WO2008059252A9

WO2008059252A9 - Methods and composition fro t cell receptors which recognize 5t4 antigen

Info

Publication number: WO2008059252A9
Application number: PCT/GB2007/004361
Authority: WO
Inventors: Kevin Myers; Irina Redchenko; William Shingler; Richard Harrop; Stuart Naylor; Alan Kingsman; Susan Kingsman
Original assignee: Oxford Biomedica Ltd; Kevin Myers; Irina Redchenko; William Shingler; Richard Harrop; Stuart Naylor; Alan Kingsman; Susan Kingsman
Priority date: 2006-11-15
Filing date: 2007-11-15
Publication date: 2008-09-18
Also published as: WO2008059252A3; WO2008059252A2

Abstract

The present invention relates to the use of peptide epitopes of 5T4 antigen in the identification and isolation of T cell receptors which recognize 5T4 antigen.

Description

METHODS AND COMPOSITIONS FOR T CELL RECEPTORS WHICH RECOGNIZE 5T4 ANTIGEN

Field of the Invention

The present invention relates to the identification of T cell receptors which recognize the 5T4 antigen, and their use in immunotherapy.

Background to the Invention

Prior to the identification of specific human tumor antigens, many clinical trials were performed attempting to immunize cancer patients against either whole cancer cells or subcellular fractions from cancer cells. The identification of genes encoding tumor antigens, however, has made it possible to develop specific immunotherapies based on attacking tumor cells bearing the identified antigens. A variety of clinical approaches utilizing these genes or gene products are possible as summarized in the following Table A.

Table A

Active immunotherapy ("Cancer vaccines")

1. Immunization with: i) purified antigen ii) immunodominant peptide (native or modified) iii) "naked" DNA encoding the antigen iv) recombinant viruses encoding the antigen v) antigen presenting cells pulsed with protein or peptide (or transfected with genes encoding the antigen)

2. Use of cytokine adjuvants such as IL-2 and IL- 12 administered systemically or encoded by the immunizing vector

Passive immunotherapy ("Adoptive immunotherapy")

1. Transfer of cells sensitized in vitro to the specific antigen (bulk or cloned populations)

2. Transduction of effector cells (or stem cells) with genes encoding T cell receptors that recognize specific antigens. Cancer vaccines aim to stimulate the adaptive arm of the immune system directly in vivo. By contrast, adoptive immunotherapy achieves T cell stimulation ex vivo by activating and expanding autologous tumor-reactive T cell populations to large numbers of cells that are then

5 transferred back to the patient. In particular, autologous tumor infiltrating lymphocytes (TIL) which were expanded ex vivo and then transferred into patients following lymphodepleting conditioning, have been found to mediate cancer regression in a proportion of patients with metastatic melanoma (Dudley et al., (2002) Science 298, 850- 854). A requirement of this approach is that patients have pre-existing tumor reactive cells that can be expanded ex vivo.

10 The approach is further limited in that in many cancer patients it is difficult to identify tumor reactive lymphocytes.

Therefore, the adoptive transfer of lymphocytes has been further modified to include the engineering of lymphocytes specific for tumor antigens. Tumor associated antigens (TAA)

15 are recognized by the T cell receptor (TCR) on the T cell surface. A number of approaches have concentrated on elucidating and manipulating the role of TCRs in this immune therapy approach. It has been shown that lymphocytes transduced with a vector encoding a TCR recognizing p53 were able to specifically recognize antigen presenting cells transfected with either wild type or mutant p53 protein (Cohen et ah, (2005), J. Immunol.), hi a different

20 study, TCR specific to the NY-ESO-I CT Ag were isolated and used to construct retroviral vectors, which were shown to transfer anti-NY-ESO-1 effector functions to normal primary human T cells (Zhao et al. (2005) J. Immunol.). Recently, it was shown that CD8+ T cells which were engineered to express a T cell receptor specific for the TAA, MART-I were able to promote cancer regression in patients with metastatic melanoma (Morgan et al. (2006)

25 Sciencexpress).

A number of oncofoetal or tumor-associated antigens have been identified and characterised in human and animal tumors, m general, TAAs are antigens expressed during foetal development which are downregulated in adult cells, and are thus normally absent or present 30. only at very low levels in adults. Tumor cells have been observed to resume expression of TAAs, and the application of TAAs for tumor diagnosis, targeting and immunotherapy has therefore been suggested. The TAA 5T4 (see WO 89/07947) has been previously characterised. It is a 72 kDa membrane glycoprotein highly expressed on placental trophoblasts. Its expression on normal adult tissues is restricted to some specialized epithelia, but it is highly expressed and broadly distributed throughout a wide range (>75%) of carcinomas including gastric, colorectal, breast and ovarian cancer (see Table B, below). It appears to be strongly correlated to metastasis in colorectal and gastric cancer. The full nucleic acid sequence of human 5T4 is known (Myers et al, 1994 J Biol Chem 169: 9319-24).

Table B

(Starzynska et al, Eur J Gastroenterol Hepatol 1998 Jun;10(6):479-84; Starzynska et al, Br J Cancer 1994 May;69(5): 899-902; Starzynska et al, Br J Cancer 1992 Nov;66(5): 867-9).

5T4 has been proposed as a marker, with possible mechanistic involvement, in tumor progression and metastasis potential (Carsberg et al, (1996) Lit J Cancer 1996 Sep 27;68(1): 84-92). 5T4 has also been proposed for use as an immunotherapeutic agent (see WO 00/29428) and is used in TroVax® (Oxford Biomedica Ltd), a cancer vaccine in clinical development for delivery of 5T4 using an attenuated vaccinia virus vector (MVA). TroVax® is currently being evaluated in a phase III clinical trial in renal cancer patients.

Although advances have been made in the treatment of cancer through passive and active immunotherapy there remains a clear need to develop new treatment approaches.

Summary of the Invention

The present inventors have devised methods of providing T cell receptors which recognize a 5T4 antigen using a number of epitopes of 5T4. The identification of particular T cell receptors provides new opportunities for the development of therapeutic strategies against cancer. In particular, the T cell receptor obtainable by methods of the present invention are useful in adoptive immunotherapy.

It is understood that the term "T cell receptor which recognises a 5T4 antigen" refers to a T cell receptor which recognises a peptide epitope of 5T4 which is associated with or bound to a MHC molecule, preferably to a class I MHC molecule. Furthermore, a T cell receptor which recognises a peptide epitope of 5T4 is a T cell receptor which shows a higher affinity to a peptide epitope of 5T4 than to another peptide epitope of another antigen. Methods of determining the affinity of a T cell receptor to an antigen (or peptide epitope of the antigen) are well known in the art and disclosed below.

Accordingly in a first aspect there is provided a method of identifying or isolating a T cell receptor which recognizes a 5T4 antigen, said method comprising contacting said receptor with a peptide epitope of 5T4, said epitope comprising an amino acid sequence as set out in any of SEQ ID NOs: 1-206. These peptides, and their corresponding SEQ. ID. NOs are set out in Figures 18,.

In an embodiment of the invention said epitope binds a MHC class I molecule; or said epitope comprises an amino acid sequence as set out in any of SEQ ID NOs: 8, 9, 17, 22, 23, 43, 45, 49, 55, 58, 59, 65, 71, 77,90, 99, 100, 101, 109, 113, 117, 125, 126, 142, 151, 161, 163, 174, 176, 179, 181, 182, 183, 186, 187, 194 and 198; or said epitope comprises an amino acid sequence selected from RLARLAL, RLRLARLALV, RLARLALVLL, FLTGNQLAVL or NIRDACRDHM.

In another embodiment of the invention said epitope binds HLA-Al MHC molecule; or said epitope comprises an amino acid sequence as set out in any of SEQ ID NOs: 43, 109, 125, 161 and 198.

In another embodiment of the invention said epitope binds HLA- A2 MHC molecule; or said epitope comprises an amino acid sequence as set out in any of SEQ ID NOs: 8, 9, 22, 49, 59, 65, 77, 99, 90 109, 125, 142, 151, 174, 176, 179, 181, 182, 183 and 186.

In another embodiment of the invention said epitope binds HLA- A3 MHC molecule; or said epitope comprises an amino acid sequence as set out in any of SEQ ID NOs: 100, 109, 125, 142, 186 and 198.

In another embodiment of the invention said epitope binds HLA-B7 MHC molecule; or said epitope comprises an amino acid sequence as set out in any of SEQ ID NOs: 8, 9, 17, 23, 45, 55, 58, 71, 101, 113, 117, 125, 126, 163, 186 and 187.

In another embodiment of the invention said peptide epitope consists of an amino acid sequence as set out in any of SEQ ID NOs: 1-206 or in any of SEQ ID NOs 207-229.

hi another embodiment of the invention said identifying comprises screening a sample of cells for a T cell receptor which recognizes a 5T4 antigen by contacting the sample with a peptide epitope of 5T4 said peptide epitope consists of an amino acid sequence as set out in any of SEQ ID NOs: 1-206; and detecting the presence of a T cell receptor which recognizes the 5T4 epitope.

In another embodiment of the invention said isolating comprises obtaining a population of cells from a sample, sorting the population of cells based on the presence of a T Cell receptor which recognizes a peptide epitope of 5T4 said peptide epitope consists of an amino acid sequence as set out in any of SEQ ID NOs: 1-206, and isolating a cell comprising the T cell receptor which recognizes the 5T4 epitope.

In another embodiment of the invention the method is selected from FACS and MACS; or wherein the population is further sorted based on the presence of at least one other cell marker; or wherein the cell population is expanded in vitro.

Another aspect of the invention is a method for isolating nucleic acids encoding a T cell receptor which recognizes a 5T4 antigen, said method comprising 1. obtaining a population of cells from a sample

2. expanding selectively cells present in said population, which cells express a T cell receptor which recognizes a 5T4 antigen, in the presence of a peptide epitope of 5T4 as defined in claim 1

3. isolating cells comprising the T cell receptor which recognizes the 5T4 epitope 4. removing and amplifying the nucleic acid encoding said T cell receptor. Suitably, the cells are sorted prior to isolation based on the presence of a T cell receptor which recognizes said peptide epitope of 5T4; or the cells are expanded by cultivating them in the presence of antigen presenting cells (APC) loaded with the 5T4 epitope, optionally wherein the APC are selected from the group of peripheral blood mononuclear cells, EBV-transformed cells, dendritic cells and T2 cells.

Another aspect of the invention is a method of preparing an isolated T cell receptor which recognizes a 5T4 antigen, said method comprising: a. isolating nucleic acids encoding a T cell receptor which recognizes a 5T4 antigen using a peptide epitope of 5T4 said peptide epitope consists of an amino acid sequence as set out in any of SEQ ID NOs: 1-206 b. introducing the nucleic acids into a host cell c. expressing the T cell receptor in said host cell d. isolating the T cell receptor.

Another aspect of the invention is a method of preparing a T cell expressing a T cell receptor which recognizes a 5T4 antigen, said method comprising: a. isolating nucleic acids encoding a T cell receptor which recognizes a 5T4 antigen using a peptide epitope of 5T4 said epitope comprising an amino acid sequence as set out in any of SEQ ID NOs: 1-206. b. introducing the nucleic acids into said T cell.

Another aspect of the invention is an isolated T cell comprising a T cell receptor specific to a peptide epitope of 5T4 said epitope comprising an amino acid sequence as set out in any of SEQ ID NOs: 1-206.

Another embodiment of the invention is a T cell prepared by the method as described above or a population of said T cell.

Another aspect of the invention is an isolated T cell receptor which recognizes a peptide epitope of 5T4 said epitope comprising an amino acid sequence as set out in any of SEQ ID NOs: 1-206.

Another embodiment is an isolated T cell receptor prepared by a method as described above..

Another aspect of the invention is a method of treating and/or preventing a disease in a subject, said method comprising administering T cells expressing a T cell receptor which recognizes a peptide epitope of 5T4 said epitope comprising an amino acid sequence as set out in any of SEQ ID NOs: 1-206, optionally wherein the disease is cancer.

Another aspect of the invention is a method of promoting the regression of cancer in a subject, said method comprising a. administering an immunodepleting therapy b. administering a population according to claim 16.

Another aspect of the invention is a method of treating and/or preventing a disease in a subject, said method comprising administering a medicament comprising a T cell or a population thereof as defined above, optionally wherein the disease is cancer.

Accordingly, in another aspect, there is provided a use of a peptide epitope of 5T4 comprising an amino acid sequence as set out in any of SEQ ID NOs: 1 - 206 for identifying and isolating a T cell receptor which recognizes a 5T4 antigen. These peptides, and their corresponding SEQ. ID. NOs are set out in Figure 18.

Suitably, a peptide epitope in accordance with this aspect of the invention binds a MHC class I molecule.

In one embodiment there is provided a use of a peptide epitope comprising an amino acid sequence as set out in any of SEQ ID NOs: 8, 9, 17, 22, 23, 43, 45, 49, 55, 58, 59, 65, 71, 77, 90, 99, 100, 101, 109, 113, 117, 125, 126, 142, 151, 161, 163, 174, 176, 179, 181, 182, 183, 186, 187 and 198 for identifying and isolating a T cell receptor which recognizes a 5T4 antigen.

Suitably, a peptide epitope in accordance with the invention binds HLA-Al, HLA- A2, HLA- A3 and HLA-B7 MHC molecules.

In one embodiment a peptide epitope in accordance with the invention binds HLA-Al MHC molecules. Suitably the peptide epitope which binds to a HLA-Al MHC molecule comprises an amino acid sequence as set out in any of SEQ ID NOs: 43, 109, 125, 161 and 198 for identifying and isolating a T cell receptor which recognizes a 5T4 antigen. In another embodiment there is provided a use of a peptide epitope wherein said epitope binds to a HLA- A2 MHC molecule for identifying and isolating a T cell receptor which recognizes a 5T4 antigen. Suitably the peptide epitope which binds to a HLA-A2 MHC molecule comprises an amino acid sequence as set out in any of SEQ ID NOs: 9, 22, 49, 59, 65, 77, 90, 99, 109, 125, 142, 151, 174, 176, 179, 181, 182, 183 and 186 for identifying and isolating a T cell receptor which recognizes a 5T4 antigen.

In yet another embodiment there is provided a use of a peptide epitope wherein said epitope binds to a HLA-A3 MHC molecule for identifying and isolating a T cell receptor which recognizes a 5T4 antigen. Suitably the peptide epitope which binds to a HLA-A3 MHC molecule comprises an amino acid sequence as set out in any of SEQ ID NOs: 100, 109, 125, 142, 186 and 198 for identifying and isolating a T cell receptor which recognizes a 5T4 antigen.

Further, there is provided a use of a peptide epitope wherein said epitope binds to a HLA-B7 MHC molecule for identifying and isolating a T cell receptor which recognizes a 5T4 antigen. Suitably the peptide epitope which binds to a HLA-B7 MHC molecule comprises an amino acid sequence as set out in any of SEQ ID NOs: 8, 9, 17, 23, 45, 55, 58, 71, 101, 113, 117, 125, 126, 163, 186 and 187 for identifying and isolating a T cell receptor which recognizes a 5T4 antigen.

hi one embodiment, the peptide epitope as used in the invention comprises a sequence as set out in any of the preceding statements of the invention and consists of 6 to 18 amino acids. Suitably, said peptide consists of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 or 18 amino acids. Preferably, the peptide epitope comprises a sequence of 8 to 12 amino acids, suitably, 8 to 10 amino acids.

In another embodiment, a peptide epitope as used in the invention consists of an amino acid sequence as set out in any of SEQ ID NOs: 1-206.

In another aspect of the invention, there is provided a use of a peptide epitope of 5T4 comprising an amino acid sequence as set out in Figure 29 for identifying and isolating a T cell receptor which recognizes a 5T4 antigen. Suitably, a peptide epitope in accordance with this aspect of the invention binds a MHC class II allele.

hi another aspect of the invention, there is provided a method for screening a sample of cells for a T cell receptor which recognizes a 5T4 antigen a) contacting the sample with a peptide epitope of 5T4 according to the present invention b) detecting the presence of a T cell receptor which recognizes the 5T4 epitope.

In another aspect of the invention, there is provided a method for isolating a cell expressing a T cell receptor which recognizes a 5T4 antigen comprising a) obtaining a population of cells from a sample b) sorting the population of cells based on the presence of a T cell receptor which recognizes a peptide epitope of 5T4 according to the present invention c) isolating a cell comprising the T cell receptors which recognizes the 5T4 epitope.

Suitably the methods according the present invention are selected from FACS and MACS. Preferably, the population of cells is further sorted based on the presence of at least one other cell marker. Suitably the population of cells is expanded in vitro.

hi another aspect of the invention, there is provided a method for isolating nucleic acids encoding a T cell receptor which recognizes a 5T4 antigen comprising a) obtaining a population of cells from a sample b) expanding selectively cells present in said population, which express a T cell receptor which recognizes a 5T4 antigen, in the presence of a peptide epitope of 5T4 according to the present invention c) isolating cells comprising the T cell receptors which recognizes the 5T4 epitope d) removing and amplifying the nucleic acid encoding said T cell receptor.

Preferably, the cells are sorted prior to isolation based on the presence of a T cell receptor which recognizes a peptide epitope of 5T4 according to the present invention.

Preferably, the cells are expanded by cultivating them in the presence of antigen presenting cells (APC) loaded with the 5T4 epitope. Suitably, the APC is selected from the group of peripheral blood mononuclear cells, EBV-transformed cells, dendritic cells and T2 cells. In another aspect of the invention, there is provided a method of preparing an isolated T cell receptor which recognizes a 5T4 antigen comprising: a) isolating a nucleic acid encoding a T cell receptor which recognizes a 5T4 antigen using a peptide epitope of 5T4 according to the present invention b) introducing the nucleic acid into a host cell c) expressing the T cell receptor in said host cell d) isolating the T cell receptor.

Preferably, the nucleic acid is isolated according to a method of the present invention for isolating nucleic acids encoding a T cell receptor which recognizes a 5T4 antigen.

In another aspect of the invention, there is provided a method of preparing a T cell expressing a T cell receptor which recognizes a 5T4 antigen comprising: a) isolating a nucleic acid encoding a T cell receptor which recognizes a 5T4 antigen using a peptide epitope of 5T4 according to the present invention b) introducing the nucleic acid into said T cell.

In another aspect of the invention, there is provided a T cell comprising a T cell receptor specific to a peptide epitope of 5T4 as defined according to the present invention. Preferably, the T cell is obtainable by a method according to the present invention.

In another aspect of the invention, there is provided a population comprising T cells of the present invention. Preferably the cell population is a clonal cell population.

In another aspect of the invention, there is provided a T cell receptor which recognizes a peptide epitope of 5T4 as defined according to the present invention.

Preferably, the T cell receptor is obtainable by a method according to the present invention.

In another aspect of the invention, there is provided a method of treating and/or preventing a disease in a subject, wherein the method comprises administering a population of T cells expressing a T cell receptor which recognizes a peptide epitope of 5T4 as defined in the present invention. Preferably, the disease is cancer. In another aspect of the invention, there is provided a method of promoting the regression of cancer in a subject comprising a) administering an immunodepleting therapy b) administering a T cell population according to the present invention.

In another aspect of the invention, there is provided a use of a T cell or a T cell population or a T cell receptor according to the present invention in the preparation of a medicament for treating and/or preventing a disease in a subject. Preferably, the disease is cancer.

Advantageously, use of the epitope according to the present invention encompasses also the combined use of the epitopes with MHC class I and class II multimers, such as tetramers and pentamers.

Accordingly, in a further aspect of the invention there is provided a use of MHC multimer, tetramer or a pentamer comprising at least one of the MHC class I or II 5T4 peptide epitopes as described herein for identifying and isolating a T cell receptor which recognizes a 5T4 antigen.

Other aspects of the present invention are presented in the accompanying claims and in the following description and discussion. These aspects are presented under separate section headings. However, it is to be understood that the teachings under each section heading are not necessarily limited to that particular section heading.

Brief Description of the Drawings

The invention is further described, for the purposes of illustration only, in the following examples in which reference is made to the following Figures.

Figure 1 shows a schematic work-plan illustrating the method for identifying 5T4 CTL epitopes.

Figure 2 shows the basic iTopia binding assay. Figure 3 shows a graph of iScores for peptides 1-69.

Figure 4 shows a graph of iS cores for peptides 70-138.

Figure 5 shows a graph of iScores for peptides 139-206.

Figure 6 shows an example of the complete iTopia system.

Figure 7 shows a graph showing iScore vs iScore-rank for A*0101.

Figure 8 shows a graph showing iScore vs iScore-rank for A*0201.

Figure 9 shows a graph showing iScore vs iScore-rank for A*0301.

Figure 10 shows a graph showing iScore vs iScore-rank for B*0702.

Figure 11 shows Class 1 Peptide pool 1 retested as individual peptides at X+6wk (left) and X+10wk (right).

Figure 12 shows Class 1 Peptide pool 5 retested as individual peptides at X+6wk (left) and X+10wk (right).

Figure 13 shows Class 1 Peptide pool 20 retested as individual peptides at X+6wk (left) and X+10wk (right).

Figure 14 shows lOmer peptides and peptide pools compared to 9mer peptides and pools in the presence and absence of an A2 blocking antibody (clone BB7.2) as indicated.

Figure 15 shows analysis of HLA-A2/9 specific CD8 positive T cells in TV2-018 patient at -2wk (Plot B), X+2wk (Plot C) and X+14wk (Plot D). The percentages in the top right quadrant indicate pentamer/CD8 double positive cells as a proportion of total lymphocytes. A HLA-type mismatched pentamer complex, HLA-A1/43, was used at X+2wk as a control for non-specific background binding (Plot A).

Figure 16 shows analysis of HLA-A2/49 -specific CD8 positive T cells in TV2-108 patient at 6wk (Plot C), 19wk (Plot D). The percentages in the top right quadrant indicate pentamer/CD8 double positive cells as a proportion of total lymphocytes. A HLA-type mismatched pentamer complex HLA-Al/43 was used at 6wk (Plot A) and 19wk (Plot B) as a control for non-specific background binding.

Figure 17 is a flow chart of the identification, isolation and cloning of T cell receptors which specifically recognize peptide epitopes of 5T4 antigen.

Figure 18 shows physical data for 9-mer peptides synthesised by JPT Peptide Technologies GmbH.

Figure 19 shows peptide binding assay results.

Figure 20 shows off-rate assay results.

Figure 21 shows affinity assay results.

Figure 22 shows iScore results from all peptides tested.

Figure 23 shows a summary of iTopia results.

Figure 24 shows peptides selected for further functional analysis in descending order of iScore.

Figure 25a shows constituents of the 5T4 iTopia hit peptide pools used in the immunomonitoring of patients' IFNγ ELISPOT responses. The figure illustrates the peptide ID and amino acid sequence for components of the A2 iTopia hit pool and the combined A1/A3/B7 iTopia hit pool. Figure 25b shows constituents of the 5T4 peptide pools used in the immunomonitoring of patients' IFNγ ELISPOT responses. The figure illustrates the peptide ID and amino acid sequence for components of each peptide pool.

Figure 26 shows positive IFNγ ELISPOT responses detected in PBMCs (recovered from TroVax® treated patients) following stimulation with 5T4 peptide pools. The figure details results where a positive ELISPOT response was detected to a 5T4 peptide pool which contained an iTopia hit for either HLA Al, A2, A3 or B7 and the responding patient had a matching allele.

Figure 27 shows positive IFNγ ELISPOT responses detected in PBMCs (recovered from TroVax® treated patients) following stimulation with iTopia hit peptides. The figure lists patients who showed a positive ELISPOT response to the A2 peptide pool or the A1/A3/B7 pool and had the same corresponding HLA type.

Figure 28 shows dissection of positive IFNγ ELISPOT responses detected in PBMCs (recovered from TroVax® treated patients) following stimulation with 5T4 peptides. The figure details patients who had initially shown a positive IFNγ ELISPOT response to 5T4 peptide pools 1, 5, 13 or 20 or the individual peptide 77. Following dissection of the peptide pool into its constituents, the single peptide responsible for the positive ELISPOT response is tabulated. In some cases, the MHC restriction of the response is known (either through use of a blocking antibody or a previously identified CTL epitope) and is listed. The HLA restriction of these CTL epitopes predicted by iTopia is also shown. Finally, pentamers have been synthesised for 2 of HLA A2 eptiopes (9 and 49) and also demonstrated positive responses in PBMCs from 2 patients

Figure 29 shows details of individual class II peptides and class II peptide pools.

Figure 30 shows positive IFNγ ELISPOT responses detected in PBMCs (recovered from TroVax® treated patients) following stimulation with 5T4 20mer peptides 39.2 and 41.2.

Figure 31 shows positive proliferative responses detected in PBMCs (recovered from TroVax® treated patients) following stimulation with 5T4 20mer peptides and peptide pools. Figure 32 shows HLA-type distribution among positive proliferative responses to 5T4 20mer peptides and peptide pools detected in PBMCs (recovered from TroVax® treated patients). The number of individuals responding to a particular antigen is shown as a fraction of the total number of responding patients (whose HLA type is known) for that antigen.

Detailed Description of the Invention

The present invention relates to the use of peptide epitopes of 5T4 for identifying and isolating a T cell receptor which recognizes a 5T4 antigen.

5T4

5T4 has been previously characterised, for example, in WO 89/07947. The sequence of human 5T4 appears in GenBank at accession no. Z29083. The peptide epitopes may also be derived from a corresponding 5T4 antigen from a different species, such as murine 5T4 (WO 00/29428), canine 5T4 (WO 01/36486) or feline 5T4. The peptide epitopes may also be derived from a naturally occurring variant of 5T4 found in a particular species, preferably a mammal. Such a variant may be encoded by a related gene of the same gene family, by an allelic variant of a particular gene, or represent an alternative splicing variant of the 5T4 gene.

A peptide derived from 5T4 from a different species or a splice variant may have a different amino acid sequence from the analogous human wild-type 5T4 peptide. However, as long as the peptide retains the same qualitative binding specificity as the human peptide (i.e. it binds in the peptide binding groove of an MHC molecule of the same haplotype) then it is still an epitope in accordance with the present invention.

Peptide epitopes of5T4

The term "peptide" is used in the normal sense to mean a series of residues, typically L-amino acids, connected one to the other typically by peptide bonds between the α-amino and carboxyl groups of adjacent amino acids. The term includes modified peptides and synthetic peptide analogues.

A T cell epitope or peptide epitope is a short peptide derivable from a protein antigen. Antigen presenting cells can internalize antigen and process it into short fragments which are capable of binding MHC molecules. The specificity of peptide binding to the MHC depends on specific interactions between the peptide and the peptide-binding groove of the particular MHC molecule.

Peptides which bind to MHC class I molecules (and are recognised by CD8+ T cells) are usually between 6 and 12, more usually between 8 and 12 amino or 8 and 10 amino acids in length. Typically, peptides are 9 amino acids in length. The amino-terminal amine group of the peptide makes contact with an invariant site at one end of the peptide groove, and the carboxylate group at the carboxy terminus binds to an invariant site at the other end of the groove. Thus, typically, such peptides have a hydrophobic or basic carboxy terminus and an absence of proline in the extreme amino terminus. The peptide lies in an extended conformation along the groove with further contacts between main-chain atoms and conserved amino acid side chains that line the groove. Variations in peptide length are accommodated by a kinking in the peptide backbone, often at proline or glycine residues.

Peptides which bind to MHC class II molecules are usually at least 10 amino acids, for example about 13-18 amino acids in length, and can be much longer. These peptides lie in an extended conformation along the MHC II peptide-binding groove which is open at both ends. The peptide is held in place mainly by main-chain atom contacts with conserved residues that line the peptide-binding groove.

The peptides used in the present invention may be made using chemical methods (Peptide Chemistry, A Practical Textbook. Mikos Bodansky, Springer- Verlag, Berlin.). For example, peptides can be synthesized by solid phase techniques (Roberge JY et al. (1995) Science 269: 202-204), cleaved from the resin, and purified by preparative high performance liquid chromatography (e.g., Creighton (1983) Proteins Structures And Molecular Principles, WH Freeman and Co, New York NY). Automated synthesis may be achieved, for example, using the ABI 43 1 A Peptide Synthesizer (Perkin Elmer) in accordance with the instructions provided by the manufacturer.

The peptide may alternatively be made by recombinant means, or by cleavage from a longer polypeptide. For example, the peptide may be obtained by cleavage from full-length 5T4. The composition of a peptide may be confirmed by amino acid analysis or sequencing (e.g., the Edman degradation procedure).

The term "peptide epitope" also encompasses modified peptides. For example 5T4 peptides may be mutated, by amino acid insertion, deletion or substitution, so long as the MHC binding-specificity of the wild-type 5T4 peptide is retained. In a preferred embodiment the modified epitope has greater affinity for the peptide binding groove. Preferably the peptide contains five or fewer mutations from the wild-type sequence, more preferably three or fewer, most preferably one or zero mutations.

Alternatively (or in addition) modifications may be made without changing the amino acid sequence of the peptide. For example, D-amino acids or other unnatural amino acids can be included, the normal amide bond can be replaced by ester or alkyl backbone bonds, N- or C-alkyl substituents, side chain modifications, and constraints such as disulphide bridges and side chain amide or ester linkages can be included. Such changes may result in greater in vivo stability of the peptide, and a longer biological lifetime.

Modification of epitopes may be performed based on predictions for more efficient T cell induction derived using the program "Peptide Binding Predictions" devised by K. Parker at the National Institutes of Health (NIH); <http://www-bimas.dcrt.nih.gov/cgi- bin/molbio/ken_parker_comboform> (see Parker, K. C et al. 1994. J.Immunol. 152:163).

A "modified" 5T4 peptide epitope includes peptides which have been bound or otherwise associated to transporter peptides or adjuvants, in order to increase their ability to elicit an immune response. For example, peptides may be fused to TAP independent transporter peptides for efficient transport to HLA and interaction with HLA molecules to enhance CTL epitopes (for review see Yewdell et at, 1998 J Immunother 21:127-31; Fu et al, (1998) J Virol 72:1469-81). To be an epitope, the peptide should be capable of binding to the peptide-binding groove of a MHC class I or II molecule and be recognised by a T cell.

Cell surface presentation of peptides derived from a given antigen is not random and tends to be dominated by a small number of frequently occurring epitopes. The dominance of a particular peptide will depend on many factors, such as relative affinity for binding the MHC molecule, spatio-temporal point of generation within the APC and resistance to degradation.

The epitope hierarchy for an antigen is thought to change with progression of an immune response. After a primary immune response to the immunodominant peptides, epitope "spreading" may occur to sub-dominant determinants (Lehmann et al. (1992) Nature 358: 155-

157).

For any given antigen, cryptic epitopes may also exist. Cryptic epitopes are those which can stimulate a T cell response when administered as a peptide but which fail to produce such a response when administered as a whole antigen. It may be that during processing of the antigen into peptides in the APC the cryptic epitope is destroyed.

The peptide used in the invention may be an immunodominant epitope, a sub-dominant epitope or a cryptic epitope of 5T4.

Epitopes for an antigen may be identified by measuring the T cell response to overlapping peptides spanning a portion of the antigen (see below) when presented by APC. Such studies usually result in "nested sets" of peptides, and the minimal epitope for a particular T cell line/clone can be assessed by measuring the response to truncated peptides.

The minimal epitope for an antigen may not be the best epitope for practical purposes. It may well be that amino acids flanking the minimal epitope will be required for optimal binding to the MHC.

The peptides are tested in an antigen presentation system which comprises antigen presenting cells and T cells. For example, the antigen presentation system may be a murine splenocyte preparation, a preparation of human cells from tonsil or PBMC. Alternatively, the antigen presentation system may comprise a particular T cell line/clone and/or a particular antigen presenting cell type. T cell activation may be measured via T cell proliferation (for example using ³H-thymidine incorporation) or cytokine production. Activation of THl -type CD4+ T cells can, for example be detected via IFNγ production which may be detected by standard techniques, such as an ELISPOT assay.

MHC Multimers

5T4 peptide epitope associated with (eg. folded with) MHC multimers (such as tetramers and pentamers) are particularly useful in the methods and uses of the present invention.

Tetramers

Tetramers are fluorescent reagents that allow for the direct visualisation of antigen-specific T-cells (Altaian et al. (1996) Science 271, 94-96). They consist of individual peptide epitopes refolded with HLA class I protein and bind to T cells that are specific for that particular epitope. They allow for the direct quantification of antigen specific lymphocytes and have been applied widely in human and murine immunology.

The tetramers may be prepared using the methods described by Airman et al. (1996) Science 271, 94-96. Briefly, tetramers may be prepared by adding biotinylated protein to streptavidin PE at a ratio of 4:1. Tetramer bound cells may be selected using magnetic activated cell sorting (MACS). MACS has been described in Radbruch et al. (1994) Methods in Cell Biology 42, 387-403.

Pentamers

5T4 peptide epitope associated with pentamers are particularly useful in the methods and uses of the present invention.

Pentamers are similar to tetramers but include five refolded peptide epitopes. Suitable pentamers include Pro5™ MHC Pentamers containing five MHC-peptide complexes that are multimerized by a self-assembling coiled-coil-domain. All five MHC-peptide complexes are held facing in the same direction, similar to a bouquet of flowers. Therefore, with Pro5™ MHC Pentamer technology, all five MHC-peptide complexes are available for binding to T cell receptors (TCRs), resulting in an interaction with very high avidity.

Each Pro5™ MHC Pentamer also contains up to five fluorescent molecules yielding an improved fluorescence intensity of the complex. Pro5™ MHC Pentamers are fully compatible with existing applications for MHC tetramers. They can also be used in combination with other technologies such as intracellular cytokine staining (e.g. IFNg / IL-2) and/or surface markers (e.g. CD69 / CD45RO) to establish an accurate profile of the functional phenotype of antigen specific T cell subsets.

Suitable pentamers can be generated to comprise 5T4 peptide epitopes of the invention.

Advantageously, the use of tetramers and pentamers allows the identification and isolation of a cell expressing a T cell receptor which recognizes a 5T4 antigen from a sample comprising a mixed population of cells, for example by using magnetic activated cell sorting. Accordingly, the present invention also relates to the use of a 5T4 peptide epitope tetramer, pentamer or multimer in a method of isolating cells expressing a T cell receptor which recognizes a 5T4 antigen from a population of cells.

Furthermore, tetramers, pentamers are useful for surface staining of cells expressing a T cell receptor which is specific for the peptide epitope of the tetramer or pentamer. Accordingly, the present invention relates to methods for identifying cells expressing a T cell receptor wherein the method comprises a further step of staining the cell with a tetramer or pentamer comprising a peptide epitope of 5T4.

Nucleic acids encoding 5T4 epitopes and T cell receptors

The present invention also relates to a nucleic acid sequence capable of encoding a peptide epitope of 5T4 useful in the methods and uses of the invention. For example, nucleic acids capable of encoding a peptide epitope of 5T4 can be introduced into antigen presenting cells which are used to expand selectively cells which recognize a 5T4 antigen. The present invention also relates to a nucleic acid sequence capable of encoding a T cell receptor which recognizes 5T4. For example, nucleic acids capable of encoding a T cell receptor recognizing 5T4 can be introduced into T cells.

A "nucleic acid", as referred to herein, may be DNA or RNA, naturally-occurring or synthetic, or any combination thereof. Nucleic acids according to the invention are limited only in that they serve the function of encoding a 5T4 peptide or a T cell receptor in such a way that it may be translated by the machinery of the cells of a host organism. Thus, natural nucleic acids may be modified, for example to increase the stability thereof. DNA and/or RNA, but especially RNA, may be modified in order to improve nuclease resistance of the members. For example, known modifications for ribonucleotides include 2'-O-methyl, 2'-fluoro, 2'-NH₂, and 2'-O-allyl. The modified nucleic acids according to the invention may comprise chemical modifications which have been made in order to increase the in vivo stability of the nucleic acid, enhance or mediate the delivery thereof, or reduce the clearance rate from the body. Examples of such modifications include chemical substitutions at the ribose and/or phosphate and/or base positions of a given RNA sequence. See, for example, WO 92/03568; U.S. 5,118,672; Hobbs et al., (1973) Biochemistry 12:5138; Guschlbauer et al., (1977) Nucleic Acids Res. 4:1933; Schibaharu et al, (1987) Nucleic Acids Res. 15:4403; Pieken et al., (1991) Science 253:314, each of which is specifically incorporated herein by reference.

Given the guidance provided herein, the nucleic acids used in the invention are obtainable according to methods well known in the art. For example, a DNA of the invention is obtainable by chemical synthesis, using polymerase chain reaction (PCR) or direct cleavage from a longer polynucleotide, such as the entire 5T4 coding sequence or a fragment thereof.

Chemical methods for synthesis of a nucleic acid of interest are known in the art and include triester, phosphite, phosphoramidite and H-phosphonate methods, PCR and other autoprimer methods as well as oligonucleotide synthesis on solid supports. These methods may be used if the entire nucleic acid sequence of the nucleic acid is known, or the sequence of the nucleic acid complementary to the coding strand is available. Alternatively, if the target amino acid sequence is known, one may infer potential nucleic acid sequences using known and preferred coding residues for each amino acid residue. It is envisaged that the nucleic acid of the invention can be modified by nucleotide substitution, nucleotide deletion, nucleotide insertion or inversion of a nucleotide stretch, and any combination thereof. Such mutants can be used e.g. to produce a 5T4 peptide or T cell receptor that has an amino acid sequence differing from the wild-type 5T4 epitope or T cell receptor. Such a peptide or T cell receptor is still a peptide or T cell receptor in accordance with the use of the present invention if it retains the capacity to act as a T cell epitope or T cell receptor recognizing a T cell epitope. Mutagenesis may be predetermined (site-specific) or random. A mutation which is not a silent mutation should not place sequences out of reading frames and preferably will not create complementary regions that could hybridize to produce secondary mRNA structure such as loops or hairpins.

Advantageously, nucleic acids encoding peptide epitopes of 5T4 can be used to transfect antigen presenting cells such as autologous dendritic cells which express the peptide epitopes endogenously. Accordingly, the present invention provides also methods wherein the antigen presenting cells have been transfected with nucleic acids encoding 5T4 peptide epitopes.

Variants/fragments/homologues/derivatives

The present invention encompasses the use of nucleotide and amino acid sequences and variants, homologues, derivatives and fragments thereof.

The term "variant" is used to mean a naturally occurring polypeptide or nucleotide sequence which differs from a wild-type sequence.

The term "fragment" indicates that a polypeptide or nucleotide sequence comprises a fraction of a subject sequence. Preferably the sequence comprises at least 50%, more preferably at least 65%, more preferably at least 80%, more preferably at least 90%, most preferably at least 90% of the subject sequence. If the fragment is a fragment of an amino acid then preferably the fragments are 6-12 amino acids in length. More preferably, the fragments are 8, 9 or 10 amino acids in length. Suitably such fragments are capable of binding MHC class I or MHC class II. The term "homologue" means an entity having a certain homology with the subject amino acid sequences and the subject nucleotide sequences. Here, the term "homology" can be equated with "identity".

In the present context, a homologous sequence is taken to include an amino acid sequence, which may be at least 75, 85 or 90% identical, preferably at least 95 or 98% identical to the subject sequence. Typically, the homologues will comprise the same activity as the subject amino acid sequence. Although homology can also be considered in terms of similarity (i.e. amino acid residues having similar chemical properties/functions), in the context of the present invention it is preferred to express homology in terms of sequence identity.

In the present context, a homologous sequence is taken to include a nucleotide sequence, which may be at least 75, 85 or 90% identical, preferably at least 95 or 98% identical to the subject sequence. Typically, the homologues will comprise the same activity as the subject sequence. Although homology can also be considered in terms of similarity (i.e. amino acid residues having similar chemical properties/functions), in the context of the present invention it is preferred to express homology in terms of sequence identity.

Homology comparisons may be conducted by eye, or more usually, with the aid of readily available sequence comparison programs. These commercially available computer programs can calculate % homology between two or more sequences.

% homology may be calculated over contiguous sequences, i.e. one sequence is aligned with the other sequence and each amino acid in one sequence is directly compared with the corresponding amino acid in the other sequence, one residue at a time. This is called an "ungapped" alignment. Typically, such ungapped alignments are performed only over a relatively short number of residues.

Although this is a very simple and consistent method, it fails to take into consideration that, for example, in an otherwise identical pair of sequences, one insertion or deletion will cause the following amino acid residues to be put out of alignment, thus potentially resulting in a large reduction in % homology when a global alignment is performed. Consequently, most sequence comparison methods are designed to produce optimal alignments that take into consideration possible insertions and deletions without penalising unduly the overall homology score. This is achieved by inserting "gaps" in the sequence alignment to try to maximise local homology.

However, these more complex methods assign "gap penalties" to each gap that occurs in the alignment so that, for the same number of identical amino acids, a sequence alignment with as few gaps as possible - reflecting higher relatedness between the two compared sequences - will achieve a higher score than one with many gaps. "Affine gap costs" are typically used that charge a relatively high cost for the existence of a gap and a smaller penalty for each subsequent residue in the gap. This is the most commonly used gap scoring system. High gap penalties will of course produce optimised alignments with fewer gaps. Most alignment programs allow the gap penalties to be modified. However, it is preferred to use the default values when using such software for sequence comparisons. For example, when using the GCG Wisconsin Bestfit package the default gap penalty for amino acid sequences is -12 for a gap and -4 for each extension.

Calculation of maximum % homology therefore firstly requires the production of an optimal alignment, taking into consideration gap penalties. A suitable computer program for carrying out such an alignment is the GCG Wisconsin Bestfit package (University of Wisconsin, U.S.A.; Devereux et al, 1984, Nucleic Acids Research 12:387). Examples of other software than can perform sequence comparisons include, but are not limited to, the BLAST package (see Ausubel et al, 1999 ibid - Chapter 18), FASTA (Atschul et al, 1990, J. MoI. Biol., 403- 410) and the GENEWORKS suite of comparison tools. Both BLAST and FASTA are available for offline and online searching (see Ausubel et al, 1999 ibid, pages 7-58 to 7-60). However, for some applications, it is preferred to use the GCG Bestfit program. A new tool, called BLAST 2 Sequences is also available for comparing protein and nucleotide sequence (see FEMS Microbiol Lett 1999 174(2): 247-50; FEMS Microbiol Lett 1999 177(1): 187-8).

Although the final % homology can be measured in terms of identity, the alignment process itself is typically not based on an all-or-nothing pair comparison. Instead, a scaled similarity score matrix is generally used that assigns scores to each pairwise comparison based on chemical similarity or evolutionary distance. An example of such a matrix commonly used is the BLOSUM62 matrix - the default matrix for the BLAST suite of programs. GCG Wisconsin programs generally use either the public default values or a custom symbol comparison table if supplied (see user manual for further details). For some applications, it is preferred to use the public default values for the GCG package, or in the case of other software, the default matrix - such as BLOSUM62.

Once the software has produced an optimal alignment, it is possible to calculate % homology, preferably % sequence identity. The software typically does this as part of the sequence comparison and generates a numerical result.

The sequences may also have deletions, insertions or substitutions of amino acid residues, which produce a silent change and result in a functionally equivalent substance. Deliberate amino acid substitutions may be made on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity, and/or the amphipathic nature of the residues as long as the secondary binding activity of the substance is retained. For example, negatively charged amino acids include aspartic acid and glutamic acid; positively charged amino acids include lysine and arginine; and amino acids with uncharged polar head groups having similar hydrophilicity values include leucine, isoleucine, valine, glycine, alanine, asparagine, glutamine, serine, threonine, phenylalanine, and tyrosine.

Conservative substitutions may be made, for example, according to Table C, below. Amino acids in the same block in the second column and preferably in the same line in the third column may be substituted for each other:

Table C

The use according to the present invention also encompasses homologous substitution in the peptide epitopes (substitution and replacement are both used herein to mean the interchange of an existing amino acid residue, with an alternative residue) may occur i.e. like-for-like substitution - such as basic for basic, acidic for acidic, polar for polar etc. Non-homologous substitution may also occur i.e. from one class of residue to another or alternatively involving the inclusion of unnatural amino acids - such as ornithine (hereinafter referred to as Z), diaminobutyric acid ornithine (hereinafter referred to as B), norleucine ornithine (hereinafter referred to as O), pyriylalanine, thienylalanine, naphthylalanine and phenylglycine.

Replacements may also be made by unnatural amino acids include; alpha* and alpha-disubstituted* amino acids, N-alkyl amino acids*, lactic acid*, halide derivatives of natural amino acids - such as trifluorotyrosine*, p-Cl-phenylalanine*, p-Br-phenylalanine*, p-I-phenylalanine*, L-allyl-glycine*, β-alanine*, L-α-amino butyric acid*, L-γ-amino butyric acid*, L-α-amino isobutyric acid*, L-ε-amino caproic acid^#, 7-amino heptanoic acid*, L-methionine sulfone , L-norleucine*, L-norvaline*, p-nitro-L-phenylalanine*, L-hydroxyproline^#, L-thioproline*, methyl derivatives of phenylalanine (Phe) - such as 4-methyl-Phe*, pentamethyl-Phe*, L-Phe (4-amino) , L-Tyr (methyl)*, L-Phe (4-isopropyl)*, L-Tic (l,2,3,4-tetrahydroisoquinoline-3-carboxyl acid)*, L-diaminopropionic acid and L-Phe (4-benzyl)*. The notation * has been utilised for the purpose of the discussion above (relating to homologous or non-homologous substitution), to indicate the hydrophobic nature of the derivative whereas # has been utilised to indicate the hydrophilic nature of the derivative, #* indicates amphipathic characteristics.

Variant amino acid sequences may include suitable spacer groups that may be inserted between any two amino acid residues of the sequence including alkyl groups - such as methyl, ethyl or propyl groups - in addition to amino acid spacers - such as glycine or β-alanine residues. A further form of variation involves the presence of one or more amino acid residues in peptoid form will be well understood by those skilled in the art. For the avoidance of doubt, "the peptoid form" is used to refer to variant amino acid residues wherein the α-carbon substituent group is on the residue's nitrogen atom rather than the α-carbon. Processes for preparing peptides in the peptoid form are known in the art, for example, Simon RJ et cd., PNAS (1992) 89(20), 9367-9371 and Horwell DC, Trends Biotechnol. (1995) 13(4), 132-134. The nucleotide sequences for use in the present invention may include within them synthetic or modified nucleotides. A number of different types of modification to oligonucleotides are known in the art. These include methylphosphonate and phosphorothioate backbones and/or the addition of acridine or polylysine chains at the 3' and/or 5' ends of the molecule. For the purposes of the present invention, it is to be understood that the nucleotide sequences may be modified by any method available in the art. Such modifications may be carried out to enhance the in vivo activity or life span of nucleotide sequences useful in the present invention. T cells

T cells can be divided into two distinct populations: a subset which carries the CD4 marker and mainly "helps" or "induces" immune responses (T_H) and a subset which carries the CD8 marker and is predominantly cytotoxic (Tc). CD4+ T cells recognise peptides in association with MHC class II molecules, whereas CD8+ T cells recognise peptides in association with Class I molecules, so the presence of CD4 or CD8 restricts the types of cell with which the T cell can interact.

Human CD4+ T cell population is a heterogeneous collection of lymphocytes having different phenotypic and functional properties. These cells can be divided into functionally distinct and largely reciprocal subsets based on their differential expression of CD45 isoforms (CD45RA and CD45RO) and CD29/integrin betal subunit (Morimoto et al. J Immunol (1985): 3762-9). The CD4+CD45RO+CD29high memory (helper inducer) subset responds preferentially to soluble recall antigens such as tetanus toxoid (TT), and provides a strong helper function for IgG production by B cells (Smith et al. Immunology (1986); 58: 63-70). In contrast, the CD4+CD45RA+CD291ow naive (suppressor inducer) subset responds poorly to recall antigens and lacks the helper function, but this T cell subset proliferates maximally in autologous mixed lymphocyte reaction (AMLR) (Morimoto et al. J Immunol (1985); 134: 1508-15). Functional diversity has also been demonstrated by functional analysis of T_H clones for cytokine secretion patterns. The T_HI subset of CD4+ T cells secrete EL-2 and IFN-γ, whereas the T_H2 subset produces IL-4, IL-5, DL-6 and BL-IO. THI cells mediate several functions associated with cytotoxicity and local inflammatory reactions. Consequently, these cells are important for combating intracellular pathogens, including viruses, bacteria and parasites. T_H2 cells are more effective at stimulating B cells to proliferate and produce antibodies, and therefore in normal immune responses function to protect against free-living organisms.

The definitive T cell lineage marker is the T cell receptor (TCR). There are presently two defined types of TCR, both of which are heterodimers of two disulphide-linked polypeptides. One type consists of α and β chains, the other type consists of γ and δ chains. Approximately 90-95 % of blood T cells express α/β TCR, the other 5-10% express γ/δ TCR.

Expression of all of the markers described above can readily be detected using specific antibodies, so the type of T cell can be selected/determined using FACS. Expression of particular cytokines can also be detected by methods known in the art, such as the ELISPOT assay.

Accordingly, the present invention relates to methods for isolating a T cell expressing a T cell receptor which recognizes a 5T4 antigen wherein a population of cells is sorted based on the presence of a T cell receptor which recognizes a peptide epitope of 5T4 and the presence of at least one other marker.

Several methods for generating T cell lines and clones are known in the art. One method for generating T cell lines is as follows:

Mice are primed with antigen (usually subcutaneously in the rear footpad), and the draining lymph nodes (in this case the popliteal and inguinal) are removed 1 week later and set up in co-culture with the antigen and with syngeneic feeder cells, i.e. cells from mice of the same inbred line (e.g. normal thymocytes or splenocytes). After four days the lymphoblasts are isolated and induced to proliferate with IL-2. When the population of cells has expanded sufficiently, they are checked for antigen and MHC specificity in a lymphocyte transformation test, and are maintained by alternate cycles of culture on antigen-treated feeder cells and culture in IL-2-containing medium.

T cell receptors

The present invention also provides methods and uses for identifying and isolating T cell receptors which recognise a peptide epitope of 5T4. A T cell receptor is considered to "recognize" a peptide sequence of the present invention if there is a greater than 2 fold difference, and preferably a 10, 25, 50 or 100 fold difference between the binding of the T cell receptor to a peptide of the present invention and another peptide sequence.

The T cell receptor may be capable of binding specifically to the peptide epitope when presented by an MHC molecule.

An number of methods for determining the affinity of a TCR to the peptide epitope to which it specifically binds (or recognizes) are known in the art ( Foote and Eisen PNAS (2000), 97, 10679-81 and references therein). For example, TCR affinity values can be determined with monomeric soluble pepMHC complexes either with the TCR having also been obtained in soluble form and immobilized on a biosensor chip ("cell-free" affinity), or with the TCR in its natural state as an integral membrane protein on live T cells. With live T cells, Kd values (intrinsic affinity) have been found to vary from slightly above 100 μM to 0.1 μM. In cell- free systems the values tend to be weaker. One difference is the absence in the cell-free system of the CD8 coreceptor found on cytotoxic T lymphocytes. CD8 interacts with a conserved MHC domain on target cells at a Kd of 104 M, and the free energy of this interaction could boost the observed affinity of TCR for pepMHC. Second, specific T cell responses to the pepMHC they recognize (also termed epitopes) on target cells appear to be determined by affinity of the TCR for its epitope and the number of copies of the epitope per target cell (epitope density). The epitope density is a fundamental parameter for interpreting TCR affinity as it applies to T cell function. Other approximations may come from cell lines expressing surface MHC molecules having empty peptide-binding sites. Extracellular peptides can bind to these MHC molecules, thereby creating epitopes on target cells. For peptides that react similarly with any particular MHC, relative epitope density values thus have been estimated from the concentration of free peptide needed to elicit a T cell response of a particular magnitude (e.g., half-maximal lysis of target cells in cytolytic reactions).

Single-chain TCRs are artificial constructs comprising a single amino acid strand, which like native heterodimeric TCRs bind to MHC-peptide complexes. WO 2004/033685 describes a class of alpha/beta-analogue single-chain TCRs which are characterised by the presence of a disulphide bond between residues of the single amino acid strand, which contributes to the stability of the molecule. WO 99/60119 describes synthetic multivalent soluble TCR complexes with a plurality of TCR binding sites and increased avidity.

The TCR may be associated with another molecule such as CD4 (for MHC class II epitopes) or CD8 (for MHC class I epitopes). Alternatively, or in addition, the receptor may be associated with CD3.

It is also possible to engineer chimeric immune receptors (CIRs) which comprise a tumor antigen recognition function and a T cell signalling function (such as the ζ chain of the TCR). Antibody-based and TCR-based chimeric CIRs have been reported. Chimeric TCRs incorporating both CD3ζ and CD28 signalling domains in their cytoplasmic regions have been found to mediate higher amounts of cytokine secretion than receptors incorporating either domain alone. Domains from other co-stimulatory molecules could be incorporated into TCRs such as OX40, 4-1BB and ICOS (Kershaw et al. 2005, Nature Reviews Immunology 5: 928-940). Thus TCRs which recognise tumor antigens such as 5T4 or the peptides of the invention could be used to generate such CIRs with enhanced antitumor efficacy.

The TCRs described herein can also be attached or combined with a therapeutic agent whereby the specificity of the TCR enables localization of the therapeutic agent to the desired target site such as a tumor. The therapeutic agent may be a toxic moiety for use in cell killing, or an immunostimulatory agent such as a cytokine or interleukin. The therapeutic agent may be attached to the TCR via a linker.

If the T cell receptor occurs naturally in the human body, then preferably the T cell receptor of the present invention is in a substantially isolated form.

In order to detect specific T cells, an antigen presentation assay may be used. When a T cell successfully recognizes an MHC:peptide complex, it is stimulated. This stimulation can be monitored by proliferation of the T cells (for example by incorporation of ³H) and/or by production of cytokines by the T cells (for example by an ELISPOT assay). Thus it is possible to detect the presence of a specific peptide by using appropriate APCs and T cells lines, and to detect the presence of a specific T cell by using appropriate APCs and peptide/antigen. Tetramers, pentamers or multimers may also be used to detect specific T cells as discussed above.

The presence of a particular cell surface molecule (such as a TCR or MHC molecule) can also be investigated using fluorescence activated cell scanning (FACS) or magnetic activated cell scanning (MACS).

Cell populations

Samples and cell populations useful in the method and uses of the present invention are available. For example, samples may be taken from a patient who suffers from cancer, in particular a cancer in which 5T4 is expressed as a tumor antigen.

Preferably the patient has received one or more rounds of immunization with a 5T4 antigen based vaccine, for example TroVax®.

Samples which are particularly suitable in the methods and uses of the present invention are derived from patients who express the HLA A2 allele.

Patient samples may be further processed to isolate the PBMCs according to conventional methods.

Advantageously, samples from patients who receive one or more rounds of immunization with a 5T4 based vaccine (for example, described in WO 00/29428) are likely to be enriched with immune cells specific for the 5T4 antigen. Furthermore, these samples might also contain cells expressing TCRs which have a very high affinity for the 5T4 antigen. Cell populations from these samples have high density and high affinity of T cells and are thus particularly useful for the identification and isolation of T cells expressing receptors which recognize the 5T4 antigen. Accordingly, the present invention relates to methods of isolating

T cells expressing T cell receptors which recognize 5T4 wherein the cell populations have been taken from patients who received one or more administrations of a 5T4 based vaccine. Expanding cells

Cells which have been selectively expanded based on their ability to recognize a 5T4 antigen are useful in the methods and uses the present invention.

Methods for expanding cells are well known in the art, for example WO 2004/021995 discloses a method of expanding T cells in IL-2 followed by further expansion using irradiated allogenic feeder cells, OKT3 antibody and IL-2.

Expansion of cells means an increase in the number of 5T4 peptide epitope specific T cells of at least about 3 -fold over a period of two weeks , more preferably at least about 10-fold over a period of two weeks.

Cells are expanded by cultivating a mixed cell population in the presence of antigen presenting cells loaded with a 5T4 peptide epitope. Preferably, these cells are autologous dendritic cells. The autologous dendritic cell may have been generated in the presence of cytokines (such as GM-CSF and IL-4) followed by a maturation step with pro-inflammatory cytokines (such as EL- lβ, IL-6, TNF-α, and PGE2). The dendritic cells are loaded with peptide epitopes of 5T4 according to the present invention and co-cultured with autologous PBMCs in the presence of cytokines (such as IL-2, IL7, IL12). After several days, for example 7 to 10 days, cultures will be re-stimulated with dendritic cells loaded with the same peptide epitopes of 5T4. Several days after the second stimulation the expanded T cell population will be counted, for example, ELISPOT analysis will be performed to evaluate the number of peptide-specific T cells.

It is advantageous to include an expansion step when isolating nucleic acids coding for the T cell receptors, although it is possible to sort peptide-specific T cells for RNA extraction from ex vivo PBMCs without the expansion stage.

Whilst cDNA synthesis from very low starting amounts of RNA is possible, the numbers of peptide-specific cells recovered from direct ex vivo sorting are likely to be very low. Additionally, specific polyclonal T cells sorted after 2 rounds of in vitro stimulation may result in a mixed population of TCR sequences that could not be assigned as 5T4 specific especially as there maybe unequal, variable numbers of α and β chains involved. Another argument in favor of expanding the cell prior to nucleic acid isolation arises from information available on the TCR repertoire of T cell clones generated from polyclonal cell lines. AU experiments to determine TCR usage have employed individual T cell clones. Montagna et al (2006) investigated T cell receptor usage by T cell clones generated from leukaemia blast-specific polyclonal T cell line. They demonstrated that T cell clones generated from the T cell line expressed a wide repertoire of different T cell receptor Vβ families. Similar results have been obtained by Dietrich et al. (2003) investigating A2 restricted Melan-A multimers and also by Weekes et al. (1999) and Keever-Taylor et al. (2001) in a viral model. By analysis of T cell receptor usage by HIV and CMV specific T cell clones, it was demonstrated that individual clones recognised the same epitope peptide via multiple TCRs in both the CMV and HIV systems.

There is the possibility that direct sorting of 5T4 peptide-specific T cells from a heterogeneous PBMC population may yield a population of peptide-specific T cells recognizing the same peptide through multiple T cell receptors, making TCR cloning and identification of the correct TCR sequence more difficult. Therefore, it is advantageous to expand the T cell population and isolate clonal lines prior to cDNA production and TCR sequence analysis.

Accordingly, the present invention also relates to methods for identifying cells expressing a T cell receptor which recognizes a 5T4 antigen and isolating nucleic acids encoding a T cell receptor which recognizes a 5T4 antigen wherein the cells have been selectively expanded prior to identification / isolation.

Antigen presenting cells

Antigen presenting cells are well known in the art.

Preferably, the antigen presenting cells are capable of expressing MHC class I or class II molecules.

Preferably the cells are autologous cells. MHC class I molecules can be expressed on nearly all cell types, but expression of MHC class II molecules is limited to so-called "professional" antigen presenting cells (APCs); B cells, dendritic cells and macrophages.

Expression of MHC class I or MHC class II molecules can also be achieved by genetic engineering (i.e. provision of a gene encoding the relevant MHC molecule to the cell to be pulsed). This approach has the advantage that an appropriate MHC haplotype(s) can be chosen which bind to specific peptide(s).

An antigen presenting cell is a cell which, in a normal immune response, is capable of processing an antigen and presenting it at the cell surface in conjunction with an MHC molecule. Antigen presenting cells include B cells, macrophages and dendritic cells. Preferably antigen presenting cells for use in the present invention are selected from the group of PBMCs, EBV-transformed B cell blasts, dendritic cell and T2 cells. In an especially preferred embodiment, the APC is a dendritic cell.

Preferably, the APC is capable of expressing an MHC molecule which binds a peptide according to the invention in its peptide binding groove.

The antigen presenting cell can be either exogenously loaded with an antigen in the form of a peptide or protein or they can be modified for endogenous expression of the antigen. The antigen presenting cell can be pulsed to load the antigen.

Peptide pulsing protocols are known in the art (see for example Redchenko and Rickinson (1999) J. Virol. 334-342; Nestle et al (1998) Nat. Med. 4 328-332; Tjandrawan et al (1998) J. Immunotherapy 21 149-157). For example, in a standard protocol for loading dendritic cells with peptides, cells are incubated with peptide at 50 μg/ml with 3 μg/ml β-2 microglobulin for two hours in serum free medium. The unbound peptide is then washed off.

Advantageously, the use of autologous dendritic cells which have been loaded with a peptide epitope of 5T4 or which express a peptide epitope of 5T4 allow the selective expansion of cells expressing T cell receptors which recognize 5T4 antigen. Accordingly, the present invention relates to methods comprising the use of autologous dendritic cells which have been loaded with a peptide epitope of 5T4 or which express a peptide epitope of 5T4 for the isolation of a cell expressing a T cell receptor which recognises the 5T4 antigen.

Isolating and cloning of T- cell receptors

Various methods for isolating and cloning T cell receptors for adoptive immunotherapy are well known in the art. For example, US Patent No. 6,770,749 discloses the molecular cloning of cDNA for both the α and β chains of human (hu) p53-specific, HLA restricted murine (mu) T cell receptor (TCR), transfer of the cDNA to hu T cells, and functional expression of the p53-specific TCR in hu cytotoxic T lymphocytes (CTLs).

Once the cell or cell population expressing the correct T cell receptor has been identified, the nucleic acids encoding the α and β chains of the T cell receptor are isolated according to known methods e.g. described in Hughes et ah, (2005) Hum Gene Ther. The isolated cDNA is amplified according to routine methods, for example 5'RACE PCR or multiple PCR amplification.

Preferably, the isolated and cloned T cell receptor is included in a vector which is capable of transducing T cell for use in adoptive immunotherapy. Suitable vectors are known and described for example in Morgan et al (2006) Scienceexpress.

Non-viral delivery systems include, but are not limited to, DNA transfection methods, such as electorporation, nucleic acid biolistics, lipid-mediated transfection, compacted nucleic acid- mediated transfection, liposomes, immunoliposomes, lipofectin, cationic agent-mediated, cationic facial amphiphiles (CFAs) (Nature Biotechnology 1996 14; 556), multivalent cations such as spermine, cationic lipids or polylysine, 1, 2,-bis (oleoyloxy)-3-(trimethylammonio) propane (DOTAP)-cholesterol complexes (Wolff and Trubetskoy 1998 Nature Biotechnology 16: 421) and combinations thereof.

Viral delivery systems include but are not limited to adenovirus vectors, adeno-associated viral (AAV) vectors, herpes viral vectors, retroviral vectors, lentiviral vectors or baculoviral vectors, Venezuelan equine encephalitis virus (VEE), poxviruses such as: canarypox virus (Taylor et al 1995 Vaccine 13:539-549), entomopox virus (Li Y et al 1998 XII^th International Poxvirus Symposium pl44. Abstract), penguine pox (Standard et at. J Gen Virol. 1998 79:1637-46) alphavirus, and alphavirus based DNA vectors.

Examples of retroviruses include but are not limited to: murine leukaemia virus (MLV), human T cell leukemia virus (HTLV), mouse mammary tumor virus (MMTV), Rous sarcoma virus (RSV), Fujinami sarcoma virus (FuSV), Moloney murine leukaemia virus (Mo-MLV),

FBR murine osteosarcoma virus (FBR MSV), Moloney murine sarcoma virus (Mo-MSV),

Abelson murine leukaemia virus (A-MLV), Avian myelocytomatosis virus-29 (MC29), and

Avian erythroblastosis virus (AEV). A detailed list of retroviruses may be found in Coffin et al, 1997, "Retroviruses", Cold Spring Harbor Laboratory Press Eds: JM Coffin, SM

Hughes, HE Varmus pp 758-763.

Lentiviruses can be divided into primate and non-primate groups. Examples of primate lentiviruses include but are not limited to: the human immunodeficiency virus (HIV), the causative agent of human auto-immunodeficiency syndrome (AIDS), and the simian immunodeficiency virus (SIV). The non-primate lentiviral group includes the prototype "slow virus" visna/maedi virus (VMV), as well as the related caprine arthritis-encephalitis virus (CAEV), equine infectious anaemia virus (EIAV) and the more recently described feline immunodeficiency virus (FIV) and bovine immunodeficiency virus (BIV).

A distinction between the lentivirus family and other types of retroviruses is that lentiviruses have the capability to infect both dividing and non-dividing cells (Lewis et al. 1992 EMBO. J 11: 3053-3058; Lewis and Emerman 1994 J. Virol. 68: 510-516). In contrast, retroviruses - such as MLV - are unable to infect non-dividing tissue.

The vector used in the present invention may be configured as a split-intron vector. A split intron vector is described in PCT patent applications WO 99/15683 and WO 99/15684.

Adoptive immune therapy

The T cell receptor identified by the methods and uses of the present invention are suitable to be used in the treatment of diseases, for example cancer. In particular, T cells which express the T cell receptor can be used in adoptive immune therapy. Adoptive immunotherapy is a cell therapy that involves the removal of immune cells from a subject, the ex-vivo processing (i.e., activation, purification and/or expansion of the cells) and the subsequent infusion of the resulting cells back into the same subject. Examples of adoptive immunotherapy methods include methods for producing and using LAK cells (Rosenberg U.S. Patent No. 4,690,915), TIL cells (Rosenberg U.S. Patent No. 5,126,132), cytotoxic T cells (Cai, et al. U.S. Patent No. 6,255,073; Celis, et al U.S. Patent No. 5,846,827), expanded tumor draining lymph node cells (Terman U.S. Patent No. 6,251,385), various preparations of lymphocytes (Bell, et al. U.S. Patent No. 6,194,207; Ochoa, et al. US Patent No. 5,443,983; Riddell, et al. U.S. Patent No. 6,040,180; Babbitt, et al. U.S. Patent No. 5,766,920; Bolton U.S. Patent No. 6,204,05 8), CD8+ TILs (Figlin, et al. (1997) Journal of Urology 158:740), CD4+ T cells activated with anti-CD3 monoclonal antibody in the presence of IL-2 (Nishimura (1992) J Immunol. 148:285), T cells co-activated with anti-CD3 and anti-CD28 in the presence of IL-2 (Garlie, et al. (1999) Journal of Immunotherapy 22:336) antigen-specific CD8+ CTL T cells produced ex-vivo and expanded with anti-CD3 and anti-CD28 monoclonal antibodies (mAb) in the presence of IL-2 (Oelke, et al. (2000) Clinical Cancer Research 6:1997), and injection of irradiated autologous tumor cells admixed with Bacille Calmette-Guerin (BCG) to vaccinate subjects followed seven days later by recovery of draining lymph node T cells which are activated with anti-CD3 mAb followed by expansion in IL-2 (Chang, et al. (1997) Journal of Clinical Oncology 15:796).

Diseases

5T4 is a tumor associated antigen. Presence of 5T4 on cancer cells is associated with the metastatic process and has been shown to be an independent indicator of prognosis in a number of different cancers.

hi a preferred embodiment, the disease (which is preventable/treatable using a T cell receptor which recognizes a peptide according to the present invention) is a cancer. In particular, the disease may be a carcinoma of, for example, the breast, lung, stomach, pancreas, endometrium, cervix, colorectal, kidney or prostate.

WO 89/07947 describes an immunohistochemical screen of neoplastic tissues using an anti- 5T4 monoclonal antibody (see Tables II and VI). Preferably, the disease is a cancer which can be shown to be 5T4 positive by diagnostic testing (such as with an anti-5T4 antibody), for example: invasive carcinoma of the Ampulla of Vater, carcinoma of breast, colon, endometrium, pancreas, or stomach, bladder such as a squamous carcinoma of the bladder, cervix, lung or oesophagus; colon, such as a tubulovillous adenoma of the colon; endometrium such as a malignant mixed Mullerian tumor of the endometrium; kidney such as a clear cell carcinoma of the kidney; lung including lung cancers (large cell undifferentiated, giant cell carcinoma, broncho-alveolar carcinoma, metastatic leiomyosarcoma); an ovary including ovarian cancer (a Brenner tumor, cystadenocarcinoma, solid teratoma); a cancer of the testis (such as seminoma, mature cystic teratoma); a soft tissue fibrosarcoma,; a teratoma such as anaplastic germ cell tumors); or a trophoblast cancer (choriocarcimoma (e.g. in uterus, lung or brain), tumor of placental site (hydatidiform mole).

EXAMPLES

EXAMPLE 1 - CLASS I

A schematic of the methods, showing the stages involved, is illustrated in Figure 1.

Methods

Peptides

Two hundred and six 9mers overlapping by seven amino acids spanning the entire 5T4 protein were generated and synthesised by JPT Technologies GmbH (Jerini) using standard techniques.

Figure 18 presents data for all 206 test peptides. These peptides are allocated SEQ ID NOs: as shown.

Testing

The peptides were dissolved at 1x10^" M, in DMSO prior to use. The 9mers were tested for Peptide Binding, Off Rate and Affinity using the iTopia Epitope Discovery System in accordance with the manufacturer's instructions. Briefly, 96 well microtiter plates coated with MHC molecules representing different MHC alleles are used to identify candidate peptides. MHC class I alleles A*0101 (Al), A*0201 (A2), A*0301 (A3), and B*0702 (B7) were used. Determinations are performed in duplicate using an ELISA plate reader and include allele specific positive controls.

i) Peptide Binding - This assay measures the ability of individual peptides to bind to the MHC molecules under standardised optimal binding conditions. The assay is performed for all the test peptides across the selected MHC alleles. The test peptides identified as "binders" are characterized further in terms of affinity and dissociation experiments.

The basic binding assay is illustrated in Figure 2.

Briefly, MHC class I monomers, bound via biotin to streptavadin-coated microtitre plates (A), first have then^* stabilising placeholder peptide and β₂M removed (B), before being reconstituted with test peptide and fresh β₂M in the presence of fluorescently labelled detection antibody (C). Following a period of binding under optimal conditions, excess antibody is removed and a measurement of total fluorescence taken (D).

Manipulation of binding conditions in subsequent assays then allows quantification of the relative binding properties of candidate peptide sequences which passed the initial screen and enables assessment of the overall quality of binding for each.

The binding of the test peptides to the MHC molecules was performed at 1.1 Ix 10^"5M of peptide under optimal, standardised test conditions. A control peptide was run in parallel on the same plate and at the same concentration as the test peptides.

ii) Off-rate Assay - This assay evaluates the dissociation of previously bound peptide at defined time points.

Briefly, the off-rate assay shifts binding from optimal to suboptimal conditions to determine the rate at which peptides dissociate from MHC complexes. Results are expressed as the amount of time needed to achieve 50% dissociation of the peptide from the MHC complex, or the tl/2 value, represented in hours. This essentially indicates the stability of the MHC-peptide complexes and has high biological relevance as it relates to the length of time available for a particular MHC-peptide complex to reach the cell surface and interact with a T cell receptor (TCR), a factor thought to be of importance in the ability to activate a T cell. Results from this assay constitute a major share of the final iScore.

iii) Affinity Assay - Candidate peptides identified in the initial peptide binding assay are incubated at increasing concentrations for a given period to determine their relative binding affinities for the MHC molecules. The affinity is expressed as the quantity of peptide needed to achieve 50% binding or ED50 value.

Briefly, the affinity assay assesses the binding potential of decreasing concentrations of peptide as a means of determining their relative affinities, with results expressed as the concentration of peptide needed to achieve 50% binding, or the ED5O value, and also contributes in part to the final iScore.

iScore

Finally, multiparametric analysis is performed on the results from these assays and an iScore is generated. The iScore represents a measure of the overall quality of peptide-MHC binding, enabling candidate peptides to be ranked in order of binding quality and allowing rational prioritisation of peptides for functional cellular follow-up studies.

Interpretation of the iScore As part of the validation of the iTopia system, a panel of overlapping peptides derived from the CMV pp65 protein were used and their binding properties for the A*0201 allele analysed. A number of T cell epitopes restricted by HLA A*0201 had already been identified (by more conventional methodologies) by other researchers for this protein. In the iTopia study, it was reported that an iScore of: >0.5 represented "good quality binding"; between ,0.25 and 0.5 represented "medium quality binding"; and <0.25 represented "poor quality binding". Six of the 20 peptides which gave a "good" iScore (>0.5) for A*0201, represented previously characterised CMV pp65 A*0201 epitopes. Of the 14 other peptides which gave a "good" iScore, 13 showed positive responses by ELISPOT and/or tetramer staining using PBMCs from CMV positive donors demonstrating that these represented functional and novel CTL epitopes. This demonstrated that the binding properties of a peptide, quantified by the peptides' iScore, gave a high probability of accurately predicting functional epitopes.

Each MHC class I allele has different binding properties and affinities for peptides which they bind. Therefore, information obtained with HLA A*0201 in which peptides are ranked as good, medium or poor binders using >0.5, 0.25-0.5 and <0.25 as thresholds is not necessarily transferable between alleles. Also, different proteins are likely to have distinct immunogenic profiles and the affinities between peptides and MHC class I molecules will be different between proteins. This may be particularly relevant in the case of self-antigens where immunogenicity is likely to be lower than in foreign proteins.

Results Figure 19 shows the results of the initial binding by allele for each peptide. The level of binding is expressed as a percentage of positive control peptide binding for each allele. Peptides with values of >15% of control have been highlighted and these were further characterised for affinity and off-rate.

Of the 206 overlapping 9mer peptides screened for each of the MHC class I alleles in this initial binding assay the following results were obtained:

A*0101: 8 peptides exhibited binding of >15% compared with controls.

A*0201: 115 peptides exhibited binding of >15% compared with controls.

A*0301: 19 peptides exhibited binding of >15% compared with controls.

B*0702: 36 peptides exhibited binding of >15% compared with controls.

Off-Rate Analysis

The peptides initially identified as binders were evaluated for stability based on their ability to remain bound to MHC molecules at 37⁰C over the course of 8 hours. The values obtained for each time point (in duplicate) have been expressed as a percentage of the positive control. A one-phase exponential decay curve, with a plateau given equal to 0, was generated using GraphPad Prism® software, which calculated the tl/2 and goodness-of-fit, as measured by r², for each peptide. Results are presented in Figure 20.

Affinity Analysis

Dose-response curves of peptide binding to MHC were prepared by peptide titration to determine the ED50 measurement for each peptide. Values for the concentrations tested (in duplicate) were obtained as a percentage of the highest (9000X) concentration of the positive control peptide. A dose-response curve was generated using GraphPad Prism® curve fitting software, which automatically calculated the ED50 (in Molarity) for each peptide. Results are presented in Figure 21.

Multi-parametric Analysis - iScore Multi-parametric analysis permits the integration of half-life and ED50 parameters in an integrated iScore. This reflects the capability of a peptide to reconstitute with MHC molecules in a stable complex, defining its overall level of binding i.e. the iScore value represents the overall quality of peptide-MHC binding and is used to rank candidate peptides as an indicator of functional relevance. The lead candidate epitopes for each allele are selected for cellular functional analysis to confirm their biological relevance.

Figures 3 to 5 provide a visual graphical representation of iScores for all tested peptides across all tested alleles. Figure 22 shows iScore results from all peptides tested.

Figure 6 gives an example of the complete iTopia system.

Figure 6 graphically demonstrates the use of the iTopia system using the example of 30 5T4 peptides (22-52) screened against the B*0702 allele. Five peptides exhibited >15% binding compared to the positive control peptide in the initial binding assay and these were analysed in the off-rate and affinity assays. When multiparametric analysis was performed, a single peptide, #45, stood out as having a higher iScore then the rest (0.389) and this is clearly reflected in the low off-rate and relatively high affinity seen for this peptide. Figure 23 summarises the results obtained in this study and categorised according to iScore per allele.

The range of iScores differed considerably between alleles, the highest iScore (Rank #1) seen with A*0101 was 0.522, 1.897 for A*0201, 0.375 for A*0301 and 1.001 for B*0702. The arbitrary thresholds (>0.5 = good, 0.5 to 0.25 = medium, and <0.25 = poor) assigned by Beckman in their previous investigation of A*0201 epitopes in the CMV pp65 protein (see "Interpretation of the iScore", above) are not suitable for use with the above data due to the inter-allelic variation.

By plotting iScore against iScore-rank, as displayed in Figures 7 to 10, it is possible to see distinct populations of iScores, as indicated by a change in the gradient of the graphs. These shifts suggest points at which to discriminate between groups of peptides with different binding properties and by which to set inclusion thresholds for further functional analyses. The changes in gradient of the graphs in Figures 7 to 10 are indicated by a line which delineates the populations of iScores forming the basis of discrimination for further functional studies.

Figure 7: Graph showing iScore vs. iScore-rank for A*0101. A change in gradient can be seen above 0.06 (indicated by the pink line) and this will form the threshold above which peptides will be included in functional analysis. Five peptides will therefore be included in functional analysis.

Figure 8: Graph showing iScore vs. iScore-rank for A*0201. A change in gradient can be seen above 0.285 (indicated by the pink line) and this will form the threshold above which peptides will be included in functional analysis. Nineteen peptides will therefore be included in functional analysis.

Figure 9: Graph showing iScore vs. iScore-rank for A*0301. A change in gradient can be seen above 0.095 (indicated by the pink line) and this will form the threshold above which peptides will be included in functional analysis. Six peptides will therefore be included in functional analysis. Figure 10: Graph showing iScore vs. iScore-rank for B*0702.

A change in gradient can be seen above 0.13 (indicated by the pink line) and this will form the threshold above which peptides will be included in functional analysis. Sixteen peptides will therefore be included in functional analysis.

Figure 24 displays the peptides selected for functional analysis (as shown in Figures 7 to 10) ranked in descending order of iScore.

Peptides are tested in an ELISPOT assay.

The ELISPOT assay is performed as described elsewhere (Czerkinsky et al. (1988) in "Theoretical and Technical Aspects of ELISA and Other Solid Phase Immunoassays (D.M.Kemeny and SJ. Challacombe, eds.) pp217-239 John Wiley & Sons, New York).

5T4-specific CTLs can be generated from healthy donors following several rounds of in vitro stimulation with peptide-loaded dendritic cells (DCs). Briefly, PBMCs from donors are HLA typed and those which are HLA-Al, A2, A3 or B7 positive donors are used for subsequent experiments. Autologous dendritic cells generated from the adherent fraction of PBMC in the presence of cytokines are pulsed with candidate peptides. Autologous PBMCs are subsequently co-cultured with peptide pulsed DCs. After several rounds of stimulation with freshly generated peptide-pulsed DCs, resulting bulk cell culture is tested for the presence of peptide-specific cells by ELISPOT as follows.

Alternatively, PBMCs are recovered from patients treated with TroVax® and interrogated with test peptides. Briefly, PBMCs, previously obtained by separation on Histopaque-1077 and frozen, are thawed and recovered overnight before being plated out at concentration of 2x10⁵ cells per well of PVDF 96- well plate covered with γ-interferon-capturing antibody. Peptides, in pools or individually, are added to each well at a final concentration of 5 μg/ml per peptide. Wells with medium alone or PHA can serve as negative and positive controls respectively. Also CEF peptides (A pool of 23 MHC Class I restricted T cell epitopes from human cytomegalovirus, Epstein-Barr virus and influenza virus, which stimulate the release of EFN-γ from CD8+ T cells) can be included as positive control. After O/N incubation plates are washed with PBS-T ween, a second-step antibody is added, followed by a third-step enzyme and a chromogenic substrate. The number of spots is counted by an automated ELISPOT plate reader.

Positive IFNγ ELISPOT responses from patients of known HLA type against appropriate peptides (i.e. peptides which were shown to bind to a HLA molecule shared by the responding patient) confirm the peptide as a CTL epitope. Antibodies capable of interfering with the presentation of epitopes by specific alleles can be used to further demonstrate allelic restriction.

lOmer experiments

lOmer peptides corresponding to the 9mer peptides listed in Figure 18, but with an additional amino acid at their carboxy termini, as set out below, were tested to identify the individual peptide epitopes responsible for the cellular responses observed with the peptide pools.

Patient TV2-018, from the TroVax® phase II clinical trial TV2, that was treated with the chemotherapeutic agents irinotecan and 5FU alongside TroVax® has been shown to have the following HLA Type: A2, A3, B44, B60, Cw3, Cw5.

The TV2 clinical trial regimen involves six TroVax® vaccinations and 12 cycles of chemotherapy. The end of chemotherapy is designated 'X' and time-points following this are named X+n, where n is the number of weeks after chemotherapy ended.

Immuno-monitoring of this patient using IFNγ ELISPOT, identified strong ex- vivo responses to a number of lOmer peptide pools, namely pools #5, #20, and #1. These responses were dissected to identify the individual peptides responsible, as detailed below.

The antigens and reagents used were as follows:

• PHA (phytohaemagglutinin - used as a non-specific positive control) • CEF (Pool of 5 T cell epitopes from human cytomegalovirus, Epstein-Barr virus and influenza virus - used as a positive control) • MVA (modified vaccinia Ankara)

• lOmer Peptide pool #1 (containing lOmer peptides 1-10)

• lOmer peptide #1 (MPGGCSRGP A)

• lOmer peptide #2 (GGCSRGP AAG) • lOmer peptide #3 (CSRGP AAGDG)

• lOmer peptide #4 (RGPAAGDGRL)

• lOmer peptide #5 (PAAGDGRLRL)

• lOmer peptide #6 (AGDGRLRLAR)

• lOmer peptide #7 (DGRLRLARLA) • lOmer peptide #8 (RLRLARLALV)

• lOmer peptide #9 (RLARLALVLL)

• lOmer peptide #10 (ARLALVLLGW)

• lOmer Peptide pool #5 (containing lOmer peptides 41-50)

• lOmer peptide #41 (NLTEVPTDLP) • lOmer peptide #42 (TEVPTDLPAY)

• lOmer peptide #43 (VPTDLPAYVR)

• lOmer peptide #44 (TDLPAYVRNL)

• lOmer peptide #45 (LPAYVRNLFL)

• lOmer peptide #46 (AYVRNLFLTG) • lOmer peptide #47 (VRNLFLTGNQ)

• lOmer peptide #48 (NLFLTGNQLA)

• lOmer peptide #49 (FLTGNQLAVL)

• lOmer peptide #50 (TGNQLAVLPA)

• lOmer Peptide pool #20 (containing lOmer peptides 191-200) • lOmer peptide #191 (IKKWMHNIRD)

• lOmer peptide #192 (KWMHNIRDAC)

• lOmer peptide #193 (MHNIRDACRD)

• lOmer peptide #194 (NIRD ACRDHM)

• lOmer peptide #195 (RD ACRDHMEG) • lOmer peptide #196 (ACRDHMEGYH)

• lOmer peptide #197 (RDHMEGYHYR)

• lOmer peptide #198 (HMEGYHYRYE)

• lOmer peptide #199 (EGYHYRYEIN)

• lOmer peptide #200 (YHYRYEINAD) The ELISPOT was performed in accordance with the procedures and documents detailed above.

Results

Figure 11 shows Class 1 Peptide pool 1 retested as individual peptides at X+6wk (left) and X+lOwk (right).

It is possible to see from the ELISPOT in Figure 11 that, in the no-cell and no-antigen wells, there is a low background, which demonstrates there are few non-specific responding cells, and that CEF and MVA have induced IFNγ responses. Peptide pool 1 (containing lOmer peptides 1-10) has produced a response at both time points and when the peptides in pool 1 are tested individually, it is clear that there is a response to peptides 8 (RLRLARLALV) and 9 (RLARLALVLL).

It is possible to see from the ELISPOT in Figure 12 that, in the no-cell and no-antigen wells, there is a low background, which demonstrates there are few non-specific responding cells, and that CEF and MVA have induced IFNγ responses. Peptide pool 5 (containing lOmer peptides 41-50) has produced a response at both time points as previously observed and when the peptides in pool 5 are tested individually, it is clear that there is a response to peptide 49 (FLTGNQLAVL).

It is possible to see from the ELISPOT in Figure 13 that, in the no cell and no antigen wells, there is a low background, which demonstrates there are few non-specific responding cells, and that CEF and MVA have induced IFNγ responses. Peptide pool 20 (containing lOmer peptides 191-200) has produced a response at both time points as previously observed and when the peptides in pool 20 are tested individually, it is clear that there is a response to peptide 194 (NIRDACRDHM). Although the HLA allelic restriction of this peptide has not been defined, it must be restricted by at least one of the HLA alleles expressed by this patient, namely HLA A2, A3, B44, B60, Cw3, or Cw5.

Discussion:

It is clear from the above results that the 5T4 lOmer peptides 8, 9, 49, and 194 are capable of inducing an ex vivo IFNγ response in PBMCs from an individual immunised with TroVax®. As this patient's HLA type is A2, A3, B44, B60, Cw3, Cw5, these responses must be restricted to one of these alleles in this patient. 9mer peptides 9 and 49, which are identical to the lOmer peptides but shorter by a single carboxy terminal amino acid residue, were identified as putative HLA- A2 epitopes using the iTopia epitope discovery system (peptide 9 being ranked 4^th and peptide 49 6^th). As patient 018 has an A2 HLA type, it is possible that the responses to these peptides are occurring via HLA A2 mediated presentation, although this will need to be verified.

9mer experiments

To verify that some of the individual lOmer peptides seen to stimulate IFN γ production in the previous experiment are also capable of stimulating a response as 9mer peptides, the following peptides were tested:

Antigens and reagents:

• A2 blocking antibody clone BB7.2 Serotec (Cat: MCA2090XZ)

• MVA (modified vaccinia Ankara) • lOmer Peptide pool #1 (containing lOmer peptides 1-10)

• lOmer peptide #1 (MPGGCSRGPA)

• lOmer peptide #8 (RLRLARLALV)

• lOmer peptide #9 (RLARLALVLL)

• lOmer peptide #10 (ARLALVLLGW) • 9mer Peptide pool #1 (containing 9mer peptides 1-10)

• 9mer peptide #1 (MPGGCSRGP) • 9mer peptide #8 (RLRLARLAL)

• 9mer peptide #9 (RLARLALVL)

• 9mer peptide #10 (ARLALVLLG)

• lOmer Peptide pool #5 (containing lOmer peptides 41-50) • lOmer peptide #41 (NLTEVPTDLP)

• lOmer peptide #48 (NLFLTGNQLA)

• lOmer peptide #49 (FLTGNQLAVL)

• lOmer peptide #50 (TGNQLAVLPA)

• 9mer Peptide pool #5 (containing 9mer peptides 41-50) • 9mer peptide #41 (NLTEVPTDL)

• 9mer peptide #48 (NLFLTGNQL)

• 9mer peptide #49 (FLTGNQLAV)

• 9mer peptide #50 (TGNQLAVLP)

The ELISPOT was performed in accordance with the procedures and documents detailed above. The HLA A2 blocking antibody (clone BB7.2) has been used in the past to demonstrate HLA A2 restriction of responses in cytotoxic T cell assays and is being used in this assay to demonstrate that particular peptide epitopes are HLA A2 restricted.

Results and Discussion:

Figure 14 shows lOmer peptides and peptide pools compared to 9mer peptides and pools in the presence and absence of the HLA A2 blocking antibody (clone BB7.2) as indicated.

It is possible to see from the ELISPOT in Figure 14 that there is a clean background, indicated by the absence of spots in the no-cell and no-antigen wells, which demonstrates there are few non-specific responding cells; and there is a response to MVA.

The fact that there is no significant reduction in response to MVA in the presence of the HLA A2 blocking antibody, indicates that the HLA A2 blocking antibody does not appear to have any toxic effect on the PBMCs. lOmer pool 1 has shown a response, which is completely ablated by the HLA A2 blocking antibody, indicating that the peptide epitope(s) in this pool for this patient is/are HLA A2 restricted. lOmer peptide 1 (MPGGCSRGP A) shows no response and nor does peptide 10 (ARLALVLLGW). Peptides 8 (RLRLARLALV) and 9 (RLARLALVLL) both show a response and using the HLA A2 blocking antibody with peptide 9, it is possible to see that this is HLA A2 restricted.

The 9mer pool 1 peptides showed an identical pattern of responses to the lOmer pool 1 peptides. 9mer pool 1 has shown a response, which is completely ablated by the HLA A2 blocking antibody, indicating that the peptide epitope(s) in this pool for this patient is/are HLA A2 restricted. 9mer peptide 1 (MPGGCSRGP) shows no response and nor does peptide 10 (ARLALVLLG). Peptides 8 (RLRLARLAL) and 9 (RLARLALVL) both show a response and using the HLA A2 blocking antibody with peptide 9, it is possible to see that this is HLA A2 restricted. Peptide 9 was identified as a putative A2 epitope (ranked 3^rd) using iTopia and the above result validates this peptide as a true class I epitope and verifies that it is HLA-A2 restricted (although it does not preclude the possibility that it is also restricted by another allele not expressed by this individual). The fact that peptides 8 and 9 share an overlapping sequence of 7 amino acids (RLARLAL) suggests that this represents a minimal epitope. It is also likely that their structure, with the anchor residues at positions 2 and 4 filled by leucine residues in both cases, accounts for the fact that they are both capable of stimulating a response. Without the use of the HLA A2 blocking antibody in this case, it is not possible to define the allelic restriction of peptide 8 other than that it must be presented by one of A2, A3, B44, B60, Cw3, and Cw5.

lOmer pool 5 has shown a response, which is completely ablated by the HLA A2 blocking antibody, indicating that the peptide epitope(s) in this pool for this patient is/are HLA A2 restricted. lOmer peptide 41 (NLTEVPTDLP) shows no response and nor does peptide 48 (NLFLTGNQLA) or peptide 50 (TGNQLAVLPA). Peptide 49 (FLTGNQLAVL) shows a response and by using the HLA A2 blocking antibody with peptide 49 it is possible to see that this is HLA A2 restricted. The fact that neither of the flanking peptides elicit a response, indicates that the epitope is defined by the sequence of peptide 49. The 9mer pool 5 peptides showed an identical pattern of responses to the lOmer pool 5 peptides. 9mer pool 5 has shown a response, which is completely ablated by the HLA A2 blocking antibody, indicating that the peptide epitope(s) in this pool for this patient is/are HLA A2 restricted. 9mer peptide 41 shows no response and nor do peptides 48 and 50. Peptide 49 shows a response and using the HLA A2 blocking antibody with peptide 49 it is possible to see that this is HLA A2 restricted. Peptide 49 was identified as a putative HLA A2 epitope (ranked 6^th) using iTopia and the above result validates this peptide as a true class I epitope and verifies that it is HLA-A2 restricted (although it does not preclude the possibility that it is also restricted by an other allele not expressed by this individual).

Reactivity of PBMCs from TroVax® vaccinated patients to 5T4 peptide pools containing iTopia hits.

Introduction: Briefly, as part of the immunonionitoring of the phase II TroVax® trial TV2, PBMCs, from colorectal cancer patients who had been vaccinated with TroVax®, were interrogated with pools of lOmer peptides (these were identical to the 9mer peptides except that they have an additional c-terminal amino acid).

Two pools of 5T4 peptides were made up of iTopia hits, one contained the A2 hits (X peptides) and the other contained all of the Al, A3 and B7 hits (Y peptides). Additional pools of peptides were also used to interrogate PBMCs; these contained adjacent 5T4 peptides.

Materials:

The peptide pools were made up as detailed in Figure 25 a (iTopia hits) and Figure 25b (pools of adjacent peptides) such that the final concentration of peptide used in the IFNγ ELISPOT was 5μg/ml per peptide.

Results:

A library of overlapping 5T4 peptides has been used to interrogate IFNγ ELISPOT responses in PBMCs recovered from patients vaccinated with TroVax®. As detailed above, each pool contained 10 adjacent peptides (with the exception of the two iTopia peptide pools). A number of these pools contain peptides which are predicted (by iTopia) to be CTL epitopes restricted through HLA Al, A2, A3 or B7. Analysis of IFNγ ELISPOT responses showed a number of patients who responded to a peptide pool following, but not before, vaccination with TroVax®. We have identified patients who responded to a peptide pool that contained a putative CTL epitope which was predicted by iTopia to be restricted through a HLA allele which was present in the responding patient. Figure 26 lists all of the instances where this has occurred.

In addition to interrogating patients' PBMCs with a panel of over-lapping peptides, pools of peptides containing iTopia HLA A2 hits and combined A1/A3/B7 hits were also used. Results in Figure 27 detail patients who showed a positive IFNγ ELISPOT response to these peptide pools and had a matching HLA allele.

Where availability of a responding patient's PBMCs has allowed, the peptide pools have been dissected into their constituents with the aim of identifying the individual peptide which induced the positive IFNγ ELISPOT response (Figure 28). By dissecting positive responses from peptide pools, four individual peptides (9, 49, 125 and 194) were identified which were responsible for the positive IFNγ ELISPOT response. It has been possible to use a blocking antibody specific for HLA- A2 to confirm the restriction through this allele for peptides 9 and 49. Peptide 77 has been identified previously as being restricted through HLA Cw7 and was identified as an HLA A2 hit by iTopia. Following the identification of positive IFNγ ELISPOT responses to individual peptides, MHC multimers (Pentamers) were synthesised for 2 HLA- A2 epitopes (9 and 49). Positive pentamer responses were detected in patient 018 to both pentamers and in patient 108 to pentamer 49.

Conclusion:

By analysing IFNγ ELISPOT responses from patients vaccinated with TroVax®, we have been able to identify peptide pools which induced a positive response and contained an iTopia hit of a HLA allele which the patient possessed. The peptide pools used to interrogate patients' PBMCs contained all of the iTopia hit peptides and, positive responses were detected in pools of peptides containing all of the iTopia hits. Therefore, the iTopia hits are genuine epitopes eliciting cellular responses. Where dissections of responding peptide pools have been carried out, it was shown that the iTopia hit contained within the pool elicited the response. Indeed, five peptides predicted to be CTL epitopes by iTopia have now been confirmed to be CTL epitopes.

Use of multimeric MHC/peptide complexes (pentamers) for the validation of iTopia hits.

Introduction

Multimeric MHC/peptide complexes (pentamers in this case) can be used for direct ex vivo analysis of the frequency and phenotype of antigen-specific T cells. The assay relies upon the interaction between the MHC/peptide complex and T cell receptor clusters on the surface of T cells. The method is known to be robust, and can detect antigen-specific populations at frequencies as low as 1:5,000 CD8+ T cells (approximately 1:50,000 PBMC).

Analysis of PBMCs from patients TV2-018 (HLA type: A2, A3, B44, B60, Cw3, Cw5) and TV2-108 (HLA type A2, A3, B8, B64 Cw7, Cw8) was done using HLA-A2 pentamers specific for peptides 9 (HLA-A2/9; peptide sequence RLARLALVL) and 49 (HLA-A2/49; peptide sequence FLTGNQLAV). A pentamer with a mismatched HLA type (HLA-A1/43; peptide sequence VPTDLPAYV) was used as a negative control for binding.

Materials: • PBMCs from patient TV2-018 at the -2wk, X+2wk, and X+14wk timepoints, and patient TV2-108 at the 6wk and 19wk timepoints.

• Class I . MHC Pro5 Pentamers HLA-A2/9 (RLARLALVL), HLA-A2/49 (FLTGNQLAV) and HLA-Al/43 (VPTDLPAYV). (from Prolmmune).

• Fluorescent labelled anti-CD8 antibody (CD8 FITC from BD Biosciences).

Methods:

Briefly, PBMCs were thawed and incubated with a primary layer consisting of the pentamer complex, followed by a secondary layer consisting of a fluorescent (PE-labelled) pentamer tag and fluorescent (FITC labelled) anti-CD8 antibody. Samples were then analysed by flow cytometry.

Results

The results are shown in Figures 15 and 16. Conclusion:

Distinct populations of CD8⁺ T cells specific for HLA- A2/9 can be seen for patient TV2-018 at the X+2wk and X+14wk time points. This is in agreement with previous ELISPOT results and confirms the HLA restriction of this epitope as A2. Distinct populations of CD8+ T cells specific for HLA-A2/49 can be seen for patient TV2-108 at the 19wk time point. This is also in agreement with previous ELISPOT results and confirms the HLA restriction of this epitope as A2.

EXAMPLE 2 - CLASS II

Reactivity of PBMCs from TroVax® vaccinated patients to 5T4 20mer peptides.

Introduction: Briefly, as part of the immunomonitoring of the phase II TroVax® trial TV2, PBMCs from colorectal cancer patients who had been vaccinated with TroVax®, were interrogated with two 20mer peptides, numbers 39.2 (MVTWLKETEVVQGKDRLTCA) and 41.2 (LTCAYPEKMRNRVLLELNSA) in ELISPOT assays and with ten individual 20mer peptides and seven pools of 20mer peptides in cellular proliferation assays.

Materials:

The peptides were included in TV2 ELISPOT assays such that the final concentration of peptide was 5μg/ml. Figure 29 displays the individual peptides and constituents of the peptide pools.

Methods:

ELISPOT is described previously.

Cellular proliferation assay is described briefly as follows. PBMCs, freshly obtained by separation on Histopaque-1077, are plated out at concentration of IxIO⁵ cells per well of 96-well plate. Peptides, individually or in pools, are added to each well at final concentration of 2 μg/ml per peptide. Wells with media alone and PHA can serve as negative and positive controls respectively. Also Tetanus toxin can be included as an antigen specific positive control. After six days of incubation (37°C;5% CO2), lμCi of tritiated thymidine (3H-Thymidine) is added to each well and, following an additional overnight incubation, cells are harvested and tritiated thymidine incorporation is measured using a scintillation counter.

Results: The class II 5T4 20mer peptides 39.2 and 41.2 were used to interrogate IFNγ ELISPOT responses in PBMCs recovered from patients vaccinated with TroVax®. Analysis of IFNγ ELISPOT responses showed a number of patients responded to a peptide following, but not before, vaccination with TroVax®. Figure 30 lists all of the instances where this has occurred.

Similarly, when individual class II 5T4 20mer peptides as well as pools of class II 5T4 peptide pools were used to interrogate cellular proliferative responses in PBMCs recovered from patients vaccinated with TroVax®, numerous responses were seen following, but not before, vaccination with TroVax®. Figure 31 lists all of the instances where this has occurred.

When the HLA types of the patients responding to a particular peptide or pool are analysed, as shown in Figure 32, the likely HLA restriction of a particular peptide or pool can be determined by the frequency with which a particular HLA type is represented amongst the responding patients. Amongst the single peptides the mostly likely HLA restriction of peptide 36.2 is either DQ2, DR7, or DR53 as each were represented by 3 out of 7 responders. The mostly likely HLA restriction of peptide 37.2 is either DQ2, DR52, or DR53 as DQ2 was represented by 7 out of 10 responders and DR52 or DR53 were each represented by 5 out of 10. The mostly likely HLA restriction of peptide 38.2 is either DQ2, DQ6, or DR52 as each were represented by 5 out of 10 responders. The mostly likely HLA restriction of peptide 39.2 is either DQ6, DR51, or DR52 as DQ6 was represented by six out of ten responders and DR51 and DR52 were represented by five out of ten responders. The mostly likely HLA restriction of peptide 40.2 is either DQ6, DR15, DR51, or DR52 as DQ6 was represented by eight out of twelve responders and DR15, DR51 and DR52 were represented by six out of twelve responders. The mostly likely HLA restriction of peptide 41.2 is either DQ6, DR51, or DR15 as DQ6 was represented by nine out of thirteen responders, DR51 was represented by seven out of thirteen responders and DR15 was represented by six out of thirteen responders. The mostly likely HLA restriction of peptide 42.2 is either DQ6, DR51, DQ5, or DR15 as DQ6 was represented by eight out of twelve responders, DR51 was represented by seven out of twelve responders and DQ5 and DR15 were represented by six out of twelve responders. The mostly likely HLA restriction of peptide 43.2 is either DQ6, DR 15, or DR51 as DQ6 was represented by seven out of eleven responders and DR 15 and DR51 were represented by six out of eleven responders. The mostly likely HLA restriction of peptide 44.2 is either DQ6, DR15, DR51, or DR52 as they were each represented by five out of nine responders. The mostly likely HLA restriction of peptide 45.2 is either DQ6, DR53, DR15, or DR51 as DQ6 and DR53 were represented by five out of eight responders and DR15 and DR51 were represented by four out of eight responders. The mostly likely HLA restriction of peptides contained in pool 4.2 are either DQ2, DQ6, DR52, or DR53 as they were each represented by six out of fifteen responders or DQ7 which was represented by five out of fifteen responders. The mostly likely HLA restriction of peptides contained in pool 5.2 are either DR52, DQ2, DR17, or DQ6 as DR52 was represented by nine out of thirteen responders, DQ2 was represented by seven out of thirteen responders, DR17 was represented by six out of thirteen responders, and DQ6 was represented by five out of thirteen responders. The mostly likely HLA restriction of peptides contained in pool 6.2 are either DQ2, DR52, DQ6, DR7, or DR17 as DQ2 and DR52 were represented by seven out of thirteen responders, and DQ6, DR7 and DR17 were represented by five out of thirteen responders. The mostly likely HLA restriction of peptides contained in pool 7.2 are either DQ6, DR52, DQ2, DR15, or DR51 as DQ6 was represented by eight out of thirteen responders, DR52 was represented by six out of thirteen responders, and DQ2, DR15 and DR51 were represented by five out of thirteen responders. The mostly likely HLA restriction of peptides contained in pool 8.2 are either DQ2, DQ6, DR52, DR15, or DR51 as DQ2, DQ6, and DR52 were represented by eight out of eighteen responders and DR 15 and DR51 were represented by seven out of eighteen responders. The mostly likely HLA restriction of peptides contained in pool 9.2 are either DQ6, DR15, DR51, DQ2, or DR53 as DQ6 was represented by eight out of twelve responders, DR15 and DR51 were represented by seven out of twelve responders and DQ2 and DR53 were represented by five out of twelve responders. The mostly likely HLA restriction of peptides contained in pool 10.2 are either DQ6, DR52, DQ2, DR15, or DR51 as DQ6 and DR52 were represented by eight out of fifteen responders, DQ2 was represented by seven out of fifteen responders and DR15 and DR51 were represented by six out of responders.

Conclusion: By analysing IFNγ ELISPOT as well as cellular proliferative responses from patients vaccinated with TroVax®, we have been able to identify peptides which induced a positive response. It is also possible to determine the likely HLA restriction.

EXAMPLE 3 - IDENTIFICATION OF T CELL RECEPTORS WHICH RECOGNIZE A 5T4 ANTIGEN

Since a number of MHC restricted 5T4 peptides have been identified using TroVax® patient sera, the TCR by which these peptides are recognized may be identified. The identification of dominant TCR clones opens up additional therapeutic avenues for 5T4 bearing tumors.

TCR isolation can be summarized as follows:

• isolate a monoclonal population of T cells, prepare cDNA,

• use the cDNA to PCR out the TCR α and β chains using primers targeting conserved regions of these target sequences,

• generate a library,

• sequence clones then • express selected α/β pairs to reconstitute antigen recognition.

The key to the efficient isolation of TCRs is a relevant source of T cells that are enriched in terms of their specificity to a particular antigen (5T4 in this case) and where additional reagents can further isolate a T cell population with a single specificity. In addition, TCRs isolated by this strategy will have utility in a therapeutic setting if they are of relatively high affinity.

It is accepted in the field of immunology, that in general, repeat exposure of the immune system to a particular antigen results in a relative amplification of immune cells (both B, and T cells) with a specificity for that antigen. In addition, this repeat exposure may result in the maturation of the immune response toward that antigen, i.e. the preferential expansion of immune cells bearing higher affinity receptors. PBMCs from patients that have received multiple immunizations with TroVax® represent a source of T cells that are enriched on the basis of both frequency and affinity.

Furthermore, using the iTOPIA system we provide T cell epitopes. These have been validated as relevant in vivo targets. As a result of these studies, pentamer reagents are provided that allow FACS identification of T cells expressing TCRs of defined specificity and thus the means of isolating such T cell populations by FACS or MACS sorting methodologies.

Therefore, the peptides comprising amino acid sequences as set out in any of SEQ ID NOs 1-206 serve as reagents for:

1) enrichment of a T cell population of defined specificity and restricted clonality

2) as a means of identifying correctly cloned TCRs in cells engineered with presumptive 5T4 specific α/β pairs.

There are a number of approaches that can be taken in terms of enrichment of T cells expressing TCRs with specificity to 5T4 epitopes. These are summarized as follows:

• Direct ex vivo sorting of PBMCs by pentamer-based FACS or MACS methodology

The direct ex vivo sorting is outlined with grey arrows in Figure 1. The strategy is to FACS sort the PBMCs immediately with a number of cell markers and 5T4 pentamers and seed at very low density 1-5 cells per well for the T cell clone generation, RNA isolation and cDNA amplification.

• Selective expansion of antigen-specific T cells in vitro using antigen-presenting cells (APCs) loaded with target antigen

The following cell subsets can be used for antigen presentation: autologous PBMCs, autologous EBV-transformed B cell blasts, autologous dendritic cells (DCs), T2 cells. The above cells can be either exogenously loaded with an antigen in the form of peptide or protein, or they can be modified for endogenous expression of the antigen. With regard to the choice of APCs for in vitro expansion, each cell subset has advantages and disadvantages. For example, a heterogenous population of autologous PBMCs, although readily available, contains only a small proportion of APCs. As for EBV-transformed B cell blasts, they are known to efficiently present antigens. However, apart from the exogenously loaded peptide of interest they endogenously express a number of EBV antigens (usually immunodominant) which may drive a T cell response towards selective expansion of EBV specific T cells, so that the T cells of interest specific for 5T4 peptides will be outgrown. T2 cells can present the peptides in the context of the HLA A02 allele, however, they lack expression of co-stimulatory molecules and cytokines secretion crucial for efficient stimulation of T cell response.

In addition, once the cDNA has been prepared from this enriched population, there are two PCR strategies that can be undertaken as follows:

• Firstly, a 5' RACE strategy whereby the cDNA is synthesised with an adaptor at the

5' terminus. PCR is then carried out with a 5' primer that will anneal to the adaptor and the 3' primer will be based in either of the constant regions of the TCR α and β chains

• Alternatively, multiple PCR amplifications can be carried out using 29 α-chain 5' primers in conjunction with the one Ca primer and 24 β-chain 5' primers in conjunction with the one Cβ primer.

The approach outlined in Figure 17, is to take PBMCs from two HLA A02 positive patients (TV2-018 and TV2-108), which were previously identified as the responders to 5T4 derived HLA A02 restricted epitope peptides, and expand peptide specific T cells by two rounds of in vitro stimulation using autologous DCs loaded with the epitope peptides as APCs cells. DCs are known in the art to be professional antigen-presenting cells. Furthermore, autologous material for DC isolation is available from the TroVax® clinical studies. Following selective expansion with peptide loaded DCs, peptide-specific CD8 T cells are then sorted with pentamer labeled magnetic beads and this enriched population is be used in two ways. The majority of cells are used for RNA isolation, whilst a small proportion is used for T cell cloning by limiting dilution and, if cell numbers allow, storage. The resulting T cell clones are also used for RNA isolation. Additionally, if sufficient numbers of antigen-specific T cells are generated by vitro expansion or isolated by sorting, they may be used for cytotoxicity tests.

Identification of the specific TCRs is carried out by subjecting the RNA to reverse transcription and 5' Rapid Amplification of cDNA Ends (5' RACE) using TCR constant chain primers. Additionally, PCR using subfamily specific Va and Vβ primers can also be carried out. The PCR products generated are cloned and sequenced. Having identified TCR sequences, the specificity is established experimentally, full length α and β chain cDNAs corresponding to the identified TCR sequences are cloned into mammalian expression vectors and transfected into appropriate cell lines that allow expression of a recombined TCR at the cell surface. The ability of these complexes to bind 5T4 peptide/ MHC pentamers is assessed by FACS to demonstrate their specificity.

To use the TCR sequences in a clinical setting, the α and β chains may be cloned into a bicistronic lentivector and then used in the same way as Morgan et al. (2006).

Methodology

Patient material PBMCs from two HLA A02 positive patients, TV2-018 and TV2-108, are used as a source material for TCR cloning. ELISPOT assay and pentamer staining analysis performed previously has demonstrated that PMBCs from these patients contain populations of T cells specific to 5T4 epitope peptides #9 and #49 restricted through the HLA A02 allele.

Clonal expansion of T cells

To expand peptide specific T cells, two rounds of in vitro stimulation using autologous DCs loaded with the epitope peptides as antigen-presenting cells is applied. Briefly, DCs are generated from adherent fraction of PBMCs in the presence of cytokines (GM-CSF and EL-4). Following maturation step with pro-inflammatory cytokines (IL- lβ, IL-6, TNF-α and PGE2), DCs are loaded with the peptides #9 and #49 and co-cultured with autologous PBMCs in the presence of cytokines (IL-2, IL7, IL12). After 7 to 10 days, cultures are re-stimulated with peptide loaded DCs, and 7 days post second stimulation ELISPOT or pentamer staining analysis is performed to evaluate the number of peptide-specific CD8 T cells. Once sufficient numbers of specific T cells are available, cell sorting with magnetic beads is performed to enrich for specific T cell population.

After the enrichment step, the majority of recovered peptide-specific polyclonal T cells are used for RNA extraction. Two smaller aliquots of enriched cells are put aside, one for storage and one for T cell cloning by limiting dilution. At this stage, the population is polyclonal, but may be sufficiently enriched for the T cells of single specificity so that the identity of the 5T4 specific TCR may be deduced. Comparison of data yielded at this point with data yielded from the RNA extracted from the peptide-specific monoclonal population is performed to verify that the polyclonal peptide-specific T cells can be used as a back up source material for

TCR cloning if subsequent T cell cloning by limiting dilution will not yield peptide specific

T cell clones.

T cell cloning is carried out by seeding the cells at 0.3 and 1 cell per well of 96-well plate in the medium supplemented with IL-2 and conditioned with allogeneic mitomycin C treated

PBMCs. T2 cells expressing HLA A2 allele loaded with the relevant peptides will be used as

APCs. Growing T cell microcultures are tested by ELISPOT assay to identify T cell clones specific for peptides #9 and #49. Specific T cell clones are expanded further to produce sufficient source material for RNA extraction and for functional assays, e.g. cytotoxicity test against tumor cell lines.

RNA preparation and PCR

It is possible to isolate RNA from very few cells, however preferrably, a minimum of ten thousand cells and more preferably 100 thousand cells and even more preferably one million cells is used for RNA isolation using commercially available kits such as the RNAqueous micro RNA Isolation kit (Ambion) or the RNeasy kit (Qiagen). Total RNA are then used as a template for cDNA synthesis and 5' RACE, using the SMART RACE cDNA amplification kit (Clontech). Two 5' RACE PCR reactions are set up, both using the 5' RACE universal primer provided in conjunction with either a Ca or Cβ primer (eg E and F, Genevee et al 1992). Further nested PCR reactions can be carried out using the nested primer provided in the kit in conjunction with an upstream Ca or Cβ primer (eg A and B, Genevee et al 1992).

To demonstrate proof of principle, RNA was isolated from one million Jurkat cells (a T-cell leukemia cell line) using the the RNeasy kit (Qiagen). The RNA was DNase treated (Turbo DNA free, Ambion) and then used to make 5' RACE ready cDNA using the SMART RACE cDNA amplification kit (Clontech). The TCR cDNA was then amplified by PCR using the Universal Primer A mix in conjunction either with the Ca (E) primer (GTTGCTCCAGGCCGCGGCACTGTT) or with the Cβ (F) primer (CGGGCTGCTCCTTGAGGGGCTGCG) (Genevee et al 1992). This gave products of an approximate size of 950 bp and 800bp respectively. These are of the right order, as would be predicted from the known gene sizes, taking into account that the exact transcription start sites are uncertain. To demonstrate that these products are most probably from the TCR genes, a second, nested PCR was carried out. Ca (A) and Cβ (B) primers, upstream of the E and F primers were used in conjunction with specific V chain primers for the α and β chains known to be expressed in Jurkat cells (Va 1; GGCATT AACGGTTTTGAGGCTGGA and Vβ 8; CCATGATGCGGGGACTGGAGTTGC) (Genevee et al 1992). These gave products both of an approximate size of 300bp. The expected sizes are 306 and 308bp respectively. Absoulte confirmation requires sequencing of the products, however the Va and β primers have been demonstrated to show specificity (Genevee et al 1992)

As an alternative to RACE, sub-family specific oligonucleotides for Va and Vβ chains may be used in conjunction with either a Ca or Cβ primer on 1^st strand DNA (Genevee et al 1992), however that would involve 53 PCR reactions. In addition, because the variable region primers are downstream of the coding start site, additional cloning steps may be required to finally obatin the full length cDNAs.

The PCR products are cloned and a number of clones sequenced. Once the Va and Vβ types have been identified, full length cDNAs are then obtained by PCR and subcloning. To demontrate that the TCR genes identified are 5T4 specific, the full length cDNAs are cloned into an approriate expression vector (see Vector section above) and expressed in an appropriate cell line. The TCR protein at the cell surface is then demonstrated to bind an approriate 5T4 pentamer / teramer/etc by FACS or another approriate methodology.

All publications mentioned in the above specification are herein incorporated by reference. Various modifications and variations of the described methods and system of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific preferred embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention which are obvious to those skilled in molecular biology or related fields are intended to be within the scope of the following claims.

Claims

1. Use of a peptide epitope of 5T4 comprising an amino acid sequence as set out in any of SEQ ID NOs: 1-206 for identifying and isolating a T cell receptor which recognizes a 5T4 antigen.

2. Use as claimed in claim 1 wherein said epitope binds a MHC class I molecule.

3. Use as claimed in claim 1 or claim 2 comprising an amino acid sequence as set out in any of SEQ ID NOs: 8, 9, 17, 22, 23, 43, 45, 49, 55, 58, 59, 65, 71, 77,90, 99, 100, 101, 109, 113, 117, 125, 126, 142, 151, 161, 163, 174, 176, 179, 181, 182, 183, 186, 187, 194 and 198.

4. Use as claimed in any of claims 1 to 3 comprising an amino acid sequence selected from the group consisting of RLARLAL, RLRLARLALV, RLARLALVLL, FLTGNQLAVL and NIRDACRDHM.

5. Use as claimed in any of claims 1 to 4 wherein said epitope binds a HLA-Al MHC molecule.

6. Use as claimed in claim 5 which comprises an amino acid sequence as set out in any of SEQ ID NOs: 43, 109, 125, 161 and 198.

7. Use as claimed in any of claims 1 to 4 wherein said epitope a HLA-A2 MHC molecule.

8. Use as claimed in claim 7 which comprises an amino acid sequence as set out in any of SEQ ID NOs: 8, 9, 22, 49, 59, 65, 77, 90, 99, 109, 125, 142, 151, 174, 176, 179,

181, 182, 183 and 186.

9. Use as claimed in any of claims 1 to 4 wherein said epitope binds a HLA- A3 MHC molecule.

10. Use as claimed in claim 9 which comprises an amino acid sequence as set out in any of SEQ ID NOs: 100, 109, 125, 142, 186 and 198.

11. Use as claimed in any of claims 1 to 4 wherein said epitope binds a HLA-B7 MHC molecule.

12. Use as claimed in claim 11 which comprises an amino acid sequence as set out in any of SEQ ID NOs: 8, 9, 17, 23, 45, 55, 58, 71, 101, 113, 117, 125, 126, 163, 186 and 187.

13. Use as claimed in any of the preceding claims wherein said peptide epitope consists of an amino acid sequence as set out in any of SEQ DD NOs: 1-206.

14. Method for screening a sample of cells for a T cell receptor which recognizes a 5T4 antigen a. contacting the sample with a peptide epitope of 5T4 as defined in any of claims

I to l3 b. detecting the presence of a T cell receptor which recognizes the 5T4 epitope.

15. Method for isolating a cell expressing a T cell receptor which recognizes a 5T4 antigen comprising a. obtaining a population of cells from a sample b. sorting the population of cells based on the presence of a T Cell receptor which recognizes a peptide epitope of 5T4 as defined in any of claims 1 to 13 c. isolating a cell comprising the T cell receptors which recognizes the 5T4 epitope.

16. Method according to claim 15 wherein the method is selected from FACS and MACS.

17. Method according to any of claims 15 to 16 wherein the population is further sorted based on the presence of at least one other cell marker.

18. Method according to any of claims 15 to 17 where the cell population is expanded in vitro.

19. Method for isolating nucleic acids encoding a T cell receptor which recognizes a 5T4 antigen comprising a. obtaining a population of cells from a sample b. expanding selectively cells present in said population, which express a T cell receptor which recognizes a 5T4 antigen, in the presence of a peptide epitope of 5T4 as defined in any of claims 1 to 13 c. isolating cells comprising the T cell receptors which recognizes the 5T4 epitope d. removing and amplifying the nucleic acid encoding said T cell receptor.

20. Method according to claim 19 wherein the cells are sorted prior to isolation based on the presence of a T cell receptor which recognizes a peptide epitope of 5T4 as defined in any of claims 1 to 13.

21. Method according to any of claims 19 to 20 wherein the cells are expanded by cultivating them in the presence of antigen presenting cells (APC) loaded with the 5T4 epitope.

22. Method according to any of claims 19 to 21 wherein the APC is selected from the group of peripheral blood mononuclear cells, EB V-transformed cells, dendritic cells and T2 cells.

23. Method of preparing an isolated T cell receptor which recognizes a 5T4 antigen comprising: a. isolating nucleic acids encoding a T cell receptor which recognizes a 5T4 antigen using a peptide epitope of 5T4 as defined in any of claims 1 to 13 b. introducing the nucleic acids into a host cell c. expressing the T cell receptor in said host cell d. isolating the T cell receptor.

24. Method according to claim 23 wherein the nucleic acid is isolated according to a method according to any of claims 19 to 22.

25. Method of preparing a T cell expressing a T cell receptor which recognizes a 5T4 antigen comprising: a. isolating nucleic acids encoding a T cell receptor which recognizes a 5T4 antigen using a peptide epitope of 5T4 as defined in any of claims 1 to 13 b. introducing the nucleic acids into said T cell.

26. T cell comprising a T cell receptor specific to a peptide epitope of 5T4 as defined in any of claims 1 to 13.

27. T cell according to claim 26 obtainable by a method according to claim 25.

28. A population comprising cells according to claim 27.

29. T cell receptor which recognizes a peptide epitope of 5T4 as defined in any of claims 1 to 13.

30. T cell receptor according to claim 31 obtainable by a method according to any of claims 23 to 24.

31. Method of treating and/or preventing a disease in a subject, wherein the method comprises administering T cells expressing a T cell receptor which recognizes a peptide epitope of 5T4 as defined in any of claims 1 to 13.

32. Method according to claim 31 wherein the disease is cancer.

33. Method of promoting the regression of cancer in a subject comprising a. administering an immunodepleting therapy b. administering a population according to claim 28.

34. Use of a T cell according to any of claims 26 to 27 or a population according to claim 28 or a T cell receptor according to any of claims 29 to 30 in the preparation of a medicament for treating and/or preventing a disease in a subject.

35. Use according to claim 34 wherein the disease in cancer.