WO2008052558A2 - Prédisposition au cancer du sein, pronostic et régime de traitement de cancer du sein mettant en œuvre des marqueurs génétiques sur le chromosome 13 - Google Patents

Prédisposition au cancer du sein, pronostic et régime de traitement de cancer du sein mettant en œuvre des marqueurs génétiques sur le chromosome 13 Download PDF

Info

Publication number
WO2008052558A2
WO2008052558A2 PCT/DK2007/000473 DK2007000473W WO2008052558A2 WO 2008052558 A2 WO2008052558 A2 WO 2008052558A2 DK 2007000473 W DK2007000473 W DK 2007000473W WO 2008052558 A2 WO2008052558 A2 WO 2008052558A2
Authority
WO
WIPO (PCT)
Prior art keywords
dlc2
stard13
breast cancer
determining
gene
Prior art date
Application number
PCT/DK2007/000473
Other languages
English (en)
Other versions
WO2008052558A3 (fr
Inventor
Lise Lotte Hansen
Jens Overgaard
Original Assignee
Aarhus Universitet
Region Midtjylland
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Aarhus Universitet, Region Midtjylland filed Critical Aarhus Universitet
Publication of WO2008052558A2 publication Critical patent/WO2008052558A2/fr
Publication of WO2008052558A3 publication Critical patent/WO2008052558A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/118—Prognosis of disease development
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/16—Primer sets for multiplex assays
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/172—Haplotypes

Definitions

  • the present invention relates to methods for the detection of predisposition and/or determining the prognosis of a period of metastasis-free, recurrence-free and/or disease-free survival of individuals suffering from breast cancer.
  • the invention also relates to a method for determining the treatment regime of an individual suffering from breast cancer.
  • the methods are based on the presence or absence of the STARD13/DLC2 gene present on the human chromosome 13.
  • the invention pertains to kits for use in the methods.
  • BRCA1 and BRCA2 contribution from inherited cancer syndromes as Li-Fraumeni (p53), Ataxia-telangiectasia (ATM), Cowden disease (PTEN), Peutz-Jeghers syndrome (LKB1/STK11) and mutations in CHK2 counts for 20-30% of the familiar cases (1 ).
  • TS genes tumour suppressor genes
  • allelic deletion of chromosomal region 13q12-13 defined by D13S260 and D13S26J correlated with an aggressive tumour type and thereby pointed at the presence of a new tumour suppressor gene (3-5)
  • the identification and localization of BRCA2 to 13q12-13 raised the question of linkage between reduced expression of BRCA2, development and progression of somatic breast cancer.
  • STARD13/DLC2 encodes a multi-domain unique Rho GTPase activating protein (RhoGAP) specific for RhoA and Cdc42 (6).
  • RhoGAP Rho GTPase activating protein
  • the RhoA subfamily includes Cdc42 and is involved in regulation of signal transduction, cell morphology, migration, endocytosis and cell cycle progression.
  • DLC2 ⁇ and ⁇ contains a SAM (sterile alpha motif), a lipid-binding StAR related lipid transfer (START) and a RhoGAP domain
  • DLC2 ⁇ contains the RhoGAP and START domains
  • the START domain is found in proteins as: steroidogenic acute regulatory protein (StAR) and metastatic lymph node-64 (MLN64). Both are binding cholesterol and StAR stimulates the intake of cholesterol from the cytoplasm into the mitochondria, thereby initiating steroidgenesis (8).
  • STARD13/DLC2 is actively targeted to the mitochondria via cytoplasmic speckles proximate to lipid droplets, suggesting a role in lipid transfer into the mitochondria (9).
  • a rate limiting enzyme in the cholesterol biosynthesis pathway HMG-CoA was found to bind to STARD13/DLC2, which further strengthen the role of the gene participating in the mitochondrial lipid biosynthesis pathway (10.
  • the gene was recently identified as being a growth suppressor of hepatocallular carcinomas (HCC) and a homologue of DLC1 (deleted in liver cancer 1 ), via Al analysis of the region spanning D13S171 and D13S267 in hepatocellular carcinomas (HCC) [Lin, 1999 #1732.
  • the gene is ubiquitously expressed in normal tissue but underexpressed in HCC and the chromosomal region exhibits a high frequency of LOH like in breast cancer. [Ching, 2003 #1711 ).
  • the transcript of STARD13/DLC2 is truncated in breast carcinoma cell lines and exhibit a low expression in other cell lines (10).
  • Ullmanova andffy 2006 International journal of oncology describes an expression study of DLC1 and DLC2 in solid tumour samples, among these solid breast cancer tumours, and in cell lines. It was found that DLC2 (and DLC1) expression is down regulated compared to matching normal breast tissue.
  • tumour suppressor genes genes that are identified as tumour suppressor genes or oncogenes.
  • Oncogenes often result from the mutation of genes involved in for example signalling pathways, one example being the human ras gene.
  • Tumour suppressor genes are typically identified through genetic studies of sporadic tumours and the tumour suppressor genes are shown to be lost or gained in such tumours as shown by studies of allelic imbalance). The number of genes that are identified as tumour suppressor genes or oncogenes is increasing. However, it is also evident that the growth control mechanism of a cell serving to maintain the integrity of normal tissue is complex.
  • hereditary breast cancer BRCA 1 and BRCA 2.
  • hereditary and sporadic breast cancer loss or gain of specific genes has been observed when comparing diseased tissue or cell lines to normal cells.
  • sporadic breast cancer which accounts for the majority of the breast cancer cases, a need exists for identifying predictive markers that can be used to predict the outcome or disease course of a disease once the breast cancer has been identified.
  • a predictive marker region positioned on chromosome 13 comprising the STARD13/DLC2 gene is disclosed which provides a tool for predicting the disease course of sporadic breast cancer.
  • the predictive marker provides information on the predisposition to metastasis formation, recurrence and overall disease-free survival of breast cancer patients.
  • the predictive marker can thus be used to select for example which treatment a patient should be given, and/or classifying the tumour.
  • the region of chromosome 13 spanning 1 ,827,629 bp between D13S260 to D13S267 previously identified as significant to invasive cancer, lymph node metastasis, ER-, large tumour size, aneuploidy and high risk of recurrence and death has now been mapped in detail in the present invention.
  • the present invention relates to a method for detecting a predisposition to a period of metastasis-free, recurrence-free and/or short disease-free survival in an individual suffering from breast cancer comprising i) establishing a breast cancer sample; ii) determining the presence or absence of a STARD13/DLC2 gene (SEQ ID NO: 1 ) or part thereof in said breast cancer sample, or iii) determining the presence or absence of a STARD13/DLC2 transcriptional product or part thereof in said breast cancer sample, or iv) determining the presence or absence of
  • the invention in a second aspect relates to a method for determining the prognosis for a period of metastasis-free, recurrence-free and/or disease-free survival in an individual suffering from breast cancer comprising the steps of i) establishing a breast cancer sample, ii) determining the presence or absence of a STARD13/DLC2 gene (SEQ ID NO:1) or part thereof in said breast cancer sample, or iii) determining the presence or absence of a STARD13/DLC2 transcriptional product or part thereof in said breast cancer sample, or iv) determining the presence or absence of a STARD 13/DLC2 translational product or part thereof in said breast cancer sample, v) determining the expression level of a STARD13/DLC2 transcriptional product or part thereof, or vi) determining the expression level of a STARD13/DLC2 translational product or part thereof, wherein the presence of said gene, transcriptional product, translational product or part thereof determined in ii) - iv)
  • a third aspect of the present invention concerns the possibility of selecting a treatment regime of an individual suffering from breast cancer.
  • the third aspect relates to a method for determining the treatment regime for an individual suffering from breast cancer comprising the steps of i) establishing a breast cancer sample, ii) determining the presence or absence of a STARD 13/DLC2 gene or part thereof in said breast cancer sample, or iii) determining the presence or absence of a STARD13/DLC2 transcriptional product or part thereof in said breast cancer sample, or iv) determining the presence or absence of a STARD13/DLC2 translational or part thereof in said breast cancer sample, v) determining the expression level of a STARD13/DLC2 transcriptional product or part thereof, or vi) determining the expression level of a STARD13/DLC2 translational product or part thereof, vii) assessing the outcome of f ii), iii), iv), v), or vi), viii) determining the risk of developing metastasis and
  • a fourth aspect relates to a method for classification of at least one tumour from an individual suffering from breast cancer comprising the steps of i) establishing a breast cancer sample, ii) determining the presence or absence of a STARD13/DLC2 gene or part thereof in said breast cancer sample, or iii) determining the presence or absence of a STARD13/DLC2 transcriptional product or part thereof in said breast cancer sample, or iv) determining the presence or absence of a STARD13/DLC2 translational or part thereof in said breast cancer sample, v) determining the expression level of a STARD13/DLC2 transcriptional product or part thereof, or vi) determining the expression level of a STARD13/DLC2 translational product or part thereof, vii) assessing the outcome of f ii), iii), iv), v), or vi), wherein the presence of said gene,
  • the present invention is also in another aspect directed to an oligonucleotide primer and/or probe for detecting a STARD13/DLC2 gene or a part thereof, wherein said at least one nucleotide primer and/or probe detects at least one genetic marker of STARD13/DLC2 or part thereof.
  • another aspect pertains to an oligonucleotide primer pair, wherein the at least 2 primers can amplify STARD13/DLC2 or part thereof.
  • a further aspect relates to use of an antibody as defined herein for the determination of the predisposition of and/or prognosis for a period of metastasis-free, recurrence-free and/or disease-free survival of an individual suffering from breast cancer.
  • a further aspect concerns use of at least one detection member for a genetic marker of STARD13/DLC2 or for a second genetic marker in linkage with said genetic marker in a kit for the determination of the predisposition of and/or prognosis for a period of metastasis-free, recurrence-free and/or disease-free survival of an individual suffering from breast cancer.
  • the present invention relates to use of a method as defined herein for producing an assay for detecting a predisposition to and/or determining the prognosis to a period of metastasis-free and/or recurrence-free and/or disease-free survival of an individual suffering from breast cancer.
  • Other aspects cover the use of a method as defined herein for producing an assay for determining the treatment regime of an individual suffering from breast cancer, use of a method as defined herein for producing an assay for classifying a tumour from an individual suffering from breast cancer, and use of a composition as defined herein for the treatment of an individual suffering from breast cancer.
  • the present invention also discloses a gene therapy vector comprising i) a DNA sequence identified as SEQ ID NO: 1 , or a fragment thereof, or ii) a cDNA sequence of the sequence identified as SEQ ID NO: 1 or a fragment of said DNA sequence.
  • the present invention relates to a vector comprising a nucleic acid sequence selected from the nucleic acid sequences identified as SEQ ID NO: 1 , or a fragment thereof, said sequence, or said fragment comprising a polymorphism associated with a predisposition to and/or prognosis of metastasis and/or recurrence according to any of the claims herein, said sequence being operably linked to a promoter sequence capable of directing the expression of a variant protein encoded by said sequence.
  • Another aspect of the present invention concerns use of a composition comprising the gene therapy vector and/or the vector described herein for the treatment of an individual suffering from breast cancer.
  • the present invention in other aspects also relates to pharmaceutical compositions for the treatment of metastasis and/or recurrence.
  • a pharmaceutical composition for the treatment of metastasis and/or recurrence in an individual suffering from breast cancer comprising a gene therapy vector or a vector as described herein and a pharmaceutically acceptable carrier or excipient is within the scope of the present invention.
  • a further aspect of the present invention is a pharmaceutical composition for the treatment of metastasis and/or recurrence in an individual suffering from breast cancer comprising the STARD13/DLC2 gene or fragment thereof, or a transcriptional or translational product or part thereof and a pharmaceutically acceptable carrier or excipient.
  • the present invention also discloses a vaccine for prophylaxis or treatment of metastasis and/or recurrence in an individual suffering from breast cancer comprising at least one expression product from gene with SEQ ID NO:1 or a fragment thereof.
  • the present invention relates to a method of treatment of an individual suffering from breast cancer having the predisposition to and/or prognosis of metastasis and/or recurrence, said method comprising administering to said subject a therapeutically effective amount of a gene therapy vector or a pharmaceutical composition as defined herein.
  • a further aspect of the present invention relates to a kit for use in a method as described herein, comprising at least one detection member, such as a detection member selected from the group consisting of antibodies, primers, probes and primer pairs.
  • a detection member selected from the group consisting of antibodies, primers, probes and primer pairs.
  • Yet a further aspect relates to the use of a gene therapy vector as defined herein or a pharmaceutical composition as defined herein for the manufacture of a medicament for the treatment of metastasis and/or recurrence of breast cancer.
  • one aspect pertains to a gene therapy vector as defined herein for the treatment of metastasis and/or recurrence of breast cancer.
  • Another aspect relates to a pharmaceutical composition comprising the STARD 13/DLC2 gene or fragment thereof for the treatment of metastasis and/or recurrence of breast cancer.
  • Yet another aspect relates to a pharmaceutical composition for treating metastasis and/or recurrence of breast cancer comprising the STARD13/DLC2 gene or fragment thereof, or a transcriptional or translational part thereof.
  • the present invention also pertains to methods and products for determine the predisposition, prognosis and/or treatment regime of an individual in relation to diabetes mellitus.
  • another aspect of the present invention covers a method for detecting a predisposition to diabetes in an individual comprising i) establishing a sample from said individual, ii) determining the presence or absence of a STARD13/DLC2 gene (SEQ ID NO:1) or part thereof in said sample, or iii) determining the presence or absence of a STARD13/DLC2 transcriptional product or part thereof in said sample, or iv) determining the presence or absence of a STARD13/DLC2 translational or part thereof in said sample, or v) determining the expression level of a STARD13/DLC2 transcriptional product or part thereof, or vi) determining the expression level of a STARD13/DLC2 translational product or part thereof.
  • one aspect relates to a method for determining the prognosis for an individual in relation to diabetes mellitus comprising the steps of i) establishing a sample from said individual, ii) determining the presence or absence of a STARD13/DLC2 gene (SEQ ID NO:1) or part thereof in said sample, or iii) determining the presence or absence of a STARD13/DLC2 transcriptional product (SEQ ID NO:2) or part thereof in said sample, or iv) determining the presence or absence of a STARD13/DLC2 translational product (SEQ ID NO:3) or part thereof in said sample, v) determining the expression level of a STARD13/DLC2 transcriptional product or part thereof, or vi) determining the expression level of a STARD13/DLC2 translational product or part thereof.
  • a further aspect pertains to a method for determining the treatment regime for an individual in relation to diabetes mellitus comprising the steps of i) establishing a sample from said individual, ii) determining the presence or absence of a STARD13/DLC2 gene or part thereof in said sample, or iii) determining the presence or absence of a STARD13/DLC2 transcriptional product or part thereof in said sample, or iv) determining the presence or absence of a STARD13/DLC2 translational or part thereof in said sample, v) determining the expression level of a STARD13/DLC2 transcriptional product or part thereof, or vi) determining the expression level of a STARD13/DLC2 translational product or part thereof, vii) assessing the outcome of f ii), iii), iv), v), or vi), viii) determining the risk of developing or having diabetes mellitus, ix) deciding on the treatment regime of said individual based on the outcome of vii)
  • one aspect relates to use of a method as described herein for producing an assay for detecting a predisposition to diabetes and/or determining the prognosis in relation to diabetes in an individual.
  • Another aspect relates to use of a method as described herein for producing an assay for determining the treatment regime of an individual suffering from diabetes.
  • Further aspects relates to use of a composition as described herein for the treatment of an individual suffering from diabetes, and an assay kit for use in the methods relating to diabetes mellitus, said kit comprising reagents and instructions for the performance of the assay method and for the interpretation of the results.
  • Yet a further aspect relates to the use of a gene therapy vector as defined herein or a pharmaceutical composition as defined herein for the manufacture of a medicament for the treatment of diabetes.
  • one aspect pertains to a gene therapy vector as defined herein for the treatment of diabetes.
  • Another aspect relates to a pharmaceutical composition
  • a pharmaceutical composition comprising the
  • STARD13/DLC2 gene or fragment thereof for the treatment of diabetes is a gene or fragment thereof for the treatment of diabetes.
  • Yet another aspect relates to a pharmaceutical composition for diabetes comprising the STARD13/DLC2 gene or fragment thereof, or a transcriptional or translational part thereof.
  • Figure 3 Disease-free survival (A) and freedom from distant metastases (B) as function of intragenic allelic imbalance affecting STARD13/DLC2 in 174 informative breast cancer patients.
  • the present invention in general relates to the field of human genetics. Specifically, the present invention relates to methods and products to determine the presence or absence of a region of the human chromosome 13 , which comprises the STARD13/DLC2 gene, wherein said methods and products are used to characterise a breast cancer tumour of an individual with respect to the tumour's capacity to develop metastasis.
  • the aspects of the present invention may be combined with the use of any other tool available that predict or are indicative of the future progression of a breast cancer disease.
  • prognostic factors such as staging, estrogen receptor analysis, and HER2/neu status. Staging is the single most important prognostic factor in breast cancer due to the fact that also lymph node status and metastasis status is observed when staging a tumour. The prognosis is better in node negative breast cancer patients, whereas a higher grade of the tumour is a worse prognosis. In breast cancer cells that are positive for HER2/neu the disease seems to progress more aggressively than compared to HER2/neu negative cells.
  • Another prognostic factor is the presence of estrogen or progesterone receptors in breast cancer cells which may also guide which treatment to offer to a patient.
  • Hormone receptor positive breast cancer is normally associated with much better prognosis compared to hormone negative breast cancer.
  • the present invention may be used in combination with any or all of the above mentioned prognostic factors.
  • the present invention relates to a method for detecting a predisposition to a period of metastasis-free, recurrence-free and/or disease-free survival in an individual suffering from breast cancer comprising i) establishing a breast cancer sample, ii) determining the presence or absence of a STARD 13/DLC2 gene or part thereof in said breast cancer sample, or iii) determining the presence or absence of a STARD13/DLC2 transcriptional product or part thereof in said breast cancer sample, or iv) determining the presence or absence of a STARD13/DLC2 translational or part thereof in said breast cancer sample, or v) determining the expression level of a STARD 13/DLC2 transcriptional product or part thereof, or vi) determining the expression level of a STARD13/DLC2 translational product or part thereof, wherein the absence of said gene, transcriptional product, translational product or part thereof determined in ii) - iv) is indicative of metastasis formation, recurr
  • the method for determining the predisposition to, the prognosis for, the treatment regime for and/or methods of treatment of an individual suffering from breast cancer relates to humans.
  • the present invention pertains to males or females.
  • the individual is a female.
  • the individual may suffer from unilateral breast cancer, bilateral breast cancer, secondary tumours for example in the lymph nodes in the axilla, or secondary tumours for example in liver or lung.
  • the term secondary tumour is used to describe tumours which are not the primary tumour but are tumours that have developed by metastasis from the primary tumour or a secondary tumour.
  • primary tumour is meant the original site where cancer occurs.
  • the present invention relates to for example females of the age ranging from 29 to 93 years. In another embodiment the age of the female ranges from 29 to 49 years. In another embodiment the age of the females ranges from less than 40 years, 40-49, 50- 59, 60-69, or above 69 years. In a preferred embodiment of the present invention the age of the female ranges from 50-59 years.
  • the individual of the present invention may have received treatment in the form of surgical removal of one or more tumours, chemotherapy, adjuvant radiotherapy or hormonal treatment.
  • the individual may have received any combination of the listed treatments for example surgical removal of one or more tumours and chemotherapy, or for example surgical removal of one or more tumours and chemotherapy followed by adjuvant radiotherapy.
  • the individual has received treatment in the form of lumpectomy and adjuvant radiotherapy.
  • the individual has received treatment in the form of radical mastectomy and adjuvant radiotherapy.
  • Another embodiment the individual suffering from breast cancer is a high risk patient, i. e. with positive axillary lymph nodes and/or high-grade, and/or large tumour, in combination with mastectomy or lumpectomy followed by adjuvant radiotherapy also receives treatment in the form of adjuvant systemic hormone and/or chemotherapy.
  • the term surgical removal includes mastectomy, or lumpectomy.
  • mastectomy the entire breast of a person suffering from breast cancer is removed by surgery.
  • Lumpectomy describes the removal by surgery of the tumour from the breast and optionally part of the surrounding breast tissue.
  • the individual may suffer from breast cancer of any type.
  • the breast cancer may be an adenoma, an adenocarcinoma, a carcinoma or carcinoma in situ.
  • tumor refers to all neoplastic cell growth and proliferation, whether malignant or benign, and all pre-cancerous and cancerous cells and tissues.
  • An adenoma is a benign tumour arising in glandular epithelium.
  • the glandular epithelium is a type of epithelial tissue whose primary function is secretion, and is the prominent tissue forming endocrine and exocrine glands, for example in the breast.
  • An adenoma may progress or transform into a malignant tumour which is then characterised as an adenocarcinoma.
  • a carcinoma is defined as a malignant tumour that begins in the lining layer (epithelial cells) of organs.
  • Carcinoma have a tendency to infiltrate into adjacent tissue and spread (metastasize) to distant organs, such as bone, liver, lung, or the brain.
  • the present invention also relates to individuals suffering from breast cancer in the form of carcinoma in situ (CIS) which is an early form of carcinoma and is defined by the absence of invasion of surrounding tissues.
  • carcinoma in situ is the abnormal growth of cells that proliferate in their normal habitat, hence the name 'in situ'.
  • Carcinoma in situ is also equivalent to the term high grade dysplasia.
  • the breast cancer of the present invention may be invasive or non-invasive.
  • invasive cancer is meant cancer characterized by spreading from its point of origination into other tissues and organs.
  • invasive breast cancers develop in milk glands (lobules) or milk passages (ducts) and spread to the nearby fatty breast tissue.
  • Some invasive cancers spread to distant areas of the body (metastasize), but others do not.
  • Invasive cancer is also referred to as infiltrating cancer. By analogy, the noninvasive cancers do not invade surrounding tissue.
  • the breast cancer from which an individual according to the present invention suffers may thus be selected from the group consisting of a primary malignant tumour, a ductal carcinoma, a lobular carcinoma, a ductal carcinoma in situ, lobular carcinoma in situ, and a secondary tumour for example in the axil, lung or liver.
  • One embodiment of the present invention relates to individuals suffering from invasive ductal carcinoma, a cancer that starts in the milk passages (ducts) of the breast and then breaks through the duct wall, where it invades the fatty tissue of the breast. When the cancer reaches this point, it has the potential to spread (metastasize) elsewhere in the breast, as well as to other parts of the body through the bloodstream and lymphatic system.
  • Invasive ductal carcinoma is the most common type of breast cancer, accounting for about 80% of breast malignancies.
  • Ductal carcinoma in situ is characterized as proliferation of abnormal cells within the milk passages (ducts) but where no visible signs of invasion into the duct wall are evident. This is a highly curable form of breast cancer that is treated with surgery or surgery plus radiation therapy.
  • the present invention also relates to Lobular carcinoma which is a cancer that begins in the lobules (the glands that make milk) of the breast.
  • Lobular carcinoma in situ is a condition in which abnormal cells are found only in the lobules. When cancer has spread from the lobules to surrounding tissues, it is invasive lobular carcinoma. LCIS does not become invasive lobular carcinoma very often, but having LCIS in one breast increases the risk of developing invasive cancer in either breast.
  • the breast cancer according to the present invention may be a hereditary or nonhereditary sporadic breast cancer.
  • hereditary breast cancer is meant a cancer that is genetically transmitted from parent to child. The incidence of hereditary breast cancer is believed to range from between 5 to 10 percent of all breast cancers.
  • BRCA1 for BReast CAnceri
  • BRCA2 have been identified on chromosome 17 and chromosome 13, respectively which in a mutated from seems to be involved in the development of breast cancer in that individuals carrying a mutated form of either BRCA1 or BRCA2, have an increased risk of developing breast or ovarian cancer at some point in their lives. Consequently, children of parents with a BRCA1 or BRCA2 mutation have a 50 percent chance of inheriting the gene mutation.
  • Nonhereditary sporadic breast cancer is the most common breast cancer of the two types of breast cancers, and accounts for as much as 90% of the cases of breast cancer.
  • the BRCA1 or BRCA2 genes are not mutated.
  • the sporadic breast cancers are caused by gene damage acquired to breast cells during the woman's lifetime (' somatic 1 mutations).
  • a wide variety of genes is commonly mutated or incorrectly regulated in sporadic breast cancers and have been implicated in the development and progression of the disease.
  • One preferred embodiment of the present invention relates to sporadic ductal carcinomas, and in particular to invasive ductal carcinomas.
  • Breast cancer may be staged according to defined characteristics relating to size and metastasising properties.
  • One staging system commonly used to divide breast cancers into stages is that of the AJCC-TNM system (American Joint Committee on Cancer (AJCC) TNM system).
  • the cancers may according to the staging system be classified based on their T, N, and M stages, where T is an abbreviation for tumour (its size and how far it has spread within the breast and to nearby organs), N stands for spread to lymph nodes (bean-shaped collections of immune system cells that help fight infections and cancers) and M is for metastasis (spread to distant organs).
  • T an abbreviation for tumour (its size and how far it has spread within the breast and to nearby organs)
  • N stands for spread to lymph nodes (bean-shaped collections of immune system cells that help fight infections and cancers)
  • M is for metastasis (spread to distant organs).
  • the stage of a breast cancer can be based on results obtained by physical examination, imaging tests or by pathological inspection of tissue following surgery.
  • the present staging system is based on the pathologic conclusion drawn by a pathologist after examination of the breast tissue and lymph nodes removed by surgery.
  • T 0 to 4 describes the size of the tumour and spread to the skin or to the chest wall under the breast, where higher T numbers indicate a large tumour and/or wider spread to tissues near the breast.
  • N followed by a number from 0 to 3 is indicative of whether the cancer has spread to lymph nodes near the breast and, if so, how many lymph nodes are affected.
  • M denotes whether the cancer has spread to distant organs, where 0 is indicative for spreading to for example the lungs or bones, and 1 is indicative for spreading of the cancer to lymph nodes distant to the breast, for example above the collarbone.
  • stage of the breast cancer is determined by combining the above features. Stage is expressed as stage 0 and in Roman numerals from stage I (the least advanced stage) to stage IV (the most advanced stage).
  • Stage 0 Tis, N0, M0: Ductal carcinoma in situ (DCIS).
  • LCIS Lobular carcinoma in situ
  • Paget disease of the nipple is stage 0. In all cases the cancer has not spread to lymph nodes or distant sites.
  • Stage I T1 , N0, M0: The tumour is 2 cm (about 3/4 of an inch) or less in diameter and has not spread to lymph nodes or distant sites.
  • Stage HA T0, N1 , M0 / T1 , N1 , M0 / T2, N0, M0: No tumour is found in the breast but it is in 1 to 3 axillary lymph nodes; or the tumour is less than 2 cm and has spread to 1 to 3 axillary lymph nodes; or cancer is found by sentinel node biopsy as microscopic disease in internal mammary nodes, but not on imaging studies or by clinical exam; or the tumour is larger than 2 cm in diameter and less than 5 cm, but hasn't spread to axillary nodes. In all cases the cancer has not spread to distant sites.
  • Stage MB T2, N1 , M0 / T3, N0, M0:
  • the tumour is larger than 2 cm in diameter and less than 5 cm and has spread to 1 to 3 axillary lymph nodes; or cancer is found by sentinel node biopsy as microscopic disease in internal mammary nodes; or the tumour is larger than 5 cm and does not grow into the chest wall and has not spread to lymph nodes. In all cases, the cancer has not spread to distant sites.
  • Stage IHA T0-2, N2, M0 / T3, N1-2, M0:
  • the tumour is smaller than 5 cm in diameter and has spread to 4 to 9 axillary lymph nodes; or it is found through imaging studies or clinical examination to have spread to internal mammary nodes; or the tumour is larger than 5 cm and has spread to 1 to 9 axillary nodes, or to internal mammary nodes. In all cases, the cancer has not spread to distant sites.
  • Stage IHB T4, N0-2, M0: The tumour has grown into the chest wall or skin and may have spread to no lymph nodes or to as many as 9 axillary nodes. It may or may not have spread to internal mammary nodes. No spread to distant sites is observed.
  • Stage IHC T0-4, N3, M0: The tumour is any size, has spread to 10 or more nodes in the axilla; or to 1 or more lymph nodes under the clavicle (infraclavicular) or above the clavicle (supraclavicular); or to internal mammary lymph nodes, which are enlarged because of the cancer. All of these are on the same side as the breast cancer. No spread to distant sites is observed. Inflammatory breast cancer is classified as stage III, unless it has spread to distant organs or lymph nodes that are not near the breast, in which case it would be stage IV.
  • Stage IV T0-4, N0-3, M1: The cancer, regardless of its size, has spread to distant organs such as bone, liver, or lung, or to lymph nodes far from the breast.
  • TX Primary tumour cannot be assessed
  • T0 No evidence of primary tumour
  • Tis Pure carcinoma in situ; intraductal carcinoma, lobular carcinoma in situ, or Paget disease of the nipple with no associated tumour mass
  • T1 Tumour 2 cm (about % of an inch) or less in greatest dimension
  • T2 Tumour more than 2 cm but not more than 5 cm (2 inches) in greatest dimension
  • T3 Tumour more than 5 cm in greatest dimension
  • T4 Tumour of any size growing into the chest wall or skin
  • NX Regional lymph nodes cannot be assessed (for example, removed previously)
  • N0 Cancer not spread to regional lymph nodes
  • N1 Cancer spread to 1 to 3 lymph node(s) under the arm
  • N2 Cancer has spread to 4 to 9 lymph nodes under the arm
  • N3 Cancer has spread to 10 or more lymph nodes under the arm or also involves lymph nodes in other areas around the breast
  • MX Presence of distant spread (metastasis) cannot be assessed
  • the breast cancer may also be characterised by a number of markers such as sex steroid hormone receptors.
  • markers such as sex steroid hormone receptors.
  • ER+ estrogen receptor positive
  • PR+ progesterone receptor positive
  • the receptor status influences the choice of treatment as, for instance, ER+ lesions are more sensitive to hormonal therapy.
  • the present invention pertains to breast cancer of any stage such as stage 0 (carcinoma in situ), I, HA, MB, IHA, IHB, IIIC or IV.
  • stage 0 carcinoma in situ
  • I, HA, MB, IHA, IHB, IIIC or IV breast cancer sample and control sample
  • the breast cancer sample used in the present invention may be any suitable cell sample capable of providing the genetic material for use in the method as a breast cancer sample.
  • the breast cancer sample may be tumour tissue removed during surgery in the process of mastectomy or lumpectomy.
  • the sample may also be a biopsy of tumour tissue.
  • control sample used in the present invention may be any suitable cell sample capable of providing the genetic material for use in the method as a control sample.
  • suitable is meant that control sample is any tissue sample in non-diseased state.
  • the sample is a blood sample, a tissue sample from any tissue not affected by the breast cancer, a sample of secretion, semen, ovum, a washing of a body surface, a clipping of a body surface (hairs, or nails), buccal swab sample, or non-diseased breast tissue sample.
  • the control sample is selected from the group consisting of blood sample, buccal swap sample, hair sample, sample of nail, breast sample and serum.
  • samples may be for example biopsies of diseased or non- diseased tissue.
  • the samples may be fresh or frozen.
  • samples may equally be a nucleic acid sequence corresponding to the sequence in the sample, that is to say that all or part of the region in the nucleic acid of the sample may firstly be amplified using any convenient technique, e.g. PCR, before use in the analysis of variation in the region.
  • any convenient technique e.g. PCR
  • the present invention relates to a method for determining the predisposition to a period of metastasis-free, recurrence-free and/or disease-free survival in an individual suffering from breast cancer, wherein predisposition is a measure of an individual's susceptibility to a disease that can be triggered under certain conditions or an individual's tendency to develop a certain disease.
  • metastasis-free survival By a period of metastasis-free survival is meant the period of time from diagnosis of breast cancer in which no metastasis has occurred in the individual.
  • metastasis is meant the migration of cancer cells from the original tumour site through the blood and lymph vessels to produce cancers in other tissues.
  • Metastasis also is the term used for a secondary cancer growing at a distant site relative to the primary tumour. The tumour arising as a result of metastasis is termed a secondary tumour.
  • the present invention relates to metastasis to any tissue of the individual.
  • metastasis in particular refers to metastasis to liver, lung, or nodes of the axilla of the individual.
  • the period of metastasis-free survival is up to 25 years, 20, 19, 18, 17, 16, 15, 14, 13, 12 or 1 1 years from the date of primary surgery. In one embodiment the period of metastasis-free survival is up to 10 years from the date of primary surgery. In one embodiment the period of metastasis-free survival is up to 9 years, 8, 7, 6, 5, 4, 3 or 2 years. In other embodiments the period of metastasis-free survival is 15 years, 14, 13, 12, 11 , 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 years.
  • a period of recurrence-free survival is meant the period of time from diagnosis of breast cancer in which no recurrence has occurred in the individual.
  • 'recurrence' refers to a condition, wherein cancer comes back after treatment.
  • Local recurrence is when the cancer comes back at the same place as the original cancer.
  • Regional recurrence is when the cancer appears in the lymph nodes near the first site.
  • Distant recurrence is when it appears in organs or tissues (such as the lungs, liver, bone marrow, or brain) farther from the original site than the regional lymph nodes.
  • Recurrence-free survival is thus defined as the period of time, wherein no return of cancer has appeared, at the same site as the original (primary) tumour or in another location, after disappearance of the tumour.
  • the present invention relates to recurrence of any type as described above.
  • the period of recurrence-free survival is up to 25 years, 20, 19, 18, 17, 16, 15, 14, 13, 12 or 11 years from the date of primary surgery . In one embodiment the period of recurrence -free survival is up to 10 years from the date of primary surgery. In one embodiment the period of recurrence -free survival is up to 9 years, 8, 7, 6, 5, 4, 3 or 2 years. In other embodiments the period of recurrence -free survival is 15 years, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 years.
  • a period of disease-free survival is meant the period of time from diagnosis of breast cancer in which no disease caused by the cancer has occurred in the individual. Such a disease may be metastasis and/or one or more secondary tumours.
  • the period of disease-free survival is up to 25 years, 20, 19, 18, 17, 16, 15, 14, 13, 12 or 11 years from the date of primary surgery. In one embodiment the period of disease -free survival is up to 10 years from the date of primary surgery. In one embodiment the period of disease -free survival is up to 9 years, 8, 7, 6, 5, 4, 3 or 2 years. In other embodiments the period of disease -free survival is 15 years, 14, 13, 12, 11 , 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 years.
  • An increased risk of recurrence, acquisition of metastasis and/or short disease-free survival is the risk of recurrence, acquisition of metastasis and/or short disease-free survival as compared to an individual according to the present invention, wherein the gene of the present invention is present (or the expression level of said gene is not reduced). Such comparison is depicted in figure 3.
  • long-term survival is used herein to refer to survival for 1-40 years, such as at least 1 year, 2 years, 3 years, 4 years, 5 years, 6 years, 7 years, 8 years, 9 years, 10 years, 11 year, 12 years, 13 years, 14 years, 15 years, 16 years, 17 years, 18 years, 19 years, 20 years, 21 years, 22 years, 23 years, 24 years, or 25 years, 26 years, 27 years, 28 years, 29 years, 30 years, 31 years, 32 years, 33 years, 34 years, or 35 years, 36 years, 37 years, 38 years, 39 years, or 40 years following the date of primary surgery.
  • the present invention relates to a method for detecting a predisposition to a period of metastasis-free, recurrence-free and disease-free survival of an individual suffering from breast cancer.
  • the present invention also relates to each of the feature of metastasis-free, recurrence-free or disease-free survival separately.
  • the present invention covers a method for detecting a predisposition to a period of metastasis-free, recurrence-free or disease-free survival of an individual suffering from breast cancer.
  • the present invention also refers to a combination of features in the method for detecting a predisposition to a period of metastasis-free survival and recurrence-free survival, or metastasis-free survival and disease-free survival of an individual suffering from breast cancer.
  • Prognosis is the forecast of the course and probable outcome of a disease.
  • the prognosis is based on information about the disease course of patients suffering from disease and the presence of certain markers, for example genetic markers.
  • the knowledge about the correlation can be compared to provide a prognosis of an individual based on the presence or absence of said genetic markers.
  • the outcome of a disease according to the present invention refers to progression of breast cancer including recurrence and metastatic spread of a neoplastic disease and long or short term survival.
  • the present invention relates to a method for determining the prognosis for a period of metastasis-free, recurrence-free and/or disease-free survival in an individual suffering from breast cancer comprising the steps of i) establishing a breast cancer sample, ii) determining the presence or absence of a STARD13/DLC2 gene (SEQ ID NO:1) or part thereof in said breast cancer sample, or iii) determining the presence or absence of a STARD13/DLC2 transcriptional product (SEQ ID NO:2)or part thereof in said breast cancer sample, or iv) determining the presence or absence of a STARD13/DLC2 translational product (SEQ ID NO:3) or part thereof in said breast cancer sample, v) determining the expression level of a STARD13/DLC2 transcriptional product or part thereof, or vi) determining the expression level of a STARD13/DLC2 translational product or part thereof, wherein the absence of said gene, transcriptional product, translational product or part thereof determined in
  • the present invention also provides tools for classifying a tumour from an individual suffering from breast cancer with regard to the metastasising potential of the tumour.
  • the present invention relates to a method for classification of at least one tumour from an individual suffering from breast cancer comprising the steps of i) establishing a breast cancer sample; ii) determining the presence or absence of a STARD 13/DLC2 gene or part thereof in said breast cancer sample, or; iii) determining the presence or absence of a STARD13/DLC2 transcriptional product or part thereof in said breast cancer sample, or; iv) determining the presence or absence of a STARD13/DLC2 translational or part thereof in said breast cancer sample, v) determining the expression level of a STARD13/DLC2 transcriptional product or part thereof, or; vi) determining the expression level of a STARD13/DLC2 translational product or part thereof, vii) assessing the outcome of f ii), iii), iv), v), or vi),
  • tumours from an individual may be classified. Such classification of more than one tumour may be performed simultaneous or sequentially from the time of surgery.
  • the classification of the tumour may aid in the selection of which treatment to offer an individual suffering from breast cancer as described elsewhere herein.
  • St. Gallen criteria are determined at present every two years at a Conference on Primary Therapy of Early Breast Cancer.
  • the clinical criteria i.e. age, type of cancer, size and metastasis essentially divide the patients into three groups according to the 2005 International Consensus Panel, (http://www.breastcancersource.com).
  • Endocrine responsiveness cells express steroid hormone receptors (diagnosed with proper immunohistological/biochemical methods) and it is probable that endocrine therapies are effective in improving disease-free and overall survival.
  • Endocrine response uncertain some expression of hormone receptors either quantitatively low or qualitatively insufficient to indicate a substantial chance for response to endocrine therapies alone, thus suggesting the need for chemotherapy.
  • Endocrine non-responsive cells have no detectable expression of steroid hormone receptors.
  • Endocrine responsive and Endocrine response uncertain are undecided, and may well be different in different clinical settings (e.g. according to number of involved axillary lymph nodes or menopausal status).
  • Nodal status remains the most important feature for defining risk category, however, the new risk groups do not adhere rigidly to the traditional node-positive/node-negative boundary.
  • the risk categories for patients with node-negative breast cancer are as follows:
  • Node positive (4 or more involved nodes)
  • GnRHa some forms of ET
  • Tamoxifen ( ⁇ OFS) ( ⁇ CT), -r ., v ' ⁇ " Tamoxifen, or
  • Taxane-containing regimens AC or A
  • Al aromatase inhibitor (anastrozole, exemestane, letrozole).
  • CT chemotherapy.
  • (A anthracycline: either adriamycin or epirubicin; epirubicin mentioned also as ⁇ ' in CEF and FEC regimens).
  • GnRHa gonadotrophin releasing hormone. Research was conducted using goserelin.
  • OFS ovarian function suppression or ablation. This table does not include information on the adjuvant treatment with trastuzumab of patients with over-expressed or amplified HER2/neu breast cancer.
  • the determination of which individuals should receive further treatment after surgery and which individuals should not receive further treatment depends on the individual's predisposition to the development of metastasis, recurrence and/or disease. With the present invention it is not only possible to select the individuals which should receive further treatment but also to determine which individuals that are not likely to develop cancer again or to form metastasis. The latter individuals can thus avoid further supplementary treatment following surgery, and be relieved from side effects of the follow-up therapy.
  • the methods of the present invention can be used clinically to make treatment decisions by choosing the most appropriate treatment modalities for any particular patient. According to the present invention individuals suffering from breast cancer wherein the presence has been determined of the STARD13/DLC2 gene, transcriptional or translational product thereof as described elsewhere herein do not need supplementary treatment.
  • the present invention thus discloses a method for determining the treatment regime for an individual suffering from breast cancer comprising the steps of i) establishing a breast cancer sample, ii) determining the presence or absence of a STARD13/DLC2 gene or part thereof in said breast cancer sample, or, iii) determining the presence or absence of a STARD 13/DLC2 transcriptional product or part thereof in said breast cancer sample, or iv) determining the presence or absence of a STARD13/DLC2 translational product or part thereof in said breast cancer sample, v) determining the expression level of a STARD13/DLC2 transcriptional product or part thereof, or vi) determining the expression level of a STARD13/DLC2 translational product or part thereof, vii) assessing the outcome of f ii), iii), iv), v), or vi); viii) determining the risk of developing metastasis and/or having a reduced overall survival; ix) deciding on the treatment regime of said individual suffering from breast
  • variants of STARD13/DLC2 are used interchangeably herein.
  • variants of STARD13/DLC2 are determined on the basis of their degree of identity or their homology with a predetermined amino acid sequence, said predetermined amino acid sequence being one of SEQ ID NO: 3, or, when the variant is a fragment, a fragment of any of the aforementioned amino acid sequences, respectively.
  • variants preferably have at least 91 % sequence identity, for example at least 91% sequence identity, such as at least 92 % sequence identity, for example at least 93 % sequence identity, such as at least 94 % sequence identity, for example at least 95 % sequence identity, such as at least 96 % sequence identity, for example at least 97% sequence identity, such as at least 98 % sequence identity, for example 99% sequence identity with the predetermined sequence.
  • sequence relationships between two or more polynucleotides are used to describe the sequence relationships between two or more polynucleotides: "predetermined sequence”, “comparison window”, “sequence identity”, “percentage of sequence identity”, and “substantial identity”.
  • a "predetermined sequence” is a defined sequence used as a basis for a sequence comparision; a predetermined sequence may be a subset of a larger sequence, for example, as a segment of a full-length DNA or gene sequence given in a sequence listing, such as a polynucleotide sequence of SEQ ID NO:1 , or may comprise a complete DNA or gene sequence. Generally, a predetermined sequence is at least 20 nucleotides in length, frequently at least 25 nucleotides in length, and often at least 50 nucleotides in length.
  • two polynucleotides may each (1) comprise a sequence (i.e., a portion of the complete polynucleotide sequence) that is similar between the two polynucleotides, and (2) may further comprise a sequence that is divergent between the two polynucleotides
  • sequence comparisons between two (or more) polynucleotides are typically performed by comparing sequences of the two polynucleotides over a "comparison window" to identify and compare local regions of sequence similarity.
  • a “comparison window”, as used herein, refers to a conceptual segment of at least 20 contiguous nucleotide positions wherein a polynucleotide sequence may be compared to a predetermined sequence of at least 20 contiguous nucleotides and wherein the portion of the polynucleotide sequence in the comparison window may comprise additions or deletions (i.e., gaps) of 20 percent or less as compared to the predetermined sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences.
  • Optimal alignment of sequences for aligning a comparison window may be conducted by the local homology algorithm of Smith and Waterman (1981 ) Adv. Appl. Math.
  • sequence identity means that two polynucleotide sequences are identical (i.e., on a nucleotide-by-nucleotide basis) over the window of comparison.
  • percentage of sequence identity is calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of positions at which the identical nucleic acid base (e.g., A, T, C, G, U, or I) occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison (i.e., the window size), and multiplying the result by 100 to yield the percentage of sequence identity.
  • substantially identical denotes a characteristic of a polynucleotide sequence, wherein the polynucleotide comprises a sequence that has at least 85 percent sequence identity, preferably at least 90 to 95 percent sequence identity, more usually at least 99 percent sequence identity as compared to a predetermined sequence over a comparison window of at least 20 nucleotide positions, frequently over a window of at least 25-50 nucleotides, wherein the percentage of sequence identity is calculated by comparing the predetermined sequence to the polynucleotide sequence which may include deletions or additions which total 20 percent or less of the predetermined sequence over the window of comparison.
  • the predetermined sequence may be a subset of a larger sequence, for example, as a segment of the full- length SEQ ID NO:1 polynucleotide sequence illustrated herein.
  • the methods of the present invention may be detected on the nucleic acid level, determining the presence or absence of a STARD13/DLC2 gene (SEQ ID NO:1) or part thereof (genomic level), or transcriptional product or part thereof (transcriptional level). It is appreciated that the methods of detecting the presence or absence of STARD13/DLC2 may be performed also on a complementary sequence. The absence or presence may be determined in for example at least one coding region of the STARD13/DLC2 gene, however, the absence or presence may also be determined in at least one regulatory sequence of the STARD13/DLC2 gene.
  • regulatory sequence is meant sequences within SEQ ID NO:1 that regulate the transcriptional and translational process, for example, promoters, enhancers, sequences that affect polyadenylation, translational or transcriptional start, splicing of transcriptional products.
  • the promoters and enhancers that control the transcription of protein- encoding genes are composed of multiple genetic elements. The cellular machinery is able to gather and integrate the regulatory information conveyed by each element, allowing different genes to evolve distinct, often complex patterns of transcriptional regulation.
  • RNA transcript products of gene transcription
  • products of gene transcription such as a RNA transcript, for example an unspliced RNA transcript, a mRNA transcript and said mRNA transcript splicing products
  • products of gene translation such as polypeptide(s) translated from any of the gene mRNA transcripts and various products of post-translational processing of said polypeptides, such as the products of post-translational proteolytic processing of the polypeptide(s) or products of various post-translational modifications of said polypeptide(s).
  • transcriptional product of the gene refers to a pre- messenger RNA molecule, pre-mRNA, that contains the same sequence information (albeit that U nucleotides replace T nucleotides) as the gene, or mature messenger RNA molecule, mRNA, which was produced due to splicing of the pre-mRNA, and is a template for translation of genetic information of the gene into a protein.
  • the term "translational product of the gene” refers to a protein, which is encoded by the STARD13/DLC2 gene (SEQ ID NO:1).
  • transcriptional product of the gene refers to a transcript which is encoded by the STARD13/DLC2 gene (SEQ ID NO:1). It is appreciated by the person skilled in the art that a number of isoforms of STARD13/DLC2 is known, lsoforms are versions of a protein with some small differences, usually a splice variant or the product of some posttranslational modification. The present invention relates to any isoform of STARD13/DLC2. The examples given herein are not meant to be limiting to the scope of the present invention. Thus the present invention relates to methods for determining the presence or absence of the transcriptional products of the STARD13/DLC2 gene corresponding to any transcriptional product of SEQ ID NO:1 or part thereof.
  • the invention relates to determining the presence or absence of the STARD13/DLC2 gene in the transcriptional products of the STARD13/DLC2 gene in (i) a nucleic acid sequence identified in the invention as SEQ ID NO: 2, SEQ
  • SEQ ID NO:4 SEQ ID NO:4 , SEQ ID NO:6 and/or SEQ ID NO:8 or fragments thereof, (ii) a nucleic acid sequence having at least 90% identity with SEQ ID NO: 2,
  • the invention also relates to determining the presence or absence of the STARD13/DLC2 gene translational products of the STARD13/DLC2 gene in
  • said variant proteins, fragments thereof and said polypeptide sequences are comprising polymorphism corresponding to the polymorphism of the corresponding genomic sequences or transcriptional products of said genomic sequences.
  • Sequence identity is determined in one embodiment by utilising fragments of STARD13/DLC2 peptides comprising at least 25 contiguous amino acids and having an amino acid sequence which is at least 80%, such as 85%, for example 90%, such as 95%, for example 99% identical to the amino acid sequence of SEQ ID NO: 3, SEQ ID NO:5 , SEQ ID NO: 7 and/or SEQ ID NO:9, wherein the percent identity is determined with the algorithm GAP, BESTFIT, or FASTA in the Wisconsin Genetics Software Package Release 7.0, using default gap weights.
  • the methods of the present invention relates to the use of the STARD13/DLC2 gene (SEQ ID NO.:1 ) or part thereof, a STARD13/DLC2 transcriptional product or part thereof, or a STARD13/DLC2 translational product or part thereof.
  • STARD13/DLC2 comprises introns and exons.
  • the presence or absence (or levels of transcriptional or translational product can thus be determined in the exons selected from the group consisting of exon 1(SEQ ID NO.:25), exons 2 (SEQ ID NO.:26), exon 3 (SEQ ID NO.:27), exon 4 (SEQ ID NO.:28), exon 5 (SEQ ID NO.:29), exons 6 (SEQ ID NO.:30), exon 7 (SEQ ID NO.:31 ), exon 8 (SEQ ID NO.:32), exon 9 (SEQ ID NO.:33), exons 10 (SEQ ID NO.:34), exon 11(SEQ ID NO.:35), exon 12 (SEQ ID NO.:36), exon 13 (SEQ ID NO.: (SEQ ID NO.:37), exon 14 (SEQ ID NO.:38), exon 15 (SEQ ID NO.:39), exon 16 (SEQ ID NO.:40), exon 17
  • the presence or absence can be determined in the exons selected from the group consisting of exon 1 , exons 2, exon 3, exon 4, exon 5, exons 6, exon 7, exon 8, exon 9, exons 10, exon 1 1 , exon 15 and exon 17 or parts thereof. In another embodiment the presence or absence can be determined in the exons selected from the group consisting of exon 1 , exons 2, exon 3, exon 4, exon 5, exons 6, exon 7, exon 8, exon 9, exons 10 and exon 11 or parts thereof.
  • the presence or absence can be determined in the exons selected from the group consisting of exon 1 , exons 2, exon 3, exon 4, exon 5, exons 6, exon 7, exon 8, exon 9, exons 10 and exon 11 or parts thereof.
  • the presence or absence can be determined in the exons selected from the group consisting of exon 1 , exons 2, exon 3, exon 4, exon 5, exons 6, exon 7, exon 8 and exon 9 or parts thereof; or selected from exon 3, exon 4, exon 5, exons 6, exon 7, exon 8, exon 9, exons 10 and exon 11 or parts thereof; or selected from exon 1 , exons 2, exon 3, exon 4, exon 5, exons 6, exon 7, exon 8, exon 9, exons 10 and exon 11 or parts thereof.
  • the presence or absence can be determined in the exons selected from the group consisting of exon 1 , exon 9, exons 10 and exon 11 or parts thereof.
  • exons selected individually from exon 1 , exons 2, exon 3, exon 4, exon 5, exons 6, exon 7, exon 8, exon 9, exons 10, exon 11 , exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon with SEQ ID NO.:42, exon with SEQ ID NO.:43, exon with SEQ ID NO.:44 or exon with SEQ ID NO.-.44 or parts thereof.
  • the presence or absence is determined in exon 9 or part thereof.
  • the presence or absence is determined in exon 10 or part thereof.
  • the presence or absence is determined in exon 11 (SEQ ID NO.: 35) or part thereof.
  • the presence or absence is determined in exon 1 (SEQ ID NO.: 25) or part thereof.
  • the presence or absence of the STARD13/DLC2 gene or part thereof as used in the methods herein can be referred to as copy number variation of the STARD13/DLC2 gene i.e whether an amplification or deletion has occurred in the STARD13/DLC2 gene or part thereof.
  • Copy number variation can be detected on the genomic DNA level, transcriptional level and translational level as described herein which are known to the person skilled in the art.
  • a preferred method is the use of multiple ligation-dependent probe amplification (MLPA).
  • MLPA multiple ligation-dependent probe amplification
  • Another preferred method for detection of copy number variation of STARD13/DLC2 is the use of allelic imbalance/loss of heterozygosity (LOH) analysis.
  • LH heterozygosity
  • a preferred method is the use of quantitative PCR. The presence or absence (or levels of transcriptional or translational product can in one embodiment be determined in the introns of the STARD13/DLC2.
  • the presence or absence of the STARD 13/DLC2 gene may also be determined by using for example genetic markers present in all regions of the gene.
  • the genetic markers may be positioned in the promoter region of the gene, in introns and/or in exons.
  • the term promoter will be used here to refer to a group of transcriptional control modules that are clustered around the initiation site for RNA polymerase II. Promoters are composed of discrete functional modules, each consisting of approximately 7-20 bp of DNA, and containing one or more recognition sites for transcriptional activator proteins. At least one module in each promoter functions to position the start site for RNA synthesis. The best known example of this is the TATA box.
  • Additional promoter elements regulate the frequency of transcriptional initiation.
  • these are located in the region 30-110 bp upstream of the start site, although a number of promoters have recently been shown to contain functional elements downstream of the start site as well.
  • the spacing between elements is flexible, so that promoter function is preserved when elements are inverted or moved relative to one another.
  • Enhancers were originally detected as genetic elements that increased transcription from a promoter located at a distant position on the same molecule of DNA.
  • the basic distinction between enhancers and promoters is operational. An enhancer region as a whole must be able to stimulate transcription at a distance; this need not be true of a promoter region or its component elements.
  • a promoter must have one or more elements that direct initiation of RNA synthesis at a particular site and in a particular orientation, whereas enhancers lack these specificities.
  • enhancers and promoters are very similar entities. They have the same general function of activating transcription in the cell. They are often overlapping and contiguous, often seeming to have a very similar modular organization.
  • the presence or absence of the STARD13/DLC2 gene may be determined by using for example genetic markers present in all regions of the gene.
  • the genetic markers are positioned in the exons of a gene. Exons are the protein-coding DNA sequences of the gene.
  • an intron is a nucleotide sequence intervening between exons (coding regions) that is excised from a gene transcript during RNA processing.
  • the presence or absence of the STARD 13/DLC2 gene is determined in i) a nucleotide sequence with SEQ ID NO: 1 , ii) a nucleotide sequence having at least 90 % sequence identity with a sequence of (i), or with a fragment thereof, and/or iii) a nucleotide sequence complementary to any of the sequences of (i) or (ii).
  • nucleic acids may be liberated from the collected cells, into a crude extract followed by additional treatments to prepare the sample for subsequent operations, such as denaturation of contaminating (DNA binding) proteins, purification, filtration and desalting.
  • Liberation of nucleic acids from the sample cells, and denaturation of DNA binding proteins may generally be performed by physical or chemical methods.
  • chemical methods generally employ lysing agents to disrupt the cells and extract the nucleic acids from the cells, followed by treatment of the extract with chaotropic salts such as guanidinium isothiocyanate or urea to denature any contaminating and potentially interfering proteins.
  • nucleic acids and denature DNA binding proteins such as physical protrusions within microchannels or sharp edged particles piercing cell membranes and extract their contents. Combinations of such structures with piezoelectric elements for agitation can provide suitable shear forces for lysis.
  • cell extraction and denaturing of contaminating proteins may be carried out by applying an alternating electrical current to the sample. More specifically, the sample of cells is flowed through a microtubular array while an alternating electric current is applied across the fluid flow. Subjecting cells to ultrasonic agitation or forcing cells through microgeometry apertures, thereby subjecting the cells to high shear stress resulting in rupture are also possible extraction methods.
  • nucleic acids Following extraction, it will often be desirable to separate the nucleic acids from other elements of the crude extract, e.g. denatured proteins, cell membrane particles and salts. Removal of particulate matter is generally accomplished by filtration or flocculation. Further, where chemical denaturing methods are used, it may be desirable to desalt the sample prior to proceeding to the next step. Desalting of the sample and isolation of the nucleic acid may generally be carried out in a single step, e.g. by binding the nucleic acids to a solid phase and washing away the contaminating salts, or performing gel filtration chromatography on the sample passing salts through dialysis membranes. Suitable solid supports for nucleic acid binding include e.g. diatomaceous earth or silica (i.e., glass wool). Suitable gel exclusion media also well known in the art may be readily incorporated into the devices of the present invention and is commercially available from, e.g., Pharmacia and Sigma Chemical.
  • desalting methods may generally take advantage of the high electrophoretic mobility and negativity of DNA compared to other elements.
  • Electrophoretic methods may also be utilized in the purification of nucleic acids from other cell contaminants and debris. Upon application of an appropriate electric field, the nucleic acids present in the sample will migrate toward the positive electrode and become trapped on the capture membrane. Sample impurities remaining free of the membrane are then washed away by applying an appropriate fluid flow. Upon reversal of the voltage, the nucleic acids are released from the membrane in a substantially purer form. Further, coarse filters may also be overlaid on the barriers to avoid any fouling of the barriers by particulate matter, proteins or nucleic acids, thereby permitting repeated use.
  • the high electrophoretic mobility of nucleic acids with their negative charges may be utilized to separate nucleic acids from contaminants by utilizing a short column of a gel or other appropriate matrices or gels which will slow or retard the flow of other contaminants while allowing the faster nucleic acids to pass.
  • Determination of presence or absence of the STARD13/DLC2 gene may be performed by the use of genetic markers.
  • the term "genetic marker” refers to a variable nucleotide sequence (polymorphism) of the DNA on the human chromosome, in the present case to nucleotide sequences on the human chromosome 13.
  • polymorphism refers to the coexistence of more than one form of a gene or portion thereof. A portion of a gene of which there are at least two different forms, i. e., two different nucleotide sequences, is referred to as a "polymorphic region of a gene".
  • a polymorphic region can be a single nucleotide, the identity of which differs in different alleles. Such polymorphism is referred herein as "single nucleotide polymorphism" or SNP.
  • a polymorphic region also can be several nucleotides in length.
  • a gene having at least one polymorphic region is referred to as a "polymorphic gene”.
  • variable nucleotide sequence can be identified by methods known to a person skilled in the art for example by using specific oligonucleotides in for example amplification methods and/or observation of a size difference. However, the variable nucleotide sequence may also be detected by sequencing or for example restriction fragment length polymorphism analysis.
  • the variable nucleotide sequence may be represented by a deletion, an insertion, repeats, and/or a point mutation.
  • One type of genetic marker is a microsatellite marker which refers to short sequences repeated after each other.
  • short sequences are for example one nucleotide, such as two nucleotides, for example three nucleotides, such as four nucleotides, for example five nucleotides, such as six nucleotides, for example seven nucleotides, such as eight nucleotides, for example nine nucleotides, such as ten nucleotides.
  • the at least one genetic marker is selected from the group of SNPs, short tandem repeats, deletions, insertions, duplications and simple tandem repeats.
  • the at least one genetic marker is simple tandem repeats.
  • the presence or absence of the STARD13/DLC2 gene may be determined by determining the presence or absence of at least one genetic marker present in STARD13/DLC2, wherein the at least one genetic marker is specific for the STARD13/DLC2 gene.
  • the markers of the present invention may thus be 13bp del, D13S1694, D13S1838, D13S1839 or D13S1493.
  • the at least one genetic marker of at least part of the STARD13/DLC2 gene is selected from the group consisting of 13bp del (( ⁇ 13bp)ln10), D13S1694, D13S1838, D13S1839 and D13S1493.
  • the at least one genetic marker of at least part of the STARD13/DLC2 gene is selected from the group consisting of 13bp del, D13S1838, D13S1839 and D13S1493.
  • the at least one genetic marker of at least part of the STARD 13/DLC2 gene is the marker D13S1838.
  • the at least one genetic marker may be a combination of at least two or more genetic markers such that the accuracy may be increased, such as at least three genetic markers, for example four genetic markers, such as at least five genetic markers, for example six genetic markers, such as at least seven genetic markers, for example eight genetic markers, such as at least nine genetic markers, for example ten genetic markers.
  • the presence or absence of at least one genetic marker is detected in a target nucleic acid sequence isolated from a biological sample.
  • the method comprises amplification of the target nucleotide sequence.
  • the detection of the presence or the absence of the at least one polymorphism may be performed by amplification, wherein the target nucleotide sequence is a genomic DNA sequence, an RNA sequence, a mRNA sequence, or a cDNA sequence.
  • the presence or absence of at least one polymorphism may be detected in a test sample obtained from a subject can be amplified using any suitable amplification method known in the art, such as polymerase chain reaction (PCR), for example ligase chain reaction (LCR), such as reverse transcriptase PCR (RT-PCR), for example isothermal amplification, such as strand displacement amplification (SDA, for example repair chain reaction (RCR), such as cyclic probe reaction (CPR).
  • PCR polymerase chain reaction
  • LCR ligase chain reaction
  • RT-PCR reverse transcriptase PCR
  • SDA strand displacement amplification
  • RCR repair chain reaction
  • CPR cyclic probe reaction
  • the methods may be used in combination with a number of signal generation systems, a selection of which is also listed in Table 3.
  • One common method for detecting for example SNPs comprises the use of a probe bound to a detectable label. By carrying out hybridization under conditions of high stringency it is ensured that the probe only hybridises to a sequence which is 100% complementary to the probe.
  • this method comprises hybridising a probe to a target nucleic acid sequence comprising at least one of the STRs at the positions identified in Table 2 (see above).
  • similar probes can be designed by the skilled practitioner and used for hybridization to a target nucleic acid sequence. The design and optimisation of probes and hybridization conditions lies within the capabilities of the skilled practitioner.
  • the detection of genetic markers or the presence or absence of the STARD13/DLC2 gene or parts thereof can according to one embodiment of the present invention be achieved by a number of techniques known to the skilled person, including typing of microsatellites or short tandem repeats (STR), restriction fragment length polymorphisms (RFLP), detection of deletions or insertions, random amplified polymorphic DNA (RAPIDs) or the typing of single nucleotide polymorphisms by methods such as restriction fragment length polymerase chain reaction, allele-specific oligomer hybridisation, oligomer-specific ligation assays, hybridisation with PNA or locked nucleic acids (LNA) probes.
  • STR microsatellites or short tandem repeats
  • RFLP restriction fragment length polymorphisms
  • RAPIDs random amplified polymorphic DNA
  • LNA locked nucleic acids
  • hybridization signifies hybridization under conventional hybridization conditions, preferably under stringent conditions, as described for example in Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition (1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.).
  • stringent when used in conjunction with hybridization conditions is as defined in the art, i.e. 15-20°C under the melting point T m , cf. Sambrook et al, 1989, pages 11.45-11.49.
  • the conditions are "highly stringent", i.e. 5-10°C under the melting point T m .
  • LNA locked nucleic acid
  • LNA is a novel class of bicyclic nucleic acid analogues in which the furanose ring conformation is restricted in by a methylene linker that connects the 2 -O position to the 4'-C position.
  • Common to all of these LNA variants is an affinity toward complementary nucleic acids, which is by far the highest affinity reported for a DNA analogue ( ⁇ rum et al. (1999) Clinical Chemistry 45, 1898-1905; WO 99/14226 EXIQON).
  • LNA probes are commercially available from Proligo LLC, Boulder, Colorado, USA. Another high-affinity DNA analogue is the so-called protein nucleic acid (PNA).
  • the sugar backbone of an oligonucleotide is replaced with an amide containing backbone, in particular an aminoethylglycine backbone.
  • the nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone (Science (1991 ) 254: 1497-1500).
  • fluorescent reporter groups are preferred because they result in a high signal/noise ratio.
  • Suitable examples of the fluorescent group include fluorescein, Cy2, Cy3, Cy3.5, Cy5, Cy5.5, Cy7, acridin, Hoechst 33258, Rhodamine, Rhodamine Green, Tetramethylrhodamine, Texas Red, Cascade Blue, Oregon Green, Alexa Fluor, europium and samarium.
  • enzyme tags Another type of labels is enzyme tags. After hybridization to the target nucleic acid sequence a substrate for the enzyme is added and the formation of a coloured product is measured.
  • enzyme tags include a beta-Galactosidase, a peroxidase, horseradish peroxidase, a urease, a glycosidase, alkaline phosphatase, chloramphenicol acetyltransf erase and a luciferase.
  • a further group of labels include chemiluminescent group, such as hydrazides such as luminol and oxalate esters.
  • a still further possibility is to use a radioisotope and detect the hybrid using scintillation counting.
  • the radioisotope may be selected from the group consisting of 32 P, 33 P, 35 S, 125 1, 45 Ca, 14 C and 3 H.
  • One particularly preferred embodiment of the probe based detection comprises the use of a capture probe for capturing a target nucleic acid sequence.
  • the capture probe is bound to a solid surface such as a bead, a well or a stick.
  • the captured target nucleic acid sequence can then be contacted with the detection probe under conditions of high stringency and the allele can be detected.
  • TAQMAN® probe This is a method for measuring PCR product accumulation using a dual-labeled flourogenic oligonucleotide probe called a TAQMAN® probe.
  • This probe is composed of a short (ca. 20-25 bases) oligodeoxynucleotide that is labeled with two different fluorescent dyes. On the 5 1 terminus is a reporter dye and on the 3' terminus is a quenching dye.
  • This oligonucleotide probe sequence is homologous to an internal target sequence present in the PCR amplicon. When the probe is intact, energy transfer occurs between the two flourophors and emission from the reporter is quenched by the quencher.
  • the probe is cleaved by 5' nuclease activity of Taq polymerase thereby releasing the reporter from the oligonucleotide-quencher and producing an increase in reporter emission intensity.
  • Other suitable methods include using mass spectrometry, single base extension, determining the Tm profile of a hybrid between a probe and a target nucleic acid sequence, using single strand conformation polymorphism, using single strand conformation polymorphism heteroduplex, using RFLP or RAPD, using HPLC, using sequencing of a target nucleic acid sequence from said biological sample.
  • DHPLC Denaturing high-performance liquid chromatography
  • Amplification may be performed by any known method including methods selected from the group consisting of polymerase chain reaction (PCR), Ligase Chain Reaction (LCR), Nucleic Acid Sequence-Based Amplification (NASBA), strand displacement amplification, rolling circle amplification, and T7-polymerase amplification.
  • PCR polymerase chain reaction
  • LCR Ligase Chain Reaction
  • NASBA Nucleic Acid Sequence-Based Amplification
  • strand displacement amplification strand displacement amplification
  • rolling circle amplification rolling circle amplification
  • T7-polymerase amplification T7-polymerase amplification.
  • the polymorphisms as defined in the present invention are present in DNA sequences transcribed as mRNA transcripts these transcripts constitute a suitable target sequence for detection of the polymorphisms.
  • Commercial protocols are available for isolation of total mRNA.
  • the target mRNA can be amplified and the presence or absence of polymorphisms be detected with any of the techniques described above for detection of polymorphisms in a DNA sequence.
  • Oligonucleotide primer and or probe In one aspect the present invention relates to oligonucleotide primers and/or probes for detecting a STARD13/DLC2 gene or a part thereof, transcriptional product or part thereof, wherein said at least one nucleotide primer and/or probe detects at least one genetic marker of STARD13/DLC2 or part thereof.
  • An isolated oligonucleotide primer of the present invention is a nucleic acid molecule sufficiently complementary to the sequence on which it is based and of sufficiently length to selectively hybridise to the corresponding region of a nucleic acid molecule intended to be amplified. The primer is able to prime the synthesis of the corresponding region of the intended nucleic acid molecule in the methods described above.
  • an isolated oligonucleotide probe of the present invention is a molecule for example a nucleic acid molecule of sufficient length and sufficiently complementary to the nucleic acid sequence of interest which selectively binds to the nucleic acid sequence of interest under high or low stringency conditions.
  • the invention relates to an isolated oligonucleotide comprising at least 10 contiguous nucleotides being 100% identical to a subsequence of the STARD13/DLC2 gene or complementary sequence of the invention comprising or adjacent to a polymorphism or mutation being correlated to a period of metastasis-free, recurrence- free and/or disease-free survival of an individual suffering from breast cancer, or being 100% identical to a subsequence of the human genome which is in linkage disequilibrium with the gene of the invention comprising or adjacent to a polymorphism or mutation being correlated to a period of metastasis-free, recurrence-free and/or disease-free survival of an individual suffering from breast cancer.
  • probes may be used for detecting the presence of a polymorphism of interest and/or they may constitute part of a primer pair and/or they may form part of a gene therapy vector used for treating the diseases of the present invention.
  • the isolated oligonucleotide comprises at least 10 contiguous bases of a sequence identified as SEQ ID NOs: 15-24 or the corresponding complementary strand, or a strand sharing at least 90% sequence identity more preferably at least 95% sequence identity with SEQ ID NOs: 15-24 or a complementary strand thereof, said isolated oligonucleotide comprising a genetic marker of the invention.
  • oligonucleotides may comprise at least 10 contiguous bases of any of the sequence identified as SEQ ID NOS: 1 or the corresponding complementary strand thereof, or a strand sharing at least 90% sequence identity more preferably at least 95% sequence identity with the SEQ ID NOS: 1 or a complementary strand thereof, said isolated oligonucleotide comprising a polymorphism of the invention.
  • These particular oligonucleotides may be used as probes for assessing the polymorphisms in the human STARD13/DLC2 gene which are strongly correlated with metastasis formation, recurrence and diseases of the invention.
  • the length of the isolated oligonucleotide depends on the purpose. When being used for amplification from a sample of genomic DNA, the length of the primers should be at least 15 and more preferably even longer to ensure specific amplification of the desired target nucleotide sequence. When being used for amplification from mRNA the length of the primers can be shorter while still ensuring specific amplification. In one particular embodiment one of the pair of primers may be an allele specific primer in which case amplification only occurs if the specific allele is present in the sample. When the isolated oligonucleotides are used as hybridisation probes for detection, the length is preferably in the range of 10-15 nucleotides.
  • the length of the probe can be somewhat shorter, e.g. down to 7-8 bases.
  • the length may be at least 15 contiguous nucleotides, such as at least 20 nucleotides.
  • An upper limit preferably determines the maximum length of the isolated oligonucleotide.
  • the isolated oligonucleotide may be less than 1000 nucleotides, more preferably less than 500 nucleotides, more preferably less than 100 nucleotides, such as less than 75 nucleotides, for example less than 50 nucleotides, such as less than 40 nucleotides, for example less than 30 nucleotides, such as less than 20 nucleotides.
  • the isolated oligonucleotide may comprise from 10 to 50 nucleotides, such as from 10 to 15, from 15 to 20, from 20 to 25, or comprising from 20 to 30 nucleotides, or from 15 to 25 nucleotides.
  • the polymorphism may be located in the centre of the nucleic acid sequence, in the 5' end of the nucleic acid sequence, or in the 3' end of the nucleic acid sequence.
  • the sequence of the oligonucleotide is adjacent to the mutation/polymorphism, either in the 3' or 5' direction.
  • the isolated oligonucleotide sequence may be complementary to a sub-sequence of the coding strand of a target nucleotide sequence or to a sub-sequence to the non- coding strand of a target nucleotide sequence as the polymorphism may be assessed with similar efficiency in the coding and the non-coding strand.
  • the isolated oligonucleotide sequence may be made from RNA, DNA, LNA, PNA monomers or from chemically modified nucleotides capable of hybridising to a target nucleic acid sequence.
  • the oligonucleotides may also be made from mixtures of said monomers.
  • a general term for primers and probes of is the term 'oligonucleotide' which comprises oligonucleotides of both natural and/or non-natural nucleotides, including any combination thereof.
  • the natural and/or non-natural nucleotides may be linked by natural phosphodiester bonds or by non-natural bonds.
  • Oligonucleotide is used interchancably with polynucleotide.
  • the oligomer or polymer sequences of the present invention are formed from the chemical or enzymatic addition of monomer subunits.
  • oligonucleotide as used herein includes linear oligomers of natural or modified monomers or linkages, including deoxyribonucleotides, ribonucleotides, anomeric forms thereof, peptide nucleic acid monomers (PNAs), locked nucleotide acid monomers (LNA), and the like, capable of specifically binding to a single stranded polynucleotide tag by way of a regular pattern of monomer-to-monomer interactions, such as Watson-Crick type of base pairing, base stacking, Hoogsteen or reverse Hoogsteen types of base pairing, or the like.
  • PNAs peptide nucleic acid monomers
  • LNA locked nucleotide acid monomers
  • oligonucleotides ranging in size from a few monomeric units, e.g. 3-4, to several tens of monomeric units, e.g. 40-60.
  • ATGCCTG an oligonucleotide is represented by a sequence of letters, such as "ATGCCTG,” it will be understood that the nucleotides are in 5' -> 3' order from left to right and the "A” denotes deoxyadenosine, "C” denotes deoxycytidine, “G” denotes deoxyguanosine, and "T” denotes thymidine, unless otherwise noted.
  • oligonucleotides of the invention comprise the four natural nucleotides; however, they may also comprise methylated or non-natural nucleotide analogs.
  • Suitable oligonucleotides may be prepared by the phosphoramidite method described by Beaucage and Carruthers (Tetrahedron Lett., 22, 1859-1862, 1981 ), or by the triester method according to Matteucci, et al. (J. Am. Chem. Soc, 103, 3185, 1981 ), both incorporated herein by reference, or by other chemical methods using either a commercial automated oligonucleotide synthesizer or VLSIPS.TM. technology.
  • double-stranded When oligonucleotides are referred to as “double-stranded,” it is understood by those of skill in the art that a pair of oligonucleotides exist in a hydrogen-bonded, helical configuration typically associated with, for example, DNA.
  • double-stranded As used herein is also meant to refer to those forms which include such structural features as bulges and loops. For example as described in US 5.770.722 for a unimolecular double-stranded DNA. It is clear to those skilled in the art when oligonucleotides having natural or non-natural nucleotides may be employed, e.g.
  • oligonucleotides consisting of natural nucleotides are required.
  • nucleotides are conjugated together in a string using synthetic procedures, they are always referred to as oligonucleotides.
  • Non-limiting examples of oligonucleotides that may be used as a primer, probe and/or primer pairs for determination of the presence or absence of the STARD13/DLC2 gene are shown in table 5.
  • Table 5 shows that oligonucleotides that may be used as a primer, probe and/or primer pairs for determination of the presence or absence of the STARD13/DLC2 gene.
  • the oligonucleotide primer is a primer for the amplification of the genetic markers 13bp del, D13S1694, D13S1838, D13S1839 or D13S1493.
  • the at least one oligonucleotide probe is a probe for the detection of the genetic markers 13bp del, D13S1694, D13S1838, D13S1839 or D13S1493.
  • the oligonucleotide primer and/or probe is selected from the group of primers consisting of 13bp del, D13S1694, D13S1838, D13S1839 and D13S1493.
  • the oligonucleotide primer is as defined as SEQ ID NO: 15.
  • nucleotide primer is as defined in SEQ ID NO: 16.
  • Another aspect of the invention relates to an oligonucleotide primer pair, wherein at least 2 primers are able to amplify the STARD13/DLC2 or part thereof.
  • the nucleotide primer pair are selected from the group consisting of at least one primer pair for amplification of 13bp del, a primer pair for amplification of D13S1694, a primer pair for amplification of D13S1838, a primer pair for amplification of D13S1839, and a primer pair for amplification of D13S1493.
  • the primer pair is SEQ ID NO: 15 and SEQ ID NO:16, SEQ ID NO: 17 and SEQ ID NO: 18, SEQ ID NO:19 and SEQ ID NO:20, SEQ ID NO:21 and SEQ ID NO:22, SEQ ID NO:23 and SEQ ID NO:24.
  • the primer pair is primers for the amplification of D13S1839.
  • the primer pair comprises the oligonucleotides defined in SEQ ID NO: 15 and 16.
  • the methods of the present invention comprises determining the expression level of a STARD13/DLC2 transcriptional and/or translational product or part thereof in a breast cancer sample, wherein a reduction in the expression level of the transcriptional product, translational product or part thereof compared to the expression level of a control sample is indicative an increased risk of recurrence, acquisition of metastasis and/or short disease-free survival.
  • the reduction is at least 10%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%.
  • the reduction is in the range of 10% - 100%, such as 20%-100%, for example 30%-100%, such as 40%- 100%, for exampie 50%-100%, such as 60%-100%, for example 70%-100%, such as 80%-100%, for example 90%-100%.
  • the reduction in the expression level is in the range of 20% - 30%, 30%-40%, 40%-50%, 50%-60%, 60%-70%, 70%-80%, or 90%-100%.
  • the transcriptional and/or translational product or part thereof is any transcriptional and/or translational product of the STARD13/DLC2 gene (SEQ ID NO: 1).
  • the transcriptional and/or translational product is be selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO: 9.
  • the transcriptional and/or translational product is SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8 or SEQ ID NO: 9..
  • the term reduction in percent is to be interpreted as the following example: in a breast cancer sample the expression level of STARD3/DLC2 has a value 10. In a control sample the expression level of STARD3/DLC2 has a value 50. This means that the reduction of the expression level in the breast cancer sample compared to the control sample is 80%.
  • RNA expression patterns are determined by measuring any gene product of a particular gene, including mRNA and protein.
  • the nucleic acid may be isolated from the sample according to any of a number of methods well known to those of skill in the art.
  • genomic DNA is preferably isolated.
  • an expression level of a gene such as the STARD13/DLC2 gene is to be detected, preferably RNA (mRNA) is isolated.
  • mRNA is isolated.
  • Methods of isolating total mRNA are well known to those of skill in the art.
  • the total nucleic acid is isolated from a given sample using, for example, an acid guanidinium-phenol-chloroform extraction method and polyA.sup.
  • RNA is isolated by oligo dT column chromatography or by using (dT)n magnetic beads (see, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual (2nd ed.), VoIs. 1-3, Cold Spring Harbor Laboratory, (1989), or Current Protocols in Molecular Biology, F. Ausubel et al., ed. Greene Publishing and Wiley-lnterscience, New York (1987)).
  • the sample may be from tissue and/or body fluids, as defined elsewhere herein.
  • sample preparation operations will include such manipulations as extraction of intracellular material, e.g., nucleic acids from whole cell samples, amplification of nucleic acids, fragmentation, transcription, labeling and/or extension reactions.
  • extraction of intracellular material e.g., nucleic acids from whole cell samples
  • amplification of nucleic acids e.g., fragmentation, transcription, labeling and/or extension reactions.
  • one or more of these various operations may be readily incorporated into the present invention.
  • Affinity columns are typically used either to isolate a single nucleic acid typically by providing a single species of affinity ligand.
  • affinity columns bearing a single affinity ligand e.g. oligo dt columns
  • affinity columns bearing a single affinity ligand have been used to isolate a multiplicity of nucleic acids where the nucleic acids all share a common sequence (e.g. a polyA).
  • affinity matrix used depends on the purpose of the analysis. For example, as in the present invention where it is desired to analyze mRNA expression levels of the STARD13/DLC2 gene in a complex nucleic acid sample (e.g., total mRNA) it is often desirable to eliminate nucleic acids produced by genes that are constitutively overexpressed and thereby tend to mask gene products expressed at characteristically lower levels.
  • the affinity matrix can be used to remove a number of preselected gene products (e.g., actin, GAPDH, etc.). This is accomplished by providing an affinity matrix bearing nucleic acid affinity ligands complementary to the gene products (e.g., mRNAs or nucleic acids derived therefrom) or to subsequences thereof.
  • Hybridization of the nucleic acid sample to the affinity matrix will result in duplex formation between the affinity ligands and their target nucleic acids.
  • the matrix Upon elution of the sample from the affinity matrix, the matrix will retain the duplexes nucleic acids leaving a sample depleted of the overexpressed target nucleic acids.
  • the affinity matrix is packed into a columnar casing.
  • the sample is then applied to the affinity matrix (e.g. injected onto a column or applied to a column by a pump such as a sampling pump driven by an autosampler).
  • the affinity matrix (e.g. affinity column) bearing the sample is subjected to conditions under which the nucleic acid probes comprising the affinity matrix hybridize specifically with complementary target nucleic acids. Such conditions are accomplished by maintaining appropriate pH, salt and temperature conditions to facilitate hybridization as discussed above.
  • the nucleic acid sample may be probed using an array of oligonucleotide probes.
  • Oligonucleotide arrays generally include a substrate having a large number of positionally distinct oligonucleotide probes attached to the substrate. These arrays may be produced using mechanical or light directed synthesis methods which incorporate a combination of photolithographic methods and solid phase oligonucleotide synthesis methods.
  • Diabetes Aspects of the present invention relate to methods and products for determining the predisposition detecting a predisposition to diabetes in an individual, determining the prognosis for an individual in relation to diabetes mellitus and/or determining the treatment regime for an individual in relation to diabetes mellitus.
  • diabetes mellitus refers to a group of disorders in which there is a defect in the transfer of glucose (sugar) from the bloodstream into cells, leading to abnormally high levels of blood sugar (hyperglycemia).
  • the disorders are caused by insufficient production of the hormone insulin by the pancreas, or insensitivity of cells to the effects of insulin.
  • Insulin is responsible for the absorption of glucose into cells for their energy needs and into the liver and fat cells for storage.
  • Type 1 insulin-dependent
  • Type 2 non-insulin dependent
  • Diabetes mellitus causes a person to lose the ability to regulate blood sugar. People with diabetes often need to follow a strict diet and may require insulin injections. During a diabetic reaction, a person may experience confusion, sudden personality changes, or loss of consciousness. In extreme cases, diabetes can also cause vision loss, cardiovascular disease, kidney failure, stroke, or necessitate the amputation of limbs
  • Diabetes type 1 is generally due to autoimmune destruction of the insulin-producing cells, pancreatic beta cells, whereas diabetes mellitus type 2 is characterized by tissue wide insulin resistance.
  • insulin is the principal hormone that regulates uptake of glucose into most cells from the blood (primarily muscle and fat cells, but not central nervous system cells), deficiency of insulin or the insensitivity of its receptors plays a central role in all forms of diabetes meilitus.
  • Type 1 diabetes appears to be triggered by some (mainly viral) infections, or in a less common group, by stress or environmental factors (such as exposure to certain chemicals or drugs). There is a genetic element in individual susceptibility to some of these triggers which has been traced to particular HLA genotypes (i.e. genetic "self identifiers used by the immune system). However, even in those who have inherited the susceptibility, type 1 diabetes mellitus seems to require an environmental trigger. A small proportion of people with type 1 diabetes carry a mutated gene that causes maturity onset diabetes of the young (MODY).
  • MODY maturity onset diabetes of the young
  • Type 2 diabetes A strong inheritance pattern for type 2 diabetes seems to exist compared to that of type 1 diabetes. Individuals with first-degree relatives with type 2 have a much higher risk of developing type 2 diabetes. Type 2 diabetes is also often connected to obesity, which is found in approximately 85% of North American patients diagnosed with this type. Consequently, it is by some people believed that inheriting a tendency toward obesity also contributes to type 2 diabetes.
  • a partial list includes: high blood pressure, elevated cholesterol levels, coronary artery disease, past gestational diabetes, polycystic ovary syndrome, chronic pancreatitis, fatty liver, hemochromatosis, cystic fibrosis, several mitochondrial neuropathies and myopathies, myotonic dystrophy, Friedreich's ataxia, some of the inherited forms of neonatal hyperinsulinism, and many others.
  • glucocorticoids especially L-asparaginase
  • antipsychotics and mood stabilizers especially phenothiazines and some atypical antipsychotics.
  • Diabetes is often detected when a person suffers a problem frequently caused by diabetes, such as a heart attack, stroke, neuropathy, poor wound healing or a foot ulcer, certain eye problems, certain fungal infections, or delivering a baby with macrosomia or hypoglycemia.
  • Diabetes mellitus is characterized by recurrent or persistent hyperglycemia, and is diagnosed by demonstrating any one of the following: a) fasting plasma glucose level at or above 126 mg/dL or 7.0 mmol/l, b) plasma glucose at or above 200 mg/dL or 11.1 mmol/l two hours after a 75 g oral glucose load in a glucose tolerance test, c) random plasma glucose at or above 200 mg/dL or 11.1 mmol/l.
  • the methods and products of the present invention relate to diabetes mellitus type 1 and/or diabetes mellitus type 2.
  • the methods and products relate to
  • the methods and products of the present invention may be used alone or in combination with any of other prognostic factors.
  • Antibodies One aspect of the present invention relates to an antibody directed to an epitope of STARD13/DLC2 protein or part thereof as described elsewhere herein.
  • the antibody may be used in methods of the present invention relating to methods for detecting the predisposition and/or determining the prognosis of an individual suffering from breast cancer to developing metastasis and recurrence.
  • epitope in this context covers any epitope capable of being recognised by an antibody or a binding fragment thereof.
  • antibody includes both polyclonal and monoclonal antibodies, as well as fragments thereof, such as, Fv, Fab and F(ab)2 fragments that are capable of binding antigen or hapten. It includes conventional murine monoclonal antibodies as well as human antibodies, and humanized forms of non-human antibodies, and it also includes 'antibodies' isolated from phage antibody libraries.
  • the antibodies of the present invention may be polyclonal or monoclonal and may be produced by in vivo or in vitro methods known in the art.
  • a monoclonal antibody is an antibody produced by a hybridoma cell.
  • Methods of making monoclonal antibody-synthesizing hybridoma cells are well known to those skilled in the art, e.g, by the fusion of an antibody producing B lymphocyte with an immortalized B-lymphocyte cell line.
  • a polyclonal antibody is a mixture of antibody molecules (specific for a given antigen) that has been purified from an immunized (to that given antigen) animal's blood.
  • Such antibodies are polyclonal in that they are the products of many different populations of antibody-producing cells.
  • the invention also pertains to mixtures of monoclonal and/or polyclonal antibodies. Also a mixture of at least two monoclonal antibodies is within the scope of the present invention. It is appreciated that the mixture may comprise 3, 4, 5, 6, 7, 8, 9, 10, or 15 monoclonal antibodies.
  • the invention also relates to a pharmaceutical composition for the treatment of metastasis and/or recurrence in an individual suffering from breast cancer, comprising a vector as described herein and a pharmaceutically acceptable carrier or excipient.
  • compositions for the treatment of metastasis and/or recurrence in an individual suffering from breast cancer comprising the STARD13/DLC2 gene or fragment thereof, or a transcriptional or translational product or part thereof and a pharmaceutically acceptable carrier or excipient.
  • the pharmaceutical composition comprises one or more of the peptides being expression products as defined above.
  • the peptides are bound to carriers.
  • the peptides may suitably be coupled to a polymer carrier, for example a protein carrier, such as BSA.
  • a polymer carrier for example a protein carrier, such as BSA.
  • BSA protein carrier
  • the peptides may be suppressor peptides normally lost or decreased in tumour tissue administered in order to stabilise tumours towards a less malignant stage.
  • the peptides are onco-peptides capable of eliciting an immune response towards the tumour cells.
  • the pharmaceutical composition comprises genetic material, either genetic material for substitution therapy, or for suppressing therapy.
  • the pharmaceutical composition comprises at least one antibody produced as described above.
  • the term pharmaceutical composition is used synonymously with the term medicament.
  • the medicament of the invention comprises an effective amount of one or more of the compounds as defined above, or a composition as defined above in combination with pharmaceutically acceptable additives.
  • Such medicament may suitably be formulated for oral, percutaneous, intramuscular, intravenous, intracranial, intrathecal, intracerebroventricular, intranasal or pulmonal administration. For most indications a localised or substantially localised application is preferred.
  • Suitable excipients are, for example, water, saline, dextrose, glycerol, ethanol or the like, and combinations thereof.
  • the preparation may contain minor amounts of auxiliary substances such as wetting or emulsifying agents, pH buffering agents, or which enhance the effectiveness or transportation of the preparation.
  • Formulations of the compounds of the invention can be prepared by techniques known to the person skilled in the art.
  • the formulations may contain pharmaceutically acceptable carriers and excipients including microspheres, liposomes, microcapsules and nanoparticles.
  • the preparation may suitably be administered by injection, optionally at the site, where the active ingredient is to exert its effect.
  • Additional formulations which are suitable for other modes of administration include suppositories, and in some cases, oral formulations.
  • suppositories traditional binders and carriers include polyalkylene glycols or triglycerides. Such suppositories may be formed from mixtures containing the active ingredient(s) in the range of from 0.5% to 10%, preferably 1-2%.
  • Oral formulations include such normally employed excipients as, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, and the like. These compositions take the form of solutions, suspensions, tablets, pills, capsules, sustained release formulations or powders and generally contain 10-95% of the active ingredient(s), preferably 25-70%.
  • the preparations are administered in a manner compatible with the dosage formulation, and in such amount as will be therapeutically effective.
  • the quantity to be administered depends on the subject to be treated, including, e.g. the weight and age of the subject, the disease to be treated and the stage of disease. Suitable dosage ranges are of the order of several hundred ⁇ g active ingredient per administration with a preferred range of from about 0.1 ⁇ g to 1000 ⁇ g, such as in the range of from about 1 ⁇ g to 300 ⁇ g, and especially in the range of from about 10 ⁇ g to 50 ⁇ g. Administration may be performed once or may be followed by subsequent administrations. The dosage will also depend on the route of administration and will vary with the age and weight of the subject to be treated. A preferred dosis would be in the interval 30 mg to 70 mg per 70 kg body weight.
  • the preparation further comprises pharmaceutically acceptable additives and/or carriers.
  • additives and carriers will be known in the art.
  • Administration may be a continuous infusion, such as intraventricular infusion or administration in more doses such as more times a day, daily, more times a week, weekly, etc.
  • the present invention relates to a vaccine for the prophylaxis or treatment of metastasis and/or recurrence in an individual suffering from breast cancer comprising at least one expression product from gene with SEQ ID NO:1 or a fragment thereof.
  • vaccines is used with its normal meaning, i.e preparations of immunogenic material for administration to induce in the recipient an immunity to infection or intoxication by a given infecting agent.
  • Vaccines may be administered by intravenous injection or through oral, nasal and/or mucosal administration.
  • Vaccines may be either simple vaccines prepared from one species of expression products, such as proteins or peptides, or a variety of expression products, or they may be mixed vaccines containing two or more simple vaccines. They are prepared in such a manner as not to destroy the immunogenic material, although the methods of preparation vary, depending on the vaccine.
  • the enhanced immune response achieved according to the invention can be attributable to e.g. an enhanced increase in the level of immunoglobulins or in the level of T-cells including cytotoxic T-cells will result in immunisation of at least 50% of individuals exposed to said immunogenic composition or vaccine, such as at least 55%, for example at least 60%, such as at least 65%, for example at least 70%, for example at least 75%, such as at least 80%, for example at least 85%, such as at least 90%, for example at least 92%, such as at least 94%, for example at least 96%, such as at least 97%, for example at least 98%, such as at least 98.5%, for example at least 99%, for example at least 99.5% of the individuals exposed to said immunogenic composition or vaccine are immunised.
  • compositions according to the invention may also comprise any carrier and/or adjuvant known in the art including functional equivalents thereof.
  • Functionally equivalent carriers are capable of presenting the same immunogenic determinant in essentially the same steric conformation when used under similar conditions.
  • Functionally equivalent adjuvants are capable of providing similar increases in the efficacy of the composition when used under similar conditions.
  • the methods and compositions disclosed herein relates to a method of treatment of an individual suffering from breast cancer having the predisposition to and/or prognosis of metastasis and/or recurrence, said method comprising administering to said subject a therapeutically effective amount of a gene therapy vector as defined herein or a pharmaceutical composition as defined herein.
  • a diagnostic kit for detecting the predisposition to a period of metastasis-free, recurrence-free and/or disease-free survival of an individual suffering from breast cancer.
  • a diagnostic kit is provided for determining the prognosis of an individual suffering from breast cancer in relation to metastasis formation, recurrence and disease.
  • the kit may also be directed to the determination of the treatment regime of an individual suffering from breast cancer.
  • the present invention relates to a kit for use in a method, comprising at least one detection member, such as a detection member selected from the group consisting of antibodies, primer, probes and primer pairs as defined elsewhere herein.
  • the kit comprises at least one primer or probe comprising a nucleic acid sequence as described elsewhere herein.
  • At least two primers or probes are comprised in the diagnostic kit. However, three, four, five, six, seven, eight, nine, ten, 15, 20 or more primers or probes may be comprised in the kit. It is appreciated that also at least one set of primers may be comprised in the kit, for example two sets, three sets, four sets, five sets, six sets, seven sets, eight sets, nine sets, or ten sets of primers, as described elsewhere herein. In one embodiment the primers or probes are linked to a detectable label.
  • the kit further comprises at least one nucleotide monomer labelled with a detectable label, a polymerase and suitable buffers and reagents.
  • the kit preferably also comprises set of primers for amplifying the STARD13/DLC2 gene and/or translational or transcriptional products of the STARD13/DLC2 gene, or the corresponding complementary strands.
  • the primers preferably are at least 15 bases long and may be coupled to an entity suitable for subsequent immobilisation.
  • a diagnostic kit of the invention may comprise an antibody as described above.
  • the kit is in the form of an array comprising oligonucleotides which recognise the transcript of SEQ ID NO:1.
  • the transcript sequence may be exemplified by SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6 and/or SEQ ID NO:8.
  • the present invention also pertains to an assay kit for use in the methods of the present invention, wherein said kit comprises reagents and instructions for the performance of the assay method and for the interpretation of results.
  • the present invention relates to methods and kits that find their use in the detection of a predisposition and/or determining the prognosis for a period of metastasis-free, recurrence-free and/or disease-free survival for an individual suffering from breast cancer. Similarly, the present invention relates to a method and kit which find their use in the determination of a treatment regime for an individual suffering from breast cancer.
  • one embodiment of the present invention is the use of an antibody as defined herein for the determination of the predisposition of and/or prognosis for a period of metastasis-free, recurrence-free and/or disease-free survival of an individual suffering from breast cancer.
  • the antibody directed to an epitope of STARD 13/DLC2 protein or part thereof is used to detect the presence or absence of STARD13/DLC2 protein or part thereof, the outcome of which is indicative of the predetermination, prognosis and/or treatment regime in an individual suffering from breast cancer.
  • the present invention also relates to the use of at least one detection member for a genetic marker of ATARD13/DLC2 or for a second genetic marker in genetic linkage with said marker in a kit for the determination of the predisposition to and/or the prognosis for a period of metastasis-free, recurrence-free and/or disease-free survival in an individual suffering from breast cancer. Furthermore, the present invention also relates to the use of at least one detection member for a genetic marker of STARD13/DLC2 or for a second genetic marker in genetic linkage with said marker in a kit for the determination of a treatment regime for an individual suffering from breast cancer.
  • the at least one detection member is selected from the group consisting of at least one nucleotide primer, primer pair, probe, and an antibody as defined elsewhere herein.
  • the at least one detection member may be any combination of primer, primer pair, probe and/or antibody.
  • the at least one detection member is a primer, a primer pair, a probe, or an antibody.
  • At least one detection member is used, or two, three, four, five, six, seven, eight, nine, or ten detection members are used.
  • the present invention relates to the use of a method as described herein for producing an assay for detecting a predisposition to and/or determining the prognosis to a period of metastasis-free and/or recurrence-free and/or disease-free survival of an individual suffering from breast cancer. Furthermore, the present invention relates to the use of a method as described herein for producing an assay for determining the treatment regime of an individual suffering from breast cancer.
  • the invention relates to the use of a composition defined elsewhere herein for the treatment of an individual suffering from breast cancer.
  • a further aspect of the invention is the use of a polypeptide or part thereof as described herein for the preparation of a pharmaceutical composition for the treatment of metastasis, recurrence of an individual suffering from breast cancer. Furthermore, the invention relates to the use of a gene or part thereof as described herein for the preparation of a pharmaceutical composition for the treatment of metastasis, recurrence of an individual suffering from breast cancer.
  • the genetic material discussed above is the described STARD13/DLC2 gene or functional parts thereof.
  • the constructs may be introduced as a single DNA molecule encoding all of the genes, or different DNA molecules having one or more genes.
  • the constructs may be introduced simultaneously or consecutively, each with the same or different markers.
  • the gene may be linked to the complex as such or protected by any suitable system normally used for transfection such as viral vectors or artificial viral envelope, liposomes or micellas, wherein the system is linked to the complex.
  • Vectors containing useful elements such as selectable and/or amplifiable markers, promoter/enhancer elements for expression in mammalian, particularly human, cells, and which may be used to prepare stocks of construct DNAs and for carrying out transfections are well known in the art. Many are commercially available.
  • adenovirus vectors for human gene therapy include injection, e.g intravascularly or intramuscularly, inhalation, or other parenteral administration.
  • Advantages of adenovirus vectors for human gene therapy include the fact that recombination is rare, no human malignancies are known to be associated with such viruses, the adenovirus genome is double stranded DNA which can be manipulated to accept foreign genes of up to 7.5 kb in size, and live adenovirus is a safe human vaccine organisms.
  • vaccinia virus which can be rendered non-replicating (U.S. Pat. Nos. 5,225,336; 5,204,243; 5,155,020; 4,769,330).
  • AVE artificial viral envelopes
  • a viral membrane such as HIV-1 or RSV
  • AVE artificial viral envelopes
  • the envelope is preferably produced in a two-step dialysis procedure where the "naked" envelope is formed initially, followed by unidirectional insertion of the viral surface glycoprotein of interest. This process and the physical characteristics of the resulting AVE are described in detail by Chander et al., (supra).
  • AVE systems are (a) an AVE containing the HIV-1 surface glycoprotein gp160 (Chander et al., supra; Schreier et al., 1995, supra) or glycosyl phosphatidylinositol (GPI)-linked gp120 (Schreier et al., 1994, supra), respectively, and (b) an AVE containing the respiratory syncytial virus (RSV) attachment (G) and fusion (F) glycoproteins (Stecenko, A. A. et al., Pharm. Pharmacol. Lett. 1 :127-129 (1992)).
  • RSV respiratory syncytial virus
  • G respiratory syncytial virus
  • F fusion glycoproteins
  • AVEs are used to deliver genes both by intravenous injection and by instillation in the lungs.
  • AVEs are manufactured to mimic RSV, exhibiting the RSV F surface glycoprotein which provides selective entry into epithelial cells.
  • F-AVE are loaded with a plasmid coding for the gene of interest, (or a reporter gene such as CAT not present in mammalian tissue).
  • the AVE system described herein in physically and chemically essentially identical to the natural virus yet is entirely “artificial", as it is constructed from phospholipids, cholesterol, and recombinant viral surface glycoproteins. Hence, there is no carry-over of viral genetic information and no danger of inadvertant viral infection. Construction of the AVEs in two independent steps allows for bulk production of the plain lipid envelopes which, in a separate second step, can then be marked with the desired viral glycoprotein, also allowing for the preparation of protein cocktail formulations if desired.
  • Another delivery vehicle for use in the present invention are based on the recent description of attenuated Shigella as a DNA delivery system (Sizemore, D. R. et al., Science 270:299-302 (1995), which reference is incorporated by reference in its entirety).
  • This approach exploits the ability of Shigellae to enter epithelial cells and escape the phagocytic vacuole as a method for delivering the gene construct into the cytoplasm of the target cell. Invasion with as few as one to five bacteria can result in expression of the foreign plasmid DNA delivered by these bacteria.
  • a preferred type of mediator of nonviral transfection in vitro and in vivo is cationic (ammonium derivatized) lipids. These positively charged lipids form complexes with negatively charged DNA, resulting in DNA charged neutralization and compaction. The complexes endocytosed upon association with the cell membrane, and the DNA somehow escapes the endosome, gaining access to the cytoplasm. Cationic lipid.DNA complexes appear highly stable under normal conditions. Studies of the cationic lipid DOTAP suggest the complex dissociates when the inner layer of the cell membrane is destabilized and anionic lipids from the inner layer displace DNA from the cationic lipid. Several cationic lipids are available commercially.
  • Consecutive tumour and blood samples from 226 patients with primary unilateral sporadic breast cancer were obtained from Aarhus University Hospital from August 1992 to January 1994. All patients fulfilled following criteria: (1) primary unilateral beast carcinoma with no evidence of disseminated disease; (2) no other malignancy; (3) complete clinical, histopathological, and biological information and full history of follow- up. Median follow-up was 120 months.
  • the median age was 57 years (range 29 - 93).
  • a total of 137 patients had ductal carcinomas and 72 patients presented positive lymph nodes in the axils.
  • 71 patients had died, 57 as a consequence of their malignant disease.
  • Treatment was either lumpectomy (51 patients), or radical, modified mastectomy (175 patients), in both situations associated with axillary dissection with node sampling.
  • Adjuvant radiotherapy was given to patients at an advanced stage of the disease after radical mastectomy and all patients treated with lumpectomy.
  • Adjuvant systemic hormone and/or chemotherapy were given to all high-risk patients, i.e. with positive axillary nodes, and/or high grade, and/or large tumour.
  • tumour DNA was purified from the hormone receptor analysis leftover. Purification of genomic DNA from leucocytes and tumour tissue are as described as follows (14). 670 tumour samples received from the receptor laboratory between August 1992 and December 1994. The receptor analysis was performed on 50 to 1500 mg tumour tissue and the yield ranged from a few pg to more than one mg DNA. In general, we isolated 400 pg DNA/ 100 mg tumour tissue.
  • the tumours were examined by a pathologist immediately after surgery. Part of the tumour was stored at -80°C. and the rest of the tumour material was used for hormone receptor analysis. The pellet containing nuclei was obtained immediately after the receptor measurement. Lysis buffer (750 p11100 mg tissue of 10 mM Tris-HC1 , 1 mM EDTA, 150 mM NaCI, 0.5% SDS, pH 10.5) and proteinase K (152 pg/100 mg tissue) were added and the pellet was incubated at 55°C for at least 90 rnin until it became soluble. 1/3 volume of 6 M NaCI was added, and the tubes were shaken cautiously and centrifuged for 15 rnin (3000 rpm) at 4°C.
  • Lysis buffer 750 p11100 mg tissue of 10 mM Tris-HC1 , 1 mM EDTA, 150 mM NaCI, 0.5% SDS, pH 10.5
  • proteinase K 152 pg/100 mg tissue
  • STRs Information on all STRs, including D13S1293, D13S220, D13S219 are accessible via the Human Genome Database (http://www.gdb.org). The assignment of D13S1493 and D13S1695 were initially performed using the Genebridge 4 radiation hybrid panel (Gb4, Research Genetics, Huntsville, Alabama). The exact locationof all STRs were eventually confirmed by The Human Genome Browser http://genome.ucsc.edu/ (version: May 2004).
  • the forward primer of each microsatellite was labeled with a fluorescent dye: 6-FAM, TET or HEX (PE Biosystems, Foster Ciy, CA).
  • Multiplex PCR amplification of 2-3 STR were performed using 20 ng DNA (control or tumour), 1 pmol of each primer, 250 ⁇ M dNTP, 1 x PCR buffer (supplied with the enzyme) and 0.18 U Taq polymerase (Roche) in a final volume of 6 ⁇ l.
  • PCR cycle conditions were: 1 cycle of 94 ° C for 4 min, 55 ° C for 30 s, 72 ° C for 36 s followed by 26 cycles of 94 ° C for 30 s, 55 ° C for 30 s, 72 ° C for 36.
  • D13S220 CCAACATCGGGAACTG TGCATTCTTTAAGTCCATGTC
  • the coding and flanking intron sequences from exons 8 - 17 of STARD13/DLC2 were PCR amplified and analyzed for mutations by denaturing high-performance liquid chromatography (DHPLC).
  • the primers were designed following the software guidelines for defining melting domains of each fragment (Transgenomic — ).
  • a GC 40 - clamp was linked to the Rhoi0GCf primer.
  • Primer sequences are listed in table 2.
  • To prepare DNA fragments for DHPLC analysis standard PCR amplification was performed, consisting of: 20 ng DNA, 250 ⁇ M dNTP, 0.8 - 2.0 pmol of each primer, 0.4 unit Taq polymerase, 1 x buffer (supplied with the enzyme) in a final volume of 20.0 ⁇ l.
  • One molar Betaine and 5% DMSO was added to the amplification of exons 8b, 8c and 9 - 13.
  • PCR product for sequencing was purified via Montage PCR Centrifugal Device columns (Millipore) according to the manufactures protocol. Both strands from each fragment were sequenced following the BigDye Terminator ® vers. 1.1 protocol from Applied Biosystems, except for a 4 times reduction of the Ready Reaction Premix. The products were precipitated using isopropanole, and the pellet was resuspended in formamide before loading onto the ABI Genetic Analyzer 3100 xl for electrophoresis. The products were analyzed via SeqScape ®, Applied Biosystems.
  • SNP analysis The methodology is based upon primer extension and the primers were designed to anneal 3' to the mutated base. To assure variable length of the primers, a multiple of (GACT) was added to the 5' end of the primer. Primer sequences are listed in table 2. The DNA fragment containing one or more SNPs were PCR amplified and treated with SAP and Exo 1. Primer extension was performed according to manufactures protocol, Snapshot ®, Applied Biosystems. The extended primers were separated by capillary electrophoresis (ABI 3100 xl) and analyzed via the GeneMapper ® vers. 3.5 software.
  • the probability of treatment failure was calculated for the endpoint of disease-specific survival and overall survival by the Kaplan-Meier product-limit analysis, using the Mantel-Cox proportional test for comparison. All time estimates were done using the date of primary surgery as initial value. A multivariate Cox proportional hazards analysis was used to evaluate prognostic parameters. Parameters were included in the model using forward selection, and statistical analysis performed by the WaId test. The level of statistical significance was set to five percent. The p-values estimated are those for a two-tailed test. The statistical analysis was performed using BMDP (1L, 2L, 4F) program package. The date for evaluation of outcome was July 1 , 2004, which gives a median potential observation time of 120 (range 75-117) months.
  • LOH analysis has been employed in order to identify regions in the chromosome which are involved in the development of cancer.
  • LOH a comparison of the allele intensities between PCR-amplified simple tandem repeats from individual matched wild-type and tumour DNAs from a cohort of cancer patients with the same cancer type is performed.
  • the simple tandem repeats are amplified by the use of primers which can be labelled for example radioactively or by fluorescent means.
  • the resulting amplified fragments can be analyzed separately or using high throughput procedures now available.
  • each product according to the present invention was visualized as a peak the height of which was proportional to the amount of DNA inherent in it.
  • A allelic loss
  • Results from tumours with intercalating Al and allelic retention were sorted to locate tumour specific chromosomal breakpoints and smallest regions of overlap (SRO), see Figure 2.
  • SRO tumour specific chromosomal breakpoints and smallest regions of overlap
  • D13S1700 is located within Leucine-Rich Repeat-Containing G Protein-Coupled Receptor 8 (LGR ⁇ /GREAT), encoding an integral, multi pas membrane protein.
  • LGR8 Mutations in LGR8 have been found to cause cryptorchidism, which is associated with an increased risk of infertility and testicular cancer (18, 19). No association with breast cancer has been reported. D13S285 is flanked closely by SOX1 and TUBGCP3 within a gene-rich area. To identify new breast cancer susceptibility genes, both regions have to be characterized further, as they each span several Mb.
  • D13S1493 is located 5' to the DLC2 ⁇ isoform and within intron 4 of an extended form of STARD13 (Ref. sequence: BX 647695 (mRNA)).
  • the polymorphic rate of D13S1838 is 0.41 in our Danish cohort, and to increase the level of information a Cox proportional hazards analysis was performed by adding the Al results from markers D13S1694, D13S1838 and D13S1839 spanning 17 kb of DLC2 ⁇ intron 1. The result was a highly significant correlation between Al of the region and risk of recurrent disease and dying of cancer, including D13S1493 decreased the significance marginally, see Table 6.
  • STARD13/DLC2 deficient patients have a significant increased risk of recurrence, of acquiring distant metastasis with strong preference especially to liver and lung, and a significantly shorter disease-free probability, see Table 7.
  • Table 7
  • a 13bp deletion (( ⁇ 13bp)ln10) was identified 147 bp from the 5' splice site of intron 10.
  • the 13bp was present in one or two consecutive copies and proved to be polymorphic (heterozygousity frequency 0.52).
  • Al, allele and genotype frequencies were established in the breast cancer cohort, and in two Danish control populations. Fig 4. No statistical differences were found between the allele frequencies in the populations. Being homozygous for two copies of 13bp, rather than heterozygous or homozygous for one 13bp copy, predicted a poor outcome, table ⁇ .Tumour specific Al of the 13bp provided information of the extension of the 5' Al.
  • Ten tumours presented a breakpoint between D13S1694 and ⁇ 13bpln10 (intron 1 and 10), indicating the presence of an intragenic fragile site.
  • the manufacturing company MRC-Holland has developed the method but no pre-made kit was available for DLC2.
  • Leukocyte DNA from 44 healthy Danish female medical students of both sexes were used as control individuals as described elsewhere herein.
  • Four exons and three control genes were analyzed using the MLPA methodology.
  • a description of the MLPA methodology is available at: http://www.mrc- holland.com/pages/indexpag.html and attached below.
  • control population was used to establish the mean value (based upon the peak height from the chromatography after capillary electrophoresis) for each exon.
  • Graphs illustrating the calculated value of the control sample is shown in Figure 6.
  • the values for each exon and each control sample is listed in table 9.
  • the cut off limit for deciding whether a variation in copy number is due to an amplification event is for exon 1 : 0.27863838; for exon 9: 0.33482048; for exon 10: 79411231 , and for exon 11 : 0.2793908.
  • amplification of the respective exons or part therof is indicative of an amplification reaction.
  • the cutt-off limit for deciding whether a variation in copy number is due to a deletion event is for exon 1 : 0.19055907; for exon 9: 0.24137581 ; for exon 10: 0.5932423, and for exon 11 : 0.19466922.
  • amplification of the respective exons or part thereof is indicative of a deletion reaction.
  • Deleted in liver cancer (DLC) 2 encodes a RhoGAP protein with growth suppressor function and is underexpressed in hepatocellular carcinoma. J Biol Chem, 278: 10824-10830, 2003.
  • GTPase activating protein suppresses growth of breast carcinoma cells, and yeast two- hybrid screen shows its interaction with several proteins.
  • DBCG Basal Cancer Group
  • SEQ ID NO: 2 mRNA sequence of STARD 13/DLC2 Homo sapiens START domain containing 13 (STARD13), transcript variant gamma, mRNA.
  • ACCESSION NM_052851 ctcacagaca acagccaagc acagaggaaa tattagctgg cagagataac gaagagaaaa 61 cactcggtga cagatgcacc atctgtcagt tctgaggag cagttttcaa gaaagctgaa
  • Homo sapiens deleted in liver cancer 2 alpha mRNA ACCESSION AY082589 gcaagaatcg gcacgaggct gttgagctgt cctgggctgg gtgccttgct ctttgactga
  • Homo sapiens deleted in liver cancer 2 beta mRNA Homo sapiens deleted in liver cancer 2 beta mRNA.
  • caagcttgtt tgtcaaatac cacagtattt tattcattgt tatcttgcca atggaaataa
  • Homo sapiens deleted in liver cancer 2 delta mRNA Homo sapiens deleted in liver cancer 2 delta mRNA.
  • ACCESSION AY082592 gcaagaatcg gcacgaggct gttgagctgt cctgggctgg gtgccttgct ctttgactga 61 gactggagac agacggcaac agccacaggc agactgaggt ggcaatagga aatctgccga

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Hospice & Palliative Care (AREA)
  • Biophysics (AREA)
  • Oncology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

La présente invention concerne des outils sous la forme de marqueurs génétiques pour la détection de la prédisposition et/ou le pronostic de formation de métastase, de la survie globale exempte de maladie et la récurrence. L'invention concerne de nouveaux procédés de détection de la prédisposition pour une période exempte de métastase, de récurrence, et/ou de maladie chez un sujet atteint de cancer du sein. L'invention est également utile pour déterminer le pronostic d'une période exempte de métastase, de récurrence, et/ou de maladie chez un sujet atteint de cancer du sein. L'invention est en outre utile pour déterminer le régime de traitement d'un sujet atteint de cancer du sein. En particulier, les procédés sont appropriés pour le cancer du sein sporadique. Les procédés reposent sur la présence ou l'absence du gène STARD13/DLC2 présent sur le chromosome 13 humain.
PCT/DK2007/000473 2006-11-03 2007-11-02 Prédisposition au cancer du sein, pronostic et régime de traitement de cancer du sein mettant en œuvre des marqueurs génétiques sur le chromosome 13 WO2008052558A2 (fr)

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US85626606P 2006-11-03 2006-11-03
US60/856,266 2006-11-03
US88498007P 2007-01-15 2007-01-15
US60/884,980 2007-01-15
DKPA200700057 2007-01-15
DKPA200700057 2007-01-15

Publications (2)

Publication Number Publication Date
WO2008052558A2 true WO2008052558A2 (fr) 2008-05-08
WO2008052558A3 WO2008052558A3 (fr) 2008-06-19

Family

ID=39253984

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/DK2007/000473 WO2008052558A2 (fr) 2006-11-03 2007-11-02 Prédisposition au cancer du sein, pronostic et régime de traitement de cancer du sein mettant en œuvre des marqueurs génétiques sur le chromosome 13

Country Status (1)

Country Link
WO (1) WO2008052558A2 (fr)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5374533A (en) * 1988-05-10 1994-12-20 Tetjin Limited Method for determining chondrocalcin

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5374533A (en) * 1988-05-10 1994-12-20 Tetjin Limited Method for determining chondrocalcin

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
"Amplimer 13qlot1" INTERNET CITATION, 2001, XP007904501 [retrieved on 2008-04-11] *
"SNP information for IMS-JST081754" INTERNET CITATION, [Online] 8 September 2001 (2001-09-08), XP007904498 Retrieved from the Internet: URL:http://snp.ims.u-tokyo.ac.jp> [retrieved on 2008-04-11] *
DEAN C J: "Preparation and characterization of monoclonal antibodies to proteins and other cellular components" METHODS IN MOLECULAR BIOLOGY, HUMANA PRESS INC., CLIFTON, NJ, US, vol. 32, 1994, pages 361-379, XP009092760 ISSN: 1064-3745 *
LEUNG THOMAS HO-YIN ET AL: "Deleted in liver cancer 2 (DLC2) suppresses cell transformation by means of inhibition of RhoA activity" PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF USA, NATIONAL ACADEMY OF SCIENCE, WASHINGTON, DC, US, vol. 102, no. 42, October 2005 (2005-10), pages 15207-15212, XP009098674 ISSN: 0027-8424 *
NAGARAJA G M ET AL: "Chromosome 13q12 encoded Rho GTPase activating protein suppresses growth of breast carcinoma cells, and yeast two-hybrid screen shows its interaction with several proteins" BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS, ACADEMIC PRESS INC. ORLANDO, FL, US, vol. 313, no. 3, 16 January 2004 (2004-01-16), pages 654-665, XP004481610 ISSN: 0006-291X *
NG ET AL: "Mitochondrial targeting of growth suppressor protein DLC2 through the START domain" FEBS LETTERS, ELSEVIER, AMSTERDAM, NL, vol. 580, no. 1, 9 January 2006 (2006-01-09), pages 191-198, XP005390335 ISSN: 0014-5793 *
RIO P G ET AL: "Loss of heterozygosity of BRCA1, BRCA2 and ATM genes in sporadic invasive ductal breast carcinoma" INTERNATIONAL JOURNAL OF ONCOLOGY, EDITORIAL ACADEMY OF THE INTERNATIONAL JOURNAL OF ONCOLOGY,, GR, vol. 13, no. 4, October 1998 (1998-10), pages 849-853, XP009098684 ISSN: 1019-6439 *
ULLMANNOVA VERONIKA ET AL: "Expression profile of the tumor suppressor genes DLC-1 and DLC-2 in solid tumors" INTERNATIONAL JOURNAL OF ONCOLOGY, EDITORIAL ACADEMY OF THE INTERNATIONAL JOURNAL OF ONCOLOGY,, GR, vol. 29, no. 5, 23 October 2006 (2006-10-23), pages 1127-1132, XP009098683 ISSN: 1019-6439 *

Also Published As

Publication number Publication date
WO2008052558A3 (fr) 2008-06-19

Similar Documents

Publication Publication Date Title
JP6386450B2 (ja) 肺がん転移の診断、予後診断および処置のための方法
KR101583546B1 (ko) 유전자 다형성을 이용한 소라페닙 치료에 대한 반응성 예측방법
JP6446381B2 (ja) ｃ−ＭＡＦを用いた前立腺がん転移の診断、予後診断および処置のための方法
EP3055429B1 (fr) Procede pour le pronostic et traitement du cancer metastatiques des os originant du cancer du seins
Zheng et al. Sequence variants of α-methylacyl-CoA racemase are associated with prostate cancer risk
EP2499258B1 (fr) Signature pour le diagnostic de l'agressivité et l'instabilité génétique du cancer du sein
US20130280705A1 (en) Methods and compositions for assessment of pulmonary function and disorders
WO2010048497A1 (fr) Profil génétique des marqueurs associés à la maladie d'alzheimer
EP2937416B1 (fr) Identification d'un groupe de gènes de la prédisposition à l'hypertension
EP3911763A1 (fr) Biomarqueurs pour le carcinome à cellules rénales
US10066266B2 (en) Genetic alterations on chromosomes 21Q, 6Q and 15Q and methods of use thereof for the diagnosis and treatment of type 1 diabetes
WO2015049063A1 (fr) Variants du promoteur de tert humains, ainsi que kits, méthodes et procédés associés
US7655403B2 (en) CHD7 gene polymorphisms are associated with susceptibility to idiopathic scoliosis
Zhou et al. Inactivation of LARS2, located at the commonly deleted region 3p21. 3, by both epigenetic and genetic mechanisms in nasopharyngeal carcinoma
US20100326218A1 (en) Identifying a subject with an increased risk of invasive mold infection
WO2008086800A2 (fr) Procédés de détection de prédisposition, de pronostic et de traitement d'un cancer du sein associé au chromosome 16 humain
JP2009529869A (ja) 癌の検出および処置
WO2008052558A2 (fr) Prédisposition au cancer du sein, pronostic et régime de traitement de cancer du sein mettant en œuvre des marqueurs génétiques sur le chromosome 13
US20130131148A1 (en) Micro-rna for cancer diagnosis, prognosis and therapy
US20140206002A1 (en) Methods of Diagnosing Breast Cancer
EP2436763B1 (fr) Procédé pour évaluer la métastase dans des ganglions lymphatiques de cancer ou le risque de celle-ci, et kit d'évaluation rapide pour ledit procédé
US20210095342A1 (en) Functional targets of mir-6891-5p & applications thereof
WO2008086799A1 (fr) Procédés de détection de prédisposition, de pronostic et de traitement d'un cancer du sein associé au chromosome 1 humain (présence)
WO2013142982A1 (fr) Colca1 et colca2 et leur utilisation dans le traitement et l'évaluation du risque d'un cancer du côlon
WO2013151505A1 (fr) Procédé de réalisation d'un pronostic pour le cancer du poumon

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 07817869

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase in:

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 07817869

Country of ref document: EP

Kind code of ref document: A2