WO2008067032A2 - Transgenic mice expressing a real-time reporter for cellular camp in a tissue-selective and inducible manner - Google Patents

Abstract

A transgenic mouse expressing a functioning protein reporter for cAMP expression. The c AMP is under control of a tissue specific and inducible promoter. The transgenic mouse allows for the continuous measurement of c AMP dynamics; identifying cell signaling events; identifying novel targets for drugs. Vectors and methods of use are further described.

Description

TRANSGENIC MICE EXPRESSING A REAL-TIME REPORTER FOR CELLULAR cAMP IN A TISSUE-SELECTIVE AND INDUCIBLE MANNER

HELD OF INVENTION

[0001] This invention relates to transgenic animals expressing a functional protein reporter for cAMP in a tightly controlled and cell-type-selective manner.

BACKGROUND OF THE INVENTION

[0002] Cyclic AMP (cAMP) is a second messenger involved in cellular signaling in a broad range of cell types and tissues. It serves to signal the detection of hormones, neurotransmitters, trophic and developmental factors. In spite of its importance in physiological processes, many aspects of the roles of cAMP remain unexplored because of the lack of a dynamic reporter for this second messenger in tissues and organs. [0003] To date, there are no dyes that bind cAMP and undergo a change of color or light output such that they could be used as reporters. (A number of such dyes are available for imaging Ca²⁺). Instead, reporters for cAMP have been constructed from proteins that bind cAMP, undergo and conformational change, and trigger a change in the light output of an attached fluorophore. In the last few years, a number of such cAMP sensor/reporters have been constructed as genetically encoded proteins. Plasmids containing such cAMP sensor/reporters have now been reported from several labs (Zaccolo and Pozzan, 2002; Evellin et al 2004; Nikolaev et al. 2004; Gesellchen et al 2006; Dyachok et al 2006). These typically are based on either Protein Kinase A or on Epac (a guanine nucleotide exchange factor). In order to function, these reporter-encoding plasmids must be transfected into cells. [0004] The need to acutely transfect cAMP sensor/reporter proteins into cultured cells is a major limitation. First, there is the question of how similar cultured cell lines or primary cultures are to native cells in vivo. Further, the role of cAMP in intact tissues and organs cannot be addressed. Nor are in vivo experiments possible. There is thus a need in the art to overcome such limitations.

SUMMARY

[0005] A transgenic mouse expressing a reporter construct is described. The uses of the transgenic mouse are numerous. For example, the mouse is used for identifying candidate therapeutic drugs, evaluation of primary and side effects of drugs; responses to circulating hormones in intact tissues and organs can be measured. [0006] A cAMP reporter comprising fused spectral variants of green Fluorescent Protein (GFP) to the Regulatory and Catalytic subunits of Protein Kinase A is used as a basis to produce the transgenic mouse. The fluorescent proteins (R-CFP and C-YFP) when used in a FRET-based imaging assay reports on changes of cAMP concentration on a cell-by-cell basis. The plasmids encoding this reporter are introduced into cells by transient transfection. Modification of the reporter construct has enhanced the fluorescent quantum yield, substantially improving the signal-to noise ratio for the FRET imaging. [0007] In a preferred embodiment, a method of introducing the reporter into the genome to produce the transgenic mouse comprises transient transfection. This is a major advance in the utility of the cAMP reporter because it allows in vivo and ex vivo studies on cells and tissues in a manner not previously possible with plasmid based reporters. Specifically, transient transfection, using plasmid based reporters is readily achieved. [0008] In another preferred embodiment, a bi-directional vector comprises a tissue- specific and inducible promoter; a cAMP sensor/reporter; and, a nucleic acid sequence expressing a fluorescent protein. Preferably, the cAMP sensor/reporter comprises a mutation expressing an amino acid wherein the mutation is a Phe-to Leu mutation at amino acid position 46.

[0009] In another preferred embodiment, the vector is administered to pronuclei of fertilized mammalian egg cells.

[0010] In another preferred embodiment, expression of nucleic acid sequences are induced in a transgenic animal by addition of an inducer molecule.

[0011] In another preferred embodiment, a method of expressing a cAMP reporter in a transgenic animal comprises a bi-directional vector comprising: a tissue-specific and inducible promoter; a cAMP sensor/reporter; and, a nucleic acid sequence expressing a fluorescent protein; administering the vector to pronuclei of fertilized mammalian egg cells; and, implanting said egg into a female mouse under conditions suitable for gestation of a transgenic mouse; identifying a transgenic mouse exhibiting a tissue specific cAMP sensor/reporter; and, inducing expression of the cAMP reporter by administering an inducer to the transgenic animal; and, measuring expression of the cAMP by expression of the fluorescent protein.

[0012] In another preferred embodiment, a transgenic mouse whose genome comprises a bi-directional vector comprising: a tissue-specific and inducible promoter; a cAMP sensor/reporter; and, a nucleic acid sequence expressing a fluorescent protein.

- ? - [0013] In another preferred embodiment, an isolated cell of the transgenic mouse expresses a cAMP sensor/reporter and fluorescent protein.

[0014] In another preferred embodiment, an isolated cell line derived from the transgenic mouse express cAMP sensor/reporter and fluorescent protein. Preferably, the cell is selected from a germ cell or a somatic cell.

[0015] In another preferred embodiment, a method of identifying candidate therapeutic agents comprises administering to the transgenic mouse, a candidate compound; and, determining the effect of the compound by the expression of the cAMP sensor/reporter. [0016] In another preferred embodiment, a transgenic non-human animal comprises in its genome an exogenous nucleic acid sequence or nucleic acid sequences comprising: a tissue-specific and inducible promoter; a trans activator; a cAMP sensor/reporter; and, a nucleic acid sequence expressing a fluorescent protein.

[0017] In another preferred embodiment, the cAMP sensor/reporter comprises yellow fluorescent protein fused to protein kinase A catalytic subunit (C-YFP) and cyan fluorescent protein fused to protein kinase regulatory II subunit (R-CFP), variants, fragments and mutants thereof. In some embodiments, the mutation at amino acid 46 comprises any amino cid in the same class as Leu, e.g. neutral, non-polar amino acids, and analogues thereof. Suitable fluorescent proteins include green fluorescent proteins (GFP), red fluorescent proteins (RFP), yellow fluorescent proteins (YFP), and cyan fluorescent proteins (CFP). Useful fluorescent proteins also include mutants and spectral variants of these proteins which retain the ability to fluoresce. Preferably, the C-YFP unit comprises a Phe-to Leu mutation at amino acid position 46. However, any fluorescent protein may be used, including mutants thereof. [0018] In preferred embodiments these marker genes are fluorescent proteins such as green fluorescent protein (GFP), cyan- (CFP), yellow- (YFG), blue- (BFP), red- (RFP) fluorescent proteins; enhanced green fluorescent protein (EGFP), EYFP, EBFP, Nile Red, dsRed, mutated, modified, or enhanced forms thereof, and the like. [0019] In another preferred embodiment, the transactivator comprises a reverse tetracycline transactivator (rtTA).

[0020] In another preferred embodiment, the animal exhibits a phenotype characterized by expression of the cAMP sensor/reporter in response to an inducer. Preferably, the animal is murine, however, the invention is not limited solely to mice but can include rats, pigs etc. [0021] In another preferred embodiment an isolated cell of the transgenic non-human animal comprises a tissue-specific and inducible promoter; a transactivator; a cAMP sensor/reporter; and, a nucleic acid sequence expressing a fluorescent protein. [0022] In another preferred embodiment, an isolated mammalian cell comprising in its genome an exogenous nucleic acid sequence comprising: a tissue-specific and inducible promoter; a trans activator; a cAMP sensor/reporter; and, a nucleic acid sequence expressing a fluorescent protein.

[0023] In another preferred embodiment, the cell is a germ cell or a somatic cell. However, any cell can be isolated from the animal, e.g. pancreatic cells, cardiomyocytes, kidney, liver etc.

[0024] In another preferred embodiment, a vector comprises a nucleic acid expressing a tissue-specific and inducible promoter; a nucleic acid expressing a transactivator; a nucleic acid expressing a cAMP sensor/reporter; and, a nucleic acid sequence expressing a fluorescent protein. The nucleic acids, operably linked to promoters can be on one or more vectors. The vector is preferably, a bidirectional vector.

[0025] In another preferred embodiment, the nucleic acid expressing the cAMP sensor/ reporter comprises a mutation expressing a Phe-to Leu mutation at amino acid position 46. [0026] In another preferred embodiment, the vector is administered to pronuclei of fertilized mammalian egg cells.

[0027] In another preferred embodiment, expression of nucleic acid sequences are induced in a transgenic animal by addition of an inducer molecule.

[0028] In another preferred embodiment, a method of expressing a cAMP reporter in a transgenic animal comprises a vector comprising: a tissue-specific and inducible promoter; a cAMP sensor/reporter; and, a nucleic acid sequence expressing a fluorescent protein; administering the vector to pronuclei of fertilized mammalian egg cells; and, implanting said egg into a female mouse under conditions suitable for gestation of a transgenic mouse; identifying a transgenic mouse exhibiting a tissue specific cAMP sensor/reporter; and, inducing expression of the cAMP reporter by administering an inducer to the transgenic animal; and, measuring temporal and spatial distribution of cAMP, and expression of the cAMP by expression of the fluorescent protein.

[0029] In one preferred embodiment, the vector is a bi-directional vector. [0030] In another preferred embodiment, a method of identifying candidate therapeutic agents comprising: administering to a transgenic mouse whose genome comprises a tissue- specific and inducible promoter; a transactivator; a cAMP sensor/reporter; and, a nucleic acid sequence expressing a fluorescent protein, a candidate compound; and, determining the effect of the compound by the expression of the cAMP sensor/reporter. [0031] In a preferred embodiment, the effect of a compound is determined by measuring: intracellular cyclic AMP (cAMP), Ca²⁺ levels and profiles thereof, temporal and spatial distribution of cAMP and membrane depolarization. [0032] Other aspects of the invention are described infra.

BRIEF DESCRIPTION OF THE DRAWINGS

[0033] The invention is pointed out with particularity in the appended claims. The above and further advantages of this invention may be better understood by referring to the following description taken in conjunction with the accompanying drawings, in which: [0034] Figure 1 is a schematic illustration showing the plasmid construct for transgenesis.

[0035] Figure 2A is a schematic illustration showing the structure of pBIcAMPF46L transgene (cAMP reporter transgene) and primers for genotyping. Genotyping transgenic lines. The schematic shows the injected transgenic construct, integrated into mouse genomic DNA (thin lines at left and right ends). Small arrows (a, b, c) under the construct are primers used for genotyping the resulting mice (Figure 2A). Figure 2B is a scan of a gel showing a typical genotyping gel. PCR products for C-YFP (340bp) and for R-CFP were detected in the positive control (lane 1, 2) and in two of three transgenic lines (lanes 7, 8, 10, 11). The endogenous gene is detected in every mouse tested (lanes 3, 6, 9, 12). [0036] Figures 3A-3H show the enhanced cAMP reporter, expressed in tissues of double transgenic mice. Figures 3A and 3B: CHO cells, stably expressing rtTA, were cotransfected with RII-CFP and either the mutated (F46L, top) or original (lower) C-YFP. Note similar CFP fluorescence (left) but enhanced YFP fluorescence (right) for the F46L mutant. Figure 3C: Transfected cells from Figures 3A and 3B, functionally imaged for FRET and stimulated with 10 μM Fsk+100 μM IBMX to elevate cAMP levels. The F46L mutant cAMP reporter (•) yields a larger peak FRET signal (F470/F535) than the original reporter (o) (mean +/- s.e.m., n=18 cells). Figure 3D: Transgenic construct in pBI vector, with C- YFP and R-CFP in opposing orientations, around a bidirectional tetracycline-inducible promoter. Genotyping primers ( ► , Λ ) and the resulting PCR products are indicated. Figure 3E: Example of genotyping on genomic DNA (gDNA) from a mouse lacking (non-Tg) or possessing the integrated transgene (pBI-cAMP Tg). PCRs with each template tested for R- CFP (lanes 1, 4, 7), C-YFP (lanes 2, 5, 8) and an endogenous gene, PLC 2 (lanes 3, 6, 9). Figures 3F-3H: Tissues from double transgenic CMV-rtTA / pBI-cAMP mice were immunostained with anti-GFP (green) to visualize the reporter in skeletal myofibers (Figure 3F), cardiac myocytes (Figure 3G) and pancreas (Figure 3H). In the pancreas, only acinar cells express the reporter, while islets of Langerhans (immunostained with anti-insulin, red) do not. In Figure 3G: nuclei are counterstained red with TO-PRO-3. Scale bars, 50 m. [0037] Figures 4A-4C: Pancreatic islets function normally in double transgenic Ins2- rtTA/pBI-cAMP mice that express the cAMP reporter in pancreatic islet β-cells. Figure 4A: Cryosections of a pancreas, immunostained with anti-insulin to reveal islets of Langerhans (red) and anti-GFP (green). The overlay (right) shows that only β-cells express the transgenic cAMP reporter. We detected no gross changes in islet histology in transgenic mice. Figure 4B: Reporter expression does not interfere with show glucose homeostasis. Double transgenic mice, subjected to a Glucose Tolerance Testi before (o), and 1 week after (•) induction of the cAMP reporter showed similar rise and fall in plasma glucose (mean +/- s.e.m.; n=5 mice). Figure 4C: β-cells from Ins2-rtTA/pBI-cAMP mice show normal glucose- stimulated Δ [Ca²⁺Ji (imaged with Fura-2). Glucose was elevated from 3mM (basal) to 11 mM (grey bar, HG). Intracellular [Ca²⁺] decreased transiently (arrow), then rapidly increased with a series of oscillations that continued for several minutes after glucose returned to the basal concentration. Similar responses were obtained in islets from wild-type mice.

[0038] Figures 5A-5J: Glucose stimulation results in dynamic changes of cAMP concentration in β-cells. Figure 5A: A living islet from an induced Ins2-rtTA/pBI-cAMP mouse, viewed for YFP fluorescence. Dotted circles are regions of interest (ROIs) analyzed in Figure 5F. Figure 5B: When cAMP was elevated (grey bar, 10 μM Forskolin) in islets excited at 430 nm, FRET emission (535 nm, orange symbols) dropped while CFP fluorescence (470 nm emission, cyan symbols) increased slightly. The ratio of these emissions (F470/F535; mean +/- s.e.m.; n=14 cells in different regions of 1 islet) is a monitor of changing cAMP concentration. Figure 5C: Repeated stimulation with 11 mM glucose (grey bars, 11 G) produced consistent cAMP responses in -cells (mean +/- s.e.m.; n=6 cells). Figure 5D: Stimulating islets with increasing concentrations of glucose (5.5 to 35 mM, grey bars) evoked increasing cAMP responses in β-cells (mean +/- s.e.m., n=4 islets). Figure 5E: The concentration response function (mean +/- s.e.m., n=4 islets) for cAMP, with EC₅₀ = 9 mM glucose, corresponds well with glucose-stimulated insulin release in isolated islets. Figure 5F: Prolonged glucose stimulation of the islet shown in Figure 5 A (grey bar, 1 IG) resulted in a nearly synchronous, biphasic elevation of intracellular cAMP in β-cells throughout the islet (black traces correspond to ROIs shown in a; red symbols are mean +/- s.e.m. from the 8 ROIs). Figure 5G: Islets expressing cAMP reporter were loaded with Fura- 2 to measure Ca²⁺ and cAMP concurrently. In response to glucose (1 IG, grey bar), the increase in cAMP (black trace) precedes Ca²⁺ elevation and oscillations (blue trace). Figures 5H-5J: Glucose-stimulated cAMP in β-cells is independent of [Ca²⁺Ji. Figure 5H: Glucose- evoked cAMP responses persist when extracellular Ca²⁺ is removed. Figure 51: In contrast, glucose-evoked Ca²⁺ oscillations are completely eliminated in the absence of extracellular Ca²⁺ for β-cells. Trace is Fura 2 responses (F340/F380) to 11 mM glucose (grey bars, HG) before, during and after the depletion of extracellular Ca²⁺. Figure 5J: Mean responses from Ca²⁺ - and cAMP imaging, to 11 mM glucose before, during, and after Ca²⁺ removed from bath (+/- s.e.m., n= 6 islets). Ca²⁺- and cAMP-imaging were conducted independently to prevent any spectral overlap.

[0039] Figures 6A-6C: Elevation of cAMP causes PKA catalytic subunit translocation to the nucleus in β -cells. Figure 6A: Islets from induced Ins2-rtTA/pBI-cAMP mice were incubated for 30 min in control media or with added glucose (25 mM), forskolin (10 μM) or IBMX (100 μM). Nuclear C-YFP fluorescence is visible after prolonged elevation of cAMP (especially with fsk) in contrast to cytoplasmic localization in control islets. Scale bar, 20 μm. Figure 6B: Z-stacks of confocal images to illustrate cytoplasmic C-YFP (i.e. with dark nucleus, left) and nuclear translocated (i.e. with bright nucleus, right) following IBMX for 30 min. Figure 6C: Fluorescence intensity was quantified in regions-of-interest (ROI, dotted circles in inset) over the nucleus and cytoplasm of cells treated as in Figure 6A. The ratio of nuclear to cytoplasmic fluorescence was significantly higher when cAMP levels were elevated relative to control (* p 0.05; ** p 0.01; Dunnett's multiple comparisons test; n= 24- 47 cells in 3 experiments for each treatment).

[0040] Figure 7 is a schematic illustration showing a model of binary transgenic system for cAMP reporter mice. We used a cAMP reporter based on Green Fluorescent Protein variants (CFP and YFP), fused to Protein Kinase A subunits. We engineered this cAMP reporter into transgenic mice using an inducible and cell-type directed system that requires two separate lines of transgenic mice. In the Responder mouse (top right), the two subunits of the cAMP reporter (PKA -regulatory and PKA-catalytic) are fused at their C-termini to CFP and YPF, respectively. These composite cDNAs were inserted in opposite orientations into the pBI vector, flanking a single, bidirectional, tetracycline-inducible promoter. Transgenic mice with integrated copies of this construct ("pB IcAMP" mice) do not express the reporter in any cells until induced with dox. In Trans activator mice (top left), reverse tetracycline transactivator (rtTA) was expressed either from a relatively non-selective promoter (CMV) or from a β-cell specific promoter (Ins2). We crossed pBI-cAMP mice (top right) separately with each of these two strains to produce double transgenic mice (bottom). In rtTA-expressing cells of such mice, cAMP reporter subunits are expressed in a dox- dependent fashion.

[0041] Figure 8 shows that the cAMP reporter is insensitive to ΔpH in the physiologic range (pH 6.5 to 8.2). CHO cells, transiently transfected with the cAMP reporter were first stimulated (grey bars) with Fsk (20 μM) plus IBMX (100 μM). They were then treated with 20 mM NH₄Cl in the recording buffer, which produces a biphasic change in intracellular pH: an initial increase followed by a decrease, spanning 1.7 pH units (i.e., pH 7.4 →pH 8.2 → pH 6.5). This fluctuation Of PH₁ did not produce any discernible change in the FRET signal from the cAMP reporter (mean ± s.e.m. for 8 cells in 1 experiment).

DETAILED DESCRIPTION

[0042] We have now successfully produced transgenic mice in which a functioning protein reporter for cAMP is expressed in a tightly controlled and cell-type-selective manner. The reporter allows one to investigate the details of cAMP-mediated signaling that underlies cellular responses to a large number of bioactive agents including neurotransmitters, hormones, metabolites, cytokines, and sensor/reportery stimuli. Cells in all mammals use a number of cytoplasmic second messengers to signal an enormous diversity of events. Of these, Ca²⁺ and cAMP are arguably two of the most prominent. A great deal is understood about the role of Ca²⁺-mediated signaling under various physiological conditions and following pharmacological, genetic or environmental manipulations. Much of this understanding is derived from techniques for imaging Ca²⁺ in living cells and tissues in realtime using Ca²⁺-binding fluorophores. Despite the power of this approach, fluorescent reporters of cAMP concentration in cells have not been available until very recently. [0043] Fluorescent imaging of cAMP in real-time in living cells is likely to bring a broad range of insights to biomedical science as Ca²⁺-imaging has done. The second messenger, cAMP is known to undergo dramatic changes of concentration within cells upon stimulation with neurotransmitters, hormones, metabolites, and cytokines. Monitoring such cAMP dynamics by imaging (rather than through bulk assays) promises to be a powerful tool. First, continuous measurements will allow an accurate depiction of rapid signals, and subsequent metabolic responses within cells. Second, the methodology will permit one to examine the key players in individual signaling systems, and to explore sites for cross-talk and modulation of such signaling. Both these functions find important applications, not only in the basic science laboratory, but increasingly, in commercial applications. Specifically, such analyses can play a role in identifying novel targets for drugs, and avoiding side-effects by recognizing the recruitment of unintended signaling by pharmaceuticals under consideration.

[0044] Importance of a Transgenic Mouse: To date, there are no dyes that bind cAMP and undergo a change of color or light output such that they could be used as reporters. (A number of such dyes are available for imaging Ca²⁺). Instead, reporters for cAMP have been constructed from proteins that bind cAMP, undergo and conformational change, and trigger a change in the light output of an attached fluorophore. In the last few years, a number of such cAMP sensor/reporters have been constructed as genetically encoded proteins. Plasmids containing such cAMP sensor/reporters have now been reported from several labs (Zaccolo and Pozzan, 2002; Evellin et al 2004; Nikolaev et al. 2004; Gesellchen et al 2006; Dyachok et al 2006). These typically are based on either Protein Kinase A or on Epac (a guanine nucleotide exchange factor). In order to function, these reporter-encoding plasmids must be transfected into cells.

[0045] The need to acutely transfect cAMP sensor/reporter proteins into cultured cells is a major limitation. First, there is the question of how similar cultured cell lines or primary cultures are to native cells in vivo. Further, the role of cAMP in intact tissues and organs cannot be addressed. Nor are in vivo experiments possible. By producing a mouse in which the cAMP reporter can be activated by the experimenter, we have overcome this limitation. By designing the transgenic with a flexible tissue-specificity, we believe it will be usable in a broad range of cell-types and tissues.

[0046] The availability of fluorescent Ca²⁺ reporter dyes that are easily introduced into cells and tissues has facilitated analysis of the dynamics and spatial patterns for Ca²⁺ signaling pathways. However, a similar dissection of the role of cAMP has lagged because indicator dyes do not exist. Genetically encoded reporters for cAMP are available but they must be introduced by transient transfection in cell culture, which limits their utility. [0047] We report here that we have produced a strain of transgenic mice in which an enhanced cAMP reporter is integrated in the genome and can be expressed in targeted tissues under experimenter control. We have expressed the cAMP reporter in β -cells of pancreatic islets and conducted an analysis of intracellular cAMP levels in relation to glucose stimulation, Ca²⁺ levels, and membrane depolarization. In induced transgenic islets, glucose evoked an increase in cAMP in β-cells in a dose-dependent manner. The cAMP response appears to be independent of (in fact, precedes) the Ca²⁺ influx that results from glucose stimulation of islets. Glucose-evoked cAMP responses appear to be synchronous in cells throughout the islet and occur in 2 phases suggestive of the time course of insulin secretion. Insofar as cAMP in islets is known to potentiate insulin, the novel transgenic mouse model will for the first time permit detailed analyses of cAMP signals in β-cells within islets, i.e. in their native physiological context. Reporter expression in other tissues (such as the heart) where cAMP plays a critical regulatory role, will similarly permit detailed analyses. [0048] Preferably, the transgenic model of the present invention is a mammal including, but not limited to, pigs, rabbits, primates and rodents. Most preferably, a transgenic model of the present invention is a rodent, and even more preferably, a mouse.

[0049] The preparation and uses of the transgenic animal model of the invention will be described below with particular reference to a transgenic mouse. However, the transgene and methods and uses for the transgenic mouse of the present invention, as described below in detail, can be modified and applied to any suitable mammal for the study of transduction pathways downstream of receptors for hormones, neurotransmitters and local signals by analyzing cyclic AMP (cAMP), Ca²⁺ and membrane voltage for changes in levels, distributions etc to provide both a spatial and temporal resolution.

[0050] According to the present invention, a transgenic mouse is a mouse that includes a recombinant nucleic acid molecule (i.e., transgene) that has been introduced into the genome of the mouse at the embryonic stage of the mouse's development. As such, the transgene will be present in all of the germ cells and somatic cells of the mouse. Methods for the introduction of a transgene into a mouse embryo are known in the art and are described in detail in Hog an et al., Manipulating the Mouse Embryo. A Laboratory Manual, Cold Spring Harbor press, Cold Spring Harbor, N. Y., 1986, which is incorporated herein by reference in its entirety. See also U.S. Pat. Nos. 4,736,866, 5,387,742, 5,545,806, 5,487,992, 5,489,742, 5,530,177, 5,523,226, 5,489,743, 5,434,340, and 5,530,179. For example, a recombinant nucleic acid molecule (i.e., transgene) can be injected into the pronucleus of a fertilized mouse egg to cause one or more copies of the recombinant nucleic acid molecule to be retained in the cells of the developing mouse. A mouse retaining the transgene, also called a "founder" mouse, usually transmits the transgene through the germ line to the next generation of mice, establishing transgenic lines. According to the present invention, a transgenic mouse also includes all progeny of a transgenic mouse that inherit the transgene. A detailed description of the method of constructing the transgenic mouse is provided in the Examples section which follows.

[0051] As used herein "a transgene-negative littermate" is a mouse that is born into the same litter as a transgenic mouse described herein (i.e., a littermate), but does not inherit the transgene (i.e., is transgene-negative). Such a mouse is essentially a normal, or wild-type, mouse and is useful as an age-matched control for the methods described herein. [0052] Briefly, the transgenic animal comprises in its genome an exogenous nucleic acid sequence or transgene comprising a tissue-specific and inducible promoter; a trans activator; a cAMP sensor/reporter; and, a nucleic acid sequence expressing a fluorescent protein. These nucleic acids can be on one or more nucleic acids or transgenes. The cAMP sensor/reporter comprises yellow fluorescent protein fused to protein kinase A catalytic subunit (C-YFP) and cyan fluorescent protein fused to protein kinase regulatory II subunit (R-CFP), variants, fragments and mutants thereof.

[0053] In a preferred embodiment, the C-YFP unit comprises a Phe-to Leu mutation at amino acid position 46. In accordance with the invention, the amino acid or nucleic acid sequence coding for the amino acid can be substituted with any other amino acid, most preferably, one in the same group as Leu.

[0054] The terms "nucleic acid molecule" or "polynucleotide" will be used interchangeably throughout the specification, unless otherwise specified. As used herein, "nucleic acid molecule" refers to the phosphate ester polymeric form of ribonucleosides (adenosine, guanosine, uridine or cytidine; "RNA molecules") or deoxyribonucleosides (deoxyadenosine, deoxyguanosine, deoxy thymidine, or deoxycytidine; "DNA molecules"), or any phosphoester analogues thereof, such as phosphorothioates and thioesters, in either single stranded form, or a double-stranded helix. Double stranded DNA-DNA, DNA-RNA and RNA- RNA helices are possible. The term nucleic acid molecule, and in particular DNA or RNA molecule, refers only to the primary and secondary structure of the molecule, and does not limit it to any particular tertiary forms. Thus, this term includes double-stranded DNA found, inter alia, in linear or circular DNA molecules (e.g., restriction fragments), plasmids, and chromosomes. In discussing the structure of particular double-stranded DNA molecules, sequences may be described herein according to the normal convention of giving only the sequence in the 5' to 3' direction along the nontranscribed strand of DNA (i.e., the strand having a sequence homologous to the mRNA). A "recombinant DNA molecule" is a DNA molecule that has undergone a molecular biological manipulation. [0055] As used herein, the term "fragment or segment", as applied to a nucleic acid sequence, gene or polypeptide, will ordinarily be at least about 5 contiguous nucleic acid bases (for nucleic acid sequence or gene) or amino acids (for polypeptides), typically at least about 10 contiguous nucleic acid bases or amino acids, more typically at least about 20 contiguous nucleic acid bases or amino acids, usually at least about 30 contiguous nucleic acid bases or amino acids, preferably at least about 40 contiguous nucleic acid bases or amino acids, more preferably at least about 50 contiguous nucleic acid bases or amino acids, and even more preferably at least about 60 to 80 or more contiguous nucleic acid bases or amino acids in length. "Overlapping fragments" as used herein, refer to contiguous nucleic acid or peptide fragments which begin at the amino terminal end of a nucleic acid or protein and end at the carboxy terminal end of the nucleic acid or protein. Each nucleic acid or peptide fragment has at least about one contiguous nucleic acid or amino acid position in common with the next nucleic acid or peptide fragment, more preferably at least about three contiguous nucleic acid bases or amino acid positions in common, most preferably at least about ten contiguous nucleic acid bases amino acid positions in common. [0056] In another preferred embodiment, the cAMP reporter comprises a fluorescent protein comprising green fluorescent protein (GFP), cyan- (CFP), yellow- (YFG), blue- (BFP), red- (RFP) fluorescent proteins; enhanced green fluorescent protein (EGFP), EYFP, EBFP, Nile Red, dsRed, mutated, modified, or enhanced forms thereof, and the like. [0057] In another preferred embodiment, the transgenic non-human animal the trans activator comprises a reverse tetracycline transactivator (rtTA). [0058] A "promoter," as used herein, refers to a polynucleotide sequence that controls transcription of a gene or coding sequence to which it is operably linked. A large number of promoters, including constitutive, inducible and repressible promoters, from a variety of different sources, are well known in the art and are available as or within cloned polynucleotide sequences (from, e.g., depositories such as the ATCC as well as other commercial or individual sources).

[0059] An "enhancer," as used herein, refers to a polynucleotide sequence that enhances transcription of a gene or coding sequence to which it is operably linked. A large number of enhancers, from a variety of different sources are well known in the art and available as or within cloned polynucleotide sequences (from, e.g., depositories such as the ATCC as well as other commercial or individual sources). A number of polynucleotides comprising promoter sequences (such as the commonly-used CMV promoter) also comprise enhancer sequences. [0060] "Operably linked" refers to a juxtaposition, wherein the components so described are in a relationship permitting them to function in their intended manner. A promoter is operably linked to a coding sequence if the promoter controls transcription of the coding sequence. Although an operably linked promoter is generally located upstream of the coding sequence, it is not necessarily contiguous with it. An enhancer is operably linked to a coding sequence if the enhancer increases transcription of the coding sequence. Operably linked enhancers can be located upstream, within or downstream of coding sequences. A polyadenylation sequence is operably linked to a coding sequence if it is located at the downstream end of the coding sequence such that transcription proceeds through the coding sequence into the polyadenylation sequence.

[0061] The transgenes according to the present invention are constructed and cloned by standard methods known in the art. Such standard methods are disclosed, for example, in Sambrook et al., 1989, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Labs Press. The reference Sambrook et al., ibid., is incorporated herein by reference in its entirety. [0062] In the transgenic mouse described herein, the transgene(s) includes DNA coding for a mutant molecule includes any mutation altering or enhancing the cAMP reporter activity. In another embodiment, the transgene(s) may be a non-mouse cAMP reporter, preferably from a larger mammal (e.g., rat or human). In another preferred embodiment, the transgenes can be selected from any animal.

[0063] In addition to the nucleic acid coding for cAMP reporter, transgenes according to the present invention are constructed to include a tissue-specific and inducible promoter. [0064] In addition to the promoter, transgenes according to the invention will contain other expression control sequences necessary or desirable for proper expression and processing of the cAMP reporter. These expression control sequences and the promoter will be operatively linked to the cAMP reporter-encoding DNA. The phrase "operatively linked" refers to linking of nucleic acid sequences in the transgene in a manner such that the transgenes can be expressed in cells when the transgene is integrated into a host genome. The additional expression control sequences are well known in the art and include sequences that control the initiation, elongation, and termination of transcription (such as enhancer sequences and polyadenylation sequences).

[0065] The term "transfection" means the introduction of a foreign nucleic acid into a cell. The term "transformation" means the introduction of a "foreign" (i.e. extrinsic or extracellular) gene, DNA or RNA sequence to an ES cell or pronucleus, so that the cell will express the introduced gene or sequence to produce a desired substance in a transgenic animal.

[0066] The terms "vector", "cloning vector" and "expression vector" mean the vehicle by which a DNA or RNA sequence (e.g. a foreign gene) can be introduced into a host cell, (e.g. ES cell or pronucleus) so as to transform the host and promote expression (e.g. transcription and translation) of the introduced sequence. [0067] The terms "express" and "expression" mean allowing or causing the information in a gene or DNA sequence to become manifest, for example producing a protein by activating the cellular functions involved in transcription and translation of a corresponding gene or DNA sequence. A DNA sequence is expressed in or by a cell to form an "expression product" such as a protein. The expression product itself, e.g. the resulting protein, may also be said to be "expressed". An expression product can be characterized as intracellular, extracellular or secreted. The term "intracellular" means something that is inside a cell. T he term "extracellular" means something that is outside a cell. A substance is "secreted" by a cell if it appears in significant measure outside the cell, from somewhere on or inside the cell. [0068] The terms "mutant" and "mutation" in the context of the invention mean any detectable change in genetic material encoding a cAMP reporter. This includes gene mutations, in which the structure (e.g., DNA sequence) of a gene is altered, any gene or DNA arising from any mutation process, and any expression product (e.g., protein or enzyme) expressed by a modified gene or DNA sequence. The term "variant" may also be used to indicate a modified or altered gene, DNA sequence, enzyme, cell, etc., i.e., any kind of mutant.

[0069] Transgene sequences are cloned using a standard cloning system, and the trans gene products are excised from the cloning vector, purified, and injected into the pronuclei of fertilized mouse eggs. Stable integration of the transgene into the genome of the transgenic embryos allows permanent transgenic mouse lines to be established. Examples of suitable techniques are further provided in the Examples sections.

[0070] Mouse strains that are suitable for the derivation of transgenic mice as described herein are any common laboratory mouse strain. Preferred mouse strains to use for the derivation of transgenic mice founders of the present invention include C57 strains, preferably C57B1/6. Founder mice are bred into wild-type mice or other suitable partners to create lines of transgenic mice to facilitate screening and establishment of stable lines. [0071] The transgenic mammals of the invention may be used to study the molecular and cellular aspects of diseases and lead to the understanding of signaling mechanisms, drug evaluations, identification of new drugs, drug profiling and the like. For instance, a transgenic mouse of the present invention may be sacrificed, and the cells and/or tissues examined at the cellular or molecular level and compared to the cells and/or tissues from transgene-negative littermates. Examples of experiments that can be performed include, but are not limited to, morphological examination of cells; histological examination of tissues; evaluation of receptor signaling; evaluation of DNA replication and/or expression; assays to evaluate enzyme (motor) activity both in solution and in nerve tissues, heart etc; and assays of three dimensional distribution of cAMP and Ca²⁺; signal transduction etc. [0072] Another embodiment of the present invention relates to a system in which to test drugs candidates for prevention or treatment of disease and disorders. In this embodiment, a transgenic mouse of the invention serves as an in vivo system to evaluate the effect of drug candidates for prevention or treatment of disease. Specifically, a transgenic mouse of the present invention is administered a candidate drug. The mouse is then evaluated for physiological and pathological changes that indicate the efficacy of the drug for prevention, treatment, or reduction of the rate of progression, of disease; Ca²⁺, cAMP and membrane voltage are monitored for changes in levels, distributions etc to provide both a spatial and temporal resolution. One of skill in the art can then identify modes of action, toxicities, efficacy, absorption, doses, half-life, distribution etc in analyzing modes of action of the candidate agent and its effects on the progression of disease.

[0073] In addition, the transgenic mice of the invention may be used to evaluate the effects of drugs that interact with or affect signaling.

[0074] In accordance with the present invention, acceptable protocols to administer a candidate drug include the mode of administration and the effective amount of candidate drug administered to an animal, including individual dose size, number of doses and frequency of dose administration. Determination of such protocols can be accomplished by those skilled in the art, and the determination of such protocols is, in fact, another use of the transgenic mice of the invention. Suitable modes of administration can include, but are not limited to, oral, nasal, topical, transdermal, rectal, and parenteral routes. Preferred parenteral routes can include, but are not limited to, subcutaneous, intradermal, intravenous, intramuscular and intraperitoneal routes. Preferred topical routes include inhalation by aerosol (i.e., spraying) or topical surface administration to the skin of an animal. Preferred is oral administration. [0075] According to the method of the present invention, an effective amount of a candidate drug to administer to an animal comprises an amount that is capable of eliciting a measurable effect on Ca²⁺, cAMP and membrane voltage. Measurements of these parameters are discussed in detail in the Examples which follow, however, one of skill in the art can easily adapt various assays to perform these measurements, without being toxic to the animal. An amount that is toxic to an animal comprises any amount that causes damage to the structure or function of an animal (i.e., poisonous). [0076] Yet another embodiment of the present invention relates to the use of a transgenic mouse of the invention to study the effects of external factors on signaling. Such factors include, but are not limited to, stress, diet and exercise.

[0077] It must be noted that as used herein and in the appended claims, the singular forms "a", "an", and "the" include plural reference unless the context clearly dictates otherwise. T hus, for example, reference to "a cell" includes a plurality of such cells and equivalents thereof known to those skilled in the art, and so forth. As well, the terms "a" (or "an"), "one or more" and "at least one" can be used interchangeably herein. It is also to be noted that the terms "comprising", "including", and "having" can be used interchangeably.

Identification of Candidate Therapeutic Compounds

[0078] The transgenic mouse described herein and cells derived (e.g. isolated, transformed with nucleic acids of choice etc) therefrom, are important in identifying new agents and compounds used for treating a wide variety of disorders. As discussed, the reporter allows one to investigate the details of cAMP-mediated signaling that underlies cellular responses to a large number of bioactive agents including neurotransmitters, hormones, metabolites, cytokines, and sensor/reportery stimuli. Cells in all mammals use a number of cytoplasmic second messengers to signal an enormous diversity of events. Of these, Ca²⁺ and cAMP are arguably two of the most prominent.

[0079] In one preferred embodiment, a candidate compound is administered to the mouse and the Ca²⁺, cAMP and membrane voltage are monitored for changes in levels, distributions etc to provide both a spatial and temporal resolution. One of skill in the art can then identify modes of action, toxicities, efficacy, absorption, doses, half-life, distribution etc in analyzing modes of action of the candidate agent. Administration of the compounds can be via any desired method, for example, in food, water, intranasally, intravenously, intra muscular, and the like.

[0080] In another preferred embodiment, cells are isolated from the animal and cultured in vitro. These cells can also be transformed with nucleic acids, e.g. expression vectors. These cells can be cultured with different agents and the Ca²⁺, cAMP and membrane voltage are monitored for changes in levels, distributions etc to provide both a spatial and temporal resolution. One of skill in the art can then identify modes of action, toxicities, efficacy, absorption, doses, half-life, distribution etc in analyzing modes of action of the candidate agent. [0081] In another preferred embodiment, the cells isolated from the transgenic animal are used in assays to measure Ca²⁺, cAMP and membrane voltage changes in levels, distributions etc, and provides both a spatial and temporal resolution..

Vectors

[0082] The Examples section describes the use of promoters, vectors, transactivators, etc. However, the invention can be practiced using any number of vectors, promoters etc. The methods involve administering the cAMP sensor/reporter polynucleotides with a suitable nucleic acid delivery system. In one embodiment, that system includes a non- viral vector operably linked to the polynucleotide. Examples of such non- viral vectors include the polynucleoside alone or in combination with a suitable protein, polysaccharide or lipid formulation.

[0083] Additionally suitable nucleic acid delivery systems include viral vector, typically sequence from at least one of an adenovirus, adenovirus-associated virus (AAV), helper- dependent adenovirus, retrovirus, or hemagglutinating virus of Japan-liposome (HVJ) complex. Preferably, the viral vector comprises a strong eukaryotic promoter operably linked to the polynucleotide e.g., a cytomegalovirus (CMV) promoter. [0084] Additionally preferred vectors include viral vectors, fusion proteins and chemical conjugates. Retroviral vectors include Moloney murine leukemia viruses and HIV- based viruses. One preferred HIV-based viral vector comprises at least two vectors wherein the gag and pol genes are from an HIV genome and the env gene is from another virus. DNA viral vectors are preferred. These vectors include pox vectors such as orthopox or avipox vectors, herpesvirus vectors such as a herpes simplex I virus (HSV) vector [Geller, A.I. et al., /. Neurochem, 64: 487 (1995); Lim, E, et al., in DNA Cloning: Mammalian Systems, D. Glover, Ed. (Oxford Univ. Press, Oxford England) (1995); Geller, A.I. et al., Proc Natl. Acad. Sci:. U.S.A.: 90 7603 (1993); Geller, A.I., et al., Proc Natl. Acad. Sci USA: 87:1149 (1990)], Adenovirus Vectors [LeGaI LaSaIIe et al., Science, 259:988 (1993); Davidson, et al., Nat. Genet. 3: 219 (1993); Yang, et al., /. Virol. 69: 2004 (1995)] and Adeno-associated Virus Vectors [Kaplitt, M.G, et al., Nat. Genet. 8:148 (1994)].

[0085] Pox viral vectors introduce the gene into the cells cytoplasm. Avipox virus vectors result in only a short term expression of the nucleic acid. Adenovirus vectors, adeno- associated virus vectors and herpes simplex virus (HSV) vectors may be an indication for some invention embodiments. The adenovirus vector results in a shorter term expression (e.g., less than about a month ) than adeno-associated virus, in some embodiments, may exhibit much longer expression. The particular vector chosen will depend upon the target cell and the condition being treated. The selection of appropriate promoters can readily be accomplished. Preferably, one would use a high expression promoter. An example of a suitable promoter is the 763 -base-pair cytomegalovirus (CMV) promoter. The Rous sarcoma virus (RSV) (Davis, et al., HMm Gene Ther 4:151 (1993)) and MMT promoters may also be used. Certain proteins can expressed using their native promoter. Other elements that can enhance expression can also be included such as an enhancer or a system that results in high levels of expression such as a tat gene and tar element. This cassette can then be inserted into a vector, e.g., a plasmid vector such as, pUC19, pUC118, pBR322, or other known plasmid vectors, that includes, for example, an E. coli origin of replication. See, Sambrook, et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory press, (1989). Promoters are discussed infra. The plasmid vector may also include a selectable marker such as the β-lactamase gene for ampicillin resistance, provided that the marker polypeptide does not adversely effect the metabolism of the organism being treated. The cassette can also be bound to a nucleic acid binding moiety in a synthetic delivery system, such as the system disclosed in WO 95/22618.

[0086] If desired, the polynucleotides of the invention may also be used with a microdelivery vehicle such as cationic liposomes and adenoviral vectors. For a review of the procedures for liposome preparation, targeting and delivery of contents, see Mannino and Gould-Fogerite, BioTechniques, 6:682 (1988). See also, Feigner and Holm, Bethesda Res. Lab. Focus, 11(2):21 (1989) and Maurer, R.A., Bethesda Res. Lab. Focus, 11(2):25 (1989). [0087] Replication-defective recombinant adenoviral vectors, can be produced in accordance with known techniques. See, Quantin, et al., Proc. Natl. Acad. Sci. USA, 89:2581-2584 (1992); Stratford-Perricadet, et al., J. Clin. Invest, 90:626-630 (1992); and Rosenfeld, et al., Cell, 68:143-155 (1992).

[0088] One preferred delivery system is a recombinant viral vector that incorporates one or more of the polynucleotides therein, preferably about one polynucleotide. Preferably, the viral vector used in the invention methods has a pfu (plague forming units) of from about 10⁸ to about 5 x 10¹⁰ pfu. In embodiments in which the polynucleotide is to be administered with a non- viral vector, use of between from about 0.1 nanograms to about 4000 micrograms will often be useful e.g., about 1 nanogram to about 100 micrograms. Test Compounds

[0089] In another preferred embodiment, candidate therapeutic agents or test compounds can be identified by their effects on intracellular cyclic AMP (cAMP), Ca²⁺ levels and profiles thereof, temporal and spatial distribution of cAMP and membrane depolarization. [0090] A variety of test compounds can be evaluated using the transgenic mouse described herein. The term "test compound" includes any reagent or test agent which is employed in the assays of the invention and assayed for its ability to influence the intracellular cyclic AMP (cAMP), Ca²⁺ levels and profiles thereof, temporal and spatial distribution of cAMP and membrane depolarization. More than one compound, e.g., a plurality of compounds, can be tested at the same time for their ability to modulate the intracellular cyclic AMP (cAMP), Ca²⁺ levels and profiles thereof, temporal and spatial distribution of cAMP and membrane depolarization.

[0091] In certain embodiments, the compounds to be tested can be derived from libraries (i.e., are members of a library of compounds). While the use of libraries of peptides is well established in the art, new techniques have been developed which have allowed the production of mixtures of other compounds, such as benzodiazepines (Bunin et al. (1992). J. Am. Chem. Soc. 114:10987; De Witt et al. (1993). Proc. Natl. Acad. Sci. USA 90:6909) peptoids (Zuckermann. (1994). /. Med. Chem. 37:2678) oligocarbamates (Cho et al. (1993). Science. 261:1303), and hydantoins (DeWitt et al. supra).

[0092] The compounds of the present invention can be obtained using any of the numerous approaches in combinatorial library methods known in the art, including: biological libraries; spatially addressable parallel solid phase or solution phase libraries, synthetic library methods requiring deconvolution, the ^v one-bead one-compound" library method, and synthetic library methods using affinity chromatography selection. The biological library approach is limited to peptide libraries, while the other four approaches are applicable to peptide, non-peptide oligomer or small molecule libraries of compounds (Lam, K. S. (1997) Anticancer Drug Des. 12:145). Other exemplary methods for the synthesis of molecular libraries can be found in the art, for example in: Erb et al. (1994). Proc. Natl. Acad. Sci. USA 91:11422; Horwell et al. (1996) Immunopharmacology 33:68; and in Gallop et al. (1994); /. Med. Chem. 37:1233.

[0093] Libraries of compounds can be presented in solution (e.g., Houghten (1992)

Biotechniques 13:412-421), or on beads (Lam (1991) Nature 354:82-84), chips (Fodor (1993) Nature 364:555-556), bacteria (Ladner U.S. Pat. No. 5,223,409), spores (Ladner U.S. Pat. No. '409), plasmids (Cull et al. (1992) Proc Natl Acad Sci USA 89:1865-1869) or on phage (Scott and Smith (1990) Science 249:386-390); (Devlin (1990) Science 249:404-406); (Cwirla et al. (1990) Proc. Natl. Acad. ScL 87:6378-6382); (Felici (1991) /. MoI. Biol. 222:301-310). In still another embodiment, the combinatorial polypeptides are produced from a cDNA library. [0094] Exemplary compounds which can be screened for activity include, but are not limited to, peptides, nucleic acids, carbohydrates, small organic molecules, and natural product extract libraries.

[0095] Candidate/test compounds include, for example, 1) peptides such as soluble peptides, including Ig-tailed fusion peptides and members of random peptide libraries (see, e.g., Lam, K. S. et al. (1991) Nature 354:82-84; Houghten, R. et al. (1991) Nature 354:84-86) and combinatorial chemistry-derived molecular libraries made of D- and/or L-configuration amino acids; 2) phosphopeptides (e.g., members of random and partially degenerate, directed phosphopeptide libraries, see, e.g., Songyang, Z. et al. (1993) Cell 72:767-778); 3) antibodies (e.g., polyclonal, monoclonal, humanized, anti-idiotypic, chimeric, and single chain antibodies as well as Fab, F(ab') ₂, Fab expression library fragments, and epitope-binding fragments of antibodies); 4) small organic and inorganic molecules (e.g., molecules obtained from combinatorial and natural product libraries); 5) enzymes (e.g., endoribonucleases, hydrolases, nucleases, proteases, synthatases, isomerases, polymerases, kinases, phosphatases, oxido-reductases and ATPases), and the like.

[0096] The test compounds of the present invention can be obtained using any of the numerous approaches in combinatorial library methods known in the art, including: biological libraries; spatially addressable parallel solid phase or solution phase libraries; synthetic library methods requiring deconvolution; the ^vone-bead one-compound" library method; and synthetic library methods using affinity chromatography selection. The biological library approach is limited to peptide libraries, while the other four approaches are applicable to peptide, non-peptide oligomer or small molecule libraries of compounds (Lam, K. S. (1997) Anticancer Drug Des. 12:145).

[0097] Examples of methods for the synthesis of molecular libraries can be found in the art, for example in: DeWitt et al. (1993) Proc. Natl. Acad. ScL USA 90:6909; Erb et al. (1994) Proc. Natl. Acad. ScL USA 91:11422; Zuckermann et al. (1994) /. Med. Chem. 37:2678; Cho et al. (1993) Science 261:1303; Carrell et al. (1994) Angew. Chem. Int. Ed. Engl. 33:2059; Carell et al. (1994) Angew. Chem. Int. Ed. Engl. 33:2061; and Gallop et al. (1994) /. Med. Chem. 37:1233.

[0098] Compounds identified in the subject screening assays can be used in methods of modulating one or more of the biological responses regulated by transduction pathways. It will be understood that it may be desirable to formulate such compound(s) as pharmaceutical compositions (described supra) prior to contacting them with cells.

[0099] Once a test compound is identified that directly or indirectly modulates, e.g., a molecule in a signal transduction pathway, the selected test compound (or "compound of interest") can then be further evaluated for its effect on cells, for example by contacting the compound of interest with cells either in vivo or ex vivo (e.g., by isolating cells from the subject and contacting the isolated cells with the compound of interest or, alternatively, by contacting the compound of interest with a cell line) and determining the effect of the compound of interest on the cells, as compared to an appropriate control (such as untreated cells or cells treated with a control compound, or carrier, that does not modulate the biological response).

Promoters

[0100] Throughout this application, the term "expression construct" is meant to include any type of genetic construct containing a nucleic acid coding for gene products in which part or all of the nucleic acid encoding sequence is capable of being transcribed. The transcript may be translated into a protein, but it need not be. In certain embodiments, expression includes both transcription of a gene and translation of mRNA into a gene product. In other embodiments, expression only includes transcription of the nucleic acid encoding genes of interest.

[0101] The nucleic acid encoding a gene product is under transcriptional control of a promoter. A "promoter" refers to a DNA sequence recognized by the synthetic machinery of the cell, or introduced synthetic machinery, required to initiate the specific transcription of a gene. The phrase "under transcriptional control" means that the promoter is in the correct location and orientation in relation to the nucleic acid to control RNA polymerase initiation and expression of the gene.

[0102] Much of the thinking about how promoters are organized derives from analyses of several viral promoters, including those for the HSV thymidine kinase (tk) and SV40 early transcription units. These studies, augmented by more recent work, have shown that promoters arc composed of discrete functional modules, each consisting of approximately 7-

20 b.p. of DNA, and containing one or more recognition sites for transcriptional activator or repressor proteins.

[0103] Additional promoter elements regulate the frequency of transcriptional initiation.

Typically, these are located in the region 30-110 b.p. upstream of the start site, although a number of promoters have recently been shown to contain functional elements downstream of the start site as well. The spacing between promoter elements frequently is flexible, so that promoter function is preserved when elements are inverted or moved relative to one another. In the tk promoter, the spacing between promoter elements can be increased to 50 b.p. apart before activity begins to decline. Depending on the promoter, it appears that individual elements can function either co-operatively or independently to activate transcription. [0104] The particular promoter employed to control the expression of a nucleic acid sequence of interest is not believed to be important, so long as it is capable of directing the expression of the nucleic acid in the targeted cell. Thus, where a mammalian cell is targeted, it is preferable to position the nucleic acid coding region adjacent to and under the control of a promoter that is capable of being expressed in a desired mammalian cell., e.g. pancreatic cells. Generally speaking, such a promoter might include either a human or viral promoter. [0105] In various embodiments, the human cytomegalovirus (CMV) immediate early gene promoter, the SV40 early promoter, the Rous sarcoma virus long terminal repeat, β-actin, rat insulin promoter and glyceraldehyde-3 -phosphate dehydrogenase can be used to obtain high-level expression of the coding sequence of interest. The use of other viral or mammalian cellular or bacterial phage promoters which are well-known in the art to achieve expression of a coding sequence of interest is contemplated as well, provided that the levels of expression are sufficient for a given purpose. By employing a promoter with well-known properties, the level and pattern of expression of the protein of interest following transfection or transformation can be optimized.

[0106] Selection of a promoter that is regulated in response to specific physiologic or synthetic signals can permit inducible expression of the gene product. For example in the case where expression of a transgene, or transgenes when a multicistronic vector is utilized, is toxic to the cells in which the vector is produced in, it may be desirable to prohibit or reduce expression of one or more of the transgenes. Examples of transgenes that may be toxic to the producer cell line are pro-apoptotic and cytokine genes. Several inducible promoter systems are available for production of viral vectors where the transgene product may be toxic. [0107] The ecdysone system (Invitrogen, Carlsbad, Calif.) is one such system. This system is designed to allow regulated expression of a gene of interest in mammalian cells. It consists of a tightly regulated expression mechanism that allows virtually no basal level expression of the transgene, but over 200-fold inducibility. The system is based on the heterodimeric ecdysone receptor of Drosophila, and when ecdysone or an analog such as muristerone A binds to the receptor, the receptor activates a promoter to turn on expression of the downstream transgene high levels of mRNA transcripts are attained. In this system, both monomers of the heterodimeric receptor are constitutively expressed from one vector, whereas the ecdysone-responsive promoter which drives expression of the gene of interest is on another plasmid. Engineering of this type of system into the gene transfer vector of interest would therefore be useful. Cotransfection of plasmids containing the gene of interest and the receptor monomers in the producer cell line would then allow for the production of the gene transfer vector without expression of a potentially toxic transgene. At the appropriate time, expression of the transgene could be activated with ecdysone or muristeron A. [0108] Another inducible system that would be useful is the Tet-Off™ or Tet-On™ system (Clontech, Palo Alto, Calif.). This system also allows high levels of gene expression to be regulated in response to tetracycline or tetracycline derivatives such as doxycycline. In the Tet-On™ system, gene expression is turned on in the presence of doxycycline, whereas in the Tet-Off™ system, gene expression is turned on in the absence of doxycycline. These systems are based on two regulatory elements derived from the tetracycline resistance operon of E. coli. The tetracycline operator sequence to which the tetracycline repressor binds, and the tetracycline repressor protein. The gene of interest is cloned into a plasmid behind a promoter that has tetracycline-responsive elements present in it. A second plasmid contains a regulatory element called the tetracycline-controlled transactivator, which is composed, in the Tet-Off™ system, of the VP16 domain from the herpes simplex virus and the wild-type tertracycline repressor. Thus in the absence of doxycycline, transcription is constitutively on. In the Tet-On™ system, the tetracycline repressor is not wild type and in the presence of doxycycline activates transcription. For gene therapy vector production, the Tet-Off™ system would be preferable so that the producer cells could be grown in the presence of tetracycline or doxycycline and prevent expression of a potentially toxic transgene, but when the vector is introduced to the patient, the gene expression would be constitutively on. [0109] In some circumstances, it may be desirable to regulate expression of a transgene. For example, different viral promoters with varying strengths of activity may be utilized depending on the level of expression desired. In mammalian cells, the CMV immediate early promoter if often used to provide strong transcriptional activation. Modified versions of the CMV promoter that are less potent have also been used when reduced levels of expression of the transgene are desired. When expression of a transgene in hematopoietic cells is desired, retroviral promoters such as the LTRs from MLV or MMTV are often used. Other viral promoters that may be used depending on the desired effect include SV40, RSV LTR, HIV-I and HIV-2 LTR, adenovirus promoters such as from the ElA, E2A, or MLP region, AAV LTR, cauliflower mosaic Virus, HSV-TK, and avian sarcoma virus. [0110] In a preferred embodiment, tissue specific promoters are used to effect transcription in specific tissues or cells so as to reduce potential toxicity or undesirable effects to non-targeted tissues. For example, promoters such as the PSA, probasin, prostatic acid phosphatase or prostate-specific glandular kallikrein (hK2) may be used to target gene expression in the prostate. Similarly, the following promoters may be used to target gene expression in other tissues (Table 1).

TABLE 1 Tissue specific promoters

Tissue Promoter

Pancreas insulin elastin amylase pdr-1 pdx-1 glucokinase

Liver albumin PEPCK

HBV enhancer alpha fetoprotein apolipoprotein C alpha-1 antitrypsin vitellogenin, NF-AB

Transthyretin

Skeletal muscle myosin H chain muscle creatine kinase dystrophin calpain p94 skeletal alpha-actin fast troponin 1

Skin keratin K6 keratin Kl

Lung CFTR human cytokeratin 18 (K18) pulmonary surfactant proteins A, B and C

CC-IO

Pl

Smooth muscle sm22 alpha

SM-alpha-actin

Endothelium endothelin-1

E-selectin von Willebrand factor

TIE (Korhonen et al . , 1995)

KDR/flk-1

Melanocytes tyrosinase

Adipose tissue lipoprotein lipase adipsin acetyl-CoA carboxylase glycerophosphate dehydrogenase adipocyte P2

Blood β-globin [0111] In certain indications, it may be desirable to activate transcription at specific times after administration of the vector. This may be done with such promoters as those that are hormone or cytokine regulatable. For example in gene therapy applications where the indication is a gonadal tissue where specific steroids are produced or routed to, use of androgen or estrogen regulated promoters may be advantageous. Such promoters that are hormone regulatable include MMTV, MT-I, ecdysone and RuBisco. Other hormone regulated promoters such as those responsive to thyroid, pituitary and adrenal hormones are expected to be useful in the present invention. Cytokine and inflammatory protein responsive promoters that could be used include K and T Kininogen, c-fos, TNF-alpha, C-reactive protein, haptoglobin, serum amyloid A2, C/EB.P. alpha, IL-I, IL-6, Complement C3, IL-8, alpha- 1 acid glycoprotein, alpha- 1 antitypsin, lipoprotein lipase, angiotensinogen, fibrinogen, c-jun (inducible by phorbol esters, TNF-alpha, UV radiation, retinoic acid, and hydrogen peroxide), collagenase (induced by phorbol esters and retinoic acid), metallothionein (heavy metal and glucocorticoid inducible), Stromelysin (inducible by phorbol ester, interleukin- 1 and EGF), alpha-2 macroglobulin and alpha- 1 antichymotrypsin. [0112] Tumor specific promoters such as osteocalcin, hypoxia-responsive element (HRE), MAGE-4, CEA, alpha-fetoprotein, GRP78/BiP and tyrosinase may also be used to regulate gene expression in tumor cells. Other promoters that could be used according to the present invention include Lac -regulatable, chemotherapy inducible (e.g. MDR), and heat (hyperthermia) inducible promoters, radiation-inducible (e.g., EGR (Joki et al., 1995)), Alpha-inhibin, RNA pol III tRNA met and other amino acid promoters, Ul snRNA (Bartlett et al., 1996), MC-I, PGK, β-actin and α-globin. Many other promoters that may be useful are listed in Walther and Stein (1996).

[0113] It is envisioned that any of the above promoters alone or in combination with another may be useful according to the present invention depending on the action desired. In addition, this list of promoters is should not be construed to be exhaustive or limiting, those of skill in the art will know of other promoters that may be used in conjunction with the promoters and methods disclosed herein.

Enhancers

[0114] Enhancers are genetic elements that increase transcription from a promoter located at a distant position on the same molecule of DNA. Enhancers are organized much like promoters. That is, they are composed of many individual elements, each of which binds to one or more transcriptional proteins. The basic distinction between enhancers and promoters is operational. An enhancer region as a whole must be able to stimulate transcription at a distance; this need not be true of a promoter region or its component elements. On the other hand, a promoter must have one or more elements that direct initiation of RNA synthesis at a particular site and in a particular orientation, whereas enhancers lack these specificities. Promoters and enhancers are often overlapping and contiguous, often seeming to have a very similar modular organization. [0115] Below is a list of promoters additional to the tissue specific promoters listed above, cellular promoters/enhancers and inducible promoters/enhancers that could be used in combination with the nucleic acid encoding a gene of interest in an expression construct. Additionally, any promoter/enhancer combination (as per the Eukaryotic Promoter Data Base EPDB) could also be used to drive expression of the gene. Eukaryotic cells can support cytoplasmic transcription from certain bacterial promoters if the appropriate bacterial polymerase is provided, either as part of the delivery complex or as an additional genetic expression construct.

TABLE 2 ENHANCER

Immunoglobulin Heavy Chain Immunoglobulin Light Chain T-CeII Receptor HLA DQa and DQβ β.-lnterferon lnterleukin-2 lnterleukin-2 Receptor MHC Class Il HLA-DRα β-Actin

Muscle Creatine Kinase Prealbumin (Transthyretin) Elastase I Metallothionein Collagenase Albumin Gene α-Fetoprotein τ-Globin β-Globin e-fos c-HA-ras Insulin

Neural Cell Adhesion Molecule (NCAM) α1 -Antitrypsin H2B (TH2B) Histone Mouse or Type I Collagen

Glucose-Regulated Proteins (GRP94 and GRP78) Rat Growth Hormone Human Serum Amyloid A (SAA) Troponin I (TN I) Platelet-Derived Growth Factor Duchenne Muscular Dystrophy SV40 Polyoma

Retroviruses

Papilloma virus

Hepatitis B Virus

Human Immunodeficiency Virus

Cytomegalovirus

Gibbon Ape Leukemia Virus

TABLE 3

Element Inducer

MT II Phorbol Ester (TPA)

Heavy metals

MMTV (mouse mammary tumor Glucocorticoids virus) β-lnterferon poly(rl)X poly(rc)

Adenovirus 5 E2 EIA c-jun Phorbol Ester (TPA), H₂O₂

Collagenase Phorbol Ester (TPA)

Stromelysin Phorbol Ester (TPA), IL- 1

SV40 Phorbol Ester (TPA)

Murine MX Gene Interferon, Newcastle Disease Virus

GRP78 Gene A23187 α-2-Macroglobulin IL-6

Vimentin Serum

MHC Class I Gene H-2kB Interferon

HSP70 EIA, SV40 Large T Antigen

Proliferin Phorbol Ester-TPA

Tumor Necrosis Factor FMA

Thyroid Stimulating Hormone α-Thyroid Hormone

Gene

Insulin E Box Glucose

[0116] The expression construct comprises a virus or engineered construct derived from a viral genome. The ability of certain viruses to enter cells via receptor-mediated endocytosis and to integrate into host cell genome and express viral genes stably and efficiently have made them attractive candidates for the transfer of foreign genes into mammalian cells. The first viruses used as gene vectors were DNA viruses including the papovaviruses (simian virus 40, bovine papilloma virus, and polyoma) and adenoviruses. These have a relatively low capacity for foreign DNA sequences and have a restricted host spectrum. Furthermore, their oncogenic potential and cytopathic effects in permissive cells raise safety concerns. They can accommodate only up to 8 kB of foreign genetic material but can be readily introduced in a variety of cell lines and laboratory animals. Donor and Acceptor Moieties

[0117] The c AMP reporter/sensor system used in the generation of transgenic mice has been described in detail in the examples which follow. However, one of skill in the art can contemplate variations.

[0118] In some embodiments both the donor and acceptor moieties are fluorescent proteins. In other embodiments both the donor and acceptor moieties are luminescent moieties. In yet other embodiments, either one of the donor or acceptor moieties can be a fluorescent protein while the other moiety is a luminescent moiety. In other embodiments, the acceptor moiety is a "quencher moiety." As used here, a "donor moiety" is a fluorophore or a luminescent moiety. The absorption spectrum of the "acceptor moiety" overlaps the emission spectrum of the donor moiety. The acceptor moiety does not need to be fluorescent and can be a fluorophore, chromophore, or quencher.

[0119] When both the donor and acceptor moieties are fluorophores, resonance energy transfer is detected as "fluorescence resonance energy transfer" (FRET). If a luminescent moiety is involved, resonance energy transfer is detected as "luminescent resonance energy transfer" (LRET). LRET includes "bioluminescent resonance energy transfer" (BRET; Boute et al., Trends Pharmacol. ScL 23, 351-54, 2002; Ayoub et al., /. Biol. Chem. 277, 21522-28, 2002). Because excitation of the donor moiety does not require exogenous illumination in an LRET method, such methods are particularly useful in live tissue and animal imaging, because penetration of the excitation light is no longer a concern. LRET methods have a high contrast and high signal-to-noise ratio; 2) no photobleaching occurs; and 3) quantification is simplified because the acceptor moiety is not directly excited.

[0120] Suitable acceptor moieties include, for example, a coumarin, a xanthene, a fluorescein, a fluorescent protein, a circularly permuted fluorescent protein, a rhodol, a rhodamine, a resorufin, a cyanine, a difluoroboradiazaindacene, a phthalocyanine, an indigo, a benzoquinone, an anthraquinone, an azo compound, a nitro compound, an indoaniline, a diphenylmethane, a triphenylmethane, and a zwitterionic azopyridinium compound. [0121] Suitable donor moieties include, but are not limited to, a coumarin, a xanthene, a rhodol, a rhodamine, a resorufin, a cyanine dye, a bimane, an acridine, an isoindole, a dansyl dye, an aminophthalic hydrazide, an aminophthalimide, an aminonaphthalimide, an aminobenzofuran, an aminoquinoline, a dicyanohydroquinone, a semiconductor fluorescent nanocrystal, a fluorescent protein, a circularly permuted fluorescent protein, and fluorescent lanthanide chelate. Fluorescent Proteins

[0122] In a preferred embodiment, a cAMP sensor/reporter comprises yellow fluorescent protein fused to protein kinase A catalytic subunit (C-YFP) and cyan fluorescent protein fused to protein kinase regulatory II subunit (R-CFP), variants, fragments and mutants thereof.

[0123] In another preferred embodiment, the C-YFP unit comprises a Phe-to Leu mutation at amino acid position 46.

[0124] In some embodiment, the mutation at amino acid 46 comprises any amino cid in the same class as Leu, e.g. neutral, non-polar amino acids, and analogues thereof.

[0125] In some preferred embodiments either or both of the donor and acceptor moieties is a fluorescent protein. Suitable fluorescent proteins include green fluorescent proteins

(GFP), red fluorescent proteins (RFP), yellow fluorescent proteins (YFP), and cyan fluorescent proteins (CFP). Useful fluorescent proteins also include mutants and spectral variants of these proteins which retain the ability to fluoresce.

[0126] In preferred embodiments these marker genes are fluorescent proteins such as green fluorescent protein (GFP), cyan- (CFP), yellow- (YFG), blue- (BFP), red- (RFP) fluorescent proteins; enhanced green fluorescent protein (EGFP), EYFP, EBFP, Nile Red, dsRed, mutated, modified, or enhanced forms thereof, and the like.

[0127] As used herein, the "green-fluorescence protein" is a gene construct which in transfected or infected cells, respectively, shines green under ultraviolet light and thus enables the detection of a cell transfected or infected, respectively, with GFP in a simple manner.

Uses of green fluorescent protein for the study of gene expression and protein localization are well known. The compact structure makes GFP very stable under diverse and/or harsh conditions such as protease treatment, making GFP an extremely useful reporter in general.

[0128] New versions of green fluorescent protein have been developed, such as a

"humanized" GFP DNA, the protein product of which has increased synthesis in mammalian cells. One such humanized protein is "enhanced green fluorescent protein" (EGFP). Other mutations to green fluorescent protein have resulted in blue-, cyan- and yellow-green light emitting versions.

[0129] Endogenously fluorescent proteins have been isolated and cloned from a number of marine species including the sea pansies Renilla reniformris, R. kollikeri and R. mullerei and from the sea pens Ptilosarcus, Stylatula and Acanthoptilum, as well as from the Pacific

Northwest jellyfish, Aequorea victoria; Szent-Gyorgyi et al. (SPIE conference 1999), D. C.

Prasher et al., Gene, 111:229-233 (1992) and several species of coral (Matz et al. Nature Biotechnology, 17 969-973 (1999). These proteins are capable of forming a highly fluorescent, intrinsic chromophore through the cyclization and oxidation of internal amino acids within the protein that can be spectrally resolved from weakly fluorescent amino acids such as tryptophan and tyrosine.

Luminescent Moieties

[0130] Luminescent moieties useful in a cAMP reporter include lanthanides, which can be in the form of a chelate, including a lanthanide complex containing the chelate (e.g, β- diketone chelates of cerium, praseodymium, neodymium, promethium, samarium, europium, gadolinium, terbium, dysprosium, holmium, erbium, thulium, or ytterbium). Lanthanide chelates are well known in the art. See Soini and Kojola, Clin. Chem. 29, 65, 1983; Hemmila et al., Anal. Biochem. 137, 335 1984; Lovgren et al., In: Collins & Hoh, eds., Alternative Immunoassays, Wiley, Chichester, U.K., p. 203, 1985; Hemmila, Scand. J. Clin. Lab. Invest. 48, 389, 1988; Mikola et al., Bioconjugate Chem. 6, 235, 1995; Peruski et al., /. Immunol. Methods 263, 35-41, 2002; U.S. Pat. No. 4,374,120; and U.S. Pat. No. 6,037,185. Suitable β- diketones are, for example, 2-naphthoyltrifluoroacetone (2-NTA), 1- naphthoyltrifluoroacetone (1-NTA), p-methoxybenzoyltrifluoroacetone (MO-BTA), p- fluorobenzoyltrifluoroacetone (F-BTA), benzoyltrifluoroacetone (BTA), furoyltrifluoroacetone (FTA), naphthoylfuroylmethane (NFM), dithenoylmethane (DTM), and dibenzoylmethane (DBM). See also US 20040146895.

[0131] Luminescent proteins include, but are not limited to, lux proteins (e.g., luxCDABE from Vibrio fischerii), luciferase proteins (e.g., firefly luciferase, Gaussia luciferase, Pleuromamma luciferase, and luciferase proteins of other beetles, Dinoflagellates (Gonylaulax; Pyrocystis;), Annelids (Dipocardia), Molluscs (Lativa), and Crustacea (Vargula; Cypridina), and green fluorescent proteins of bioluminescent coelenterates (e.g., Aequorea Victoria, Renilla mullerei, Renilla reniformis; see Prendergast et al., Biochemistry 17, 3448-53, 1978). Many of these proteins are commercially available. Firefly luciferase is available from Sigma, St. Louis, Mo., and Boehringer Mannheim Biochemicals, Indianapolis, Ind. Recombinantly produced firefly luciferase is available from Promega Corporation, Madison, Wis. Jellyfish aequorin and luciferase from Renilla are commercially available from Sealite Sciences, Bogart, Ga.

[0132] The DNA sequences of the aequorin and other luciferases employed for preparation of some cAMP reporters of the invention can be derived from a variety of sources. For example, cDNA can be prepared from mRNA isolated from the species disclosed above. See Faust, et al., Biochem. 18, 1106-19, 1979; De Wet et al., Proc. Natl. Acad. ScL USA 82, 7870-73, 1985.

[0133] Luciferase substrates (luciferins) are well known and include coelenterazine

(available from Molecular Probes, Eugene, Oreg.) and ENDUREN™. These cell-permeable reagents can be directly administered to cells, as is known in the art. Luciferin compounds can be prepared according to the methods disclosed by Hori et al., Biochemistry 14, 2371-76, 1975; Hori et al., Proc. Natl. Acad. Sci. USA 74, 4285-87, 1977). [0134] All documents mentioned herein are incorporated herein by reference. All publications and patent documents cited in this application are incorporated by reference for all purposes to the same extent as if each individual publication or patent document were so individually denoted. By their citation of various references in this document, Applicants do not admit any particular reference is "prior art" to their invention. The invention has been described in detail with reference to preferred embodiments thereof. However, it will be appreciated that those skilled in the art, upon consideration of this disclosure, may make modifications and improvements within the spirit and scope of the invention. The following non-limiting examples are illustrative of the invention.

EXAMPLES

Enhancing YFP fluorescence

[0135] In FRET, excitation of CFP at 440 nm results in energy transfer to the YFP acceptor, followed by emission at 545 nm. This technology has been in use for cells in culture for several years. However, few reports exist of the successful production of transgenic mammals with FRET-based reporters. Anecdotal explanations of this failure have centered on technical problems such as the acid- and chloride-sensitivity of YFP, and the inefficient folding of YFP at 37°C, leading to slow development of fluorescence. After perusing the literature for novel variant fluorescent proteins, we chose to incorporate a single point mutation into the YFP portion of the cAMP reporter. This mutation, at amino acid position 46 (F46L), was reported to enhance brightness, and improve the trafficking of the YFP protein. We considered that both these parameters would improve the signal-to-noise ratio of the cAMP reporter. We introduced the point mutation into the YFP cDNA using QuikChange XL Site-Directed Mutagenesis Kit, and confirmed the DNA sequence of the resulting construct. The point mutation at position 46 of YFP protein was introduced into - CFP and pCDNA-C-YFPF46L were co-transfected in CHO cells, treated with forskolin/IBMX, and then cAMP change was imaged. Data was collected from at least 5 cells by triplicates.

Transgenic expression construct for reporter

[0136] The original constructs were in the pcDNA3 vector. In brief, the reporter comprises the catalytic and regulatory subunits of Protein Kinase A (PKA). The catalytic subunit is fused to Yellow Fluorescent Protein (C-YFP) and the regulatory subunit-II is fused to Cyan Fluorescent Protein (R-CFP). These constructs were received as plasmid DNAs (cDNAs cloned in pcDNA3). We changed the plasmid vector and promoter sequence for producing the transgenic. There were two goals:

[0137] A. The design of the cAMP reporter is such that the optimum results should be obtained only when the two subunits (R-CFP and C-YFP) are expressed at about equivalent levels in cells. Although this can be achieved stochastically in transfected cells in culture, achieving this in a transgenic mouse may be more difficult. Hence, we chose to use a single bi-directional plasmid vector, pBI (4.4 kb, Clontech/BD Biosciences) to ensure equivalent expression of both polypeptides.

[0138] B. The reporter is formed of two active subunits of PKA. Continuous expression of the reporter in tissues, especially during development, may dramatically alter the function of cells and the health or viability of the mouse. Thus, we chose to use a tissue- specific (i.e. only a selected cell type would express the reporter) and an inducible promoter (i.e. expression would be controlled by the experimenter to avoid chronic expression of excess PKA in all tissues throughout development. We selected the tetracycline-inducible system with the reverse transactivator, rtTA because of its tight control and robust induction properties.

[0139] Both these goals were met by transferring the two cDNAs to the pBI plasmid as a first step to making an effective transgenic mouse for the cAMP reporter. The re-cloning was achieved in the following sequence:

[0140] Step 1. The C-YFP cDNA (1801 bp) was released from its original pcDNA3 vector, using Notl and Xbal and ligated into the corresponding sites of the Multiple Cloning Site (mcs II) of the pBI vector. This plasmid was named pBI-CYFP (6.2kb). [0141] Step 2. The R-CFP plasmid was linearized at Xbal at the 3 ' end of the cDNA. The Xbal ends were blunt ended. Then, the R-CFP cDNA was released from its original pcDNA3 vector by cutting at its 5' end with Nhel. The cDNA (approx 1.9kb) was gel- purified. [0142] Step 3. The pBI-CYFP plasmid (step 1 above) was linearized with Nhel and

EcoRV, both of which cut uniquely in mcs I of the pBI vector. The R-CFP cDNA fragment (step 2 above) was ligated with the linearized plasmid to yield pBI.cAMPp₄6_L (8.2kb). [0143] At each step, plasmids were transformed into E. coli, and diagnostic restriction digests were used on purified plasmids to confirm correct ligations. The cDNA segments of the entire plasmid were confirmed by DNA sequencing before proceeding to transgenesis.

Generation ofpBIcAMPp46L transgenic mice

[0144] The pBI.cAMP_F46L plasmid was linearized with AatII and Asel. These unique sites are located in the plasmid vector, immediately beyond the two 3'-UTR/poly-adenylation sites. The digest separated a fragment for injection (including cDNAs for both reporters and the dual promoter) from nearly all vector sequences. The former DNA was gel purified, and was injected into pronuclei of fertilized eggs (C57BL/6J x SJL/J). The embryos were transferred to foster mothers. DNA injection and implantation was performed by the University of Miami Transgenic Facility. Founder mice were bred with wild type C57BL/6J mice (Jackson laboratory, MA) to establish the transgenic lines.

Isolation and culturing of pancreatic islets of double transgenic mice [0145] Using collagenase P (Roche Diagnostics GmbH), pancreas of Ins2- rtTA/pBIcAMP double transgenic mice was isolated after 5 days injection intraperitoneally of doxycyclin. 2.0 to 2.5 ml of collagenase P solution (lmg/ml in HBSS, Hank's balanced salt solution, Invitrogen) was injected into pancreas through bile duct. The swallowed pancreas was cut it off from digestive tracts and incubated in 15 ml of falcon tube at 37°C shaking incubator for 7 to 10 minutes. After incubation, the pancreatic lysates was washed with washing solution (HBSS containing 10 mM Hepes and 5% FBS) at 4°C for 5 minutes three times. Finally, the lysates was dissolved in 5 ml of washing solution and poured into 30 mm culture dish (Falcon). The released pancreatic islets were collected using glass pipette and put it together into new culture dish. Dissociated single cells were obtained from five to ten isolated islets using dissociation buffer [HBSS (Ca²⁺/Mg²⁺-free) containing 3 mM EGTA, 20 mg/ml BSA, and 2.2 mg/ml glucose]. Dissociated single cells and whole islets were cultured in 4 well-dish (Corning) with celltak (Sigma)-coated coverslip in Opti-MEM containing 10% FBS and Ix pen/strep at 37°C, 5% CO₂ incubator up to used. cAMP imaging

[0146] Imaging experiments were conducted up to 7 days culture. The coverslip with single cells or whole islets were attached to imaging chamber and filled with imaging buffer containing 138 mM NaCl, 4.8 mM KCl, 1.3 mM CaCl₂, 1.2 mM MgCl₂, 3 mM glucose and 25 mM HEPES, pH7.40. The cAMP dynamics was measured using inverted Nikon microscope system. Each experiments, images were collected from at least five cells from three different preparation. Imaging data acquisition and processing were accomplished with MetaMorph/MetaFluor software (Universal Imaging Corp) and OriginPro 7E (OriginLab Corp.). Emission intensities were background-substracted. Data are expressed as the ratio of FRET donor and acceptor emission (485/535 nm ratio).

pBI-cAMP and other transgenic mice

[0147] The R-CFP and C-YFP subunits of the PKA-based cAMP reporter were cloned into in pcDNA3. The C-YFP cDNA was released with Notl and Xbal (1818 bp) and cloned into pBI vector (BD Biosciences). Next, R-CFP cDNA was released with Nhel and Xbal (2044 bp) and ligated into the opposite cloning site of the vector. A point mutation at amino acid #46 of YFP was introduced by PCR to yield the pBI-cAMPF46L construct (Figure 3D). This plasmid was linearized with AatII and Asel to remove vector sequences and purified. The DNA was injected into fertilized eggs of C57BL/6J x SJL/J mice, and eggs were transferred into foster mothers, all at the University of Miami Transgenic Facility. Founder mice were bred with C57BL/6J mice to establish "pBI-cAMP" transgenic lines expressing the F46L- variant of the original cAMP reporter. We tested each of 7 transgenic lines by culturing fibroblasts from the tail tissue of young mice, and transiently transfecting them with pTet-ON (BD Biosciences). After 2 days, dox ( 2μg/ml) was added to the culture for 24 hours and YFP fluorescence was assessed to identify lines in which the transgenes were expressed in a dox- and rtTA-dependent fashion.

[0148] Two trans activator lines of mice were purchased from Jackson Laboratory (Bar

Harbor, ME): Tg(rtTAhCMV)4Bjd/J (#003273) and NOD.Cg-Tg(Ins2-rtTA)2Doi/DoiJ (#004602). We refer to these strains as CMV-rtTA and Ins2-rtTA respectively. Each strain was separately mated with pBI-cAMP mice and the progeny were interbred to homozygosity for rtTA or for both rtTA and the reporter transgenes. The resulting strains, CMV- rtTA/pBIcAMP or Ins2-rtTA/pB IcAMP mice, are here referred to as "double transgenic mice". Doxycycline (dox) induction

[0149] Expression of the pBI-cAMP transgenes was induced by twice injecting dox

(Sigma Chemicals; 100 mg/Kg body weight) intraperitoneally, 4 and 2 days prior to euthanasia. Lower doses or shorter duration of induction appeared to produce lower levels of reporter expression. We also noted that homozygosity of the rtTA allele seemed to be important for high levels of reporter expression sufficient for functional imaging.

Genotyping and immunohistochemistry

[0150] All experimental procedures followed NIH Guidelines for the Care and Use of

Animals and were approved by the University of Miami Animal Care and Use Committee. Tail tissue was genotyped as previously described (Kim, J. W. et al. Chem. Senses 31, 213- 219 (2006)) using the following primer pairs: tgccatgtgagcctagcctaag (SEQ ID NO: 1) and gcaatagaacagggttgagcaaag (SEQ ID NO: 2) for the endogenous PLCβ2 gene; gccgccattattacgacaag (SEQ ID NO: 3) and cctcgatggtagacccgtaa (SEQ ID NO: 4) for rtTA; atggatgtgcaagcatttga (SEQ ID NO: 5) and gtggtgcagatgaacttcag (SEQ ID NO: 6) for R-CFP; caatgagaagtgtggcaagg (SEQ ID NO: 7) and gtggtgcagatgaacttcag (SEQ ID NO: 8) for C-YFP. A common reverse primer in the GFP sequence was used for both R-CFP and C-YFP. All PCRs were carried out for 32 cycles with annealing at 58°C. [0151] Immunohistochemistry was carried out on perfusion-fixed (4% paraformaldehyde) tissues, essentially as described previously (Kim, J.W. et al. Chem. Senses 31, 213-219 (2006)) and using the following antibodies: chicken anti-GFP at 1:2000 (GFP- 1020, Aves Labs, Tigard, OR); guinea pig pre-diluted anti-insulin (AR029-5R, BioGenex, San Ramon, CA); Alexa 488-goat anti-chicken IgG at 1:2000 (Al 1039, Invitrogen); Al 1075); Alexa 594-goat anti-guinea pig IgG at 1:1000 (Al 1076, Invitrogen). In some instances, nuclei were counterstained with 1 μM TO-PRO-3 (Invitrogen) for 15 min.

Isolating and culturing pancreatic islets

[0152] For functional studies, we used islets from adult (5-14 weeks) male and female

Ins2-rtTA/pBI-cAMP mice, dox-induced as above. After euthanasia, 2.0-2.5 ml of collagenase P (Roche Diagnostics, Indianapolis, IN) was injected with a 30 ga. needle as a 1 mg/ml solution in Hank's balanced salt solution (HBSS) through the bile duct into the pancreas. The filled pancreas was dissected free, incubated at 37oC for 7-10 min, then triturated in Washing Buffer (HBSS supplemented with 10 mM Hepes and 5% bovine serum albumin) to release individual islets. Such islets were washed 3 times in Washing Buffer at 4°C. Islets were then collected with glass pipettes, and cultured on Celltak (Sigma)-coated coverslips, in Opti-MEM (Invitrogen) supplemented with 10% fetal bovine serum and 2 μg/ml dox.

cAMP and Ca²⁺ imaging

[0153] Islets from Ins2-rtTA/pBI-cAMP mice were isolated and maintained in culture for up to 7 days for functional studies. Coverslips with islets were placed in a recording chamber (Warner Instruments, Hamden, CT) in buffer containing 120 mM NaCl, 4.8 mM KCl, 2.5 mM CaCl₂, 1.2 mM MgCl₂, 3 mM glucose, 25 mM NaHCO₃, 1% BSA and 10 mM HEPES, pH 7.4. Stimuli were applied by a gravity fed perfusion system at a rate of ~1 ml/min which produced a full exchange of the bath in approximately 60 sec. For imaging cAMP, islets were illuminated with a Lambda DG4 Wavelength Switcher (Sutter Instruments, Novato, CA) at 430 nm and two successive images were collected at 470 and 535 nm with a Cooke Sensican CCD camera. Data are expressed as the ratio of emission at 470 and 535 nm, F470/ F535. For imaging Ca²⁺, islets were loaded with Fura2AM (4 μM), rinsed, and illuminated at 340 and 380 nm successively. Images were collected at 510 nm. Ca²⁺ imaging data are expressed as the ratio of excitation at 340 and 380 nm, F340/F380. We analyzed images with Imaging Workbench v5 software (Indec Biosystems, Santa Clara, CA). [0154] Because glucose causes transient increase and decrease of cytoplasmic pH in β- cells, we considered whether glucose-evoked changes in fluorescence intensity might be attributable to any pH-sensitivity of our cAMP reporter subunits. We tested this in cells expressing our enhanced cAMP reporter by deliberately acidifying and alkalinizing the cytoplasm with NH₄Cl (Figure 8). We observed no change in the F470/F535 ratio over much broader range of pH (est. 1.7 pH units) than occurs in β-cells upon glucose stimulation (<0.1 pH unit). Another potential confound we considered is autofluorescence from NADH produced in β-cells exposed to glucose. However, NADH fluorescence requires excitation below 400 nm and exhibits minimal emission at 535 nm. Consistent with this, we did not measure any glucose-stimulated changes in F470/F535 from wild-type islets or from transgenic islets that were not induced with dox. Thus, neither cytoplasmic pH changes nor autofluorescent metabolites contaminate the cAMP-derived FRET ratio signals.

Glucose Tolerance Test

[0155] Five double transgenic Ins2-rtTA/pBI-cAMP male mice, 17-18 weeks old, were fasted overnight with water ad libitum. The mice were weighed, then injected i.p. with glucose (2mg/g body weight). Plasma glucose levels were monitored using a One Touch Basic Glucometer on blood drawn at timed intervals from a tail vein. All five mice were then induced with two sequential dox injections at days 1 and 5 and were re-subjected to a glucose tolerance test on day 8.

Example 1: Genotyping

[0156] All experimental procedures followed the NIH Guidelines for the Care and Use of Animals, and were approved by the University of Miami Animal Care and Use Committee. Genotyping protocols for identifying mice carrying the transgene were as we described previously (Kim et al., 2006). All genotyping was carried out for the two transgenes, R-CFP and C-YFP, and an endogenous mouse gene (phospholipase Cβ2, Plcb2) in parallel. A single reverse primer was used to detect both CFP and YFP, and was paired with a forward primer in either PKA -regulatory or PKA-catalytic subunits. These primers are designated a, c and b respectively in Figure 1. A positive control for genotyping was assembled by combining genomic DNA from a wildtype mouse with pBI.cAMP_F46L plasmid in a ratio of 1 copy plasmid /genome equivalent. Of 34 mice born following zygote implantation, 8 were genotype -positive for both parts of the transgene. Of these 8 original founder mice, 2 were found to yield colonies of mice in which the transgene was faithfully propagated, and in which the fusion protein(s) could be detected by fluorescence microscopy. In both lines, the R-CFP and C-YFP portions of the transgene were present at 7 or more copies per haploid genome.

[0157] Expression ofcAMP reporter: Induction via Tetracycline-Transactivator (rtTA): The tetracycline-regulated (Tet-ON) system that we selected prevents transgene expression in the absence of induction. This is beneficial so that the mice and all organ systems are allowed to develop under physiological conditions without perturbations arising from transgene expression. To activate the transgene, it is necessary to express the Tetracycline Transactivator protein which is available in two forms: either activated by tetracycline (rtTA, reverse tet transactivator) or is suppressed by it (tTA, tet-transactivator). The rtTA form seems to give more tight regulation of gene expression. We have achieved this tetracycline- dependent expression of R-CFP and C-YFP in at least three separate ways: [0158] Transactivation by rtTA in cell culture: We achieved this by establishing primary cultures of fibroblasts from the pBI.cAMP transgenic Responder mice. These were liposome-transfected with a plasmid encoding rtTA driven by a non-selective CMV promoter, and cultured with or without doxycycline. Such transfected fibroblasts were imaged and clearly demonstrated that elevation of cellular cAMP (by forskolin) resulted in a robust increase in the FRET emission ratio (F470/F535) in doxycycline -treated cells. [0159] Transactivation by rtTA transgenic mice, CMV-rtTA: The CMV-rtTA mice were purchased from Jackson Laboratories (Bar Harbor, ME). We crossed these Transactivator mice with our pBI.cAMP Responder mice. When the mice genotype-positive for rtTA and the C-YFP were injected i.p. with doxycycline, several tissues showed doxycycline - dependent fluorescence, as expected for the low-selectivity CMV promoter. However, the intensity of fluorescence was relatively modest in most of these, presumably reflecting a low effectiveness of the CMV promoter in this transgenic mouse.

[0160] Transactivation by rtTA transgenic mice, Ins2-rtTA: The Ins2-rtTA mice also were obtained from Jackson Labs (Bar Harbor, ME). Crossing them with our pBI.cAMP transgenic Responder mice resulted in a doxycycline-dependent expression of bright fluorescence in the β-cells of pancreatic islets. We confirmed that in pancreatic β-cells, forskolin (which directly activates cAMP-synthesizing enzymes) gives a pronounced FRET signal. Several labs have studied signaling in β-cells in response to glucose and insulinotropic factors. It is known that cAMP plays a key role in these physiological processes. To date, our FRET-based cAMP signals in islet cells correlate exactly with conditions previously though to elevate cAMP. However, the cellular resolution afforded by our transgenic islets is far superior to previously available methods for studying cAMP-based signaling. We expect that the pBI.cAMP transgenic mouse will be a valuable tool in this area.

Example 2: Imaging cyclic AMP changes in pancreatic islets of transgenic reporter mice [0161] The original cAMP reporter (Zaccolo, M. & Pozzan, T. Science 295, 1711-1715

(2002)) consists of two chimeric proteins, Yellow Fluorescent Protein fused to the Protein Kinase A (PKA) Catalytic subunit (C-YFP) and Cyan Fluorescent Protein fused to the PKA Regulatory II subunit (R-CFP). Close apposition of the subunits produces Fluorescence Resonance Energy Transfer (FRET) that varies with cAMP concentration. We enhanced the efficiency of the reporter by introducing a single mutation in YFP (phenylalanine to leucine at amino acid 46). This F46L variant of YFP matures faster, fluoresces brighter, and we predicted to be a more efficient acceptor for FRET. Indeed, we found that cells transfected with F46L cAMP reporter (Figure 3A) produced an enhanced FRET signal (i.e. emission at 535 nm following excitation at 430 nm) compared with the original reporter (Figure 3B, 3C). [0162] As with most genetically-encoded reporters, a major limitation is that plasmids must be transfected into cells, a process not readily achieved in native tissues in situ. Recently, transgenic mice have been produced that endogenously express functional reporters, e.g. for calcium, synaptic vesicle release and recently, cAMP. We wished to avoid altering the physiological state of tissues by chronically over-expressing reporter proteins that bind and sequester cAMP. Hence, we produced transgenic mice in which the cAMP reporter protein genes are silent until induced by the presence of a reverse tetracycline transactivator (rtTA) and the tetracycline analog, doxycycline (dox) (Figure 3D, 3E and Figure 7). To reveal expression of the fluorescent reporter, we crossed these "pBI-cAMP" transgenic mice separately with two rtTA transactivator mouse strains: (1) CMV -rtTA, with a broadly expressed cytomegalovirus promoter and (2)Ins2-rtTA, with a β-cell specific expression of rtTA.

[0163] In CMV -rtTA / pBI-cAMP double transgenic mice, dox induction resulted in expression of R-CFP and C-YFP in several tissues, including skeletal (Figure 3F) and cardiac (Figure 3G) muscle. The reporter displayed sarcomeric distribution, probably because the R- CFP subunit associates with A-Kinase Anchoring Protein (AKAP) and thereby is attached to transverse tubules. In the pancreas of CMV-rtTA / pBI-cAMP mice, reporter was present only in acinar cells (Figure 3H). In all three tissues, only a subset of cells of any type expressed the reporter proteins, likely a function of the efficiency of the CMV promoter (expressing rtTA). We also observed C-YFP expression in the choroid plexus, and lung. No fluorescence was detected in the absence of dox-induction. We did not characterize these mice further.

[0164] In Ins2-rtTA/pBI-cAMP mice, reporter expression was also dependent on dox and was limited to β-cells in pancreatic islets of Langerhans (Figure 4A). We noted that not all β-cells expressed the reporter. We detected no abnormalities in gross structure or histology of the induced, transgenic pancreas. We then tested whether expression of the cAMP reporter in β-cells interfered with normal pancreatic function. Double transgenic Ins2- rtTA / pBI-cAMP mice were subjected to a glucose tolerance test (GTT) before, and 1 week after, dox-induction. The transient rise of blood glucose and return to resting levels were indistinguishable before and after dox (Figure 4B), and resembled those in normal mice. This result demonstrates that cAMP reporter expression does not adversely affect glucose sensing or insulin secretion in these transgenic mice.

[0165] To assess the glucose sensitivity of β-cells more directly, we isolated and cultured islets from dox-induced Ins2-rtTA /pBI-cAMP mice, loaded the islets with Fura-2, and measured glucose-stimulated changes in intracellular Ca²⁺. Isolated islets responded to glucose with an initial slight decrease in [Ca²⁺Ji, followed by a sharp increase, and subsequent oscillations (Figure 4C). Such Ca²⁺ oscillations are typical of healthy, freshly isolated islets. Further, by measuring Ca²⁺ signals in Regions of Interest (ROIs) in different regions of individual islets, we confirmed that rapid Ca²⁺ oscillations were synchronized throughout induced transgenic islets, as widely reported for wild type islets. These findings verified that there was no gross alteration in the physiology of β-cells from pBI-cAMP double transgenic mice expressing the cAMP reporter.

[0166] We next proceeded to determine whether the reporter monitored intracellular cAMP in the transgenic mice. Pancreatic islets from dox-induced double transgenic mice yielded a FRET signal when excited at 430 nm, and more importantly, showed a change in FRET intensity when intracellular cAMP was elevated experimentally. Perfusing islets with forskolin (10 μM) plus IBMX (100 μM) decreased emission from the yellow fluorophore with no change or a slight increase in emission of the cyan fluorophore (colored traces in Figure 5B). Forskolin and IBMX separately also elicited similar changes of FRET intensity, consistent with the interpretation that changes of intracellular [cAMP] underlie changes in the emission ratio (F470/F535, lower trace Figure 5B).

[0167] Having established that a FRET -based signal monitors [cAMP], we tested responses to glucose. Starting from a resting level of 3 mM glucose, repeated brief applications of 11 mM glucose elicited reproducible cAMP responses with little potentiation or attenuation (Figure 5C). Next, we measured the concentration-response relationship for glucose-evoked cAMP increases (Figure 5D, 5E). The EC₅₀ calculated from these data was 9 mM, consistent with steady state measures of cAMP in glucose-stimulated islets. [0168] We also subjected islets to prolonged elevations of glucose. Extended stimulation with 11 mM glucose elicited a biphasic increase in cAMP: an initial peak was followed by a second, slowly developing plateau (Figure 5F). The cellular resolution afforded by the transgenically expressed cAMP reporter revealed that glucose-evoked Δ[cAMP] was nearly synchronous throughout the islet. This is evident in the individual traces in Figure 5F, and the small s.e.m. in the averaged response (colored trace at bottom, Figure 5F). Interestingly, the biphasic kinetics of the cAMP response to prolonged glucose stimulation resembles the commonly observed biphasic secretion of insulin, including in mice. [0169] Next, we concurrently imaged changes in cAMP and Ca²⁺ by loading islets from transgenic mice with the calcium indicator dye Fura 2, and measuring ΔF470/F535 (for cAMP) and ΔF340/F380 (for Ca²⁺). Our results showed that glucose-stimulated increases in c AMP preceded Ca²⁺ increases. Further, there was no obvious parallel between Ca²⁺ oscillations and cAMP signals (Figure 5G) even though our sampling rate would have detected these. To eliminate the possibility of spectral overlap between the cAMP reporter and Fura-2, we also conducted independent Ca²⁺ and cAMP imaging. In Fura-2-loaded transgenic islets, we confirmed that glucose-stimulated Ca²⁺ influx disappears when Ca²⁺ is removed from the bathing medium (Figure 51). In contrast, glucose-evoked cAMP elevation was unaffected by removing Ca²⁺ from the bath (Figure 5H). Our results, using intact mouse islets, differ from a previous report that the cAMP response to glucose in MIN6 cells is calcium-dependent. The discrepancy may reflect functional cooperation in our intact islet preparation between adjacent β- and non-β cells, relative to cell lines. Taken together, these data indicate that glucose-stimulated influx of Ca²⁺ and elevation of cAMP arise from distinct cellular mechanisms in β-cells.

[0170] Membrane depolarization underlies glucose-stimulated Ca²⁺ influx and insulin secretion in β-cells. To test whether depolarization influences cAMP accumulation, we stimulated islets with 50 mM KCl while imaging cAMP. Whereas KCl elicited reliable and robust Ca²⁺ influx as expected, it did not evoke cAMP responses (data not shown; n=6 islets in 3 experiments).

[0171] In many tissues, prolonged elevation (10' s of min) of cAMP levels causes the dissociated catalytic subunit of PKA to translocate from the cytoplasmic to nuclear compartment where it phosphorylates and activates targets such as CREB, the cAMP Response Element Binding protein. To examine if the YFP-tagged PKA catalytic subunit of the transgenically expressed reporter would exhibit this behavior, we elevated cAMP in islets by incubating them in 25 mM glucose, lOμM Fsk or lOOμM IBMX, all for 30 min. Each of these treatments resulted in a significant increase of YFP-fluorescence within the nucleus (Figure 6A, 6B). The effect was more pronounced with Fsk and IBMX (Figure 4C), in keeping with the higher apparent cAMP accumulation observed in FRET studies using these treatments. The GFP moiety fused to the PKA catalytic subunit did not prevent nuclear translocation in our transgenic model, in contrast to the apparent failure with a different chimeric catalytic subunit tested in transfected β-cells.

[0172] In response to glucose, β-cells in islets exhibit highly synchronized responses of metabolism, membrane voltage and [Ca²⁺Ji which may in turn underlie the finely regulated kinetics of insulin secretion. We show here that glucose-evoked cAMP signals in β-cells in intact islets also exhibit such synchrony and approximately mirror the kinetics of insulin secretion. Biphasic insulin secretion reflects an immediate vesicular release followed by a slower mobilization of reserve insulin granules. Although cAMP clearly potentiates insulin secretion, the mechanism of this interaction is not fully understood. cAMP may stimulate vesicular mobilization or may facilitate insulin secretion via Epac and PKA pathways, or both. Another possible role for glucose-stimulated cAMP is its action on Hyperpolarization- activated cyclic nucleotide-gated (HCN) channels, recently identified in islets and MIN6 cells. By regulating membrane voltage via HCN channels, cAMP may help shape the time course and duration of glucose-evoked bursts of action potentials. The transgenic mice that we describe present an opportunity to dissect these processes with high spatial and temporal resolution.

TABLE 4 Production of pBI-cAMP transgenic mice

Other Embodiments

[0173] It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention. Other aspects, advantages, and modifications are within the scope of the following claims. [0174] All references cited herein, are incorporated herein by reference.

References:

Dyachok O, Isakov Y, Sagetorp J, Tengholm A. 2006 Oscillations of cyclic AMP in hormone-stimulated insulin-secreting beta-cells. Nature 439:349-52.

Evellin S, Mongillo M, Terrin A, Lissandron V, Zaccolo M. 2004. Measuring dynamic changes in cAMP using fluorescence resonance energy transfer. Methods MoI Biol. 284: 259-270.

Gesellchen F, Prinz A, Zimmermann B, Herberg FW. 2006 Quantification of cAMP antagonist action in vitro and in living cells. Eur J Cell Biol. Jul;85(7):663-72.

Kim JW, Roberts C, Maruyama Y, Berg S, Roper S, Chaudhari N. 2006. Faithful Expression of GFP from the PLCβ2 Promoter in a Functional Class of Taste Receptor Cells. Chem Senses 31:213-9.

Nagai T, Ibata K, Park ES, Kubota M, Mikoshiba K, Miyawaki A. 2002. A variant of yellow fluorescent protein with fast and efficient maturation for cell-biological applications. Nat Biotechnol. 20:87-90.

Nikolaev VO, Bunemann M, Hein L, Hannawacker A, Lohse MJ. 2004. Novel single chain cAMP sensor/reporters for receptor-induced signal propagation. J Biol Chem. 279: 37215- 37218.

Zaccolo M, Pozzan T. 2002. Discrete microdomains with high concentration of cAMP in stimulated rat neonatal cardiac myocytes. Science 295: 1711-1715.

Claims

What is claimed:

1. A transgenic non-human animal comprising in its genome an exogenous nucleic acid sequence comprising: a tissue-specific and inducible promoter; a transactivator; a cAMP sensor/reporter; and, a nucleic acid sequence expressing a fluorescent protein.

2. The transgenic non-human animal of claim 1, wherein the cAMP sensor/reporter comprises yellow fluorescent protein fused to protein kinase A catalytic subunit (C-YFP) and cyan fluorescent protein fused to protein kinase regulatory II subunit (R-CFP), variants, fragments and mutants thereof.

3. The transgenic non-human animal of claim 2, wherein the C-YFP unit comprises a Phe-to Leu mutation at amino acid position 46.

4. The transgenic non-human animal of claim 1, wherein the transactivator comprises a reverse tetracycline transactivator (rtTA).

5. The transgenic non-human animal of claim 1, wherein the mouse exhibits a phenotype characterized by expression of the cAMP sensor/reporter in response to an inducer.

6. The transgenic non-human animal of claim 1, wherein the animal is murine.

7. An isolated cell of the transgenic non-human animal of claim 1, wherein the cell comprises: a tissue-specific and inducible promoter; a transactivator; a cAMP sensor/reporter; and, a nucleic acid sequence expressing a fluorescent protein.

8. The isolated cell of claim 7, wherein the cells express cAMP sensor/reporter and fluorescent protein.

9. An isolated mammalian cell comprising in its genome an exogenous nucleic acid sequence comprising: a tissue-specific and inducible promoter; a transactivator; a cAMP sensor/reporter; and, a nucleic acid sequence expressing a fluorescent protein.

10. The isolated mammalian of claim 9, wherein the cell is selected from a germ cell or a somatic cell.

11. The isolated mammalian cell of claim 9, wherein the mammal is murine.

12. A vector comprising : a nucleic acid expressing a tissue-specific and inducible promoter; a nucleic acid expressing a transactivator; a nucleic acid expressing a cAMP sensor/reporter; and, a nucleic acid sequence expressing a fluorescent protein.

13. The vector of claim 12, wherein the nucleic acid expressing the cAMP sensor/reporter comprises a mutation expressing a Phe-to Leu mutation at amino acid position 46.

14. The vector of claim 13, wherein said vector is administered to pronuclei of fertilized mammalian egg cells.

15. The vector of claim 12, wherein expression of nucleic acid sequences are induced in a transgenic animal by addition of an inducer molecule.

16. A method of expressing a cAMP reporter in a transgenic animal comprising: a vector comprising: a tissue-specific and inducible promoter; a cAMP sensor/reporter; and, a nucleic acid sequence expressing a fluorescent protein; administering the vector to pronuclei of fertilized mammalian egg cells; and, implanting said egg into a female mouse under conditions suitable for gestation of a transgenic mouse; identifying a transgenic mouse exhibiting a tissue specific cAMP sensor/reporter; and, inducing expression of the cAMP reporter by administering an inducer to the transgenic animal; and, measuring temporal and spatial distribution of cAMP, and expression of the cAMP by expression of the fluorescent protein.

17. The method of claim 16, wherein the vector is a bi-directional vector.

18. A method of identifying candidate therapeutic agents comprising: administering to a transgenic mouse whose genome comprises a tissue-specific and inducible promoter; a transactivator; a cAMP sensor/reporter; and, a nucleic acid sequence expressing a fluorescent protein, a candidate compound; and, determining the effect of the compound by the expression of the cAMP sensor/reporter.

19. The method of claim 18, wherein the effect of a compound is determined by mmeeaassuurriinngg:: iinnttrraacceelllluullaarr ccyycclliicc AAMMPP ((ccAAMMPP)),, CCaa²²⁺⁺ lleevveellss aannd profiles thereof, temporal and spatial distribution of cAMP and membrane depolarization.