WO2008067069A2 - Mitogen activated protein kinase phosphatase 4 (mkp4) and methods of use thereof - Google Patents

Abstract

Compositions and methods are provided for treating cancer, particularly skin cancer.

Description

MITOGEN ACTIVATED PROTEIN KINASE PHOSPHATASE 4 (MKP4) AND METHODS OF USE THEREOF

This application claims priority under 35 U.S. C. §119(e) to U.S. Provisional Patent Application No. 60/852,807, filed on October 19, 2006. The foregoing application is incorporated by reference herein.

FIELD OF THE INVENTION

This invention relates to the fields of oncology. More specifically, the present invention provides methods and compositions for treating cancers, particularly non- melanoma skin tumors, by administering MAP kinase inhibitors.

BACKGROUND OF THE INVENTION

Several publications and patent documents are cited throughout the specification in order to describe the state of the art to which this invention pertains. Each of these citations is incorporated herein by reference as though set forth in full. Ras activation is one of the most common alterations in human carcinogenesis (Katz and McCormick (1997) Curr. Opin. Genet. Dev., 7:75-79). Although Ras mutations are found in approximately 30% of human cancers overall (Bos, J.L. (1989) Cancer Res., 49:4682-4689), activation of the Ras pathway has been recognized as a general feature of human cancer through B-Raf mutation (Davies et al. (2002) Nature, 417:949-954), EGFR amplification (Rogers et al. (2005) Cancer Metastasis Rev., 24:47-69), and the loss of neurofibromin in human cancer without Ras mutation

(Cichowski and Jacks (2001) Cell 104:593-604). Ras mutation activates a signaling cascade that leads to the activation of a number of downstream effectors essential for carcinogenesis. One of these is Erk which is activated by MEK, a dual-specificity kinase that phosphorylates threonine and tyrosine residues in the TXY motif of Erk. The phosphorylated Erk is translocated from the cytosol to the nucleus where it phosphorylates numerous substrates needed for cell cycle entry. Erk activation is essential for carcinogenesis (Lewis et al. (1998) Adv. Cancer Res., 74:49-139), and constitutively activated Erk is found in a variety of human cancers (Hoshino et al. (1999) Oncogene, 18:813-822). Constitutive activation of MEK is sufficient to transform mammalian cells (Mansour et al. (1994) Science, 265:966-970). Furthermore, Erk inhibition by small molecule inhibitors of MEK has been shown to result in tumor regression in vivo (Sebolt-Leopold et al. (1999) Nat. Med., 5:810-816).

In contrast to Erkl and Erk2, whose roles in carcinogenesis have been characterized, the involvement of Erk 5, Erk7, and Erk8 in carcinogenesis is largely unknown (Abe et al. (1996) J. Biol. Chem., 271 :16586-16590; Abe et al. (2001) J. Biol. Chem., 276:21272-21279; Abe et al. (2002) J. Biol. Chem., 277:16733-16743). In contrast to the established role of Erk activation in carcinogenesis, the role of JNK and p38 in carcinogenesis remains a matter of debate (Rennefahrt et al. (2005) Cancer Lett., 217:1-9). JNK and p38 are stress activated MAP kinases (Davis, R.J. (2000) Cell, 103:239-252; Zarubin and Han (2005) Cell Res., 15:11-18). On one hand, numerous studies identify JNK and p38 as factors involved in apoptosis in response to cellular stress. Additionally, JNK deficient cells are more susceptible to H-Ras transformation (Kennedy et al. (2003) Genes Dev., 17:629-637). Furthermore, complete inactivation of p38 through disruption of MKK3 and MKK6 leads to defective growth arrest and increased tumorigenesis (Brancho et al. (2003) Genes Dev., 17:1969-1978). Mutations within JNK3 and a JNK activator (MKK4) are also found in human brain and prostate cancers (Yoshida (2001) J. Hum. Genet., 46:182- 187; Kim et al. (2001) Cancer Res., 61 :2833-2837). The activation of JNK and p38 seen in these contexts makes them generally considered to be pro-apoptotic and anti- oncogenic MAPKs in carcinogenesis.

In contrast, there are other lines of evidence which implicate that JNK and p38 are oncogenes. For example, phosphorylated p38 is correlated with the progression of low grade follicular lymphoma to high grade diffuse large B cell lymphoma (Elenitoba- Johnson et al. (2003) Proc. Natl. Acad. ScL, 100:7259-7264).

Phosphorylated p38 is detected in about 20% of human breast carcinoma and associated with poor prognosis (Esteva et al. (2004) Cancer, 100:499-506). A pro- oncogenic role of JNK originates from its substrates c-Jun, Fos, and ATF, which are API components essential for Ras-mediated transformation (Angel and Karin (1991) Biochim. Biophys. Acta, 1072:129-157; Vogt, P.K. (2002) Nat. Rev. Cancer, 2:465- 469). The c-jun proteins with mutation at JNK phosphorylation sites are unable to cooperate with Ras in transformation of cells in culture (Smeal et al. (1991) Nature, 354:494-496). Oncogenic JNK is more likely involved in malignant progression. Introduction of fos into benign papilloma cells is sufficient to convert the cells to SCC (Greenhalgh et al. (1990) Proc. Natl. Acad. ScL, 87:643-647). In contrast, papillomas from fos deficient mice carrying an activated H-Ras fail to develop malignant tumors, whereas those from wild type littermates undergo malignant conversion (Saez et al.

(1995) Cell 82:721-732). Furthermore, JNK is required for tumorigenesis by Ras and fos (Behrens et al. (2000) Oncogene, 19:2657-2663).

Normally, Erk activity is tightly regulated by MAPK phosphatases (MKPs). MKPs are dual-specificity phosphatases that dephosphorylate the corresponding TXY residues phosphorylated by MEK (Keyse, S. M. (2000) Curr. Opin. Cell Biol., 12:186- 192). There are at least nine distinct mammalian MKPs and they share a highly conserved C-terminal catalytic domain. The specificity of MKPs appears to be achieved through MAPK interaction with the less conserved N-terminal domains (Fjeld et al. (2000) J. Biol. Chem., 275:6749-6757). The substrate specificity of MKPs may not be simply a biochemical issue. Other properties of MKPs, such as cell type-specific expression, cellular localization, and their regulation may contribute to the substrate specificity and function of MKPs (Camps et al. (2000) FASEB J., 14:6- 16). Many MKPs are induced by activated MAPKs, thus forming a negative regulation loop. MKPl is the prototype of MKPs, first identified as an immediate early gene induced by mitogen and oxidative stress (Sun et al. (1993) Cell, 75:487- 493; Keyse and Emslie (1992) Nature, 359:644-647). Erk inhibition by MKPl is sufficient to block DNA synthesis and cell cycle entry activated by oncogenic Ras (Sun et al. (1994) Science, 266:285-288). In addition to transcriptional induction, MKPl, MKP2, and MKP3 proteins are stabilized by Erk mediated phosphorylation. Furthermore, the enzymatic activity of MKPl and MKP3 is allosterically activated by Erk binding to their N-terminal non-catalytic domain. MKP 1 and MKP2 are localized in the nucleus whereas MKP3 and MKP4 are mainly cytosolic, suggesting distinct roles to inactivate Erk in different cellular compartments. Multiple regulations of Erk by the different MKPs provide a feedback mechanism to fine-tune Erk activity for its biological action.

With the identification of MKPs as negative regulators of Erk, it has been suggested that MKPs may function as tumor suppressors in carcinogenesis (Sun et al. (1994) Science, 266:285-288). However, analysis of MKPl expression in human cancer suggests that MKPl does not behave as a tumor suppressor. Overexpression of MKPl is found in a variety of human cancers including breast cancer (Loda et al.

(1996) Am. J. Pathol., 149:1553-1564), non-small cell lung cancer (Vicent et al. (2004) Clin. Cancer Res., 10:3639-3649), and prostate cancer (Magi-Galluzzi et al. (1997) Lab Invest., 76:37-51). Furthermore, down-regulation of MKPl suppresses tumorigenicity of pancreatic cancer cells in vivo (Liao et al. (2003) Gastroenterology, 124:1830-1845). Studies of mouse epidermal carcinogenesis also suggest that MKPs may have different roles at different stages of carcinogenesis. Elevated MKPl expression has been found in the initiated keratinocyte (03C) followed by normalized MKPl expression in their paired malignant cell derivative (03R; Wang et al. (2002) Carcinogenesis, 23:635-643). In a chemical hepatocarcinogenesis model, MKPl mRNA is increased in primary hepatomas whereas MKP2 mRNA is increased in hepatic malignancies (Yokoyama et al. (1997) Biochem. Biophys. Res. Commun., 239:746-751). Cytosolic MKP3 protein is overexpressed in mild dysplasia as well as in severe dysplasia/carcinoma in situ in pancreatic ducts, but MKP3 is under- expressed in poorly differentiated pancreatic carcinoma (Furukawa et al. (2003) Am. J. Pathol., 162:1807-1815). The tumor suppressor activity of MKP3 has been demonstrated by MKP3-mediated growth arrest and apoptosis in pancreatic cancer cells (Furukawa et al. (2003) Am. J. Pathol., 162:1807-1815) as well as suppression of Ras-dependent tumorigenesis by a GFP-fused MKP3 protein (Marchetti et al. (2004) J. Cell Physiol, 199:441-450). The identification of cytosolic MKP3 but not nuclear MKPl as a tumor suppressor raises questions of what is the role of cytosolic Erk in carcinogenesis and what is the effect of Erk inhibition by cytosolic MKPs.

MKP4 is another cytosolic MKP with MAP kinase selectivity Erk>p38=JNK (Muda et al. (1997) J. Biol. Chem., 272:5141-5151; Dickinson et al. (2002) Biochem. J., 364:145-155). It shows closest sequence similarity to MKP3 (57% identity) and MKPX (61% identity) in the MKP family. Notably, the deletion of the MKP4 gene results in embryonic lethality due to placental insufficiency (Christie et al. (2005)

MoI. Cell Biol., 25:8323-8333). However to date there has been no direct evidence as to the mechanism of action of tumor suppression by MKPs.

SUMMARY OF THE INVENTION In accordance with one aspect of the instant invention, methods are provided for treating cancer comprising administering a pharmaceutical composition to a patient in need thereof, wherein the pharmaceutical composition comprises at least one compound which increases MKP4 activity and a pharmaceutically acceptable carrier. In one embodiment, the compound is MKP4 protein or a nucleic acid molecule encoding MKP4 (e.g., an expression vector encoding MKP4 (e.g., a lentiviral or adenoviral vector). In a preferred embodiment, the at least one compound is an inhibitor of at least one mitogen activated protein (MAP) kinase, particularly a MPA kinase selected from the group consisting of Erk, JNK, and p38. In yet another embodiment, the compound(s) inhibits at least Erk and JNK. The inhibitors may be isoform specific, may inhibit certain isoforms of a MAP kinase, may inhibit all isoforms of a MAP kinase, and/or inhibit isoforms of more than one MAP kinase. In a particular embodiment, the cancer to be treated is a non-melanoma skin cancer. The pharmaceutical composition may be administered topically. According to another aspect of the instant invention, methods are provided for diagnosing a tumor as a tumor susceptible to mitogen activated protein (MAP) kinase inhibitor treatment. The method comprises comparing the level of MPK expression in a biological sample from a patient to the corresponding tissue in a normal person, wherein a decrease in the level of MKP in the biological sample obtained from the patient compared to the MKP level in the normal patient indicates the patient has a tumor susceptible to MAP kinase inhibitor treatment. In a particular embodiment, the MPK is MPK4. The tumor susceptible to MAP kinase inhibitor administration may be treated by restoring MKP4 activity by delivering at least one inhibitor of a mitogen activated protein (MAP) kinase selected from the group consisting of Erk, JNK, and p38 and/or increasing expression of MKP4.

In accordance with another aspect of the instant invention, methods are provided for determining the effectiveness of a MAP kinase inhibitor for the treatment of cancer in a patient, particularly a cancer characterized by a decrease in MKP activity (e.g., MKP4 activity). The methods comprise determining whether the MAP kinase isoform(s) inhibited by the MAP kinase inhibitor is a substrate of the MPK. If the MAP kinase inhibitor inhibits at least one MAP kinase isoform which is a substrate of the MPK, then the MAP kinase inhibitor is effective for the treatment of a cancer characterized by a decrease in the activity of the MPK.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure IA is a schematic of the strategy to identify MKP4 from the multistage epidermal cell model of carcinogenesis by microarray analysis. Figure IB provides images of a gel depicting the analysis of MKP4 mRNA level in the epidermal model of carcinogenesis by RT-PCR with HPRT as a loading control. Figure 1C provides images of a Western blot analysis with anti-MKP4 antibody of MKP4 protein in cell lysates from malignant SCC lineages (initiated 03C and tumorigenic 03R), benign papilloma lineages (initiated 09C and tumorigenic 09R), and their parental cell (291). Figure ID provides images of a Western blot analysis of MKP4 protein in lysates from UV induced SCC tissue and DMBA/TPA induced papillomas.

Figure 2A provides images of Western blot analyses of Erk, JNK, and p38 MAP kinase activities in 03R tumor cells reconstituted with MKP4 by MKP4 recombinant lentivirus. 03R cells were infected with MKP4 lentivirus (MKP4) or GFP lentivirus as control (Con). The phosphorylation status of Erk, JNK and p38 was measured by direct immunoblotting with antibodies specific to dual-phosphorylated Erk, JNK, and p38, respectively. The parental 291 cell was included as negative control. Figure 2B provides images of 03R tumor cells infected with recombinant lentivirus in which MKP4 wild type cDNA and GFP are co-expressed from an IRE expression cassette (MKP4), with lentivirus containing GFP only as a control (Con). GFP expression was monitored by immunofluorescence to track both groups of lentivirus infected cells. The morphology of 03R cells infected with MKP4 virus at day 3, 6, 9 and control virus at day 9 is shown in the left panel. The percent survival of MKP4 lentivirus-infected 03R cells was calculated by relative ratio of the number of GFP positive cells 9 days after the infection to the initial infection efficiency (right panel). Figure 2C provides images of blots comparing the phosphatase activities of MKP3 and MKP4 in 03R cells (as in Fig. 2A). Figure 2D provides images of the effect of MKP3 expression in 03R tumor cells by infection with MKP3 lentivirus. The morphology of 03R cells infected with control virus, MKP3 virus, and MKP4 virus at 9 days after the infection is shown on the left panel. The survival percentage of MKP4 lentivirus-infected 03R cell was calculated as in Figure 2B above and is shown in the right panel.

Figure 3 A provides Western blot analyses of a tetracycline controlled MKP4 expression system established in H 1299 cells. The tetracycline dependent MKP4 expression and its phosphatase activity were measured by immunoblotting with MKP4 antibody and phosphospecific antibodies to Erk, JNK, and p38, respectively. Figure 3B provides images of the morphological changes of H1299/MKP4-Tet cells at 2, 4, and 6 days after tetracycline induction. Figure 3C contains graphs of the DNA content changes following MKP4 induction. Figure 3D provides graphs of the cell death profiles of H1299/MKP4-Tet cells after tetracycline induction. Dead cell population is indicated by solid circles.

Figure 4A provides images of 03R cells infected with control lentivirus (Con) and MKP4 lentivirus (MKP4), respectively. Four days after the infection, cells were permeablized to release free tubulin prior to fixation. Microtubules were stained with anti-tubulin-α antibody. The nuclei were stained with Hoechst 33342. The images were captured and processed with a Nikon confocal imager system. Figure 4B provides images of the microtubule structure of H1299/MKP4-Tet cells 4 days after MKP4 induction by tetracycline. The images were captured with Leica imager system. The bar equals 50 microns.

Figure 5 A is a graph representing the suppression of 03R tumor formation by MKP4 lentivirus. Two million each of 03R cells infected with MKP4 lentivirus (MKP4) or control GFP lentivirus (Con) were inoculated subcutaneously into Balb/C neonates. The tumor size was monitored beginning at 10 days after the inoculation. Tumor size was calculated by using the equation: Tumor size (in mm³)=0.4 x length x width². The error bars represent the standard deviation from the mean. Figure 5B provides images of the GFP expression in tumor sections measured by immunostaining with anti-GFP antibody to track lentiviral infected 03R cells. The nuclei in tumor sections were stained with Hoechst. Figure 5C demonstrates the suppression of pre-existing tumor xenographs by tetracycline induced MKP4 expression. Two million H1299-MKP4-Tet cells were subcutaneously inoculated into each flank of nude mice. When visible tumor appeared (approx. 50 mm³) at 35 days after the inoculation, MKP4 expression was induced by administration of tetracycline in the drinking water. Tumor sizes were measured over time after MKP4 induction by tetracycline. The right panel shows the example of tumors in the nude mice on day 10 after MKP4 induction by tetracycline. Figure 5D provides images of H1299 tumor specimens from mice on day 8 after MKP4 induction by tetracycline. The bar equals 50 microns.

Figure 6A provides Western blots of the infection efficiency of MKP4 lentivirus on non-tumorigenic cells 291 and tumorigenic cells 03R evaluated by immunoblotting of MKP4 and GFP. Figure 6B provides images of the morphology of MKP4 lentivirus infected 291 and 03R cells at 9 days after the infection. Figure 6C provides a graph of the percentage of MKP4 positive cells that survived, as calculated by dividing the number of MKP4 positive cells at 9 days by the number of MKP4 positive cells at 3 days.

Figure 7 provides images of Western blots demonstrating the association of MKP4 with MAPK isoforms. The Flag-tagged ERK2, p38α/β/γ/δ, JNKl -βl, JNK2- α2, and JNK3-2 were transfected into H1299/MKP4-Tet cells. The expression of MKP4 was induced by tetracycline (5 μg/ml) 8 hours after the transfection. Prior to lysate harvest, the cells were treated with 0.5 mM H₂O₂ for 4 hours. The cell lysates were subjected to immunoprecipitation with anti-Flag antibody M2 followed by immunoblotting with MKP4 antibody. Figure 8 provides images (left panels) of human small cell lung carcinoma cells H1299 treated for 5 days with Erk inhibitor (UO126), JNK inhibitor (SP600125), combined inhibition of both Erk and JNK (UO+SP), and DMSO (vehicle). The right panels provide graphical representations of the DNA content changes upon the specific treatments.

DETAILED DESCRIPTION OF THE INVENTION In searching for early alterations in the Ras pathway in epidermal carcinogenesis, MKP4, a cytosolic MKP with specificity to not only Erk but also to a lesser extent JNK and p38, was identified. MKP4 is downregulated at initiation and lost at malignant conversion in a clonal model of sporadic epidermal carcinogenesis that lacks Ras mutation. The loss of MKP4 is associated with the malignant squamous cell carcinoma lineages but not benign papilloma lineages. Reconstitution of MKP4 expression in malignant mouse or human tumor cells leads to microtubule disruption and mitotic catastrophe. Microtubule disruption by MKP4 provides the basis for tumor suppression by cytosolic MKPs. Furthermore, MKP4 reconstitution demonstrated a tumoricidal effect on well established human tumor xenographs, providing proof of principle for a novel therapeutic strategy through combined MAPK inhibitions that mimic the function of MKP4.

The identification of MKP4 as a tumor suppressor supports original conceptions of MKPs as negative regulators of oncogenic ERK activation and putative tumor suppressors. The current data point towards MKP localization as a determinant for its contribution in carcinogenesis. Since both MKPl and MKP2 are nuclear MKPs induced by activated Erk, they appear to be good candidates for forming negative feedback loops to inactivate Erk in the nucleus and opposing nuclear Erk's role in activation of cell cycle entry. However, the evidence from MKPl and MKP2 overexpression in human cancer argue against their role in tumor suppression. So far MKP3 and MKP4 are the only MKPs with demonstrated tumor suppression activity. Both MKP3 and MKP4 are cytosolic MKPs with predominant activity specific to Erk. This suggests that the inhibition of cytosolic Erk activity is critical for tumor suppression.

The fact that activated Erk is generally considered to be translocated into the nucleus to mediate growth signal transduction raises questions regarding what contribution cytosolic Erk makes to carcinogenesis and how the cytosolic MKPs regulate Erk activity. Herein, reconstitution of MKP4 was found to lead to microtubule disruption, implicating itself and the activation state of its substrate Erk in microtubule formation. In fact, Erk was originally identified as a kinase of microtubule associated protein 2 (MAP2) long before being recognized as a mitogen activated protein kinase (Ray and Sturgill (1988) Proc. Natl. Acad. Sci., 85:3753- 3757). Despite the fact that about half of activated Erk activity is associated with microtubules (Reszka et al. (1995) Proc. Natl. Acad. Sci., 92:8881-8885), the role of Erk activation in microtubule regulation is largely overlooked. Microtubules are not only structural proteins contributing to cell shape maintenance and cell polarity but they also act as molecular motors for intracellular transport and mitosis. Microtubules undergo constant polymerization and depolymerization, termed as microtubule dynamic instability. This process is regulated through stabilizing factors such as microtubule associated protein 2 (MAP2) and destabilizing factors such as stathmin or oncoprotein 18 (Desai and Mitchison (1997) Annu. Rev. Cell Dev. Biol., 13:83-117). Microtubule poisons disrupt microtubules by perturbing either polymerization (colchicines) or depolymerization (taxol). In addition to Erk, other MAP kinases,

JNK and p38 are also implicated in microtubule regulation. MAP2 is also a substrate of JNKl. Compromised microtubule integrity was observed in neuronal cells from JNKl deficient mice (Chang et al. (2003) Dev. Cell, 4:521-533). Stathmin, a microtubule destabilizing factor, is phosphorylated by p38 (Mizumura et al. (2006) J. Cell Physiol., 206:363-370). Stathmin phosphorylation inhibits its function as a destabilizing factor; thus p38 also potentially contributes to microtubule polymerization. Microtubule disruption by MKP4, a phosphatase with specificity to Erk, JNK, and p38, suggests that the regulation of microtubule polymerization/depolymerization is a combined effect from different MAP kinases. Erk activation is generally considered to contribute to cell cycle entry by activating the expression of cyclins needed for the cell cycle, such as cyclin Dl. However, cyclin Dl expression and cell cycle entry is independent of Erk activation in many malignant tumor cells (Solit et al. (2006) Nature, 439:358-362). This is probably due to the inactivation of the Rb pathway in those tumor cells, for example, the loss of pi 6 in 03R cell. As both Rb inactivation and Ras activation are required for malignant transformation as suggested from the transformation of primary human mammary epithelial cells (Elenbaas et al. (2001) Genes Dev., 15:50-65), sustained Erk activation by oncogenic Ras should contribute to activities other than the activation of cell cycle entry in tumor cells. Although the mechanisms of microtubule regulation by Erk remain largely unclear, perturbation of microtubule dynamic instability by MKP4 suggests the involvement of Erk in coordination of microtubule activity in cell cycle progression. It is possible that the regulation of Erk and other MAPK activities by MKP4 is a mechanism to coordinate DNA synthesis and microtubule formation to prevent pre-mature cell division. The contribution of Ras activation to chromosomal instability has been demonstrated in various systems from yeast to human (Segal and Clarke (2001) Bioessays, 23:307-310). The activation of Ras is able to generate aberrant chromosomes even within a single cell cycle (Denko et al. (1994) Proc. Natl. Acad. Sci., 91 :5124-5128), and Ras induced chromosome instability is mediated through Erk activation (Saavedra et al. (1999) J. Biol. Chem., 274:38083-38090). It may be hypothesized that MKP4 induction upon Erk activation is not only a negative feedback mechanism but also a checkpoint mechanism to ensure the completion of DNA synthesis before spindle formation and segregation. MKP4 induction is particularly critical when JNK and p38 are activated under stress. Herein, novel approaches to cancer therapy are provided by the evidence for the mechanism of MKP4 action in tumor suppression through its ability to induce tumor cells to undergo mitotic catastrophe, a kind of cell death occurring during mitosis as a result of DNA damage or defective spindle formation in tumor cells. A major advantage of MKP4 reconstitution is its selectivity of effect on tumor cells versus normal cells. In theory, MKP4 expression in normal cells should lead to growth arrest as Erk inhibition is sufficient to block normal cell cycle entry at the Gl /S boundary. In addition, the intact DNA structure checkpoint or spindle checkpoint should block cycling cells in the G2/M phase until the damage is repaired. Indeed, MKP expression leads to mitotic catastrophe in tumor cells but growth arrest in normal cells. Furthermore, in vivo, normal cells abide in GO states which are inaccessible to MKP4 activity. As tumor cells are more actively cycling and are defective in these checkpoints, DNA damage or defective spindles induce mitotic catastrophe instead of growth arrest. Reconstitution of MKP4 expression in mouse or human malignant cells is shown herein to be sufficient to suppress tumor cell growth in vitro and tumorigenesis in vivo. MKP4 inactivation in tumorigenic cells may, among other things, contribute to: 1) the activation of Erk for uncontrolled proliferation and/or 2) the activation of JNK and p38 for malignant progression. JNK and p38 are stress activated MAP kinases that mediate apoptosis and cellular adaptation responses. Increased NF-κB activity by Trim32 (an E3 ligase), overexpression may overcome the pro-apoptotic activity generally associated with JNK and p38. Notably, Trim32 is upregulated in rapidly malignant initiated keratinocyte lineages.

Mitotic catastrophe by MKP4 reconstitution provides a basis for establishing strategies using MAPK inhibitors in cancer therapy. Erk inhibition by small pharmacological molecules has shown promising therapeutic value in animal models (Sebolt-Leopold et al. (1999) Nat. Med., 5:810-816). However, Erk inhibitors alone have been found to be ineffective in many tumor cells (Solit et al. (2006) Nature, 439:358-362) and have failed in treating advanced human tumors in clinical trials (Rinehart et al. (2004) J. Clin. Oncol., 22:4456-4462). Overexpression of Erk specific MKP3 in tumor cells results in growth arrest but not mitotic catastrophe (Marchetti et al. (2004) J. Cell Physiol., 199:441-450). Erk inhibition by UO126 has no effect on the growth and survival of 03R and Hl 299 cells. These lines of evidence suggest that that Erk inactivation may not be sufficient to induce mitotic catastrophe, and therefore other activities associated with MKP4 are required. In addition to Erk, at least, JNK and p38 are inactivated by MKP4. Therefore, the combination of MAPK inhibitors to mimic the activities of MKP4 is an effective strategy in cancer therapy.

The compositions and methods of the instant invention can be used to treat cancer in general. Cancers that may be treated using the present protocol include, but are not limited to: prostate cancers, colorectum, pancreas, cervix, stomach, endometrium, brain, liver, bladder, ovary, testis, head, neck, skin (including melanoma and basal carcinoma), mesothelial lining, white blood cell (including lymphoma and leukemia) esophagus, breast, muscle, connective tissue, lung (including small-cell lung carcinoma and non-small-cell carcinoma), adrenal gland, thyroid, kidney, or bone; glioblastoma, mesothelioma, renal cell carcinoma, gastric carcinoma, sarcoma, choriocarcinoma, cutaneous basocellular carcinoma, and testicular seminoma. In one embodiment, the compositions and methods of the instant invention are suitable for treating head and neck cancer. In particular, the compositions and methods of the instant invention are suitable for treating non- melanoma skin cancer. Non-melanoma skin cancers include, without limitation, squamous cell carcinoma, basal cell carcinoma, mycosis fungoides, kerotocanthoma, actinic keratosis, and seborrheic keratoses.

The compositions of the instant invention may comprise at least one inhibitor of a mitogen activated protein (MAP) kinase. In one embodiment, the MAP kinase is selected from the group consisting of Erk, JNK, and p38. In a particular embodiment, the composition comprises: 1) at least one Erk inhibitor and at least one JNK inhibitor, 2) at least one Erk inhibitor and at least one p38 inhibitor, 3) at least one p38 inhibitor and at least one JNK inhibitor, or 4) at least one Erk inhibitor, at least one p38 inhibitor, and at least one JNK inhibitor. The inhibitors may be isoform specific, may inhibit certain isoforms of a MAP kinase, may inhibit all isoforms of a MAP kinase, and/or inhibit isoforms of more than one MAP kinase. In one embodiment, the composition comprises UO 126 and SP600125. The compositions may further comprise a pharmaceutically acceptable carrier suitable for a desired route of administration. In yet another particular embodiment, the composition comprises a pharmaceutically acceptable carrier for topical administration and at least one inhibitor of a mitogen activated protein (MAP) kinase selected from the group consisting of Erk, JNK, and p38.

Erk inhibitors decrease the activity of Erk. For example, the Erk inhibitor may block, reduce and/or retard the activity of Erk (e.g., the phosphorylation of its substrate(s)) and/or may reduce the amount of Erk present in the cell. Inhibitors may be general inhibitors or isoform specific. Erk inhibitors include, without limitation, small molecules, peptides, peptidomimetics, nucleic acid molecules (e.g., antisense molecules or siRNA), and antibodies. In a particular embodiment, the Erk inhibitors are small molecules ("small molecules" encompasses molecules other than proteins or nucleic acids without strict regard to size). Exemplary Erk inhibitors include, without limitation, CL-1040, PD0325901 (Pfizer), PD98059, PD184352, AZD6244 (AstraZeneca), U0126, GW5074, BAY 43-9006, 3-cyano-4-(phenoxyanilno) quinolines, Ro 09-2210, L-783,277, purvalanol, and derivatives thereof (see, e.g., Kelemen et al. (2002) J. Biol. Chem., 277: 87841-8748; U.S. Patent Application Publications 20030060469, 20040048861, and 20040082631).

JNK inhibitors decrease the activity of JNK. For example, the JNK inhibitor may block, reduce and/or retard the phosphorylation of c- Jun or any other substrate by JNK and/or may reduce the amount of JNK present in the cell. Inhibitors may be general inhibitors or isoform specific. JNK inhibitors include, without limitation, small molecules, peptides, peptidomimetics, nucleic acid molecules (e.g., antisense molecules or siRNA), and antibodies. In a particular embodiment, the JNK inhibitors are small molecules. Exemplary JNK inhibitors include, without limitation, CC-401 (Celgene; Summit, NJ), SP600125, AS-602801, CEP-1347, SB-203580, SB-202190, SPC0009766 and derivatives thereof (see, e.g., WO 2000/035906, WO 2000/035909, WO 2000/035921, WO 2000/064872, WO 2000/75118, WO 2001/012609, WO 2001/012621, WO 2001/023378, WO 2001/023379, WO 2001/023382, WO 2001/047920, WO 2001/091749, WO 2002/046170, WO 2002/062792, WO 2002/081475, WO 2002/083648, and WO 2003/024967). p38 inhibitors decrease the activity of p38. For example, the p38 inhibitor may block, reduce and/or retard the activity of p38 (e.g., the phosphorylation of its substrate(s)) and/or may reduce the amount of p38 present in the cell. Inhibitors may be general inhibitors or isoform specific. JNK inhibitors include, without limitation, small molecules, peptides, peptidomimetics, nucleic acid molecules (e.g., antisense molecules or siRNA), and antibodies. In a particular embodiment, the JNK inhibitors are small molecules. Exemplary inhibitors of p38 include, without limitation, SB242235 (GlaxoSmithKline), SB203580, SC68376, SB203580(Iodo), SB202190, SB203580(Sulfone), PD 169316, SB220025, SKF-86002, SB239063, ML 3163, thienyl urea analog, and derivatives thereof (see, e.g., U.S. Patent Application Publications 20050203111 and 20050009844; Aoshiba et al. (1999) J. Immunol., 162:1692-700; and U.S. Patents 6,608,060; 6,147,080; and 5,945,418).

Since Erk, JNK, and p38 MAP kinase have several isoforms, it is possible that different isoforms may have distinct roles in mediating stress signal transduction and carcinogenesis. Yet, the specific roles of these isoforms in carcinogenesis have not been fully characterized. The identification of MKP4 loss as an oncogenic event allows one to define the function of these isoforms. MKP4 is a phosphotase specific to not only Erk but also JNK and p38. As the reconstitution of MKP4 induces mitotic catastrophe in tumor cells, the isoform(s) specific to MKP4 may be targeted to design appropriate and specific cancer therapy.

Currently, there are 9 different MKPs identified in human as summarized in the Table 1. They demonstrate different substrate specificity and play distinct roles in tumorigenesis. Molecular profiling the MKPs status, as described hereinbelow, provides information in designing, for example, appropriate combinations of MAP kinases inhibitors for cancer therapy.

Table 1 I. Definitions

The following definitions are provided to facilitate an understanding of the present invention.

"Nucleic acid" or a "nucleic acid molecule" as used herein refers to any DNA or RNA molecule, either single or double stranded and, if single stranded, the molecule of its complementary sequence in either linear or circular form. In discussing nucleic acid molecules, a sequence or structure of a particular nucleic acid molecule may be described herein according to the normal convention of providing the sequence in the 5¹ to 3¹ direction. With reference to nucleic acids of the invention, the term "isolated nucleic acid" is sometimes used. This term, when applied to DNA, may refer to a DNA molecule that is separated from sequences with which it is immediately contiguous in the naturally occurring genome of the organism in which it originated. For example, an "isolated nucleic acid" may comprise a DNA molecule inserted into a vector, such as a plasmid or virus vector, or integrated into the genomic DNA of a prokaryotic or eukaryotic cell or host organism. Alternatively, this term may refer to a DNA that has been sufficiently separated from (e.g., substantially free of) other cellular components with which it would naturally be associated. "Isolated" is not meant to exclude artificial or synthetic mixtures with other compounds or materials, or the presence of impurities that do not interfere with the fundamental activity, and that may be present, for example, due to incomplete purification.

With respect to single stranded nucleic acids, particularly oligonucleotides, the term "specifically hybridizing" refers to the association between two single-stranded nucleotide molecules of sufficiently complementary sequence to permit such hybridization under pre-determined conditions generally used in the art (sometimes termed "substantially complementary"). In particular, the term refers to hybridization of an oligonucleotide with a substantially complementary sequence contained within a single-stranded DNA molecule of the invention, to the substantial exclusion of hybridization of the oligonucleotide with single-stranded nucleic acids of non- complementary sequence. Appropriate conditions enabling specific hybridization of single stranded nucleic acid molecules of varying complementarity are well known in the art.

For instance, one common formula for calculating the stringency conditions required to achieve hybridization between nucleic acid molecules of a specified sequence homology is set forth below (Sambrook et al. (1989) Molecular Cloning - A Laboratory Manual, 2nd Edition. Cold Spring Harbor Laboratory Press, New York):

T_m = 81.5C16.6Log [Na+] + 0.41(% G+C) - 0.63 (% formamide) - 600/#bp in duplex

As an illustration of the above formula, using [Na+] = [0.368] and 50% formamide, with GC content of 42% and an average probe size of 200 bases, the T_m is 57⁰C. The T_m of a DNA duplex decreases by 1 - 1.5°C with every 1% decrease in homology. Thus, targets with greater than about 75% sequence identity would be observed using a hybridization temperature of 42⁰C .

The stringency of the hybridization and wash depend primarily on the salt concentration and temperature of the solutions. In general, to maximize the rate of annealing of the probe with its target, the hybridization is usually carried out at salt and temperature conditions that are 20-25⁰C below the calculated T_m of the hybrid. Wash conditions should be as stringent as possible for the degree of identity of the probe for the target. In general, wash conditions are selected to be approximately 12- 2O⁰C below the T_m of the hybrid. In regards to the nucleic acids of the current invention, a moderate stringency hybridization is defined as hybridization in 6X SSC, 5X Denhardt's solution, 0.5% SDS and 100 μg/ml denatured salmon sperm DNA at 42°C, and washed in 2X SSC and 0.5% SDS at 55°C for 15 minutes. A high stringency hybridization is defined as hybridization in 6X SSC, 5X Denhardt's solution, 0.5% SDS and 100 μg/ml denatured salmon sperm DNA at 42°C, and washed in IX SSC and 0.5% SDS at 65°C for 15 minutes. A very high stringency hybridization is defined as hybridization in 6X SSC, 5X Denhardt's solution, 0.5% SDS and 100 μg/ml denatured salmon sperm DNA at 42°C, and washed in 0.1X SSC and 0.5% SDS at 65°C for 15 minutes. When using microarrays obtained from a commercial vendor, hybridization conditions recommended by the manufacturer may be employed.

The term "primer" as used herein refers to an oligonucleotide, either RNA or DNA, either single-stranded or double-stranded, either derived from a biological system, generated by restriction enzyme digestion, or produced synthetically which, when placed in the proper environment, is able to functionally act as an initiator of template-dependent nucleic acid synthesis. When presented with an appropriate nucleic acid template, suitable nucleoside triphosphate precursors of nucleic acids, a polymerase enzyme, suitable cofactors and conditions such as appropriate temperature and pH, the primer may be extended at its 3' terminus by the addition of nucleotides by the action of a polymerase or similar activity to yield a primer extension product. The primer may vary in length depending on the particular conditions and requirement of the application. For example, in diagnostic applications, the oligonucleotide primer is typically 15-25 or more nucleotides in length. The primer must be of sufficient complementarity to the desired template to prime the synthesis of the desired extension product, that is, to be able to anneal with the desired template strand in a manner sufficient to provide the 3' hydroxyl moiety of the primer in appropriate juxtaposition for use in the initiation of synthesis by a polymerase or similar enzyme. It is not required that the primer sequence represent an exact complement of the desired template. For example, a non-complementary nucleotide sequence may be attached to the 5' end of an otherwise complementary primer. Alternatively, non-complementary bases may be interspersed within the oligonucleotide primer sequence, provided that the primer sequence has sufficient complementarity with the sequence of the desired template strand to functionally provide a template-primer complex for the synthesis of the extension product.

The term "probe" as used herein refers to an oligonucleotide, polynucleotide or DNA molecule, whether occurring naturally as in a purified restriction enzyme digest or produced synthetically, which is capable of annealing with or specifically hybridizing to a nucleic acid with sequences complementary to the probe. The probes of the present invention refer specifically to the oligonucleotides attached to a solid support in the DNA microarray apparatus such as the glass slide. A probe may be either single-stranded or double-stranded. The exact length of the probe will depend upon many factors, including temperature, source of probe and use of the method. For example, for diagnostic applications, depending on the complexity of the target sequence, the oligonucleotide probe typically contains 15-25 or more nucleotides, although it may contain fewer nucleotides. The probes herein are selected to be complementary to different strands of a particular target nucleic acid sequence. This means that the probes must be sufficiently complementary so as to be able to "specifically hybridize" or anneal with their respective target strands under a set of pre-determined conditions. Therefore, the probe sequence need not reflect the exact complementary sequence of the target. For example, a non-complementary nucleotide fragment may be attached to the 5' or 3' end of the probe, with the remainder of the probe sequence being complementary to the target strand. Alternatively, non- complementary bases or longer sequences can be interspersed into the probe, provided that the probe sequence has sufficient complementarity with the sequence of the target nucleic acid to anneal therewith specifically.

The term "gene" refers to a nucleic acid comprising an open reading frame encoding a polypeptide, including both exon and (optionally) intron sequences. The nucleic acid may also optionally include non coding sequences such as promoter or enhancer sequences. The term "intron" refers to a DNA sequence present in a given gene that is not translated into protein and is generally found between exons. The term "promoter" or "promoter region" generally refers to the transcriptional regulatory regions of a gene. The "promoter region" may be found at the 5' or 3' side of the coding region, or within the coding region, or within introns. Typically, the "promoter region" is a nucleic acid sequence which is usually found upstream (5') to a coding sequence and which directs transcription of the nucleic acid sequence into mRNA. The "promoter region" typically provides a recognition site for RNA polymerase and the other factors necessary for proper initiation of transcription. A "vector" is a replicon, such as a plasmid, cosmid, bacmid, phage or virus, to which another genetic sequence or element (either DNA or RNA) may be attached so as to bring about the replication of the attached sequence or element. In a particular embodiment, the vector is a viral vector, including, without limitation adenoviral vectors, adeno-associated viral vectors, retroviral vectors, and lentiviral vectors.

An "expression operon" refers to a nucleic acid segment that may possess transcriptional and translational control sequences, such as promoters, enhancers, translational start signals (e.g., ATG or AUG codons), polyadenylation signals, terminators, and the like, and which facilitate the expression of a polypeptide or nucleic acid molecule coding sequence in a host cell or organism (see, e.g., Ausubel et al. (2006) Current Protocols in Molecular Biology, John Wiley and Sons, Inc).

The term "oligonucleotide," as used herein refers to sequences, primers and probes of the present invention, and is defined as a nucleic acid molecule comprised of two or more ribo- or deoxyribonucleotides, preferably more than three. The exact size of the oligonucleotide will depend on various factors and on the particular application and use of the oligonucleotide. The oligonucleotides may be modified by methods known in the art, such as, with methylphosphonate and phosphorothioate analogs (see, e.g., Uhlmann et al., Chemical Review, 90: 544-584 (1990); Cohen, J.S. (ed.) Oligodeoxynucleotides: Antisense Inhibitors of Gene Expression, CRC Press, Inc., Boca Raton, FL (1989))

The phrase "small, interfering RNA (siRNA)" refers to a short (typically less than 30 nucleotides long, particularly 12-30 nucleotides in length) double stranded RNA molecule. Typically, the siRNA modulates the expression of a gene to which the siRNA is targeted. Methods of identifying and synthesizing siRNA molecules are known in the art (see, e.g., Ausubel et al. (2006) Current Protocols in Molecular Biology. John Wiley and Sons, Inc). As used herein, the term siRNA may include short hairpin RNA molecules (shRNA). Typically, shRNA molecules consist of short complementary sequences separated by a small loop sequence wherein one of the sequences is complimentary to the gene target. shRNA molecules are typically processed into an siRNA within the cell by endonucleases. Exemplary modifications to siRNA molecules are provided in U.S. Application Publication No. 20050032733. Expression vectors for the expression of siRNA molecules preferably employ a strong promoter which may be constitutive or regulated. Such promoters are well known in the art and include, but are not limited to, RNA polymerase II promoters, the T7 RNA polymerase promoter, and the RNA polymerase III promoters U6 and Hl (see, e.g., Myslinski et al. (2001) Nucl. Acids Res., 29:2502 09). Preferably, RNA polymerase III promoters are employed. Preferable expression vectors for expressing the siRNA molecules of the invention are plasmids and viral vectors.

"Antisense nucleic acid molecules" include nucleic acid molecules which are targeted to translation initiation sites and/or splice sites to inhibit the expression of the protein of interest. Such antisense molecules are typically between about 15 and about 50 nucleotides in length, more particularly between about 15 and about 30 nucleotides, and often span the translational start site of mRNA molecules. Antisense constructs may also be generated which contain the entire sequence of the target nucleic acid molecule in reverse orientation. Antisense oligonucleotides targeted to any known nucleotide sequence can be prepared by oligonucleotide synthesis according to standard methods. The term "pharmaceutically acceptable carrier" includes any and all solvents, dispersion media and the like which may be appropriate for the desired route of administration of the pharmaceutical composition. The use of such media for pharmaceutically active substances is known in the art. Except insofar as any conventional media or agent is incompatible with the compounds to be administered, its use in the pharmaceutical preparation is contemplated. Examples of pharmaceutically acceptable carriers include, without limitation, water, buffered saline, ethanol, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol and the like), dimethyl sulfoxide (DMSO), oils, detergents, suspending agents or suitable mixtures thereof. Suitable pharmaceutically acceptable carriers and formulations are described in Remington's Pharmaceutical Sciences, 19th Ed. (Mack Publishing Co., Easton, 1995). Additionally, general types of pharmaceutically acceptable topical carriers include, without limitation, sterile liquids, water, alcohol (e.g., ethanol, isopropanol), oils (including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like), aqueous saline solutions, aqueous dextrose and glycerol solutions, emulsions (e.g., microemulsions and nanoemulsions), gels (e.g., an aqueous, alcohol, alcohol/water, or oil (e.g., mineral oil) gel using at least one suitable gelling agent (e.g., natural gums, acrylic acid and acrylate polymers and copolymers, cellulose derivatives (e.g., hydroxymethyl cellulose and hydroxypropyl cellulose), and hydrogenated butylene/ethylene/styrene and hydrogenated ethylene/propylene/styrene copolymers), solids (e.g., a wax-based stick, soap bar composition, or powder (e.g., bases such as talc, lactose, starch, and the like), and liposomes (e.g., unilamellar, multilamellar, and paucilamellar liposomes, optionally containing phospholipids). When more than one therapeutic agent is to be administered, the therapeutic agents can be administered separately or concurrently. The pharmaceutical compositions may further comprise at least one pharmaceutically acceptable carrier, excipient, carrier, buffer, antibiotic, or stabilizer. Such materials should be non-toxic and should not interfere with the efficacy of the active ingredient. Pharmaceutically acceptable carriers are preferably approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in/on animals, and more particularly in/on humans.

As used herein, a "therapeutically effective amount" of an agent or composition of the present invention is an amount sufficient to inhibit growth of or reduce the size of a tumor.

The term "gene therapy" refers to the transfer of genetic material (e.g., DNA or RNA) of interest into a host (e.g., a human or an animal) to treat or prevent a genetic or acquired disease or condition. The genetic material of interest encodes a product, particularly a protein, of therapeutic value whose production in vivo is desired.

As used herein, the term "Erk" may comprise isoforms of Erk, such as, without limitation, Erkl, Erk2, Erk3, Erk4, Erk5 (Abe et al. (1996) J. Biol. Chem., 271 :16586-16590), Erk7 (Abe et al. (2001) J. Biol. Chem., 276:21272-21279), and Erk8 (Abe et al. (2002) J. Biol. Chem., 277:16733-16743).

As used herein, the term "JNK" may comprise isoforms of JNK, such as, without limitation, JNKl, JNK2, and JNK3.

As used herein, the term "p38" may comprise isoforms of p38, such as, without limitation, p38α, p38β, p38γ, and p38δ (Davis, R.J. (2000) Cell, 103:239-252; Zarubin and Han (2005) Cell Res., 15:11-18).

Chemotherapeutic agents are compounds that exhibit anticancer activity and/or are detrimental to a cell (e.g., a toxin). Suitable chemotherapeutic agents include, but are not limited to: toxins (e.g., saporin, ricin, abrin, ethidium bromide, diptheria toxin, Pseudomonas exotoxin, and others listed above); alkylating agents (e.g., nitrogen mustards such as chlorambucil, cyclophosphamide, isofamide, mechlorethamine, melphalan, and uracil mustard; aziridines such as thiotepa; methanesulphonate esters such as busulfan; nitroso ureas such as carmustine, lomustine, and streptozocin; platinum complexes such as cisplatin and carboplatin; bioreductive alkylators such as mitomycin, procarbazine, dacarbazine and altretamine); DNA strand-breakage agents (e.g., bleomycin); topoisomerase II inhibitors (e.g., amsacrine, dactinomycin, daunorubicin, idarubicin, mitoxantrone, doxorubicin, etoposide, and teniposide); DNA minor groove binding agents (e.g., plicamydin); antimetabolites (e.g., folate antagonists such as methotrexate and trimetrexate; pyrimidine antagonists such as fluorouracil, fluorodeoxyuridine, CB3717, azacitidine, cytarabine, and floxuridine; purine antagonists such as mercaptopurine, 6-thioguanine, fludarabine, pentostatin; asparginase; and ribonucleotide reductase inhibitors such as hydroxyurea); tubulin interactive agents (e.g., vincristine, vinblastine, and paclitaxel (Taxol)); hormonal agents (e.g., estrogens; conjugated estrogens; ethinyl estradiol; diethylstilbesterol; chlortrianisen; idenestrol; progestins such as hydroxyprogesterone caproate, medroxyprogesterone, and megestrol; and androgens such as testosterone, testosterone propionate, fluoxymesterone, and methyltestosterone); adrenal corticosteroids (e.g., prednisone, dexamethasone, methylprednisolone, and prednisolone); leutinizing hormone releasing agents or gonadotropin-releasing hormone antagonists (e.g., leuprolide acetate and goserelin acetate); and antihormonal antigens (e.g., tamoxifen, antiandrogen agents such as flutamide; and antiadrenal agents such as mitotane and aminoglutethimide). In a particular embodiment, the chemotherapeutic agent is selected from the group consisting of: placitaxel (Taxol®), cisplatin, docetaxol, carboplatin, vincristine, vinblastine, methotrexate, cyclophosphamide, CPT-11, 5- fluorouracil (5-FU), gemcitabine, estramustine, carmustine, adriamycin (doxorubicin), etoposide, arsenic trioxide, irinotecan, and epothilone derivatives.

As used herein, a "MKP activity" or "biological activity of MKP" refers to an activity exerted by an MKP protein on a substrate, e.g., a MAP kinase. In a particular embodiment, the MKP activity is a direct activity, such as an association with a MKP substrate (e.g., a molecule with which a MKP protein binds or interacts). For example, a MKP4 activity is the inhibition of MAP kinases such as Erk, JNK, and p38. The MKP activity may also be an indirect activity, e.g., a downstream cellular activity. Exemplary MKP activities include, without limitation, 1) the ability to modulate or inactivate (e.g., via dephosphorylation) enzymes involved in signaling pathways (e.g., MAP kinases); 2) the ability to reverse the effects of the activities of enzymes (e.g., MEKs) involved in signaling pathways; 3) the ability to modulate or inhibit pathways via the modulation or inhibition of components of the pathways such as signal transduction pathways (e.g. those involved in cellular growth, mitogenesis, and differentiation); insulin signaling pathways, and the glycogen synthesis pathway. The presence of the MKP is not required for MKP activity. Indeed, as explained herein, MKP4 activity can be increased or restored through the administration of a MAP kinase inhibitor, such as an Erk inhibitor, even though MKP4 may be absent or non-functional.

As used herein, the term "biological sample" refers to a subset of the tissues of a biological organism, its cells or component parts (e.g. body fluids).

II. Therapeutics In a particular embodiment, pharmaceutical compositions of the instant invention comprise at least one compound which increases or mimics MPK activity, particularly MPK4. In a particular embodiment, the compound(s) inhibits at least one substrate of MPK4, such as MAP kinase(s) (e.g., Erk, JNK, and p38). In a particular embodiment, the pharmaceutical composition comprises inhibitors of Erk, JNK, and p38. The inhibitors may be isoform specific, may inhibit certain isoforms of a MAP kinase, inhibit all isoforms of a MAP kinase, and/or inhibit isoforms of more than one MAP kinase. In another embodiment, the inhibitors only inhibit the MAP kinase isoforms which are substrates of a MPK, such as MPK4. Preferably, the pharmaceutical composition further comprises at least one pharmaceutically acceptable carrier. The pharmaceutical compositions may further comprise at least one additional chemotherapeutic agent.

The pharmaceutical compositions of the instant invention may comprise a pharmaceutically acceptable carrier suitable for the delivery of the inhibitors by any route of administration such as, without limitation, topically, orally, or by direct administration/injection to the tumor. In a particular embodiment, the composition is provided by topical administration. As used herein, "topically applying" means directly laying on or spreading on outer skin. The topical compositions may be applied by an applicator such as a wipe, swab, or roller. The topical compositions of the present invention may be made into a wide variety of product types such as, without limitation, liquids, lotions, powders, creams, salves, gels, milky lotions, sticks, sprays (e.g., pump spray), aerosols, ointments, pastes, mousses, dermal patches, controlled release devices, and other equivalent forms. Pharmaceutically acceptable carriers for topical administration of the instant invention include, without limitation, sterile liquids, such as water (may be deionized), alcohol (e.g., ethanol, isopropanol), oils (including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like), other organic compounds or copolymers, emulsions (e.g., microemulsions and nanoemulsions), gels (e.g., an aqueous, alcohol, alcohol/water, or oil (e.g., mineral oil) gel using at least one suitable gelling agent (e.g., natural gums, acrylic acid and acrylate polymers and copolymers, cellulose derivatives (e.g., hydroxymethyl cellulose and hydroxypropyl cellulose), and hydrogenated butylene/ethylene/styrene and hydrogenated ethylene/propylene/styrene copolymers), solids (e.g., a wax-based stick, soap bar composition, or powder (e.g., bases such as talc, lactose, starch, and the like), and liposomes (e.g., unilamellar, multilamellar, and paucilamellar liposomes, optionally containing phospholipids). The pharmaceutically acceptable carriers also include stabilizers, penetration enhancers, chelating agents (e.g., EDTA, EDTA derivatives (e.g., disodium EDTA and dipotassium EDTA), iniferine, lactoferrin, and citric acid), and excipients. Protocols and procedures which facilitate formulation of the topical compositions of the invention can be found, for example, in Cosmetic Bench Reference 2005, Published by Cosmetics & Toiletries, Allured Publishing Corporation, Illinois, USA, 2005 and in International cosmetic ingredient dictionary and handbook. 10th ed. Edited by Tatra E. Gottschalck and Gerald E. McEwen. Washington, Cosmetic, Toiletry and Fragrance Association, 2004.

The dose and dosage regimen of a pharmaceutical preparation may be determined by a physician considering the patient's age, sex, weight, general medical condition, and the specific condition and severity thereof for which the preparation is being administered. The physician may also consider the route of administration of the agent, the pharmaceutical carrier with which the agent may be combined, and the agent's biological activity.

In accordance with the instant invention, nucleic acid molecules encoding MKP4 may be used in a method of gene therapy, to treat a patient. Vectors, such as viral vectors have been used to introduce genes into a wide variety of different target cells. Typically the vectors are exposed to the target cells so that transformation can take place in a sufficient proportion of the cells to provide a useful therapeutic or prophylactic effect from the expression of the desired polypeptide. The transfected nucleic acid may be permanently incorporated into the genome of each of the targeted cells, providing long lasting effect, or alternatively the treatment may have to be repeated periodically. A variety of vectors for gene therapy, both viral vectors and plasmid vectors, are known in the art.

III. Diagnostic The instant invention also encompasses diagnosing of tumors for the determination of appropriate medical treatment. Specifically, biological samples may be obtained from the tumor of a patient. The protein and/or nucleic acid (in particular, mRNA) levels and/or activity of MKP4 can then be assessed in the biological sample by methods known in the art (e.g., by the use of MKP4 specific probes, MKP4 specific primers for RT-PCR, MKP4 specific antibodies by immunoblotting/staining, dephosphorylation assays). The MKP4 levels from the patient can then be compared to MKP4 levels from a biological sample obtained from a normal patient. Decreased levels of MKP4 in the biological sample obtained from the patient indicate that the patient is a candidate for treatment with MAP kinase inhibitors, particularly those described hereinabove. The patient may also be considered a candidate for MKP4 gene therapy.

As used herein, a "tumor susceptible to MAP kinase inhibitor treatment" refers to those tumors that will be retarded in growth or reduced in size because of the administration of MAP kinase inhibitors (e.g., inhibitors of Erk, JNK, p38) and/or at least the restoration of MKP 4 activity.

While MKP4 is exemplified hereinabove, other members of the MKP family may be used in the diagnostic methods, particularly, MKPl and MKP3. Without wishing to be bound by theory, MKPl may be considered an oncogene while MKP3 may be considered cytostatic and MKP4 to be cytotoxic. Assessing the protein and/or nucleic acid levels of at least one MKP as compared to levels from normal individuals will allow the diagnosis of the tested tumor and allow for the determination of appropriate medical treatment and expected outcome. For example, a loss in MKP3 could indicate that the tumor should be treated to at least restore MKP3 activity and that such treatment will have a cytostatic effect on the tumor. Additionally, a gain in MKPl could indicate that the tumor should be treated with agents to reduce MKPl activity.

The examples set forth below are provided to better illustrate certain embodiments of the invention. They are not intended to limit the invention in any way.

EXAMPLE I METHODS

Cell culture

Non-transformed epidermal cells 291 were grown in the conditional low calcium medium as described (Kulesz-Martin et al. (1988) Carcinogenesis, 9:171- 174). The initiated cell lines (03C and 09C) as well as the tumorigenic cell lines (03RAT and 09RAT) were maintained in high calcium Eagle's minimal essential medium. H1299 cells were grown in Dulbecco's modified eagle's medium supplemented with 10% fetal calf serum. Total RNAs were isolated from each cell type performed in biological triplicate using TRIZOL reagent according to the instructions of the manufacturer (Invitrogen; Carlsbad, CA). The Affymetrix Genechip (Santa Clara, CA) analysis was performed by the Gene Microarray Shared Resource at OHSU. The expression level of MKP4 was confirmed by RT-PCR with a set of MKP4 specific primers:

ACCCACCTTCCTTCTTTACTACCC (forward; SEQ ID NO: 2) and TTCTACTCTGTTCCTGCCTTGCTC (reverse; SEQ ID NO: 3) which amplified a 220 base pair cDNA fragment of mouse MKP4. A set of primers specific to hypoxanthine-guanine phosphoribosyltransferase (HPRT): CCTGCTGGATTACATTAAAGCACTG (forward; SEQ ID NO: 4) and GTCAAGGGCATATCCAACAACAAAC (reverse; SEQ ID NO: 5), was used in each RNA sample to amplify HPRT cDNA as a reference.

Antibody production and immunoblotting

The anti-MKP4 antibody was produced by immunizing rabbits with the synthetic peptide corresponding to the last 20 amino acids of murine MKP4, NH₂- Asp-Pro-Pro-Ser-Phe-Phe-Thr-Thr-Pro-Thr-Ser-Asp-Gly-Val-Phe-Glu-Leu-Asp-Pro- Thr-COOH (SEQ ID NO: 1). The specificity of the antisera was determined by immunoblotting analysis of MKP4 protein in 03R cells infected with MKP4 recombinant lentivirus. Antibodies for dual-phosphorylated Erk (T202/Y204), JNK (Tl 83/Yl 85), and p38 (Tl 80/Yl 82) were from Cell Signaling (Danvers, MA). Antibody for MKP3 was from Santa Cruz (Santa Cruz, CA).

Recombinant lentivirus and transduction

The mouse MKP4 cDNA digested with BamHI and Smal from MKP4 cDNA vector (ATCC No. MGC-6681) was subcloned into BgIII and Smal digested pIRE- EGFP vector (Clontech; Palo Alto, CA) which contains an internal ribosome entry site sequence for co-expression of GFP. The bicistronic expression cassette of MKP4 and GFP was subcloned into pSL35 lentiviral vector modified from pRRL(42). GFP cDNA were subcloned into pSL35 lentiviral vector as control. Recombinant lentiviruses were generated using the 4-plasmid system by cotransfection of 293T cells with pSL3 which expresses the vesicular stomatitis virus G envelope protein; pSL4 which expresses the HIV-I gag/pol genes; pSL5 which expresses the rev gene, and pSL35 containing MKP4 and GFP respectively. Lentivruses were harvested at 48 and 72 hours after the transfection and concentrated by ultracentrufigation at 500,000xg for 90 minutes. The recombinant virus titer was determined to monitor use of minimal viral particles to achieve >90% infection of 03R cells.

Tetracycline inducible MKP4 expression Tet responsive cell line (H1299-Tet) was generated by transfection of H 1299 cell with pIRES-TetR vector constructed by cloning Nhel/Smal TetR fragment from pcDNA6/TR (Invitrogen) into pIRES2-EGFP vector (Clontech; Mountain View, CA). The H1299-Tet clones were maintained in G418 medium and were selected by measuring luciferase activity induced by tetracycline (5 μg/ml) after transient transfection of pcDNA4/TO-Luciferase reporter. The treatment of tetracycline at 5 μg/ml had no effect on the growth of H1299-Tet clones. Murine wild type MKP4 cDNA was cloned into pcDNA4/TO vector (Invitrogen) and transfected into H 1299- Tet cells with zeocin selection. The tetracycline responsive clones (H1299/MKP4- Tet) were selected by western analysis of MKP4 protein levels in response to tetracycline treatment.

Tubulin immunostaining

Cells were plated on collagen coated coverslips. Before fixation, cells were permeabilized with 02% Triton X-100 for 10 seconds to release free tubulin. The cells on the coverslips were fixed with 4% paraformaldahyde and stained with anti-α- tubulin (Sigma; St. Louis, MO). The image was captured and processed with a Nikon confocal imaging system.

Flow cytometry Cells were harvested at 2, 4, and 6 days after MKP4 induction by tetracycline

(1 μg/ml). The cells were fixed by 100% cold ethanol, treated with RNase, and stained with Propidium Iodide (50 μg/ml). The DNA content was analyzed by a Becton- Dickinson FACS Calibur® analyzer (San Jose, CA). All analysis was performed in duplicate.

In vivo tumorigenesis

Animal studies were performed according to institutional guidelines. Two million lentivirus-infected 03R cells were subcutaneously inoculated into the back of Balb/C neonates. Tumor sizes were compared between groups infected with GFP lentivirus versus MKP4 lentivirus (6 mice each group). For tetracycline inducible MKP4, 5 million H1299-Tet/MKP4 cells were subcutaneously injected into the flanks of 8 week old female nude mice (Taconic; Germantown, NY). MKP4 expression was induced by administrating doxycycline water (lmg/ml) when visible tumor appeared (approximately 50 mm³). The tumor size was measured and calculated by the formula: 0.4 x (tumor length) x (tumor width)².

RESULTS

In an attempt to identify alterations that activate the Ras pathway in a non-ras mutation model of epidermal carcinogenesis (Kulesz-Martin et al. (1988)

Carcinogenesis, 9:171-174), the gene expression of epidermal cells representing different carcinogenesis stages was profiled by means of Affymetrix GeneChip analysis (Fig. IA). Candidate gene defects were selected based on the criteria that it must be altered at the initiation stage (03C) and sustained or further altered in the malignant stage (03R). The selection was further narrowed down by comparing tissue-cultured 03R cells with 03R tumor tissue. The selection with these criteria lead to the identification of MKP4, a negative regulator of MAP kinase. At the mRNA level, MKP4 was down-regulated in the initiated cells and was further lost in malignant tumor cells (Fig. IB). To evaluate MKP4 expression at the protein level, a MKP4 polyclonal antibody was developed that recognizes the C-terminus of MKP4. MKP4 loss was specific to SCC-producing lineages (03C and 03R) but not papillomagenic lineages (09C and 09R) (Fig. 1C). In order to address the broader significance of MKP4 loss as a potential initiation event, and to test the hypothesis that its loss or inactivation is associated with malignancy, tumors were examined independently which were generated by application of chemical or physical (UVB) carcinogens in mice (Fig. ID). MKP4 loss occurred in all (100%, n=5) rapidly invasive SCC induced by ultraviolet (UVB) light, but fewer than half (40%, n=20) of DMBA-TPA chemically induced papillomas. The finding of MKP4 loss in a subset of the DMBA-TPA induced tumors corresponds with the -50% malignant conversion rate of these papillomas in the clonal carcinogenesis model (Kulesz-Martin et al. (1991) Cancer Res., 51:4701-4706). MKP4 loss in SCC-producing lineages and UVB-induced SCC suggests that MKP4 loss is an initiation event that is associated with the progression of carcinogenesis to a more invasive and metastatic phenotype. It was first determined whether the malignant 03R cells, as a result of their sporadic MKP4 expression loss, showed elevated Erk, JNK, and p38 activity relative to 291 cells, as measured by immunoblotting with their corresponding dual phospho- specific antibodies (first two lanes each panel in Fig. 2A). The phosphorylated Erk, JNK, and p38 MAP kinases were significantly reduced in 03R cells infected with

MKP4 lentivirus (third relative to fourth lane each panel, Fig. 2A), which is consistent with previous reports that MKP4 is a phosphatase with MAP kinase specificity for Erk>p38≥JNK (Muda et al. (1997) J. Biol. Chem., 272:5141-5151; Dickinson et al. (2002) Biochem. J., 364:145-155). To test whether MKP4 reconstitution could counteract tumor cell characteristics, a recombinant MKP4 lentivirus with a bicistronic cassette in which MKP4 and GFP are coexpressed through an internal ribosome entry site (IRES) was constructed, thereby allowing for the monitoring of phenotypes of infected cells. Viral titers were adjusted to the minimum that achieved >90% infection of 03R cells. To test whether the MKP4 expressed from the lentivirus is functional, the phosphatase activity of MKP4 was evaluated by examining the phosphorylation status of endogenous MAP kinases. Both MKP4 and control viruses infected more than 90% of 03R cells, (comparing GFP expression throughout the cells in MKP4 (3 day) and Con (Fig. 2B)). The MKP4 virus-infected cells progressively enlarged over time after the infection. The MKP4 virus infected cells were selected against, gradually being replaced by the small subset of un-infected cells (GFP negative) as a result of cell death by MKP4 (Fig. 2B) such that by 9 days after the infection nearly 90% of the infected cells were eliminated.

To test whether 03R tumor cell death can be induced by other MKP members of more restricted MAPK substrate specificity, the activity of MKP4 with MKP3, a cytosolic MKP with MAP kinase selectivity predominantly to Erk, were compared. A recombinant MKP3 lentivirus with MKP3 and GFP co-expression in the bicistronic cassette was generated. MKP3 showed similar Erk dephosphalytion but had no effect on JNK and p38, shown compared with MKP4 (Fig. 2C). Although MKP3 inactivated Erk as effectively as MKP4, MKP3 lentivirus-infected 03R cells showed no signs of enlargement or cell death, whereas nearly 90% of MKP4 lentivirus- infected 03R cells died by 9 days after the infection (Fig. 2D). Although both MKP3 and MKP4 are cytosolic MKPs with phosphatase activity to Erk, failure to induce 03R tumor cell death by MKP3 suggests that the inactivation of other MAP kinases associated with MKP4 is required to cooperate with Erk inactivation to mediate death of these highly invasive, metastatic tumor cells.

Cellular proliferation is normally determined by extracellular signals- mediated Erk activation that engages the expression of cyclin Dl and the assembly of the cyclin D-cdk4 complex needed for cell cycle entry (Cheng et al. (1998) Proc. Natl. Acad. Sci. U.S.A., 95:1091-6; Sherr et al. (2002) Cancer Cell, 2:103-12), with small molecule inhibitors of Erk such as CL- 1401 blocking cell cycle progression at the Gl/S boundary (Sebolt-Leopold et al. (1999) Nat. Med., 5:810-816). Therefore it was evaluated whether MKP4 reconstitution similarly blocked cell cycle progression in Gl. Because 03R cells exhibit strong homophilic cell adhesion, we expanded these studies to the human small cell lung carcinoma cell line H 1299 cells, also characterized by undetectable MKP4 protein expression, to evaluate the effect of MKP4 on cell cycle progression and tumor suppression. Induction of MKP4 expression was tightly responsive to tetracycline in the Hl 299 stable lines (Fig. 3A). MKP4 induction resulted in dephosphorylated Erk, JNK, and p38, consistent with the phosphatase activity of MKP4. Upon MKP4 induction, H1299/MKP4-Tet cells became enlarged with decondensed chromatin, followed by cell death (Fig. 3B). In contrast to Gl growth arrest, as expected from Erk inhibition (Sebolt-Leopold et al. (1999) Nat. Med., 5:810-816), cells with MKP4 induction accumulated in the G2/M phase of the cell cycle (Fig. 3C), corresponding to cell death (Fig. 3D). In conjunction with cell enlargement and decondensed chromatin in MKP4 expressing cells, the G2/M associated cell death by MKP4 suggests that these cells are undergoing mitotic catastrophe, a general term applied to cell death occurring during mitosis as a result of DNA damage or defective spindle formation in tumor cells (Castedo et al. (2004) Oncogene, 23 :2825-2837).

Because death occurred upon MKP4 induction without added DNA damaging agents, the microtubule structure in response to MKP4 induction was examined to see if defective spindle formation is the cause of G2/M associated cell death. Indirect immunofluorescence staining of polymerized microtubules with anti -tubulin antibody revealed microtubule disruption, as indicated by the collapsed microtubule structure in malignant 03R cells infected with MKP4 lentivirus (Fig. 4A, top right), as compared to a typical network of polymerized mictotubules in cells infected with control lentivirus (Fig. 4A, top left). Although the staining pattern of microtubule structure in H 1299 cells was different from that in 03R tumor cells, the changes in microtubule structure was also observed in H 1299 cells with MKP4 expression induced by tetracycline (Fig. 4B bottom right compared to bottom left).

MKP4 activity as a tumor suppressor was then explored by two approaches, one in a tumorigenicity assay and the other by reconstitution of MKP4 by tetracycline induction of established tumors. To evaluate the effect of MKP4 on tumorigenesis in vivo, the 03R cells were infected with MKP4-containing virus and immediately inoculated subcutaneously to Balb/c neonates (Fig. 5A). Tumors reached an average of 72mm³ in mice injected with 03R cells infected with GFP virus by day 22 after the inoculation compared to no tumors in six mice injected with cells infected with MKP4 virus. By 30 days, tumors in 6/6 GFP alone, control cell-injected mice averaged 319mm³ compared to only 43mm³ for the tumors in mice injected with the MKP4 virus. Immunostaining of the tumor sections revealed that GFP was negative in tumors from mice injected with 03R cells infected with virus co-expressing MKP4 and GFP (Fig. 5B two right panels), indicating that these tumors were likely derived from the small fraction of un-infected 03R cells in the injected cell population. In contrast, tumors generated from cells infected with control lentivirus were GFP positive (Fig. 5B, two left panels). The evidence from both the in vitro assays and in vivo tumorigenesis studies suggests that MKP4 has tumor suppressive activities.

The ability of MKP4 to suppress growth in well established tumors was also examined by subcutaneously inoculating H1299/MKP4-Tet cells into the flanks of nude mice. MKP4 was induced when visible tumors appeared, by administering tetracycline to the mice in their drinking water 35 days after the inoculation. The tumors with MKP4 induction had significantly reduced tumor size compared with control tumors (Fig. 5C). Histology of tumor specimens from MKP4 induced mice showed distinct morphological changes as compared with tumors from control mice (Fig. 5D). The tumor cells were evidently enlarged with decondensed nuclei, consistent with the morphology observed in cultured cells shown in Fig. 3B. Although the tumor growth curve suggests tumor stasis, the enlarged volume of the tumor cells after MKP4 induction suggests that MKP4 has a tumoricidal effect that contributes to tumor suppression. Taken together, the evidence from these in vitro assays and in vivo tumorigenesis studies indicate that MKP4 acts as a tumor suppressor and that its activities could be exploited in developing novel approaches to molecular-targeted cancer therapy. Ideally, therapies should be selective for tumor cells while leaving normal cells unaffected. To test whether normal cells are spared from the action of MKP4, the effect of MKP4 on non-tumorigenic keratinocyte precursor cells (291) was compared with their tumorigenic derivative cells (03R). 291 and 03R cells were infected with MKP4 lentivirus in which MKP4 and GFP are cotranslated from a bicistronic transcript, providing GFP as an indicator for MKP4 expression. The 291 and 03R cells showed similar infection efficiency and MKP4 expression as indicated from the level of GFP and MKP4 in both cell lines (Fig. 6A). As expected, the MKP4 positive 03R cells showed significant cell enlargement followed by cell death. At 9 days after the infection, MKP4 positive 03R cells were decreased more than 6-fold in number and those that remained were significantly enlarged. The enlarged 03R cells gradually disappeared and were replaced with non-infected, GFP- negative cells. However, over the same time period after MKP4 expression, the non- tumorigenic 291 cells did not show significant morphological changes, and there was no significant reduction in number of MKP4 positive 291 cells (Fig. 6B & C). Thus MKP4 expression caused cell death in the 03R malignant cells but not in phenotypically normal 291 keratinocytes. As growth arrest in normal cells can be reversible or consistent with adult tissue function, the differential effect of MKP4 expression in non-tumorigenic cells versus tumorigenic cells indicates the effectiveness of selective cancer therapy designed to mimic the effect of MKP4.

EXAMPLE II

There are more than a dozen MAPK genes in mammals. The well characterized MAPKs are ERKl/2, JNK 1/2/3, and p38α/β/γ/δ. The other MAPKs include ERK3/4, ERK5, and ERK7/8. More MAPK isoforms are generated by alternative splicing. For example, a total of 12 spliced isoforms are derived from 3 JNK genes. Combination therapies, as with single agents for MAPK inhibition can inhibit multiple MAPK isoforms that are not the specific substrate of MKP4. Despite the substantial homology among the isoforms in each MAPK, there is evidence that distinct isoforms also exhibit distinct properties and in some cases may have opposing biologic activities. Therefore, isoform specific substrates of MKP4 should be identified in order to formulate the combination MAPK inhibition mimic to MKP4.

Due to lack of isoform specific antibodies for activated MAPKs, the substrate specificity of MKPs may be generally inferred from its binding to tagged MAPKs or from in vitro kinase assays with purified MAPKs. As the reaction condition and substrate are different for each MAPK in the in vitro kinase assay, it is not generally objective to compare the specificity of MKP among the different MAPKs by in vitro kinase assay. Therefore, the analysis of MKP4 binding to tagged MAPK is a more specific measure of the substrate specificity of MKP4. This is achieved by immunoprecipitation of tagged MAPK followed by immunoblotting of MAPK bound MKP4. The Flag-tagged ERK2, p38α/β/γ/δ, JNKl -βl, JNK2-α2, and JNK3-2 were transfected into H1299/MKP4-Tet cells. The expression of MKP4 was induced by tetracycline 8 hours after the transfection. As MKP4 binding to MAPKs represent the transient intermediate state of the dephosphorylation reaction, the inhibition of the catalytic activity of MKP 4 should trap MAPK binding to MKP4. As the catalytic cysteine of MKP4 is oxidation sensitive, the cells were treated with H₂O₂ to inactivate the catalytic activity of MKP4 for the detection of MAPK bound MKP4. Under such conditions, MKP4 specifically bound to ERK2, p38α/β, and JNKl-βl but not to p38γ, p38δ, JNK2-α2, and JNK3-2 (Fig. 7). The identification of isoform specific substrates of MKP4 provides a basis for specific MAPK inhibition that mimic the action of MKP4.

In another aspect of the invention, methods are provided for determining the effectiveness of a mitogen activated protein (MAP) kinase inhibitor for the treatment of cancer in a patient, wherein the cancer is characterized by decreased MKP (e.g., MPK4) activity compared to a normal patient. The methods comprise determining in vitro if at least one MAP kinase isoform inhibited by the MAP kinase inhibitor is a substrate of mitogen activated protein kinase phosphatase 4 (MKP4). Examples of appropriate in vitro assays are described herein (see, e.g., hereinabove and Example II). The instant methods comprise determining whether a particular MAP kinase inhibitor inhibits at least one of the MAP kinase isoforms identified as a substrate of the MKP and/or identifying whether a MAP kinase isoform(s) is a substrate of the MKP.

EXAMPLE III

To test the concept of combined inhibition of MAP kinases in cancer therapy, human small cell lung carcinoma Hl 299 cells were treated with Erk inhibitor (UO 126) and JNK inhibitor (SP600125). Mitotic catastrophe was induced in H 1299 cells treated with both Erk and JNK inhibitors. Both cell enlargement and cell accumulation at G2/M phase were observed in H 1299 cells treated with combined inhibitors of Erk and JNK (Figure 8). These features characterize the treated cell undergoing mitotic catastrophe similarly observed in H 1299 cell with MKP4 reconstitution. No significant changes in cell morphology and DNA content were observed in Hl 299 cells treated with either Erk inhibition or JNK inhibition alone. This indicates that combined inhibition of MAP kinases has efficacy to achieve tumoricidal effect in cancer therapy.

While the invention has been described in detail and with reference to specific examples thereof, it will be apparent to one skilled in the art that various changes and modifications can be made therein without departing from the spirit and scope thereof.

Claims

What is claimed is:

1. A method for treating cancer in a patient in need thereof, said method comprising administering a pharmaceutical composition comprising at least one compound which increases or mimics mitogen activated protein kinase phosphatase 4 (MKP4) activity and at least one pharmaceutically acceptable carrier.

2. The method of claim 1, wherein said at least one compound inhibits at least one mitogen activated protein (MAP) kinase which is a substrate of MPK4.

3. The method of claim 2, wherein said at least one compound inhibits at least one Erk and at least one JNK.

4. The method of claim 3, wherein said at least one compound further inhibits at least one p38.

5. The method of claim 3, wherein said at least one compound inhibits Erk2 and JNK- βl.

6. The method of claim 4, wherein said at least one compound further inhibits p38α and p38β.

7. The method of claim 1, wherein said cancer is selected from the group consisting of prostate cancer, colorectum cancer, pancreas cancer, cervix cancer, endometrial cancer, brain cancer, liver cancer, bladder cancer, ovary cancer, testicular cancer, head cancer, neck cancer, skin cancer, mesothelial cancer, lymphoma, leukemia, esophageal cancer, breast cancer, muscle cancer, connective tissue cancer, lung cancer, adrenal gland cancer, thyroid cancer, kidney cancer, bone cancer, glioblastoma, renal cell carcinoma, gastric carcinoma, sarcoma, choriocarcinoma, and cutaneous basocellular carcinoma.

8. The method of claim 7, wherein said cancer is a non-melanoma skin cancer.

9. The method of claim 8, wherein said non-melanoma skin cancer is selected from the group consisting of squamous cell carcinoma, basal cell carcinoma, mycosis fungoides, kerotocanthoma, actinic keratosis, and seborrheic keratoses.

10. The method of claim 1, wherein said pharmaceutical composition is administered topically.

11. The method of claim 10, wherein at least one of said pharmaceutically suitable carriers is for topical administration.

12. The method of claim 1, wherein said pharmaceutical composition further comprises at least one additional chemotherapeutic agent.

13. A method for diagnosing a patient as having a tumor susceptible to mitogen activated protein (MAP) kinase inhibitor treatment comprising: a) obtaining a biological sample from said patient; b) determining the level of at least one mitogen activated protein kinase phosphatase 4 (MKP4) in the biological sample; and c) comparing the level of MKP4 in the biological sample to the level of MKP4 in a biological sample from a normal patient, wherein a decrease in the level of MKP4 in the biological sample obtained from the patient compared to the MKP4 level in the normal patient indicates the patient has a tumor susceptible to MAP kinase inhibitor treatment.

14. The method of claim 13, further comprising determining expression levels of MKPl and MKP3 in tumor samples relative to normal tissues.

15. The method of claim 13, wherein step b) comprises determining the amount of MKP4 protein or nucleic acid in the biological sample.

16. The method of claim 13, wherein step b) comprises determining the MKP4 activity in the biological sample.

17. The method of claim 16, wherein said determination of the MKP4 activity comprises determining the level of at least one MAP kinase in the biological sample, wherein an increase in the MAP kinase activity in the biological sample obtained from the patient compared to the MAP kinase activity in a normal patient indicates a decrease in MKP4 activity.

18. A method for determining the effectiveness of a mitogen activated protein (MAP) kinase inhibitor for the treatment of cancer in a patient, said method comprising determining in vitro if at least one MAP kinase isoform inhibited by the MAP kinase inhibitor is a substrate of mitogen activated protein kinase phosphatase 4 (MKP4), wherein said cancer is characterized by decreased MKP4 activity compared to a normal patient.