WO2008046328A1 - A levorotatory lactonohydrolase producing strain and its use for producing chiral oxyacid - Google Patents

Abstract

A specific levorotatory lactonohydrolase producing strain and its use for producing chiral oxyacid are disclosed. The enzyme producing stain is Fusarium proliferatum Nirenberg ECU2002 with deposit number CGMCC 1494. The chiral oxyacid preparing method includes: (1) using the fungus mycelium, rough enzyme extract or their immobilization derivative as biocatalyst; (2) processing antipode selectivity hydrolysis resolution for a series of racemic chirality lactones to gain many optically active (+)-oxyacids and (+)-lactones which can be hydrolyzed into (-)-oxyacids; (+)-alpha-hydroxyl-beta, beta-dimethyl-gamma-butyric acid which is D- (+)-pantoic acid; and simple acidizing to gain chirality intermediate D-(-)-pantoic acid lactone widely used in preparing feed and daily chemical engineering industry.

Description

 L-lactone hydrolase producing bacteria and method for preparing chiral hydroxy acid thereof

 The present invention relates to a highly selective L-lactone hydrolase producing strain and a technical method for preparing a chiral hydroxy acid or a corresponding lactone using the strain. technical background

 Hydroxy acids, such as lactic acid, malic acid, tartaric acid, citric acid, and gluconic acid, are a very important class of organic acids that have unique physiological functions in living organisms and are very useful in the food/feed industry. Functional additive. This situation is very similar to amino acids, and the two can also be transformed into each other under certain conditions. Some non-natural hydroxy acids, especially optically active chiral hydroxy acids, can also be used as "structural blocks" for the chemical synthesis of various natural products and drug molecules.

 In addition to pure α-hydroxy acid, the β-hydroxy acid, γ-hydroxy acid and hydroxyl group at the terminal ω-hydroxy acid can be dehydrated and closed under acidic conditions to form a four-membered ring, a five-membered ring or a polycyclic lactone. The compounds are referred to as β-lactone, γ-lactone or ω-lactone, respectively. Β-lactones and γ-lactones generally have a fruity aroma, while certain macrocyclic ω-lactones have a musky scent, which has important applications in the food and cosmetic industries. In addition, certain insect hormones and plant growth regulators are also lactone compounds. The lactone can be hydrolyzed to the corresponding hydroxy acid, and can be easily condensed with other nucleophiles such as an alcohol/amine to form a plurality of derivatives such as a hydroxy ester/hydroxy amide, and thus has a wide range of uses in the fine chemical and pharmaceutical industries.

 Among various lactone compounds, γ-lactone is relatively common and useful because of its stable five-membered ring structure. a γ-lactone which is mono- or poly-substituted at the α/β-position, the structure of which is present in many natural products, and compounds containing such a structure tend to have various biological activities (for example, cytotoxicity and antifungal activity; Such compounds may be screened as new anti-tumor or anti-bacterial drugs. Such compounds generally contain asymmetric chiral carbon atoms, and their biological activities are often associated with their optical activity. The synthesis of optically active lactone compounds and the study of their biological activity and structure-activity relationship is an important task that helps people discover new drugs.

 The synthesis of optically pure chiral lactones by conventional chemical methods requires complex steps and the use of special catalysts, usually with low yields, contamination and toxicity problems, and biocatalytic synthesis has the advantages of green chemistry. Simple, mild, and responsive, and increasingly gaining widespread attention.

For example, α-hydroxy-γ-butyrolactone is a useful optically active substance. Copy of Fuji Pharmaceutical Industry Hui Si et al. (JP9308497) used a selective ring-opening hydrolysis of α-hydroxy-γ-butyrolactone catalyzed by Fusarium oxysporum to obtain (S)-(+)-a-hydroxyazinolactone and (R) -(+)-a-hydroxy-γ-butyric acid, which is acidified and lactonized to give an optical purity of 96% (RH;-;)-a-hydroxy-γ-butyrolactone in a yield of 40 %.

 In another example, β-hydroxy-γ-butyrolactone is a very important chiral structural block, (-β-hydroxy-γ-butyrolactone is a hypolipidemic drug atorvastatin, neurotransmitter L-(-)-meat Alkali, HIV protease inhibitor amprenavir, a key intermediate for the treatment of dermatological drugs hydroxyeicosatetraenoic acid, anticancer drug Aplysistatint, etc. (SH-)-P-hydroxy-γ-butyl Lactone reduction can give 05 (-)-β-hydroxytetrahydrofuran, which is an important intermediate for AIDS treatment; convert (-)-β-hydroxy-γ-butyrolactone to (-)-5- Hydroxymethyl-1,3-oxazolin-2-one can be used to obtain the latest generation of antibacterial drugs. In addition, many important natural compounds can be synthesized from (-)-β-hydroxy-γ-butyrolactone, and RM+)-P-hydroxy-γ-butyrolactone is also a very important organic synthesis intermediate. Currently (-)-β-hydroxy-γ-butyrolactone is synthesized by chemical method. Henrot (Synth Commun, 1986 , 16(2): 183~ 190) Using (-)-malic acid as raw material, methyl esterification to form (-)-dimethyl malate, followed by reduction and transesterification to form (-)-β-hydroxyl -γ-丁Tanaka (Synthesis, 1987, 6: 570~573) synthesized (-)-β-hydroxy-γ-butyrolactone by a six-step reaction using D-isoascorbic acid as a raw material. Suzuki et al. (E ym. Microb. Technol., 1999, 24: 13-20) Selectively racemic 4-chloro-chloride using dechlorinating enzymes such as Pseudomonas sp. and Enterobacter sp.

Dechlorination of the (-)-enantiomer of -3-hydroxybutyrate to give (-)-β-hydroxy-γ-butyrolactone and the remaining (+)_ ₄ _chloro- ₃ -hydroxybutyric acid ester.

For example, (-)-α-hydroxy-β, β-dimethyl-γ-butyrolactone, commonly known as D-(-)-pantolactone, is a preparation of D-pantothenate and D-panthenol. Important synthetic intermediates. D-calcium pantothenate (also known as vitamin Β ₅ ) is one of the important vitamins and is widely used in the pharmaceutical, feed and food industries.

Etzyme MicfobTechnol, 1988, 10: 689-690) Separation of 0-acetyl pantolactone using lipase, Adam et al (Synthesis, 1988, 5: 373~375) was prepared using a nitrilase (- - Pantolactone, also known (Appl. Microbiol, 1974, 27(1): 130-134; Enzyme Microb Technol, 1987, 9(7): 41 1~416; Agric Biol Chem, 1987, 51: 289-290; Agric Biol Chem, 1987, 51 : 301 1~3016; Tetrahedron: Asymmetry, 1994, 5(8): 1419~ 1423) Trying to prepare (-)-general solution by asymmetric redox reaction using oxidoreductase Acid lactone; In 1994, Shimizu et al. (AppL Microbiol. Biotechnol, 1995, 44: 333~338) of Kyoto University used Fusarium oxysporum AKU3702 to catalyze the resolution of racemic pantolactone; in 2002, Moshi Biochem of Jiangnan University, China, etc. 2002, 38: 545~ 549) The pantolactone was resolved by Fusarium moniliforme SW-902 enzymatic method, and D-(-)-pantolactone was obtained with higher optical purity. Although in the existing chiral hydroxy acid synthesis technology, both the chemical resolution method and the existing biological method have made some progress, there are still relatively low substrate concentrations, the product optical purity is not high enough, and the catalyst activity is not strong enough. The shortcomings of this or the other affect the industrial application of these methods. Moreover, most of the strains currently found to be suitable for the production of chiral hydroxy acids by biological methods can only be used for single or a small number of substrates, and are not widely used. Summary of the invention

 After long-term research and repeated screening tests, the inventors accidentally screened a strain of Fusarium that produces L-lactone hydrolase, which is highly resistant to substrates and can catalyze a variety of substrates. The enantioselective hydrolysis of the ester produces the corresponding chiral hydroxy acid with high catalytic activity and high optical purity of the product. Therefore, the technical problem to be solved by the present invention is to disclose a L-lactone hydrolase-producing bacterium and a method thereof for preparing a chiral hydroxy acid to overcome the drawbacks of the prior art.

 In a first aspect of the present invention, a strain of Fusarium proliferatum Nirenberg ECU2002 producing L-lactone hydrolase is provided, and the accession number is CGMCC 1494.

 In another preferred embodiment, the bacterium comprises a DNA having the nucleotide sequence shown at positions 86 to 1206 of SEQ ID NO: 1. This DNA encodes a L-lactone hydrolase.

 In another preferred embodiment, the DNA has the nucleotide sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2.

 In a second aspect of the invention, there is provided a method of preparing a chiral hydroxy acid using the Fusarium proliferatum Nirenberg ECU 2002, comprising the steps of:

 (1) cultivating the Fusarium proliferatum Nirenberg ECU2002 to obtain a culture;

 (2) contacting the culture of step (1) or its extract with a racemic chiral lactone substrate (gP (± lactone substrate;) to hydrolyze (-)-lactone to form (+) - Hydroxy acid.

 In another preferred example,

 In the step (1), the Fusarium proliferatum Nirenberg ECU2002 is fermented in a medium containing carbon, nitrogen, phosphorus and an inorganic salt to obtain a culture;

 In the step (2), the culture obtained in the step (1) or the extract thereof is used as a catalyst to catalyze the enantioselective hydrolysis of the lactone substrate, and the unhydrolyzed (+)-lactone is separated and removed, and obtained by (-)-hydroxy acid formed by hydrolysis of lactone;

Said lactone substrate includes (but is not limited to): β-butyrolactone, α-hydroxy-γ-butyrolactone, α-hydroxy-β, β- Dimethyl-γ-butyrolactone, α-acetyl-γ-butyrolactone, β-hydroxy-γ-butyrolactone, n-butylphthalide, and the like.

 In another preferred embodiment, in the step (2), the extract of the culture is selected from the group consisting of:

 a mycelium obtained by centrifuging or filtering the culture;

 a fermentation supernatant obtained after removing the culture body from the culture;

 a cell-free extract obtained by disrupting the mycelium and extracting it; or

 Immobilized cells or immobilized cell extracts.

In another preferred embodiment, the composition and concentration of the medium are as follows: glycerol 10 to 50 g/L, peptone 1 to 20 g/L, yeast extract 1 to 20 g/L, ammonium nitrate 1 to 10 g/ L, inorganic salt: NaCl 0.1~2 g/L; MgSO ₄ '7H ₂ O 0.1~ ₂ g/L; FeSO ₄ '7H ₂ O 0.01~0.05 g/L; ZnSO ₄ '7H ₂ O 0.01~0.05 g/ L; CuSO ₄ '5H ₂ O 0.001~0.01 g/L;

 In another preferred embodiment, the fermentation conditions are:

 pH 5~9, temperature 25~35. C, the inoculum based on the volume of the fermentation medium is 1 to 10% by volume, and the fermentation time is 12-48 ho.

 In another preferred embodiment, the concentration of the lactone substrate is from 1 to 75% by weight, and the amount of the catalyst based on the weight of the substrate lactone is from 0.25 to 1.5 grams of cells per gram of lactone or 0.25 to 10 units of enzyme per Ketone, reaction temperature is 25~40 °C, pH 6.0~8.0, reaction time is 0.1-40 ho

 In another preferred embodiment, the lactone substrate is (±)-α-hydroxy-γ-butyrolactone.

 In another preferred embodiment, the lactone substrate is (±)-pantolactone.

 In another preferred embodiment, the catalyst is in any of the following forms:

 (1) Mycelium collected by centrifugation or filtration after the Fusarium ECU2002 is cultured in liquid or solid;

 (2) The fermentation supernatant remaining after removing the cells;

 (3) crushing the mycelium by grinding or homogenizing, and extracting the obtained cell-free extract with water or buffer;

 (4) Immobilized cells or immobilized enzymes.

 In another preferred embodiment, after the step (2), the method further comprises the step of: dehydrating the (+)-hydroxy acid under acidic conditions to obtain a (-)-lactone.

 More preferably, the acidic condition is pH 1-4.

In a third aspect of the invention, there is provided the use of the Fusarium bacterium, characterized in that it is used to produce a L-lactone hydrolase catalyst for the preparation of a chiral hydroxy acid or a chiral lactone. The L-lactone-producing bacterium of the present invention, Fusarium oxysporum (also known as Fusarium) F^ar/w proliferatum Nirenberg ECU2002, is a uniquely isolated (-)-separated from the soil recently. Ester hydrolase-producing bacteria, which was deposited at the China General Microorganisms Collection (CGMCC) on October 17, 2005, with the accession number CGMCC 1494.

 The separation and screening methods of the strains of the present invention are briefly described as follows:

 400 soil samples under different environmental conditions were collected, using γ-butyrolactone, DL-pantolactone, DL-pantothenate, D-calcium pantothenate, D-(-)-pantolactone , L-(+)-pantolactone, or D-pantothenate is the only carbon source for enrichment culture, and the (-)-lactone hydrolase-producing bacteria are screened.

(1) Place the soil sample in a test tube and add 2 mL of enrichment medium A (g/L) (substrate 1.0, NaNO ₃ 4.0, KH ₂ PO ₄ 4.0, MgSO ₄ 0.1, KC1 0.5 , ZnSO ₄ -7H ₂ O 0. 1 , CuSO ₄ '5H ₂ O 0.05), enriched for 1 day at 200 °C/min at 30 °C, retaining tubes with obvious signs of microbial growth, 0.2 mL of enriched medium per tube Add 1.8 mL of sterilized enriched medium B (g/L) (substrate 5.0, NaNO ₃ 4.0, KH ₂ PO ₄ 4.0, MgSO ₄ 0.1, KC1 0.5 , ZnSO ₄ -7H ₂ O 0. 1 , CuSO ₄ -5H ₂ O 0.05), cultured at 30 ° C, 200 r / min for 1 to 2 days, each tube took 0.1 mL of enriched culture solution coated with bromophenol blue indicator Plate medium C (g/L) (substrate 5.0, glycerol 10, yeast extract 7.5, peptone 7.5, agar 20) was incubated at 30 ° C for 2 to 3 days. The hydrolyzed strain produced a hydrolyzed circle on the plate medium C, and the medium surrounding the colony changed from blue to yellow, and further separated and purified to obtain a single colony.

 (2) Inoculate a single colony into 100 mL of rich medium D (glycerol 10, yeast extract 7.5, peptone 7.5), 30. C, 160 r/min culture for 2 to 3 days. After filtration or centrifugation to obtain wet cells, 10 mL of potassium phosphate buffer (100 mM, pH 7.0) and 1% (w/v) of substrate α-hydroxy-γ-butyrolactone were added at 30 °C. 160 r / min reaction for 12 h. The remaining substrate was extracted with ethyl acetate, the product in the remaining aqueous phase was lactonized, and extracted with ethyl acetate. The optical purity of the hydrolyzed hydroxy acid and the remaining substrate lactone was analyzed by sampling.

 (3) A strain of Fusarium proliferatum (Nirenberg EGU2002) producing a specific (-)-lactone hydrolase was isolated by repeated screening. The Fusarium (F^ar/w proliferatum Nirenberg ECU2002) has the following microbiological characteristics:

Cultured on solid medium for three days, producing a large number of pink intracellular hyphae, the aerial hyphae are white fluffy, with yellow pigment, the colony diameter is about 25 mm; filaments in liquid medium At the beginning, there are many small conidia, the size is 6~15 μηι Χ 3~4 μηι, and brown pigment is produced in the later stage. Branches of conidiophores, spore stalks ca. 25 μηι, aggregated or scattered, small conidia stalks stalked into sessile or sessile spores, observed under a low-power microscope, in spore stalks On, the conidia chain is "V" type. Large conidia were not observed, and no chlamydospores were found, which could survive in an environment with a temperature of 10 to 60 ° C, a pH of 4.0 to 9.0, and a NaCl concentration of 0 to 7% (w/v).

 This strain was identified as a Fusarium proliferatum Nirenberg group by the German DSMZ company. There are significant differences between the Fusarium moniliforme SW-902 and the Fusarium ox pora AKU3702 reported in the previous literature Microbiol. Biotechnol, 1995, 44: 333~338; Process Biochem, 2002, 38: 545~549). The main difference is that The F^ar/w proliferatum ECU2002 of the present invention is a pink fungus, and has many small conidia in the initial stage, and the enzyme fermentation time is as short as 1 to 2 days, while the Fusarium moniliforme SW-902 and Fusarium oxysporum reported in the literature. AKU3702 is a white fungus with spores larger in beads. The fermentation time of Fusarium moniliforme SW-902 is 2~3 days. The fermentation time of F ari oxysporum AKU3702 is 5~7 days longer, while Fusarium oxysporum AKU3702 is more. It is a phytopathogenic bacterium. In addition, the Fusarium proliferatum ECU 2002 of the present invention can hydrolyze various lactone substrates to form corresponding chiral hydroxy acids, and is highly resistant to the concentration of the substrate, such as catalyzing the hydrolysis of D-(-)-pantolactone. The substrate concentration can be as high as 75% w/v (the substrate concentration reported in the literature is generally 10 to 30%, w/v). After recrystallization, the optical purity of the product (-)-lactone exceeds 99%. .

 The Fusarium oxysporum (F^ar/w proliferatum Nirenberg ECU2002) of the present invention can be used to prepare a chiral hydroxy acid, and includes the following steps:

 (1) fermenting said Fusarium (3⁄4sar/w proliferatum Nirenberg ECU2002) in a medium containing carbon, nitrogen, phosphorus and other inorganic salts to obtain a culture;

 The composition and concentration (g/L) of the medium are as follows:

Glycerol 10~50, peptone 1~20, yeast extract 1~20, ammonium nitrate 1~10, inorganic salt: NaCl 0. 1-2; MgSO ₄ 7H ₂ O 0. 1-2; FeSO ₄ 7H ₂ O 0.01— 0.05; ZnSO ₄ 7H ₂ O 0.01 - 0.05; CuSO ₄ 5H ₂ O 0.001~0.01; pH 5~9, temperature 25~35. C, the inoculum amount based on the medium volume is 1 to 10% ν / ν, the culture time is 12 to 48 hours;

 (2) contacting the catalyst with a substrate chiral lactone compound to be resolved, performing enantioselective catalytic hydrolysis, and then collecting unhydrolyzed (; +)-lactone from the reaction product and (-)- Hydrolysis of lactone to form (; +)-hydroxy acid;

 The concentration of the substrate lactone is 1 to 75% (w/v), and the catalyst is used in an amount of 0.25 to 1.5 g of cells per gram of lactone or 0.25 to 10 units of enzyme per gram of lactone based on the weight of the substrate lactone. For 25~40. C, pH 6.0-8.0, reaction time is 0. 1-40 h;

Using γ-butyrolactone as a substrate for the determination of lactone hydrolase activity, the lactone water was determined by the following method. Enzyme activity:

 In 10 mL of an aqueous phase reaction system containing 2% (^/ν) γ-butyrolactone, add the catalyst to be tested, and add 0.1 M NaOH at 30 °C under magnetic stirring to maintain the pH of the reaction solution. 7.0, Determine the time required to consume 100 μΐ NaOH solution. The enzyme unit (U) is defined as the amount of enzyme required to catalyze the hydrolysis of 1 μηιοΐ γ-butyrolactone to the corresponding hydroxy acid in 1 min under the above conditions.

 Said catalyst is any of the following forms:

 (1) Mycelium (containing most (-)-lactonease) collected by centrifugation or filtration after the liquid or solid culture of Fusarium oxysporum ECU2002;

 (2) The fermentation supernatant remaining after removing the cells (containing a small amount of free (-)-endoesterase secreted into the extracellular space);

 (3) crushing the mycelium by grinding or homogenizing, and extracting the obtained cell-free extract with water or buffer;

 (4) using an appropriate method, such as gel embedding, glutaraldehyde cross-linking or carrier adsorption, etc., to treat the immobilized cells or immobilized enzyme obtained by the above-mentioned material containing the active enzyme component;

 The lactone substrate includes, but is not limited to: β-butyrolactone, α-hydroxy-γ-butyrolactone, α-hydroxy-β, β-dimethyl-γ-butyrolactone (commonly known as a general solution) Acid lactone;), α-acetyl-γ-butyrolactone, β-hydroxy-γ-butyrolactone, n-butylphthalide, and the like.

 A preferred substrate lactone is (±)-α-hydroxy-γ-butyrolactone.

 A preferred substrate lactone is (±)-pantolactone.

 The strain of the invention has stable enzyme production and good stereoselectivity, and can directly use the mycelium obtained by fermentation as an enzyme source to hydrolyze the racemic lactone to obtain a chiral hydroxy acid with high optical purity and the remaining lactone.

 By using the disintegration process of the invention, various types of high optical purity chiral hydroxy acids can be obtained simply and conveniently, and it is a production method with broad application prospects, which can meet the needs of the rapidly developing pharmaceutical industry, and the following The technical content of the present invention is further described by way of example. DRAWINGS

 Figure 1 shows the results of multi-batch hydrolysis resolution of 10% (; wA a-hydroxy-γ-butyrolactone) catalyzed by immobilized cells.

Figure 2 shows the results of multi-batch hydrolysis resolution of 20% (; w/v) pantolactone catalyzed by immobilized cells. Figure 3 shows the results of multi-batch hydrolysis resolution of 35% (; w/v) pantolactone catalyzed by immobilized enzyme. Figure 4 shows the progress of the catalytic resolution of 75% (; w/v) pantolactone by immobilized enzyme. detailed description

 Example 1 Fermentation culture of Fusarium proliferatum ECU2002

Bevel and plate medium (g/L): glycerol 30, yeast extract 7.5, peptone 7.5, agar 20. Sterilize at 121 °C for 15 minutes, sterilize, cool, plate, inoculate, and incubate at 30 °C for 2 days. Fermentation medium (g/L): glycerol 30; peptone 10; yeast extract 10; NH ₄ NO ₃ 3; inorganic salt (g/L) (NaCl 1; MgSO ₄ '7H ₂ O 1; FeSO ₄ '7H ₂ O 0.02; ZnSO ₄ 7H ₂ O 0.03; CuSO ₄ '5H ₂ O 0.005); pH 7.5. Sterilize at 121 °C for 15 minutes, sterilize, inoculate, inoculate 2%, inoculate at 30 °C, rotate at 160 r/min, and the dry weight of the cells will reach 18 g/L for 2 days. The enzyme can reach above 90U/L, and the specific activity is 5 U/g. Example 2 Immobilization of cell debris

 1) Take 50 g of Fusarium proliferatum ECU2002 cells, grind it with 5 g of quartz sand for 1 h, and centrifuge at 12,000 rpm for 15 min. The supernatant is a cell-free extract and precipitated as cell debris.

 2) Take 5g of cell debris, add different carriers, immobilize the cell debris, and measure the residual activity after storage at 4 °C for 1 week (see Table 1 for the results).

 3) The cell debris immobilized by glutaraldehyde cross-linking is used as the enzyme source, (±)-pantolactone as the substrate, the reaction volume is 20 mL, the substrate concentration is 2 M, and the immobilized cell debris is put into 10 g. The temperature was 30 °C, 3 M ammonia water was added dropwise to maintain the pH of the reaction solution at 7.0, and after 24 h, the conversion was 34.4%, and the optical purity of the product (-)-pantolactone was 94.6%. Table 1 Catalytic activity of different cell-fixed cell debris

 Carrier Enzyme activity (U/gcell) Relative vigor (%) Residual viability after one week (%) None 112±1.9 100±1.7 65.8±0.7

K-carrageenan 97±1.8 87±1.6 50.1±0.2 gelatin 79±1.4 71±1.2 34.0±3.5 agar 101±6.2 90±5.5 89±1.4 <≡3⁄41^ according to 82±7.9 74±7.0 97±4.9 sodium alginate 30.6±0.4 27.4±0.4 96±2.4 sodium alginate + chitosan 30.0±0.3 26.9±0.3 94±2.8 glutaraldehyde 96.0±1.3 86± 1.1 92±3.9 soluble starch + glutaraldehyde 103±2.0 92±1.8 37±1.9 diatomaceous earth + glutaraldehyde 73±1.8 66±1.6 90±1.2 hydroxymethylcellulose + glutaraldehyde 80±2.5 72±2.3 97±2.4 polyacrylamide + glutaraldehyde 59±2.2 53±2.0 88±4.1 glutaraldehyde + ethylenediamine 76±3.4 68±3.0 75±3.7

Example 3~13 Fusarium proliferatum ECU2002 Immobilized cells hydrolyzed against a series of lactone compounds

 In the following list 2, a series of lactones are substrates, the substrate concentration is ΙΟΟπιΜ, the reaction volume is 10 mL, and 0.2 g of immobilized cells (cells obtained by cross-linking with 15 mM glutaraldehyde at 30 ° C for 3 h) are placed at 30 . C. The activity was measured after 0.1~0.5 h of reaction under magnetic stirring. Table 2 lists the relative viability of immobilized cells when different lactones are hydrolyzed. With the activity of γ-butyrolactone being 100%, the hydrolysis effect of immobilized cells on the more complex lactone (such as n-butylphthalide) is not obvious, and the activity of the enzyme is only 25%. The immobilized cells showed high activity against α-substituted lactone. When the substrate was α-hydroxy-γ-butyrolactone, the activity was the highest, which was 54 times that of γ-butyrolactone. Taking (earth)-pantolactone and (-)-pantolactone as examples, the viable cell viability was 21 times that of γ-butyrolactone 14.7. Table 2. Catalytic Activity of Immobilized Cells on a Series of Lactone Compounds Example No. Substrate Structural Formula Relative Activity (%) Example 3 γ-butyrolactone 100 ± 1

Example 4 (soil) -β-butyrolactone 1 184 ± 26

Example 5 (±)-α-hydroxy-γ-butyl awake 5541 ± 84 Example 6 (earth) -β-hydroxy-γ-butyl awake 374 Example 7 (+)-β-hydroxy-γ-butyl Wake up 129 ± 3 Example 8 (-) -β-hydroxy-γ-butyl awake 517 ± 16 Example 9 (earth) - pantolactone 1468 ± 23

 Example 10 (-)-pantolactone 2103 ± 4

 , 0

 Example 1 1 (+)-pantolactone

Example 12 (±)-α-acetyl-γ-butyl awake Example 13 n-butylphenyl hydrazine

Example 14~: 17 The crude enzyme extract of Fusarium proliferatum ECU2002 was used to separate the chirality with ECU2002 crude enzyme extract as the enzyme source, (±)-β-butyrolactone, (±)-α-hydroxy-γ-butyl Lactone, (+)-β-hydroxy-γ-butyrolactone and (±)-pantolactone as substrate, reaction volume 20 mL, substrate concentration 100 mM, input crude enzyme 13 U, reaction temperature The reaction time was 0.2 to 12 h at 30 ° C, and the pH of the reaction solution was kept constant at 7.0 by dropwise addition of NaOH, and the conversion was calculated from the alkali consumption. When the (±)-pantolactone was used as a substrate, the (-; )-lactone substrate was selectively hydrolyzed to form (+)-hydroxy acid, and the conversion rate was as high as 38.2%, and (10) - The hydroxy acid is converted to (-)-lactone under acidic conditions at pH = 1, and heated at 90 °C for 0.5 h. The optical purity of the product (-)-pantolactone is up to 98.2% ee. And (±)-α-hydroxy-γ-butyrolactone, knot The fruit is similar to (±)-pantolactone, but its reaction time is greatly shortened, the conversion rate reaches 44.2%, and the resulting (d)-hydroxy acid is pH=1 under acidic conditions, and 0.5 h when heated at 90 °C. When the optical purity of the converted product (-)-α-hydroxy-γ-butyrolactone is 96.3% ee, only 0.2 h is required, and the initial reaction rate is also the fastest, reaching 52.6 μΜ/min. (^ value;) is 27.6. Catalytic resolution of several chiral lactone compounds by crude extracts from esterase bottoms in Table 3

 Object

 Implementation initial velocity reaction conversion optical purity

 Case number (M/min) Time rate (%), +χ

 ^ ) ^, lactone hydroxy acid selectivity

(ee _s , %) (ee _P , %) (E value) Implementation (earth) -β-butyrolactone 2.6 4 41.0

Example 14

Implementation of (±)-α-hydroxy-γ-butane 52.6 0.2 44.2 68.0 96.3 26.

 Example 15

 ΟΗ

,Eight

Implementation (soil) -β-hydroxy-γ-butene 1.1 12 38.5 46.4 94.8 10.6 Example 16 ester

 Implementation (soil) - pantothenic acid 酉 9.8 2 38.2 51.9 98.2 19.2 Example 17

Example 18 Immobilized Cell Catalyzed Multi-Batch Hydrolysis of (±)-α-Hydroxy-γ- Butyrolactone (Concentration 10% w/v)

In a 20 mL reaction system with a substrate (±)-α-hydroxy-γ-butyrolactone concentration of 1 M (10% w/v), glutaraldehyde cross-linked cells were added to 0.1 g at 30 °. C, 160 rpm conditions for 10 h, adding ammonia to adjust the pH of the control reaction is 6.8 ~ 7.5. Repeat 10 times. The results are shown in Figure 1. After 10 batches of hydrolysis reaction, the activity of the immobilized enzyme decreased by only 10%, and the half-life of the enzyme reached 36 batches. In the case of the secondary hydrolysis reaction, the conversion of the reaction can still be maintained at about 40%. The (; + )-hydroxy acid produced at this time was completely converted into (-)-α-hydroxy-γ-butyrolactone under acidic conditions (pH=3) and heated at 80 °C for 4 h. The optical purity of the product (-)-α-hydroxy-γ-butyrolactone was maintained between 93-96% ee. The above results indicate that the immobilized cells have good enantioselectivity and excellent operational stability when subjected to hydrolysis-resolving reaction of α-hydroxy-γ-butyrolactone. Example 19 Immobilized cells catalyze the multi-batch hydrolysis of pantolactone (concentration 20% w/v) at a substrate (±)-pantolactone concentration of 1.5 M (20% w/v) In a 50 mL reaction system, 15 g of cells immobilized by glutaraldehyde cross-linking were added, and reacted at 30 ° C, 160 rpm for 10 h, and ammonia was added to adjust the pH of the reaction to 6.5 to 7.0. The operation was repeated 30 times with free cells as a control. As a result, as shown in FIG. 2, the immobilized catalyst can be reused for more than 30 times, and the enzymatic hydrolysis reaction can be carried out multiple times, and both of them have satisfactory resolution effects, and have potential industrial application value. Example 20 Immobilized enzyme catalyzed multi-batch hydrolysis of pantolactone (concentration: 35% w/v)

1) Preparation of immobilized enzyme: In an ice bath, a half volume of cold acetone was slowly added to the crude cell extract, slowly stirred for 0.5 h, and then cross-linked with 20 mM glutaraldehyde for 4 h, at 4. C, centrifuge at 154,000 rpm for 15 min, and wash twice with physiological saline. 2) In a 20 mL reaction system with a substrate (±)-pantolactone concentration of 2.7 M (35% w/v), 60 U of immobilized enzyme was added and reacted at 30 ° C and 120 rpm. 6 h, add ammonia water (3 M) to adjust the pH of the control reaction at 6.5~7.0, and repeat the operation 10 times. As a result, as shown in Fig. 3, after 10 hydrolysis reactions, the activity of the immobilized enzyme was decreased by 33%, the half-life of the enzyme was about 17 batches, and the optical purity of the product was maintained at 95% or more. In the 10th hydrolysis reaction, the conversion of the reaction can still be maintained at about 30%, and the product accumulates to about 30 after 10 reactions. The above results indicate that the immobilized lactonase has good enantioselectivity and is very Good operational stability. Example 21 Catalytic resolution of high concentration (75% w/v) of (earth)-pantolactone by immobilized enzyme in a 20 mL reaction system with a substrate concentration of 5.7 M (; 75% _W / _V ) (; ±)-pantolactone, and put 40.0 U of immobilized enzyme, react at 160 rpm, 30 °C, add ammonia (3 M) to control the reaction pH at 7.2. The progress of the reaction is shown in Fig. 4. After 36 h of reaction, the conversion rate is 36.8%. The (+)-hydroxy acid produced at this time is converted to (at pH=2) under acidic conditions at 80 °C for 1 h. -) - lactone. The optical purity of the product (-)-pantolactone is still >90% ee. The optical purity of the product after recrystallization can be Reach > 99% ee. Example 22 Cloning of the lactone hydrolase gene

 1. Take 0.5 g of Fusarium mycelium, freeze it in liquid nitrogen and grind it into powder. Transfer the powder into 1.5 ml DEPC water-treated EP tube, extract total RNA according to the instructions of total RNA extraction kit, and take appropriate amount of total RNA. For the samples, the absorbances of OD260, OD280, and OD230 were measured, and the total RNA concentration was calculated and the purity was estimated. Simultaneous RNA electrophoresis was performed to determine the integrity of total RNA.

 2. Isolation and extraction of mRNA from the total RNA obtained in Operation 1, and operating according to the instructions of the Biopolymer Co., Ltd. mRNA isolation kit.

 3. Using the artificial reverse transcription kit, the mRNA isolated from 2 was used as a template to synthesize the first strand of cDNA, and the instructions were carried out according to the instructions of the Biosynthetics cDNA Synthesis Kit.

 4. Based on the structure of the mRNA and the homologous sequence analysis of the cDNA encoding the L-lactone hydrolase, the following primers were designed:

 弓 I substance 1 (SEQ ID NO: 3): GGAACATATGCCTTCTTCCATTTCTGT (lined part of Nde I restriction site)

 Primer 2 (SEQ ID NO: 4): GGACCATATGGCTAAGCTTCCTTCTACG

 弓 I I 3 (SEQ ID NO: 5): AAGGGGATCCCTAATCATAGAGCTTGGGAC (the part of the line is the BamHI restriction site)

 The primers 1, 3 and primers 2 and 3 were used to amplify the L-lactone hydrolase cDNA gene with the first strand of the total cDNA as a template. The PCR parameters were 94 °C for 30 s, 57 °C for 30 s, and 72 °C for 80 s. After repeating 30 cycles, continue to extend 10 min at 72 °C. The PCR product was identified by electrophoresis on a 0.0% agarose gel. The PCR product was approximately 25 μl, and the fragment of interest was recovered by electrophoresis on 0.7% agarose. The DNA gel recovery kit is used for recovery. The method is described in the DNA gel recovery kit.

 The recovered target fragment is ligated to the vector pMD 18-T (TaKaRa), and the specific method is as follows.

The PMD 18-T vector kit instructions were used to construct recombinant plasmids pMD 18-T-12 (primer 1 and primer 3) and pMD 18-T-14 (primer 2 and primer 3). The recombinant plasmid was then electroporated into the E. co//JM109 host strain as described in the literature.

The transformed bacterial solution was inoculated into 3 ml of LB medium containing 50 μ ₈ /ηι 1 ampicillin (Amp), and cultured at 37 ° C overnight. The plasmid was extracted by alkaline lysis, and the PCR product was identified by restriction endonuclease Nde I and BamHI. The PCR product was identified by 0.1% agarose gel electrophoresis, and the positive clones were screened and verified by sequencing.

PCR was carried out using primer 1 and primer 3, and the obtained PCR product sequence is shown in SEQ ID NO: 1. PCR was carried out using primer 2 and primer 3, and the obtained PCR product sequence is shown in SEQ ID NO: 2.

 The above sequence obtained was subjected to nucleotide sequence BLAST analysis on NCBI, and it was found that it was different from the currently known gene sequences. Strain preservation

The Fusarium proliferat m Nirenberg ECU 2002 of the present invention was deposited on October 17, 2005 at the General Microbiology Center of the China Microbial Culture Collection Management Committee (Beijing, China) under the number CGMCC 1494.

Applicant or Agent File No. 074483 PCW0 International Application No. Note on Microbial Deposits

 (Rule 13 bis)

 A. Description of the microorganisms described in the _ 14 _ page, page _ 6-8 _ of the instructions

 B. Deposits

 Name of the depository unit China Microbial Culture Collection Management Committee General Microbiology Center (CGMCC) Depository Address

 (including zip code and country name) China, Beijing 100080

 Institute of Microbiology, Chinese Academy of Sciences Preservation Date October 17, 2005 Deposit No. CGMCC 1494

C. Supplementary explanation (if necessary) Supplementary page in this column □

D. This note is for the following designated countries (if the description is not for all designated countries)

E. Supplementary explanation (if necessary)

The following instructions will then be provided to the International Bureau (write the type of description, eg: "The number of the deposit")

Filled in by the receiving office, filled in by the International Bureau

□ This page has been received with the international application. □ The International Bureau received the date of this page:

 Authorized official

 PCT/R0/134 (July 1992)

Claims

Rights request

1. A strain of Fusarium proliferatum Nirenberg ECU2002 producing L-endo-hydrolase, deposited under CGMCC 1494.

 The Fusarium bacterium according to claim 1, wherein the bacterium contains a DNA having the nucleotide sequence shown in positions 86 to 1206 of SEQ ID NO: 1.

 3. A method for preparing a chiral hydroxy acid using the Fusarium proliferatum Nirenberg ECU 2002 of claim 1, comprising the steps of:

 (1) cultivating the Fusarium proliferatum Nirenberg ECU2002 to obtain a culture;

 (2) The culture of the step (1) or an extract thereof is contacted with a racemic chiral lactone substrate to hydrolyze (-)-lactone to form a (+)-hydroxy acid.

 4. The method of claim 3, wherein

 In the step (1), the Fusarium sp. 3⁄4sar/w proliferatum Nirenberg ECU2002 is fermented in a medium containing carbon, nitrogen, phosphorus and an inorganic salt to obtain a culture;

 In the step (2), the culture obtained in the step (1) or the extract thereof is used as a catalyst to catalyze enantioselective hydrolysis of the lactone substrate, and the remaining (+)-lactone which is not hydrolyzed is removed to obtain a (+)-hydroxy acid formed by hydrolysis of (-)-lactone;

The lactone substrate includes: β-butyrolactone, α-hydroxy-γ-butyrolactone, _α -hydroxy-β, β-dimethyl-γ-butyrolactone, α-acetyl-γ- Butyrolactone, β-hydroxy-γ-butyrolactone, n-butylphthalide.

5. The method according to claim 4, wherein the composition and concentration of the medium are as follows: glycerol 10 to 50 g/L, peptone l 20 g/L, yeast paste 1 to 20 g/L , ammonium nitrate 1~10 g/L, inorganic salt: NaCl 0.1~2 g/L; MgSO ₄ '7H ₂ O 0.1~ ₂ g/L; FeSO ₄ '7H ₂ O 0.01~0.05 g/L; ZnSO ₄ ' 7H ₂ O 0.01~0.05 g/L; CuSO ₄ '5H ₂ O 0.001-0.01 g/L;

 6. The method according to claim 4, wherein the fermentation conditions are:

 pH 5~9, temperature 25~35. C, the inoculum based on the volume of the fermentation medium is 1 to 10% by volume, and the fermentation time is 12-48 ho.

7. The method according to claim 4, wherein the concentration of the lactone substrate is from 1 to 75% by weight, and the catalyst is used in an amount of from 0.25 to 1.5 g/g based on the weight of the substrate lactone. Ester or 0.25~10 unit enzyme / gram lactone, the reaction temperature is 25~40. C, pH 6.0-8.0, reaction time is 0.1~40 h.

8. The method according to claim 4, wherein the catalyst is in any one of the following forms:

 (1) Mycelium collected by centrifugation or filtration after the Fusarium ECU2002 is cultured in liquid or solid;

 (2) The fermentation supernatant remaining after removing the cells;

 (3) crushing the mycelium by grinding or homogenizing, and extracting the obtained cell-free extract with water or buffer;

 (4) Immobilized cells or immobilized enzymes.

 9. The method according to claim 3, further comprising, after the step (2), dehydrating and ring-closing the (+)-hydroxy acid under acidic conditions to obtain a (-)-lactone.

 The use of Fusarium according to claim 1, which is for producing a L-lactone hydrolase.