996. Engineering of recombinant soluble CD46: an inhibitor of
complement activation.) Immunology. 87: 348.
7). Emery P et al & G Seido. 2001. (Emery P et al. & G Seydo
ux. 2001.) Rheumatology (Oxford) 40: 699.
8). Evans MJ etc. & SP Squint. 1995. “Rapid expression of anti-human C5 chimeric Fabs using vectors that replicate in COS and 293 cells” (Evans M
J et al. & SP Squinto. 1995. Rapid expression of an anti-human C5 chimeri
c Fab utilizing a vector that replicates in COS and 293 cells.) J Immuno
l Methods. 1995 184: 123.
9. Garman SC et al., 2000. “Structure of Fc fragment of human IgE bound to high affinity receptor FcεRIα” (Garman SC et al., 2000. Structure of the Fc
fragment of human IgE bound to its high-affinity receptor Fc epsilonRI al
pha.) Nature 406 (6793): 259-66.
10. Her AB et al., 2003. “Insights into IgA-mediated immune responses from the crystal structure of human FcαRI and its complex with IgA1-Fc” (Herr AB et al., 200
3. Insights into IgA-mediated immune responses from the crystal structur
es of human FcalphaRI and its complex with IgA1-Fc.) Nature 423 (6940): 61
4-20.
11. Hibbs ML etc. & PM Hogarth. 1988. Human immunoglobulin GF
Molecular cloning of the c receptor ”(Hibbs ML et al. & PM Hogarth. 1988. Molecul
ar cloning of a human immunoglobulin G Fc receptor.) Proc Natl Acad Sci U
SA 85 (7), 2240.
12 Hewlett MD etc. & PM Hogarth. 1991. "Chimeric Fc receptor identity functional domain of mouse high affinity receptor for IgG" (Hulett MD et al
& PM Hogarth. 1991. Chimeric Fc receptors identify functional domains o
f the murine high affinity receptor for IgG.) J Immunol. 47 (6): 1863-8.

13. Hewlett MD etc. & PM Hogarth. 1994. [IgGFcγRI
Identification of the IgG binding site of the human low affinity receptor for I. Promoting and removing binding by site-directed mutagenesis ”(Hulett MD et al. & PM Hogarth. 1994. Identi
fication of the IgG binding site of the human low affinity receptor for I
gG Fc gamma RII.Enhancement and ablation of binding by site-directed mut
agenesis.) J Biol Chem. 269 (21): 15287.
14 Hewlett MD etc. & PM Hogarth. 1995. [Human FcγRII
Multiple regions of (CD32) contribute to IgG binding ”(Hulett MD et al. & PM H
ogarth. 1995. Multiple regions of human Fc gamma RII (CD32) contribute to
the binding of IgG.) J Biol Chem. 270 (36): 21188.
15. Hewlett MD & PM Hogarth. 1998. “FcγRI (CD64
) Give the IgG2a unique high affinity binding ”(Hulett MD & PM Hogarth. 1998. The second and third extracellular doma
ins of FcgammaRI (CD64) confer the unique high affinity binding of IgG2a.
) Mol Immunol. 35 (14-15): 989.
16. Yerino FL etc. & PM Hogarth. 1993a. “Recombinant soluble human FcγRII: production, characterization, and inhibition of the Alsus response” (Ierino FL et al
& PM Hogarth. 1993a. Rec. Soluble human FcγRII: prodn, characterizatio
n, and inhibition of the Arthus reaction.) J Exp Med 178: 1617.
17. Yerino FL etc. & PM Hogarth. 1993b. “Epitope mapping of human FcγRII (CDw32) using monoclonal antibodies and recombinant receptors” (Ierino FL et al. & PM Hogarth. 1993b. Mapping epitopes of human
Fc gamma RII (CDw32) with monoclonal antibodies and recombinant receptor
s.) J. Immunol. 150: 1794-803.
18. Lau LM et al & DE Jackson. 2004. “Tetraspanin superfamily member CD151 regulates integrin αIIbβ3 signaling and platelet function into cells” (Lau LM et al. & DE Jackson. 2004. The t
etraspanin superfamily member CD151 regulates outside-in integrin alphaII
bbeta 3 signaling and platelet function.) Blood. 104 (8): 2368.
19. Maxwell KF and others & PM Hogarth. 1999. “Crystal structure of human leukocyte Fc receptor FcγRIIa” (Maxwell KF et al. & PM Hogarth. 1999. Cry
stal structure of the human leukocyte Fc receptor, Fc gammaRIIa.) Nat St
ruct Biol 6: 437.
20. Nabbe KC and others & WB van Denberg. 2003. “Coordinated expression of Fcγ receptor I and III activation and Fcγ receptor type II inhibition in the measurement of joint inflammation and cartilage destruction during immune complex-mediated arthritis” (Nabbe KC et al. & WB va
n den Berg. 2003. Coordinate expression of activating Fc gamma receptors
I and III and inhibiting Fc gamma receptor type II in the determination o
f joint inflammation and cartilage destruction during immune complex-medi
ated arthritis.) Arthritis Rheum 48: 255.
21. Nandakumar KS and others & Holmdahl R. 2004. “Type II collagen (CII) -specific antibodies induce arthritis in the absence of T or B cells, but arthritis progression is promoted by CII-reactive T cells” (Nandakumar KS et al
& Holmdahl R. 2004. Collagen type II (CII) -specific antibodies induce
arthritis in the absence of T or B cells but the arthritis progression is
enhanced by CII-reactive T cells.) Arthritis Res Ther. 6 (6): R544-50.
22. Plum LR & ML Graeme. 1979. “A possible study of the Alsus response, anti-inflammatory and anti-rheumatic drugs in rats” (Pflum LR & ML Graeme. 1979. T
he Arthus reaction in rats, a possible test for anti-inflammatory and ant
i-rheumatic drugs.) Agents Actions 9: 184.
23. Powell MS et al & PM Hogarth. 1999. “Biochemical analysis and crystallization of low affinity receptor FcγRIIa for IgG” (Powell MS et al. & PM H
ogarth. 1999. Biochemical analysis and crystallisation of Fc gamma RIIa,
the low affinity receptor for IgG.) Immunol Lett. 68 (1): 17.
24. Radhaev S et al., 2001. “Structure in complex of human type III Fcγ receptor with Fc” (Radaev S et al., 2001. The structure of a human type III
Fcgamma receptor in complex with Fc.) J. Biol. Chem. 276 (19): 16469-77.
25. Sonderman P et al., 2000. [Human IgG1 Fc fragment-FcγRII
3.2-A crystal structure of I complex ”(Sondermann P et al., 2000. The 3.2-A cry
stal structure of the human IgG1 Fc fragment-Fc gammaRIII complex.) Na
ture 406 (6793): 267-73.
26. Sonderman P et al., 2001. "Molecular basis of immune complex recognition: aFc-
Comparison of receptor structures (Sondermann P et al., 2001. Molecular basis for immune c
omplex recognition: a comparison of Fc-receptor structures.) J. Mol. Bi
ol. 309 (3): 737-49.
27. Seki T. 1989. “Identification of multiple isoforms of low affinity human IgG Fc receptor” (Seki T. 1989. Identification of multiple isoforms of the
low-affinity human IgG Fc receptor.) Immunogenetics. 30: 5-12.
28. Stuart S and others & Bo D. 1987. “Isolation and expression of cDNA clone encoding human receptor for IgG (Fc-RII)” (Stuart S
et al. & Vaux D. 1987. Isolation and expression of cDNA clones encoding a
human receptor for IgG (Fc-RII).) J Exp Med. 166: 1668-1684.
29. Takai T. 2002. "Role of Fc receptors in autoimmunity" (Takai T.
2002. Roles of Fc receptors in autoimmunity.) Nat Rev Immunol. 2 (8): 580.
30. Tam A and others & RE Schmidt RE. 1996. [Human FcγRII
The IgG binding site of the IB receptor contains the CC ′ and FG loops of the adjacent membrane domain ”
(Tamm A et al. & RE Schmidt RE. 1996. The IgG binding site of human Fcga
mmaRIIIB receptor involves CC 'and FG loops of the membrane-proximal doma
in.). J Biol Chem. 271 (7): 3659.
31. Thai LeM and others & DE Jackson. 2003. “P on platelet cytoplasmic membrane
Physical proximity and functional interaction of ECAM-1 with Fc receptor FcγRIIa ”(Thai LeM et al. & DE Jackson. 2003. Physical proximity and functional
interplay of PECAM-1 with the Fc receptor Fc gamma RIIa on the platelet
plasma membrane.). Blood. 102 (10): 3637.
32. Wines BD & SB Easter Brook Smith. 1988. “Promotion of C1q binding to immune complexes by polyethylene glycol” (Wines BD & SB E
asterbrook-Smith. 1988. Enhancement of the binding of C1q to immune compl
exes by polyethylene glycol.) Mol Immunol. 25 (3): 263.
33. Wines BD etc. & PM Hogarth. 2000. “IgG Fc is different from F
c Receptor (FcR) binding site: leukocyte receptors FcγRI and FcγRII
a binds to a region in Fc different from that recognized by neonatal FcR and protein A ”(Wines BD et al. & PM Hogarth. 2000. The IgG Fc contains d
istinct Fc receptor (FcR) binding sites: the leukocyte receptors Fc gamma
RI and Fc gamma RIIa bind to a region in the Fc distinct from that recog
nized by neonatal FcR and protein A.) J. Immunol. 164: 5313-8
34. Wines BD etc. & PM Hogarth. 2001. “Implementation of FcαRI interaction with IgA and leukocyte receptor cluster ligand binding by immune receptors” (Wines BD et al. & PM Hogarth. 2001. The interaction of Fc alpha
RI with IgA and its implications for ligand binding by immunoreceptors o
f the leukocyte receptor cluster. J Immunol. 166 (3): 1781.
35. Wines BD etc. & PM Hogarth. 2003. Soluble FcγRIIa
Inhibits rheumatoid factor binding to immune complexes ”(Wines BD et al. & PM Hogart
h. 2003. Soluble FcgammaRIIa inhibits rheumatoid factor binding to immune
complexes.) Immunology. 109 (2): 246.
36. Wright JK and others & JC Jayton. 1980. “Preparation and characterization of chemically defined oligomers of rabbit immunoglobulin G molecules for complement binding studies” (Wright JK et al. & JC Jaton. 1980. Preparation and characterization o
f chemically defined oligomers of rabbit immunoglobulin G molecules for t
he complement binding studies.) Biochem J. 187 (3): 767.

Claims (23)

A soluble multimeric polypeptide capable of inhibiting the interaction of leukocyte Fcγ receptor (FcγR) and immunoglobulin G (IgG), comprising two or more Fc binding regions bound in a head-to-tail configuration, at least one of which The peptide, wherein the peptide is derived from an FcγR-type receptor and includes a modified Fc domain that is substantially incapable of binding the Fc binding region and that allows for dimerization of the polypeptide. 2. The polypeptide of claim 1 comprising only two bound Fc binding regions, at least one of which is derived from an FcγR type receptor. At least one Fc binding region derived from the FcγR type receptor is FcγRII.
The polypeptide of claim 1 or 2 derived from a type receptor. 4. The polypeptide of claim 3, wherein the at least one Fc binding region is derived from FcγRIIa. 2. Each of the bound Fc binding regions is derived from an FcγR type receptor.
5. The polypeptide according to any one of 4 to 4. 6. The polypeptide of claim 5, wherein each of the bound Fc binding regions is derived from the same FcγRII type receptor. The Fc binding region binds via a linker comprising 1 to 20 amino acids,
The polypeptide of any one of claims 1-6. 8. The polypeptide of any one of claims 1 to 7, wherein the modified Fc domain exhibits altered effector function. Said Fc domain is derived from IgG ₁ and Leu ²³⁴ and / or Leu ²³⁵
9. The polypeptide of any one of claims 1 to 8, which is modified by substitution. The Fc domain is derived from IgG2a and Leu ²³⁵ , Glu ³¹⁸ , Lys ^3
20 and has been modified by any one or more of the substitutions of Lys ^322, any one of the polypeptides of claims 1 to 8. The polypeptide of any one of claims 1 to 8, wherein the Fc domain is derived from IgG4 and is modified by one or more amino acid modifications of amino acids at positions 228, 233, 234, 235 and 236. . 12. The polypeptide of any one of claims 1 to 11, further comprising a carrier protein. 13. The carrier protein is human serum albumin (HSA).
Polypeptide. A soluble multimeric protein comprising a dimer of the polypeptide of any one of claims 1-13. 15. The protein of claim 14, in the form of an Fc fusion dimeric protein, wherein the Fc fusion dimeric protein comprises a first polypeptide chain and a second polypeptide chain, each polypeptide chain comprising (i) a head Two Fc-binding regions derived from FcγRIIa, coupled in a two-tailed configuration, and (ii) a substantially modified Fc domain that is substantially incapable of binding FcγRIIa and allows dimerization of the first and second polypeptide chains Said protein. The polypeptide of any one of claims 1 to 13, or claim 14 or 15
A polynucleotide molecule comprising a nucleotide sequence encoding the protein of The polynucleotide molecule of claim 16 present in an expression cassette or expression vector.   A recombinant host cell comprising the polynucleotide molecule of claim 16 or 17. The following stages:
(I) providing a recombinant host cell comprising the polynucleotide molecule of claim 16 or 17;
(Ii) culturing the host cell in a suitable medium and under conditions suitable for expression of the polypeptide or protein; and (iii) cultivating the polypeptide or protein from the culture and optionally from the medium. A method of producing a polypeptide or protein. A method of treating a subject for an inflammatory disease comprising the polypeptide of any one of claims 1 to 12 or the protein of claim 14 or 15 to the subject.
Said method comprising administering in any combination with a pharmaceutically or veterinarily acceptable carrier or additive. 21. The method of claim 20, wherein the inflammatory disease is an immune complex (IC) mediated inflammatory disease. The IC-mediated inflammatory disease is from the group consisting of rheumatoid arthritis (RA), immune thrombocytopenic purpura (ITP), systemic lupus erythematosus (SLE), glomerulonephritis heparin-induced thrombocytopenia syndrome (HITTS). 22. The method of claim 21, wherein the method is selected. The following stages:
(I) providing the polypeptide of any one of claims 1 to 13 or the protein of claim 14 or 15 bound to a suitable substrate;
(Ii) by contacting blood collected from the subject with the polypeptide or protein bound to the substrate ex vivo, so that the IC present in the blood is transferred to the substrate via the polypeptide or protein. Processing to combine,
Circulating from a subject afflicted with an immune complex-mediated inflammatory disease comprising: (iii) separating the treated blood from the substrate; and (iv) then returning the treated blood to the subject. A method of removing sex immune complex (IC).