WO2008065544A2 - Prédicteurs génétiques d'un risque de diabète sucré de type 2 - Google Patents

Prédicteurs génétiques d'un risque de diabète sucré de type 2 Download PDF

Info

Publication number
WO2008065544A2
WO2008065544A2 PCT/IB2007/004361 IB2007004361W WO2008065544A2 WO 2008065544 A2 WO2008065544 A2 WO 2008065544A2 IB 2007004361 W IB2007004361 W IB 2007004361W WO 2008065544 A2 WO2008065544 A2 WO 2008065544A2
Authority
WO
WIPO (PCT)
Prior art keywords
seq
snp
t2dm
gene
sample
Prior art date
Application number
PCT/IB2007/004361
Other languages
English (en)
Other versions
WO2008065544A3 (fr
Inventor
Constantin Polychronakos
Rob Sladek
Philippe Froguel
Original Assignee
Mcgill University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Mcgill University filed Critical Mcgill University
Publication of WO2008065544A2 publication Critical patent/WO2008065544A2/fr
Publication of WO2008065544A3 publication Critical patent/WO2008065544A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/136—Screening for pharmacological compounds
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/172—Haplotypes

Definitions

  • Type 2 diabetes mellitus is the most common metabolic disease and a major cause of morbidity and mortality. Its rapidly increasing prevalence is thought to be due to environmental factors (increased availability of food and decreased opportunity /motivation for physical activity), acting on a substrate of genetic susceptibility. The latter must be important, as the heritability T2DM is one of the highest among common multifactorial diseases (reviewed in Permutt et al., 2005). Except for rare monogenic forms, (Maturity onset of the Young (MODY), neonatal and mitochondrial diabetes) it is clear that in the majority of cases this genetic susceptibility is a complex genetic trait, dependent on multiple loci. Knowledge of these loci is expected to permit early, presymptomatic detection of the disease and, possibly, to identify subtypes among phenotypically identical cases that may respond differentially to specific treatments.
  • T2DM susceptibility is a complex genetic trait, dependent on multiple loci, most of which remain to be defined.
  • the present invention relates to a method of assessing or aiding in assessing whether an individual (e.g., a human) is at risk for developing Type 2 diabetes mellitus (T2DM), in which a (at least one, one or more) single nucleotide polymorphism (SNP) that is associated with T2DM (or a complement thereof/a complement of a SNP that is associated with T2DM) is used to analyze a sample (e.g., tissue, cells or cell components that contain genetic material) obtained from the individual for genetic material associated with T2DM.
  • a SNP associated with T2DM (also referred to as a T2DM-associated SNP) is a SNP that has one allele with higher frequency in individuals with T2DM than in the general population.
  • the risk allele of a SNP associated with T2DM is the allele that occurs more often (is more commonly present) in individuals with T2DM than in individuals who do not have T2DM. If the sample obtained from an individual being assessed for his/her risk of developing T2DM includes (contains) the risk allele of the T2DM associated SNP, then the individual is more likely to develop T2DM than an individual in whom the risk allele is not present.
  • a SNP associated with T2DM (also referred to as a SNP associated with a gene associated with T2DM) can be located within (contained in) the gene associated with T2DM, such as in the transcribed region of the gene associated with T2DM; in the coding region of the gene associated with T2DM; in a non coding region of the gene associated with T2DM; in an intergenic region of the gene associated with T2DM; or in two regions (overlaps at least part of two regions) of the gene associated with T2DM.
  • the SNP associated with T2DM can also be located outside (not contained in) the gene associated with T2DM, provided, for example, that it is located in such a manner that its detection is useful to identify an individual as having the gene associated with T2DM.
  • the method of the present invention can be carried out to determine the occurrence (presence or absence) of a SNP (at least one SNP, one or more SNPs) associated with T2DM in a sample obtained from an individual, such as the occurrence of the risk allele of a SNP associated with T2DM.
  • a particular individual's risk can be determined by assessing the risk allele or combination of risk alleles of T2DM-associated SNPs.
  • Samples which can be analyzed using the methods and compositions of the present invention can be any sample, obtained from an individual, that comprises genetic material that can be analyzed for one or more SNPs associated with T2DM or products (e.g., proteins, polypeptides, peptides) encoded by such genetic material.
  • Samples that can be used include, but are not limited to, blood or components thereof, bone marrow, tissues/organs and cells obtained from tissues/organs and body fluids (e.g., lymph, semen, saliva). Samples can be obtained from any individual in need of assessment, such as a human and other nonhuman mammals.
  • the method of assessing or aiding in assessing an individual's risk of developing T2DM of this invention can be carried out by analyzing a sample for as few as one SNP associated with T2DM or by analyzing a sample for a group or collection of two or more SNPs associated with T2DM. Techniques known to those in the art for detecting nucleic acids in a sample can be used to analyze a sample for T2DM associated SNP(s).
  • These techniques include, for example, hybridization techniques in which genetic material (e.g., DNA or RNA), as obtained from the sample or obtained and amplified (amplified DNA, RNA), is used.
  • genetic material e.g., DNA or RNA
  • amplified DNA, RNA amplified DNA, RNA
  • products polypeptides, which includes proteins and peptides
  • polypeptides which includes proteins and peptides
  • T2DM can be detected in a sample obtained from an individual to be assessed for his/her risk of developing T2DM.
  • the presence of a polypeptide encoded by DNA comprising the risk allele of a SNP associated T2DM indicates that the individual is at risk of developing T2DM.
  • Proteins encoded by DNA comprising a SNP associated with T2DM can be assessed for their function or activity and compared with the function or activity of a reference protein, which can be a protein encoded by corresponding wild type DNA or a protein encoded by DNA comprising a SNP associated with T2DM, which is not the risk allele.
  • a difference in function or activity between a protein encoded by DNA comprising the risk allele of a SNP associated with T2DM and a reference protein can be assessed for its effects on contribution to T2DM.
  • isolated nucleic acids comprising a SNP associated with T2DM or the complement of such a SNP, such as a SNP that is associated with a gene associated with T2DM.
  • genes include, but are not limited to, CAMTAl, TTC13, RYR2, CXCR4, DARS (also referred to herein as CXCR4/DARS), SLC6A20, VPS 13 A, FAM69B, HHEX (also referred to herein as HHEX/IDE), TCF7L2, MMP26, EXT2, NLGN2, LDLR, ZNF649, ZNF613, ZNF350, ZNF615, FLJ90680, FLJ27365, MXRA5, SLC44A3, LOC642123, RAFTLIN, TSPAN5, DB127798, SLC30A8, LOC387761, ALX4, KIRREL3, BTGl, PYY, CR592664, NEUROG3, RYR2, FGF5, TCF2, WNT8B, LRRC59, NR5A2, ICAl and PEX26.
  • the isolated nucleic acid comprise SNP associated with T2DM, or the complement of such a SNP, wherein the SNP is at least one SNP associated with a gene that is associated with T2DM, such as a gene selected from the group consisting of TCF7L2, SLC30A8, HHEX (also referred to as HHEX/IDE), TCF2, CXCR4, DARS (also referred to as CXCR4/DARS), ALX4, CAMTAl, EXT2, FGF5, KIRREL3, LDLR, LOC387761, LRRC59, MMP26, NLGN2, NR5A2, PEX26,
  • a gene that is associated with T2DM such as a gene selected from the group consisting of TCF7L2, SLC30A8, HHEX (also referred to as HHEX/IDE), TCF2, CXCR4, DARS (also referred to as CXCR4/DARS), ALX4, CAMTAl, EXT2, FGF5, KIRREL3,
  • the isolated nucleic acid comprises a SNP associated with T2DM, or the complement of such a SNP, wherein the SNP is associated with a gene that is associated with T2DM, such as a gene selected from the group consisting of TCF7L2, SLC30A8, HHEX (also referred to as HHEX/IDE) and TCF2.
  • the invention encompasses isolated nucleic acid that hybridizes to nucleic acid that comprises a SNP associated with T2DM, such as siRNA, nucleic acids (DNA, RNA) that are useful as probes (e.g., allele-specific probes) for analyzing samples and primers for amplification methods.
  • a SNP associated with T2DM such as siRNA
  • nucleic acids DNA, RNA
  • probes e.g., allele-specific probes
  • Such isolated nucleic acid comprises DNA or RNA that hybridizes to a SNP associated with a gene such as, but not limited to, CAMTAl , TTC 13, RYR2, CXCR4, DARS, SLC6A20, VPS 13 A, FAM69B, HHEX, TCF7L2, MMP26, EXT2, NLGN2, LDLR, ZNF649, ZNF613, ZNF350, ZNF615, FLJ90680, FLJ27365, MXRA5, SLC44A3, LOC642123, RAFTLIN, TSPAN5, DB127798, SLC30A8, LOC387761, ALX4, KIRREL3, BTGl, PYY, CR592664, NEUROG3, RYR2, FGF5, TCF2, WNT8B, LRRC59, NR5A2, ICAl and PEX26.
  • a gene such as, but not limited to, CAMTAl , TTC 13, RYR2, CXCR4, DARS,
  • isolated nucleic acid hybridizes to a SNP associated with a gene such as, but not limited to, TCF7L2, SLC30A8, HHEX, TCF2, CXCR4/DARS, ALX4, CAMTAl, EXT2, FGF5, KIRREL3, LDLR, LOC387761, LRRC59, MMP26, NLGN2, NR5A2, PEX26, RAFTLIN and ZNF649 and, in further specific embodiments, one of the following genes: TCF7L2, SLC30A8, HHEX and TCF2.
  • the isolated nucleic acids such as those used as probes or primers, can be conjugated to a detectable marker.
  • Detectable markers include, for example, fluorescent markers, such as fluorescent proteins (e.g., green fluorescent protein, red fluorescent protein, yellow fluorescent protein, blue fluorescent protein), radioactive labels, enzymatic labels, antibodies, a member of a ligand binding pair (e.g., biotin or avidin).
  • fluorescent markers such as fluorescent proteins (e.g., green fluorescent protein, red fluorescent protein, yellow fluorescent protein, blue fluorescent protein), radioactive labels, enzymatic labels, antibodies, a member of a ligand binding pair (e.g., biotin or avidin).
  • the isolated nucleic acids can be of any size appropriate for an intended use, such as any size from a few bases up to and including the whole genome.
  • inventions include an isolated polypeptide encoded by a nucleic acid comprising a SNP associated with T2DM, such as an isolated polypeptide encoded by a nucleic acid comprising a SNP that is associated with a gene selected from the group consisting of CAMTAl, TTC 13, RYR2, CXCR4, DARS, SLC6A20, VPS 13 A, FAM69B, HHEX, TCF7L2, MMP26, EXT2, NLGN2, LDLR, ZNF649, ZNF613, ZNF350, ZNF615, FLJ90680, FLJ27365, MXRA5, SLC44A3, LOC642123, RAFTLIN, TSPAN5, DB127798, SLC30A8, LOC387761, ALX4, KIRREL3, BTGl, PYY, CR592664, NEUROG3, RYR2, FGF5, TCF2, WNT8B, LRRC59, NR5A2, ICAl, PEX26 and other T
  • Antibodies that bind to a polypeptide encoded by a nucleic acid comprising a SNP associated with T2DM and particularly antibodies that bind preferentially or bind specifically (only) to a polypeptide encoded by a nucleic acid comprising a SNP associated with T2DM are also described. Such antibodies can be made using methods known to those of skill in the art and nucleic acids described herein and can be polyclonal or monoclonal. Of particular interest are mammalian antibodies, such as mouse, human or chimeric (e.g., mouse/human, chimeric, humanized) polyclonal or monoclonal antibodies and fragments thereof.
  • a further embodiment is a kit for assessing or aiding in assessing whether an individual is at risk for developing T2DM.
  • a kit comprises a (at least one, one or more) SNP associated with T2DM (or a complement of the SNP) or nucleic acid (DNA, RNA) comprising a SNP associated with T2DM (or a complement of such a nucleic acid) and, optionally, materials (reagents) for analyzing samples for the alleles of one or more SNPs associated with T2DM, using a method such as sequencing, restriction digestion at polymorphic sites, allele-specific amplification, allele-specific hybridization, allele-specific primer extension, allele-specific ligation or mass spectrometry.
  • kits include a risk allele of a SNP associated with T2DM or the complement thereof.
  • the kit comprises at least one SNP or at least one nucleic acid comprising a SNP associated with a gene associated with T2DM, such as CAMTAl 5 TTC13, RYR2, CXCR4, DARS 5 SLC6A20, VPS13A, FAM69B, HHEX, TCF7L2, MMP26, EXT2, NLGN2, LDLR, ZNF649, ZNF613,
  • the kit comprises at least one SNP associated with a gene associated with T2DM, such as one of the following: TCF7L2, SLC30A8, HHEX, TCF2, CXCR4/DARS, ALX4, CAMTAl, EXT2, FGF5, KIRREL3, LDLR, LOC387761, LRRC59, MMP26, NLGN2, NR5A2, PEX26, RAFTLIN and ZNF649 and, in further specific embodiments, at least one SNP associated with one of the following genes: TCF7L2, SLC30A8, HHEX and TCF2.
  • the kit comprises nucleic acid (DNA, RNA) that hybridizes to (is complementary to) a SNP described herein.
  • a kit comprises at least two SNPs, each associated with a different gene, such as, but not limited to, one of the following: CAMTAl, TTC 13, RYR2, CXCR4, DARS, SLC6A20, VPS 13 A, FAM69B, HHEX, TCF7L2, MMP26, EXT2, NLGN2, LDLR, ZNF649, ZNF613, ZNF350, ZNF615, FLJ90680, FLJ27365, MXRA5, SLC44A3, LOC642123, RAFTLIN, TSP AN5, DB127798, SLC30A8, LOC387761, ALX4, KIRREL3, BTGl, PYY, CR592664, NEUROG3, RYR2, FGF5, TCF2, WNT8B, LRRC59, NR5A2, ICAl and PEX26 or at least two nucleic acids that each comprise a SNP associated with a different gene, such as, but not limited to, one
  • a kit comprises at least two SNPs, each associated with a different gene, such as one of the following: TCF7L2, SLC30A8, HHEX, TCF2, CXCR4/DARS, ALX4, CAMTAl, EXT2, FGF5, KIRREL3, LDLR, LOC387761, LRRC59, MMP26, NLGN2, NR5A2, PEX26, RAFTLIN and ZNF649 and, in further specific embodiments, one of the following genes: TCF7L2, SLC30A8, HHEX and TCF2 or at least two nucleic acids that each comprise a SNP associated with a different gene selected from the group consisting of TCF7L2, SLC30A8, HHEX, TCF2, CXCR4/DARS, ALX4, CAMTAl, EXT2, FGF5, KIRREL3, LDLR, LOC387761, LRRC59, M
  • the kit can include one copy of each SNP associated with a specific gene associated with T2DM or a complement of the SNP.
  • the kit can include multiple copies of each SNP associated with a specific gene or of a complement of the SNP.
  • a kit can further, or alternatively, comprise a complement of any SNP described herein or nucleic acid (DNA, RNA) that is a complement of any SNP described herein.
  • a sample obtained from an individual (e.g., a human) to be assessed for the risk of developing T2DM is analyzed for a SNP that is associated with T2DM; if the risk allele of the SNP associated with T2DM is present in the sample, the individual is (is identified as being) at risk for developing T2DM.
  • the sample is analyzed for two or more SNPs, each of which is associated with T2DM; if the risk allele for at least one of the T2DM associated SNPs is present in the sample, the individual is at risk for developing T2DM.
  • nucleic acid that is a SNP associated with T2DM can be detected through the use of the SNP, the complement of the SNP, DNA or RNA that comprises the complement of the SNP or a combination of the foregoing.
  • the SNP is associated, for example, with a gene selected from the group consisting of CAMTAl, TTC13, RYR2, CXCR4, DARS, SLC6 A20, VPS 13 A, FAM69B, HHEX, TCF7L2, MMP26, EXT2, NLGN2, LDLR, ZNF649, ZNF613, ZNF350, ZNF615, FLJ90680, FLJ27365, MXRA5, SLC44A3, LOC642123, RAFTLIN, TSP AN5, DB127798, SLC30A8, LOC387761, ALX4, KIRREL3, BTGl, PYY, CR592664, NEUR0G3, RYR2, FGF5, TCF2, WNT8B, LRRC59, NR5A2, ICAl and PEX26.
  • the SNP is associated with a gene selected from the group consisting of TCF7L2,
  • At least two SNPs associated with T2DM are identified in a sample, such as two or more SNPs, each associated with a different gene, such as, but not limited to one of the following: CAMTAl, TTC13, RYR2, CXCR4, DARS, SLC6A20, VPS13A, FAM69B, HHEX, TCF7L2, MMP26, EXT2, NLGN2, LDLR, ZNF649, ZNF613, ZNF350, ZNF615, FLJ90680, FLJ27365, MXRA5, SLC44A3, LOC642123, RAFTLIN, TSPAN5, DB127798, SLC30A8, LOC387761, ALX4, KIRREL3, BTGl, PYY,
  • each of the two or more SNPs is associated with a different gene, such as but not limited to, one of the following: TCF7L2, SLC30A8, HHEX, TCF2, CXCR4/DARS, ALX4, CAMTAl, EXT2, FGF5, KIRREL3, LDLR, LOC387761 , LRRC59, MMP26, NLGN2, NR5A2, PEX26,
  • each of the two or more SNPs is associated with one of the following genes: TCF7L2, SLC30A8, HHEX and TCF2.
  • the sample is analyzed for at least one SNP that is associated with TCF7L2 and at least one additional SNP, such as any SNP described herein including at least one SNP that is associated with a gene selected from the group consisting of CAMTAl, TTC13, RYR2, CXCR4, DARS, SLC6A20, VPS13A, FAM69B, HHEX, MMP26, EXT2, NLGN2, LDLR, ZNF649, ZNF613, ZNF350, ZNF615, FLJ90680, FLJ27365, MXRA5, SLC44A3, LOC642123, RAFTLIN, TSP AN5, DB127798, SLC30A8, LOC387761, ALX4, KIRREL3, BTGl, PYY, CR592664, NEUROG3, RYR2, FGF5, TCF2, WNT8B, LRRC59, NR5A2, ICAl and PEX26.
  • a gene selected from the group consisting of CAM
  • the sample is analyzed for at least one SNP that is associated with TCF7L2 and at least one SNP associated with a gene selected from the group consisting of SLC30A8, HHEX, TCF2, CXCR4/DARS, ALX4, CAMTAl, EXT2, FGF5, KIRREL3, LDLR, LOC387761, LRRC59, MMP26, NLGN2, NR5A2, PEX26, RAFTLIN and ZNF649.
  • the sample is analyzed for at least one SNP that is associated with TCF7L2 and at least one SNP associated with SLC30A8, HHEX or TCF2.
  • the sample is analyzed for at least one SNP that is associated with PYY and at least one SNP that is associated with a gene selected from the group consisting of CAMTAl, TTC13, RYR2, CXCR4, DARS, SLC6A20, VPS 13 A, FAM69B, HHEX, TCF7L2, MMP26, EXT2, NLGN2, LDLR, ZNF649, ZNF613, ZNF350, ZNF615, FLJ90680, FLJ27365, MXRA5, SLC44A3, LOC642123, RAFTLIN, TSP AN5, DB127798, SLC30A8, LOC387761, ALX4, KIRREL3, BTGl, CR592664, NEUROG3, RYR2, FGF5, TCF2, WNT8B, LRRC59, NR5A2, ICAl and PEX26.
  • a gene selected from the group consisting of CAMTAl, TTC13, RYR2, CXCR4, DARS
  • the sample is analyzed for at least one SNP that is associated with NEUROG3 and at least one SNP that is associated with a gene selected from the group consisting of CAMTAl , TTCl 3, RYR2, CXCR4, DARS, SLC6A20, VPS 13 A, FAM69B, HHEX, TCF7L2, MMP26, EXT2, NLGN2, LDLR, ZNF649, ZNF613, ZNF350, ZNF615, FLJ90680, FLJ27365, MXRA5, SLC44A3, LOC642123, RAFTLIN, TSPAN5, DB127798, SLC30A8, LOC387761, ALX4, KIRREL3, BTGl, CR592664, RYR2, FGF5, TCF2, WNT8B, LRRC59, NR5A2, ICAl and PEX26.
  • a gene selected from the group consisting of CAMTAl , TTCl 3, RYR2, CXCR4, DARS, S
  • a sample obtained from an individual to be assessed for the risk of developing T2DM is analyzed for a SNP that is associated with T2DM, wherein the (at least one) SNP is associated with a gene selected from the group consisting of SLC30A8, FGF5, CXCR4, HHEX, RYR2, DARS, LDLR, TCF2, ALX4, CAMTAl, EXT2, KIRREL3, LOC387761, LRRC59, NLGN2, NR5A2, PEX26, RAFTLIN, and ZNF649.
  • the sample is analyzed for at least one SNP that is associated with SLC30A8; at least one SNP that is associated with FGF5; at least one SNP that is associated with CXCR4; at least one SNP that is associated with HHEX; at least one SNP that is associated with RYR2; or at least one SNP that is associated with DARS; at least one SNP that is associated with LDLR; at least one SNP that is associated with TCF2; at least one SNP that is associated with ALX4; at least one SNP that is associated with CAMTA; at least one SNP that is associated with EXT2; at least one SNP that is associated with KIRREL3; at least one SNP that is associated with LOC387761; at least one SNP that is associated with LRRC59; at least one SNP that is associated with NLGN2; at
  • Additional embodiments are methods for assessing or aiding in assessing whether an individual is at risk for developing T2DM comprising analyzing a sample obtained from the individual for a SNP or a group of two or more SNPs selected from the group consisting of any of the SNP sequences included herein, such as any one of SEQ. ID No 1-871, wherein if the risk allele of the SNP or the risk allele of one or more of the SNPs is present in the biological sample, the individual is at risk for developing T2DM.
  • one embodiment is a method for assessing or aiding in assessing whether an individual is at risk for developing T2DM comprising (a) obtaining a sample from the individual; (b) isolating nucleic acid from the biological sample; and (c) analyzing the nucleic acid for at least one SNP that is associated with T2DM, wherein if the risk allele of the at least one SNP is present in the biological sample, the individual is at risk for developing T2DM.
  • This embodiment of the method can comprise sequencing the nucleic acid(s).
  • Analyzing the nucleic acid in (c) can be carried out by means of a hybridization step, which can be carried out in a wide variety of formats, such as in solution or on a surface to which at least one nucleic acid useful in the analysis is affixed.
  • the surface can be, for example, flat or curved and can be, for example, a microarray on a flat or curved surface, such as a chip or a bead.
  • the surface can be glass, plastic or other synthetic material, silicon, or a metal, such as gold and derivatized forms of these substrates.
  • Nucleic acid analyzed can be nucleic acid (DNA, RNA) as obtained from the sample obtained from an individual or can be amplified (e.g., amplified DNA).
  • the method can optionally include an amplification step, in which DNA from the sample is amplified using methods known to those of skill in the art, such as the polymerase chain reaction (PCR).
  • PCR polymerase chain reaction
  • an individual's risk of developing T2DM can also be assessed by a method in which a sample obtained from an individual is analyzed for a polypeptide encoded by a nucleic acid comprising at least one SNP associated with T2DM, such as a polypeptide encoded by a nucleic acid comprising at least one SNP located in the gene associated with T2DM (e.g., a polypeptide encoded by a nucleic acid comprising at least one SNP located in a coding region of the gene associated with T2DM; a polypeptide encoded by a nucleic acid comprising at least one SNP located in the transcribed region of the gene associated with T2DM; a polypeptide encoded by a nucleic acid comprising at least one SNP located in the non coding region of the gene associated with T2DM or a polypeptide encoded by a nucleic acid comprising at least one SNP located in an intergenic region of the gene associated with T2DM).
  • the method is a method for assessing or aiding in assessing whether an individual is at risk for developing T2DM comprising: analyzing a sample obtained from the individual for a polypeptide encoded by a nucleic acid comprising at least one SNP associated with T2DM, wherein if the polypeptide is encoded by a nucleic acid comprising the risk allele of the SNP associated with T2DM, the individual is at risk for developing T2DM.
  • the method for assessing or aiding in assessing whether an individual is at risk for developing T2DM comprises analyzing a sample obtained from the individual for a polypeptide encoded by a nucleic acid comprising at least one SNP associated with T2DM (e.g., a polypeptide encoded by a nucleic acid comprising at least one SNP located in a coding region of a gene associated with T2DM), wherein analyzing comprises comparing the polypeptide to a polypeptide encoded by the allele of the same gene that does not predispose an individual to T2DM and determining if the polypeptides perform differently (e.g., exhibit different functions and/or activity).
  • a polypeptide encoded by a nucleic acid comprising at least one SNP associated with T2DM e.g., a polypeptide encoded by a nucleic acid comprising at least one SNP located in a coding region of a gene associated with T2DM
  • analyzing comprises comparing the polypeptide to
  • the assay can be, for example, an enzymatic assay or an antibody binding assay (e.g. ELISA or other antibody-based assay).
  • a method of the present invention can further comprise performing a fasting plasma glucose test on the individual; performing an oral glucose tolerance test on the individual; determining the fasting serum insulin level of the individual; determining serum C-peptide levels of the individual and any combination thereof.
  • a method of screening for a therapeutic agent for use in treating T2DM, comprising contacting an agent with a polypeptide encoded by nucleic acid (DNA, RNA) comprising a SNP that is associated with T2DM, and particularly by nucleic acid comprising the risk allele of a SNP associated with T2DM, and determining whether the agent binds to the polypeptide, wherein if the agent binds to the polypeptide, the agent is a candidate therapeutic for treatment of T2DM.
  • the SNP associated with T2DM is located in the coding region of a gene associated with T2DM.
  • a further embodiment is a method of assessing or aiding in assessing whether an individual with or at risk of developing T2DM will be responsive to treatment for T2DM, comprising: determining a genotype of the individual, wherein the genotype is defined by at least one SNP selected from the group consisting of: SEQ. ID No 1-871, wherein the genotype is indicative of responsiveness to treatment for T2DM.
  • the genotype is defined by at least one SNP associated with a gene associated with T2DM, wherein the gene is selected from the group consisting of CAMTAl, TTC 13, RYR2, CXCR4, DARS, SLC6A20, VPS 13 A, FAM69B, HHEX, TCF7L2, MMP26, EXT2, NLGN2, LDLR, ZNF649, ZNF613, ZNF350, ZNF615, FLJ90680, FLJ27365, MXRA5, SLC44A3, LOC642123, RAFTLIN, TSP AN5, DB127798, SLC30A8, LOC387761, ALX4, KIRREL3, BTGl, CR592664, RYR2, FGF5, TCF2, WNT8B, LRRC59, NR5A2, ICAl and PEX26.
  • the gene is selected from the group consisting of CAMTAl, TTC 13, RYR2, CXCR4, DARS, SLC6A20, VPS 13
  • the genotype is determined as to one or more SNPs and then compared with the genotype of individuals known to respond to the treatment. If the genotype of an individual to be assessed (test individual) is substantially the same as that of individuals known to respond to the treatment, it is likely that the individual to be assessed will also respond to the treatment, which can be administered to the test individual and its effects determined.
  • the SNP or SNPs determined for an individual can be one or more SNPs, each of which is associated with a gene associated with T2DM, such as a gene selected from the group consisting of CAMTAl, TTC13, RYR2, CXCR4, DARS, SLC6A20, VPS13A, FAM69B, HHEX, TCF7L2, MMP26, EXT2, NLGN2, LDLR, ZNF649, ZNF613, ZNF350, ZNF615, FLJ90680, FLJ27365, MXRA5, SLC44A3, LOC642123, RAFTLIN, TSP AN5, DB127798, SLC30A8, LOC387761, ALX4, KIRREL3, BTGl, PYY, CR592664, NEUROG3, RYR2, FGF5, TCF2, WNT8B, LRRC59, NR5A2, ICAl and PEX26.
  • T2DM such as a gene selected from the group consisting of
  • the SNP(s) is/are associated with a gene selected from the group consisting of SLC30A8, FGF5, CXCR4, HHEX, RYR2, DARS and LDLR.
  • each SNP is associated with a gene selected from the group consisting of TCF7L2, SLC30A8, HHEX, TCF2, CXCR4/DARS, ALX4, CAMTAl, EXT2, FGF5, KIRREL3, LDLR, LOC387761, LRRC59, MMP26, NLGN2, NR5A2, PEX26, RAFTLIN and ZNF649 and, in further specific embodiments, is associated with one of the following genes: TCF7L2, SLC30A8, HHEX and TCF2.
  • the microarray comprises at least one SNP associated with T2DM, such as at least one SNP selected from the group consisting of SEQ ID NO 1-871.
  • the microarray comprises at least one SNP associated with a gene selected from the group consisting of: CAMTAl, TTCl 3, RYR2, CXCR4, DARS, SLC6A20, VPS 13 A, FAM69B, HHEX, TCF7L2, MMP26, EXT2, NLGN2, LDLR, ZNF649, ZNF613, ZNF350, ZNF615, FLJ90680, FLJ27365, MXRA5, SLC44A3, LOC642123, RAFTLIN, TSPAN5, DB127798, SLC30A8, LOC387761, ALX4, KIRREL3, BTGl, PYY, CR592664, NEUROG3, RYR2, FGF5, TCF2, WNT8B, LRRC59, NR5A2, ICAl
  • the microarray comprises at least one SNP associated with a gene selected from the group consisting of SLC30A8, FGF5, CXCR4, HHEX, RYR2, DARS and LDLR. In specific embodiments, the microarray comprises at least one SNP associated with a gene selected from the group consisting of TCF7L2, SLC30A8, HHEX, TCF2,
  • a microarray will comprise a group of two or more SNP, two or more nucleic acids (e.g., DNA, RNA), each comprising a SNP described herein or nucleic acid that hybridizes to a SNP described herein, such as nucleic acid that is complementary to a T2DM - associated SNP or nucleic acid comprising nucleic acid complementary to a T2DM - associated SNP.
  • the nucleic acid is DNA.
  • This invention pertains to genetic tests and methods of diagnosis of type 2 diabetes mellitus (methods of assessing or aiding in assessing the likelihood an individual will develop/whether an individual is at risk for developing T2DM), as well as to methods of screening for a therapeutic agent, methods of assessing or aiding in assessing whether an individual with or at risk of developing T2DM will be responsive to treatment for T2DM, and reagents, kits and microarrays useful in the methods.
  • T2DM susceptibility loci In order to identify T2DM susceptibility loci, Applicants have performed a two- stage, genome- wide association study (GWS) using high-density SNP -based assays. In the study of -400K variants, Applicants identified 76 SNPs that represent T2DM susceptibility loci based on stringent statistical criteria. In addition, Applicants identified more than 800 SNPs that showed a linkage disequilibrium with r 2 > 0.5 based on data released in build 21 of the International Haplotype Map Project. The work described herein has resulted in localization of disease (T2DM) associated to a particular defined LD (linkage disequilibrium) block.
  • T2DM localization of disease
  • LD linkage disequilibrium
  • T2DM-associated markers that are useful as predictors of T2DM in individuals (useful to assess or aid in assessing whether an individual is at risk for developing T2DM).
  • T2DM-associated SNPs polymorphisms/SNPs
  • one of ordinary skill in the art can resequence the region in samples (cases and/or controls) in order to identify/discover additional T2DM- associated polymorphisms (SNPs).
  • SNPs can be shown to be T2DM -associated SNPs by genotyping any new SNP in a small number of DNA samples (cases, controls or both).
  • a person of skill in the art can further assess the SNP for its role/use as a proxy or equivalent of a SNP identified herein (e.g., with reference to one of several statistical indicators, such as r 2 value).
  • Such SNPs can be used as predictors of T2DM and possibly, better predictors of T2DM than SNPs identified herein.
  • Additional markers T2DM-associated SNPs
  • Fine mapping consists of genotyping additional polymorphisms in a large cohort of cases and controls, defining the most highly associated marker, and then determining whether other markers contribute additional effect by conditional regression analysis, using any of a number of publicly available software packages.
  • Additional markers e.g., SNPs identified within an LD block described herein (e.g., SNPs whose nearest gene is a gene for which a SNP is identified herein) are considered to be equivalents or obvious variants of the marker(s) (T2DM-associated SNP(s)) described herein. See Supplemental Tables 2 and 3. They are expected to be useful as additional or substitute SNPs or markers in Applicants' methods, kits and microarrays.
  • rs 10823406 located in proximity to the diabetes-associated locus NEUROG3 (Jackson et al., 2004).
  • the work described herein resulted in the identification of several candidate susceptibility loci that are co-localized with genes implicated in the response to pancreatic injury (CXCR4), in pancreatic development (HHEX), and in ⁇ - cell homeostasis (SLC30A8, FGF5 and RYR2).
  • the candidate loci include a non- synonymous SNP (rsl978717) located in ZNF615, as well as 5 additional SNPs situated in a cluster of C2H2-zinc finger transcription factors located on chromosome 19.
  • the invention also identified non-synonymous coding polymorphisms in SLC30A8 (rsl3266634), a ⁇ -cell-specific zinc transporter (Chimienti et al., 2004); in MMP26 (rs2499953), a matrix metalloproteinase which is a potential target of wnt/ ⁇ -catenin (Marchenko et al., 2002); and in FAM69B (rs945384), a protein of unknown function.
  • T2DM-associated SNPs were also found in the introns of RAFTLIN ( ⁇ s 1262927), a protein associated with peptide hormone signalling (Saeki et al., 2003); in EXT2 a transmembrane endoplasmic reticulum glycoprotein that has been previously linked to T2DM risk (Salonen et al., 2006); in ALX4(rs7949067), a homeodomain protein linked to the function of T-cell transcription factors and wnt signalling (Boras et al, 2002); in VPSlSA (rs2050831), a protein associated with vacuolar and endosomal transport that has been shown to cause choreoacanthocytosis (Rampoldi et al., 2001) (Ueno et al., 2001); in SLC6A20 (rsl3064991), an imino transporter (Takanaga et al., 2005), and in SLC44A3 (r
  • T2DM-associated SNPs in proximity to PEX26 (rsl0483096), a gene implicated in Zellweger Syndrome and other disorders of peroxisomal biogenesis (Matsumoto et al., 2003); as well as BTGl (rs35666), a growth-regulatory protein and transcriptional coactivator involved in TCF signalling (Busson et al., 2005) that promotes apoptosis (Lee et al, 2003).
  • rs932206 lies adjacent to CXCR4 (involved in pancreatic regeneration (Kayali, 2003)) and DARS, an amino acid synthase that was downregulated in rat INS832/13 cells exposed to glucolipotoxic stimuli.
  • T2DM susceptibility loci can be used for early, presymptomatic detection of the disease and possibly identification of subtypes among phenotypically identical cases that may respond differentially to specific treatments.
  • the association with rsl 111875 is particularly interesting because it maps near a locus that has been previously identified in T2DM in whole-genome linkage studies (Duggirala et al., 1999) (Ghosh et al., 2000) (Wiltshire et al., 2001) (Meigs et al., 2002).
  • This SNP is located in an LD block that includes HHEX, a homeobox transcription factor essential for hepatic and pancreatic development (Bort et al., 2004) (Bort et al., 2006). While the signalling pathways transduced by HHEX during pancreatic development are not well defined, HHEX has been shown to act in concert with BMPs, FGFs, WNTs and eIF4e in other cell contexts. The association between HHEX and the WNT signalling pathway is particularly interesting because TCF7L2, the strongest T2DM susceptibility locus identified to date, is also a downstream target of WNT.
  • This LD block also contains IDE, whose KO results in glucose intolerance (Farris et al., 2003) and which has been associated with beta-amyloid accumulation in Alzheimer's disease brains (Bjork et al., 2006).
  • IDE polymorphisms influence fasting insulin levels in humans (Gu et al., 2004). While SNPs located within the IDE transcriptional unit showed weak (Groves et al., 2003) (Karamohamed et al., 2003) or no association (Florez et al., 2006) with T2DM, fine mapping of the IDE-KIFl 1 -HHEX locus will be required to identify the causative SNP.
  • sequence variation refers to at least one nucleotide in a nucleic acid which is different in chromosomes of different individuals. Sequence variations include, but are not limited to, base pair substitutions, insertions, deletions, and variable-number repeats. The two DNA copies, which are identical to one another except at the variable position, are referred to. as alleles.
  • a risk allele for a specific disease or ailment is defined as an allele that is most common in people with that specific disease or ailment.
  • An individual can have zero risk allele when the individual is homozygous for one of the alleles most common in people who do not have the specific disease or ailment.
  • An individual can also have one risk allele (heterozygous for the risk allele) or two risk alleles (homozygous for the risk allele).
  • a "polymorphic region” is a region or segment of DNA which varies from individual to individual.
  • a polymorphism is allelic because some members of a species carry one allele and other members carry a variant allele. When only one variant sequence exists, a polymorphism is referred to as a diallelic polymorphism.
  • sequence variants are provided herein which include single allelic variants and sequences with more than one sequence variation that are genetically linked (e.g. haplotype).
  • haplotype includes more than one sequence variation within a single gene or within a set of linked genes.
  • haplotype refers to an ordered combination of alleles in a defined genetic region that co-segregate. Such alleles are said to be "linked.”
  • the alleles of the haplotype may be within a gene, between genes, or in adjacent genes or chromosomal regions that co-segregate with high fidelity.
  • linkage refers to the degree to which regions of a nucleic acid are inherited together. DNA on different chromosomes are inherited together 50% of the time and do not exhibit linkage.
  • linkage disequilibrium refers to the co-segregation of two alleles at linked loci such that the frequency of the co-segregation of the alleles is greater than would be expected from separate frequencies of occurrence of each allele. Additional SNPs that are proxies for or equivalent of T2DM-associated SNPs disclosed herein can be identified using the information provided herein and methods known to those of skill in the art.
  • a proxy or equivalent T2DM-associated SNP is, for example, a SNP within an LD block described herein that is sufficiently close to a T2DM-associated gene that it is useful to identify those at risk for developing T2DM.
  • a proxy or equivalent for a T2DM- associated SNP described herein can be a SNP whose nearest gene is a T2DM- associated gene, such as those described herein (e.g., CAMTAl, TTC 13, RYR2, CXCR4, DARS (also referred to herein as CXCR4/DARS), SLC6A20, VPS 13 A, FAM69B, HHEX (also referred to herein as HHEX/IDE), TCF7L2, MMP26, EXT2, NLGN2, LDLR, ZNF649, ZNF613, ZNF350, ZNF615, FLJ90680, FLJ27365, MXRA5, SLC44A3, LOC642123, RAFTLIN, TSPAN5, DB127798, S
  • Amplification methods The presence or absence of the sequence variation in a nucleic acid molecule may be determined, for instance, with amplification methods which include, but are not limited to: direct RNA amplification, reverse transcription of RNA to cDNA, real-time (RT)-PCR, amplification of cDNA, anchor PCR, RACE PCR, and LCR (ligation chain reaction), etc.
  • the amplification may be a preliminary step performed in order to increase the number of nucleic acid molecules to be further analyzed. For instance, amplification can be combined with subsequent separation or detection procedures such as gel electrophoresis, capillary gel electrophoresis, mass spectrometry, and HPLC.
  • Genotyping The genotype of an individual for a part of the genome, a single gene, or set of genes can be determined with any of a number of methods that are well known to those of skill in the art. Genotyping includes analyzing a nucleic acid for SNPs. The genotype of the individual can be determined, for instance, using any standard sequencing or sequence analysis techniques. Examples of such techniques are described in Cotton, R.G.H., Mutation Detection, Oxford University Press, 1998.
  • sequencing or sequence analysis techniques include direct sequencing, minisequencing, pyrosequencing (Ronaghi, et al., Science,28l, 1998), PCR primer mismatch, single-base extension, restriction fragment length polymorphism, single stranded conformational analysis, and ligation assays in addition to a variety of other amplification and hybridization techniques.
  • the genotyping can be performed using a SEQUENOM MassARRA Y Matrix Assisted Laser Desorption and Ionization Time of Flight (MALDI-TOF) mass spectrometer (Sequenom, San Diego, CA).
  • SEQUENOM MALDI-TOF mass spectrometer allows the analysis of unlabeled single-base extension minisequencing reactions. Primers for use in these minisequencing reactions can be designed with a variety of methods known in the art, including the semi-automated primer design program (Spectro DESIGNER, Sequenom).
  • VSET very short extension method
  • the identity of the nucleotide in gene in a sample can be determined using the SNP-ITTM method (Orchid BioSciences, Inc., Princeton, NJ).
  • SNP-ITTM is a 3-step primer extension reaction. In the first step a target polynucleotide is isolated from a sample by hybridization to a capture primer, which provides a first level of specificity. In a second step the capture primer is extended from a terminating nucleotide trisphosphate at the target SNP site, which provides a second level of specificity.
  • the extended nucleotide trisphosphate can be detected using a variety of known formats, including: direct fluorescence, indirect fluorescence, an indirect colorimetric assay, mass spectrometry, and fluorescence polarization. Reactions can be processed in 384 well format in an automated format using a SNP stream instrument (Orchid BioSciences, Inc., Princeton, NJ).
  • sequence variants including SNPs can also be performed with any of a number of specific hybridization procedures well known in the art.
  • a Southern blot may be performed using the foregoing conditions, together with a detectably labeled probe (e.g. radioactive, chemiluminescent or fluorescent probes). After washing the membrane to which the DNA is finally transferred, the membrane can be placed against X-ray film or analyzed using a phosphorimager device to detect the radioactive, fluorescent or chemiluminescent signal.
  • Northern blot hybridizations using the foregoing conditions can also be performed on samples taken from subjects suspected of having or diagnosed as having a disease, such as diabetes, heart disease, COPD or asthma. Other hybridization techniques include FISH (fluorescent in situ hybridization), dot blot, slot blot analyses and microarrays.
  • probes which hybridize to a sequence variant do so under sufficient hybridizing conditions. It is within the knowledge of one of skill in the art to be able to determine the hybridizing conditions necessary to detect one or more sequence variants in a sample.
  • the probe hybridizes to the sequence variant under low or medium stringent conditions.
  • the probe hybridizes under highly stringent conditions.
  • stringent conditions refers to parameters with which the art is familiar. Such parameters include salt, temperature, length of the probe, etc. The amount of resulting base mismatch upon hybridization can range from about 0% ("high stringency") to about 30% (“low stringency”). Nucleic acid hybridization parameters may be found in references such as Molecular Cloning: A Laboratory Manual, J.
  • hybridization buffer 3.5X SSC, 0.02% Ficoll, 0.02% polyvinyl pyrrolidone, 0.02% Bovine Serum Albumin, 2.5mM NaH2PO4(pH7), 0.5% SDS, 2mM EDTA).
  • SSC 0.15M sodium chloride/0.15M sodium citrate, pH7; SDS is sodium dodecyl sulphate; and EDTA is ethylenediaminetetracetic acid.
  • a membrane upon which the nucleic acid is transferred is washed, for example, in 2X SSC at room temperature and then at 0.1 - 0.5X SSC/0.1X SDS at temperatures up to 68°C.
  • a "probe” as used herein is any compound which specifically interacts with and identifies a sequence variation.
  • a probe may be a nucleic acid, such as a complementary nucleic acid molecule, a protein or a peptide nucleic acid (PNA) molecule.
  • the probes may be specific for a nucleotide sequence that contains a single sequence variation, or may specifically hybridize to a nucleotide sequence that contains 2, 3, 4, 5 or more sequence variations.
  • One or more probes may be used to identify multiple sequence variations. For instance, one or more probes may specifically hybridize to a region of a nucleic acid molecule that indicates a haplotype.
  • a set of probes may be used which are capable of hybridizing to more than one sequence variant in one or more genes.
  • the probes may be of any length to specifically detect the sequence or sequences of interest.
  • Nucleic acid probes are selected from the group of nucleic acids including, but not limited to: DNA, genomic DNA, cDNA, and oligonucleotides they may be natural or synthetic. Oligonucleotide probes vary in size according to the context in which they are used and often are from about 20 to 25-mer oligonucleotides.
  • DNA/cDNA probes can be a variety of lengths as well, such as from about 500 to 5000 bases in length, although other lengths may be used.
  • the probes are about 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, or more nucleotides in length. Appropriate probe length may be determined by one of ordinary skill in the art by following art-known procedures. Probes may be purified to remove contaminants using standard methods known to those of ordinary skill in the art such as gel filtration or precipitation. The probe or set of probes may optionally be attached to a solid substrate.
  • nucleic acid microarray technology which is also known by other names, including DNA chip technology, gene chip technology, and solid-phase nucleic acid array technology, is well known to those of ordinary skill in the art and is based on, but not limited to, obtaining an array of identified nucleic acid probes on a fixed substrate, labeling target molecules with reporter molecules (e.g., radioactive, chemiluminescent, or fluorescent tags such as fluorescein, Cye3-dUTP, or Cye5-dUTP), hybridizing target nucleic acids to the probes, and evaluating target-probe hybridization.
  • reporter molecules e.g., radioactive, chemiluminescent, or fluorescent tags such as fluorescein, Cye3-dUTP, or Cye5-dUTP
  • a probe with a nucleic acid sequence that perfectly matches the target sequence will, in general, result in produce a stronger reporter-molecule signal than will probes with less perfect matches.
  • the probes can be attached to a variety of functional and structural surfaces, including, a chip, a bead, a slide, glass surfaces, plastic surfaces, flat surfaces and curved surfaces. Many components and techniques utilized in nucleic acid microarray technology are presented in The Chipping Forecast, Nature Genetics, Vol.21, Jan 1999, the entire contents of which are incorporated by reference herein.
  • Microarrays also encompass bead arrays, in which nucleotide probes are attached to beads.
  • Commercial examples of this technique are the Illumina Infinum Human 1 and Hap300 arrays (Illumina, San Diego, CA).
  • Targets for microarrays include proteins or nucleic acids including but not limited to DNA, genomic DNA, cDNA, RNA, mRNA; these may be natural or synthetic.
  • one or more control nucleic acid molecules are added to a biological sample. Control nucleic acid molecules allow determination of factors such as nucleic acid quality and binding characteristics, reagent quality and effectiveness, hybridization success, and analysis thresholds and success. Control nucleic acids may include but are not limited to expression products of genes such as housekeeping genes or fragments thereof.
  • Detection and identification of hybridized probes can also be determined with analytical separation techniques such as those listed above.
  • MALDI-TOF mass spectrometry is used. The use of MALDI-TOF to separate peptide nucleic acid (PNA) probe hybridization products has been described (Ross, et al., Anal. Chem., 69 (20):4197-202, 1997).
  • capillary electrophoresis is used for probe hybridization product separation (Basile, et al., Electrophoresis, 23 (6), 2002).
  • sample and “biological sample” are used interchangeably and include but are not limited to: tissue, cells, or body fluid (e.g. serum, blood, lymph node fluid).
  • the fluid sample may include cells and/or fluid.
  • tissue and cells may be obtained from a subject or may be grown in culture (e.g. from a cell line).
  • Samples used in the methods described herein may comprise cells from the eye, epidermis, epithelium, blood, tears, saliva, mucus, urine, stool, sperm, ova, or any other tissues or bodily fluids from which sufficient DNA or RNA can be obtained.
  • cells obtained from a buccal swab are used.
  • the sample should be sufficiently processed to render DNA or RNA present available for assaying in the methods described herein.
  • samples may be processed such that DNA from the sample is available for amplification by DNA polymerases or other enzymes that increase the total DNA content or for hybridization to another polynucleotide.
  • the processed samples may be crude lysates where available DNA or RNA is not purified from other cellular material, or may be purified to specifically isolate DNA or RNA.
  • Samples may be processed by any means known in the art that renders DNA or RNA available for assaying in the methods described herein.
  • Methods for processing samples may include, without limitation, mechanical, chemical, enzymatic, or molecular means of lysing and/or purifying cells and cell lysates.
  • Processing methods may include chromatographic methods such as ion exchange (e.g., cation and anion), size exclusion, affinity, and hydrophobic interaction chromatography.
  • isolated nucleic acids In another aspect of the invention isolated nucleic acid molecules are provided.
  • nucleic acid molecules may contain one or more SNPs associated with T2DM.
  • isolated nucleic acid molecules are provided which are selected from the following sequences: SEQ ID NOs: 1-76 and fragments thereof. In other instances the isolated nucleic acid molecules are selected from the following sequences: SEQ ID NOs: 76-871 risk alleles and fragments thereof.
  • Fragments of the isolated nucleic acid molecules are provided which include portions of the nucleotide sequences which contain one or more sequence variations including SNPs as described herein. Fragments, for example, are long enough to assure that the presence or absence of the precise sequence indicates the presence or absence of a sequence variant of interest.
  • the sequence variant of interest can be a single allelic variant or a haplotype.
  • an isolated nucleic acid may be substantially purified, but need not be.
  • a nucleic acid that is isolated within a cloning or expression vector is not pure in that it may comprise only a tiny percentage of the material in the cell in which it resides.
  • Such a nucleic acid is isolated, however, as the term is used herein because it is readily manipulable by standard techniques known to those of ordinary skill in the art.
  • nucleic acid is used broadly herein to mean a sequence of deoxyribo nucleotides or ribonucleotides that are linked together by a phosphodiester bond.
  • a nucleic acid can be RNA or can be DNA, which can be a gene or a portion thereof, and can be single stranded or double stranded, as well as a DNA/RNA hybrid.
  • a nucleic acid can contain nucleoside or nucleotide analogs, or a backbone bond other than a phosphodiester bond.
  • nucleotides comprising a nucleic acid or polynucleotide are naturally occurring deoxyribonucleotides, such as adenine, cytosine, guanine or thymine linked to 2'-deoxyribose, or ribonucleotides such as adenine, cytosine, guanine or uracil linked to ribose.
  • a nucleic acid also can contain nucleotide analogs, including non-naturally occurring synthetic nucleotides or modified naturally occurring nucleotides.
  • nucleotide analogs are well known in the art and commercially available, as are polynucleotides containing such nucleotide analogs (Lin et al., Nucl. Acids Res. 22: 5220-5234(1994); Jellinek et al., Biochemistry 34: 11363-11372 (1995); Pagratis et al., Nature Biotechnol. 15:68-73 (1997), each of which is incorporated herein by reference).
  • the covalent bond linking the nucleotides of a nucleic acid generally is a phosphodiester bond.
  • the covalent bond also can be any of numerous other bonds, including a thiodiester bond, a phosphorothioate bond, a peptide-like bond or any other bond known to those in the art as useful for linking nucleotides to produce synthetic polynucleotides (see, for example, Tarn et al., Nucl. Acids Res. 22: 977-986 (1994); Ecker and Crooke, BioTechnology 13:351360 (1995), each of which is incorporated herein by reference).
  • nucleotide analogs or bonds linking the nucleotides or analogs can be particularly useful where the polynucleotide is to be exposed to an environment that can contain a nucleolytic activity, including, for example, a tissue culture medium or upon administration to a living subject, since the modified nucleic acids can be less susceptible to degradation.
  • a nucleic acid comprising naturally occurring nucleotides and phosphodiester bonds can be chemically synthesized or can be produced using recombinant DNA methods, using an appropriate nucleic acid as a template.
  • nucleic acid comprising nucleotide analogs or covalent bonds other than phosphodiester bonds generally are chemically synthesized, although an enzyme such as T7 polymerase can incorporate certain types of nucleotide analogs into a polynucleotide and, therefore, can be used to produce such a nuclei acid recombinantly from an appropriate template (Jellinek et al., supra, 1995).
  • nucleic acid as used herein includes naturally occurring nucleic acid molecules, which can be isolated from a cell, as well as synthetic molecules, which can be prepared, for example, by methods of chemical synthesis or by enzymatic methods such as by the polymerase chain reaction (PCR).
  • PCR polymerase chain reaction
  • the methods may also be accomplished using the mutant polypeptides (including whole proteins and partial proteins) that are encoded by the sequence variants described herein.
  • Such mutant polypeptides are useful, for example, alone or as fusion proteins to generate antibodies, and as components of a diagnostic assay.
  • Mutant polypeptides can be isolated from biological samples including tissue or cell homogenates, and can also be expressed recombinantly in a variety of prokaryotic and eukaryotic expression systems by constructing an expression vector appropriate to the expression system, introducing the expression vector into the expression system, and isolating the recombinantly expressed mutant protein. Fragments of the mutant polypeptides also can be synthesized chemically using well-established methods of peptide synthesis. Polypeptides encoded by nucleic acids that comprise T2DM-predisposing sequence variants including SNPs can be compared to control polypeptides encoded by nucleic acids that do not have the sequence variants. Comparisons between polypeptides can be performed with both functional and structural assays.
  • Non-limiting examples of functional assays are antibody binding assays and enzymatic assays.
  • the invention further includes protein microarrays (including antibody arrays) for the analysis of mutant polypeptides encoded by nucleotide sequences comprising one or more SNPs.
  • Protein microarray technology which is also known by other names including protein chip technology and solid-phase protein array technology, is well known to those of ordinary skill in the art and is based on, but not limited to, obtaining an array of identified peptides or proteins on a fixed substrate, binding target molecules or biological constituents to the peptides, and evaluating such binding. See, e.g., G. MacBeath and S. L. Schreiber, "Printing Proteins as Microarrays for High-Throughput Function Determination," Science 289(5485):1760-1763, 2000.
  • small interfering RNA refers to a RNA molecule derived from the successive cleavage of long double-stranded RNA (dsRNA) within a cell to produce an RNA molecule generally have a length of between 15 and 30 nucleotides, and more often between 20 and 25 nucleotides.
  • siRNAs direct the destruction of corresponding mRNA targets during RNA interference in animals, and during other RNA-silencing phenomena, including posttranscriptional gene silencing of plants and quelling of Neurospor a.
  • RNAs are preferably chemically synthesized using appropriately protected ribonucleoside phosphoramidites and a conventional DNA/RNA synthesizer.
  • siRNAs can be obtained from commercial RNA oligo synthesis suppliers. In general, RNAs are not too difficult to synthesize and are readily provided in a quality suitable for RNAi.
  • RNA can be used in the methods of the present invention, provided that it has sufficient homology to the nucleic acid comprising the SNPs to mediate RNAi.
  • the RNA can range from about 21 base pairs (bp) of the gene to the full length of the gene or more.
  • the RNA used in the methods of the present invention is about 1000 bp in length.
  • the RNA is about 500 bp in length.
  • the RNA is about 22 bp in length.
  • the preferred length of the RNA of the invention is 21 to 23 nucleotides.
  • kits for diagnostics are also provided that are useful for assessing or aiding in assessing whether an individual is at risk for developing T2DM.
  • a kit of the invention is a kit that provides components necessary to determine the presence or absence of one or more sequence variants including SNPs of the invention.
  • Such components include probes that hybridize to the sequence variants of the invention, such as, for instance, nucleotide sequences set forth as SEQ 1-871 (see Supplemental Table 2) and fragments thereof, wherein the fragment contains a sequence variation.
  • kits include components such as primers useful for amplification of one or more sequence variants and/or other chemicals for PCR amplification.
  • the primers are constructed and arranged to selectively amplify a region of a nucleic acid molecule that is suspected of containing one or more sequence variations. It is within the skill of the art to construct and arrange primers necessary to assess the genotype of a subject.
  • kits provided can also, optionally, contain one or more control agents.
  • the kits also may contain instructions for using the probes/primers of the invention and to correlate the hybridization/amplification to the risk of an individual for developing T2DM.
  • Type 2 Diabetes mellitus is also referred to as adult-onset diabetes or non-insulin dependent diabetes mellitus.
  • T2DM is currently diagnosed with a variety assays.
  • diagnostic assays for T2DM are the "fasting plasma glucose test” and the “oral glucose tolerance test", which are known to persons of ordinary skill in the art.
  • Other embodiments of diagnostic tests are the determination of fasting serum insulin levels and serum C-peptide levels. These diagnostic tests are also known to people of ordinary skill in the art.
  • diagnostic serum level and tolerance tests described above can be used in conjunction with SNP analysis methods described herein for assessing or aiding in assessing individuals at risk for T2DM, including association and linkage disequilibrium methods, described below.
  • a two-stage strategy was used to perform a cost-effective GWS without sacrificing statistical power.
  • Illumina Infinium Human 1 and Hap300 (Ilumina, San Diego, CA) arrays were used to obtain genotypes for 689 (Hap300: 694) T2DM patients (sex ratio: 418 m. / 272 f, mean age at diagnosis: 44.9 ⁇ 8.4 yr., mean age at exam: 59.9 ⁇ 10.4 yr., mean BMI: 25.8 ⁇ 2.8 kg/m 2 ) and 670 (Hap300: 654) control subjects (sex ratio: 264 m. / 406 f, mean age at exam: 53.4 ⁇ 5.6 yr., mean BMI: 23.2 + 1.8 kg/m 2 ). The subjects were all unrelated French Caucasians.
  • Inclusion criteria for affected individuals were (i) T2DM according to 1997 American Diabetes Association (ADA) criteria; (ii) familial history of diabetes in first degree relatives; (iii) BMI ⁇ 30 kg/m 2 .
  • the BMI cut-off was designed to enrich the population for variants determining insulin resistance and ⁇ -cell dysfunction that act independent of obesity.
  • Inclusion criteria for control subjects were; (i) age at exam > 45 yr.; (ii) normal glucose tolerance according to 1997 ADA criteria; (iii) BMI ⁇ 27 kg/m 2 .
  • the control subjects were participants in the Data from an Epidemiological Study on the Insulin Resistance syndrome (DESIR.) program (a 9-year longitudinal study that aims to clarify the development of the insulin resistance syndrome) and came from 10 health examination centers in the western central part of France (Balkau, 1996). All participants signed an informed consent and the protocol was approved by the French ethics committee. The study subjects were selected to optimize Stage 1 power by including patients with at least one affected first degree relative, to enrich for risk alleles (Fingerlin, 2004).
  • DESIR. Epidemiological Study on the Insulin Resistance syndrome
  • case- control pairing for BMI should further increase study power.
  • Genomic DNA was extracted from peripheral blood cells using PURE-GENE D50K DNA isolation kits (Gentra Systems; Minneapolis, MN) or DNeasy Blood & Tissue Kit (Qiagen, Germantown, MD). Genotypes were obtained for each study subject using two SNP-based platforms: a) Illumina Infinium Humanl BeadArrays, which assay 109,375 SNPs chosen using an exon-centric design based on genes identified in RefSeq, Ensembl and Swiss-Prot; and b) Human Hap300 BeadArray, which assay 317,503 SNPs chosen to tag haplotype blocks identified by the Phase I HapMap (International HapMap Consortium, 2005).
  • genotypes were obtained for 99.2% (Humanl) and 99.4% (Hap300) of loci assayed for each subject with a reproducibility of >99.9% (both platforms). Markers that deviated significantly from Hardy- Weinberg equilibrium (HWE) (p ⁇ 0.001 in the control samples), that had low MAF ( ⁇ 0.01 in both the case or control samples), or that had a call rate ⁇ 95% in the case and control samples combined, were excluded from further analysis. In total, Applicants analyzed genotypes for 100,996 (Humanl) and 309,776 (Hap300) SNPs representing 393,736 unique loci.
  • HWE Hardy- Weinberg equilibrium
  • STRUCTURE Principal et al. 2000
  • This program uses genotype information from each individual (without indication of its geographical origin) and assigns them to inferred populations by minimizing both the linkage disequilibrium between unlinked loci and the deviation from Hardy- Weinberg equilibrium within each population.
  • Each individual is assigned to one or more populations with different "coefficients of ancestry" (between 0 and 1, the sum of the coefficients being equal to 1).
  • coefficients of ancestry between 0 and 1, the sum of the coefficients being equal to 1.
  • Unrelated individuals from three populations genotyped by the HapMap project 60 CEPH from Utah (CEU), 60 Yoruba (YRI) and 89 Han Chinese /Japanese (CHB/JPT) were also included. This will better separate individuals according to their continental origin, since the allele frequencies for the non-European populations will be estimated using at least 60 individuals.
  • the data set consisted of 1619 individuals (736 cases, 674 controls and 209 individuals from the HapMap) and their genotypes at 328 SNPs. When the data set was split into three populations, the assignment of the HapMap individuals corresponded to their geographic origin, with each individual belonging to one population with a coefficient of ancestry larger than 0.90. While most cases and controls fell within the range of the CEPH individuals from the HapMap, Applicants identified 43 individuals who lay outside the CEPH cluster. No differences between the assignment of cases and controls could be detected after removal of these outliers. T2DM association
  • T2DM association was tested with Armitage's trend test as well as dominant and recessive models for autosomal SNPs (Sasieni, 1997).
  • Applicants examined the strongest association obtained from the three models. Genome- wide significance values were obtained using 10,000 permutations of the case-control labels under the null hypothesis and evaluating the test statistic against the combined distribution of all SNPs. Subtle subpopulation structure or systematic genotyping errors can give rise to variance inflation for the measured test statistics and a deviation from the expected ⁇ 2 (l) distribution (Devlin et al., 1999) (Reich et al., 2001) (Clayton et al., 2005) (Kohler et al., 2005).
  • Applicants estimated the variance inflation factor by taking the ratio between the mean of the measured statistic and the mean of the expected one for the SNPs with the lowest 90% of the measured statistic (Clayton et al., 2005) and used this to correct the observed ⁇ 2 statistic.
  • the adjusted Quantile-Quantile plots show a distribution of p- values that better align with the expected uniform distribution.
  • rs932206 maps to a region displaying positive selection, very close to the "lactase SNP" (Campbell et al., 2005), Applicants tested for population structure or geographic MAF gradient that could cause spurious association. Principal Component Analysis was performed on markers, with the first four PCA axes used as covariate for each individual. The association between rs932206, disease status and these covariates was re-tested through logistic regression. The T2DM association remained highly significant. Moreover, the first PCA axis explained slightly over 1/871 of the variance (0.0002) which confirms absence of significant evidence of residual population structure.
  • Supplementary Table 2 provides a summary of all linkage disequilibrium SNPs identified in this study.
  • the second stage cohort included 2,617 subjects with T2DM and 2,894 control subjects.
  • Inclusion criteria for cases were (i) T2DM according to 1997 ADA criteria; (ii) BMI ⁇ 35 kg/m 2 .
  • Inclusion criteria for controls were (i) age at exam > 40 yr.; (ii) normal fasting glucose according to 1997 ADA criteria; (iii) BMI ⁇ 35 kg/m 2 .
  • Stage 2 Unlike the Stage 1 sample, the affected individuals studied in Stage 2 were not required to have a family history of T2DM or to be lean. However, severely obese subjects were excluded by requiring BMI ⁇ 35 kg/m 2 .
  • the inclusion criteria for control sub- jects in Stage 2 differed from those for Stage 1 control subjects in that Stage 2 controls included individuals with normal fasting glucose according to 1997 ADA criteria ( ⁇ 6.1 mM).
  • the Stage 2 cohort was chosen to be more representative of the diabetic patients than would be seen in the general population. This reduces the chances that a locus identified in Stage 1 would be predictive of a subphenotype of diabetes (for example, lean diabetic patients) and not of diabetes in general. This may result in a more conservative assessment of the T2DM association.
  • Sequenom iPLEX assays (Sequenom, Cambridge, MA) were used to obtain genotypes for 59 out of the 66 unique SNPs that passed the selected cutoff thresholds. Only the strongest associated SNP out of the eight SNPs located in TCF7L2 was tested. Locus-specific PCR primers and allele-specif ⁇ c detection primers were designed using the MassARRAY Assay Design 3.0 software (Sequenom). The sample DNAs were amplified in a 25-31-plex PCR reaction and labelled using a locus-specific single base extension reaction. The resulting products were desalted and transferred to a 384-element SpectroCHIP array.
  • Allele detection was performed using Matrix-Assisted Laser De- sorption/Ionization Time-of-Flight Mass Spectrometry (MALDI-TOF MS). The mass spectrograms were analyzed by the MassARRAY TYPER software (Sequenom).
  • SNPs were filtered according to call rate (>95% required), deviation from Hardy- Weinberg equilibrium (p>0.001 in controls required), and minor allele frequency (MAF>0.01 required).
  • the first stage and second stage genotyping data were analyzed jointly for association with T2DM. Test statistics for additive, dominant and recessive models were calculated according to published methods (Sasieni 1997) and the MAX statistic was formed across these to select the strongest obtainable association for any of the three models.
  • the joint analysis confirmed associations (P ⁇ 0.05) for 53 SNPs (Supplementary Table 1). A further 7 SNPs, located in TCF7L2, were not tested in Stage 2, but were validated in other studies (Supplementary Table 1). Twelve SNPs did not achieve significance in the joint analysis: of these, however, 4 (rs6541240 and rs35666, rs7651936 and rsl 1190578) were confirmed by other studies and showed association with T2DM at p ⁇ 0.05 (Supplementary Table 1). This suggests that the remaining unconfirmed associations may be validated in additional studies with greater statistical power.
  • Insulin-degrading enzyme regulates the levels of insulin, amyloid beta-protein, and the beta-amyloid precursor protein intracellular domain in vivo. Proc Natl Acad Sci USA 100:4162-7.
  • KATP channel subunits Kir6.2 (KCNJI l) and SURl (ABCC8) confirm that the
  • KCNJl 1 E23K variant is associated with type 2 diabetes. Diabetes 52:568-72
  • IDE insulin-degrading enzyme
  • Polymorphisms in the insulin-degrading enzyme gene are associated with type 2 diabetes in men from the NHLBI Framingham Heart Study. Diabetes 52:1562-1567. Kayali AG Van Gunst K, Campbell IL, Stotland A, Kritzik M, Liu G, Flodstrom-
  • Boehnke M Collins FS (2004) Genetic variation near the hepatocyte nuclear factor- 4 alpha gene predicts susceptibility to type 2 diabetes. Diabetes 53:1141-1149. Skol AD, Scott LJ, Abecasis GR, Boehnke M (2006) Joint analysis is more efficient than replication-based analysis for two-stage genome-wide association studies. Nat Genet 38:209-13.
  • Vasseur F Helbecque N, Dina C, Lobbens S, Delannoy V, Gaget S, Boutin P, Vaxillaire M, Leprtre F, Dupont S, Hara K, Clement K, Bihain B, Kadowaki T, Froguel P (2002) Single-nucleotide polymorphism haplotypes in the both proximal promoter and exon 3 of the APMl gene modulate adipocyte-secreted adiponectin hormone levels and contribute to the genetic risk for type 2 diabetes in French Caucasians. Hum Molec Genet 11 :2607-2614.
  • HHEX/IDE are used interchangeably herein.
  • CXCR4 and DARS are used interchangeably.
  • TTTGTAI I 1 1 IAGTAGAGACGAGGTTTCGCC
  • the pMAX statistic was computed using the allele counts in the downloaded files for patients with type 2 diabetes and control subjects
  • Magnusdottir D Stefansdottir G, Kristjansson K, Bagger Y, Wilensky RL, Reilly MP, Morris AD, Kiraber CH, Adeyemo A, Chen Y, Zhou J, So WY, Tong PC,
  • Melander M Rastam L, Speliotes EK, Taskinen MR, Tuomi T, Guiducci C, Berglund A, Carlson J, Gianniny L, Hackett R, Hall L, Holrnkvist J, Lau ⁇ la E,
  • CAGGCTGGAGTACAGTGGTGCCATCTCA GCTCACTGCAACCTTCGTCTCCTGGGTT CAAGCAATTCTCTCTGCCTCAGTCTCCTG AGTAGCTGGGATTACAGGTGCCTGCTGC CATGCCCGGCTAA I I I I I I GTA I I I I I A GTAGAAGTAGAGTTTCACCATGTTAGCCA GGCTGGTCTCAAACTCCTGACCTCAAGT AATCTACCCACCTCAGCCTCCCAAAGTG CTGGGATTATGGGTGTGAGCCACCGCGC CCGGCTGAGAAGAGGAAATTGAGATGCA GAGAGGGGAAGGTGTATCACTGGTAGGA

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Pathology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

L'invention concerne des procédés d'analyse d'individus étant à risque pour le développement d'un diabète sucré de Type 2 (T2DM). Des acides nucléiques obtenus à partir d'échantillons biologiques d'individus souffrant de T2DM ont été analysés et des SNP associés aux gènes de T2DM ont été découverts. De plus, des SNP en déséquilibre de liaison avec des gènes de T2DM sont décrits.
PCT/IB2007/004361 2006-09-11 2007-09-11 Prédicteurs génétiques d'un risque de diabète sucré de type 2 WO2008065544A2 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US84358606P 2006-09-11 2006-09-11
US60/843,586 2006-09-11

Publications (2)

Publication Number Publication Date
WO2008065544A2 true WO2008065544A2 (fr) 2008-06-05
WO2008065544A3 WO2008065544A3 (fr) 2009-03-19

Family

ID=39468332

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2007/004361 WO2008065544A2 (fr) 2006-09-11 2007-09-11 Prédicteurs génétiques d'un risque de diabète sucré de type 2

Country Status (1)

Country Link
WO (1) WO2008065544A2 (fr)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011051276A1 (fr) 2009-10-26 2011-05-05 Externautics S.P.A. Marqueurs de tumeurs du rectum et du côlon, et leurs méthodes d'utilisation
WO2011051278A1 (fr) 2009-10-26 2011-05-05 Externautics S.P.A. Marqueurs de tumeurs du poumon et leurs méthodes d'utilisation
WO2011051280A1 (fr) 2009-10-26 2011-05-05 Externautics S.P.A. Marqueurs de tumeurs des ovaires et leurs méthodes d'utilisation
WO2013110245A1 (fr) * 2012-01-27 2013-08-01 The Chinese University Of Hong Kong Biomarqueurs pour le diabète
WO2021178166A1 (fr) * 2020-03-06 2021-09-10 Denovo Biopharma Llc Compositions et procédés pour évaluer l'efficacité d'inhibiteurs de transporteurs de neurotransmetteurs

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR2847263A1 (fr) * 2002-11-18 2004-05-21 Commissariat Energie Atomique Polynucleotide specifique de la cellule pancreatique beta des ilots de langerhans
WO2004042358A2 (fr) * 2002-11-01 2004-05-21 Decode Genetics Ehf. Gene slit-3 du diabete de type ii humain situe sur le chromosome 5q35
US20050147987A1 (en) * 2000-09-08 2005-07-07 Applera Corporation (Ny) Polymorphisms in known genes associated with type II diabetes and obesity, methods of detection and uses thereof
WO2006022634A1 (fr) * 2004-07-22 2006-03-02 Sequenom, Inc. Méthodes d’identification du risque d’apparition de diabètes de type ii et traitements associés
WO2008065682A2 (fr) * 2006-11-30 2008-06-05 Decode Genetics Ehf. Variantes génétiques de susceptibilité au diabète mellitus de type 2

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050147987A1 (en) * 2000-09-08 2005-07-07 Applera Corporation (Ny) Polymorphisms in known genes associated with type II diabetes and obesity, methods of detection and uses thereof
WO2004042358A2 (fr) * 2002-11-01 2004-05-21 Decode Genetics Ehf. Gene slit-3 du diabete de type ii humain situe sur le chromosome 5q35
FR2847263A1 (fr) * 2002-11-18 2004-05-21 Commissariat Energie Atomique Polynucleotide specifique de la cellule pancreatique beta des ilots de langerhans
WO2006022634A1 (fr) * 2004-07-22 2006-03-02 Sequenom, Inc. Méthodes d’identification du risque d’apparition de diabètes de type ii et traitements associés
WO2008065682A2 (fr) * 2006-11-30 2008-06-05 Decode Genetics Ehf. Variantes génétiques de susceptibilité au diabète mellitus de type 2

Non-Patent Citations (9)

* Cited by examiner, † Cited by third party
Title
DATABASE ENTREZ PROTEIN [Online] NCBI; 7 May 2008 (2008-05-07), "CAH72347. Reports calmodulin bindin...[gi:55665770]" XP002497997 retrieved from HTTP://WWW.NCBI.NLM.NIH.GOV/ENTREZ/VIEWER.FCGI?DB=PROTEIN Database accession no. 55665770 -& DATABASE ENTREZ PROTEIN [Online] NCBI; 18 May 2005 (2005-05-18), "CAH72347. Reports calmodulin bindin...[gi:55665770]" XP002497998 retrieved from HTTP://WWW.NCBI.NLM.NIH.GOV/ENTREZ/VIEWER.FCGI?DB=PROTEIN Database accession no. 55665770 *
DATABASE PROBE [Online] ncbi; 22 February 2006 (2006-02-22), "rs13266634" XP002509338 retrieved from HTTP://WWW.NCBI.NLM.NIH.GOV Database accession no. Pr003758580.1 *
DATABASE SNP [Online] NCBI; 10 October 2003 (2003-10-10), "rs1193179" XP002497772 retrieved from HTTP://WWW.NCBI.NLM.NIH.GOV Database accession no. rs1193179 *
DATABASE SNP [Online] NCBI; 13 September 2004 (2004-09-13), "rs3266634" XP002509337 retrieved from HTTP://WWW.NCBI.NLM.NIH.GOV Database accession no. rs13266634 *
DIABETES GENETICS INITIATIVE OF BROAD INSTITUTE OF HARVARD AND MIT, LUND UNIVERSITY, AND NOVARTIS INSTITUTES OF BIOMEDICAL RESEARC: "Genome-wide association analysis identifies loci for type 2 diabetes and triglyceride levels." SCIENCE (NEW YORK, N.Y.) 1 JUN 2007, vol. 316, no. 5829, 1 June 2007 (2007-06-01), pages 1331-1336, XP002509336 ISSN: 1095-9203 *
GRANT STRUAN F A ET AL: "Variant of transcription factor 7-like 2 (TCF7L2) gene confers risk of type 2 diabetes" NATURE GENETICS, NATURE PUBLISHING GROUP, NEW YORK, US, vol. 38, no. 3, 1 March 2006 (2006-03-01), pages 320-323, XP009096714 ISSN: 1061-4036 *
KANG EUN SEOK ET AL: "The influence of adiponectin gene polymorphism on the rosiglitazone response in patients with type 2 diabetes." May 2005 (2005-05), DIABETES CARE MAY 2005, VOL. 28, NR. 5, PAGE(S) 1139 - 1144 , XP002496473 ISSN: 0149-5992 abstract page 1139, right-hand column, paragraph 2 page 1143, left-hand column, last paragraph *
SLADEK ROBERT ET AL: "A genome-wide association study identifies novel risk loci for type 2 diabetes" NATURE, NATURE PUBLISHING GROUP, LONDON, UK, vol. 445, no. 7130, 22 February 2007 (2007-02-22), pages 881-885, XP002465137 ISSN: 0028-0836 *
STEPHANE CAUCHI ET AL: "Analysis of novel risk loci for type 2 diabetes in a general French population: the D.E.S.I.R. study" 22 January 2008 (2008-01-22), JOURNAL OF MOLECULAR MEDICINE, SPRINGER, BERLIN, DE, PAGE(S) 341 - 348 , XP019576423 ISSN: 1432-1440 page 342, left-hand column, last paragraph tables 2-4 figure 1 page 347, left-hand column, paragraph BRIDGING - right-hand column *

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011051276A1 (fr) 2009-10-26 2011-05-05 Externautics S.P.A. Marqueurs de tumeurs du rectum et du côlon, et leurs méthodes d'utilisation
WO2011051278A1 (fr) 2009-10-26 2011-05-05 Externautics S.P.A. Marqueurs de tumeurs du poumon et leurs méthodes d'utilisation
WO2011051280A1 (fr) 2009-10-26 2011-05-05 Externautics S.P.A. Marqueurs de tumeurs des ovaires et leurs méthodes d'utilisation
US10288617B2 (en) 2009-10-26 2019-05-14 Externautics Spa Ovary tumor markers and methods of use thereof
WO2013110245A1 (fr) * 2012-01-27 2013-08-01 The Chinese University Of Hong Kong Biomarqueurs pour le diabète
US10689702B2 (en) 2012-01-27 2020-06-23 The Chinese University Of Hong Kong Biomarkers for diabetes
WO2021178166A1 (fr) * 2020-03-06 2021-09-10 Denovo Biopharma Llc Compositions et procédés pour évaluer l'efficacité d'inhibiteurs de transporteurs de neurotransmetteurs

Also Published As

Publication number Publication date
WO2008065544A3 (fr) 2009-03-19

Similar Documents

Publication Publication Date Title
EP2718466A2 (fr) Matériels et méthode pour l'identification de vecteurs d'amyotrophie spinale
WO2008065544A2 (fr) Prédicteurs génétiques d'un risque de diabète sucré de type 2
JP2010525788A (ja) 心臓血管機能及び障害の評価のための方法及び組成物
US20100240539A1 (en) Human Autism Susceptibility Gene Encoding PRKCB1 and Uses Thereof
US20090011414A1 (en) Human autism susceptibility gene encoding a kinase and uses thereof
US20130109589A1 (en) Single nucleotide polymorphisms associated with amyotrophic lateral sclerosis
US9752195B2 (en) TTC8 as prognostic gene for progressive retinal atrophy in dogs
EP2501825B1 (fr) Procédés de diagnostic de maladies de la peau
EP1756316B1 (fr) Gene humain de susceptibilite a l'obesite codant pour un canal potassique commande par tension et utilisations dudit gene
WO2010072608A1 (fr) Polymorphisme de nucléotide unique de pcsk1 dans le diabète de type 2
EP1403380A1 (fr) Gène humain de susceptibilité à l'obésité et leurs utilisations
CA2586208A1 (fr) Gene humain de susceptibilite a l'obesite codant pour des canaux ioniques au potassium et leurs utilisations
KR20150092937A (ko) 한국인의 고혈압 예측용 ｓｎｐ 마커
JP2007089546A (ja) 関節リウマチ感受性遺伝子、及び関節リウマチ罹患リスクの測定方法
WO2005071104A1 (fr) Dosage pour trouble affectif bipolaire
EP1362926A1 (fr) Gène humain de susceptibilité à l'obésité et leurs utilisations
US20060240461A1 (en) Methods for detecting nemaline myopathy
AU2006251402A1 (en) Genetic association of polymorphisms in the ATF6-alpha gene with insulin resistance phenotypes
US20070218057A1 (en) Human Obesity Susceptibility Gene and Uses Thereof
US20080286765A1 (en) Human Obesity Susceptibility Gene Encoding a Taste Receptor and Uses Thereof
WO2007139402A2 (fr) Procédés et compositions permettant d'évaluer la fonction et les troubles pulmonaires
CA2674808A1 (fr) Gene iglc de sensibilite au diabete humain

Legal Events

Date Code Title Description
NENP Non-entry into the national phase in:

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 07866630

Country of ref document: EP

Kind code of ref document: A2