WO2008034177A1 - Equine performance test - Google Patents

Equine performance test Download PDF

Info

Publication number
WO2008034177A1
WO2008034177A1 PCT/AU2007/001379 AU2007001379W WO2008034177A1 WO 2008034177 A1 WO2008034177 A1 WO 2008034177A1 AU 2007001379 W AU2007001379 W AU 2007001379W WO 2008034177 A1 WO2008034177 A1 WO 2008034177A1
Authority
WO
WIPO (PCT)
Prior art keywords
converting enzyme
seq
angiotensin converting
intron
animal
Prior art date
Application number
PCT/AU2007/001379
Other languages
French (fr)
Inventor
Natasha Anne Ellis
Herman W. Raadsma
Imke Tammen
Original Assignee
The University Of Sydney
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from AU2006905157A external-priority patent/AU2006905157A0/en
Application filed by The University Of Sydney filed Critical The University Of Sydney
Priority to AU2007299578A priority Critical patent/AU2007299578B2/en
Priority to NZ576349A priority patent/NZ576349A/en
Publication of WO2008034177A1 publication Critical patent/WO2008034177A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/34—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase
    • C12Q1/37—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase involving peptidase or proteinase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/16—Primer sets for multiplex assays
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/172—Haplotypes

Definitions

  • the present invention relates to genetic markers and to methods of using such markers as a prognostic indicator of the health and performance of horses. More particularly the present invention relates to methods and kits for determining markers as a prognostic indicator of health and/or physical performance in horses.
  • polymorphisms in the equine ACE gene are associated with athletic performance. These polymorphisms can be used to create a diagnostic DNA test to identify horses that have a better genetic potential than others to perform certain physical tasks.
  • the whole coding sequence and the majority of the non-coding nucleotide sequences of the gene for equine ACE has been obtained for the first time, and this will provide a fundamental platform for the discovery of additional polymorphisms within this gene which can be linked to health and performance traits.
  • an isolated polynucleotide comprising an equine angiotensin converting enzyme gene having at least one of the following characteristics: (a) a polynucleotide comprising the nucleotide sequence as shown in SEQ ID NO:
  • an isolated polynucleotide encoding a polypeptide having the activity of equine angiotensin converting enzyme, wherein said polynucleotide shares at least 90% identity with the nucleotide sequence as shown in SEQ ID NO: 2, or encodes a polypeptide comprising an amino acid sequence which shares at least 90% identity with the amino acid sequence as shown in SEQ ID NO: 3.
  • a polynucleotide according to the first or second aspect may comprise a polymorphism.
  • the polymorphism may be associated with level of expression of an angiotensin converting enzyme gene in a subject, level of angiotensin converting enzyme activity in a subject, or both level of expression of an angiotensin converting enzyme gene and level of angiotensin converting enzyme activity in a subject.
  • an isolated nucleic acid molecule capable of hybridising to the polynucleotide of the first aspect under stringent conditions.
  • an isolated nucleic acid molecule suitable as a probe or as a primer for specific amplification of at least a portion of the polynucleotide of the first aspect.
  • the nucleic acid molecule may hybridise to an intronic region of the equine angiotensin converting enzyme gene.
  • the intronic region may be intron 16 of equine angiotensin converting enzyme gene, and the nucleic acid molecule may be selected from the following:
  • the nucleic acid molecule may comprise a nucleotide sequence as shown in any one of SEQ ID Nos: 5 to 18. In a more specific embodiment may comprise a nucleotide sequence as shown in any one of SEQ ID Nos: 7 to 12, 15 or 16, and in a more specific embodiment the nucleic acid molecule may comprise a nucleotide sequence as shown in any one of SEQ ID Nos: 9 to 12.
  • an oligonucleotide primer pair suitable for amplification of a region of the equine angiotensin converting enzyme gene comprising a forward primer and a reverse primer comprising nucleotide sequences as respectively shown in: SEQ ID Nos: 5 and 6; SEQ ID Nos: 7 and 8; SEQ ID Nos: 9 and 10; SEQ ID Nos: 11 and 12; SEQ ID Nos: 13 and 14; SEQ ID Nos: 15 and 16; or SEQ ID Nos: 17 and 18.
  • the oligonucleotide primer pair may be suitable for amplification of at least a portion or all of intron 16 of the equine angiotensin converting enzyme gene, wherein said oligonucleotide primer pair comprises a forward primer and a reverse primer comprising nucleotide sequences as shown in SEQ ID Nos: 9 and 10 respectively or as shown in SEQ ID Nos: 11 and 12 respectively.
  • the oligonucleotide primer pair may be suitable for amplification of at least a portion of intron 8 of the equine angiotensin converting enzyme gene, wherein said oligonucleotide primer pair comprises a forward primer and a reverse primer comprising nucleotide sequences as shown in SEQ ID Nos: 7 and 8 respectively.
  • the oligonucleotide primer pair may be suitable for amplification of at least a portion of intron 21 of the equine angiotensin converting enzyme gene, wherein said oligonucleotide primer pair comprises a forward primer and a reverse primer comprising nucleotide sequences as shown in SEQ ID Nos: 15 and 16 respectively.
  • a nucleic acid or oligonucleotide primer pair may hybridise with at least a portion of a polynucleotide according to the first or second aspect which comprises a polymorphism.
  • the nucleic acid or oligonucleotide pair may hybridise with at least a portion of intron 8, intron 16, intron 21, or any combination thereof, of the equine angiotensin converting enzyme gene.
  • the polymorphism may be associated with level of expression of an angiotensin converting enzyme gene in a subject, level of angiotensin converting enzyme activity in a subject, or both level of expression of an angiotensin converting enzyme gene and level of angiotensin converting enzyme activity in a subject.
  • the polymorphism may be selected from any one of the following polymorphisms or a combination thereof: A -» G at nucleotide 25 of intron 5;
  • G - A at nucleotide 160 of exon 26. and in a specific embodiment may be selected from any one of the following polymorphisms, or any combination thereof:
  • the polymorphism may be associated with a haplotype which is associated with level of expression of an angiotensin converting enzyme gene in a subject, level of angiotensin converting enzyme activity in a subject, or both level of expression of an angiotensin converting enzyme gene and level of angiotensin converting enzyme activity in a subject.
  • the polymorphism is associated with a haplotype selected from haplotypes 1 , 6 or 7 as described herein.
  • the present invention also provides a genetic marker for distinguishing animals that have a trait associated with health or physical performance, wherein said marker is a polymorphism in a polynucleotide according to the first or second aspects described above.
  • the genetic marker may comprise a polymorphism as described above.
  • the marker may comprise a polymorphism in intron 8, intron 16, intron 20 or intron 21 of the equine angiotensin converting enzyme gene, as described above.
  • the marker may comprise a polymorphism in intron 16 of the equine angiotensin converting enzyme gene, as described above.
  • the marker may be associated with level of expression of an angiotensin converting enzyme gene in a subject, level of angiotensin converting enzyme activity in a subject, or both level of expression of an angiotensin converting enzyme gene and level of angiotensin converting enzyme activity in a subject.
  • the marker may be associated with a haplotype which is associated with level of expression of an angiotensin converting enzyme gene in a subject, level of angiotensin converting enzyme activity in a subject, or both level of expression of an angiotensin converting enzyme gene and level of angiotensin converting enzyme activity in a subject.
  • the marker is associated with a haplotype selected from haplotypes 1, 6 or 7 as described herein.
  • a method for detecting at least one polymorphism in an angiotensin converting enzyme gene comprising analysing at least a portion of said angiotensin converting enzyme gene using at least one nucleic acid molecule according to the third or fourth aspects or at least one oligonucleotide primer pair according to the sixth aspect to detect the presence or absence of said at least one polymorphism.
  • the angiotensin converting enzyme gene may be an equine angiotensin converting enzyme gene.
  • a method for selecting an animal using marker assisted selection comprising:
  • the genetic marker may be a marker according to the invention as described above.
  • a method for breeding an animal using marker assisted selection comprising:
  • the genetic marker may be a marker according to the invention as described above.
  • the nucleic acid molecule, or member of an oligonucleotide primer pair may be any size suitable for specific hybridisation to a target nucleotide sequence under stringent conditions, and may comprise from about 15 nucleotides to about 100 nucleotides, but may more typically be from about 15 to about 30 nucleotides in length.
  • the method comprises amplifying at least a portion of said angiotensin converting enzyme gene using said at least one nucleic acid molecule or said at least one oligonucleotide primer pair, and analysing the amplification product or products to detect the presence or absence of said at least one polymorphism.
  • Said at least one nucleic acid molecule may comprise two nucleic acid molecules, one being a primer specific for the equine angiotensin converting enzyme gene, and the other being specific for a known polymorphic allele.
  • the at least one nucleic acid molecule may comprise a nucleotide sequence as shown in any one of SEQ ID Nos: 5 to 18, or the forward primer and reverse primer of the at least one oligonucleotide primer pair may comprise nucleotide sequences as respectively shown in: SEQ ID Nos: 5 and 6; SEQ ID Nos: 7 and 8; SEQ ID Nos: 9 and 10; SEQ ID Nos: 11 and 12; SEQ ID Nos: 13 and 14; SEQ ID Nos: 15 and 16; or SEQ ID Nos: 17 and 18.
  • the region of the angiotensin converting enzyme gene to be amplified may comprise at least a portion of one or more of intron 8, intron 16, intron 20 or intron 21, or non-equine equivalent thereof, of said gene in combinations with other variants as identified here.
  • a method of the invention may comprise amplifying at least a portion of one or more of intron 8, intron 16 or intron 21, or non-equine equivalent thereof, of an angiotensin converting enzyme gene using an oligonucleotide primer pair comprising a forward primer and a reverse primer suitable for said amplification, wherein the forward primer and a reverse primer of said at least one oligonucleotide primer pair comprise nucleotide sequences as respectively shown in: SEQ ID Nos: 7 and 8; SEQ ID Nos: 9 and 10; SEQ ID Nos: 11 and 12; SEQ ID Nos: 13 and 14; or SEQ ID Nos: 15 and 16..
  • the oligonucleotide primer pair may comprise a forward primer and a reverse primer comprising the nucleotide sequences as shown in SEQ ID Nos: 9 and 10 respectively or as shown in SEQ ID Nos: 11 and 12 respectively.
  • a method of the invention may comprise detecting a haplotype which is associated with level of expression of an angiotensin converting enzyme gene in a subject, level of angiotensin converting enzyme activity in a subject, or both level of expression of an angiotensin converting enzyme gene and level of angiotensin converting enzyme activity in a subject.
  • the present invention provides a method for testing a subject for a haplotype which is associated with level of expression of an angiotensin converting enzyme gene in a subject, level of angiotensin converting enzyme activity in a subject, or both level of expression of an angiotensin converting enzyme gene and level of angiotensin converting enzyme activity in a subject, said method comprising analysing an angiotensin converting enzyme gene from said subject for the presence or absence of polymorphisms by a method according to the invention and determining the haplotype of said subject based on the pattern of any polymorphisms detected.
  • the haplotype may be selected from haplotypes 1, 6 or 7 as described herein.
  • Methods of the invention may be used for predicting the physical performance of a horse encompassing but not restricted to endurance performance, sprint performance, racing performance, and common sport performance associated with sporthorses.
  • predisposition or susceptibility to EIPH exercise induced pulmonary haemorrhage
  • other factors regulating blood pressure and related physiological factors such as circulating ACE level, blood pressure regulators
  • the diagnostic is also prospective for health related indicators in the horse.
  • a method of predicting the health or physical performance of an animal comprising: analyzing a nucleic acid sample from said animal for the presence of at least one polymorphism in the equine angiotensin converting enzyme gene of said horse, wherein the polymorphism is predictive of the physical performance of the horse.
  • the polymorphism may be located in one or more of intron 8, intron 16, intron 20 or intron 21 of the equine angiotensin converting enzyme gene.
  • the method may comprise: isolating from said horse a polynucleotide comprising at least a portion of the equine angiotensin converting enzyme gene known to harbour at least one polymorphic site associated with health or physical performance potential of a horse; amplifying at least a portion of said polynucleotide comprising said at least one polymorphic site; and analysing the amplification product or products for the presence or absence of a polymorphism associated with health or physical performance of a horse.
  • the portion of the equine angiotensin converting enzyme gene is selected from at least a portion of intron 8, intron 16, intron 21 or any combination thereof.
  • said at least a portion of the equine angiotensin converting enzyme gene may be amplified using an oligonucleotide primer pair comprising nucleotide sequences as respectively shown in: SEQ ID Nos: 7 and 8; SEQ ID Nos: 9 and 10; SEQ ID Nos: 11 and 12; SEQ ID Nos: 13 and 14; or SEQ ID Nos: 15 and 16, or any combination thereof.
  • the presence of a G— >A polymorphism at nucleotide 178 of SEQ ID NO:4, a G— »T polymorphism at nucleotide 1513 of SEQ ID NO: 4, or combined G- ⁇ A polymorphism at nucleotide 178 and G ⁇ T polymorphism at nucleotide 1513 of SEQ ID NO:4 is indicative of health or physical endurance performance of a horse.
  • the presence of a G ⁇ T polymorphism at nucleotide 146 of intron 8, a G ⁇ A ⁇ C polymorphism at nucleotide 58 of intron 20, a C ⁇ A polymorphism at nucleotide 39 of intron 21, or a combination of said polymorphisms is indicative of health or physical endurance performance of a horse.
  • a method of the invention may comprise detecting a haplotype which is associated with level of expression of an angiotensin converting enzyme gene in a subject, level of angiotensin converting enzyme activity in a subject, or both level of expression of an angiotensin converting enzyme gene and level of angiotensin converting enzyme activity in a subject.
  • the haplotype may be selected from haplotypes 1, 6 or 7 as described herein.
  • the equine angiotensin converting enzyme gene may be analysed by any suitable method known in the art, including the following methods: electromobility shift assays (EMSA); polymerase chain reaction (PCR) followed by sequence analysis; polymerase chain reaction (PCR) followed by restriction endonuclease digestion and gel electrophoresis; polymerase chain reaction (PCR) followed by heteroduplex analysis; microsphere hybridisation; or real-time PCR allelic discrimination assays and any other commonly known methods to detect variation in DNA level or gene products (including but not restricted to mRNA and protein molecules) encoded by such gene variants.
  • ESA electromobility shift assays
  • PCR polymerase chain reaction
  • PCR polymerase chain reaction
  • PCR polymerase chain reaction
  • PCR polymerase chain reaction
  • PCR polymerase chain reaction
  • PCR polymerase chain reaction
  • PCR polymerase chain reaction
  • PCR polymerase chain reaction
  • PCR polymerase chain reaction
  • PCR polymerase chain reaction
  • kits for assessing the health or physical performance potential of an animal comprising at least one nucleic acid molecule according to the third or fourth aspect, as previously described above or at least one oligonucleotide primer pair according to the fifth aspect, as also previously described above, and instructions for using said at least one nucleic acid molecule, or said at least one oligonucleotide primer pair for detection of at least one polymorphism in the angiotensin converting enzyme gene which is associated with physical performance potential of said animal.
  • the kit may comprise at least an oligonucleotide primer pair comprising a forward primer and a reverse primer comprising nucleotide sequences as respectively shown in: SEQ ID Nos: 7 and 8; SEQ ID Nos: 9 and 10; SEQ ID Nos: 11 and 12; SEQ ID Nos: 13 and 14; or SEQ ID Nos: 15 and 16, or any combination thereof.
  • the kit comprises at least the following oligonucleotide primer pairs comprising forward primer and reverse primers respectively: SEQ ID Nos: 7 and 8; SEQ ID Nos: 9 and 10; SEQ ID Nos: 11 and 12;
  • a kit according to the invention may be adapted to detect one or more genetic haplotypes which are associated with level of expression of an angiotensin converting enzyme gene in a subject, level of angiotensin converting enzyme activity in a subject, or both level of expression of an angiotensin converting enzyme gene and level of angiotensin converting enzyme activity in a subject.
  • the one or more haplotypes may selected from haplotypes 1, 6 or 7 as described herein.
  • the kit may be for predicting the physical performance of a horse.
  • the kit may be for predicting the genetic predisposition of a horse to exercise induced pulmonary haemorrhage.
  • a method for predicting the physical performance of a subject by detecting the level of expression of an angiotensin converting enzyme gene in said subject comprising detecting angiotensin converting enzyme-encoding mRNA in a sample derived from said subject using at least one nucleic acid or at least one oligonucleotide primer pair according to the invention, or any combination thereof.
  • the subject may be a horse.
  • a method for predicting s the genetic predisposition of a subject to exercise induced pulmonary haemorrhage by detecting the level of expression of an angiotensin converting enzyme gene in said subject, said method comprising detecting angiotensin converting enzyme-encoding mRNA in a sample derived from said subject using at least one nucleic acid or at least one oligonucleotide primer pair according to the invention, or any combination thereof.
  • Theo subject may be a horse.
  • a method for reducing the level of expression of an angiotensin converting enzyme gene in a subject, the level of angiotensin converting enzyme activity in a subject, or both level of expression of an angiotensin converting enzyme gene and level of angiotensin converting enzyme activitys in a subject comprising administering to said subject an effective amount of a substance capable of interfering with transcription of the angiotensin converting enzyme gene.
  • the substance may be any suitable substance capable of reducing expression of the ACE gene.
  • the substance comprises a polynucleotide or oligonucleotide complementary to at least a portion of the polynucleotide according to the0 first or second aspects.
  • the polynucleotide or oligonucleotide may be complementary to at least a portion of SEQ ID NO: 4, may be and oligonucleotide comprising any one of SEQ ID NOs: 9 to 12, any one of SEQ ID NOs: 19 to 21, or an oligonucleotide complementary thereto, and may be an antisense polynucleotide or oligonucleotide, or may comprise siRNA.
  • methods according to this aspect may beS for improving the endurance performance of said subject, or for preventing exercise induced pulmonary haemorrhage in said subject.
  • the subject may be a horse.
  • a system for predicting the health or physical performance of an animal comprising means for analyzing a nucleic acid sample from said animal for the presence of at least one genetic0 marker in the angiotensin converting enzyme gene, wherein said genetic marker is predictive of the health or physical performance of said animal.
  • the system may comprise a kit according to the invention as described above.
  • the genetic marker may be a genetic marker according to the invention as described herein.
  • the subject may be a horse.
  • a system for selecting an animal using marker assisted selection comprising: (a) means for analyzing a nucleic acid sample from said animal for the presence of at least one genetic marker in the angiotensin converting enzyme gene, wherein said genetic marker is predictive of the health or physical performance of said animal; and (b) means for selecting said animal based on the presence or absence of the genetic marker.
  • the system may comprise a kit according to the invention as described above.
  • the genetic marker may be a genetic marker according to the invention as described herein.
  • the subject may be a horse.
  • a system for breeding an animal using marker assisted selection comprising:
  • the system may comprise a kit according to the invention as described above.
  • the genetic marker may be a genetic marker according to the invention as described herein.
  • the subject may be a horse.
  • Figure 1 shows the genomic sequence (SEQ ID NO:1) of the equine ACE gene including primer positions for amplification of the gene and screening for polymorphisms. Exonic sequence is shown in upper case and intronic sequence in lower case. Primers and direction thereof are indicated with sequence targeted by the primers being indicated in white text on black background. Sequence changes are highlighted in bold, larger type, with the alternative allele(s) above or below the base change. Underlined areas indicate sequence that was screened for polymorphisms in the pools. The cDNA numbering is shown in brackets for each exon, with the first base of the start codon(s) numbered 1. The lengths of exons 1, 13 and 26 have been predicted according to alignments with known exons from other species and were not confirmed with cDNA analysis.
  • Figure 2 shows the equine somatic ACE coding sequence (SEQ ID NO:2). Putative and confirmed exon/intron boundaries are marked. Areas underlined indicate regions confirmed with cDNA analysis.
  • the equine somatic ACE amino acid sequence (SEQ ID NO:3) is also shown, numbered from the leucine residue predicted to be at the 5' end of the mature ACE protein, which is preceded by a putative 36 residue signal peptide. The position of exon 13 in the testicular transcript is indicated.
  • the TATAA box, start codon, stop codon, and the first polyadenylation signal are also indicated in white text on black background.
  • Figure 3 shows the nucleotide sequence determined for intron 16 of the equine ACE gene (SEQ ID NO:4), including polymorphic sites (sequence changes are highlighted in bold, larger type, with the alternative allele(s) above or below the base change). Sequence that is highly homologous in the horse and human is indicated in bold capitals. An 18 nucleotide stretch within this homologous region (indicated in bold capital text on grey background) has been found to be fully conserved across the equine, human, rat and mouse ACE gene intron 16 sequences.
  • Potential binding sites for the Broad Complex 2 (AAATAGAA), and the Hepatocyte nuclear factor-3 / Fork head Homologue (HFH-3) transcription factors (AAATAAACAGGA) are underlined.
  • base pair means a pair of nitrogenous bases, each in a separate nucleotide, in which each base is present on a separate strand of DNA and the bonding of these bases joins the component DNA strands.
  • a DNA molecule contains four bases; A (adenine), G (guanine), C (cytosine), and T (thymidine).
  • a and G are purine bases, typically designated by the letter “R”
  • C and T are pyrimidine bases, typically designated by the letter "Y”. Where A or T may occupy a single position it is typically designated by the letter W. Where G or C may occupy a single position it is typically designated by the letter S.
  • a or C may occupy a single position it is typically designated by the letter M.
  • G or T may occupy a single position it is typically designated by the letter K.
  • A, T or C may occupy a single position it is typically designated by the letter H.
  • G, C or T may occupy a single position it is typically designated by the letter B.
  • G, A or T may occupy a single position it is typically designated by the letter D.
  • G, C or A may occupy a single position it is typically designated by the letter V.
  • G, C, A or T may occupy a single position it is typically designated by the letter N.
  • base pair is abbreviated to "bp”
  • kilobase pair is abbreviated to kb.
  • the term “comprising” means “including principally, but not necessarily solely”. Variations of the word “comprising”, such as “comprise” and “comprises”, have correspondingly similar meanings.
  • the term “genetic marker” refers to a variant or polymorphism at DNA sequence level linked to a specific chromosomal location unique to an individual's genotype, inherited in a predictable manner, and measured as a direct DNA sequence variant or polymorphism, such as at least one Single Nucleotide Polymorphism (SNP), Restriction Fragment Length Polymorphism (RFLP), or Short Tandem Repeat (STR), or as measured indirectly as a DNA sequence variant (eg.
  • SNP Single Nucleotide Polymorphism
  • RFLP Restriction Fragment Length Polymorphism
  • STR Short Tandem Repeat
  • a marker can also be a variant at the level of a DNA derived product such as RNA polymorphism/abundance, protein polymorphism or cell metabolite polymorphism, or any other biological characteristics which have a direct relationship with the underlying DNA variants or gene product,
  • genotyp means the genetic constitution of an organism. This may be considered in total, or as in the present application, with respect to the alleles of a single gene (that is, at a given genetic locus). Accordingly, the term “homozygote” refers to an organism that has identical alleles at a given locus on homologous chromosomes, whereas the term “heterozygote” refers to an organism in which different alleles are found on homologous alleles for a given locus.
  • the term "horse” includes all domesticated and wild horse members of the family Equidae. but with particular emphasis on domesticated breeds including Thoroughbreds, Arabians, Quarterhorses, Standardbreds, Warmbloods, stock horses, sport horses, draught horses, and any hybrid thereof.
  • modifying component in the context of the present invention means any component added to a nucleic acid molecule so as to enable or facilitate detection or analysis of a product of the interaction of the nucleic acid molecule with another nucleic acid molecule, or any other entity.
  • a modifying component may, for example, comprise a further nucleotide sequence which is readily recognisable by a processing enzyme, binding entity or other.
  • a modifying component may be a component which results in physical parameters of the interaction product which allow for physical distinction from other molecules or components in a mixture comprising said interaction product, such as mass, size, melting temperature, and/or charge, or may be a label (fluorescent, antibody, antigen, charged, radioactive, and the like), which may be attached to, or be incorporated in one or more nucleotides of the nucleic acid molecule.
  • polypeptide means a polymer made up of amino acids linked together by peptide bonds.
  • polypeptide and protein are used interchangeably herein, although for the purposes of the present invention a “polypeptide” may constitute a portion of a full length protein.
  • polynucleotide refers to a single- or double-stranded polymer of deoxyribonucleotide, ribonucleotide bases or known analogues or natural nucleotides, or mixtures thereof.
  • primer means a single-stranded oligonucleotide capable of acting as a point of initiation of template-directed DNA synthesis.
  • An "oligonucleotide” is a single-stranded nucleic acid typically ranging in length from 2 to about 500 bases. The precise length of a primer will vary according to the particular application, but typically ranges from 15 to 30 nucleotides. A primer need not reflect the exact sequence of the template but must be sufficiently complementary to hybridize to the template.
  • protein proteins
  • polypeptide polypeptide
  • polynucleotide polynucleotide
  • nucleic acid fragments and variants thereof, including but not limited to reverse compliment and antisense forms of polynucleotides and nucleic acids.
  • portion when used in relation to a polynucleotide refers to a constituent of a polynucleotide.
  • the portion may possess qualitative biological activity in common with the polynucleotide.
  • portions of a polynucleotide do not necessarily need to encode polypeptides which retain biological activity. Rather, a portion may, for example, be useful as a hybridization probe or PCR primer, or be a target for detection and/or amplification by such a probe or PCR primer.
  • the portion may be derived from a polynucleotide of the invention or alternatively may be synthesized by some other means, for example chemical synthesis.
  • restriction enzyme as used herein means an endonuclease enzyme that recognises and cleaves a specific sequence of DNA (recognition sequence).
  • single nucleotide polymorphisms or "SNP” or “SNPs”, as used herein, refers to common DNA sequence variations among subjects.
  • the DNA sequence variation is typically a single base change or point mutation resulting in genetic variation between individuals.
  • the single base change can be an insertion or deletion of a base.
  • variant refers to substantially similar sequences. Generally, polynucleotide sequence variants possess qualitative biological activity in common. Further, these polynucleotide sequence variants may share at least 90%, 95%, 96%, 97%, 98% or 99% sequence identity. Detailed Description of the Invention
  • Angiotensin-converting enzyme is an important part of the Renin-Angiotensin System (RAS), and is specifically involved in increasing blood pressure during conditions of physiological demand.
  • RAS Renin-Angiotensin System
  • the RAS is the primary endocrine system responsible for regulating blood pressure by influencing vascular tone and electrolyte-fluid homeostasis.
  • the components of this system are angiotensinogen, renin, angiotensins I and II, and angiotensin-converting enzyme.
  • Aldosterone release- Stimulate salt and water homeostasis Increase thirst Vasodilation, endothelial and Increase muscle glucose cardiac growth
  • Renin an enzyme synthesized in the kidneys (Gomez, R. A., et al (1990), "Molecular biology of the renal renin-angiotensin system", Kidney International 38(Supp 30): S- 18- S23), catalyzes the proteolytic conversion of angiotensinogen (a large globular protein derived from the liver (Morris, BJ. et al (1979), "Localization of angiotensinogen in rat liver by immunocytochemistry", Endocrinology 105(3): 796-800) to angiotensin I.
  • Angiotensin I is the precursor to the octapeptide angiotensin II, which acts through many pathways to regulate volume homeostasis.
  • angiotensin I The conversion of angiotensin I to angiotensin II is catalyzed by ACE in the pulmonary vasculature (Campbell, D.J. (1985), "The site of angiotensin production", Journal of Hypertension 3: 199-207).
  • a dipeptidyl carboxy peptidase this enzyme hydrolyses dipeptides from the COOH-terminus of polypeptides (Peach, M.J. (1977), "Renin- angiotensin system: Biochemistry and mechanisms of action", Physiological Reviews 57(2): 313-70; Morris, BJ.
  • Angiotensin II is a potent vasoconstrictor that also stimulates the proliferation of smooth muscle cells, whilst ACE itself inhibits the vasodilator bradykinin (Erdos, E.a.S., R. A. (1987), "The angiotensin I-converting enzyme", Laboratory Investigation 56: 345-48; Griendling, K..K. et al (1993), "Molecular biology of the renin-angiotensin system", Circulation 87(6): 1816-28).
  • Angiotensin II also stimulates aldosterone secretion, increasing sodium resorption in the cells and thereby increasing the amount of water reabsorbed by the body to increase blood volume (Gomez et al. (1990), Kidney International 38(Supp 30): S-18- S23).
  • a lesser action of angiotensin II is to increase water consumption by stimulating thirst (Fitzsimons, J.T. (1978), "Angiotensin, thirst, and sodium appetite: Retrospect and prospect", Federation Proceedings 37: 2669-75).
  • I/D insertion/deletion polymorphism in intron 16 (a non-protein coding region) of the human ACE gene has been associated with elite endurance performance in human athletes.
  • Both the full genomic sequence and the coding sequence may be used as basis for the design of suitable oligonucleotides for detection of the ACE gene and polymorphisms thereof, for design of antisense or small interfering RNA molecules for regulation of ACE expression in subjects, or in recombinant techniques for the purpose of, for example, genetic modification of non-human animals incorporating but not restricted to transgenic, gene therapy, DNA vaccination and cell or /stem cell mediated treatments.
  • haplotypes Nine of the polymorphisms occur in more than one individual, and are inherited in patterns known as haplotypes, which have been studied in a panel of horses of different breeds.
  • the breeds included were the Thoroughbred, which has been created for high speed (gallop) racing; Arabians, which were selected as those that successfully race in endurance events of over 100 kms; Standardbreds, a breed derived to race at the slightly slower gait of the pace or trot, in addition to pulling a small, light cart, as well as Draught horses, which originated to perform heavy slow (pulling) work.
  • At least 2 of the polymorphisms have been identified as possibly having an effect on the regulatory function of the ACE gene and thus affect observed circulating levels of the enzyme.
  • These two polymorphisms occur within intron 16 of the ACE gene, a G- ⁇ A transition at nucleotide 178 of intron 16 (SEQ ID NO:4), and a G— >T transition at nucleotide 1513 of intron 16.
  • a highly conserved region comprising a putative regulatory module has been identified within this intron that has an effect on circulating enzyme levels.
  • At least this identified haplotype is responsible for a 10% decrease in circulating ACE levels in the horse.
  • the G178 ⁇ A and G1513 ⁇ T intron 16 equine ACE gene polymorphisms result in reduced circulatory levels of ACE in horses and are associated with athletic performance. At least these markers can therefore be used to create a diagnostic DNA test to identify horses that have a better genetic potential than others to perform on the racetrack.
  • these markers, and others identified during these studies, or which may be identified using the sequences and teachings of the present disclosure may also find use in tests predictive of other physical traits in horses, as direct (causing differences in gene expression or function) or indirect (not causative polymorphisms but physically near the causative polymorphism) genetic markers for a number of traits which affect equine performance.
  • intron 8 amplifiable by primer pair SEQ ID Nos: 7 and 8, actual sequence in SEQ ID No 1
  • intron 20 amplifiable by primer pair SEQ ID Nos: 13 and 14, actual sequence in SEQ ID No 1
  • intron 21 amplifiable by primer pair SEQ ID Nos: 15 and 16, actual sequence in SEQ ID No 1 specifically and in addition to those listed in Table 1.
  • haplotype comprising these three polymorphisms was found to have a significant association with circulating ACE levels in horses (heterozygous haplotype being indicative of lower circulating ACE levels, and homozygous haplotype being indicative of higher circulating ACE levels).
  • Table 10 A series of nucleotide variants describing commonly observed haplotype variants is shown in Table 10 (in the examples). Variants are not restricted to these variants only, but highlight the range of variation observed.
  • nucleotide 25 of intron 5 A- ⁇ -G nucleotide 146 of intron 8 G ⁇ T
  • nucleotide 89 of intron 16 SEQ ID NO:4 C->G
  • nucleotide 58 of intron 20 G ⁇ A ⁇ C nucleotide 115 of intron 20 G ⁇ T
  • nucleotide 39 of intron 21 C->A nucleotide 160 of exon 26 G->A (also known as G3872A or Argl255His), and the polymorphic number of A nucleotides residing between positions 494 and 510 within intron 14.
  • One genetic test contemplated by the present invention is one that predicts the type of racing a horse is best suited to.
  • EIPH exercise induced pulmonary haemorrhage
  • the present invention also contemplates using expression of the angiotensin converting enzyme as a means for diagnosing race performance and/or health of a horse.
  • a method may involve detection of ACE mRNA by any appropriate means as known in the art, for example by Northern analysis and/or PCR techniques.
  • the present invention also contemplates manipulation of the level of expression of angiotensin converting enzyme gene in a subject by genetic and/or standard therapeutic means.
  • Nucleic acid molecules for Identifying ACE gene polymorphisms are provided.
  • Nucleic acid molecules for identifying polymorphisms in the equine angiotensin- converting enzyme gene may be any appropriate sequence which is designed based on the complete equine angiotensin-converting enzyme gene as now disclosed herein (SEQ ID NO:1).
  • the nucleotide sequence of said nucleic acid molecule may be identical to, or be complementary to at least a portion of SEQ ID NO:1, or SEQ ID NO:2, and may comprise the full sequence, or complement thereof or, may comprise an oligonucleotide of from about 10 nucleotides in length to about 100 nucleotides in length, such as from about 10 to about 50 nucleotides in length, about 15 to about 100 nucleotides in length, about 15 to about 50 nucleotides in length, about 10 to about 30 nucleotides in length, or about 15 to about 30 nucleotides in length.
  • a nucleic acid molecule of the invention may comprise a nucleotide sequence designed based on the amino acid sequence of equine angiotensin-converting enzyme (SEQ ID NO:3), using degeneracy of the genetic code, and optionally preferred codon usage information. Suitable nucleic acid molecule sizes are as already discussed immediately above.
  • a nucleic acid molecule of the invention may also be a variant of either the complete equine angiotensin-converting enzyme gene or complement or portion thereof, sharing at least at least about 90% identity therewith.
  • a nucleic acid molecule of the invention may comprise a nucleotide sequence specific for a portion of the equine angiotensin-converting enzyme gene and a modifying component which enables or facilitates subsequent detection and/or analysis of a product of the interaction between the nucleic acid molecule and the target portion of the equine angiotensin-converting enzyme gene.
  • such a modifying component may allow for, or facilitate detection of a hybridised nucleotide duplex formed between the nucleic acid molecule and a target portion of the equine angiotensin-converting enzyme gene, or allow for, or facilitate amplification of a target portion of the equine angiotensin- converting enzyme gene using said nucleic acid molecule, or detection of the amplification product(s).
  • Nucleic acid sequences which may be useful for the detection of specific single nucleotide polymorphisms in the equine angiotensin-converting enzyme gene may be as shown in Table 1.
  • oligonucleotides useful as probes or amplification primers in methods or kits of the present invention are listed in Tables 4 and 7 in the examples, with modifying component, where present, indicated in lower case (plain or bold type) or upper case bold type, and methods which may be employed for their use are exemplified in Tables 5, 6 and 8 in the examples.
  • DNA from the subject to be assessed may be extracted by a number of suitable methods known to those skilled in the art. Most typically, DNA is extracted from a blood sample, and in particular from white blood cells from fresh blood samples by a method based on that of Montgomery et al (1997), Circulation 96(3): 741-47) or from whole frozen blood using a spin column extraction process, for example as described for the Body Fluid Spin Protocol in the QIAGENTM kit handbook (QIAampTM DNA Blood Mini Kit).
  • Suitable methods may involve detection of labelled hybridisation product(s) between a polymorphism-specific probe and at least a portion of the equine angiotensin-converting enzyme gene or, more typically, by amplification of at least a portion of the equine angiotensin-converting enzyme gene using either a primer and suitable probe, or using a pair of primers (forward and reverse primers) for amplification of a specific portion of the equine angiotensin-converting enzyme gene followed by either direct partial and/or complete sequencing of the amplified DNA, or RFLP analysis thereof.
  • the polymorphisms detected in these studies in the equine angiotensin-converting enzyme gene were found to be appropriately detected using PCR amplification followed by RFLP analysis, and the polymorphisms detected in introns 16 (SNP 3 - C ⁇ G; SNP 4 - G ⁇ A; and SNP 5 - G ⁇ T), 20 (SNP 6 - G ⁇ A ⁇ C; SNP 7 G ⁇ T) and 21 (SNP 8 - C ⁇ A) were appropriately detected using PCR amplification followed by genotyping the amplification products by sequencing.
  • a method suitable for the detection of a polymorphism in intron 16, intron 20, or intron 21 of the equine angiotensin-converting enzyme gene is a PCR/sequence determination analysis strategy.
  • a method suitable for the detection of a polymorphism in intron 8 of the equine angiotensin-converting enzyme gene is a PCR/RFLP analysis strategy
  • PCR reaction may be altered without affecting the ability to amplify the desired product.
  • Mg 2+ concentration and temperatures employed may be varied.
  • amount of genomic DNA used as a template may also be varied depending on the amount of DNA available.
  • the DNA may be analysed by a range of suitable methods, including electrophoresis.
  • electrophoresis a technique commonly used by those skilled in the art for separation of DNA fragments on the basis of size.
  • concentration of agarose or polyacrylamide in the gel in large part determines the resolution ability of the gel and the appropriate concentration of agarose or polyacrylamide will therefore depend on the size of the DNA fragments to be distinguished.
  • Detection and/or determination of the existence of a polymorphism may be aided by computer analysis using any appropriate software. Suitable software packages for comparison of determined nucleotide sequences are well known in the art and are readily available.
  • Methods of the invention may involve detection of a plurality of polymorphisms in the equine angiotensin-converting enzyme gene.
  • prediction of a particular phenotype potential such as endurance racing potential, may involve detection of the presence of a plurality of polymorphisms in the equine angiotensin-converting enzyme gene, including at least SNPs 4 and 5 (intron 16, position 178 G— >A and position 1513 G— >T: associated with haplotype 6), but possibly other polymorphisms, such as SNPs 2, 6 and 8 associated with haplotype 7.
  • methods of the invention may be used to detect other ACE phenotypes which may be associated with different combinations of polymorphisms, recognised groups of animals having specific combinations of polymorphisms being identified as haplotypes.
  • Kits for the detection of at least one polymorphism in the equine ACE gene and for predicting physical performance of horses are also contemplated by the present invention.
  • Kits according to the present invention may be designed specifically to enable the amplification and analysis of at least one segment of the ACE gene associated with a health or physical trait of horses.
  • the kit may be designed specifically to enable the amplification and analysis of at least one segment of intron 16 wherein, for example, the polymorphism involves SNP 4 (a G ⁇ A transition at nucleotide 178 of intron 16/SEQ ID NO:4), SNP 5 (a G ⁇ T transition at nucleotide 1513 of intron 16), or both of these transitions.
  • kits designed to enable detection of other polymorphisms as well as, or instead of these polymorphisms in intron 16 of the angiotensin-converting enzyme gene, such as SNPs 2, 6 and/or 8.
  • a kit of the invention may be designed to detect a particular equine angiotensin-converting enzyme gene haplotype in a sample. Kits able to detect at least haplotypes 1, 6 and/or 7 may be particularly suitable.
  • kits may comprise all of the following primer pairs: SEQ ID Nos: 5 and 6; SEQ ID Nos: 7 and 8; SEQ ID Nos: 9 and 10; SEQ ID Nos: 11 and 12; SEQ ID Nos: 13 and 14; SEQ ID Nos: 15 and 16; and SEQ ID Nos: 17 and 18; or a subset of these primer pairs, such as: all of SEQ ID Nos: 7 and 8, SEQ ID Nos: 9 and 10, SEQ ID Nos: 11 and 12, SEQ ID Nos: 13 and 14, and SEQ ID Nos: 15 and 16; or at least SEQ ID Nos: 9 and 10 and SEQ ID Nos: 11 and 12 (for detection of SNPs 4 and 5, and therefore presence or absence of haplotype 6); or at least SEQ ID Nos: 7 and 8, SEQ ID Nos: 13 and 14, and SEQ ID Nos. 15 and 16 (for detection of SNPs 2, 6 and 8, and therefore presence or absence of haplotype 7).
  • kits of the present invention typically include one or more primers that specifically hybridize to at least a portion of the ACE gene.
  • the primers may comprise one or more oligonucleotide primer pairs comprising forward and reverse primers specifically designed to anneal either side of the polymorphic site of interest, or may comprise a general forward or reverse primer designed to specifically hybridise with the
  • kits appropriate amounts of either the one or more oligonucleotide primer pairs, or the one or more primers and allele specific probes are provided in suitable containers.
  • the oligonucleotides may be provided suspended in an aqueous solution or as a freeze-dried or lyophilized powder, for example.
  • a kit of the invention may comprise one or more appropriately labelled oligonucleotide probes specific for particular polymorphisms.
  • a kit of the present invention includes at least two primers.
  • the appropriate sequences of the primers may vary, but primers having the sequences as shown in SEQ ID Nos: 9 to 12, for amplifying relevant portions of intron 16, are particularly suitable. Primers having the sequences as shown in SEQ ID Nos: 7, 8 and 13 to 16, which are capable of amplifying relevant portions of introns 8, 20 and 21, such as may detect haplotype 7, are also suitable.
  • a kit of the invention may comprise all, or a combination of these primer pairs.
  • the amount of each oligonucleotide supplied in the kit can be any appropriate amount, depending on the nature of the application, and would likely be an amount sufficient to prime at least several amplification reactions. A person skilled in the art would readily appreciate the appropriate amount of each nucleic acid to use in a detection reaction.
  • kits according to the present invention may also include a suitable control template molecule and/or control primers for use in a control reaction.
  • the kit may also include a sample of DNA of each genotype associated with the one or more polymorphisms to be detected.
  • a kit of the invention may comprise a sample of each of the genotypes associated with SNPs 4 and 5, such as GIG, GIG; G/A, GIG; GIG, G/A; G/A, G/A; A/A, G/G; A/A, G/A; G/G, A/A; G/A, A/A; and A/A, A/A.
  • a kit according to the present invention may additionally include other components for performing amplification reactions including, for example, DNA sample preparation reagents, appropriate buffers (e.g. polymerase buffer), salts (e.g. magnesium chloride), and deoxyribonucleotides (dNTPs).
  • the kit may further include the necessary reagents for carrying out analysis of the amplified DNA, such as an appropriate restriction enzyme, reaction buffer for restriction enzyme digestion, and reagents for use in separating digested fragments (e.g. agarose).
  • a kit may also include containers for housing the various components and instructions for using the kit components to conduct amplification reactions according to the present invention.
  • the present invention also provides methods for inhibiting the expression of the ACE gene using a transcriptional inhibitor thereof.
  • the inhibitor may be nucleic-acid based, peptide-based or other suitable chemical compound.
  • the inhibitor may be a nucleic-acid based inhibitor of expression of a polynucleotide disclosed herein or a fragment thereof.
  • Suitable molecules include small interfering RNA (siRNA) species, antisense constructs, such as antisense oligonucleotides, and catalytic antisense nucleic acid constructs.
  • Suitable molecules can be manufactured by chemical synthesis, recombinant DNA procedures or, in the case of antisense RNA, by transcription in vitro or in vivo when linked to a promoter, by methods known to those skilled in the art.
  • RNA interference RNA interference
  • Fire et al. (1998) Nature 391: 806-811; Hammond, et al (2001) Nature Rev, Genet. 2: 110-1119; Hammond et al. (2000) Nature 404: 293-296; Bernstein et al.
  • RNAi refers to a means of selective post- transcriptional gene silencing by destruction of specific mRNA by small interfering RNA molecules (siRNA).
  • siRNA is typically generated by cleavage of double stranded RNA, where one strand is identical to the message to be inactivated.
  • Double-stranded RNA molecules may be synthesised in which one strand is identical to a specific region of the mRNA transcript and introduced directly.
  • dsDNA can be employed, which, once presented intracellularly is converted into dsRNA.
  • Methods for the synthesis of suitable siRNA molecules for use in RNAi and for achieving post- transcriptional gene silencing are known to those of skill in the art.
  • the skilled addressee will appreciate that a range of suitable siRNA constructs capable of inhibiting the expression of the disclosed polynucleotides can be identified and generated based on knowledge of the sequence of the gene in question using routine procedures known to those skilled in the art without undue experimentation.
  • nucleotide sequence match there need not necessarily be 100% nucleotide sequence match between the target sequence and the siRNA sequence.
  • the capacity for mismatch is dependent largely on the location of the mismatch within the sequences. In some instances, mismatches of 2 or 3 nucleotides may be acceptable but in other instances a single nucleotide mismatch is enough to negate the effectiveness of the siRNA.
  • the suitability of a particular siRNA molecule may be determined using routine procedures known to those skilled in the art without undue experimentation.
  • Antisense constructs may be derived from various regions of the ACE gene.
  • Antisense constructs may be designed to target and bind to regulatory regions of the nucleotide sequence, such as the promoter, or to coding (exon) or non-coding (intron) sequences.
  • Contemplated herein in particular are antisense oligonucleotides targeted at intron 16, and which may be complementary for any suitable portion of intron 16 which results in reduced expression of the ACE gene.
  • Suitable targets may comprise homologous area B (SEQ ID NO.19), or any suitable sequence within homologous area A of the equine ACE gene, such as SEQ ID Nos 20 or 21 .
  • Antisense constructs of the invention may be generated which are at least substantially complementary across their length to the region of the gene in question. Binding of an antisense construct to its complementary cellular sequence may interfere with transcription, RNA processing, transport, translation and/or mRNA stability.
  • Suitable antisense oligonucleotides may be prepared by methods well known to those of skill in the art. Typically antisense oligonucleotides will be synthesized on automated synthesizers. Suitable antisense oligonucleotides may include modifications designed to improve their delivery into cells, their stability once inside a cell, and/or their binding to the appropriate target. For example, the antisense oligonucleotide may be modified by the addition of one or more phosphorothioate linkages, or the inclusion of one or morpholine rings into the backbone.
  • suitable inhibitory nucleic acid molecules may be administered in a vector.
  • the vector may be a plasmid vector, a viral vector, or any other suitable vehicle adapted for the insertion of foreign sequences and introduction into eukaryotic cells.
  • the vector is an expression vector capable of directing the transcription of the DNA sequence of an inhibitory nucleic acid molecule of the invention into RNA.
  • Viral expression vectors include, for example, epstein-barr virus-, bovine papilloma virus-, adenovirus- and adeno-associated virus-based vectors.
  • the vector is episomal. The use of a suitable episomal vector provides a means of maintaining the inhibitory nucleic acid molecule in target cells in high copy number extra-chromosomally thereby eliminating potential effects of chromosomal integration.
  • a further means of substantially inhibiting gene expression may be achieved by introducing catalytic antisense nucleic acid constructs, such as ribozymes, which are capable of cleaving RNA transcripts and thereby preventing the production of wildtype protein.
  • Ribozymes are targeted to and anneal with a particular sequence by virtue of two regions of sequence complementarity to the target flanking the ribozyme catalytic site. After binding, the ribozyme cleaves the target in a site-specific manner.
  • the design and testing of ribozymes which specifically recognize and cleave sequences of interest can be achieved by techniques well known to those in the art (for example Lieber and Strauss, (1995) MoI. Cell. Biol. 15:540-551, the disclosure of which is incorporated herein by reference).
  • polypeptides and polynucleotides disclosed herein including, for example, small molecule or other non-nucleic acid or non-proteinaceous inhibitors. Many such inhibitors are already known in the art, and additional inhibitors may be identified by those skilled in the art by screening using routine techniques.
  • the DNA samples used in this study were obtained from a number of different sources and utilized for different purposes. Table 2 outlines the origins of each group of samples as well as their uses.
  • Blood for DNA extraction was collected from the jugular vein in 1OmL glass Vacutainer tubes (Becton Dickinson) containing 15mg of EDTA to prevent coagulation. The blood was stored at 4 0 C for no longer than three days, or frozen if longer storage was required. Prior to extraction, a 600 ⁇ L aliquot was collected and stored in a 1.5mL eppendorf at - 2O 0 C as a reserve sample.
  • the blood was centrifuged in the collection tubes for 10 min at 3000 rpm, after which the serum was removed and discarded. Seven mL of cold (4 0 C) red blood cell lysis buffer (RCLB) [15OmM NH 4 Cl, 1OmM KHCO 3 and 0.ImM EDTA - pH 8.0, autoclaved] was added and the sample vortexed. The samples were centrifuged for lOmin at 3000rpm. The supernatant was poured off and 1OmL of cold (4 0 C) RCLB added, the sample thoroughly vortexed, and again centrifuged for 10 min at 3000 rpm.
  • RCLB red blood cell lysis buffer
  • TBS tris-buffered saline
  • the white cell pellets in TBS were transferred to 15mL falcon tubes. Three washes of 2mL of TBS were used to rinse the original collection tubes. The samples were vortexed to break down the cell pellets, then centrifuged at 2500rpm for 10 min.
  • the precipitated DNA was spooled out on a glass pipette, washed in 70% ethanol, and blotted dry on KimWipe tissue. It was transferred into 500 ⁇ L of sterile TE buffer in a 1.5mL eppendorf tube and placed on a mixer overnight. The samples were stored at -2O 0 C.
  • DNA was extracted from frozen blood using a QIAamp® DNA Blood Mini Kit (QIAGEN). Extraction was performed on 200 ⁇ L of blood as per manufacturers instructions following the Blood and Body Fluid Spin Protocol from the QIAGEN handbook. Basically, the red blood cells in the sample were lysed and bound to the silica- gel matrix of the spin columns by centrifugation. The bound samples were washed at least twice, and eluted into buffer or water. The samples were stored at -2O 0 C when not in use.
  • QIAamp® DNA Blood Mini Kit QIAGEN
  • Extraction was performed on 200 ⁇ L of blood as per manufacturers instructions following the Blood and Body Fluid Spin Protocol from the QIAGEN handbook. Basically, the red blood cells in the sample were lysed and bound to the silica- gel matrix of the spin columns by centrifugation. The bound samples were washed at least twice, and eluted into buffer or water. The samples were stored at -2O 0 C when not in use.
  • the blood samples were centrifuged for lOmin at 2500rpm and O 0 C, after which the buffy coats were removed and placed into 1.5mL Eppendorf tubes. Each buffy coat was split into two or three samples. Erythrocyte Lysis (EL) buffer (QIAGEN) was added to each sample at a ratio of 3 : 1. After mixing the samples by pipetting, they were centrifuged at 2000rpm and 4 0 C for lOmin. The supernatant was carefully removed and the process repeated until the cell pellets were white (3 to 4 washes).
  • EL Erythrocyte Lysis
  • the extraction protocol then followed the spin procedure of the "Animal Cells 1 extraction method" described in the RNeasy® Mini handbook, continuing on from step 2 of the protocol. Briefly, the cells were disrupted and lysed with a buffer that inactivates RNAses, allowing stabilization of the sample. Homogenization was achieved by passing the sample repeatedly through a 20-g needle fitted to an RNAse free syringe. Ethanol (70%) was added to adjust conditions for binding to the selective silica- gel matrix of the spin column. The sample was bound to the gel membrane by centrifugation through the spin column. Three washes were performed to eliminate impurities, and elution carried out in 40 ⁇ L RNase-free water into a clean 1.5mL Eppendorf tube.
  • DNA/RNA factor and dilution factors the answer being the concentration in ng/ ⁇ L.
  • DNA was diluted according to its concentration to create working solutions containing 20-30ng of DNA for PCR.
  • the RNA was then used in a reverse transcription PCR to create cDNA.
  • RT-PCR Reverse Transcriptase PCR
  • RNA samples were carried out on total RNA samples to convert RNA to cDNA.
  • Each reaction comprised of up to 2 ⁇ g of total RNA, 0.1 ⁇ g Oligo dT (Promega) and 400 ⁇ m of each dNTP, made up to a total solution of 14 ⁇ L with H 2 O incubated at 65 0 C for exactly 5min, before being immediately placed on ice.
  • Six ⁇ L of a master mix containing Ix First Strand Buffer (FSB, Invitrogen), 40 U RNAsin (Promega) and 5 U Super Script III enzyme (Invitrogen) was added to each reaction. The samples were incubated at 5O 0 C for 60min, followed by 5min at 75 0 C.
  • the cDNA was diluted to a 1 in 5 dilution and 1 ⁇ L used as a template in PCR with a total volume of 25 ⁇ L.
  • Primers were selected manually in regions of interest and evaluated for secondary structures and dimer formation using Primer Premier 5, Demo version (Premier Biosoft International) http://www.premierbiosoft.com/. Forward and reverse primers were also selected for matching melting temperatures (T m ) within pairs.
  • the M 13 tail sequence was identical to that of the corresponding M 13 -IRD primers, which were labelled with an infrared dye (IRD) of the 700 or 800 wavelengths.
  • Forward primers were ordered with a Ml 3-29 sequence and reverse primers with either M 13 -38 or M13-rev. This allowed bi-directional sequencing on the LI-COR sequencer (LI-COR).
  • IRD-Labeled primers (M13-29, -38 or -rev) as well as gene specific primers for direct BAC sequencing were provided by MWG Biotech, diluted to 200pmol/ ⁇ L with sterile TE buffer and stored at -8O 0 C.
  • Working solutions were prepared by further dilution to lpmol/ ⁇ L with sterile water and stored at -2O 0 C.
  • Standard primers were synthesized and provided lyophilized by Sigma Genosys. After arrival they were diluted to 200pmol/ ⁇ L with sterile TE buffer and stored at -2O 0 C. The stock solutions were then further diluted to 20pmol/ ⁇ L with sterile water and stored at -2O 0 C.
  • PCR Polymerase Chain Reaction
  • the PTC-100, PTC-200 and PTC-200 Gradient Cycler were used for all PCR reactions.
  • the Gradient Cycler machine was used for PCR optimization and a large proportion of the sequencing work that required the amplification of a small number of samples at different annealing temperatures.
  • the other machines were primarily used for microsatellite PCR of larger numbers of animals.
  • PCR products were cleaned up for sequencing by one of two methods.
  • the first eliminates short oligonucleotides and salts using a spin column method as per manufacturers instructions (JetQuick PCR Purification Spin Kit Genomed).
  • the PCR product is bound to the matrix of a spin column, then washed and eluted into a suitable volume of buffer or water (30-50 ⁇ L). To allow for some loss of PCR product through the washes 80-1 OO ⁇ L of sample was purified using this process.
  • the second technique uses the enzyme ExoSapIT (Amersham Pharmacia) to degrade single stranded DNA and hydrolyze surplus dNTPs when incubated.
  • PCR product (lO ⁇ L) was mixed with 2 ⁇ L of ExoSapIT was incubated for 45min at 37°C, followed by 15min at 80°C for enzyme inactivation.
  • the products analysed on the LI-COR 4200 were sequenced based on the method developed by Sanger (Sanger et al. (1977), Proceedings of the National Academy of Sciences, USA 74: 5463-67) using SequiTherm Excel II DNA sequencing kits - LC (Epicentre Technologies, catalogue numbers SE9101LC and SE9202LC) and IRD- labelled primers.
  • the type of sequencing kit used was determined by the size of the product to be sequenced, with any product over 700 base pairs analysed on a 66cm gel.
  • the IRD labelled primers used were identical to the Ml 3 tail on the primer used for PCR. Sequencing was performed either in one direction or bi-directionally, using 2 different Ml 3 primers with a 700 and 800 label respectively (LI-COR).
  • each reaction 2 ⁇ L of each ddNTP mix was placed in 4 separate wells of a 96-well PCR plate.
  • a bulk mix was made with IX buffer, either 2 ⁇ mol of IRD700 or 3pmol of IRD800 primer, 5-7 ⁇ L of purified PCR product, 4 U of SequiTherm Excel II Polymerase and water to a total volume of 17 ⁇ L.
  • Four ⁇ L of bulk mix was then added to each of the 4 wells, followed by a drop of mineral oil.
  • the sequencing cycle consisted of initial denaturation for 5min at 95 0 C, followed by 45 cycles of 95 0 C for 30s, 6Q 0 C for 15s and 7O 0 C for 60-12Os.
  • the primer Aceex26for was designed and manufactured with an IRD700 label (Millenium Science for MWG Biotech) for direct sequencing of the BAC DNA of a BAC clone comprising the equine ACE gene (801F9) using a SequiTherm Excel II (Epicentre Technologies, SE9101LC) sequencing kit.
  • IRD700 label Millenium Science for MWG Biotech
  • a SequiTherm Excel II Epicentre Technologies, SE9101LC sequencing kit.
  • approximately 0.8 ⁇ g BAC DNA, 2pmol of the IRD labelled primer and 3 ⁇ L of QIAGEN Q solution (QIAGEN) were used in the master mix.
  • intron 14 was amplified by PCR, it proved difficult to sequence.
  • a bulk mix of 1.8 ⁇ g BAC DNA and 3.2 ⁇ mol of primer AceI14rev was sent to Millennium Institute and sequenced using the BDT method.
  • PCR product and genomic DNA was visualized on 0.8 - 4% [w/w] agarose gels (Progen).
  • the gel was prepared by mixing the appropriate amount of agarose and IX TBE buffer [9OmM Tris-borate, 2mM EDTA] (Sambrook et al. 1989). The gel was cooled to approximately 5O 0 C before the addition of ethidium bromide to a final volume of 0.5 ⁇ g/mL gel. The gel was poured into a casting tray containing combs and allowed to solidify.
  • Agarose gel loading buffer (15% Ficoll Type 400 [Pharmacia], 0.25% bromophenol blue and 0.25% xylene cyanol) (3 ⁇ L) was added to 5 ⁇ L of PCR product and mixed.
  • the samples were loaded into the wells of the agarose gel in the electrophoresis tank containing IX TBE buffer.
  • a size standard was loaded to enable estimation of size and concentrations of the DNA or product.
  • the gel was electrophoresed at 10 - 12 V/cm gel to produce optimal separation of the bands.
  • the bands were illuminated using an Ultra.Lum UV trans-illuminator. Either a DS-34 Polaroid camera, 2 megapixel Kodak camera or ImageMaster VDS version 2.0 (Pharmacia Biotech) was used to document the gel. 1.10 Polyacrylamide Gel Electrophoresis (PAGE)
  • Polyacrylamide gels of three sizes were used on the LI-COR sequencer, depending on the size of product to be analysed. Most microsatellites (100 - 250bp) were visualized on 25cm long plates, whilst the longer gels were used primarily for sequencing. The 41 plates were used for sequencing of products less than 700bp, while the 66cm gel was used when the product was estimated to be over 700bp.
  • a pair of glass plates was cleaned with water and left to drain. Once dry, the plates were wiped clean with Kimwipes and 70% isopropanol. A mixture of equal parts bind silane and 10% acetic acid was prepared and applied to one plate at the area of well formation. The plates were separated with 0.25mm spacers and assembled using the provided clamps.
  • the gel for 25cm glass plates was prepared by measuring 8.4g of urea (BDH AnalaR, Merck), 4mL of 5x TBE [9OmM Tris-borate, 2mM EDTA] (S ambrook et al. 1989), 3mL of PAGE 1 Sequencing Gel Mix (19:1) (Boehringer Mannheim) and adding water to a final weight of 22.5g. The solution was mixed until the urea dissolved, then 150 ⁇ L of 10% Ammonium Persulfate (APS) (Amresco) and 15 ⁇ L of TEMED (Progen) were added. The gel solution was again thoroughly mixed and injected between the tilted plate assembly with a 5OmL syringe.
  • urea BDH AnalaR, Merck
  • 5x TBE 9OmM Tris-borate, 2mM EDTA
  • PAGE 1 Sequencing Gel Mix (19:1) (Boehringer Mannheim)
  • APS Ammonium Persulfate
  • TEMED
  • the plates were levelled and a 48 well comb inserted. A clamp was placed over the comb and the gel left to set. After 1 Vi to 2 hours the gel solidified and was placed in a 4200 LI-COR automated sequencer. Following loading of the samples the LI-COR was run at scan speed 3, 45 watts (W) and 5O 0 C, according to manufacturers instructions.
  • the 41cm gel was prepared by mixing 13. Ig of urea, 6.3mL of 5x TBE, 3.ImL of PAGE 1 Sequencing Gel Mix (19:1) and water to a final weight of 35g. After mixing 210 ⁇ L of 10% APS and 25 ⁇ L of TEMED were added. The gel was poured and run as previously described, apart from the use of a 32 well comb when appropriate and the sequencer running at 31.5W.
  • the 66cm gel was prepared by mixing 18.9g of urea, 10.8ml of 5x TBE, 3.6mL of Long
  • Ranger Acrylamide gel solution (50%) (Biowhittaker Molecular Application) and water up to a weight of 50.7g. Once the solution was mixed 30 ⁇ L of TEMED was added, followed by 300 ⁇ L of 10% APS. The solution was quickly mixed and poured as previously described, except for the use of a 32 well comb. The gel was run at 31.5W and 50 0 C as per manufacturers directions.
  • the chromatograms of the sequences were visualized using Sequencher Demo version (Gene Codes, www.genecodes.com), and manual editing performed when necessary.
  • the text files containing the sequence were analysed using a BLAST search (Altschul et al. (1990), Journal of Molecular Biology 215(3): 403-10) to confirm amplification of the target region.
  • Multiple sequences were aligned using the ClustalW program at Biomanager (Thompson J.D. et al (1994), Nucleic Acids Research 22: 4673-80; http://biomanager.angis.org.au/).
  • contigs of overlapping sequences were created using the program GeneDoc (Nicholas et al (1997), EMBO NEWS 4: 14; www.psc.edu/biomed/genedoc/) .
  • Example 2 Sequencing of the equine angiotensin-converting enzyme gene 2.1
  • Primers and procedures The sequence of the equine ACE gene was developed by designing primers based on comparative sequence information available from the human, rat, rabbit and chicken. Alignment of cDNA sequences of these species (Accession Nos: J04144, AF201332, L40175 and X62551) obtained through Genbank gave conserved regions from which primers to amplify the equine ACE gene could be designed. Primers were used originally to amplify 2 exons of genomic DNA(exons 5 and 8), from which horse specific primers were designed.
  • Table 4 lists the primer sequences and Table 5 the PCR conditions used for each primer pair to determine the sequence of the equine ACE gene.
  • Table 6 shows the primer combinations and conditions used to obtain the cDNA sequence, and
  • Table 7 shows the specific PCR primer pairs used to genotype the detected polymorphisms.
  • Ml 3 sequences Ml 3-29, -38 or -rev, Table 4
  • the Ml 3 tail sequence was identical to that of the corresponding M13-IRD primers, which were labelled with an infrared dye (IRD) of the 700 or 800 wavelengths.
  • the PCRs were performed in reactions of 25 ⁇ L containing approximately 20ng of purified DNA, 1 x PCR buffer, varying MgCl 2 concentrations (Tables 5, 6 and 7), 200mm of each dNTP, 5pmol of each primer, and 1 unit of Taq polymerase.
  • Thermocycler conditions were set to an initial denaturation of 95 0 C centigrade for 5 mins, 30 to 45 cycles (Tables 5, 6 and 7 ), of 95°C for 30s, annealing temperature for 30s (Tables 5, 6 and 7 ), 72°C for 60s, and a final extension of 5mins at 72°C.
  • Ace2int.l cacgacgttgtaaaacgacTTCATCGCTAACATTTTCTCG
  • Ace9int.l cacgacgttgtaaaacgacGCTAAATCAGCCTGTGTGC
  • Acel4int.l cacgacgttgtaaaacgacTCTTTCCCTCCTTCCCTT
  • Acel4int.3 cacgacgttgtaaaacgacCAGGCAAAGACGGCAACT
  • Acel6int.3 cacgacgttgtaaaacgacCCGAAATAAGGAGAGTGAG
  • Ace20int.l cacgacgttgtaaaacgacGCTTGCCCATTGGATTCT
  • Ace20int.3 cacgacgttgtaaaacgacGCAGTAAGGACAGCAGTT
  • Ace21sint.l cacgacgttgtaaacgacGGGATAAAGAAGGGGCAG
  • Ace23int.l cacgacgttgtaaaacgacAGCCTCAGTTTCCTCACCT
  • Ace23int.3 cacgacgttgtaaaacgacCTCCAACCACCCGCACTC
  • Ace25int.l cacgacgttgtaaaacgacCTCCCCAGTTCAGGCAT
  • Table 5 PCR conditions used to generate equine ACE sequence.
  • Details include MgCl 2 concentration, annealing temperature and the number of cycles used for each primer combination, in addition to the details of any conditions used to optimise the amplification of a single product for sequencing.
  • Table 6 PCR primers and conditions used to amplify equine ACE cDNA.
  • Table 7 Primer sequences used for PCR to screen the equine ACE gene.
  • M13 tail sequences as follows: M13-29 sequence - lower case, M 13 -38 - lower case bold; and M 13 -rev in uppercase BOLD.
  • Ace5utrfor.1 cacgacgttgtaaaacgacCTGTGAGAGCCCTGACCTAAG
  • Ace2int.1 cacgacgttgtaaaacgacTTCATCGCTAACATTTTCTCG
  • Ace5sint.l cacgacgttgtaaaacgacTCGGGAACACAGAGCACT
  • Ace6sint.2 CACCAGGGGGTCCTAAAG
  • Ace9s.l cacgacgttgtaaaacgacGACAGAAAGCGACATCAAT
  • AcelOsint.l cacgacgttgtaaacgacCTGGTTGGGCTTCTGTCC
  • Acel2s.5 cacgacgttgtaaacgacGCAAGAGGTGCTGAAGGA
  • Acel3s.3 cacgacgttgtaaaacgacTCAACCAGGGAACAACCAGC
  • Acel5int.5 cacgacgttgtaaaacgacGCCTGCTGCCTCTCTTCTT
  • Acel6int.3 cacgacgttgtaaaacgacCCGAAATAAGGAGAGTGAG
  • Acel6sint.5 cacgacgttgtaaaacgacCATCTGCTCCCTCTCCGT
  • Acel6sint.7 cacgacgttgtaaaacgacGCCCAACTCCCACATTAG
  • Acel6sint.l3 cacgacgttgtaaaacgacGCTCCTGTTCAATCTTCACC
  • Acel6sint.l5 cacgacgttgtaaaacgacCCCACCCTTTCTCCTATT
  • Ace20s.3 cacgacgttgtaaaacgacAAGCCAACTGATGGACGG
  • Ace20int.3 cacgacgttgtaaaacgacGCAGTAAGGACAGCAGTT
  • Ace21sint.l cacgacgttgtaaacgacGGGATAAAGAAGGGGCAG
  • Ace22sint.3 cacgacgttgtaaacgacACAGAGGCACAGCACGCA
  • Ace23sint.5 cacgacgttgtaaaacgacCTCCAACCACCCCACTCTC
  • Ace24sint.3 cacgacgttgtaaaacgacATGTGCCATCTCCAGTG
  • Ace25int.l cacgacgttgtaaaacgacCTCCCCAGTTCAGGCAT
  • PCR reaction was conducted in the required number of wells of a 96-well PCR plate, and overlaid with a drop of mineral oil to prevent evaporation.
  • PCR products were visualized on ethidium bromide stained 0.8-4% agarose gel before they were cleaned up for sequencing using 2 ⁇ L of the enzyme ExoSapIT (Amersham Pharmacia) for lO ⁇ L of product. This was incubated for 45min at 37°C, followed by 15min at 80 0 C for enzyme inactivation.
  • sequencing cycle consisted of initial denaturation for 5min at 95 0 C, followed by 45 cycles of 95°C for 30s, 6O 0 C for 15s and 70 0 C for 60-12Os. All sequencing products were mixed with the provided loading buffer and loaded onto a 41 or 66cm polyacrylamide gel as per manufacturers instructions. Electrophoresis and analysis was performed using a LI-COR 4200 automated sequencer.
  • the gene encoding for equine angiotensin converting enzyme was characterized by sequencing genomic and BAC DNA.
  • the entire coding sequence (4184 base pairs) of the equine ACE gene (Figure 2; SEQ ID NO:2) has been developed within 20 499 bp of surrounding sequence ( Figure 1; SEQ ID NO:1), and the putative encoded amino acid sequence determined ( Figure 2; SEQ ID NO:3).
  • the equine ACE gene contains 25 exon/intron boundaries with an average intron length of 650 bp.
  • Four introns are large (over 2 kb) and, with the exception of intron 16 ( Figure 3; SEQ ID NO:
  • the ACE gene encodes two enzymes of 1313 and
  • the nucleotide and amino acid sequences showed a high level of homology with other species. Also apparent in the equine gene was the internal level of homology, caused by the duplication of one half of the gene prior to mammalian radiation in evolution. This was seen both in the nucleotide content of the two domains of the gene, and in the exon intron structure, with exons 4 - 11 and 17 - 24 mirroring each other in size. The two active sites were also identified in the equine gene, with the C-terminal site differing slightly in sequence to all other species, although this is not thought to have an effect on the activity of the site. The high level of homology of the equine ACE enzyme with other mammalian ACE enzymes indicates that it plays a similar physiological role in all species examined. 2.2.1 Equine ACE promotors
  • Both the somatic and testicular promotors were identified within the equine sequence as containing promotor elements conserved with other species. While the actual elements regulating transcription of the somatic enzyme were not determined, two SPl elements were conserved between the horse, human, mouse and rabbit. As these elements have been shown to be functional in the human, mouse and rabbit, it is likely that they are at least partially responsible for driving transcription of equine sACE.
  • the equine tACE promotor also showed high homology to the equivalent promotor in other species, with the TTATT box and CRE-like sequence identified.
  • testis-specific cDNA was not obtained in the horse, an exon highly homologous to exon 13 was identified.
  • An ACE-like protein has been previously identified in equine testis (Dobrinski et al. (1997), Molecular Reproduction and Development 48: 251-60), and ACE activity has been measured in stallion spermatozoa, seminal plasma and testis (Ball et al (2003), Theriogenology 59: 901-14).
  • the 13 amino acids determined from the ACE-like protein (which differed slightly to other species ACE sequence) are identical to amino acids 182-194 in equine tACE. It is therefore very likely that the tACE isozyme is expressed in the horse. Sequencing of the somatic ACE cDNA confirmed that exon 13 is excluded from the somatic transcript, as is the case in the human, rabbit and mouse.
  • the sequence between 537 - 563 and 641 - 853 bp in the equine intron 16 showed 85% homology with the corresponding human intron.
  • This area includes an 18 bp region (bp 761 - 778; Figure 3) that is identical between the human, rat, mouse and equine introns. It is possible that at least part of this region is a transcriptional element, such as an enhancer or silencer. It is also possible that this region may form part of the RNA regulatory network.
  • the identification of two potential binding sites in intron 16 for transcriptional activators promotes a theory that the folly conserved 18 base sequence may play a role as a binding site for a sequence-specific transcriptional activator protein.
  • This protein could interact with the basal transcription apparatus, stimulating or blocking transcription.
  • the first site (AAATAGAA) just prior to the fully conserved 18 base sequence was recognised as a binding site for Broad complex 2 binding site.
  • This zinc-fmger protein mediates protein- to-protein interaction and drives metamorphosis in Drosophila melanogaster (Crossgrove et al. (1996), Developmental Biology 180(2): 745-58; Chen et al. (2002), Mechanisms of Development 119(2): 145-56).
  • AAAT AAACAGGA spans most of the fully conserved 18 base sequence and was identified as a Hepatocyte nuclear factor-3 / Fork head Homologue (HFH-3) binding site.
  • HH-3 Hepatocyte nuclear factor-3 / Fork head Homologue
  • Example 3 Detection of polymorphisms in the equine angiotensin-converting enzyme gene
  • the primary areas considered for screening were coding DNA, the promotor region and intron 16 ( Figure 3; SEQ ID NO:4). Although not all exons could be screened, a large amount of intronic DNA flanking the exons was included. Sequencing of pooled DNA was employed to allow screening of a larger number of animals. Polymorphisms were detected by comparing the sequencing traces of a single animal to that of 3 breed pools, composed of 10 Thoroughbreds (TB) 5 14 Arabians (AR) and 10 horses of mixed breeds (MB).
  • TB Thoroughbreds
  • AR Arabians
  • MB mixed breeds
  • Blood samples were collected and DNA extracted, as described in Example 1, from 89 racing and 3 non-racing Thoroughbreds, 14 racing Arabians, 10 non-racing Standardbreds, 10 heavy horses ⁇ 8 Clydesdales (CD) and 2 Shires (SH) ⁇ , 2 ponies and 2 Quarter Horses (QH). From these samples 3 pools of DNA were created, namely TB, AR 5 and a mixed breed pool containing 2 TBs, SBs, QHs, CDs and ponies. Additionally, samples from 10 individual horses per breed (TB, AR, SB and HH) were assembled to represent the multi-breed panel as described below.
  • the mixed breed pool was composed of 2 horses each from the following breeds: CD, SB, TB, QH and ponies. Pedigrees were not investigated to any major extent for this pool.
  • the multi -breed panel of 40 horses included 10 of the TBs and ARs used in the pools, as well as 10 HHs and 10 SBs.
  • the pedigrees of the SB horses were only available to 2 generations, and no pedigrees were available for the HHs. However, information was obtained as to each horses history (stud of origin) and animals with the least likelihood of being related were selected for inclusion in this study. 5 3.1.5 UK Thoroughbreds
  • the DNA was quantified using spectrophotometric analysis (Maniatis et al. 1982) (Bio Photometer, Eppendorf) as described in Example 1 and working solutions of 20 ng/ ⁇ L were created. To compare the quality and confirm the s concentration of the DNA samples, an aliquot of the final working solutions were run on a 1% agarose gel. PCR was performed on individual samples to ensure that amplification was consistent in all DNA samples. Once the solutions were of equal concentrations and quality, 30 ⁇ L of working solution was used from each of the animals to create the three pools. o 3.3 Primers
  • Previously generated equine sequence (Example 2 - Figure 1) and the program Primer Premier 5 were used to design primers as described in Example 1. All forward primers and most reverse primers were manufactured with an Ml 3 tail (-29 for forward primers, -38 or -rev for reverse primers) on the 5' end for sequencing. Primers were positioned tos improve the chances of discovering functional polymorphisms. The full list and positions of primers used is given in Table 8 and Figure 1 respectively.
  • PCRs were performed in 25 ⁇ L reactions containing 20 ng of genomic DNA, 1 x PCR buffer, specific MgCl 2 concentrations, 200 ⁇ M of each dNTP, 5pmol of each primer and0 IU of Tag polymerase as described in Example 1. Additives such as 1% Tween 20 and NP40 were also used as indicated to improve PCR quality. Dimethyl sulfoxide (DMSO, 4%w/v) was used in the sequencing of the 5' UTR and exon 1 as this area is GC rich.
  • DMSO dimethyl sulfoxide
  • Thermocycler conditions were an initial denaturation of 95 0 C for 5 mins, 30 to 45 cycles of 95 0 C for 30s, annealing temperature for 30s, 72 0 C for 60s, and final extension of 55 mins at 72 0 C.
  • Specific MgCl 2 concentrations, annealing temperatures, number of thermocycles and any special conditions for each primer pair are given in Table 8.
  • Example 1 Five ⁇ L of the product was added to 3 ⁇ L of loading buffer and electrophoresed before visualization on a 2% agarose gel stained with ethidium bromide (Example 1). When a single well-defined band was amplified, the product was cleaned up and sequenced as described in Example 1. All PCR products were sequenced in the 3 pools and one single animal for comparison purposes. The sequencing was either carried out on a LI-COR automated sequencer, or sent to the Millennium Institute, Westmead Hospital, NSW, Australia. Table 8: PCR conditions used to screen specific areas of the equine ACE gene for polymorphisms.
  • Details include the MgCl 2 concentration, annealing temperature, number of cycles and additives used for each primer combination.
  • Polymorphisms were identified using the program Sequencher, Demo version (Gene Codes).
  • the .scf files generated by the LI-COR sequencer and .abl files generated by the ABI sequencer were imported and aligned in Sequencher.
  • base changes could be identified as differences in the sequencing pattern.
  • Sequencing was repeated when a possible base change was identified to confirm its presence. Once a base change was verified, all the individual animals within the breed panel were genotyped to gain frequency information. Genotyping of individual animals in the multi-breed panel was byo PCR-RFLP (restriction fragment length polymorphism), fragment length analysis, and direct SNP typing as described below.
  • a polymorphism identified in intron 5 was found to eliminate an Nspl restriction site.
  • the restriction enzyme Nspl (Genesearch) was therefore used to genotype samples for the A -» G polymorphism.
  • the PCR was carried out with primers Ace5.1 and Ace5sint.2,0 2.ImM MgCl 2 , and a 35 cycle thermocycle with an annealing temperature of 59°C. Presence of the 620bp PCR product was confirmed by electrophoresis on 2% ethidium bromide stained agarose gel.
  • a polymorphism identified in intron 8 introduces a BamHI restriction site.
  • the restriction enzyme BamHI Promega was therefore used to genotype samples for the G to T polymorphism.
  • the primer combination of Acel ⁇ for and AceI8rev in the usual recipe,0 including 0.85 mM MgCl 2 and 1% Tween 20/NP40 were thermocycled with an annealing temperature of 52 0 C for 45 cycles.
  • the resultant 284 bp PCR product was digested with 8U of BamHI for 4 hrs at 37 0 C.
  • SNP 3 Intron 16 C ⁇ G
  • SNP 4 Intron 16 G ⁇ A
  • SNP 5 Intron 16 G ⁇ T
  • SNP 6 Intron 20 G ⁇ A ⁇ C
  • SNP 7 Intron 20 G ⁇ T
  • SNP 8 Intron 21 C ⁇ A
  • Animals were genotyped for these polymorphisms by partial sequencing.
  • Primer combinations were: Acel5int.5 - Acel6sintl4, Acel6int.3 -Acel6sint.8, Ace20s.3 - Ace20sint.4 and Ace20int.3 - Ace21int.2.
  • Primer sequences and PCR conditions are as described in Table 7 (Example 2) and Table 8 (Example 3) respectively.
  • a normal sequencing reaction was performed for each animal using only the nucleotides involved in the base change.
  • a repeat sequence of variable length was identified in intron 14. To determine the size of an individual's alleles, fragment length analysis was performed. A PCR was carried out containing 20ng of genomic DNA, 1 x PCR buffer, ImM MgCl 2 , 200 ⁇ M of each dNTP, 0.5pmol of IRD label, 5 pmol each of primers Acel4for(M13-29) and Acel4rev 5 and 1 U of Taq polymerase. The thermocycling conditions included a 5min initial denaturation of 95 0 C, and 40 cycles of 95 0 C for 30s, 52 0 C for 30s and 72 0 C for 60s. A final extension of 5mins at 72 0 C was performed at the end of the cycle. Three ⁇ L of the product was added to 7 ⁇ L of loading buffer and run on a 41cm 4% polyacrylamide gel on a LI-COR 4200 sequencer as described in Example 1.
  • the variant When a polymorphism occurred in a cDNA, the variant was numbered according to its position in the coding sequence, where 1 is the first base of the start codon. An amino acid exchange is also numbered accordingly, with 1 the first AA in the mature peptide. The intron number and the bases involved in the change were used to identify a sequence variant in a non-coding region.
  • the regions considered most important for screening were those that affect gene function, namely coding DNA and promotor regions.
  • the ideal length of sequence for polymorphism detection was 500 - 600bp, with the quality of sequence trace degrading in products longer than this. Since most exons were around 200bp or less, sections of intronic sequence adjacent to protein-coding exons were included in the screen, accounting for the large amount of intronic sequence studied.
  • Exons 2, 5, 6, 8, 9, 10, 11, 13, 14, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 and 26 were examined, along with the surrounding intronic regions. A number of entire introns were screened, generally those of smaller size. Intron 16 was specifically included as this is the homologous location of the I/D polymorphism described in human ACE gene. Intron 12 was screened as it contains the testicular ACE promotor.
  • SNPs 1 - 9 9 were found in more than one animal (SNPs 1 - 9, indicated in Table 9 above). These were genotyped across the panel of SB, AR, TB and heavy horses. The 62 UK TBs were also genotyped, with the results analysed further in the association study described in Example 5.
  • a G ⁇ T transversion was identified in intron 8. This variant was originally identified in the TB pool.
  • the intronic polymorphism introduces a BamHI restriction site.
  • the restriction enzyme BamHI was used to genotype samples for this polymorphism.
  • the SNP allele was at high frequency in the two TB populations (36 and 48% respectively), at a lower incidence in the Arabians (9%), and not observed in the SBs or draught horses.
  • Sequencing with BDT chemistry on the ABI sequencer indicated that the panel had alleles containing 12 - 14 A nucleotides. However, sequencing chromatograms showed some inconsistencies with the pattern seen on the gel. Although fragment length analysis indicated that the repeat was polymorphic, it is possible that the sequencing enzyme may have 'slipped' and the number of A nucleotides can not be assigned unambiguously. For this reason this polymorphism was not further investigated.
  • the first polymorphism a C -» G base change (SNP 3) was originally identified in the heterozygous form in a TB, and found to occur only in the AR and TB samples.
  • low animal numbers and SNP allele frequencies may have affected the ⁇ 2 tests.
  • the 2095 bp equine intron 16 (Figure 3; SEQ ID NO:4) contains an area of sequence that is conserved with that of the human intron. The area stretches from bp 537 - 833, (with the first bp of the intron numbered 1). Relative to this, SNP 3 is located at bp 89, SNP 4 at 178 and SNP 5 at 1513, positioning SNPs 4 and 5 on either side of the conserved region within the intron.
  • Intron 20 (SNPs 6 and 7)
  • the tri-allelic SNP only occurred in the TBs and ARs.
  • the G and A alleles are the most frequent, with the C allele the rarer allele.
  • the frequency of SNP 7 was not significantly different between the populations.
  • a C — > A transversion was identified in intron 21 in the Thoroughbred pool. As no restriction enzyme was available this SNP was genotyped by sequencing. This polymorphism was observed in all breeds except the SBs. This SNP occurred at significantly different frequencies across the breeds (P 0.000), with the UK TBs having the highest frequency of the A allele (58.9%), followed by the Australian TBs (45.8%), the ARs (25%), the HHs (5%) and the SBs (0%).
  • SNP 9 Another G -» A transition (SNP 9) was identified at position 3872 in exon 26. This variant was originally identified in the mixed breed pool.
  • This polymorphism changes a triplet codon from CGC to CAC, causing an amino acid substitution of 1255Arg -> His.
  • the restriction enzyme Acil was used to genotype this SNP.
  • the predicted pattern for the restriction digest was 100, 200 and 45 bp fragments for the wildtype and 100 and 245 bp for the SNP.
  • an additional band was present at around 185 bp in all samples, and a fragment of approximately 60 bp also occurred only in the samples containing the A allele.
  • haplotypes were generated from the genotyping data derived from the multi-breed panel. The data was analysed using the program PHASE version 2.0.2 (Stephens et al. (2001), American Journal of Human Genetics 68: 978-89; Stephens et al. (2003), American Journal of Human Genetics 73: 1162-69), available at www.stat.washington.edu/stephens/software.html. This assigned the most likely haplotype combinations for individual polymorphisms screened in the population. 4.3.1 Statistical analyses for SNP frequency comparisons
  • haplotypes From the 80 possible haplotype representations, seven non-unique haplotypes were identified.
  • One haplotype (Hl) was represented 47 times, two (H6 and H7) 7 times, one (H2) 6 times, one (H9) 5 times, two (H5 and H8) 3 times and 2 (H3 and H4) were observed only once.
  • haplotypes 7 and 9 are thus associated with performance on a breed level.
  • Haplotype 6 was found at a frequency of around 5% in racing Thoroughbreds in a separate association study described further below. However, in a group of Arabian horses specifically selected for their excellent endurance racing records, this haplotype was found at the higher frequency of 15%. The frequency of this haplotype was also higher (10%) in the Standardbreds (which generally run in longer races than most Thoroughbreds) and Draught horses (which have been developed for heavy slow endurance work).
  • Genotyping was performed on the identified samples in the tails as described in Examples 1 and 3.
  • the cell fractions of the samples were extracted as described in Example 1 using a QIAamp® DNA Blood Mini Kit.
  • the horses were genotyped for the following SNPs: SNP 1 (intron 5 A ⁇ G), SNP 2 (intron 8 G ⁇ T), SNPs 3, 4 and 5 (intron 16 C ⁇ G, G ⁇ A, G ⁇ T), SNPs 6 and 7 (intron 20 G ⁇ A- ⁇ C and G ⁇ T), SNP 8 (intron 21 C ⁇ A) and SNP 9 (exon 26 3872G ⁇ A).
  • the primer sequences and PCR conditions are listed in Tables 7 and 8, and PCRs were performed as described in Examples 1 and 3.
  • the samples were genotyped either by sequencing or RFLP.
  • SNPs 1, 2 and 9 were genotyped using restriction digests as described in Example 3. The remaining 6 polymorphisms could not be genotyped with a restriction enzyme, so sequencing was used as described in Example 3. Partial sequencing using the nucleotides coding for the SNP was used to genotype SNPs 3, 4, 5 and 8. SNPs 6 and 7. A mix of 5.7 ⁇ L of water, 3.2pmol of primer and 6 ⁇ L of cleaned up product was sequenced using 'Big-Dye' Terminator (BDT) chemistry version 3.1 on an ABI PRISM 3100 Genetic Analyzer (Applied Biosystems).
  • BDT 'Big-Dye' Terminator
  • haplotype 6 Following the association of haplotype 6 with low enzyme levels in the preliminary analysis of the tailed samples, the remaining 141 horses were genotyped for this haplotype. This involved SNPs 4 and 5, which were genotyped using microsphere based technology. Samples containing 30 ⁇ L of 10-25 ng/ ⁇ L DNA samples were sent to Genera Biosystems, Bundoora, Australia, in 96-well plates. Equine DNA for optimisation was supplied along with SNP allele and surrounding sequence information. Multiplex PCR was used to amplify the regions surrounding the two SNPs simultaneously; using phosphorylated forward primers and unmodified reverse primers.
  • the unincorporated primers were removed from the PCR mix by digestion with Exonuclease I, before the forward strand was degraded by digestion with Lamda Exonuclease, which specifically digests dsDNA with a 5' phosphate group.
  • the remaining reverse single stranded DNA from each individual product was bound to AmpaSandTM microspheres (beads) and hybridized with equimolar amounts of f ⁇ uorescently labelled allele specific probes.
  • the beads were analysed by flow cytometry (Becton-Dickenson FACSArray) and ShowPlots software (Genera Biosystems) was used to determine the individual genotypes. 5.5 Statistical analysis
  • Age was the only other environmental factor measured that had a significant effect on ACE expression, with both a higher mean level and greater within group variation at a younger age (Coomer et al. 2003).
  • Phase 2.02 identified 5 haplotypes, all with a phase probability of 100%.
  • Table 11 Characteristics of the 5 haplotypes within the subgroups of horses with high and low plasma ACE levels. The distribution of the haplotypes is shown across 62 horses within the high and low tails. The results of ⁇ 2 tests for association between haplotype and ACE levels are shown with significance achieved at 0.05 and indicated in bold text.
  • haplotypes 1 and 7 were associated with ACE levels, which were 3.6 to 4.0 units lower in animals heterozygous for either haplotype 1 or 7, compared to (homozygous) horses with 0 or 2 copies of haplotypes 1 or 7.
  • Table 12 Estimated deviation from mean ACE level for 0, 1 or 2 copies of each haplotype based on the fitted mixture distribution model.
  • the mean ACE level on residuals indicates the mean ACE level of the individuals with a particular haplotype compared to the mean residual ACE level (0 units) of the whole group.
  • the likelihood test statistic and corresponding P-value is given for each test. Significance is achieved at 0.05, with significant values indicated in bold text.
  • haplotype 6 Following the identification of haplotype 6 by ⁇ 2 and mixture model analysis as a potential molecular marker for low ACE levels, the remaining 141 samples were genotyped for the two SNPs that comprise this haplotype (SNPs 4 and 5 in intron 16). These samples were genotyped using the microsphere hybridisation method described previously. A total of 192 horses were genotyped by this method, including 51 that had been previously genotyped. For the intron 16 G ⁇ A SNP, 94.3% of samples were successfully genotyped, which increased to 99.0% for the intron 16 G ⁇ T SNP. AU samples were genotyped for at least one SNP and the 51 repeated results were in agreement.
  • the SNPs were in Hardy- Weinberg equilibrium and in complete linkage for the 194 horses that were typed for both sites.
  • the 9 horses that were missing a result for one SNP were designated the haplotype inferred by the typed polymorphism as they were assumed to be in complete linkage disequilibrium.
  • Haplotype 6 was present 19 times in the UK population (frequency of 4.68%). 0 5.6.7 Association analysis of haplotype 6
  • Table 13 Distribution of haplotype 6 shown with mean residual ACE activity and standard deviation (SD). Mean residual ACE and SD are not applicable for the horse0 homozygous for haplotype 6 as it has a sample size of one.
  • haplotypes 1, 7 and 9 were common to both the Australian and UK TB populations, while 3 and 6 were found only in the UK group.
  • a further haplotype (H8) was identified in the Australian TBs but not seen in the UK group. The difference in haplotype distribution between the two populations is likely to be due to local breeding trends.
  • Haplotype 6 was identified as associated with ACE levels in preliminary analysis of the tails and the mixed model distribution.
  • the predictions of the mixture model were confirmed by genotyping the remaining individuals for this H6, with the actual size of the effect (13.01 units decrease compared to residual mean of 0 units) shown to be very similar to the mixture model prediction (14.25 units decrease). This shows that the preliminary analysis and mixture model distribution was an accurate and cost effective alternative to genotyping all individuals for all SNPs.
  • the microsphere genotyping system gave results for just over 96% of individuals. These horses were allocated the haplotype inferred by the genotyped SNPs, which is justified by the complete linkage disequilibrium (LD) of the 2 SNPs in 204 TBs (194 UK and 10 Aust). The 3 instances where the 2 SNPs were not in complete LD were in Standardbreds, a breed that has been developed from a more diverse genetic base than the Thoroughbred. The two breed populations have been separated by the introduction of closed studbooks for over 200 years.
  • LD linkage disequilibrium
  • haplotype 6 Since only one horse was homozygous for H6, assessment of this genotype effect was impossible due to the lack of replicates, and this animal was omitted from the analysis. However, it is important to note that if this horse were left in the analysis, the haplotype would account for only 0.24% less of the total variation than the effect seen when excluding this animal. It is presumed that the low number of horses homozygous for this haplotype is due to the overall low frequency of the haplotype in the population (just under 5%) and a significantly greater and preferably unbiased sample of horses is required to study the full effect of genotype on circulating ACE level.
  • the two SNPs defining haplotype 6 are positioned at bp 178 and 1513 within the 2095 bp equine intron 16 (Figure 3).
  • This intron comprises a region of 222 bases from 537 - 853bp in the equine gene which shares significant homology with the human, rat and mouse ACE gene intron 16 sequences, including a fully conserved 18 base sequence (positions 761-778 of SEQ ID NO:4). Relative to this, the position of the human I/D insertion polymorphism is equivalent to base 1446 in the equine intron 16.
  • this area may encode for a transcription regulatory module.
  • the conserved 18 base sequence corresponds to a likely binding site of transcription factor Hepatocyte nuclear factor-3 / Fork head Homologue (HFH-3). It has been proposed that this factor interacts with the basal transcription mechanism through physical proximity of the supercoiled structure of the DNA helix.
  • polymorphisms flanking the putative regulatory module that are associated with variation in equine ACE levels are therefore of specific interest. Either of these SNPs may change the tertiary structure of the intronic DNA, or might affect binding of other transcription factors to the site, modulating the effect of the potential regulatory unit by altering the binding pattern.
  • Haplotype 1 contains the wildtype alleles at all polymorphic sites, while haplotype 7 consists of SNPs in introns 8, 20 (SNP 6, A allele) and 21, and there is no obvious molecular explanation for the effects seen in the heterozygotes of these haplotypes. However, the most likely reason for this observation is the small sample number.
  • Table 14 shows that a larger number of horses classed as having high ACE activity are homozygous for haplotypes 1 and 7 (18), compared to the low group (10). Concurrently, there are 22 heterozygotes in the low group, including 11 1,7 individuals. This distribution may have occurred by chance, and the typing of more individuals is required to determine whether there is a real effect of either haplotypes 1 or 7 on enzyme IQYGL

Abstract

The present invention provides an isolated polynucleotide comprising an equine angiotensin converting enzyme gene having at least one of the following characteristics: (a) a polynucleotide comprising the nucleotide sequence as shown in SEQ ID NO:1 or its complement; (b)a polynucleotide located on equine chromosome ECA I lpl3, and comprising at least about 23000 nucleotides; or (c) a polynucleotide sharing at least 90% identity with the nucleotide sequence of (a) or (b), as well as the enzyme's coding nucleotide sequence, and the putative amino acid sequence of the encoded enzyme. Also provided are methods and materials for detecting polymorphisms in angiotensin converting enzyme genes, which may be used in methods for predicting the health or performance potential of animals. These methods may be used for selecting and/or breeding animals.

Description

Equine Performance Test
Field of the Invention
The present invention relates to genetic markers and to methods of using such markers as a prognostic indicator of the health and performance of horses. More particularly the present invention relates to methods and kits for determining markers as a prognostic indicator of health and/or physical performance in horses.
Background to the Invention
The horse industry is one of the largest industries in Australia, contributing an estimated $6.2 billion per annum to the economy. In Australia over 18 000 Thoroughbred foals are born from 30 000 broodmares each year. Horse racing enthusiasts have long been fascinated with the inheritance of racing ability in racehorses. Although they rarely recoup their purchase prices on the racetrack, the yearlings with the most fashionable pedigrees are often sold for inflated prices - upwards of $A1 million dollars - with the belief that they will always be valuable for their breeding potential. In spite of this being the basis of the thoroughbred breeding industry, little is known about the inheritance of the characteristics that make a racehorse successful.
Due to the large amount of money involved in horse breeding, it would be desirable to develop a genetic test that could predict the type of racing or work a horse is best suited to. This would allow planned breeding and the selection of mates for breeding stock, the identification of superior animals for specific tasks/characteristics (either in selection of yearlings to buy or as selection of which colts to leave as entires and which to geld), and in the creation of specific, individually designed training programs that are tailored to genetic potential of individual horses. Similarly the global interest in sporting performance (harness racing, polo, endurance riding, showjumping, dressage for instance) relies on elite athletic performance in competitive settings. Thus, it is an object of the present invention to provide a genetic test which is predictive of horse physical performance, and to provide materials and kits for this purpose.
Summary of the Invention
It has now been found that polymorphisms in the equine ACE gene are associated with athletic performance. These polymorphisms can be used to create a diagnostic DNA test to identify horses that have a better genetic potential than others to perform certain physical tasks. In the course of these studies, the whole coding sequence and the majority of the non-coding nucleotide sequences of the gene for equine ACE has been obtained for the first time, and this will provide a fundamental platform for the discovery of additional polymorphisms within this gene which can be linked to health and performance traits. Thus, according to a first aspect of the invention, there is provided an isolated polynucleotide comprising an equine angiotensin converting enzyme gene having at least one of the following characteristics: (a) a polynucleotide comprising the nucleotide sequence as shown in SEQ ID
NO:1 or its complement;
(b) a polynucleotide located on equine chromosome ECA I lpl3, and comprising at least about 23000 nucleotides;
(c) a polynucleotide sharing at least 90% identity with the nucleotide sequence of (a) or (b).
According to a second aspect of the invention, there is provided an isolated polynucleotide encoding a polypeptide having the activity of equine angiotensin converting enzyme, wherein said polynucleotide shares at least 90% identity with the nucleotide sequence as shown in SEQ ID NO: 2, or encodes a polypeptide comprising an amino acid sequence which shares at least 90% identity with the amino acid sequence as shown in SEQ ID NO: 3.
A polynucleotide according to the first or second aspect may comprise a polymorphism. The polymorphism may be associated with level of expression of an angiotensin converting enzyme gene in a subject, level of angiotensin converting enzyme activity in a subject, or both level of expression of an angiotensin converting enzyme gene and level of angiotensin converting enzyme activity in a subject.
According to a third aspect of the invention, there is provided an isolated nucleic acid molecule capable of hybridising to the polynucleotide of the first aspect under stringent conditions.
According to a fourth aspect, there is provided an isolated nucleic acid molecule suitable as a probe or as a primer for specific amplification of at least a portion of the polynucleotide of the first aspect.
In an embodiment of the third or fourth aspects, the nucleic acid molecule may hybridise to an intronic region of the equine angiotensin converting enzyme gene. The intronic region may be intron 16 of equine angiotensin converting enzyme gene, and the nucleic acid molecule may be selected from the following:
(a) intron 16 of the horse angiotensin converting enzyme or complement thereof;
(b) a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 4 or complement thereof; (c) a polynucleotide comprising at least 15 contiguous nucleotides of (a) or (b)
; and
(d) a polynucleotide sharing at least 90% identity with the nucleotide sequence of (a). (b) or (c).
A nucleic acid molecule according to this embodiment may also comprise at least:
(a) the nucleotide sequence of nucleotides 761-778 of SEQ ID No: 4;
(b) a nucleotide sequence complementary to (a); or
(c) a polynucleotide sharing at least 90% identity with the nucleotide sequence of (a) or (b).
In another embodiment of the third or fourth aspects, the nucleic acid molecule may comprise a nucleotide sequence as shown in any one of SEQ ID Nos: 5 to 18. In a more specific embodiment may comprise a nucleotide sequence as shown in any one of SEQ ID Nos: 7 to 12, 15 or 16, and in a more specific embodiment the nucleic acid molecule may comprise a nucleotide sequence as shown in any one of SEQ ID Nos: 9 to 12.
According to a fifth aspect of the invention, there is provided an oligonucleotide primer pair suitable for amplification of a region of the equine angiotensin converting enzyme gene, comprising a forward primer and a reverse primer comprising nucleotide sequences as respectively shown in: SEQ ID Nos: 5 and 6; SEQ ID Nos: 7 and 8; SEQ ID Nos: 9 and 10; SEQ ID Nos: 11 and 12; SEQ ID Nos: 13 and 14; SEQ ID Nos: 15 and 16; or SEQ ID Nos: 17 and 18. In a more specific embodiment, the oligonucleotide primer pair may be suitable for amplification of at least a portion or all of intron 16 of the equine angiotensin converting enzyme gene, wherein said oligonucleotide primer pair comprises a forward primer and a reverse primer comprising nucleotide sequences as shown in SEQ ID Nos: 9 and 10 respectively or as shown in SEQ ID Nos: 11 and 12 respectively.
In another specific embodiment of the invention, the oligonucleotide primer pair may be suitable for amplification of at least a portion of intron 8 of the equine angiotensin converting enzyme gene, wherein said oligonucleotide primer pair comprises a forward primer and a reverse primer comprising nucleotide sequences as shown in SEQ ID Nos: 7 and 8 respectively.
In another specific embodiment of the invention, the oligonucleotide primer pair may be suitable for amplification of at least a portion of intron 21 of the equine angiotensin converting enzyme gene, wherein said oligonucleotide primer pair comprises a forward primer and a reverse primer comprising nucleotide sequences as shown in SEQ ID Nos: 15 and 16 respectively. A nucleic acid or oligonucleotide primer pair may hybridise with at least a portion of a polynucleotide according to the first or second aspect which comprises a polymorphism. The nucleic acid or oligonucleotide pair may hybridise with at least a portion of intron 8, intron 16, intron 21, or any combination thereof, of the equine angiotensin converting enzyme gene. The polymorphism may be associated with level of expression of an angiotensin converting enzyme gene in a subject, level of angiotensin converting enzyme activity in a subject, or both level of expression of an angiotensin converting enzyme gene and level of angiotensin converting enzyme activity in a subject. The polymorphism may be selected from any one of the following polymorphisms or a combination thereof: A -» G at nucleotide 25 of intron 5;
G -> T at nucleotide 146 of intron 8;
Poly A insertion between nucleotides 494 and 495 of intron 14;
C -» G at nucleotide 89 of intron 16;
G ->■ A at nucleotide 178 of intron 16; G -» T at nucleotide 1513 of intron 16;
G — » A — » C at nucleotide 58 of intron 20;
G -> T at nucleotide 115 of intron 20;
C — » A at nucleotide 39 of intron 21; and
G -» A at nucleotide 160 of exon 26. and in a specific embodiment may be selected from any one of the following polymorphisms, or any combination thereof:
G -> T at nucleotide 146 of intron 8;
G -> A at nucleotide 178 of intron 16;
G → T at nucleotide 1513 of intron 16; G -> A -» C at nucleotide 58 of intron 20; and
C -» A at nucleotide 39 of intron 21.
The polymorphism may be associated with a haplotype which is associated with level of expression of an angiotensin converting enzyme gene in a subject, level of angiotensin converting enzyme activity in a subject, or both level of expression of an angiotensin converting enzyme gene and level of angiotensin converting enzyme activity in a subject. According to a specific embodiment the polymorphism is associated with a haplotype selected from haplotypes 1 , 6 or 7 as described herein.
The present invention also provides a genetic marker for distinguishing animals that have a trait associated with health or physical performance, wherein said marker is a polymorphism in a polynucleotide according to the first or second aspects described above. The genetic marker may comprise a polymorphism as described above. In a specific embodiment, the marker may comprise a polymorphism in intron 8, intron 16, intron 20 or intron 21 of the equine angiotensin converting enzyme gene, as described above. In an even more specific embodiment, the marker may comprise a polymorphism in intron 16 of the equine angiotensin converting enzyme gene, as described above. The marker may be associated with level of expression of an angiotensin converting enzyme gene in a subject, level of angiotensin converting enzyme activity in a subject, or both level of expression of an angiotensin converting enzyme gene and level of angiotensin converting enzyme activity in a subject. In addition, the marker may be associated with a haplotype which is associated with level of expression of an angiotensin converting enzyme gene in a subject, level of angiotensin converting enzyme activity in a subject, or both level of expression of an angiotensin converting enzyme gene and level of angiotensin converting enzyme activity in a subject. In a specific embodiment, the marker is associated with a haplotype selected from haplotypes 1, 6 or 7 as described herein.
According to a sixth aspect of the invention, there is provided a method for detecting at least one polymorphism in an angiotensin converting enzyme gene, said method comprising analysing at least a portion of said angiotensin converting enzyme gene using at least one nucleic acid molecule according to the third or fourth aspects or at least one oligonucleotide primer pair according to the sixth aspect to detect the presence or absence of said at least one polymorphism. The angiotensin converting enzyme gene may be an equine angiotensin converting enzyme gene.
According to another aspect of the invention, there is provided a method for selecting an animal using marker assisted selection, wherein said method comprises:
(a) analysing a nucleic acid sample from said animal for the presence of at least one genetic marker in the angiotensin converting enzyme gene, wherein the genetic marker is predictive of health or physical performance of an animal; and
(b) selecting an animal based on the presence or absence of said genetic marker or markers. The genetic marker may be a marker according to the invention as described above.
According to another aspect of the invention, there is provided a method for breeding an animal using marker assisted selection, wherein said method comprises:
(a) analyzing a nucleic acid sample from said animal for the presence of at least one genetic marker in the angiotensin converting enzyme gene, wherein the genetic marker is predictive of health or physical performance of an animal;
(b) breeding from said animal based on the presence or absence of said genetic marker; and (c) selecting progeny of said animal based on the presence or absence of said genetic marker. The genetic marker may be a marker according to the invention as described above.
While it is contemplated that the methods of the present invention will find most application in the field of equine genetics, it is also contemplated that the methods of the present invention will readily extend to animals beyond horses, and especially to donkeys, mules and members of the Camellidae, such as camels.
The nucleic acid molecule, or member of an oligonucleotide primer pair, may be any size suitable for specific hybridisation to a target nucleotide sequence under stringent conditions, and may comprise from about 15 nucleotides to about 100 nucleotides, but may more typically be from about 15 to about 30 nucleotides in length.
In an embodiment, the method comprises amplifying at least a portion of said angiotensin converting enzyme gene using said at least one nucleic acid molecule or said at least one oligonucleotide primer pair, and analysing the amplification product or products to detect the presence or absence of said at least one polymorphism. Said at least one nucleic acid molecule may comprise two nucleic acid molecules, one being a primer specific for the equine angiotensin converting enzyme gene, and the other being specific for a known polymorphic allele.
In an embodiment of a method of the invention, the at least one nucleic acid molecule may comprise a nucleotide sequence as shown in any one of SEQ ID Nos: 5 to 18, or the forward primer and reverse primer of the at least one oligonucleotide primer pair may comprise nucleotide sequences as respectively shown in: SEQ ID Nos: 5 and 6; SEQ ID Nos: 7 and 8; SEQ ID Nos: 9 and 10; SEQ ID Nos: 11 and 12; SEQ ID Nos: 13 and 14; SEQ ID Nos: 15 and 16; or SEQ ID Nos: 17 and 18.
According to another embodiment of a method of the invention, the region of the angiotensin converting enzyme gene to be amplified may comprise at least a portion of one or more of intron 8, intron 16, intron 20 or intron 21, or non-equine equivalent thereof, of said gene in combinations with other variants as identified here.
Thus, a method of the invention may comprise amplifying at least a portion of one or more of intron 8, intron 16 or intron 21, or non-equine equivalent thereof, of an angiotensin converting enzyme gene using an oligonucleotide primer pair comprising a forward primer and a reverse primer suitable for said amplification, wherein the forward primer and a reverse primer of said at least one oligonucleotide primer pair comprise nucleotide sequences as respectively shown in: SEQ ID Nos: 7 and 8; SEQ ID Nos: 9 and 10; SEQ ID Nos: 11 and 12; SEQ ID Nos: 13 and 14; or SEQ ID Nos: 15 and 16.. In a specific embodiment the oligonucleotide primer pair may comprise a forward primer and a reverse primer comprising the nucleotide sequences as shown in SEQ ID Nos: 9 and 10 respectively or as shown in SEQ ID Nos: 11 and 12 respectively.
According to this embodiment, a method of the invention may comprise detecting a haplotype which is associated with level of expression of an angiotensin converting enzyme gene in a subject, level of angiotensin converting enzyme activity in a subject, or both level of expression of an angiotensin converting enzyme gene and level of angiotensin converting enzyme activity in a subject. Thus, the present invention provides a method for testing a subject for a haplotype which is associated with level of expression of an angiotensin converting enzyme gene in a subject, level of angiotensin converting enzyme activity in a subject, or both level of expression of an angiotensin converting enzyme gene and level of angiotensin converting enzyme activity in a subject, said method comprising analysing an angiotensin converting enzyme gene from said subject for the presence or absence of polymorphisms by a method according to the invention and determining the haplotype of said subject based on the pattern of any polymorphisms detected. The haplotype may be selected from haplotypes 1, 6 or 7 as described herein.
Methods of the invention may be used for predicting the physical performance of a horse encompassing but not restricted to endurance performance, sprint performance, racing performance, and common sport performance associated with sporthorses. In addition, predisposition or susceptibility to EIPH (exercise induced pulmonary haemorrhage ) as well as other factors regulating blood pressure and related physiological factors (such as circulating ACE level, blood pressure regulators) may be predicted from variants within the ACE gene, and therefore the diagnostic is also prospective for health related indicators in the horse.
Thus, according to another embodiment of the sixth aspect, there is provided a method of predicting the health or physical performance of an animal, wherein said method comprises: analyzing a nucleic acid sample from said animal for the presence of at least one polymorphism in the equine angiotensin converting enzyme gene of said horse, wherein the polymorphism is predictive of the physical performance of the horse.
The polymorphism may be located in one or more of intron 8, intron 16, intron 20 or intron 21 of the equine angiotensin converting enzyme gene.
The method may comprise: isolating from said horse a polynucleotide comprising at least a portion of the equine angiotensin converting enzyme gene known to harbour at least one polymorphic site associated with health or physical performance potential of a horse; amplifying at least a portion of said polynucleotide comprising said at least one polymorphic site; and analysing the amplification product or products for the presence or absence of a polymorphism associated with health or physical performance of a horse.
In this embodiment the portion of the equine angiotensin converting enzyme gene is selected from at least a portion of intron 8, intron 16, intron 21 or any combination thereof.
According to another embodiment, said at least a portion of the equine angiotensin converting enzyme gene may be amplified using an oligonucleotide primer pair comprising nucleotide sequences as respectively shown in: SEQ ID Nos: 7 and 8; SEQ ID Nos: 9 and 10; SEQ ID Nos: 11 and 12; SEQ ID Nos: 13 and 14; or SEQ ID Nos: 15 and 16, or any combination thereof.
In a method according to the invention for predicting the physical performance potential of a horse, the presence of a G— >A polymorphism at nucleotide 178 of SEQ ID NO:4, a G— »T polymorphism at nucleotide 1513 of SEQ ID NO: 4, or combined G-→A polymorphism at nucleotide 178 and G→T polymorphism at nucleotide 1513 of SEQ ID NO:4 is indicative of health or physical endurance performance of a horse.
According to another embodiment, the presence of a G→T polymorphism at nucleotide 146 of intron 8, a G→A→C polymorphism at nucleotide 58 of intron 20, a C→A polymorphism at nucleotide 39 of intron 21, or a combination of said polymorphisms is indicative of health or physical endurance performance of a horse.
According to another embodiment, a method of the invention may comprise detecting a haplotype which is associated with level of expression of an angiotensin converting enzyme gene in a subject, level of angiotensin converting enzyme activity in a subject, or both level of expression of an angiotensin converting enzyme gene and level of angiotensin converting enzyme activity in a subject. According to another embodiment the haplotype may be selected from haplotypes 1, 6 or 7 as described herein.
In the methods of the sixth aspect, the equine angiotensin converting enzyme gene may be analysed by any suitable method known in the art, including the following methods: electromobility shift assays (EMSA); polymerase chain reaction (PCR) followed by sequence analysis; polymerase chain reaction (PCR) followed by restriction endonuclease digestion and gel electrophoresis; polymerase chain reaction (PCR) followed by heteroduplex analysis; microsphere hybridisation; or real-time PCR allelic discrimination assays and any other commonly known methods to detect variation in DNA level or gene products (including but not restricted to mRNA and protein molecules) encoded by such gene variants.
According to another aspect of the invention, there is provided a kit for assessing the health or physical performance potential of an animal, said kit comprising at least one nucleic acid molecule according to the third or fourth aspect, as previously described above or at least one oligonucleotide primer pair according to the fifth aspect, as also previously described above, and instructions for using said at least one nucleic acid molecule, or said at least one oligonucleotide primer pair for detection of at least one polymorphism in the angiotensin converting enzyme gene which is associated with physical performance potential of said animal.
In an embodiment of a kit of the invention, the kit may comprise at least an oligonucleotide primer pair comprising a forward primer and a reverse primer comprising nucleotide sequences as respectively shown in: SEQ ID Nos: 7 and 8; SEQ ID Nos: 9 and 10; SEQ ID Nos: 11 and 12; SEQ ID Nos: 13 and 14; or SEQ ID Nos: 15 and 16, or any combination thereof.
According to an embodiment, the kit comprises at least the following oligonucleotide primer pairs comprising forward primer and reverse primers respectively: SEQ ID Nos: 7 and 8; SEQ ID Nos: 9 and 10; SEQ ID Nos: 11 and 12;
SEQ ID Nos: 13 and 14; and SEQ ID Nos: 15 and 16.
A kit according to the invention may be adapted to detect one or more genetic haplotypes which are associated with level of expression of an angiotensin converting enzyme gene in a subject, level of angiotensin converting enzyme activity in a subject, or both level of expression of an angiotensin converting enzyme gene and level of angiotensin converting enzyme activity in a subject. According to an embodiment, the one or more haplotypes may selected from haplotypes 1, 6 or 7 as described herein.
According to another embodiment, the kit may be for predicting the physical performance of a horse.
According to another embodiment, the kit may be for predicting the genetic predisposition of a horse to exercise induced pulmonary haemorrhage.
According to another aspect of the invention, there is provided a method for predicting the physical performance of a subject by detecting the level of expression of an angiotensin converting enzyme gene in said subject, said method comprising detecting angiotensin converting enzyme-encoding mRNA in a sample derived from said subject using at least one nucleic acid or at least one oligonucleotide primer pair according to the invention, or any combination thereof. The subject may be a horse.
According to another aspect of the invention, there is provided a method for predicting s the genetic predisposition of a subject to exercise induced pulmonary haemorrhage by detecting the level of expression of an angiotensin converting enzyme gene in said subject, said method comprising detecting angiotensin converting enzyme-encoding mRNA in a sample derived from said subject using at least one nucleic acid or at least one oligonucleotide primer pair according to the invention, or any combination thereof. Theo subject may be a horse.
According to another aspect of the invention, there is provided a method for reducing the level of expression of an angiotensin converting enzyme gene in a subject, the level of angiotensin converting enzyme activity in a subject, or both level of expression of an angiotensin converting enzyme gene and level of angiotensin converting enzyme activitys in a subject, said method comprising administering to said subject an effective amount of a substance capable of interfering with transcription of the angiotensin converting enzyme gene. The substance may be any suitable substance capable of reducing expression of the ACE gene. According to an embodiment, the substance comprises a polynucleotide or oligonucleotide complementary to at least a portion of the polynucleotide according to the0 first or second aspects. The polynucleotide or oligonucleotide may be complementary to at least a portion of SEQ ID NO: 4, may be and oligonucleotide comprising any one of SEQ ID NOs: 9 to 12, any one of SEQ ID NOs: 19 to 21, or an oligonucleotide complementary thereto, and may be an antisense polynucleotide or oligonucleotide, or may comprise siRNA. In certain embodiments, methods according to this aspect may beS for improving the endurance performance of said subject, or for preventing exercise induced pulmonary haemorrhage in said subject. The subject may be a horse.
According to another aspect of the invention, there is provided a system for predicting the health or physical performance of an animal, wherein said system comprises means for analyzing a nucleic acid sample from said animal for the presence of at least one genetic0 marker in the angiotensin converting enzyme gene, wherein said genetic marker is predictive of the health or physical performance of said animal. The system may comprise a kit according to the invention as described above. The genetic marker may be a genetic marker according to the invention as described herein. The subject may be a horse. 5 According to another aspect of the invention, there is provided a system for selecting an animal using marker assisted selection, wherein said system comprises: (a) means for analyzing a nucleic acid sample from said animal for the presence of at least one genetic marker in the angiotensin converting enzyme gene, wherein said genetic marker is predictive of the health or physical performance of said animal; and (b) means for selecting said animal based on the presence or absence of the genetic marker. The system may comprise a kit according to the invention as described above. The genetic marker may be a genetic marker according to the invention as described herein. The subject may be a horse.
According to another aspect of the invention, there is provided a system for breeding an animal using marker assisted selection, wherein said system comprises:
(a) means for analyzing a nucleic acid sample from said animal for the presence of at least one genetic marker in the angiotensin converting enzyme gene, wherein said genetic marker is predictive of the health or physical performance of said animal; and (b) means for breeding said animal based on the presence or absence of the genetic marker, and
(c) means for selecting progeny of said animal based on the presence or absence of the genetic marker. The system may comprise a kit according to the invention as described above. The genetic marker may be a genetic marker according to the invention as described herein. The subject may be a horse.
Brief Description of the Drawings
Figure 1 shows the genomic sequence (SEQ ID NO:1) of the equine ACE gene including primer positions for amplification of the gene and screening for polymorphisms. Exonic sequence is shown in upper case and intronic sequence in lower case. Primers and direction thereof are indicated with sequence targeted by the primers being indicated in white text on black background. Sequence changes are highlighted in bold, larger type, with the alternative allele(s) above or below the base change. Underlined areas indicate sequence that was screened for polymorphisms in the pools. The cDNA numbering is shown in brackets for each exon, with the first base of the start codon(s) numbered 1. The lengths of exons 1, 13 and 26 have been predicted according to alignments with known exons from other species and were not confirmed with cDNA analysis.
Figure 2 shows the equine somatic ACE coding sequence (SEQ ID NO:2). Putative and confirmed exon/intron boundaries are marked. Areas underlined indicate regions confirmed with cDNA analysis. The equine somatic ACE amino acid sequence (SEQ ID NO:3) is also shown, numbered from the leucine residue predicted to be at the 5' end of the mature ACE protein, which is preceded by a putative 36 residue signal peptide. The position of exon 13 in the testicular transcript is indicated. The TATAA box, start codon, stop codon, and the first polyadenylation signal are also indicated in white text on black background.
Figure 3 shows the nucleotide sequence determined for intron 16 of the equine ACE gene (SEQ ID NO:4), including polymorphic sites (sequence changes are highlighted in bold, larger type, with the alternative allele(s) above or below the base change). Sequence that is highly homologous in the horse and human is indicated in bold capitals. An 18 nucleotide stretch within this homologous region (indicated in bold capital text on grey background) has been found to be fully conserved across the equine, human, rat and mouse ACE gene intron 16 sequences. Potential binding sites for the Broad Complex 2 (AAATAGAA), and the Hepatocyte nuclear factor-3 / Fork head Homologue (HFH-3) transcription factors (AAATAAACAGGA) are underlined.
Definitions The term "base pair" as used herein means a pair of nitrogenous bases, each in a separate nucleotide, in which each base is present on a separate strand of DNA and the bonding of these bases joins the component DNA strands. Typically a DNA molecule contains four bases; A (adenine), G (guanine), C (cytosine), and T (thymidine). A and G are purine bases, typically designated by the letter "R", whereas C and T are pyrimidine bases, typically designated by the letter "Y". Where A or T may occupy a single position it is typically designated by the letter W. Where G or C may occupy a single position it is typically designated by the letter S. Where A or C may occupy a single position it is typically designated by the letter M. Where G or T may occupy a single position it is typically designated by the letter K. Where A, T or C may occupy a single position it is typically designated by the letter H. Where G, C or T may occupy a single position it is typically designated by the letter B. Where G, A or T may occupy a single position it is typically designated by the letter D. Where G, C or A may occupy a single position it is typically designated by the letter V. Where G, C, A or T may occupy a single position it is typically designated by the letter N. The term "base pair" is abbreviated to "bp", and the term "kilobase pair" is abbreviated to kb.
As used herein, the term "comprising" means "including principally, but not necessarily solely". Variations of the word "comprising", such as "comprise" and "comprises", have correspondingly similar meanings. As used herein, the term "genetic marker" refers to a variant or polymorphism at DNA sequence level linked to a specific chromosomal location unique to an individual's genotype, inherited in a predictable manner, and measured as a direct DNA sequence variant or polymorphism, such as at least one Single Nucleotide Polymorphism (SNP), Restriction Fragment Length Polymorphism (RFLP), or Short Tandem Repeat (STR), or as measured indirectly as a DNA sequence variant (eg. Single-strand conformation polymorphism (SSCP), Denaturing Detergent Gradient Gel Electrophoresis (DDGE)). A marker can also be a variant at the level of a DNA derived product such as RNA polymorphism/abundance, protein polymorphism or cell metabolite polymorphism, or any other biological characteristics which have a direct relationship with the underlying DNA variants or gene product,
The term "genotype" as used herein means the genetic constitution of an organism. This may be considered in total, or as in the present application, with respect to the alleles of a single gene (that is, at a given genetic locus). Accordingly, the term "homozygote" refers to an organism that has identical alleles at a given locus on homologous chromosomes, whereas the term "heterozygote" refers to an organism in which different alleles are found on homologous alleles for a given locus.
For the purposes of the present invention, the term "horse" includes all domesticated and wild horse members of the family Equidae. but with particular emphasis on domesticated breeds including Thoroughbreds, Arabians, Quarterhorses, Standardbreds, Warmbloods, stock horses, sport horses, draught horses, and any hybrid thereof.
The term "modifying component" in the context of the present invention means any component added to a nucleic acid molecule so as to enable or facilitate detection or analysis of a product of the interaction of the nucleic acid molecule with another nucleic acid molecule, or any other entity. A modifying component may, for example, comprise a further nucleotide sequence which is readily recognisable by a processing enzyme, binding entity or other. Alternatively a modifying component may be a component which results in physical parameters of the interaction product which allow for physical distinction from other molecules or components in a mixture comprising said interaction product, such as mass, size, melting temperature, and/or charge, or may be a label (fluorescent, antibody, antigen, charged, radioactive, and the like), which may be attached to, or be incorporated in one or more nucleotides of the nucleic acid molecule.
The term "polypeptide" means a polymer made up of amino acids linked together by peptide bonds. The terms "polypeptide" and "protein" are used interchangeably herein, although for the purposes of the present invention a "polypeptide" may constitute a portion of a full length protein.
The term "polynucleotide" as used herein refers to a single- or double-stranded polymer of deoxyribonucleotide, ribonucleotide bases or known analogues or natural nucleotides, or mixtures thereof.
The term "primer" as used herein means a single-stranded oligonucleotide capable of acting as a point of initiation of template-directed DNA synthesis. An "oligonucleotide" is a single-stranded nucleic acid typically ranging in length from 2 to about 500 bases. The precise length of a primer will vary according to the particular application, but typically ranges from 15 to 30 nucleotides. A primer need not reflect the exact sequence of the template but must be sufficiently complementary to hybridize to the template.
Within the scope of the terms "protein", "polypeptide", "polynucleotide" and "nucleic acid" as used herein are fragments and variants thereof, including but not limited to reverse compliment and antisense forms of polynucleotides and nucleic acids.
The term "portion" when used in relation to a polynucleotide refers to a constituent of a polynucleotide. The portion may possess qualitative biological activity in common with the polynucleotide. Alternatively, portions of a polynucleotide do not necessarily need to encode polypeptides which retain biological activity. Rather, a portion may, for example, be useful as a hybridization probe or PCR primer, or be a target for detection and/or amplification by such a probe or PCR primer. The portion may be derived from a polynucleotide of the invention or alternatively may be synthesized by some other means, for example chemical synthesis.
The term "restriction enzyme" as used herein means an endonuclease enzyme that recognises and cleaves a specific sequence of DNA (recognition sequence).
As used herein, the term "single nucleotide polymorphisms" or "SNP" or "SNPs", as used herein, refers to common DNA sequence variations among subjects. The DNA sequence variation is typically a single base change or point mutation resulting in genetic variation between individuals. The single base change can be an insertion or deletion of a base.
The term "variant" as used herein refers to substantially similar sequences. Generally, polynucleotide sequence variants possess qualitative biological activity in common. Further, these polynucleotide sequence variants may share at least 90%, 95%, 96%, 97%, 98% or 99% sequence identity. Detailed Description of the Invention
Angiotensin-converting enzyme is an important part of the Renin-Angiotensin System (RAS), and is specifically involved in increasing blood pressure during conditions of physiological demand. The RAS is the primary endocrine system responsible for regulating blood pressure by influencing vascular tone and electrolyte-fluid homeostasis. The components of this system are angiotensinogen, renin, angiotensins I and II, and angiotensin-converting enzyme.
Angiotensinogen or blood volume loss
Figure imgf000016_0001
Renin
Angiotensin I
Figure imgf000016_0002
Angiotensin-converting enzyme
Angiotensin II
Inactivation of Bradykinins
Figure imgf000016_0003
Aldosterone release- Stimulate salt and water homeostasis Increase thirst Vasodilation, endothelial and Increase muscle glucose cardiac growth
Renin, an enzyme synthesized in the kidneys (Gomez, R. A., et al (1990), "Molecular biology of the renal renin-angiotensin system", Kidney International 38(Supp 30): S- 18- S23), catalyzes the proteolytic conversion of angiotensinogen (a large globular protein derived from the liver (Morris, BJ. et al (1979), "Localization of angiotensinogen in rat liver by immunocytochemistry", Endocrinology 105(3): 796-800) to angiotensin I. Angiotensin I is the precursor to the octapeptide angiotensin II, which acts through many pathways to regulate volume homeostasis.
The conversion of angiotensin I to angiotensin II is catalyzed by ACE in the pulmonary vasculature (Campbell, D.J. (1985), "The site of angiotensin production", Journal of Hypertension 3: 199-207). A dipeptidyl carboxy peptidase, this enzyme hydrolyses dipeptides from the COOH-terminus of polypeptides (Peach, M.J. (1977), "Renin- angiotensin system: Biochemistry and mechanisms of action", Physiological Reviews 57(2): 313-70; Morris, BJ. (1996), "Hypothesis: An angiotensin-converting enzyme genotype, present in one in three Caucasians, is associated with an increased mortality rate", Clinical and Experimental Pharmacology and Physiology 23: 1-10). Angiotensin II is a potent vasoconstrictor that also stimulates the proliferation of smooth muscle cells, whilst ACE itself inhibits the vasodilator bradykinin (Erdos, E.a.S., R. A. (1987), "The angiotensin I-converting enzyme", Laboratory Investigation 56: 345-48; Griendling, K..K. et al (1993), "Molecular biology of the renin-angiotensin system", Circulation 87(6): 1816-28). Angiotensin II also stimulates aldosterone secretion, increasing sodium resorption in the cells and thereby increasing the amount of water reabsorbed by the body to increase blood volume (Gomez et al. (1990), Kidney International 38(Supp 30): S-18- S23). A lesser action of angiotensin II is to increase water consumption by stimulating thirst (Fitzsimons, J.T. (1978), "Angiotensin, thirst, and sodium appetite: Retrospect and prospect", Federation Proceedings 37: 2669-75).
An insertion/deletion (I/D) polymorphism in intron 16 (a non-protein coding region) of the human ACE gene has been associated with elite endurance performance in human athletes.
In the course of the present studies, 20 500 bp of the estimated 23 000 bp surrounding and interspersing genomic sequence of the equine ACE gene (inclusive of 5'UTR region and polyA signal in close proximity to the skeletal muscle voltage gated sodium channel alpha-subunit gene (SCN4A) and growth hormone 1 (GHl) genes: Fig. 1 - SEQ ID NO:1) located on chromosome ECA I lpl3, and the full equine ACE cDNA sequence (4184 base pairs - Figure 2, SEQ ID NO:2) and putative encoded amino acid sequence (Fig.2 - SEQ ID NO:3) have been obtained for the first time.
Both the full genomic sequence and the coding sequence may be used as basis for the design of suitable oligonucleotides for detection of the ACE gene and polymorphisms thereof, for design of antisense or small interfering RNA molecules for regulation of ACE expression in subjects, or in recombinant techniques for the purpose of, for example, genetic modification of non-human animals incorporating but not restricted to transgenic, gene therapy, DNA vaccination and cell or /stem cell mediated treatments.
In the course of these studies a number of oligonucleotides were designed for the purpose of sequencing and characterising the equine ACE gene and its variations. As a result sixteen polymorphisms have been identified in the equine gene across a number of breeds, although more may exist. At least one of the polymorphisms detected is predicted to change an amino acid within the ACE protein, with a possible alteration in protein function. Other single nucleotide polymorphisms (SNPs) that have been found are within non-coding regions of the gene and therefore do not directly alter the protein.
Nine of the polymorphisms occur in more than one individual, and are inherited in patterns known as haplotypes, which have been studied in a panel of horses of different breeds. The breeds included were the Thoroughbred, which has been created for high speed (gallop) racing; Arabians, which were selected as those that successfully race in endurance events of over 100 kms; Standardbreds, a breed derived to race at the slightly slower gait of the pace or trot, in addition to pulling a small, light cart, as well as Draught horses, which originated to perform heavy slow (pulling) work.
At least 2 of the polymorphisms have been identified as possibly having an effect on the regulatory function of the ACE gene and thus affect observed circulating levels of the enzyme. An association study performed on over 200 Thoroughbred racehorses for the purposes of this work has shown that one haplotype including both of these polymorphisms was highly significantly associated with circulating ACE levels (P = 0.000). These two polymorphisms occur within intron 16 of the ACE gene, a G-→A transition at nucleotide 178 of intron 16 (SEQ ID NO:4), and a G— >T transition at nucleotide 1513 of intron 16. A highly conserved region comprising a putative regulatory module has been identified within this intron that has an effect on circulating enzyme levels.
At least this identified haplotype is responsible for a 10% decrease in circulating ACE levels in the horse.
Without wishing to be bound by theory, it is postulated that the G178→A and G1513→T intron 16 equine ACE gene polymorphisms result in reduced circulatory levels of ACE in horses and are associated with athletic performance. At least these markers can therefore be used to create a diagnostic DNA test to identify horses that have a better genetic potential than others to perform on the racetrack. In addition, these markers, and others identified during these studies, or which may be identified using the sequences and teachings of the present disclosure may also find use in tests predictive of other physical traits in horses, as direct (causing differences in gene expression or function) or indirect (not causative polymorphisms but physically near the causative polymorphism) genetic markers for a number of traits which affect equine performance.
In addition similar nucleotide polymorphisms of significance have been identified in intron 8 (amplifiable by primer pair SEQ ID Nos: 7 and 8, actual sequence in SEQ ID No 1) intron 20 (amplifiable by primer pair SEQ ID Nos: 13 and 14, actual sequence in SEQ ID No 1) and intron 21 (amplifiable by primer pair SEQ ID Nos: 15 and 16, actual sequence in SEQ ID No 1) specifically and in addition to those listed in Table 1. One haplotype comprising these three polymorphisms was found to have a significant association with circulating ACE levels in horses (heterozygous haplotype being indicative of lower circulating ACE levels, and homozygous haplotype being indicative of higher circulating ACE levels). A series of nucleotide variants describing commonly observed haplotype variants is shown in Table 10 (in the examples). Variants are not restricted to these variants only, but highlight the range of variation observed.
Other polymorphisms of potential interest are located at nucleotide 25 of intron 5 A-→-G, nucleotide 146 of intron 8 G→T, nucleotide 89 of intron 16 (SEQ ID NO:4) C->G, nucleotide 58 of intron 20 G→A→C, nucleotide 115 of intron 20 G→T, nucleotide 39 of intron 21 C->A, nucleotide 160 of exon 26 G->A (also known as G3872A or Argl255His), and the polymorphic number of A nucleotides residing between positions 494 and 510 within intron 14.
One genetic test contemplated by the present invention is one that predicts the type of racing a horse is best suited to.
Another test contemplated by the present invention is in the area of genetic predisposition to EIPH (exercise induced pulmonary haemorrhage). This is a condition that causes horses, particularly racehorses, to bleed from the lungs when they exercise strenuously. Any horse found 'bleeding' at the races or trackwork is automatically suspended for three months, for a second bleeding event they are barred for life, so this condition has a serious financial impact as well as the welfare issue. It has been hypothesised that variants in the ACE gene may affect blood pressure in the pulmonary vasculature, thus influencing a horses susceptibility to EIPH.
The applications of these tests would be in planned breeding and the selection of mates for breeding stock, the identification of superior animals prior to the start of their racing careers (either in selection of yearlings to buy or as selection of which colts to leave as entires and which to geld), and in the creation of specific, individually designed training programs that are tailored to genetic potential of individual horses.
The present invention also contemplates using expression of the angiotensin converting enzyme as a means for diagnosing race performance and/or health of a horse. Such a method may involve detection of ACE mRNA by any appropriate means as known in the art, for example by Northern analysis and/or PCR techniques.
The present invention also contemplates manipulation of the level of expression of angiotensin converting enzyme gene in a subject by genetic and/or standard therapeutic means. Nucleic acid molecules for Identifying ACE gene polymorphisms
Nucleic acid molecules for identifying polymorphisms in the equine angiotensin- converting enzyme gene may be any appropriate sequence which is designed based on the complete equine angiotensin-converting enzyme gene as now disclosed herein (SEQ ID NO:1).
The nucleotide sequence of said nucleic acid molecule may be identical to, or be complementary to at least a portion of SEQ ID NO:1, or SEQ ID NO:2, and may comprise the full sequence, or complement thereof or, may comprise an oligonucleotide of from about 10 nucleotides in length to about 100 nucleotides in length, such as from about 10 to about 50 nucleotides in length, about 15 to about 100 nucleotides in length, about 15 to about 50 nucleotides in length, about 10 to about 30 nucleotides in length, or about 15 to about 30 nucleotides in length.
Alternatively, a nucleic acid molecule of the invention may comprise a nucleotide sequence designed based on the amino acid sequence of equine angiotensin-converting enzyme (SEQ ID NO:3), using degeneracy of the genetic code, and optionally preferred codon usage information. Suitable nucleic acid molecule sizes are as already discussed immediately above.
A nucleic acid molecule of the invention may also be a variant of either the complete equine angiotensin-converting enzyme gene or complement or portion thereof, sharing at least at least about 90% identity therewith.
In addition, a nucleic acid molecule of the invention may comprise a nucleotide sequence specific for a portion of the equine angiotensin-converting enzyme gene and a modifying component which enables or facilitates subsequent detection and/or analysis of a product of the interaction between the nucleic acid molecule and the target portion of the equine angiotensin-converting enzyme gene. For example, such a modifying component may allow for, or facilitate detection of a hybridised nucleotide duplex formed between the nucleic acid molecule and a target portion of the equine angiotensin-converting enzyme gene, or allow for, or facilitate amplification of a target portion of the equine angiotensin- converting enzyme gene using said nucleic acid molecule, or detection of the amplification product(s).
Nucleic acid sequences which may be useful for the detection of specific single nucleotide polymorphisms in the equine angiotensin-converting enzyme gene may be as shown in Table 1. Table 1 - Oligonucleotide hybridising sequences suitable for design of forward and reverse primers for amplification of specific portions of the equine angiotensin- converting enzyme gene comprising specific Single Nucleotide Polymorphisms
(SNPs)
Figure imgf000021_0001
Other suitable oligonucleotides useful as probes or amplification primers in methods or kits of the present invention are listed in Tables 4 and 7 in the examples, with modifying component, where present, indicated in lower case (plain or bold type) or upper case bold type, and methods which may be employed for their use are exemplified in Tables 5, 6 and 8 in the examples.
Methods for Detecting Polymorphisms
DNA from the subject to be assessed may be extracted by a number of suitable methods known to those skilled in the art. Most typically, DNA is extracted from a blood sample, and in particular from white blood cells from fresh blood samples by a method based on that of Montgomery et al (1997), Circulation 96(3): 741-47) or from whole frozen blood using a spin column extraction process, for example as described for the Body Fluid Spin Protocol in the QIAGEN™ kit handbook (QIAamp™ DNA Blood Mini Kit). Once suitable DNA has been isolated, this may be analysed for the presence of absence of a polymorphism by any suitable method as known in the art, and which method/strategy is employed may depend on the specificity desired, and the availability of suitable sequences and/or enzymes for restriction fragment length polymorphism (RFLP) analysis. Suitable methods may involve detection of labelled hybridisation product(s) between a polymorphism-specific probe and at least a portion of the equine angiotensin-converting enzyme gene or, more typically, by amplification of at least a portion of the equine angiotensin-converting enzyme gene using either a primer and suitable probe, or using a pair of primers (forward and reverse primers) for amplification of a specific portion of the equine angiotensin-converting enzyme gene followed by either direct partial and/or complete sequencing of the amplified DNA, or RFLP analysis thereof.
Of the polymorphisms detected in these studies in the equine angiotensin-converting enzyme gene, the polymorphisms detected in introns 5 (SNP 1 - A→G) and 8 (SNP 2 - G→T) and Exon 26 (SNP 9 - 3872G→A) were found to be appropriately detected using PCR amplification followed by RFLP analysis, and the polymorphisms detected in introns 16 (SNP 3 - C→G; SNP 4 - G→A; and SNP 5 - G→T), 20 (SNP 6 - G→A→C; SNP 7 G→T) and 21 (SNP 8 - C→A) were appropriately detected using PCR amplification followed by genotyping the amplification products by sequencing.
Thus, according to the present invention, a method suitable for the detection of a polymorphism in intron 16, intron 20, or intron 21 of the equine angiotensin-converting enzyme gene, is a PCR/sequence determination analysis strategy. A method suitable for the detection of a polymorphism in intron 8 of the equine angiotensin-converting enzyme gene, is a PCR/RFLP analysis strategy
The methods and reagents for use in a PCR amplification reaction are well known to those skilled in the art. Suitable protocols and reagents will largely depend on individual circumstances. Guidance may be obtained from a variety of sources, such as for example Sambrook et al., Molecular Cloning : A Laboratory Manual, Cold Spring Harbor, New York, 1989, and Ausubel et al., Current Protocols in Molecular Biology, Greene Publ. Assoc, and Wiley-Intersciences, 1992.
A person skilled in the art would readily appreciate that various parameters of the PCR reaction may be altered without affecting the ability to amplify the desired product. For example the Mg2+ concentration and temperatures employed may be varied. Similarly, the amount of genomic DNA used as a template may also be varied depending on the amount of DNA available.
Other methods of analysis of the amplified DNA to determine the presence or absence of the polymorphism are well known to those skilled in the art. For instance, following digestion of the amplified DNA with a suitable restriction enzyme to detect the ACE polymorphism, the DNA may be analysed by a range of suitable methods, including electrophoresis. Of particular use is agarose or polyacrylamide gel electrophoresis, a technique commonly used by those skilled in the art for separation of DNA fragments on the basis of size. The concentration of agarose or polyacrylamide in the gel in large part determines the resolution ability of the gel and the appropriate concentration of agarose or polyacrylamide will therefore depend on the size of the DNA fragments to be distinguished.
Detection and/or determination of the existence of a polymorphism may be aided by computer analysis using any appropriate software. Suitable software packages for comparison of determined nucleotide sequences are well known in the art and are readily available.
Methods of the invention may involve detection of a plurality of polymorphisms in the equine angiotensin-converting enzyme gene. For example, prediction of a particular phenotype potential, such as endurance racing potential, may involve detection of the presence of a plurality of polymorphisms in the equine angiotensin-converting enzyme gene, including at least SNPs 4 and 5 (intron 16, position 178 G— >A and position 1513 G— >T: associated with haplotype 6), but possibly other polymorphisms, such as SNPs 2, 6 and 8 associated with haplotype 7. In addition, methods of the invention may be used to detect other ACE phenotypes which may be associated with different combinations of polymorphisms, recognised groups of animals having specific combinations of polymorphisms being identified as haplotypes.
Kits for Assessing Performance Potential of Horses
Kits for the detection of at least one polymorphism in the equine ACE gene and for predicting physical performance of horses are also contemplated by the present invention.
Kits according to the present invention may be designed specifically to enable the amplification and analysis of at least one segment of the ACE gene associated with a health or physical trait of horses. For example, the kit may be designed specifically to enable the amplification and analysis of at least one segment of intron 16 wherein, for example, the polymorphism involves SNP 4 (a G→A transition at nucleotide 178 of intron 16/SEQ ID NO:4), SNP 5 (a G→T transition at nucleotide 1513 of intron 16), or both of these transitions. Also contemplated are kits designed to enable detection of other polymorphisms as well as, or instead of these polymorphisms in intron 16 of the angiotensin-converting enzyme gene, such as SNPs 2, 6 and/or 8. For example, a kit of the invention may be designed to detect a particular equine angiotensin-converting enzyme gene haplotype in a sample. Kits able to detect at least haplotypes 1, 6 and/or 7 may be particularly suitable. Such kits may comprise all of the following primer pairs: SEQ ID Nos: 5 and 6; SEQ ID Nos: 7 and 8; SEQ ID Nos: 9 and 10; SEQ ID Nos: 11 and 12; SEQ ID Nos: 13 and 14; SEQ ID Nos: 15 and 16; and SEQ ID Nos: 17 and 18; or a subset of these primer pairs, such as: all of SEQ ID Nos: 7 and 8, SEQ ID Nos: 9 and 10, SEQ ID Nos: 11 and 12, SEQ ID Nos: 13 and 14, and SEQ ID Nos: 15 and 16; or at least SEQ ID Nos: 9 and 10 and SEQ ID Nos: 11 and 12 (for detection of SNPs 4 and 5, and therefore presence or absence of haplotype 6); or at least SEQ ID Nos: 7 and 8, SEQ ID Nos: 13 and 14, and SEQ ID Nos. 15 and 16 (for detection of SNPs 2, 6 and 8, and therefore presence or absence of haplotype 7).
Accordingly, kits of the present invention typically include one or more primers that specifically hybridize to at least a portion of the ACE gene. The primers may comprise one or more oligonucleotide primer pairs comprising forward and reverse primers specifically designed to anneal either side of the polymorphic site of interest, or may comprise a general forward or reverse primer designed to specifically hybridise with the
ACE gene, and a forward or reverse allele-specific probe. In such kits, appropriate amounts of either the one or more oligonucleotide primer pairs, or the one or more primers and allele specific probes are provided in suitable containers. The oligonucleotides may be provided suspended in an aqueous solution or as a freeze-dried or lyophilized powder, for example. Alternatively, a kit of the invention may comprise one or more appropriately labelled oligonucleotide probes specific for particular polymorphisms.
Typically a kit of the present invention includes at least two primers. The appropriate sequences of the primers may vary, but primers having the sequences as shown in SEQ ID Nos: 9 to 12, for amplifying relevant portions of intron 16, are particularly suitable. Primers having the sequences as shown in SEQ ID Nos: 7, 8 and 13 to 16, which are capable of amplifying relevant portions of introns 8, 20 and 21, such as may detect haplotype 7, are also suitable. A kit of the invention may comprise all, or a combination of these primer pairs. The amount of each oligonucleotide supplied in the kit can be any appropriate amount, depending on the nature of the application, and would likely be an amount sufficient to prime at least several amplification reactions. A person skilled in the art would readily appreciate the appropriate amount of each nucleic acid to use in a detection reaction.
A kit according to the present invention may also include a suitable control template molecule and/or control primers for use in a control reaction. In addition, the kit may also include a sample of DNA of each genotype associated with the one or more polymorphisms to be detected. For example, a kit of the invention may comprise a sample of each of the genotypes associated with SNPs 4 and 5, such as GIG, GIG; G/A, GIG; GIG, G/A; G/A, G/A; A/A, G/G; A/A, G/A; G/G, A/A; G/A, A/A; and A/A, A/A. Similar samples for the genotypes associated with other SNPs, such as SNPs 2, 6 and/or 8 (associated with haplotype 7) may also be included in such a kit. The design of suitable control templates, primers and of control reactions is well known to those skilled in the art.
A kit according to the present invention may additionally include other components for performing amplification reactions including, for example, DNA sample preparation reagents, appropriate buffers (e.g. polymerase buffer), salts (e.g. magnesium chloride), and deoxyribonucleotides (dNTPs). The kit may further include the necessary reagents for carrying out analysis of the amplified DNA, such as an appropriate restriction enzyme, reaction buffer for restriction enzyme digestion, and reagents for use in separating digested fragments (e.g. agarose). Typically, a kit may also include containers for housing the various components and instructions for using the kit components to conduct amplification reactions according to the present invention.
Inhibition of ACE transcription The present invention also provides methods for inhibiting the expression of the ACE gene using a transcriptional inhibitor thereof. Typically the inhibitor may be nucleic-acid based, peptide-based or other suitable chemical compound.
The inhibitor may be a nucleic-acid based inhibitor of expression of a polynucleotide disclosed herein or a fragment thereof. Suitable molecules include small interfering RNA (siRNA) species, antisense constructs, such as antisense oligonucleotides, and catalytic antisense nucleic acid constructs. Suitable molecules can be manufactured by chemical synthesis, recombinant DNA procedures or, in the case of antisense RNA, by transcription in vitro or in vivo when linked to a promoter, by methods known to those skilled in the art.
One suitable technology for inhibiting gene expression, known as RNA interference (RNAi), (see, eg. Chuang et al. (2000) PNAS USA 97: 4985) may be used for the purposes of the present invention, according to known methods in the art (for example Fire et al. (1998) Nature 391: 806-811; Hammond, et al (2001) Nature Rev, Genet. 2: 110-1119; Hammond et al. (2000) Nature 404: 293-296; Bernstein et al. (2001) Nature 409: 363-366; Elbashir et al (2001) Nature 411: 494-498; WO 99/49029 and WO 01/70949, the disclosures of which are incorporated herein by reference), to inhibit the expression of the disclosed polynucleotides. RNAi refers to a means of selective post- transcriptional gene silencing by destruction of specific mRNA by small interfering RNA molecules (siRNA). The siRNA is typically generated by cleavage of double stranded RNA, where one strand is identical to the message to be inactivated. Double-stranded RNA molecules may be synthesised in which one strand is identical to a specific region of the mRNA transcript and introduced directly. Alternatively corresponding dsDNA can be employed, which, once presented intracellularly is converted into dsRNA. Methods for the synthesis of suitable siRNA molecules for use in RNAi and for achieving post- transcriptional gene silencing are known to those of skill in the art. The skilled addressee will appreciate that a range of suitable siRNA constructs capable of inhibiting the expression of the disclosed polynucleotides can be identified and generated based on knowledge of the sequence of the gene in question using routine procedures known to those skilled in the art without undue experimentation.
Those skilled in the art will appreciate that there need not necessarily be 100% nucleotide sequence match between the target sequence and the siRNA sequence. The capacity for mismatch is dependent largely on the location of the mismatch within the sequences. In some instances, mismatches of 2 or 3 nucleotides may be acceptable but in other instances a single nucleotide mismatch is enough to negate the effectiveness of the siRNA. The suitability of a particular siRNA molecule may be determined using routine procedures known to those skilled in the art without undue experimentation.
Sequences of antisense constructs may be derived from various regions of the ACE gene. Antisense constructs may be designed to target and bind to regulatory regions of the nucleotide sequence, such as the promoter, or to coding (exon) or non-coding (intron) sequences. Contemplated herein in particular are antisense oligonucleotides targeted at intron 16, and which may be complementary for any suitable portion of intron 16 which results in reduced expression of the ACE gene. Suitable targets may comprise homologous area B (SEQ ID NO.19), or any suitable sequence within homologous area A of the equine ACE gene, such as SEQ ID Nos 20 or 21 . Antisense constructs of the invention may be generated which are at least substantially complementary across their length to the region of the gene in question. Binding of an antisense construct to its complementary cellular sequence may interfere with transcription, RNA processing, transport, translation and/or mRNA stability.
Suitable antisense oligonucleotides may be prepared by methods well known to those of skill in the art. Typically antisense oligonucleotides will be synthesized on automated synthesizers. Suitable antisense oligonucleotides may include modifications designed to improve their delivery into cells, their stability once inside a cell, and/or their binding to the appropriate target. For example, the antisense oligonucleotide may be modified by the addition of one or more phosphorothioate linkages, or the inclusion of one or morpholine rings into the backbone.
In particular embodiments of the invention, suitable inhibitory nucleic acid molecules may be administered in a vector. The vector may be a plasmid vector, a viral vector, or any other suitable vehicle adapted for the insertion of foreign sequences and introduction into eukaryotic cells. Preferably the vector is an expression vector capable of directing the transcription of the DNA sequence of an inhibitory nucleic acid molecule of the invention into RNA. Viral expression vectors include, for example, epstein-barr virus-, bovine papilloma virus-, adenovirus- and adeno-associated virus-based vectors. In one embodiment, the vector is episomal. The use of a suitable episomal vector provides a means of maintaining the inhibitory nucleic acid molecule in target cells in high copy number extra-chromosomally thereby eliminating potential effects of chromosomal integration.
A further means of substantially inhibiting gene expression may be achieved by introducing catalytic antisense nucleic acid constructs, such as ribozymes, which are capable of cleaving RNA transcripts and thereby preventing the production of wildtype protein. Ribozymes are targeted to and anneal with a particular sequence by virtue of two regions of sequence complementarity to the target flanking the ribozyme catalytic site. After binding, the ribozyme cleaves the target in a site-specific manner. The design and testing of ribozymes which specifically recognize and cleave sequences of interest can be achieved by techniques well known to those in the art (for example Lieber and Strauss, (1995) MoI. Cell. Biol. 15:540-551, the disclosure of which is incorporated herein by reference).
Also included within the scope of the present invention are alternative forms of inhibition of expression of polypeptides and polynucleotides disclosed herein, including, for example, small molecule or other non-nucleic acid or non-proteinaceous inhibitors. Many such inhibitors are already known in the art, and additional inhibitors may be identified by those skilled in the art by screening using routine techniques.
Preferred forms of the present invention will now be described, by way of example only, with reference to the following examples, including comparative data, and which are not to be taken to be limiting to the scope or spirit of the invention in any way.
Examples Example 1 - General Materials and Methods
1.1 Sample Collection
The DNA samples used in this study were obtained from a number of different sources and utilized for different purposes. Table 2 outlines the origins of each group of samples as well as their uses. Blood for DNA extraction was collected from the jugular vein in 1OmL glass Vacutainer tubes (Becton Dickinson) containing 15mg of EDTA to prevent coagulation. The blood was stored at 40C for no longer than three days, or frozen if longer storage was required. Prior to extraction, a 600μL aliquot was collected and stored in a 1.5mL eppendorf at - 2O0C as a reserve sample.
Table 2 - Description of the origin of DNA samples used in this study.
Figure imgf000028_0001
1 International Horse Reference Family Panel (Guerin, G.E. et al, (1999) Report of the International Equine Gene Mapping Workshop: Male Linkage Map. > Animal Genetics 30(5):341-354)
2 M.H. Gluck Equine Research Center, University of Kentucky, Lexington, United States of America
3 Institut National de Ia Recherche Agronomique, Jouy-en-Josas, France
4 The Sydney University Veterinary Faculty Horse Unit, University of Sydney, Camden, New South Wales, Australia
5 Department of Physiology, University of Cambridge, United Kingdom, provided blood samples from various Newmarket racing stables. 1.2 DNA and RNA extraction
Two different protocols were used to extract the DNA; either a salting out procedure based on the protocol described by Montgomery et al. (Montgomery et al. 1990) or a spin column extraction using a commercial kit (QIAamp® DNA Blood Mini Kit, QIAGEN). Extraction was carried out on all fresh blood samples using the salting out procedure, while the spin column procedure was used on all samples that had been frozen. The full salting out procedure is outlined in the next section, while the spin column extraction process is detailed fully in the Blood and Body Fluid Spin Protocol from the QIAGEN kit handbook.
1.2.1.1 Preparation of white blood cells
The blood was centrifuged in the collection tubes for 10 min at 3000 rpm, after which the serum was removed and discarded. Seven mL of cold (40C) red blood cell lysis buffer (RCLB) [15OmM NH4Cl, 1OmM KHCO3 and 0.ImM EDTA - pH 8.0, autoclaved] was added and the sample vortexed. The samples were centrifuged for lOmin at 3000rpm. The supernatant was poured off and 1OmL of cold (40C) RCLB added, the sample thoroughly vortexed, and again centrifuged for 10 min at 3000 rpm. The supernatant was decanted carefully leaving the white blood cell (WBC) pellet at the bottom of the tube. Three mL of tris-buffered saline (TBS) [14OmM NaCl, 5mM KCL, 24mM Tris-base, autoclaved] was added to the tube. Samples were then either stored at -2O0C for extraction at a later date, or the extraction was continued.
1.2.1.2 DNA extraction from white blood cells
The white cell pellets in TBS were transferred to 15mL falcon tubes. Three washes of 2mL of TBS were used to rinse the original collection tubes. The samples were vortexed to break down the cell pellets, then centrifuged at 2500rpm for 10 min.
After centrifugation, the supernatant was poured off and 3mL of TE was added, followed by vortexing to re-suspend the cell pellet. Freshly prepared proteinase K solution [300μL 0.5M EDTA, 210μL 10% SDS, 0.5 mg Proteinase K in 2.5 mL Milli-Q-water per sample] (3mL) was mixed thoroughly through the sample. The samples were incubated in a shaking water bath at 37-5O0C. Additional proteinase K (20μL, 20mg/mL) was added periodically to the sample until the cell pellets were completely dissolved, which could take up to 8 days at 370C.
To precipitate the protein, 3mL of saturated NaCl (6M) was added once the pellet had dissolved and the samples vigorously shaken for at least 30s. The samples were centrifuged at 2600 rpm for lOmin, and the supernatant transferred into new 15mL falcon tubes. An equal volume of chloroform was added, and the samples shaken vigorously for at least 30s. The samples were again centrifuged at 2600rpm for 10 min. The supernatant was transferred into a tall glass tube containing 2OmL absolute ethanol (-2O0C). The glass tube was covered with parafilm and the samples mixed by gentle inversion 2 - 3 times. The precipitated DNA was spooled out on a glass pipette, washed in 70% ethanol, and blotted dry on KimWipe tissue. It was transferred into 500μL of sterile TE buffer in a 1.5mL eppendorf tube and placed on a mixer overnight. The samples were stored at -2O0C.
1.2.2 DNA extraction from frozen blood
DNA was extracted from frozen blood using a QIAamp® DNA Blood Mini Kit (QIAGEN). Extraction was performed on 200μL of blood as per manufacturers instructions following the Blood and Body Fluid Spin Protocol from the QIAGEN handbook. Basically, the red blood cells in the sample were lysed and bound to the silica- gel matrix of the spin columns by centrifugation. The bound samples were washed at least twice, and eluted into buffer or water. The samples were stored at -2O0C when not in use.
1.2.3 RNA extraction from fresh blood
After obtaining the genomic sequence for the equine ACE gene, cDNA sequence was analysed to confirm the location of predicted exon/intron boundaries. RNA was extracted from whole blood, collected from the jugular vein in 1OmL glass Vacutainer EDTA tubes (purple-topped, Becton Dickinson). The samples were placed onto ice for transport to the laboratory. RNA extraction was performed immediately upon returning to the lab (within 15min of collection) to minimize RNA degradation. A spin-column procedure was used, by means of an RNeasy® Mini Kit (QIAGEN) and an adapted protocol from the RNeasy® Mini handbook.
The blood samples were centrifuged for lOmin at 2500rpm and O0C, after which the buffy coats were removed and placed into 1.5mL Eppendorf tubes. Each buffy coat was split into two or three samples. Erythrocyte Lysis (EL) buffer (QIAGEN) was added to each sample at a ratio of 3 : 1. After mixing the samples by pipetting, they were centrifuged at 2000rpm and 40C for lOmin. The supernatant was carefully removed and the process repeated until the cell pellets were white (3 to 4 washes).
The extraction protocol then followed the spin procedure of the "Animal Cells 1 extraction method" described in the RNeasy® Mini handbook, continuing on from step 2 of the protocol. Briefly, the cells were disrupted and lysed with a buffer that inactivates RNAses, allowing stabilization of the sample. Homogenization was achieved by passing the sample repeatedly through a 20-g needle fitted to an RNAse free syringe. Ethanol (70%) was added to adjust conditions for binding to the selective silica- gel matrix of the spin column. The sample was bound to the gel membrane by centrifugation through the spin column. Three washes were performed to eliminate impurities, and elution carried out in 40μL RNase-free water into a clean 1.5mL Eppendorf tube.
1.3 DNA and RNA quantification
The DNA and RNA were quantified using spectrophotometric analysis (Maniatis et al. (1982). Molecular cloning. A laboratory manual, Cold Spring Harbour Laboratory; Bio
Photometer, Eppendorf). Five μL of each sample was diluted in 75μL water and the absorption of the sample was measured at 260nm. The reading was multiplied by the
DNA/RNA factor and dilution factors, the answer being the concentration in ng/μL. The
DNA was diluted according to its concentration to create working solutions containing 20-30ng of DNA for PCR. The RNA was then used in a reverse transcription PCR to create cDNA.
1.4 Reverse transcriptase PCR
Reverse Transcriptase PCR (RT-PCR) was carried out on total RNA samples to convert RNA to cDNA. Each reaction comprised of up to 2μg of total RNA, 0.1 μg Oligo dT (Promega) and 400 μm of each dNTP, made up to a total solution of 14μL with H2O incubated at 650C for exactly 5min, before being immediately placed on ice. Six μL of a master mix containing Ix First Strand Buffer (FSB, Invitrogen), 40 U RNAsin (Promega) and 5 U Super Script III enzyme (Invitrogen) was added to each reaction. The samples were incubated at 5O0C for 60min, followed by 5min at 750C. The cDNA was diluted to a 1 in 5 dilution and 1 μL used as a template in PCR with a total volume of 25 μL.
1.5 Primers
Primers were selected manually in regions of interest and evaluated for secondary structures and dimer formation using Primer Premier 5, Demo version (Premier Biosoft International) http://www.premierbiosoft.com/. Forward and reverse primers were also selected for matching melting temperatures (Tm) within pairs.
To visualize PCR products or to simplify sequencing on a LI-COR automated sequencer 1 of 3 M13 sequences (M13-29, -38 or -rev, Table 3) was added to the 5' end of at least one of the primers in a pair (Oetting et al. (1995), Genomics 30: 450-58).
Table 3 - M13 IRD primer sequences
Figure imgf000031_0001
The M 13 tail sequence was identical to that of the corresponding M 13 -IRD primers, which were labelled with an infrared dye (IRD) of the 700 or 800 wavelengths. Forward primers were ordered with a Ml 3-29 sequence and reverse primers with either M 13 -38 or M13-rev. This allowed bi-directional sequencing on the LI-COR sequencer (LI-COR).
IRD-Labeled primers (M13-29, -38 or -rev) as well as gene specific primers for direct BAC sequencing were provided by MWG Biotech, diluted to 200pmol/μL with sterile TE buffer and stored at -8O0C. Working solutions were prepared by further dilution to lpmol/μL with sterile water and stored at -2O0C. Standard primers were synthesized and provided lyophilized by Sigma Genosys. After arrival they were diluted to 200pmol/μL with sterile TE buffer and stored at -2O0C. The stock solutions were then further diluted to 20pmol/μL with sterile water and stored at -2O0C.
1.6 Polymerase Chain Reaction (PCR)
Polymerase Chain Reaction (PCR) was used extensively for sequencing and microsatellite genotyping. Details of the specific reactions used can be found in the relevant examples. A number of PCR reagents were used including various Taq polymerases and accompanying reagents supplied by QIAGEN and Fisher Biotech. Each PCR reaction was conducted in the required number of wells in a 96-well PCR plate, and overlaid with a drop of mineral oil to prevent evaporation. DNA and PCR products were visualized on ethidium bromide stained 0.8-4% agarose gel, with the exception of microsatellites, which were visualized using polyacrylamide gel electrophoresis on the LI-COR automated sequencer.
Three 96 well PCR machines, the PTC-100, PTC-200 and PTC-200 Gradient Cycler, (MJ Research Inc) were used for all PCR reactions. The Gradient Cycler machine was used for PCR optimization and a large proportion of the sequencing work that required the amplification of a small number of samples at different annealing temperatures. The other machines were primarily used for microsatellite PCR of larger numbers of animals.
1.7 Sequencing of PCR Products
1.7.1 Clean up of PCR product for sequencing
PCR products were cleaned up for sequencing by one of two methods. The first eliminates short oligonucleotides and salts using a spin column method as per manufacturers instructions (JetQuick PCR Purification Spin Kit Genomed). The PCR product is bound to the matrix of a spin column, then washed and eluted into a suitable volume of buffer or water (30-50μL). To allow for some loss of PCR product through the washes 80-1 OOμL of sample was purified using this process. The second technique uses the enzyme ExoSapIT (Amersham Pharmacia) to degrade single stranded DNA and hydrolyze surplus dNTPs when incubated. PCR product (lOμL) was mixed with 2μL of ExoSapIT was incubated for 45min at 37°C, followed by 15min at 80°C for enzyme inactivation.
1.7.2 Sequencing of PCR product
The majority of product was sequenced on a LI-COR 4200 automated sequencer. Some samples were sent to the DNA Sequencing Facility at the Millennium Institute, Westmead
Hospital, NSW, Australia for sequencing on an ABI PRISM 3100 Genetic Analyzer
(Applied Biosystems) using 'Big-Dye' Terminator (BDT) chemistry version 3.1 (Applied
Biosystems). Product sent to the Millennium Institute was prepared in a 12μL mix containing the appropriate volume of water, 3.2pmol of primer and 5-8μL of cleaned up product, depending on the intensity and length of the PCR product.
The products analysed on the LI-COR 4200 were sequenced based on the method developed by Sanger (Sanger et al. (1977), Proceedings of the National Academy of Sciences, USA 74: 5463-67) using SequiTherm Excel II DNA sequencing kits - LC (Epicentre Technologies, catalogue numbers SE9101LC and SE9202LC) and IRD- labelled primers. The type of sequencing kit used (either SE9101LC for 25-4 lcm gels or SE9202LC for 66cm gels) was determined by the size of the product to be sequenced, with any product over 700 base pairs analysed on a 66cm gel. The IRD labelled primers used were identical to the Ml 3 tail on the primer used for PCR. Sequencing was performed either in one direction or bi-directionally, using 2 different Ml 3 primers with a 700 and 800 label respectively (LI-COR).
For each reaction, 2μL of each ddNTP mix was placed in 4 separate wells of a 96-well PCR plate. A bulk mix was made with IX buffer, either 2ρmol of IRD700 or 3pmol of IRD800 primer, 5-7μL of purified PCR product, 4 U of SequiTherm Excel II Polymerase and water to a total volume of 17μL. Four μL of bulk mix was then added to each of the 4 wells, followed by a drop of mineral oil. Unless otherwise stated the sequencing cycle consisted of initial denaturation for 5min at 950C, followed by 45 cycles of 950C for 30s, 6Q0C for 15s and 7O0C for 60-12Os.
All sequencing products were mixed with the provided loading buffer and loaded onto a 41 or 66cm polyacrylamide gel as per manufacturers instructions. Electrophoresis and analysis was performed using a LI-COR 4200 automated sequencer.
1.8 Direct BAC Sequencing
Since no equine ACE sequence information was available it was not possible to design primers to cover the areas upstream of exon 1 and downstream of exon 26. Different approaches were used to develop the sequence at the 5' and 3' ends of the gene. 1.8.1 Direct BAC sequencing (fluorescent labelled primers)
The primer Aceex26for was designed and manufactured with an IRD700 label (Millenium Science for MWG Biotech) for direct sequencing of the BAC DNA of a BAC clone comprising the equine ACE gene (801F9) using a SequiTherm Excel II (Epicentre Technologies, SE9101LC) sequencing kit. In addition to the standard reagents in the kit, approximately 0.8μg BAC DNA, 2pmol of the IRD labelled primer and 3μL of QIAGEN Q solution (QIAGEN) were used in the master mix. An adapted sequencing cycle of 3min at 980C, 60 cycles of 950C for 30s, 5O0C for 30s and 6O0C for 4min was carried out, and the product electrophoresed and analysed on a LI-COR 4200 automated sequencer.
1.8.2 Direct BAC sequencing (big dye terminators)
Since the BAC sequencing method described above was unsuccessful in amplifying the GC rich 5' UTR of the gene, this area was sequenced using 'Big-Dye' Terminator (BDT) chemistry version 3.1 (Applied Biosystems) on an ABI PRISM 3100 Genetic Analyser (Applied Biosystems). A mix of 3.2pmol of unlabelled reverse primer (Aceexlrev), lμL of DMSO and approximately 1.8μg of BAC DNA was sent to the Millennium Institute, Westmead Hospital, NSW, Australia for sequencing.
Although intron 14 was amplified by PCR, it proved difficult to sequence. A bulk mix of 1.8μg BAC DNA and 3.2ρmol of primer AceI14rev was sent to Millennium Institute and sequenced using the BDT method.
1.9 Agarose Gel Electrophoresis
PCR product and genomic DNA was visualized on 0.8 - 4% [w/w] agarose gels (Progen). The gel was prepared by mixing the appropriate amount of agarose and IX TBE buffer [9OmM Tris-borate, 2mM EDTA] (Sambrook et al. 1989). The gel was cooled to approximately 5O0C before the addition of ethidium bromide to a final volume of 0.5μg/mL gel. The gel was poured into a casting tray containing combs and allowed to solidify.
Agarose gel loading buffer (15% Ficoll Type 400 [Pharmacia], 0.25% bromophenol blue and 0.25% xylene cyanol) (3μL) was added to 5μL of PCR product and mixed. The samples were loaded into the wells of the agarose gel in the electrophoresis tank containing IX TBE buffer. A size standard was loaded to enable estimation of size and concentrations of the DNA or product. The gel was electrophoresed at 10 - 12 V/cm gel to produce optimal separation of the bands. The bands were illuminated using an Ultra.Lum UV trans-illuminator. Either a DS-34 Polaroid camera, 2 megapixel Kodak camera or ImageMaster VDS version 2.0 (Pharmacia Biotech) was used to document the gel. 1.10 Polyacrylamide Gel Electrophoresis (PAGE)
Polyacrylamide gels of three sizes were used on the LI-COR sequencer, depending on the size of product to be analysed. Most microsatellites (100 - 250bp) were visualized on 25cm long plates, whilst the longer gels were used primarily for sequencing. The 41 plates were used for sequencing of products less than 700bp, while the 66cm gel was used when the product was estimated to be over 700bp.
1.10.1 Preparation of glass plates
A pair of glass plates was cleaned with water and left to drain. Once dry, the plates were wiped clean with Kimwipes and 70% isopropanol. A mixture of equal parts bind silane and 10% acetic acid was prepared and applied to one plate at the area of well formation. The plates were separated with 0.25mm spacers and assembled using the provided clamps.
1.10.2 Preparation of 6% acrylamide/bisacrylamide microsatellite gel
The gel for 25cm glass plates was prepared by measuring 8.4g of urea (BDH AnalaR, Merck), 4mL of 5x TBE [9OmM Tris-borate, 2mM EDTA] (S ambrook et al. 1989), 3mL of PAGE 1 Sequencing Gel Mix (19:1) (Boehringer Mannheim) and adding water to a final weight of 22.5g. The solution was mixed until the urea dissolved, then 150μL of 10% Ammonium Persulfate (APS) (Amresco) and 15μL of TEMED (Progen) were added. The gel solution was again thoroughly mixed and injected between the tilted plate assembly with a 5OmL syringe. Once the gel was poured the plates were levelled and a 48 well comb inserted. A clamp was placed over the comb and the gel left to set. After 1 Vi to 2 hours the gel solidified and was placed in a 4200 LI-COR automated sequencer. Following loading of the samples the LI-COR was run at scan speed 3, 45 watts (W) and 5O0C, according to manufacturers instructions.
1.10.3 Preparation of 4% acrylamide/bisacrylamide sequencing gel
The 41cm gel was prepared by mixing 13. Ig of urea, 6.3mL of 5x TBE, 3.ImL of PAGE 1 Sequencing Gel Mix (19:1) and water to a final weight of 35g. After mixing 210μL of 10% APS and 25μL of TEMED were added. The gel was poured and run as previously described, apart from the use of a 32 well comb when appropriate and the sequencer running at 31.5W.
1.10.4 Preparation of long ranger acrylamide sequencing gel
The 66cm gel was prepared by mixing 18.9g of urea, 10.8ml of 5x TBE, 3.6mL of Long
Ranger Acrylamide gel solution (50%) (Biowhittaker Molecular Application) and water up to a weight of 50.7g. Once the solution was mixed 30μL of TEMED was added, followed by 300μL of 10% APS. The solution was quickly mixed and poured as previously described, except for the use of a 32 well comb. The gel was run at 31.5W and 500C as per manufacturers directions.
1.10.5 Analysis of polyacrylamide gel results
Analysis of microsatellite gels was performed using the program RFLPScan Plus Version 3.12 software (Scanalytics). Sequencing gels were analysed using the LI-COR analysis programs Base ImagIR Image Manipulation (v4.00), Base ImagIR Image Analysis (v4.10), and SCF File Creation (V4.10) (LI-COR).
The chromatograms of the sequences were visualized using Sequencher Demo version (Gene Codes, www.genecodes.com), and manual editing performed when necessary. The text files containing the sequence were analysed using a BLAST search (Altschul et al. (1990), Journal of Molecular Biology 215(3): 403-10) to confirm amplification of the target region. Multiple sequences were aligned using the ClustalW program at Biomanager (Thompson J.D. et al (1994), Nucleic Acids Research 22: 4673-80; http://biomanager.angis.org.au/). Finally, contigs of overlapping sequences were created using the program GeneDoc (Nicholas et al (1997), EMBO NEWS 4: 14; www.psc.edu/biomed/genedoc/) .
Example 2 — Sequencing of the equine angiotensin-converting enzyme gene 2.1 Primers and procedures The sequence of the equine ACE gene was developed by designing primers based on comparative sequence information available from the human, rat, rabbit and chicken. Alignment of cDNA sequences of these species (Accession Nos: J04144, AF201332, L40175 and X62551) obtained through Genbank gave conserved regions from which primers to amplify the equine ACE gene could be designed. Primers were used originally to amplify 2 exons of genomic DNA(exons 5 and 8), from which horse specific primers were designed.
Table 4 lists the primer sequences and Table 5 the PCR conditions used for each primer pair to determine the sequence of the equine ACE gene. Table 6 shows the primer combinations and conditions used to obtain the cDNA sequence, and Table 7 shows the specific PCR primer pairs used to genotype the detected polymorphisms. To visualize products on a LI-COR automated sequencer, 1 of 3 Ml 3 sequences (Ml 3-29, -38 or -rev, Table 4) was added to the 5' end of at least one of the primers in a pair [Oetting, 1995 #273]. The Ml 3 tail sequence was identical to that of the corresponding M13-IRD primers, which were labelled with an infrared dye (IRD) of the 700 or 800 wavelengths. The PCRs were performed in reactions of 25 μL containing approximately 20ng of purified DNA, 1 x PCR buffer, varying MgCl2 concentrations (Tables 5, 6 and 7), 200mm of each dNTP, 5pmol of each primer, and 1 unit of Taq polymerase. Thermocycler conditions were set to an initial denaturation of 950C centigrade for 5 mins, 30 to 45 cycles (Tables 5, 6 and 7 ), of 95°C for 30s, annealing temperature for 30s (Tables 5, 6 and 7 ), 72°C for 60s, and a final extension of 5mins at 72°C. For some reactions a touchdown program was used instead of the previous program: initial denaturation at 950C for 5mins, 5 cycles of 95°C for 45s, 680C for 1 min 30s (-2 degrees per cycle), 72°C for 1 min, followed by 4 cycles of 95°C for 45 s, 58°C for lmin (-2 degrees per cycle), 72°C for lmin and 25 cycles of 95°C for 45s, 50°C for lmin, 72°C for lmin, with an additional final extension of 72°C for 5min.
Table 4: Primers used for PCR to sequence the equine ACE gene.
The position for each primer is shown in Figure 1. All primers were used for sequencing of PCR product with the exceptions of Aceexlrev, AceI14rev Aceex26for, which were used for direct BAC sequencing. Aceexlrev and AceI14rev were manufactured without modifications, while Aceex26for was created with an IRD700 label. Ml 3 tail sequences as follows: M13-29 sequence - lower case, M13-38 - lower case bold; and M13-rev in uppercase BOLD.
Primer Name Sequence 5' to 3'
Aceexlrev TGGGTGATGTTGGTGACG
Acel.3 cacgacgttgtaaaacgaccGCACGACACCAACATCAC
Acels.7 cacgacgttgtaaaacgacCTGCTGCCACCGCCGC
Acelint.2 tttcccagtcacgacgttgGAGCCAGCCTCATCCTTCG
Ace2.1 GAGGAAGMRGCCCTGMTCA
Ace2int.l cacgacgttgtaaaacgacTTCATCGCTAACATTTTCTCG
Ace2int.2 tttcccagtcacgacgttgCAGTCAGGACCCCTACAGA
Ace3.2 tttcccagtcacgacgttgGCAGGTGGCAGTCTTGTT
Ace3int.l GGATAACAATTTCACACAGGGCTCTGGTGAAGGCTGTTA
Ace4.2 tttcccagtcacgacgttgGTTGTGCCAGCCCTCCCA
Ace4sint.4 tttcccagtcacgacgttgCTCGGCGTGTGTGGATA
Ace5.1 CCTACTGGCGCTCCTGGTA
Ace5.2 cacgacgttgtaaaacgacTGGGTCCCCTGAGGTTGAT
Ace5.3 GTATGAGTCGCCCACCTTCAT
Ace5.4 tttcccagtcacgacgttgGAGCACCTCTACCATCAAT
Aceό.l cacgacgttgtaaaacgacCGATGTCACCAGCACTATG
Ace7.1 tttcccagtcacgacgttgAAYGCCACRCACATGTTCC
Ace7.2 CTGAAGTCTTTTCTGTTGTAGAAGTCC
Aceδ.l GATYAAGCAGTGCACRCRGGT
Ace8.2 cacgacgttgtaaaacgacTGTCATTGGYRACACGGTCRAG
Ace8.3 TGCACGCGGGTCACTCTA
Ace8.5 cacgacgttgtaaaacgacGTCTCCACCCCTACACA Primer Name Sequence 5' to 3'
Ace9.2 CGAAGATACCACCAGTC
Ace9int.l cacgacgttgtaaaacgacGCTAAATCAGCCTGTGTGC
Acell.l cacgacgttgtaaaacgacGCACCAGTGTGACATCTA
Acell.2 tttcccagtcacgacgttgGCCCCTGCCTTGGTGGAC
Acel2.3 cacgacgttgtaaaacgacCAGGAGCAGAACCAGCAGAA
Acel2.2 ATGCCYTCYGGGTAGTTGT
Acβl3.1 cacgacgttgtaaaacgacCTGCCCAGCCTCCTCTTC
Acel3.2 tttcccagtcacgacgttgTGGGCTCTGGGCTGATGTCT
AceH.l cacgacgttgtaaaacgacGCTGGTGAGTGATGAGGC
Ace 14.2 tttcccagtcacgacgttgCGGTCATACTCCTCCACGA
Acel4int.l cacgacgttgtaaaacgacTCTTTCCCTCCTTCCCTT
Acel4int.3 cacgacgttgtaaaacgacCAGGCAAAGACGGCAACT
AceI14rev AGTTCTCTGTGGCTCCTCTTGA
Acelδ.l cacgacgttgtaaaacgacGCAAATAGCCAACCACACC
Acel5.2 tttcccagtcacgacgttgGTCCTGAACCTTCTTTATGA
Acel5int.2 tttcccagtcacgacgttgCAAGAGGACGGTTCAGAGGC
Ace 15 int.5 cacgacgttgtaaaacgacGCCTGCTGCCTCTCTTCTT
Ace 16.1 cacgacgttgtaaaacgacATGGAGACCACTTACAGCGT
Acelόint.l cacgacgttgtaaaacgacAGAGCCAGAGGCATAAACATT
Acel6int.2 tttcccagtcacgacgttgTTCCCTTCTATTTGTCATTGT
Acel6int.3 cacgacgttgtaaaacgacCCGAAATAAGGAGAGTGAG
Acelόint.l 2 GGATAACAATTTCACACAGGGGGGCTGCTTCTAAGTGGT
Acel7.1 cacgacgttgtaaaacgacGCTGGCGAGACAAGGTGG
Acel7.2 tttcccagtcacgacgttgCCACCTTGTCTCGCCAGC
Acel7int2 tttcccagtcacgacgttgAGAGCCAGTGATGCCAG
Acelδ.l GATGCAGGGGACTCGTGGA
Ace 18.2 cacgacgttgtaaaacgacAGCAGGTGAGCAGGAATGGG
Ace 18.3 cacgacgttgtaaaacgacCCGCTCTACCTGAACCTGC
Acelδint.l cacgacgttgtaaaacgacATAGGAGCGTGAGGAAGGGG
Acel8sint.3 cacgacgttgtaaaacgacTGGTTCGCCTCACCCTGT
Ace 19.2 tttcccagtcacgacgttgCGTGGGGGCTGAAGGGAA
Ace20.1 cacgacgttgtaaaacgacGCCCAGGAGGATGTTTAAGGA
Ace20.2 CTTGCCGTTGTAGAAGTCCCA
Ace20int.l cacgacgttgtaaaacgacGCTTGCCCATTGGATTCT
Ace20int.2 tttcccagtcacgacgttgGGTAGGGAGAGGGTGTTGA
Ace20int.3 cacgacgttgtaaaacgacGCAGTAAGGACAGCAGTT
Ace21sint.l cacgacgttgtaaaacgacGGGATAAAGAAGGGGCAG
Ace21int.2 tttcccagtcacgacgttgCCCCATTATTCACCATTG
Ace22.1 cacgacgttgtaaaacgacAGCAYGACATCAACTTYCT
Ace22.2 tttcccagtcacgacgttgCTCCACCACTCCTGGTTGT
Ace22sint.4 GGATAACAATTTCACACAGGGCACACTCACACAGACACC Primer Name Sequence 5' to 3'
Ace23.1 cacgacgttgtaaaacgacAAGGTGACTTTGACCCAGG
Ace23.2 tttcccagtcacgacgttgGCCCCTGGGTCAAAGTCA
Ace23int.l cacgacgttgtaaaacgacAGCCTCAGTTTCCTCACCT
Ace23int.2 tttcccagtcacgacgttgGTCCCTTCCACGCCTCC
Ace23int.3 cacgacgttgtaaaacgacCTCCAACCACCCGCACTC
Ace24.2 tttcccagtcacgacgttgCGTGGAACTGGAACTGGA
Ace25.1 cacgacgttgtaaaacgacCCGCTGATGGACTGGCTC
Ace25int.l cacgacgttgtaaaacgacCTCCCCAGTTCAGGCAT
Ace25int.2 tttcccagtcacgacgttgGCTTCCCTCTCCTTGCTC
Ace26.2 tttcccagtcacgacgttgAGGAAGAGCAGCACCCAC
Ace26int.2 GGATAACAATTTCACACAGGGTGTTCCTGTCCCTGTCC
Aceex26for CCTGGGCTTGAACCTGGAG
Table 5: PCR conditions used to generate equine ACE sequence.
Details include MgCl2 concentration, annealing temperature and the number of cycles used for each primer combination, in addition to the details of any conditions used to optimise the amplification of a single product for sequencing.
Figure imgf000039_0001
Figure imgf000040_0001
Table 6: PCR primers and conditions used to amplify equine ACE cDNA.
Figure imgf000041_0001
Table 7: Primer sequences used for PCR to screen the equine ACE gene.
The position for each primer is given in Figure 1. M13 tail sequences as follows: M13-29 sequence - lower case, M 13 -38 - lower case bold; and M 13 -rev in uppercase BOLD.
Primer Name Sequence 5' to 3'
Ace5utrfor.1 cacgacgttgtaaaacgacCTGTGAGAGCCCTGACCTAAG
Aceexlrev.6 GGATAACAATTTCACACAGGTCCTGGGTGATGTTGGTGA
Acelsint.l cacgacgttgtaaaacgacTGAGACAGATTCCCCCAG
Ace2int.1 cacgacgttgtaaaacgacTTCATCGCTAACATTTTCTCG
Ace2int.2 tttcccagtcacgacgttgCAGTCAGGACCCCTACAGA
Ace4.2 tttcccagtcacgacgttgGTTGTGCCAGCCCTCCCA
Ace5.1 cacgacgttgtaaaacgacCCTACTGGCGCTCCTGGTA
Ace5.2 cacgacgttgtaaaacgacTGGGTCCCCTGAGGTTGAT
Ace5.3 GTATGAGTCGCCCACCTTCAT
Ace5sint.l cacgacgttgtaaaacgacTCGGGAACACAGAGCACT
Ace5sint.2 tttcccagtcacgacgttgGAGTGCTCTGTGTTCCCGA
Ace6sint.2 CACCAGGGGGTCCTAAAG
Aceδ.l GATYAAGCAGTGCACRCRGGT
Ace8.2 cacgacgttgtaaaacgacTGTCATTGGYRACACGGTCRAG
Ace8.5 cacgacgttgtaaaacgacGTCTCCACCCCTACACA
AceISfor cacgacgttgtaaaacgacTTGTTTCTGCCTCACTGC
AceISrev ATTGATGTCGCTTTCTGTC
Ace9s.l cacgacgttgtaaaacgacGACAGAAAGCGACATCAAT
Ace9.2 CGAAGATACCACCAGTC
AcelOsint.l cacgacgttgtaaaacgacCTGGTTGGGCTTCTGTCC
Acelθsint.2 tttcccagtcacgacgttgGCAGGGGACTAAAGGTG
Acel lsint.2 tttcccagtcacgacgttgGTCTCAGGCTGGAGTTCAC
Acel2s.5 cacgacgttgtaaaacgacGCAAGAGGTGCTGAAGGA
Acel3s.3 cacgacgttgtaaaacgacTCAACCAGGGAACAACCAGC
Acel3s.4 tttcccagtcacgacgttgTGCCTGGCTGGTTGTTC
Acel4sint.6 ACCCCCAAGGGAAGGAGG Primer Name Sequence 5' to 3'
AceI14for cacgacgttgtaaaacgacTGCTGTGGTAGGCGTCCC
AceI14rev AGTTCTCTGTGGCTCCTCTTGA
Acel5int.5 cacgacgttgtaaaacgacGCCTGCTGCCTCTCTTCTT
Acel6int.2 tttcccagtcacgacgttgTTCCCTTCTATTTGTCATTGT
Acel6int.3 cacgacgttgtaaaacgacCCGAAATAAGGAGAGTGAG
Acel6sint.5 cacgacgttgtaaaacgacCATCTGCTCCCTCTCCGT
Acel6sint.6 GGATAACAATTTCACACAGGGCTCACTCTCCTTATTTCGG
Acel6sint.7 cacgacgttgtaaaacgacGCCCAACTCCCACATTAG
Acel6sint.8 GGATAACAATTTCACACAGGCCCACTGACACCAAAATC
Acelόsint.lO GGATAACAATTTCACACAGGAGCCCTTCGCTCACCTC
Acel6sint.l3 cacgacgttgtaaaacgacGCTCCTGTTCAATCTTCACC
Acel6sint.l4 tttcccagtcacgacgttgAGGGTATGGCACAGGGAG
Acel6sint.l5 cacgacgttgtaaaacgacCCCACCCTTTCTCCTATT
Acel7s.3 cacgacgttgtaaaacgacTATGAAGAACTGTTGTGGGC
Acel7int.2 tttcccagtcacgacgttgAGAGCCAGTGATGCCAG
Acel8s.4 CAGGTTGACGTGTTGTGG
Acel8sint.3 cacgacgttgtaaaacgacTGGTTCGCCTCACCCTGT
Ace20.2 CTTGCCGTTGTAGAAGTCCCA
Ace20s.3 cacgacgttgtaaaacgacAAGCCAACTGATGGACGG
Ace20int.3 cacgacgttgtaaaacgacGCAGTAAGGACAGCAGTT
Ace20sint.4 CTGAGCCTCTGTTACTGGTGA
Ace21sint.l cacgacgttgtaaaacgacGGGATAAAGAAGGGGCAG
Ace21int.2 tttcccagtcacgacgttgCCCCATTATTCACCATTG
Ace22sint.3 cacgacgttgtaaaacgacACAGAGGCACAGCACGCA
Ace22sint.4 GGATAACAATTTCACACAGGGCACACTCACACAGACACC
Ace23sint.4 TGTCAAAAGAGTGAAGCAATGG
Ace23sint.5 cacgacgttgtaaaacgacCTCCAACCACCCCACTCTC
Ace24sint.2 CGCTCTACCAGCCTGAACTT
Ace24sint.3 cacgacgttgtaaaacgacATGTGCCATCTCCAGTG
Ace25int.l cacgacgttgtaaaacgacCTCCCCAGTTCAGGCAT
Ace25int.2 tttcccagtcacgacgttgGCTTCCCTCTCCTTGCTC
Ace26.4 GAGGCTGGTGGAGGCTGTA
Ace26int.2 GGATAACAATTTCACACAGGGTGTTCCTGTCCCTGTCC
Each PCR reaction was conducted in the required number of wells of a 96-well PCR plate, and overlaid with a drop of mineral oil to prevent evaporation. PCR products were visualized on ethidium bromide stained 0.8-4% agarose gel before they were cleaned up for sequencing using 2μL of the enzyme ExoSapIT (Amersham Pharmacia) for lOμL of product. This was incubated for 45min at 37°C, followed by 15min at 800C for enzyme inactivation. The products were sequenced based on the method developed by Sanger [Sanger, 1977 #184] using SequiTherm Excel II DNA sequencing kits - LC (Epicentre Technologies, catalogue numbers SE9101LC and SE9202LC) and IRD- labelled primers. For each reaction, 2μL of each ddNTP mix was placed in 4 separate wells of a 96-well PCR plate. A bulk mix was made with IX buffer, either 2ρmol of IRD700 or 3pmol of IRD800 primer, 5 - 7μL of purified PCR product, 4U of SequiTherm Excel II Polymerase and water to a total volume of 17μL. 4μL Of bulk mix was then added to each of the 4 wells, followed by a drop of mineral oil. Unless otherwise stated the sequencing cycle consisted of initial denaturation for 5min at 950C, followed by 45 cycles of 95°C for 30s, 6O0C for 15s and 700C for 60-12Os. All sequencing products were mixed with the provided loading buffer and loaded onto a 41 or 66cm polyacrylamide gel as per manufacturers instructions. Electrophoresis and analysis was performed using a LI-COR 4200 automated sequencer.
Sequencing of PCR product was used extensively to determine the nucleotide sequence of the gene, while direct sequencing of the BAC DNA or a subclone was used where PCR was not suitable. cDNA was also sequenced to confirm the locations of many of the exon/intron boundaries.
2.2 Structure
The gene encoding for equine angiotensin converting enzyme was characterized by sequencing genomic and BAC DNA. The entire coding sequence (4184 base pairs) of the equine ACE gene (Figure 2; SEQ ID NO:2) has been developed within 20 499 bp of surrounding sequence (Figure 1; SEQ ID NO:1), and the putative encoded amino acid sequence determined (Figure 2; SEQ ID NO:3). As in the human gene, the equine ACE gene contains 25 exon/intron boundaries with an average intron length of 650 bp. Four introns are large (over 2 kb) and, with the exception of intron 16 (Figure 3; SEQ ID
NO:4), have not been fully sequenced. The ACE gene encodes two enzymes of 1313 and
737 AAs length, creating the somatic and testicular isozymes.
The nucleotide and amino acid sequences showed a high level of homology with other species. Also apparent in the equine gene was the internal level of homology, caused by the duplication of one half of the gene prior to mammalian radiation in evolution. This was seen both in the nucleotide content of the two domains of the gene, and in the exon intron structure, with exons 4 - 11 and 17 - 24 mirroring each other in size. The two active sites were also identified in the equine gene, with the C-terminal site differing slightly in sequence to all other species, although this is not thought to have an effect on the activity of the site. The high level of homology of the equine ACE enzyme with other mammalian ACE enzymes indicates that it plays a similar physiological role in all species examined. 2.2.1 Equine ACE promotors
Both the somatic and testicular promotors were identified within the equine sequence as containing promotor elements conserved with other species. While the actual elements regulating transcription of the somatic enzyme were not determined, two SPl elements were conserved between the horse, human, mouse and rabbit. As these elements have been shown to be functional in the human, mouse and rabbit, it is likely that they are at least partially responsible for driving transcription of equine sACE. The equine tACE promotor also showed high homology to the equivalent promotor in other species, with the TTATT box and CRE-like sequence identified. This sequence has been identified in a number of genes in which expression is testis specific, and binds to a testis-specific CRE modulator, activating transcription in response to cyclic AMP (Howard et al. (1993), Molecular and Cellular Biology 13(1): 18-27.).
2.2.2 Testicular ACE
Although the testis-specific cDNA was not obtained in the horse, an exon highly homologous to exon 13 was identified. An ACE-like protein has been previously identified in equine testis (Dobrinski et al. (1997), Molecular Reproduction and Development 48: 251-60), and ACE activity has been measured in stallion spermatozoa, seminal plasma and testis (Ball et al (2003), Theriogenology 59: 901-14). The 13 amino acids determined from the ACE-like protein (which differed slightly to other species ACE sequence) are identical to amino acids 182-194 in equine tACE. It is therefore very likely that the tACE isozyme is expressed in the horse. Sequencing of the somatic ACE cDNA confirmed that exon 13 is excluded from the somatic transcript, as is the case in the human, rabbit and mouse.
2.2.3 Equine ACE introns The size of the introns was similar to the corresponding human introns, although they showed little sequence homology, with the exceptions of introns 12 and 16. While similarity was expected between the two species intron 12 as this contains the promotor region for tACE, the homology in intron 16 was unexpected. An equine repetitive element was also identified in intron 14. 2.2.4 Intron 16
The sequence between 537 - 563 and 641 - 853 bp in the equine intron 16 showed 85% homology with the corresponding human intron. This area includes an 18 bp region (bp 761 - 778; Figure 3) that is identical between the human, rat, mouse and equine introns. It is possible that at least part of this region is a transcriptional element, such as an enhancer or silencer. It is also possible that this region may form part of the RNA regulatory network. The identification of two potential binding sites in intron 16 for transcriptional activators promotes a theory that the folly conserved 18 base sequence may play a role as a binding site for a sequence-specific transcriptional activator protein. This protein could interact with the basal transcription apparatus, stimulating or blocking transcription. The first site (AAATAGAA) just prior to the fully conserved 18 base sequence was recognised as a binding site for Broad complex 2 binding site. This zinc-fmger protein mediates protein- to-protein interaction and drives metamorphosis in Drosophila melanogaster (Crossgrove et al. (1996), Developmental Biology 180(2): 745-58; Chen et al. (2002), Mechanisms of Development 119(2): 145-56).
The second site, AAAT AAACAGGA spans most of the fully conserved 18 base sequence and was identified as a Hepatocyte nuclear factor-3 / Fork head Homologue (HFH-3) binding site. This group of proteins share homology in the winged helix DNA-binding domain and have been implicated in cellular differentiation during development and cell type specific gene regulation (Overdier et al. (1997), The Journal of Biological Chemistry 272(21): 13725-30). Both the Broad complex and HFH-3 factors were homologous to the antisense (AS) strand of intron 16.
Example 3 - Detection of polymorphisms in the equine angiotensin-converting enzyme gene The primary areas considered for screening were coding DNA, the promotor region and intron 16 (Figure 3; SEQ ID NO:4). Although not all exons could be screened, a large amount of intronic DNA flanking the exons was included. Sequencing of pooled DNA was employed to allow screening of a larger number of animals. Polymorphisms were detected by comparing the sequencing traces of a single animal to that of 3 breed pools, composed of 10 Thoroughbreds (TB)5 14 Arabians (AR) and 10 horses of mixed breeds (MB). Common polymorphisms were typed across a panel of 40 horses to obtain allele frequency information and haplotype reconstruction was carried out. The panel included the 10 TBs and 10 ARs screened in the pools, in addition to 10 Standardbreds (SB) and 10 heavy horses (HH). An additional group of 62 TBs of UK origin was also typed for an association study described in Example 5.
3.1 Sampling of horses
Blood samples were collected and DNA extracted, as described in Example 1, from 89 racing and 3 non-racing Thoroughbreds, 14 racing Arabians, 10 non-racing Standardbreds, 10 heavy horses {8 Clydesdales (CD) and 2 Shires (SH)}, 2 ponies and 2 Quarter Horses (QH). From these samples 3 pools of DNA were created, namely TB, AR5 and a mixed breed pool containing 2 TBs, SBs, QHs, CDs and ponies. Additionally, samples from 10 individual horses per breed (TB, AR, SB and HH) were assembled to represent the multi-breed panel as described below.
3.1.1 Thoroughbred pool
To ensure that the TB pool of 10 horses would represent a wide genetic base, the pedigree
5 of each horse was obtained to the 5th generation from the Thoroughbred studbook
(www.studbook.org.au). Closely related horses such as those sharing sires were eliminated, leaving a subset of 30 animals. Their relationships were used to calculate the inbreeding coefficient (Tier 1990) for each horse in an attempt to identify the most heterozygous horses in the sample. The 10 horses with the lowest inbreeding coefficients,o that also showed the least relatedness to each other, were selected for the pool.
3.1.2 Endurance Arabian pool
Only two generations of pedigree were available which were visually analysed to prevent the use of closely related animals. The Arabians were selected as those that regularly compete successfully at distances over 80 km. 5 3.1.3 Mixed breeds pool
The mixed breed pool was composed of 2 horses each from the following breeds: CD, SB, TB, QH and ponies. Pedigrees were not investigated to any major extent for this pool.
3.1.4 Multi-breed panel o The multi -breed panel of 40 horses included 10 of the TBs and ARs used in the pools, as well as 10 HHs and 10 SBs. The pedigrees of the SB horses were only available to 2 generations, and no pedigrees were available for the HHs. However, information was obtained as to each horses history (stud of origin) and animals with the least likelihood of being related were selected for inclusion in this study. 5 3.1.5 UK Thoroughbreds
The final group of horses genotyped in this chapter are the subjects of an association study described in Example 5. Details of the selection of animals and collection of samples are described in (Coomer et al (2003), Equine Veterinary Journal 35(1): 96-98). In summary, 7 racing stables situated in the Newmarket region of the UK participated in0 this study, allowing the collection of samples from 203 TBs. The blood samples were collected as described in Example 1, and much of the serum removed following centrifugation for ACE measurement. The remaining blood cell fractions were stored at - 8O0C until they were imported into Australia for DNA extraction. 3.2 Creation of DNA pools
Following extraction, the DNA was quantified using spectrophotometric analysis (Maniatis et al. 1982) (Bio Photometer, Eppendorf) as described in Example 1 and working solutions of 20 ng/μL were created. To compare the quality and confirm the s concentration of the DNA samples, an aliquot of the final working solutions were run on a 1% agarose gel. PCR was performed on individual samples to ensure that amplification was consistent in all DNA samples. Once the solutions were of equal concentrations and quality, 30μL of working solution was used from each of the animals to create the three pools. o 3.3 Primers
Previously generated equine sequence (Example 2 - Figure 1) and the program Primer Premier 5 were used to design primers as described in Example 1. All forward primers and most reverse primers were manufactured with an Ml 3 tail (-29 for forward primers, -38 or -rev for reverse primers) on the 5' end for sequencing. Primers were positioned tos improve the chances of discovering functional polymorphisms. The full list and positions of primers used is given in Table 8 and Figure 1 respectively.
3.4 PCR and sequencing
The PCRs were performed in 25 μL reactions containing 20 ng of genomic DNA, 1 x PCR buffer, specific MgCl2 concentrations, 200μM of each dNTP, 5pmol of each primer and0 IU of Tag polymerase as described in Example 1. Additives such as 1% Tween 20 and NP40 were also used as indicated to improve PCR quality. Dimethyl sulfoxide (DMSO, 4%w/v) was used in the sequencing of the 5' UTR and exon 1 as this area is GC rich. Thermocycler conditions were an initial denaturation of 950C for 5 mins, 30 to 45 cycles of 950C for 30s, annealing temperature for 30s, 720C for 60s, and final extension of 55 mins at 720C. Specific MgCl2 concentrations, annealing temperatures, number of thermocycles and any special conditions for each primer pair are given in Table 8.
Five μL of the product was added to 3μL of loading buffer and electrophoresed before visualization on a 2% agarose gel stained with ethidium bromide (Example 1). When a single well-defined band was amplified, the product was cleaned up and sequenced as described in Example 1. All PCR products were sequenced in the 3 pools and one single animal for comparison purposes. The sequencing was either carried out on a LI-COR automated sequencer, or sent to the Millennium Institute, Westmead Hospital, NSW, Australia. Table 8: PCR conditions used to screen specific areas of the equine ACE gene for polymorphisms.
Details include the MgCl2 concentration, annealing temperature, number of cycles and additives used for each primer combination.
Figure imgf000048_0001
3.5 Polymorphism analysis
Polymorphisms were identified using the program Sequencher, Demo version (Gene Codes). The .scf files generated by the LI-COR sequencer and .abl files generated by the ABI sequencer were imported and aligned in Sequencher. By comparing the 5 chromatograms of pooled sequence with that of a single animal, base changes could be identified as differences in the sequencing pattern. Sequencing was repeated when a possible base change was identified to confirm its presence. Once a base change was verified, all the individual animals within the breed panel were genotyped to gain frequency information. Genotyping of individual animals in the multi-breed panel was byo PCR-RFLP (restriction fragment length polymorphism), fragment length analysis, and direct SNP typing as described below.
3.5.1 PCR-RFLP
All identified SNPs were examined to determine whether they modified a restriction site, thus causing a difference in the restriction pattern as seen after digestion ands electrophoresis. In total 3 SNPs were screened in this manner as described below.
3.5.1.1 SNP 1 RFLP: Intron 5 A to G RFLP using Nspl
A polymorphism identified in intron 5 was found to eliminate an Nspl restriction site. The restriction enzyme Nspl (Genesearch) was therefore used to genotype samples for the A -» G polymorphism. The PCR was carried out with primers Ace5.1 and Ace5sint.2,0 2.ImM MgCl2, and a 35 cycle thermocycle with an annealing temperature of 59°C. Presence of the 620bp PCR product was confirmed by electrophoresis on 2% ethidium bromide stained agarose gel. Digestion of 8μL PCR product with 8U of Nspl at 37°C for 12hrs and electrophoresis on a 4% agarose gel resulted in fragments of 108, 110 and 405bp for allele A and 110 and 513bp for allele G. The two small fragments of similarS size overlap in agarose gel electrophoresis.
3.5.1.2 SNP 2 RFLP: Intron 8 G to T RFLP using BamHI
A polymorphism identified in intron 8 introduces a BamHI restriction site. The restriction enzyme BamHI (Promega) was therefore used to genotype samples for the G to T polymorphism. The primer combination of Acelδfor and AceI8rev in the usual recipe,0 including 0.85 mM MgCl2 and 1% Tween 20/NP40 were thermocycled with an annealing temperature of 520C for 45 cycles. The resultant 284 bp PCR product was digested with 8U of BamHI for 4 hrs at 370C. Fragments of 92 and 192bρ for allele G and 68, 92 and 124bp for allele T were evident after electrophoresis on a 4% agarose gel stained with ethidium bromide. 3.5.1.3 SNP 9 RFLP: Exon 26 G to A RFLP using Acil
As a polymorphism identified in exon 26 removes an Acil (Genesearch) restriction site this enzyme was used to genotype samples for the G -» A polymorphism. The exon 26 polymorphism was therefore genotyped using the enzyme Acil. Following successful amplification of the 325bp PCR product, (with primers Ace25int.l and Ace26.4, 1.3mM MgCl2, 1% Tween 20/NP40 for 35 cycles and an annealing temperature of 52°C), digestion was accomplished using 8U of Acil at 37°C for 6hrs. Electrophoresis on a 4% agarose gel gave fragments of 100, 185, 200 and 45bρ for the wildtype and 60, 100, 185 and 245bp for the SNP.
3.5.2 Genotyping by sequencing (SNPs 3, 4, 5, 6, 7 and 8)
A number of polymorphisms were identified that were not analysed by RFLP analysis since no enzymes were available. The following SNPs were analysed by sequencing: SNP 3: Intron 16 C→G, SNP 4: Intron 16 G→A, SNP 5: Intron 16 G→T, SNP 6: Intron 20 G→A→C, SNP 7: Intron 20 G→T, and SNP 8: Intron 21 C→A). Animals were genotyped for these polymorphisms by partial sequencing. Primer combinations were: Acel5int.5 - Acel6sintl4, Acel6int.3 -Acel6sint.8, Ace20s.3 - Ace20sint.4 and Ace20int.3 - Ace21int.2. Primer sequences and PCR conditions are as described in Table 7 (Example 2) and Table 8 (Example 3) respectively. A normal sequencing reaction was performed for each animal using only the nucleotides involved in the base change.
3.6 Fragment length analysis
A repeat sequence of variable length was identified in intron 14. To determine the size of an individual's alleles, fragment length analysis was performed. A PCR was carried out containing 20ng of genomic DNA, 1 x PCR buffer, ImM MgCl2, 200μM of each dNTP, 0.5pmol of IRD label, 5 pmol each of primers Acel4for(M13-29) and Acel4rev5 and 1 U of Taq polymerase. The thermocycling conditions included a 5min initial denaturation of 950C, and 40 cycles of 950C for 30s, 520C for 30s and 720C for 60s. A final extension of 5mins at 720C was performed at the end of the cycle. Three μL of the product was added to 7μL of loading buffer and run on a 41cm 4% polyacrylamide gel on a LI-COR 4200 sequencer as described in Example 1.
3.7 Results
Overall, 10.1 kb of sequence, including 3067 (73%) of the 4184 protein coding nucleotides were screened for base changes. A total of 16 sequence changes were identified (Table 9, below). Fifteen single nucleotide polymorphisms (SNPs) were found: 11 in non-coding sequence, 3 in coding sequence that did not cause an amino acid (AA) exchange (Exon 8 1155G to A5 Exon 18 2484A to G and Exon 26 3813C to T), and 1 causing an amino acid change (Exon 26 3872 G to A). A poly-A stretch of variable length was also identified in intron 14. The amino acid altering SNP changes an arginine to a histidine. At this stage the effect of this change on the tertiary structure of the protein is unknown.
When a polymorphism occurred in a cDNA, the variant was numbered according to its position in the coding sequence, where 1 is the first base of the start codon. An amino acid exchange is also numbered accordingly, with 1 the first AA in the mature peptide. The intron number and the bases involved in the change were used to identify a sequence variant in a non-coding region.
Table 9 - Summary of polymorphisms found in the equine ACE gene.
Figure imgf000051_0001
1 Only exonic SNPs are numbered according to cDNA position from start codon.
2 The breeds the variant occurs in only includes animals from my populations.
3 The allocated SNP number, for SNPs used to screen breed panel.
4 Seen in one single sample, and verified by bi-directional sequencing.
5 Seen in one single sample, and not verified by bi-directional sequencing. The occasional sequence change was identified only in the BAC or as singletons in individuals. When no evidence was seen in the DNA pools of that particular base change, it was not explored further. Rare alleles are unlikely to be of interest in the first instance in association studies, and pooling DNA targets the detection of polymorphisms of a reasonably high frequency that are common across breeds.
Example 4 - Characterisation of Polymorphisms
4.1 Regions targeted
The regions considered most important for screening were those that affect gene function, namely coding DNA and promotor regions. The ideal length of sequence for polymorphism detection was 500 - 600bp, with the quality of sequence trace degrading in products longer than this. Since most exons were around 200bp or less, sections of intronic sequence adjacent to protein-coding exons were included in the screen, accounting for the large amount of intronic sequence studied.
Exons 2, 5, 6, 8, 9, 10, 11, 13, 14, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 and 26 were examined, along with the surrounding intronic regions. A number of entire introns were screened, generally those of smaller size. Intron 16 was specifically included as this is the homologous location of the I/D polymorphism described in human ACE gene. Intron 12 was screened as it contains the testicular ACE promotor.
4.2 Identified polymorphisms Of the 15 identified base changes, 9 were found in more than one animal (SNPs 1 - 9, indicated in Table 9 above). These were genotyped across the panel of SB, AR, TB and heavy horses. The 62 UK TBs were also genotyped, with the results analysed further in the association study described in Example 5.
4.2.1 Intron 5 A → G (SNP 1) An A -» G transition was identified in intron 5. This variant was originally identified in a heterozygous TB. This polymorphism eliminates an Nspl restriction site, so this enzyme was used to genotype the samples. This SNP was seen in relatively low frequencies in the TB and AR sample only. Analysis of the allele frequencies between these groups showed there was no difference in frequency between the TB and AR populations.
4.2.2 Exon 8 1155G → A
A G — > A sequence variant was identified at position 1155 of the coding sequence in the BAC clone. This was a synonymous mutation and found in only one individual in the screened population. This SNP was not further investigated. 4.2.3 Intron 8 G -> T (SNP 2)
A G → T transversion was identified in intron 8. This variant was originally identified in the TB pool. The intronic polymorphism introduces a BamHI restriction site. The restriction enzyme BamHI was used to genotype samples for this polymorphism. The SNP allele was at high frequency in the two TB populations (36 and 48% respectively), at a lower incidence in the Arabians (9%), and not observed in the SBs or draught horses. The frequency of the SNP was significantly different in the different populations (P = 0.000), although this should be interpreted with caution due to the small numbers in most groups.
4.2.4 Intron 11 C → G
A C → G base change was identified in intron 11 of the gene in the BAC clone. This SNP was sequenced bi-directionally and is therefore verified. No evidence of this SNP was seen in the 3 pools of genomic DNA and this SNP was not further investigated.
4.2.5 Intron 14 poly-A region A polymorphic series of A nucleotides was identified in intron 14 of the ACE gene. Direct sequencing of the BAC clone in this area revealed 16 'A' nucleotides. Further analysis of this area was performed by PCR on the multi-breed panel and electrophoresis on a 41cm 4% polyacrylamide gel. All genomic samples gave 2 PCR fragments with lbp differences in length, and at least 3 alleles were evident over all 40 samples. To determine the actual number of 'A' nucleotides present in each individual, a subset of 4 samples was sequenced. Sequencing with BDT chemistry on the ABI sequencer (Example 1) indicated that the panel had alleles containing 12 - 14 A nucleotides. However, sequencing chromatograms showed some inconsistencies with the pattern seen on the gel. Although fragment length analysis indicated that the repeat was polymorphic, it is possible that the sequencing enzyme may have 'slipped' and the number of A nucleotides can not be assigned unambiguously. For this reason this polymorphism was not further investigated.
4.2.6 Intron 16 polymorphisms (SNPs 3, 4 and 5)
Four polymorphisms were identified in intron 16 of the gene. One, a C → T transition, was identified in 1 CD only and was not further investigated. The others occurred at higher frequencies in at least 2 breed groups. All horses were genotyped by sequencing as either no enzyme was available or it was excessively expensive compared with sequencing.
The first polymorphism, a C -» G base change (SNP 3), was originally identified in the heterozygous form in a TB, and found to occur only in the AR and TB samples. The second and third SNPs, a G → A transition (SNP 4) and G -> T polymorphism (SNP 5), were both originally detected in the endurance Arabian pool and were detected in all five breeds examined in the panel. The frequency of SNPs 3 and 4 differed significantly between the breeds (P = 0.005 and 0.015), while no significant difference in frequency was observed for SNP 5. However, low animal numbers and SNP allele frequencies may have affected the χ2 tests.
The 2095 bp equine intron 16 (Figure 3; SEQ ID NO:4) contains an area of sequence that is conserved with that of the human intron. The area stretches from bp 537 - 833, (with the first bp of the intron numbered 1). Relative to this, SNP 3 is located at bp 89, SNP 4 at 178 and SNP 5 at 1513, positioning SNPs 4 and 5 on either side of the conserved region within the intron.
Exon 18 2484A → G
An A — > G transition was observed in the BAC clone in exon 18. No evidence of this polymorphism was seen in any of the pools or individual animals sequenced over this area. This SNP is in a coding region but does not cause an amino acid exchange, and was not further investigated.
Intron 20 (SNPs 6 and 7)
Two polymorphisms were identified in an individual Thoroughbred in intron 20. The first (SNP 6) proved to be tri-allelic, from G in the wildtype sequence, to A or C. As it was tri-allelic, it was not suitable to type individuals with an enzyme, so all individuals were genotyped by sequencing. The second base change, a G — > T transversion (SNP 7), was in complete linkage disequilibrium with the C allele of the tri-allelic intron 20 marker. Since the two polymorphisms are only 56 bp apart, this is not unexpected.
The tri-allelic SNP only occurred in the TBs and ARs. The G and A alleles are the most frequent, with the C allele the rarer allele. The allele frequencies were found to be significantly different across all populations (P = 0.000), primarily due to the G and A alleles occurring at a much higher and lower frequency respectively in the ARs compared with the TBs. The frequency of SNP 7 was not significantly different between the populations.
Intron 21 C-»A (SNP 8)
A C — > A transversion was identified in intron 21 in the Thoroughbred pool. As no restriction enzyme was available this SNP was genotyped by sequencing. This polymorphism was observed in all breeds except the SBs. This SNP occurred at significantly different frequencies across the breeds (P = 0.000), with the UK TBs having the highest frequency of the A allele (58.9%), followed by the Australian TBs (45.8%), the ARs (25%), the HHs (5%) and the SBs (0%).
Exon 26: 3813C → T, 3872G → A (SNP 9), G -> A
Three polymorphisms were identified in exon 26. The first, 3813T — » C, was identified in one Quarter Horse. Although in coding sequence, this SNP did not cause an amino acid exchange. A G — >• A base change was also identified in a Clydesdale, occurring after the termination codon. Both SNPs were heterozygous and verified with bi-directional sequencing. However, there was no evidence of the presence of either of these polymorphisms in the pools suggesting a low frequency at population level in the TB, AR and mixed breed sample.
Another G -» A transition (SNP 9) was identified at position 3872 in exon 26. This variant was originally identified in the mixed breed pool. The three parents from the Newmarket Reference Family (Swinburne et al (2000), Animal Genetics 31: 237) panel were genotyped to investigate the possibility of linkage mapping the ACE gene. As none of the parents were heterozygous for the SNP, this was not performed. However, one of the parents was homozygous for the SNP and proved to be the only AA horse in the sample. This SNP was found at low frequency in the heavy horses and SBs, and not at all in the TBs or ARs. While the SNP genotype distributions indicated that the frequency of this SNP would be significantly different between populations, sample and allele frequency numbers were too low to calculate a P value.
This polymorphism changes a triplet codon from CGC to CAC, causing an amino acid substitution of 1255Arg -> His. The restriction enzyme Acil was used to genotype this SNP. The predicted pattern for the restriction digest was 100, 200 and 45 bp fragments for the wildtype and 100 and 245 bp for the SNP. However, an additional band was present at around 185 bp in all samples, and a fragment of approximately 60 bp also occurred only in the samples containing the A allele.
4.3 Haplotype analysis
To allow a more thorough investigation of possible associations between the ACE gene and phenotypic data, haplotypes were generated from the genotyping data derived from the multi-breed panel. The data was analysed using the program PHASE version 2.0.2 (Stephens et al. (2001), American Journal of Human Genetics 68: 978-89; Stephens et al. (2003), American Journal of Human Genetics 73: 1162-69), available at www.stat.washington.edu/stephens/software.html. This assigned the most likely haplotype combinations for individual polymorphisms screened in the population. 4.3.1 Statistical analyses for SNP frequency comparisons
Statistical analyses were carried out using MINIT AB® Release 14 (www.minitab.coirT). χ tests were performed to compare polymorphism frequencies.
The inheritance of the 9 common polymorphisms (SNPs 1-9) was studied and 9 haplotypes identified (Table 10) using the program PHASE version 2.0.2 available at www.stat.washington.edu/stephens/software.html. Haplotypes 3 and 4 were only observed once in the examined population.
Table 10 - Haplotype description and distribution across the multi-breed panel
(polymorphic nucleotides highlighted in bold)
Figure imgf000056_0001
From the 80 possible haplotype representations, seven non-unique haplotypes were identified. One haplotype (Hl) was represented 47 times, two (H6 and H7) 7 times, one (H2) 6 times, one (H9) 5 times, two (H5 and H8) 3 times and 2 (H3 and H4) were observed only once.
The distribution of both the SNPs and haplotypes differed across different breeds, with haplotypes 7, 8 and 9 only observed in racing Thoroughbreds and Arabian horses. Conversely, Haplotype 2, containing the only polymorphism that causes an amino acid exchange, has been found only in the heavier pulling breeds such as the Draught horses and Standardbreds. These haplotypes are thus associated with performance on a breed level.
Haplotype 6 was found at a frequency of around 5% in racing Thoroughbreds in a separate association study described further below. However, in a group of Arabian horses specifically selected for their excellent endurance racing records, this haplotype was found at the higher frequency of 15%. The frequency of this haplotype was also higher (10%) in the Standardbreds (which generally run in longer races than most Thoroughbreds) and Draught horses (which have been developed for heavy slow endurance work).
Example 5 - Association Analysis of The Equine ACE Gene
The association study was initiated after the paper 'Plasma angiotensin-converting enzyme (ACE) concentration in Thoroughbred racehorses' was published (Coomer,
R.P.C., AJ. Forhead, A.P. Bathe and M.J. Head (2003), "Plasma angiotensin-converting enzyme (ACE) concentration in Thoroughbred racehorses" Equine Veterinary Journal
35(1): 96-98). Consequently, the authors of this paper performed the collection of blood samples and analysis of plasma ACE levels. The cell fractions of the blood samples were stored at -8O0C until they were imported into Australia for SNP analysis.
5.1 Selection of horses
Two hundred and three Thoroughbred racehorses were sampled from 7 racing stables in the Newmarket area, England. They ranged in age from 19-23 months (n = 132), 31-35 months (n = 48), 43-47 months (n = 9) and older than 54 months (n = 14). All were in training, healthy, and receiving no medication at the time of sampling.
5.2 Sampling and assay methods for circulating ACE
Sampling and assay methods are described in Coomer et al (2003). The horses were sampled at rest in the early morning prior to feeding and exercise. Blood was sampled from the jugular vein into a 2mL heparinized tube, which was immediately placed on ice. The samples were then centrifuged at 3000 g for 5 mins, the plasma removed, and both the plasma and remaining cell fraction frozen on dry ice. They were stored at -8O0C until further analysis. Plasma from 12 horses was sampled twice and measured within one assay to estimate inter-assay variation.
5.3 Identification of horses in preliminary association study Upon arrival of the samples in Australia, horses with high and low ACE activity were identified for initial genotype analysis. A study of Plasma ACE vs Age indicated that ACE decreased with age. To accommodate this, a non-linear model of the form y = A + BRX + ε was fitted to the data (203 horses) using GenStat Version 7 (VSN International Ltd), where y = plasma ACE level; x = race age; ε = random error; and A, B, R are parameters to be estimated. The effects of sex, trainer and packed cell volume were also assessed and found to be non-significant. Residuals from the model were obtained (i.e. the age effect was removed), and horses with an ACE level ± 1 standard deviation (SD) from the adjusted mean were selected. Thirty-two horses were selected for the low activity group and 30 in the high group. These horses were genotyped for the 9 previously described SNPs (Example 3). 5.4 Genotyping
Genotyping was performed on the identified samples in the tails as described in Examples 1 and 3. The cell fractions of the samples were extracted as described in Example 1 using a QIAamp® DNA Blood Mini Kit. The horses were genotyped for the following SNPs: SNP 1 (intron 5 A→G), SNP 2 (intron 8 G→T), SNPs 3, 4 and 5 (intron 16 C→G, G→A, G→T), SNPs 6 and 7 (intron 20 G→A-→C and G→T), SNP 8 (intron 21 C→A) and SNP 9 (exon 26 3872G→A). The primer sequences and PCR conditions are listed in Tables 7 and 8, and PCRs were performed as described in Examples 1 and 3. The samples were genotyped either by sequencing or RFLP.
5.4.1 Genotyping by RFLP and sequencing
SNPs 1, 2 and 9 were genotyped using restriction digests as described in Example 3. The remaining 6 polymorphisms could not be genotyped with a restriction enzyme, so sequencing was used as described in Example 3. Partial sequencing using the nucleotides coding for the SNP was used to genotype SNPs 3, 4, 5 and 8. SNPs 6 and 7. A mix of 5.7μL of water, 3.2pmol of primer and 6μL of cleaned up product was sequenced using 'Big-Dye' Terminator (BDT) chemistry version 3.1 on an ABI PRISM 3100 Genetic Analyzer (Applied Biosystems).
5.4.2 Genotyping by microsphere hybridization
Following the association of haplotype 6 with low enzyme levels in the preliminary analysis of the tailed samples, the remaining 141 horses were genotyped for this haplotype. This involved SNPs 4 and 5, which were genotyped using microsphere based technology. Samples containing 30μL of 10-25 ng/μL DNA samples were sent to Genera Biosystems, Bundoora, Australia, in 96-well plates. Equine DNA for optimisation was supplied along with SNP allele and surrounding sequence information. Multiplex PCR was used to amplify the regions surrounding the two SNPs simultaneously; using phosphorylated forward primers and unmodified reverse primers. The unincorporated primers were removed from the PCR mix by digestion with Exonuclease I, before the forward strand was degraded by digestion with Lamda Exonuclease, which specifically digests dsDNA with a 5' phosphate group. The remaining reverse single stranded DNA from each individual product was bound to AmpaSand™ microspheres (beads) and hybridized with equimolar amounts of fϊuorescently labelled allele specific probes. The beads were analysed by flow cytometry (Becton-Dickenson FACSArray) and ShowPlots software (Genera Biosystems) was used to determine the individual genotypes. 5.5 Statistical analysis
5.5.1 Haplotype analysis
Most likely haplotypes were reconstructed from the genotype data of the UK horses as described in Example 4, using the program PHASE version 2.0.2 (www.stat.washington.edu/stephens/software.html) (Stephens et al. 2001) (Stephens et al. 2003).
5.5.2 Estimation of haplotype effect
For initial analysis of the horses within the high and low ACE level 'tails', χ2 tests were performed to identify a possible association of each haplotype with plasma ACE levels, This was carried out using the program MINIT AB® Release 14 (www.minitab.com).
Further analysis was performed to make full use of all the information available. For each of the five haplotypes, the effect of the haplotype (0, 1 or 2 copies) was assessed on the age-adjusted ACE phenotype. While ACE levels were available for all horses sampled, genotype information was available on only restricted individuals. Fitting a mixture distribution to the data that allowed for the three possible genotypes in the ungenotyped horses, but still used the observed genotypes from the 'tails' incorporated these 'missing genotypes'. For samples for which complete genotype information was available (i.e. all animals genotyped for a putative haplotype) a one-way analysis of variance (ANOVA) was used to determine the allelic effect size.
5.6 Results
5.6.1 ACE levels
The results of the study of equine ACE levels have been previously described (Coomer, R.P.C., AJ. Forhead, A.P. Bathe and MJ. Head (2003), "Plasma angiotensin-converting enzyme (ACE) concentration in Thoroughbred racehorses" Equine Veterinary Journal 35(1): 96-98). Briefly, plasma ACE levels of 203 racehorses were found to be 58.8U/L for 19 - 23 month old horses, 51.1U/L for 31 - 35 month old horses, 27.3U/L for those aged 43 - 47 months, and 23U/L for those over 54 months old. Intra- and inter-assay coefficients of variation were 3.6% and 3.8 (n = 10 and 18 assays respectively). Age was the only other environmental factor measured that had a significant effect on ACE expression, with both a higher mean level and greater within group variation at a younger age (Coomer et al. 2003).
5.6.2 Selection of horses for initial study
To investigate the association of ACE levels with polymorphisms in the equine gene, two sub-groups of horses were selected from the UK racehorses. The raw ACE levels were adjusted for age and scaled to a mean of 0 units. Horses with an adjusted plasma ACE level ± 1 standard deviation (SD, ±11 units) from this mean were selected for genotyping. Sixty-two horses were thus included in the preliminary study. These included 32 horses in the low range and 30 horses in the high range of plasma ACE concentration. DNA was extracted from these horses and they were genotyped for the 9 polymorphisms as described above.
5.6.3 Haplotype analysis
All SNPs were found to be in Hardy- Weinberg (HW) equilibrium. Phase 2.02 identified 5 haplotypes, all with a phase probability of 100%.
5.6.4 Preliminary $ analysis
The frequency of each haplotype was compared against ACE level using χ2 analysis. Table 11 shows the distribution of haplotypes between the 62 horses genotyped and the results of the χ2 tests. Initial analysis showed that haplotype 6 was significantly associated with low ACE levels, while haplotypes 7 and 9 had P-values indicating borderline significance. The frequency for haplotypes 1 and 3 were not significantly different between the high and low tails.
Table 11 - Characteristics of the 5 haplotypes within the subgroups of horses with high and low plasma ACE levels. The distribution of the haplotypes is shown across 62 horses within the high and low tails. The results of χ2 tests for association between haplotype and ACE levels are shown with significance achieved at 0.05 and indicated in bold text.
Figure imgf000060_0001
5.6.5 Mixture model analysis
A mixture distribution was fitted to utilise the phenotypic data available for all 203 horses instead of just the 62 individuals genotyped within the tails. This analysis also indicated that haplotype 6 was strongly associated with low ACE levels (Table 12). Mixture model analysis indicated that haplotype 6 is highly significantly associated with low ACE levels, with one copy of this haplotype accounting for an estimated 14.3 units decrease in ACE level (on the residual values). No animals included in the analysis were homozygous for H6 so no predicted effect of 2 copies on ACE levels could be estimated. The mixture model analysis also indicated that haplotypes 1 and 7 were associated with ACE levels, which were 3.6 to 4.0 units lower in animals heterozygous for either haplotype 1 or 7, compared to (homozygous) horses with 0 or 2 copies of haplotypes 1 or 7.
Table 12 - Estimated deviation from mean ACE level for 0, 1 or 2 copies of each haplotype based on the fitted mixture distribution model. The mean ACE level on residuals indicates the mean ACE level of the individuals with a particular haplotype compared to the mean residual ACE level (0 units) of the whole group. The likelihood test statistic and corresponding P-value is given for each test. Significance is achieved at 0.05, with significant values indicated in bold text.
Figure imgf000061_0001
5.6.6 Genotyping of all samples for haplotype 6
Following the identification of haplotype 6 by χ2 and mixture model analysis as a potential molecular marker for low ACE levels, the remaining 141 samples were genotyped for the two SNPs that comprise this haplotype (SNPs 4 and 5 in intron 16). These samples were genotyped using the microsphere hybridisation method described previously. A total of 192 horses were genotyped by this method, including 51 that had been previously genotyped. For the intron 16 G→A SNP, 94.3% of samples were successfully genotyped, which increased to 99.0% for the intron 16 G→T SNP. AU samples were genotyped for at least one SNP and the 51 repeated results were in agreement. The SNPs were in Hardy- Weinberg equilibrium and in complete linkage for the 194 horses that were typed for both sites. For the purposes of the analysis, the 9 horses that were missing a result for one SNP were designated the haplotype inferred by the typed polymorphism as they were assumed to be in complete linkage disequilibrium. Haplotype 6 was present 19 times in the UK population (frequency of 4.68%). 0 5.6.7 Association analysis of haplotype 6
The samples were analysed to determine whether an association existed between H6 and plasma ACE level using ANOVA on adjusted residual values. A highly significantly association was indicated (P = 0.000). The presence of a single H6 homozygote within the high range of activity suggested a non-additive response (Table 13). One-ways ANOVA revealed that H6 was responsible for 10.26% of the variation in ACE concentration. Analysis of the data without the homozygote outlier gave a slightly higher value (10.49%).
Table 13 - Distribution of haplotype 6 shown with mean residual ACE activity and standard deviation (SD). Mean residual ACE and SD are not applicable for the horse0 homozygous for haplotype 6 as it has a sample size of one.
Figure imgf000062_0001
5.7 Discussion
5.7.1 Haplotype analysis
Following age adjustment of the data, the animals with enzyme activity ranging further than 1 standard deviation from the mean level were selected as representing the high andS low ends of ACE activity. The selection and analysis was based on the residual values, as it proved difficult to fit a non-linear age model and then the haplotype effect on the raw data. Previously identified polymorphisms were used to screen the ACE gene. These polymorphisms are not inherited independently from each other, but are linked in genetic blocks or haplotypes (Clark 2004). Consequently, haplotype reconstruction of the data was used to assess the pattern of inheritance of the SNPs. Nine haplotypes have been previously identified, with 7 of these common to more than one animal (Examples 3 and 4). Five of these haplotypes were detected in the UK population of Thoroughbreds examined in this Example. Haplotypes 1, 7 and 9 were common to both the Australian and UK TB populations, while 3 and 6 were found only in the UK group. A further haplotype (H8) was identified in the Australian TBs but not seen in the UK group. The difference in haplotype distribution between the two populations is likely to be due to local breeding trends.
5.7.2 Preliminary and mixture model analysis
Haplotype 6 was identified as associated with ACE levels in preliminary analysis of the tails and the mixed model distribution. The predictions of the mixture model were confirmed by genotyping the remaining individuals for this H6, with the actual size of the effect (13.01 units decrease compared to residual mean of 0 units) shown to be very similar to the mixture model prediction (14.25 units decrease). This shows that the preliminary analysis and mixture model distribution was an accurate and cost effective alternative to genotyping all individuals for all SNPs. The mixture model indicated that haplotypes 1 and 7 might also have a minor effect on ACE levels.
5.7.3 Haplotype categorization of horses with missing genotypes
The microsphere genotyping system gave results for just over 96% of individuals. These horses were allocated the haplotype inferred by the genotyped SNPs, which is justified by the complete linkage disequilibrium (LD) of the 2 SNPs in 204 TBs (194 UK and 10 Aust). The 3 instances where the 2 SNPs were not in complete LD were in Standardbreds, a breed that has been developed from a more diverse genetic base than the Thoroughbred. The two breed populations have been separated by the introduction of closed studbooks for over 200 years.
5.7.4 Analysis of haplotype 6 Since only one horse was homozygous for H6, assessment of this genotype effect was impossible due to the lack of replicates, and this animal was omitted from the analysis. However, it is important to note that if this horse were left in the analysis, the haplotype would account for only 0.24% less of the total variation than the effect seen when excluding this animal. It is presumed that the low number of horses homozygous for this haplotype is due to the overall low frequency of the haplotype in the population (just under 5%) and a significantly greater and preferably unbiased sample of horses is required to study the full effect of genotype on circulating ACE level.
5.7.5 Possible mode of action of haplotype 6
The two SNPs defining haplotype 6 are positioned at bp 178 and 1513 within the 2095 bp equine intron 16 (Figure 3). This intron comprises a region of 222 bases from 537 - 853bp in the equine gene which shares significant homology with the human, rat and mouse ACE gene intron 16 sequences, including a fully conserved 18 base sequence (positions 761-778 of SEQ ID NO:4). Relative to this, the position of the human I/D insertion polymorphism is equivalent to base 1446 in the equine intron 16.
Without wishing to be bound by theory, it is believed that this area may encode for a transcription regulatory module. The conserved 18 base sequence corresponds to a likely binding site of transcription factor Hepatocyte nuclear factor-3 / Fork head Homologue (HFH-3). It has been proposed that this factor interacts with the basal transcription mechanism through physical proximity of the supercoiled structure of the DNA helix.
The presence of polymorphisms flanking the putative regulatory module that are associated with variation in equine ACE levels are therefore of specific interest. Either of these SNPs may change the tertiary structure of the intronic DNA, or might affect binding of other transcription factors to the site, modulating the effect of the potential regulatory unit by altering the binding pattern.
5.7.6 Other haplotypes associated with ACE level
Mixture model indicated that haplotypes 1 and 7 were also significantly associated with ACE (P = 0.031 and 0.040, respectively). As the mixture distribution uses more information than a simple χ2 test, it is a more powerful analysis, and its estimation of the effect of haplotype 6 was proven quite accurate. Haplotypes 1 and 7 appear to lower the activity of ACE when in the heterozygous form, but increase it in homozygous individuals. There are a number of possible explanations for this. There may be an interaction effect between haplotypes 1 and 7. Additionally, 7 horses are heterozygous for haplotype 6 (which is known to reduce ACE activity) with either 1 or 7, perhaps leading to an apparent decrease in expression associated with those haplotypes. Haplotype 1 contains the wildtype alleles at all polymorphic sites, while haplotype 7 consists of SNPs in introns 8, 20 (SNP 6, A allele) and 21, and there is no obvious molecular explanation for the effects seen in the heterozygotes of these haplotypes. However, the most likely reason for this observation is the small sample number. Table 14 shows that a larger number of horses classed as having high ACE activity are homozygous for haplotypes 1 and 7 (18), compared to the low group (10). Concurrently, there are 22 heterozygotes in the low group, including 11 1,7 individuals. This distribution may have occurred by chance, and the typing of more individuals is required to determine whether there is a real effect of either haplotypes 1 or 7 on enzyme IQYGL
Table 14 - Distribution of haplotypes in low and high ACE activity tails.
Figure imgf000065_0001
5.7.7 Identification of functional mutations While it is possible that the polymorphism causing the decrease in expression of ACE associated with haplotype 6 has not been discovered, the entire intron 16 has been screened using pooled DNA. Many areas have also been extensively sequenced in single animals, most notably the 1 - 200 bp flanking each polymorphism, and apart from those previously described in Examples 3 and 4, no other polymorphisms were detected in this study. Either SNP 4 or 5 may be the causative mutation and functional studies need to be carried out to determine this.
It is also likely that there are a number of polymorphisms within the equine ACE gene that have an effect on ACE levels that have not been discovered in this study. Polymorphisms have been identified both in the promotor and 3' region of the human gene that have a small effect on expression (Zhu et al. (2000), American Journal of Human Genetics 61: 1144-53; Zhu et al (2001), American Journal of Human Genetics 68: 1139-48). The mode of action for these is unknown, but interference with the recruitment of the basal transcription apparatus and proximity to the putative regulatory module in intron 16 were suggested. Any polymorphism that interacts with the regions controlling transcription of the gene may have an effect.
5.8 Conclusions
The results presented above indicate that at least one haplotype of the equine ACE gene is strongly associated with circulating ACE levels. This particular haplotype, defined by the presence of 2 SNPs within intron 16 of the gene, has the effect of lowering plasma ACE level by 10.5%. The presence of polymorphisms affecting enzyme activity within intron 16 of the equine gene further strengthens the theory that the first part of the intron contains a putative regulatory element, and the observed polymorphisms in intron 16 may interact with the efficiency of this regulatory element. Mixture model analysis indicated that two other haplotypes were also weakly associated with ACE levels, an effect that needs to be confirmed by genotyping all available samples and a larger population of horses. Repeated analysis of ACE levels from horses spanning six months indicated that basic ACE level is reasonably stable, although it is not known what environmental stimuli might trigger an acute response.
It will be appreciated that, although specific embodiments of the invention have been described herein for the purpose of illustration, various modifications may be made without deviating from the spirit and scope of the invention as defined in the following claims.

Claims

Claims
1. An isolated polynucleotide comprising an equine angiotensin converting enzyme gene having at least one of the following characteristics:
(a) a polynucleotide comprising the nucleotide sequence as shown in SEQ ID NO: 1 or its complement;
(b) a polynucleotide located on equine chromosome ECA I lpl3, and comprising at least about 23000 nucleotides; or
(c) a polynucleotide sharing at least 90% identity with the nucleotide sequence of (a) or (b).
2. An isolated polynucleotide encoding a polypeptide having the activity of equine angiotensin converting enzyme, wherein said polynucleotide comprises a nucleotide sequence as shown in SEQ ID NO: 2, or encodes a polypeptide comprising an amino acid sequence as shown in SEQ ID NO: 3.
3. An isolated nucleic acid molecule suitable as a probe or as a primer for specific amplification of at least a portion of the polynucleotide of claim 1.
4. An isolated nucleic acid molecule according to claim 3 selected from the following:
(a) intron 16 of the horse angiotensin converting enzyme or complement thereof; (b) a polynucleotide comprising the nucleotide sequence of SEQ ID NO:4 or complement thereof;
(c) a polynucleotide comprising at least 15 contiguous nucleotides of (a) or (b); and
(d) a polynucleotide sharing at least 90% identity with the nucleotide sequence of (a), (b) or (c).
5. An isolated nucleic acid molecule according to claim 4 comprising a nucleotide sequence as shown in any one of SEQ ID Nos: 5 to 18.
6. An oligonucleotide primer pair suitable for amplification of a region of the equine angiotensin converting enzyme gene, comprising a forward primer and a reverse primer comprising nucleotide sequences as respectively shown in: SEQ ID Nos: 5 and 6; SEQ ID Nos: 7 and 8; SEQ ID Nos: 9 and 10; SEQ ID Nos: 11 and 12; SEQ ID Nos: 13 and 14; SEQ ID Nos: 15 and 16; or SEQ ID Nos: 17 and 18.
7. An isolated nucleic acid molecule according to claim 4 comprising at least: (a) the nucleotide sequence of nucleotides 761-778 of SEQ ID No: 4; (b) a nucleotide sequence complementary to (a); or
(c) a polynucleotide sharing at least 90% identity with the nucleotide sequence of (a) or (b).
8. A genetic marker for distinguishing animals that have a trait associated with health or physical performance, wherein said marker is a polymorphism in the polynucleotide according to claim 1 or claim 2.
9. The marker according to claim 8 which comprises a polymorphism in at least intron 8, intron 16, intron 20, or intron 21 of the equine angiotensin converting enzyme gene.
10. The marker according to claim 9, which comprises a polymorphism in intron 16 of the equine angiotensin converting enzyme gene.
11. The marker according to any one of claims 8 to 10, which is associated with level of expression of an angiotensin converting enzyme gene in a subject, level of angiotensin converting enzyme activity in a subject, or both level of expression of an angiotensin converting enzyme gene and level of angiotensin converting enzyme activity in a subject.
12. The marker according to claim 8 comprising a polymorphism selected from any one of the following polymorphisms:
G → T at nucleotide 146 of intron 8; G -» A at nucleotide 178 of intron 16; G ->• T at nucleotide 1513 of intron 16; G -> A -> C at nucleotide 58 of intron 20; and C -» A at nucleotide 39 of intron 21.
13. The marker according to any one of claims 8 to 12, which is associated with a haplotype which is associated with level of expression of an angiotensin converting enzyme gene in a subject, level of angiotensin converting enzyme activity in a subject, or both level of expression of an angiotensin converting enzyme gene and level of angiotensin converting enzyme activity in a subject.
14. The marker according to claim 13, wherein said haplotype is selected from haplotypes 1, 6 or 7 as described herein.
15. A method for detecting at least one polymorphism in an angiotensin converting enzyme gene, said method comprising analysing at least a portion of said angiotensin converting enzyme gene using at least one nucleic acid molecule according to any one of claims 3 to 5, at least one oligonucleotide primer pair according to claim 6, or any combination thereof, to detect the presence or absence of said at least one polymorphism.
16. A method for selecting an animal using marker assisted selection, wherein said method comprises:
(a) analysing a nucleic acid sample from said animal for the presence of at least one genetic marker in the angiotensin converting enzyme gene, wherein the genetic marker is predictive of health or physical performance of an animal; and (b) selecting an animal based on the presence or absence of said genetic marker or markers.
17. A method for breeding an animal using marker assisted selection, wherein said method comprises:
5 (a) analyzing a nucleic acid sample from said animal for the presence of at least one genetic marker in the angiotensin converting enzyme gene, wherein the genetic marker is predictive of health or physical performance of an animal;
(b) breeding from said animal based on the presence or absence of said genetic marker; and o (c) selecting progeny of said animal based on the presence or absence of said genetic marker.
18. The method according to claim 16 or claim 17, wherein said at least one marker is selected from at least one marker according to any one of claims 7 to 14.
19. A method according to any one of claims 15 to 18, wherein at least as portion of intron 16, or non-equine equivalent thereof, of the angiotensin converting enzyme gene is amplified.
20. A method for testing a subject for a haplotype which is associated with level of expression of an angiotensin converting enzyme gene in a subject, level of angiotensin converting enzyme activity in a subject, or both level of expression of an0 angiotensin converting enzyme gene and level of angiotensin converting enzyme activity in a subject, said method comprising analysing an angiotensin converting enzyme gene from said subject for the presence or absence of polymorphisms by a method according to claim 15 and determining the haplotype of said subject based on the pattern of any polymorphisms detected. S
21. The method according to claim 20, wherein said haplotype is selected from haplotypes 1, 6 or 7 as described herein.
22. The method according to claim 21, wherein said haplotype is haplotype 6 as described herein.
23. A method according to any one of claims 15 or 20 to 22 for predicting the0 health or physical performance of a horse.
24. A method according to any one of claims 16 to 18, comprising predicting the health or physical performance of a horse.
25. A method according to claim 23 or claim 24, wherein the presence of a G-→A polymorphism at nucleotide 178 of SEQ ID NO:4, a G→T polymorphism at5 nucleotide 1513 of SEQ ID NO:4, or combined G— >A polymorphism at nucleotide 178 and G-→-T polymorphism at nucleotide 1513 of SEQ ID NO:4 is indicative of health or physical endurance performance of a horse.
26. A kit for assessing the health or physical performance potential of an animal, said kit comprising at least one nucleic acid molecule according to any one of claims 3 to 5, at least one oligonucleotide primer pair according to claim 6, or any combination thereof, and instructions for using said at least one nucleic acid molecule, or said at least one oligonucleotide primer pair for detection of at least one polymorphism in the angiotensin converting enzyme gene which is associated with health or physical performance potential of the animal.
27. A kit according to claim 26, wherein said at least one nucleic acid molecule comprises a nucleotide sequence as shown in any one of SEQ ID Nos: 5 to 18.
28. A kit according to claim 27, which comprises at least the following oligonucleotide primer pairs comprising forward primer and reverse primers respectively:
SEQ ID Nos: 7 and 8;
SEQ ID Nos: 9 and 10;
SEQ ID Nos: 11 and 12; SEQ ID Nos: 13 and 14; and
SEQ ID Nos: 15 and 16.
29. A system for predicting the health or physical performance of an animal, wherein said system comprises means for analyzing a nucleic acid sample from said animal for the presence of at least one genetic marker in the angiotensin converting enzyme gene, wherein said genetic marker is predictive of the health or physical performance of said animal.
30. A system for selecting an animal using marker assisted selection, wherein said system comprises:
(a) means for analyzing a nucleic acid sample from said animal for the presence of at least one genetic marker in the angiotensin converting enzyme gene, wherein said genetic marker is predictive of the health or physical performance of said animal; and
(b) means for selecting said animal based on the presence or absence of the genetic marker.
31. A system for breeding an animal using marker assisted selection, wherein said system comprises:
(a) means for analyzing a nucleic acid sample from said animal for the presence of at least one genetic marker in the angiotensin converting enzyme gene, wherein said genetic marker is predictive of the health or physical performance of said animal; and
(b) means for breeding said animal based on the presence or absence of the genetic marker, and (c) means for selecting progeny of said animal based on the presence or absence of the genetic marker.
32. The system according to any one of claims 29 to 31, wherein said marker is a marker according to any one of claims 7 to 14.
33. The system according to any one of claims 29 to 32, which comprises a kit according to any one of claims 26 to 28.
PCT/AU2007/001379 2006-09-18 2007-09-18 Equine performance test WO2008034177A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
AU2007299578A AU2007299578B2 (en) 2006-09-18 2007-09-18 Equine performance test
NZ576349A NZ576349A (en) 2006-09-18 2007-09-18 Equine performance test

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
AU2006905157 2006-09-18
AU2006905157A AU2006905157A0 (en) 2006-09-18 Equine performance test

Publications (1)

Publication Number Publication Date
WO2008034177A1 true WO2008034177A1 (en) 2008-03-27

Family

ID=39200080

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/AU2007/001379 WO2008034177A1 (en) 2006-09-18 2007-09-18 Equine performance test

Country Status (3)

Country Link
AU (1) AU2007299578B2 (en)
NZ (1) NZ576349A (en)
WO (1) WO2008034177A1 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010029527A1 (en) 2008-09-11 2010-03-18 University College Dublin - National University Of Ireland, Dublin A method for predicting athletic performance potential
US9249470B2 (en) 2008-09-11 2016-02-02 University College Dublin-National University of Ireland Method for predicting the athletic performance potential of a subject
WO2016022614A1 (en) * 2014-08-04 2016-02-11 Lafayette Christa Method for evaluating health and genetic predisposition of animals

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5359045A (en) * 1988-09-27 1994-10-25 Institut National De La Sante Et De La Recherche Medicale Nucleic acid coding for the human angiotensin converting enzyme (ACE), and its uses, especially for the in vitro diagnosis of arterial hypertension
WO1998031835A1 (en) * 1997-01-16 1998-07-23 University Of Maryland College Park Genetic methods for identifying individuals for improving well being and performance through exercise
WO2004024947A1 (en) * 2002-09-16 2004-03-25 Genetic Technologies Limited Actn3 genotype screen for athletic performance

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5359045A (en) * 1988-09-27 1994-10-25 Institut National De La Sante Et De La Recherche Medicale Nucleic acid coding for the human angiotensin converting enzyme (ACE), and its uses, especially for the in vitro diagnosis of arterial hypertension
WO1998031835A1 (en) * 1997-01-16 1998-07-23 University Of Maryland College Park Genetic methods for identifying individuals for improving well being and performance through exercise
WO2004024947A1 (en) * 2002-09-16 2004-03-25 Genetic Technologies Limited Actn3 genotype screen for athletic performance

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
DATABASE GENBANK [online] 2 December 1991 (1991-12-02), accession no. NCBI Database accession no. (X62551) *
DATABASE GENBANK [online] 27 April 1993 (1993-04-27), accession no. NCBI Database accession no. (J04144) *
DATABASE GENPEPT [online] 12 November 2000 (2000-11-12), accession no. NCBI Database accession no. (AAG31358) *
GAYAGAY G. ET AL.: "Elite endurance athletes and the ACE I allele-the role of genes in athletic performance", HUMAN GENETICS, vol. 103, 1998, pages 48 - 50 *
QADAR PASHA M.A. ET AL.: "Angiotensin converting enzyme insertion allele in relation to high altitude adaptation", ANNALS OF HUMAN GENETICS, vol. 65, 2001, pages 531 - 536 *
WOODS D.R. ET AL.: "Endurance and the ACE I/D polymorphism", SCIENCE PROGRESS, vol. 83, no. 4, 2000, pages 317 - 336 *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010029527A1 (en) 2008-09-11 2010-03-18 University College Dublin - National University Of Ireland, Dublin A method for predicting athletic performance potential
US8771943B2 (en) 2008-09-11 2014-07-08 University College Dublin—National University of Ireland, Dublin Method for predicting athletic performance potential
AU2009290452B2 (en) * 2008-09-11 2015-01-29 University College Dublin - National University Of Ireland, Dublin A method for predicting athletic performance potential
US9249470B2 (en) 2008-09-11 2016-02-02 University College Dublin-National University of Ireland Method for predicting the athletic performance potential of a subject
WO2016022614A1 (en) * 2014-08-04 2016-02-11 Lafayette Christa Method for evaluating health and genetic predisposition of animals

Also Published As

Publication number Publication date
NZ576349A (en) 2012-09-28
AU2007299578B2 (en) 2013-08-15
AU2007299578A1 (en) 2008-03-27

Similar Documents

Publication Publication Date Title
Karim et al. Variants modulating the expression of a chromosome domain encompassing PLAG1 influence bovine stature
Hoopes et al. The insulin-like growth factor 1 receptor (IGF1R) contributes to reduced size in dogs
Housley et al. The long and the short of it: evidence that FGF5 is a major determinant of canine ‘hair’‐itability
Hamilton et al. Analysis of four DLX homeobox genes in autistic probands
Cheong et al. Titin-cap (TCAP) polymorphisms associated with marbling score of beef
AU2007299578B2 (en) Equine performance test
AU2009265290B2 (en) Method for diagnosing and predicting cerebellar ataxia
Nakagaki et al. Transgenic mice with a tandem duplication of the Necdin gene overexpress Necdin
EP1660675B1 (en) Polymorphism of the igf2 gene and improving production characteristics of cattle
EP2132337B1 (en) Method of detecting canine exercise-induced collapse
US8124337B2 (en) Hereditary cataract status in canines based on HSF4 gene marker
US20090148844A1 (en) Dna marker for meat tenderness in cattle
US20110263435A1 (en) Genetic markers for boar taint
US7608400B2 (en) Methods for detecting a cyclophilin B SNP associated with HERDA
Ropka-Molik et al. New Polymorphisms in Regulatory Regions of Porcine μ-Calpain Gene and Their Association with Transcript Abundance
JP2006519593A (en) Methods for identifying genetic traits in animals
Hou et al. Developmental stage-specific imprinting of IPL in domestic pigs (Sus scrofa)
US20120183958A1 (en) Methods for predicting fat and lean phenotypes in chickens
KUNEJ et al. A single nucleotide polymorphism possibly associated with fat deposition is methylated in the bovine TFAM promoter
WO2001009161A1 (en) Drug target isogenes: polymorphisms in the solute carrier family 6_neurotransmitter transporter, serotonin_, member 4 gene
Jedrzejczak Polymorphic sites within a Bov-A2 element in the promoter region of the steroid 21-hydroxylase gene in cattle.
AU2006312996A1 (en) DNA marker for meat tenderness in cattle
WO2013156785A1 (en) Diagnostic gene
WO2003087309A2 (en) Bdnf polymorphisms and association with bipolar disorder

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 07800333

Country of ref document: EP

Kind code of ref document: A1

DPE1 Request for preliminary examination filed after expiration of 19th month from priority date (pct application filed from 20040101)
NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 576349

Country of ref document: NZ

Ref document number: 2007299578

Country of ref document: AU

ENP Entry into the national phase

Ref document number: 2007299578

Country of ref document: AU

Date of ref document: 20070918

Kind code of ref document: A

122 Ep: pct application non-entry in european phase

Ref document number: 07800333

Country of ref document: EP

Kind code of ref document: A1