WO2008029868A1 - Inhibiteur de néovascularisation fibreuse oculaire - Google Patents

Inhibiteur de néovascularisation fibreuse oculaire Download PDF

Info

Publication number
WO2008029868A1
WO2008029868A1 PCT/JP2007/067369 JP2007067369W WO2008029868A1 WO 2008029868 A1 WO2008029868 A1 WO 2008029868A1 JP 2007067369 W JP2007067369 W JP 2007067369W WO 2008029868 A1 WO2008029868 A1 WO 2008029868A1
Authority
WO
WIPO (PCT)
Prior art keywords
chondroitin sulfate
substance
proteodarican
sulfate proteodarican
gene
Prior art date
Application number
PCT/JP2007/067369
Other languages
English (en)
Japanese (ja)
Inventor
Hiroyuki Yoneyama
Hideaki Oharazawa
Original Assignee
Stelic Institute Of Regenerative Medicine, Stelic Institute & Co.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Stelic Institute Of Regenerative Medicine, Stelic Institute & Co. filed Critical Stelic Institute Of Regenerative Medicine, Stelic Institute & Co.
Publication of WO2008029868A1 publication Critical patent/WO2008029868A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/713—Double-stranded nucleic acids or oligonucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/43—Enzymes; Proenzymes; Derivatives thereof
    • A61K38/45—Transferases (2)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00—Drugs for disorders of the senses
    • A61P27/02—Ophthalmic agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/04—Endocrine or metabolic disorders
    • G01N2800/042—Disorders of carbohydrate metabolism, e.g. diabetes, glucose metabolism
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/16—Ophthalmology
    • G01N2800/164—Retinal disorders, e.g. retinopathy

Definitions

  • the present invention relates to CSPG's ocular tissue, particularly the retina and choroid (as a substance active ingredient having an action of promoting the degradation of chondroitin sulfate proteodarican (CSPG), an inhibitory action of CSPG synthesis, and an inhibitory action of CSPG sulfation ( Retinal choroid), Retinal choroidal vascular hyperplasia, Neovascularization inhibitor, CSPG deposition suppression method, and ocular neovascular diseases based on this method, particularly retinopathy and macular degeneration It is.
  • CSPG's ocular tissue particularly the retina and choroid
  • CSPG as a substance active ingredient having an action of promoting the degradation of chondroitin sulfate proteodarican (CSPG), an inhibitory action of CSPG synthesis, and an inhibitory action of CSPG sulfation ( Retinal choroid), Retinal choroidal vascular hyperplasia, Neovascularization inhibitor
  • the present invention is based on a substance having CSPG degradation promoting action, CSPG synthesis inhibitory action, CSPG sulfation inhibitory action, which is exemplified by chondroitin-4-desulfating enzyme, versican'antisense drug, etc.
  • the present invention relates to a method for the treatment and prevention of retina choroidal neovascular diseases, particularly diabetic retinopathy, retinopathy of prematurity, and age-related macular degeneration.
  • Retinal choroidal neovascularization in eye diseases is a serious pathological condition that reduces visual function and leads to blindness, and is often difficult to treat.
  • Major diseases include diabetic retinopathy, retinal vein occlusion, retinopathy of prematurity, and age-related macular degeneration.
  • Diabetic retinopathy is one of the causes of ischemia due to microcirculatory disturbance of retinal blood vessels and development of retinal neovascularization. Diabetic retinopathy is currently the leading cause of adult blindness in Japan. With long-term exposure to high blood sugar, the balance between blood coagulation ability and anticoagulation ability is inclined to the coagulation side, vascular smooth muscle contraction is likely to occur, and ischemia due to microvascular occlusion occurs. For survival, ischemic tissue creates a fibrovascular membrane on the ischemic retina and develops new blood vessels. New blood vessels form in the vitreous from the proliferative membrane, causing vitreous hemorrhage, resulting in a significant reduction in visual acuity.
  • Retinal vein occlusion is mainly caused by hypertension and hyperlipidemia and is caused by arteriosclerosis and the like. This is a pathological condition in which stenosis occurs in the veins at the intersection, and microembolic material deposits in the blood vessels of the stenosis, causing further stenosis and occlusion.
  • the ocular vasculature forms the final artery, and blood flows to the peripheral blood vessels at the arterial branch and returns to the veins as blood reflux from the peripheral blood vessels.
  • occlusion force S occurs in the retinal vena cava
  • blood that has flowed to the periphery due to relatively high pressure and pressure is blocked by the occluded vein, resulting in retinal hemorrhage and vitreous hemorrhage as venous rupture I have diminished vision.
  • the retinal tissue in the dominant region of the vein becomes ischemic due to the disruption of blood flow, and new blood vessels are generated.
  • Secondary glaucoma and vitreous hemorrhage are complicated by the same mechanism as diabetic retinopathy.
  • retinal detachment and macular edema due to vascular disruption of the retinal macular region have also caused disability leading to blindness.
  • Treatment is laser photocoagulation, and vitreous retinoplasty is performed for recurrent vitreous hemorrhage.
  • Retinopathy of prematurity is a disease in which new blood vessels develop due to abrupt relative ischemia of immature tissue, causing vitreous hemorrhage and traction retinal detachment as a complication. Born as a premature baby and exposed to high concentrations of oxygen in an incubator for a period of time to survive. The growth of retinal blood vessels in premature babies is insufficient, and the retinal blood vessels do not reach the surrounding retinal tissues sufficiently. Under high-concentration oxygen, immature retinal blood vessel growth is unnecessary, so blood vessel growth stops, and management under an incubator is no longer necessary, and the atmosphere returns to a relatively low oxygen concentration. When this occurs, new blood vessels develop due to relative ischemia, causing significant visual impairment. Treatment may include laser photocoagulation or retinal hyaline pair surgery. Visual prognosis is very poor
  • Age-related macular degeneration in which choroidal force neovascularization develops under the retina of the unexplained retinal macular region and damages the retinal tissue, is also an eye disease that leads to blindness.
  • age-related macular degeneration choroidal neovascularization in the macular region occurs and proliferates, and neovascularization proliferates under the retina, retinal tissue, and in front of the retina, resulting in marked visual loss due to edema and destruction of the macular region. It is the first place for adult blindness. If treatment is away from the foveal fovea, laser photocoagulation is performed. Recently, photodynamic therapy has been attempted for lesions in the fovea, and surgical treatment has been performed, but a solid treatment has been developed.
  • VEGF vascular endothelial growth factor
  • the proteodarican which is a target substance of the present invention is a generic term for molecules having a structure in which one or more glycosaminodarican (GAG) chains are covalently bonded to a protein called a core protein, and is a cell surface And a component of extracellular matrix (Non-patent Documents 3 and 4). It is thought that the specific sugar chain structure of the GAG chain bound to proteoglycan is responsible for the various functions of proteodarican, and proteodarican is based on the skeletal structure of GAG and chondroitin sulfate proteodarican. , Dermatan sulfate proteodarican, heparan sulfate proteodarican, and ketalan sulfate proteodarican. (Non-Patent Documents 5 to 11)
  • chondroitin sulfate proteodarican is an essential molecule during the embryonic period and is known to decrease with the strong birth, growth, and aging that exist in each organ.
  • the in vivo function of darican has not been clarified yet.
  • mice genetically deficient in CSPG fall into embryonic lethality and organ dysplasia, and thus recognition of CSPG as an essential molecule in the living body has increased.
  • CSPG is a therapeutic target called chondroitin-4 desulfating enzyme, which desulfates the 4-position sulfate group, and gene silencing (RNA interference: RNAi) of versican, one of CSPGs.
  • RNAi gene silencing
  • Non-Patent Document 1 Witmer AN, Vrensen GFJM, Van Noorden CJF and Schlingemann RO: Vascular endothelial growth factors and angiogenesis in eye diseases. Prog Retin Eye Res. 2003 Jan; 22 (1): 1-29 ⁇ Review .
  • Non-Patent Document 2 Ferrara N, Gerber HP and LeCouter J: The biology of VEGF and its receptors. Nat Med. Jun; 9 (6): 669-79. Review.
  • Non-Patent Document 3 Berfield M: Annu Rev Biochem 1999 68: 729-777
  • Non-Patent Document 4 Iozzo RV: Annu Rev Biochem 1998 67: 609-652
  • Non-Patent Document 5 Lindahl, U et al. (1972) In Glycoproteins (Gottschalk, A. ed) pp. 491-
  • Non-Patent Document 6 Oegema, T et al. J. Biol. Chem. (1984) 259, 1720-1726
  • Non-patent document 7 Sugahara, et al. J. Biol. Chem. (1988) 263, 10168-10174
  • Non-patent document 8 Sugahara, et al. J. Biol. Chem. (1992) 267, 6027-6035
  • Non-Patent Document 9 De Waard et al. J. Biol. Chem. (1992) 267, 6036-6043
  • Non-Patent Document 10 Moses, J, Oldberg et al. Eur. J. Biol. (1992) 248, 521-526
  • Non-Patent Document 11 Yamada, S et al. Trends in Glycoscience and Glycotechnology,. (199)
  • Non-Patent Document 12 Inatani M et al. Prog Retin Eye Res. 21: 429-447, 2002
  • An object of the present invention is to provide a retina choroidal neovascularization inhibitor, a therapeutic agent for a retina choroidal neovascularization disease containing the drug as an active ingredient, and a screening method for a retina choroidal neovascularization inhibitor.
  • the present inventors have conducted extensive research to develop such a drug, the power that has not been considered to be the etiology of angiogenic lesions in the retina choroid, the excessive accumulation power of CSPG S, the retina choroid We thought that it may contribute to the proliferation of vascular endothelial cells and angiogenic lesions. Based on this idea, the present inventors have conducted research with a plurality of different approaches, and as a result, inhibited the accumulation or biosynthesis of chondroitin sulfate proteodalycan. The present invention was completed by demonstrating that retina choroidal neovascularization can be suppressed.
  • the present inventor relates to chondroitin-4-desulfase and versican siRNA! /,
  • versican gene silencing nucleic acid which is a substance having “synthesis inhibitory action” of chondroitin sulfate proteodarican
  • chondroitin-4-desulfurization which is a substance having “desulfation action” of chondroitin sulfate proteodarican
  • the present invention relates to an inhibitor of retina choroidal neovascularization, a therapeutic agent for retina choroidal neovascularization disease containing the agent as an active ingredient, a screening method for a retina choroidal neovascularization inhibitor, and more specifically, ,
  • a retina choroidal neovascularization inhibitor comprising, as an active ingredient, a substance that inhibits the production or accumulation of chondroitin sulfate proteodarican,
  • the retina choroidal neovascularization disease is diabetic retinopathy, retinal vein occlusion, retinopathy of prematurity, or age-related macular degeneration,
  • Retinal collagen growth inhibitor comprising as an active ingredient a substance that inhibits the production or accumulation of chondroitin sulfate proteodarican
  • a screening method for a choroidal neovascularization inhibitor comprising selecting a substance having an action of inhibiting the production or accumulation of chondroitin sulfate proteodarican from a test sample,
  • a screening method for a retina choroidal neovascularization inhibitor comprising the following steps (a) to (c):
  • the present invention further relates to the following. [15] Use of the drug according to any one of [1] to [9] in the production of a retina choroidal neovascularization inhibitor.
  • a method for treating a retina choroidal neovascularization disease comprising a step of administering the drug according to any one of [1] to [9] to an individual (patient or the like).
  • a method for suppressing retina choroidal neovascularization comprising a step of administering a substance that inhibits the production or accumulation of chondroitin sulfate proteodarican to an individual.
  • a method for inhibiting retinal collagen growth comprising a step of administering a substance that inhibits the production or accumulation of chondroitin sulfate proteodarican to an individual.
  • composition comprising the drug according to [1] to [; 10] and any one of the above and a pharmaceutically acceptable carrier.
  • the present invention aims to suppress the deposition of CSPG (chondroitin sulfate proteodarican) on the retina-choroid tissue, and has the mechanism of promoting the degradation of CSPG, inhibiting the synthesis of CSPG, and inhibiting the sulfation of CSPG.
  • One object is to provide a method for treating and preventing retina choroidal neovascularization.
  • FIG. 1 is a photograph showing the attenuation effect of CSPG of chondroitin 4 desulfase in a type 2 diabetic retinopathy model mouse.
  • the CSPG (CS56) stained image (brown, arrow) in the retina of type 2 diabetes model mouse is shown.
  • FIG. 2 is a photograph showing the suppressive effect of chondroitin 4 desulfase on the vascular growth in type 2 diabetic retinopathy model mice. Blood vessels in type 2 diabetes model mouse retina Endothelial cell (CD31) stained image (brown, arrow) is shown.
  • CD31 type 2 diabetes model mouse retina Endothelial cell
  • FIG. 3 is a photograph showing the collagen growth inhibitory effect of chondroitin 4 desulfase on type 2 diabetic retinopathy model mice.
  • a type IV collagen stained image (brown, arrow) in the retina of a type 2 diabetes model mouse is shown.
  • FIG. 4 is a photograph showing the enhanced expression of versican in the type 2 diabetic retinopathy model mouse eye and the silencing effect of versican SiRNA treatment.
  • Fig. 2 shows versican gene expression in type 2 diabetes model mouse eyeball. GAPDH is shown as an internal control. In the untreated group (left), enhanced versican expression is observed, whereas in the SiRNA treated group (right), versican expression is suppressed! /.
  • FIG. 5 is a photograph showing suppression of CSPG accumulation by versican SiRNA treatment in type 2 diabetic retinopathy model mouse eyeballs.
  • the CSPG (CS5 6) stained image (brown, arrow) in the retina of type 2 diabetes model mouse is shown.
  • FIG. 6 is a photograph showing suppression of vascular proliferation by versican SiRNA treatment in type 2 diabetic retinopathy model mouse eyeballs.
  • a vascular endothelial cell (CD31) stained image (brown, arrow) in the retina of a type 2 diabetes model mouse is shown.
  • FIG. 7 is a photograph showing suppression of collagen growth by versican SiRNA treatment in type 2 diabetic retinopathy model mouse eyeballs. A type IV collagen stained image (brown, arrow) in the retina of a type 2 diabetes model mouse is shown.
  • FIG. 8 is a photograph showing suppression of angiogenesis by versican SiRNA treatment in hyperoxia-dependent retinal neovascularization. A retinal extension specimen is shown. New blood vessels (green, arrows) are suppressed in the treatment group.
  • diabetic retinopathy As a pathological condition associated with diabetic retinopathy, which is one of the typical retina choroidal neovascular diseases, there is retinal neovascularization that develops due to ischemia due to microcirculatory disturbance of retinal blood vessels.
  • the present inventors paid attention to the function of chondroitin sulfate proteodalycan in order to suppress the angiogenic state in the retinal tissue of the eye as one effective method for treating diabetic retinopathy.
  • the condition that suppresses the accumulation of chondroitin sulfate proteodalycan is diabetic retinopathy.
  • the present invention relates to a retina choroidal neovascularization inhibitor comprising, as an active ingredient, a substance that inhibits the production or accumulation of chondroitin sulfate proteodarican.
  • the "chondroitin sulfate proteodarican” of the present invention is one of the proteodaricans, and is a covalently bonded compound of chondroitin sulfate / dermatan sulfate, which is a typical sulfated mucopolysaccharide, and a protein (coprotein). It is a general term.
  • the “chondroitin sulfate proteodarican” in the present invention is preferably a human chondroitin sulfate proteodarican, but the species from which it is derived is not particularly limited.
  • chondroitin sulfate proteodaricans Proteins equivalent to kan (homologs, orthologs, etc.) are also included in “chondroitin sulfate proteodaricans” in the present invention.
  • the present invention can be carried out as long as the organism has a protein corresponding to human chondroitin sulfate proteodalycan and has a protein equivalent to human chondroitin sulfate proteoglycan.
  • chondroitin sulfate proteoglycans examples include neurocan, brevican, ⁇ -glycan, Decorin, Biglycan, Fioromodulin, and PG-Lb.
  • the chondroitin sulfate proteodarican according to the present invention is not limited to these and may be any substance having activity as a chondroitin sulfate proteodarican! /.
  • the chondroitin sulfate proteodarican activity includes, for example, cell adhesion ability or cell growth promotion.
  • a person skilled in the art can evaluate the activity as a chondroitin sulfate proteoglycan by the following method.
  • a protein containing a partial region of chondroitin sulfate proteodarican amino acid sequence, or high homology with a partial region generally Measure mitotic growth of tumor cells (eg Caco_2, HT-29 cells, etc.) in the presence of a protein that usually has 70% or more, preferably 80% or more, more preferably 90% or more, most preferably 95% or more) .
  • Proteins that have the effect of promoting mitotic proliferation can be determined as proteins with chondroitin sulfate proteoglycan activity (Int J Exp Pathol.
  • high homology means 50% or more, preferably 70% or more, more preferably 80% or more, more preferably 90% or more (e.g., 95% or more, further 96%, 97%, 98% or 99%). % Or higher) homology. This homology was determined by the mBLAST algorithm (Altschul et al. (1990) Proc. Natl. Ac ad. Sci. USA 87: 2264-8; arlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90: 5873- 7) can be determined by.
  • retinochoroid angiogenesis refers to a state in which angiogenesis has occurred in the retina choroid, and includes expression of angiogenesis markers such as an increase in CD31 positive cells and an increase in retinal collagen. Including the state that can be.
  • “inhibiting production or accumulation” of chondroitin sulfate proteodarican means, for example, “degradation promotion”, “synthesis inhibition”, “desulfation”, “sulfation” of chondroitin sulfate proteodarican. Forces such as “inhibition”
  • the present invention is not limited to this, and it means that the abundance, function or activity of chondroitin sulfate proteodarican is reduced or eliminated as compared with the comparison target.
  • the “substance that inhibits the production or accumulation” of chondroitin sulfate proteodarican is not particularly limited, but preferably the “substance that has an activity of promoting degradation of chondroitin sulfate proteoglycan” and “the substance has an inhibitory effect on synthesis”. “Substance”, “Substance with desulfurization and oxidation action”, or “Substance with sulfation inhibition action”.
  • “Degradation promotion” of chondroitin sulfate proteodarican includes, for example, inhibition of expression / reduction of the protein that is the core of chondroitin sulfate proteodarican.
  • “core protein of chondroitin sulfate proteoglycan” includes, for example, core proteins such as aggrican and versican (norsicanri, neurocan, brevican) if matri X type chondronan sulfate proteoglycan is used.
  • Membrane-type chondroitin sulfate pro-glycans include, for example, core proteins such as ⁇ giycan, Decorin, Biglycan, Pibromodulin ⁇ P ⁇ L b, etc. Any protein can be used as long as it is a core of chondroitin sulfate proteodarican.
  • “Expression” means “transcription” from a gene! /, And includes “translation” into a polypeptide and “degradation inhibition” of a protein. “Expression of the protein that is the core of chondroitin sulfate proteodarican” refers to the transcription and translation of the gene that encodes the protein that is the core of chondroitin sulfate proteodarican, or the chondroitin sulfate proteo This means that the protein that forms the core of Darican is produced.
  • the function of the protein serving as the core of chondroitin sulfate proteodarican includes, for example, the function of the protein binding to chondroitin sulfate and the binding to other components in the cell.
  • the various functions described above can be appropriately evaluated (measured) by those skilled in the art using common techniques. Specifically, the methods described in the examples described later, or the methods can be appropriately modified and carried out.
  • chondroitin sulfate proteodarican may be an increase in the expression of an enzyme that cleaves or degrades chondroitin sulfate proteodarican or an enzyme related thereto.
  • these enzymes include meta-mouth proteinases (eg, AD AMTS-1, ADAMTS-4, ADAMTS-5, etc.), chondroitinase (chondroitinase), Calpain I, etc. I can't.
  • “Degradation promotion” may be a decrease in the abundance of chondroitin sulfate proteodarican caused by administration of these enzymes or a part of them.
  • Degradation promotion may be caused by administration of a substance that promotes suppression of chondroitin sulfate proteodarican expression.
  • substances include, but are not limited to, n-butylate, Diethyl carbamazepine, i'umcamycin, non-steroidal estrogen ⁇ and yclofeml deipheno.
  • Preferable embodiments of the "substance having a decomposition promoting action” include, for example, a compound (nucleic acid) selected from the group consisting of the following (a) to (c).
  • nucleic acid having a ribozyme activity that specifically cleaves the transcription product of the gene encoding the core protein of chondroitin sulfate proteodarican
  • examples of the “substance having a decomposition promoting action” include compounds selected from the following groups (a) to (c):
  • Synthetic inhibition of chondroitin sulfate proteodarican includes, for example, inhibition of glycosaminodarlican biosynthesis, inhibition of enzymes involved in chondroitin sulfate proteodarican synthesis, but are not necessarily limited to these. This refers to inhibiting the process of chondroitin sulfate proteodarican synthesis.
  • chondroitin sulfate proteodarican As a substance that inhibits the synthesis of chondroitin sulfate proteodarican, as a substance that inhibits the biosynthesis of glycosaminoglycan, for example, ⁇ -D-xyloside, 2-deoxy-D-glucose (2_DLT), ethane-1-hydroxy-1, 1-diphosphonate fcTDP), 5-nexyl-2-aeoxyunaine (H UdR), and the like. These and other substances inhibit the biosynthesis of glycosaminodarlicans and inhibit the synthesis of chondroitin sulfate proteodaricans.
  • examples of enzymes involved in chondroitin synthesis include GalNAc4ST-1, GalNAc4 ST-2, GALNAC4S_6ST, UA20ST, GalT_I, GalT_H, GlcAT_I, XylosylT, and the like. By inhibiting these and other enzymes and suppressing their expression, the synthesis of chondroitin sulfate proteodalycan is inhibited.
  • Preferable embodiments of the "substance having a synthesis inhibitory action” include, for example, compounds (nucleic acids) selected from the group consisting of the following (a) to (c).
  • examples of the "substance having a synthesis inhibitory action” include compounds selected from the following groups (a) to (c):
  • Desulfation of chondroitin sulfate proteodarican refers to removal of sulfate groups in chondroitin sulfate proteodarican, for example, desulfation by endogenous or externally administered desulfating enzymes, or sulfation. This includes, but is not limited to, the process by which sulfate groups are removed.
  • Examples of the desulfating enzyme include Chondroitin-4-sulfatase, Chondroitin-6-sulfatase force S.
  • Examples of the compound that suppresses sulfation include Chlorate and EGF receptor antagonist.
  • Preferable embodiments of the "substance having desulfating action” include, for example, a compound (nucleic acid) selected from the group consisting of the following (a) to (c).
  • nucleic acid having a ribozyme activity that specifically cleaves a transcript of a gene encoding a chondroitin sulfate proteodarican desulfase inhibitor protein
  • Examples of the "substance having desulfating action” include compounds selected from the following groups (a) to (c):
  • the “desulfation-inhibiting compound” is not limited to a protein, and includes non-protein compounds such as coenzymes, for example.
  • the “sulfation inhibitory action” of chondroitin sulfate proteodarican is, for example, the force S including inhibition of sulfate group transfer enzyme, but is not limited to this, and occurs in the process of chondroitin sulfate proteodarican synthesis. It refers to inhibition of sulfation.
  • Examples of the sulfotransferase include C4ST-l (Chondroitin D-N-acetylgalactosamine
  • C43 ⁇ 4T-2 Cnondroitin DN-acetylgalactosamine-4-O-sulfotransferase 2
  • C4ST-3 Chodroitin DN-acetylgalactosamine-4-0-sulfotransferas e 3
  • D4ST C6ST-1 And C6ST-2.
  • a compound (nucleic acid) selected from the group consisting of the following (a) to (c) can be mentioned.
  • examples of the “substance having a sulfation inhibiting action” include compounds selected from the group consisting of the following (a) to (c).
  • the enzymes exemplified above include not only one enzyme corresponding to one gene but also an enzyme group sharing certain characteristics.
  • chondroitinase is a collective term for enzymes such as ABC, AC, and B that share the characteristics of mucopolysaccharide-degrading enzymes but differ in substrate specificity.
  • chondroitinase AC I is chondroitin sulfate (A, C or E), chondroitin Cleaved, chondroitin sulfate-dermatan sulfate hybrid type and hyaluronic acid N-acetyl hexosaminide bond is cleaved by elimination reaction to generate oligosaccharides with ⁇ 4-glucuronic acid residue at the non-reducing end.
  • This enzyme does not act on dermatan sulfate (chondroitin sulfate B, which has L-iduronic acid as hexuronic acid), ketalan sulfate, heparan sulfate and heparin.
  • chondroitinase AC II cleaves the N-acetyl hexosaminide bond of chondroitin, chondroitin acid A, and chondroitin sulfate C in a desorption reaction to produce ⁇ 4-unsaturated disaccharide ( ⁇ 0 ⁇ 05, AD 4S and A Di-6S).
  • This enzyme also works well on hyaluronic acid. It does not act on dermatan sulfate (chondroitin sulfate B) and is a competitive inhibitor of this enzyme.
  • Chondroitinase B (dermatanase) cleaves the N-acetyl galatatosaminide bond bound to L-iduronic acid of dermatan sulfate in an elimination reaction, and has a ⁇ 4-hexuronic acid residue at the non-reducing end. Produces oligosaccharides (disaccharides and tetrasaccharides). This enzyme does not act on chondroitin sulfate A and chondroitin sulfate without L-iduronic acid. Dermatan, a derivative obtained by removing the sulfate group of dermatan sulfate, does not serve as a substrate for this enzyme.
  • the site where the second position of the L-iduronic acid unit of dermatan sulfate is sulfated is more cleaved by this enzyme.
  • Chondroitinase ABC cleaves the N-acetyl hexosaminide bond of chondroitin sulfate A, chondroitin sulfate C, dermatan sulfate, chondroitin, and hyaluronic acid in a reactive manner, resulting in ⁇ 4-hexuronic acid at the non-reducing end.
  • This enzyme does not act on ketalan sulfate, heparin and heparan sulfate.
  • Chondroitinase is a collective term for enzymes that have different properties but share the same properties of mucopolysaccharide-degrading enzyme. Chondroitinase A and I, Cnondroitinase A and II, and hondrotinase B and Chondrotinase B It is not limited to roitinase ABC.
  • chondroitin-4-sulfatase chondroitin_6_sulfatase is a sequence referenced by multiple accession numbers in the genome database (for example, Gen bank accession number NT_039500 (part of which is accession number CAAA01098429 (sequence No .: 73)), NT_078575, NT_039353, NW_001030904, NW_0 01030811, NW_001030796, NW_000349) on the public gene database Genbank It is searched with.
  • chondroitin sulfate proteoglycan examples of the above chondroitin sulfate proteoglycan, aggrican, versican (noncan), neurocan, brevican, ⁇ -glycan, Decorin, Biglycan, ribromodulin, PG_Lb, an enzyme that cleaves or degrades chondroitin sulfate proteoglycan or this ADAMTS-1, ADAMTS-4, ADAMTS_5, Calpain I, GalNAc4ST-l, GalNAc4ST_2, GALNAC4S_6ST, UA20ST, GalT-1, GalT-II, exemplified as enzymes involved in chondroitin synthesis, GlcAT_I, XylosylT, exemplified as sulfate transferase, C4ST-1, C4ST-2, C4ST-3, D4ST, C6ST_1, C6ST-2
  • aggrican (Accession number NM—007424, SEQ ID NO: 1 for nucleotide sequence, SEQ ID NO: 2 for amino acid sequence)
  • neurocan accession number NM_010875, nucleotide sequence SEQ ID NO: 5, amino acid sequence SEQ ID NO: 6)
  • Biglycan (Accession number BC057185, SEQ ID NO: 13 for nucleotide sequence, SEQ ID NO: 14 for amino acid sequence)
  • Fibromodulin (Accession number NM_021355, nucleotide sequence number: 15, amino acid sequence number: 16)
  • PG-Lb (Accession number NM_007884, SEQ ID NO: 17 of nucleotide sequence, Arrangement of amino acid sequence Column number: 18)
  • ADAMTS-1 (Accession number NM_009621, nucleotide sequence SEQ ID NO: 19, amino acid sequence SEQ ID NO: 20)
  • ADAMTS_4 (Accession number NM_172845, SEQ ID NO: 21 of nucleotide sequence, SEQ ID NO: 22 of amino acid sequence)
  • ADAMTS_5 (Accession number AF140673, SEQ ID NO: 23, Amino Acid IJ SEQ ID: 24)
  • Calpain I (Accession number NM_007600, nucleotide sequence SEQ ID NO: 25, amino acid sequence SEQ ID NO: 26)
  • GalNAc4ST-l accession number NM_175140, nucleotide sequence number: 27, amino acid sequence number: 28
  • GalNAc4ST-2 (Accession number NM_199055, nucleotide sequence SEQ ID NO: 29, amino acid sequence SEQ ID NO: 30)
  • GALNAC4S-6ST (Accession number NM_029935, nucleotide sequence SEQ ID NO: 31, amino acid sequence SEQ ID NO: 32)
  • UA20ST (Accession number NM—177387, SEQ ID NO: 33 for nucleotide sequence, SEQ ID NO: 34 for amino acid sequence)
  • GalT-I (Accession number NM—016769, nucleotide sequence number: 35, amino acid sequence number: 36)
  • GalT-II (Accession number BC064767, nucleotide sequence number: 37, amino acid sequence number: 38)
  • GlcAT-I accession number BC058082, nucleotide sequence number: 39, amino acid sequence number: 40, or accession number NM_024256, nucleotide sequence number: 41, amino acid sequence number: 42)
  • XylosylT (Accession number NM—145828, nucleotide sequence number: 43, amino acid sequence number: 44)
  • C4ST-1 (Accession number NM_021439, nucleotide sequence SEQ ID NO: 45, amino acid sequence SEQ ID NO: 46)
  • C4ST-2 (Accession number NM_021528, nucleotide sequence number: 47, amino acid sequence number: 48)
  • C4ST-3 (Accession No. XM—355798, nucleotide sequence SEQ ID NO: 49, amino acid sequence SEQ ID NO: 50)
  • D4ST (Accession number NM— 028117, nucleotide sequence number: 51, amino acid sequence number: 52)
  • C6ST-1 (Accession number NM_016803, nucleotide sequence SEQ ID NO: 53, amino acid sequence SEQ ID NO: 54)
  • C6ST-2 (Accession number AB046929, nucleotide sequence number: 55, amino acid sequence number: 56)
  • proteins other than those described above have high homology with, for example, the sequences described in the sequence listing (usually 70% or more, preferably 80% or more, more preferably 90% or more, most preferably 95% or more). And a protein having a function of the protein (for example, a function of binding to a constituent component in a cell) is included in the protein of the present invention.
  • the above proteins are, for example, the following: IJ numbers: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36 , 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, the amino acid sequence in which one or more amino acids are added, calo, deletion, substitution, or insertion
  • a protein consisting of a sequence, wherein the number of normally changing amino acids is within 30 amino acids, preferably within 10 amino acids, more preferably within 5 amino acids, most preferably within 3 amino acids.
  • Examples of the gene in the present invention include, for example, SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, or 55, an endogenous gene in another organism corresponding to the DNA comprising the nucleotide sequence described in any one of the above (a homologue of the above human gene) Etc.).
  • IJ numbers 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39 41, 43, 45, 47, 49, 51, 53, 55, the basic DNA of other organisms corresponding to the IJ force, Sequence number: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, and 55.
  • High homology means 50% or more, preferably 70% or more, more preferably 80% or more, more preferably 90% or more (e.g., 95% or more, further 96%, 97%, 98% or 99% or more). It means the homology of (above).
  • stringent conditions for example, “2 X SSC, 0.1% SDS, 50.C”, “2 X SSC, 0.1% SDS, 42 ° C”, “1 X SSC, 0.1% SDS, 37 ° C ”and more stringent conditions“ 2 X SSC, 0.1% SDS, 65.C ”,“ 0.5 X SSC, 0.1% SDS, 42.C ”and“ 0.2 X SSC, 0.1% SDS, 65 ° The ability S to raise the condition of “C”.
  • a person skilled in the art will convert a protein functionally equivalent to the above protein from the above highly homologous protein into a chondroitin sulfate proteodarican degradation promoting action, synthetic inhibitory action, desulfating action or sulfating action. It can be obtained appropriately by using an inhibitory activity measurement method. A specific activity measuring method will be described in the section of the screening method in the present invention. Moreover, those skilled in the art can appropriately obtain an endogenous gene corresponding to the above gene in another organism based on the base sequence of the above gene.
  • the above-mentioned proteins and genes corresponding to the above-mentioned proteins and genes in organisms other than humans, or the above-mentioned proteins and genes functionally equivalent to the above-mentioned proteins and genes are also simply referred to as the above-mentioned names. It may be described in.
  • the protein of the present invention can be prepared not only as a natural protein but also as a recombinant protein using a gene recombination technique.
  • a natural protein for example, it can be prepared by a method using affinity chromatography using an antibody against the above protein against an extract of a cell (tissue) considered to express the above protein. It is.
  • the recombinant protein is, for example, the above protein It can be prepared by culturing cells transformed with DNA encoding.
  • the above-mentioned protein of the present invention is suitably used, for example, in the screening method described later.
  • Nucleic acid in the present invention means RNA or DNA. Chemically synthesized nucleic acid analogs such as so-called PNA (peptide nuoleic acid) are also included in the nucleic acid of the present invention. PNA replaces the pentose / phosphate skeleton, which is the basic skeleton structure of nucleic acid, with a polyamide skeleton with glycine as a unit, and has a three-dimensional structure very similar to nucleic acid.
  • PNA peptide nuoleic acid
  • antisense nucleic acids inhibit the expression of target genes by inhibiting various processes such as transcription, splicing or translation (Hirashima and Inoue, Shinsei Kagaku Kogaku Kenkyu 2 Nucleic acid IV gene replication and expression, Japan Biochemical Society, Tokyo Chemical Doujin, 1993, 319-347.).
  • the antisense nucleic acid used in the present invention can be any of the above-described chondroitin sulfate proteodarican core protein, synthase, desulfase-inhibiting protein, and sulfotransferase by any of the above-described actions. Expression and / or function of the gene encoding the force may be inhibited.
  • the above-mentioned chondroitin sulfate proteodarican core protein, synthase, desulfase inhibitor protein, or sulfate group transferase Designing an antisense sequence complementary to the untranslated region near the 5 'end of the mRNA of the gene encoding the element would be effective in inhibiting gene translation.
  • an IJ complementary to the coding region or the 3 ′ untranslated region can also be used.
  • the anti-translation region of the anti-translation region consisting of the core protein, the synthase, the desulfation enzyme inhibitory protein, or the gene encoding the sulfotransferase as described above is not limited to the anti-translation region.
  • a nucleic acid containing a sense sequence is also included in the antisense nucleic acid used in the present invention.
  • the antisense nucleic acid to be used is linked downstream of an appropriate promoter, and preferably a sequence containing a transcription termination signal is linked on the 3 ′ side.
  • the nucleic acid thus prepared can be transformed into a desired animal (cell) using a known method.
  • the sequence of the antisense nucleic acid is the gene encoding the endogenous chondroitin sulfate proteodarican core protein, synthase, desulfase inhibitor protein, or sulfotransferase of the animal (cell) to be transformed or one of them.
  • the sequence is complementary to the region, but it may not be completely complementary as long as gene expression can be effectively suppressed.
  • the transcribed RNA has a complementarity of preferably 90% or more, and most preferably 95% or more, to the target gene transcript.
  • the length of the antisense nucleic acid is preferably at least 15 bases and less than 25 bases.
  • the antisense nucleic acid of the present invention is necessarily used. However, it is not limited to this length, and may be, for example, 100 bases or more, or 500 bases or more.
  • the antisense nucleic acid of the present invention is not particularly limited.
  • the base sequence of Versican gene (GenBank accession number BC096495, SEQ ID NO: 3), C4ST-UGenBank accession number NM_021439, sequence No. 45), C4ST_2 (GenBank accession number NM_021528, SEQ ID NO: 47), C4ST-3 (GenBank accession number XM_355798, SEQ ID NO: 49) and the like.
  • Ribozyme refers to an RNA molecule that has catalytic activity. Ribozymes have various activities The focus on ribozyme as an enzyme that cleaves RNA, especially RNA, has made it possible to design ribozymes that cleave RNA site-specifically.
  • Some ribozymes have a size of 400 nucleotides or more, such as group I intron type and Ml RNA contained in RNase P, but some have an active domain of about 40 nucleotides called hammerhead type or hairpin type. (Makoto Koizumi and Eiko Otsuka, Protein Nucleic Acid Enzyme, 1990, 35, 2191 ⁇ ).
  • the self-cleaving domain of the hammerhead ribozyme cleaves on the 3 'side of C15 in the sequence G13U14C15, but base pairing between U14 and A9 is important for its activity. Shows that A15 or U15 can also be cleaved (Koizumi, M. et al., FEBS Lett, 1988, 228, 228.).
  • a ribozyme whose substrate binding site is complementary to the RNA sequence in the vicinity of the target site, it is possible to create a restriction RNA-cleaving ribozyme that recognizes the sequence UC, UU or UA in the target RNA (Koizumi , M.
  • Hairpin ribozymes are also useful for the purposes of the present invention. This ribozyme is found, for example, in the minus strand of tobacco ring spot virus satellite RNA (Buzayan, JM., Nature, 1986, 323, 349). It has been shown that hairpin-type ribozymes can also produce target-specific RNA cleavage ribozymes (Kikuchi, Y. & Sasaki, N., Nucl Acids Res, 1991, 19, 6751., Hiroshi Kikuchi, Biology, 1992, 30, 112.).
  • the ribozyme is used to specifically cleave the above-mentioned chondroitin sulfate proteodarican core protein, synthase, desulfase inhibitor protein, or transcript of a gene encoding a sulfotransferase. Gene expression can be inhibited.
  • RNA interference (hereinafter abbreviated as "RNAi") using double-stranded RNA having the same or similar sequence as the target gene sequence. can be fi.
  • RNAi is a technique that is currently attracting attention because when a double-stranded RNA (dsRNA) is taken directly into a cell, expression of a gene having a sequence homologous to this dsRNA is suppressed.
  • dsRNA double-stranded RNA
  • RNAi can be induced by using short dsRNA (siRNA). RNAi is more stable, easier to experiment, and less expensive than knockout mice.
  • RNAi is a phenomenon discovered by Fire et al. In 1998 (Fire A, Nature (1998) 391,: 806-811). It strongly enhances the expression of target genes with double-stranded RNA homology. It is to suppress it. It has recently been attracting attention because it is simpler than conventional gene transfer methods using vectors and can be applied to gene therapy with high target specificity.
  • RNAi is a short double-stranded RNA (hereinafter abbreviated as “dsRNA”) consisting of a sense RNA consisting of a sequence homologous to the mRNA of the target gene and an antisense RNA consisting of a complementary sequence.
  • dsRNA short double-stranded RNA
  • This is a phenomenon that induces destruction by specifically and selectively binding to the target gene mRNA, and efficiently inhibiting (suppressing) the expression of the target gene by cleaving the target gene. For example, when dsRNA is introduced into a cell, the expression of the gene homologous to the RNA is suppressed (knocked down).
  • RNAi can suppress the expression of target genes in this way, it can be applied as a simple gene knockout method instead of the conventional complicated and low-efficiency gene disruption method by homologous recombination, or for gene therapy. It is attracting attention as a method.
  • the RNA used for RNAi must be completely identical to the above-mentioned chondroitin sulfate proteodarican core protein, synthetic enzyme, desulfase inhibitor protein, or gene encoding a sulfotransferase, or a partial region of the gene. None, but preferably has complete homology.
  • the target is not particularly limited as long as it is a gene encoding the above-mentioned chondroitin sulfate proteoglycan core protein, synthetic enzyme, desulfase inhibitor protein, or sulfate transferase. It is possible to make any arbitrary region as a target candidate.
  • the salt of the Versican gene Base sequence (SEQ ID NO: 3), C4ST-1 gene base sequence (SEQ ID NO: 45), C4ST-2 gene base sequence (SEQ ID NO: 47), C4ST-3 gene base sequence (SEQ ID NO: 49) It can be created based on etc. More specifically, a partial region of the sequence can be used as a target candidate.
  • siRNA synthesized in vitro is linked to plasmid DNA and introduced into the cell
  • a method of annealing two RNAs, or the like can be employed.
  • the two RNA molecules may be molecules having a structure in which one end is closed, for example, a siRNA (shRNA) having a hairpin structure.
  • shRNA is called short hairpin RNA, and is an RNA molecule having a stem-loop structure so that a part of a single strand forms a complementary strand with another region. That is, molecules capable of forming a double-stranded RNA structure in the molecule are also included in the siRNA of the present invention.
  • RNA capable of suppressing the expression of Versican, C4ST_1, C4ST_2, C4ST-3 and the like by an RNAi effect
  • siRNA targeting the specifically shown DNA sequence for example, even if it is a double-stranded RNA having a structure in which one or a few RNAs are added or deleted, As long as it has a function of suppressing the expression of a gene encoding a chondroitin sulfate proteodarican core protein, synthetic enzyme, desulfurase inhibitor protein, or sulfotransferase, it is included in the siRNA of the present invention. .
  • RNA used for RNAi may be a gene encoding the above protein or Need not be completely identical (homologous) to a partial region of the gene !, but preferably have perfect identity (similarity).
  • the power of DICER comes into contact with double-stranded RNA, and the double-stranded RNA is small interfering RNA or It is thought to be broken down into small fragments called siRNAs.
  • the double-stranded RNA having the RNAi effect in the present invention includes double-stranded RNA before being digested by DICER as described above. That is, even if a long RNA that does not have the RNAi effect as it is is expected to be degraded into siRNA having the RNAi effect in the cell, the double-stranded RNA in the present invention The length of is not particularly limited.
  • the strand RNA can be decomposed in advance with DICER, and the degradation product can be used as the agent of the present invention.
  • This degradation product is expected to contain double-stranded RNA molecules (siRNA) having the RNAi effect. According to this method, it is not necessary to particularly select a region on mRNA expected to have an RNAi effect. That is, the region on the mRNA of the above-mentioned gene of the present invention having an RNAi effect does not necessarily need to be accurately defined.
  • the above-mentioned "double-stranded RNA that can be suppressed by the RNAi effect" of the present invention means that, for those skilled in the art, the above-mentioned chondroitin sulfate proteodarican core protein, synthase, desulfurization that is the target of the double-stranded RNA It can be appropriately produced based on the base sequence of a gene encoding an oxidase-inhibiting protein or a sulfotransferase.
  • the double-stranded RNA of the present invention can be prepared based on the nucleotide sequence set forth in SEQ ID NO: 67.
  • RNA region of mRNA that is a transcription product of the sequence is selected, and a double-stranded RNA corresponding to this region is prepared.
  • the person skilled in the art can appropriately carry out within the range of normal trials.
  • those skilled in the art can appropriately select a siRNA sequence having a stronger // RNAi effect from the mRNA sequence which is a transcription product of the sequence, by a known method.
  • those skilled in the art can easily use the other strand (complementary strand).
  • the base sequence can be known.
  • a siRNA can be appropriately prepared by those skilled in the art using a commercially available nucleic acid synthesizer.
  • a general synthetic contract service can be used for synthesis of desired RNA.
  • the siRNA in the present invention may be a mixture of a plurality of sets of double-stranded RNAs for a region containing a target sequence that is not necessarily a set of double-stranded RNAs for the target sequence.
  • siRNA as a nucleic acid mixture corresponding to the target sequence can be appropriately prepared by a person skilled in the art using a commercially available nucleic acid synthesizer and a DICER enzyme. You can use the composite contract service.
  • the siRNA of the present invention includes so-called “cocktail siRNA”.
  • RNA ribonucleotides
  • one or more ribonucleotides constituting siRNA may be a corresponding deoxyribonucleotide.
  • This “corresponding” refers to the same base species (adenine, guanine, cytosine, thymine (uracil)) although the structures of the sugar moieties are different.
  • uracil uracil
  • the “plurality” is not particularly limited, but preferably refers to a small number of about 25.
  • a DNA (vector) capable of expressing the RNA of the present invention is also included in a preferred embodiment of the compound capable of suppressing the expression of the gene encoding the above-described protein of the present invention.
  • the DNA (vector) capable of expressing the double-stranded RNA of the present invention is a DNA encoding one strand of the double-stranded RNA and a DNA encoding the other strand of the double-stranded RNA, Each DNA has a structure linked to a promoter so that it can be expressed.
  • the expression vector of the present invention can be prepared by appropriately inserting a DNA encoding the RNA of the present invention into various known expression vectors.
  • the expression inhibitory substance of the present invention includes the above chondroitin sulfate proteodarican core protein, synthase, desulfase inhibitor protein, or sulfate group transferase.
  • the expression regulatory region of the gene to be encoded for example, the promoter region.
  • Specific examples include the nucleotide sequence represented by SEQ ID NO: 66, which is the promoter region of PG-Lb).
  • the compound is, for example, a promoter DNA fragment of a gene encoding the above chondroitin sulfate proteodarican core protein, synthase, desulfase inhibitor protein, or sulfotransferase, and binding activity to the DNA fragment It can be obtained by a screening method using as an index.
  • those skilled in the art will determine whether or not the desired compound inhibits the expression of the above-mentioned chondroitin sulfate-teododalican core protein, synthase, desulfase-inhibiting protein, or gene encoding sulfotransferase. The determination can be appropriately carried out by a known method such as a reporter assay method.
  • the DNA (vector) capable of expressing the RNA of the present invention is also a core protein, a synthetic enzyme, a desulfase-inhibiting protein, or a sulfate group of the above-described chondroitin sulfate proteodarican of the present invention.
  • a preferred embodiment of the compound capable of inhibiting the expression of a gene encoding a transferase is included.
  • the DNA (beta) capable of expressing the double-stranded RNA of the present invention is a DNA that encodes one strand of the double-stranded RNA and a DNA force S that encodes the other strand of the double-stranded RNA.
  • DNAs having a structure linked to a promoter so that each can be expressed are DNAs having a structure linked to a promoter so that each can be expressed.
  • Those skilled in the art can appropriately prepare the above DNA of the present invention by a general genetic technique. More specifically, the expression vector of the present invention can be prepared by appropriately inserting DNA encoding the RNA of the present invention into various known expression vectors.
  • Preferred embodiments of the vector of the present invention include Versican, C4ST_1,
  • RNAi RNA that can suppress the expression of C4ST-2, C4ST-3, etc. by the RNAi effect.
  • chondroitin sulfate proteodarican core protein synthetic enzyme, desulfating enzyme inhibitory compound, or antibody that binds to sulfotransferase
  • synthetic enzyme desulfating enzyme inhibitory compound
  • antibody that binds to sulfotransferase can be prepared by methods known to those skilled in the art. If it is a polyclonal antibody, for example: You can get the power S. Serum is obtained by immunizing small animals such as rabbits with recombinant (recombinant) protein expressed in microorganisms as a fusion protein with the above-mentioned natural protein or GST, or a partial peptide thereof.
  • ammonium sulfate precipitation protein A, protein G column, DEAE ion exchange chromatography, core protein of the above chondroitin sulfate proteodarican, synthase, desulfase inhibitor compound, or sulfate transferase Or by purification using an affinity column coupled with a synthetic peptide.
  • a monoclonal antibody for example, the above-mentioned chondroitin sulfate proteodarican core protein, synthetic enzyme, desulfase inhibitor compound, or sulfotransferase or its partial peptide is immunized to a small animal such as a mouse.
  • the spleen is removed from the mouse and ground to separate the cells.
  • the cells are fused with mouse myeloma cells using a reagent such as polyethylene glycol. From the above, a clone producing an antibody that binds to the above chondroitin sulfate proteodarican coprotein, synthase, desulfase inhibitor compound, or sulfotransferase is selected.
  • the obtained hyperidoma was transplanted into the abdominal cavity of the mouse, and ascites was collected from the mouse, and the resulting monoclonal antibody was purified using, for example, ammonium sulfate precipitation, protein A, protein G column, DEAE ion exchange chromatography, It can be prepared by purification using the above-mentioned chondroitin sulfate proteodarican core protein, synthetic enzyme, desulfating enzyme inhibitory compound, or an affinity column coupled with a sulfotransferase protein or synthetic peptide. It is.
  • the antibody of the present invention is not particularly limited as long as it binds to the above-described chondroitin sulfate proteodarican core protein of the present invention, a synthetic enzyme, a desulfase inhibitor compound, or a sulfotransferase.
  • a synthetic enzyme a desulfase inhibitor compound
  • a sulfotransferase a sulfotransferase.
  • human antibodies, humanized antibodies obtained by genetic recombination, and antibody fragments or modified antibodies thereof may also be used.
  • the protein of the present invention used as a sensitizing antigen for obtaining an antibody is not limited with respect to the animal species from which it is derived, but a protein derived from a mammal such as a mouse is preferred, and a protein derived from a human is particularly preferred.
  • Human-derived proteins are appropriately obtained by those skilled in the art using the gene sequences or amino acid sequences disclosed in this specification. Can do.
  • the protein used as the sensitizing antigen may be a complete protein or a partial peptide of the protein.
  • the partial peptide of the protein include an amino group (N) terminal fragment and a carboxy (C) terminal fragment of the protein.
  • antibody means an antibody that reacts with the full length or fragment of a protein.
  • human lymphocytes such as human lymphocytes infected with EB virus are sensitized in vitro with proteins, protein-expressing cells or lysates thereof. And fusion of sensitized lymphocytes with human-derived permanent mitotic cells, such as U266, to produce a hyperidoma that produces the desired human antibody with protein-binding activity. .
  • chondroitin sulfate proteodarican core protein, synthase, desulfase inhibitor compound, or antibody to sulfate group transferase of the present invention binds to the protein to thereby regulate the expression or function of the protein. An inhibiting effect is expected.
  • a human antibody or a humanized antibody is preferable in order to reduce immunogenicity.
  • the present invention relates to the above chondroitin sulfate proteodarican as a substance capable of inhibiting the function of the core protein, synthase, desulfase inhibitor, or sulfotransferase of the above chondroitin sulfate proteodarican. It also contains a low molecular weight substance (low molecular weight compound) that binds to a core protein, a synthetic enzyme, a desulfurizing oxidase inhibiting compound, or a sulfotransferase.
  • the low molecular weight substance may be a natural or artificial compound. Usually, it is a compound that can be produced or obtained by using methods known to those skilled in the art. The compound of the present invention can also be obtained by the screening method described later.
  • the chondroitin sulfate proteodarican core protein, synthase, desulfurase inhibitor protein, or the protein variant having a dominant negative property to sulfate group refers to the core of chondroitin sulfate proteodarican. It refers to a protein having a function of eliminating or reducing the activity of an endogenous wild-type protein by expressing a gene encoding a protein, a synthase, a desulfase-inhibiting protein, or a sulfotransferase.
  • Examples of such dominant negative proteins include Versican core protein mutants that competitively inhibit the binding to chondroitin sulfate with wild-type Versican core protein.
  • the tissue or cell that inhibits the production or accumulation of chondroitin sulfate proteodarican is not particularly limited, but is preferably the retina choroid, more preferably the vascular endothelial cell in the retina choroid. .
  • a compound that inhibits the production or accumulation of chondroitin sulfate proteodarican is expected to be a drug for treating or preventing a choroidal neovascularization disease.
  • the “treatment or prevention” may be a case where it has a partial effect that is not necessarily required to have a complete therapeutic effect or preventive effect on tissues or cells exhibiting retina choroidal neovascularization.
  • the retina choroidal neovascularization disease is not particularly limited as long as it is a disease accompanied by reticulochoroidal neovascularization, but is preferably a retina choroidal neovascularization disease, more preferably diabetic.
  • the retina choroidal neovascularization inhibitor of the present invention has an action of suppressing retina choroidal neovascularization by inhibiting the production or accumulation of chondroitin sulfate proteodalycan which is the cause of reticulochoroidal neovascularization. Therefore, as a preferred embodiment of the present invention, for example, a therapeutic agent for retinal neovascularization, a therapeutic agent for diabetic retinopathy, a therapeutic agent for retinal vein occlusion, which comprises the retina choroidal neovascularization inhibitor of the present invention as an active ingredient, A therapeutic agent for retinopathy of prematurity or a therapeutic agent for age-related macular degeneration is provided.
  • rechochoroidal neovascularization inhibitor of the present invention can also be expressed as “retrochoroidal neovascularization therapeutic agent”, “retrochoroidal neovascularization improving agent” or the like.
  • inhibitor can also be expressed as “medicine”, “pharmaceutical composition”, “therapeutic drug”, and the like.
  • treatment in the present invention includes a prophylactic effect capable of previously suppressing the occurrence of retina choroidal neovascularization.
  • it is not necessarily limited to having a complete therapeutic effect on cells (tissue) expressing retina choroidal neovascularization, and may be a case having a partial effect.
  • the drug of the present invention can be mixed with a physiologically acceptable carrier, excipient, certain! /, Diluent or the like, and can be administered orally or parenterally as a pharmaceutical composition.
  • a physiologically acceptable carrier such as granules, powders, tablets, capsules, solvents, emulsions or suspensions
  • parenteral preparation dosage forms such as injections, drops, external preparations, eye drops or suppositories can be selected. Examples of injections include subcutaneous injections, intramuscular injections, intraperitoneal injections, intracranial injections, intranasal injections, intravitreal injections, and the like.
  • a nasal agent or an ointment can be shown. Formulation techniques for the above dosage forms so as to include the drug of the present invention as the main component are known.
  • a tablet for oral administration can be produced by adding an excipient, a disintegrant, a binder, a lubricant and the like to the drug of the present invention, mixing, and compressing and shaping.
  • an excipient lactose, starch, mannitol or the like is generally used.
  • disintegrant calcium carbonate or carboxymethyl cellulose calcium is generally used.
  • binder gum arabic, carboxymethyl cellulose, or polybulur pyrrolidone is used.
  • talc magnesium stearate and the like are known.
  • the tablet containing the drug of the present invention can be subjected to a known coating for masking or enteric preparation.
  • a coating agent ethyl cellulose, polyoxyethylene glycol or the like can be used.
  • an injection can be obtained by dissolving the agent of the present invention, which is the main component, together with an appropriate dispersant, or dissolving or dispersing in a dispersion medium.
  • aqueous solvent distilled water, raw Use saline or Ringer's solution as a dispersion medium.
  • oil-based solvents various vegetable oils such as propylene glycol are used as dispersion media.
  • a preservative such as paraben can be added as necessary.
  • known isotonic agents such as sodium chloride and glucose can be added to the injection.
  • a soothing agent such as benzalkonium chloride pro-hydrochloride can be added.
  • An external preparation can be obtained by preparing a solid, liquid, or semi-solid composition of the agent of the present invention. About a solid or liquid composition, it can be set as an external preparation by setting it as the composition similar to what was described previously.
  • a semi-solid composition can be prepared by adding a thickener to an appropriate solvent as required. As the solvent, water, ethyl alcohol, polyethylene glycol, or the like can be used. As the thickener, bentonite, polybutyl alcohol, acrylic acid, methacrylic acid, or polyvinyl pyrrolidone is generally used. This composition can be added with a preservative such as benzalkonium chloride.
  • a suppository can also be obtained by combining an oily base material such as cacao butter or an aqueous gel base material such as cellulose derivative as a carrier.
  • the agent of the present invention is used as a gene therapy agent, in addition to the method of directly administering the agent of the present invention by injection, a method of administering a vector incorporating a nucleic acid can be mentioned.
  • a method of administering a vector incorporating a nucleic acid examples include adenovirus vectors, adeno-associated virus vectors, herpes vinores vectors, vaccinia vinores betaters, retro winores betaters, and lentivirus vectors. Throw well with the power S.
  • a phospholipid vesicle such as a ribosome
  • the endoplasmic reticulum retaining siRNA or shRNA is introduced into a predetermined cell by the ribofusion method.
  • the obtained cells are then administered systemically, for example, intravenously or intraarterially. It can also be administered locally to the retina choroidal neovascularization tissue or the like.
  • siRNA it has a very excellent specific post-transcriptional inhibitory effect in vitro. In vivo, it is rapidly degraded by nuclease activity in serum.
  • the necessary amount (effective amount) of the drug of the present invention is administered to mammals including humans within the safe dose range.
  • the dosage of the drug of the present invention can be appropriately determined finally based on the judgment of a doctor or veterinarian in consideration of the type of dosage form, administration method, patient age and weight, patient symptoms, and the like.
  • the power varies depending on age, sex, symptoms, administration route, number of administrations, and dosage forms.
  • the dose in the case of adenovirus is about 10 6 to 10 13 per day, 1 week to 8 It is administered at weekly intervals.
  • RNA introduction kit for example, Adeno Express: Clontech
  • the application site or the type of the disease is not particularly limited as long as it is a disease that develops retina choroidal neovascularization.
  • a disease that develops retina choroidal neovascularization For example, retinal neovascular disease, diabetic retinopathy, retinal vein Applicable for obstruction, retinopathy of prematurity, and age-related macular degeneration.
  • the above-mentioned diseases may be accompanied with other diseases.
  • the present invention also provides a screening method for an inhibitor of retina choroidal neovascularization, which comprises selecting a substance having an action of inhibiting the production or accumulation of chondroitin sulfate proteodarican from a test sample.
  • a candidate compound for a retina choroidal neovascularization inhibitor or a retina choroidal neovascularization inhibitor can be efficiently obtained.
  • a preferred embodiment of the screening method of the present invention includes a method for screening a retina choroidal neovascularization inhibitor comprising the step of selecting a substance having the action described in any of the following (a) to (d): It is.
  • CSPG chondroitin sulfate proteodarican
  • GAG glycosaminoglycan
  • Test compounds for example, huge compound libraries owned by pharmaceutical companies
  • chondroitin sulfate proteodarican, synthase, desulfase inhibitor compound, sulfate transferase, degradation promoting enzyme, and desulfase used are derived from human, mouse, Forces derived from rats and the like are not particularly limited to those derived from these.
  • the part of chondroitin sulfate proteodalycan is a component such as a glycosaminodarican chain, a core protein, or a part thereof, and is not particularly limited.
  • test compound used in the embodiments described below is not particularly limited.
  • natural compounds, organic compounds, inorganic compounds, proteins, peptides and other single compounds, compound libraries examples include gene library expression products, cell extracts, cell culture supernatants, fermented microorganism products, marine organism extracts, plant extracts, and the like.
  • the "contact" to the test compound in the embodiment described below usually includes chondroitin sulfate proteodarican, a part thereof, a synthase, a desulfase inhibitor compound, a sulfate group transferase, a degradation promoting enzyme.
  • the method is not limited to this method, which is performed by mixing a desulfating enzyme with a test compound.
  • the above “contact” can be performed by contacting a cell expressing these proteins or a part thereof with a test compound.
  • the origin of the "cell” in the embodiments described below is not limited to cells derived from these, and is used in each embodiment, including cells derived from humans, mice, rats, and the like. It is also possible to use microbial cells such as Escherichia coli and yeast transformed to express the protein.
  • microbial cells such as Escherichia coli and yeast transformed to express the protein.
  • chondroitin sulfate proteo ⁇ Darican-expressing cells '' include cells that express the endogenous chondroitin sulfate proteodarican gene! /, Or exogenous chondroitin sulfate proteodarican gene is introduced and expressed. Cells can be used.
  • a cell expressing an exogenous chondroitin sulfate proteodarican gene can be produced by introducing an expression vector into which the chondroitin sulfate proteodarican gene is inserted into a host cell.
  • the expression vector can be produced by general genetic engineering techniques.
  • chondroitin sulfate proteodarican core protein (and the matrix type is chondroitin sulfate proteoglycan, and the eyelet is aggrican, vers ican (versican), neurocan, brevican, etc.) Core proteins, or membrane chondroitin, Frote glycan sulfate glycans, such as Decorin, Biglycan, Fibromodulin, PG—Lb, etc.
  • Synthetic enzymes include, for example, GalNAc4ST-l, GalNAc4ST-2 , GALNAC4S_6ST, UA20ST, GalT_I, GalT_II, GlcAT_I, XylosylT, etc.
  • “Sulfyltransferase” is, for example, C4ST-l (Chondroitin DN-acetylgalactosamine-4- ⁇ -sulfotransrerase 1 in C43 ⁇ 4 r-2 (Cnonaroitin DN -acetylgalactosamine-4-O-sulfotrans ferase 2), C43 ⁇ 4-3 (Chondroitin D—N—acetylgalactosamine—4—0—sulrotransrerase 3), D4ST, C6ST-1, C6ST-2, etc.
  • progressive enzyme examples include ADAMTS_1, ADAMTS-4, ADAMTS-5, Chondroitinase ABC (ChABC), Chondroitinase AC, Chondroitinase B, Calpain I, etc. Hondroitm_6_sulmtase.
  • a method comprising a step of selecting a compound having an action of promoting the degradation of chondroitin sulfate proteodarican.
  • the above method of the present invention includes the following steps, for example.
  • the amount of chondroitin sulfate proteodarican or a part thereof is measured.
  • the measurement can be performed by methods known to those skilled in the art. For example, it can be detected by measuring the amount of labeling using a labeled compound or antibody that binds to chondroitin sulfate proteodarican or a part thereof. It can also be detected using a chromatographic method or mass spectrometry.
  • a compound that reduces the abundance of the chondroitin sulfate proteodarican or a part thereof is then selected as compared with the case where the test compound is not contacted (control).
  • the compound that lowers becomes a drug for treating choroidal neovascularization.
  • CS-GAG such as chondroitin sulfate A (CS_A), CS_B, CS-C (Seikagaku Corporation, ICN, Sigma, etc.), human-derived proteodalycan (BGN, ISL, etc.), etc.
  • the well plate is coated at a concentration of 10 g / mL (Kawashima H et al .; J. Biol. Chem. 277: 12921-12930, 2002. etc.). Add various test compounds to each well of this plate and detect CS-GAG change after 2 hours reaction at 37 ° C.
  • a WFA lectin (Nodafuji lectin) binding method can be mentioned as a simple method. Since WFA lectin binds to the GalNAc residue of CS-GAG chain, CS-GAG can be easily detected. Chondroitinase ABC is used as a positive control for the test compound. When CS-GAG chain is degraded by chondroitinase ABC addition, WFA lectin cannot be bound, so use that principle.
  • FITC-labeled WFA lectin such as EY
  • EY FITC-labeled WFA lectin
  • the CS-GAG is decomposed to change the FITC fluorescence intensity in the well.
  • a compound with the lowest fluorescence value before and after mixing is a new compound that satisfies this concept. It can be determined as a therapeutic candidate compound.
  • an anti-CS antibody (clone: CS56, manufactured by Seikagaku Corporation) that directly labels CS-GAG itself can be used.
  • FITC-labeled anti-CS antibody can be added to CS-coated wells so that mass screening can be performed in a very short time and simply if changes in fluorescence values are observed.
  • free GAG was obtained by adding 2-AB (2-aminobenzamide) or 2-AP (2-aminopyridine; V, manufactured by LUD, etc.) to the plate before and after the test compound was mixed. More detailed analysis is possible by simply fluorescently labeling the reducing end of the chain and analyzing each type of sugar chain and the content of each type by HPLC, MALDI-MS, LC-MS, etc. . This is a method for the next stage of screening in which the properties of candidate compounds are examined in detail.
  • a method including a step of selecting a substance having an inhibitory action on chondroitin sulfate proteodarican synthesis can be mentioned.
  • the above method of the present invention comprises, for example, the following steps.
  • chondroitin sulfate proteodarican or an intermediate in its synthesis process Measure the amount of synthesis.
  • the measurement can be appropriately carried out by those skilled in the art by a known method, for example, a method using a labeled antibody, mass spectrometry, chromatography, or the like.
  • a compound that reduces (suppresses) the amount of synthesis is selected compared to the case where the test compound is not contacted (control).
  • a compound that lowers (suppresses) a drug for the treatment of retina choroidal neovascularization is selected compared to the case where the test compound is not contacted (control).
  • chondroitin sulfate is produced in 16 hours of cell culture using the standard method of collecting and culturing mononuclear cells after collecting peripheral blood from healthy individuals (Uhlin-Hansen L et al , Blood 82: 2880, 1993, etc.). More simply, known cell lines such as fibroblast cell line MH3T3 (Phillip HA, et al. J. Biol. Chem. 279: 48640, 2004), renal tubular cancer cell line ACHN (Kawashima H et al., J. Biol. Chem.
  • CS-GAG synthase genes such as GalNAc4ST-1 and XylosylT are introduced into CHO cells and L cells in a well-known manner and expressed constantly is created. I can do it.
  • a cell line that constantly synthesizes CS-GAG a therapeutic candidate compound can be determined more clearly.
  • a method comprising a step of selecting a substance having a desulfating action of chondroitin sulfate proteodalycan.
  • the above method of the present invention comprises, for example, the following steps. ( a ) The process of contacting the test compound with chondroitin sulfate proteodarican or a part thereof
  • a test compound is brought into contact with chondroitin sulfate proteodarican or a part thereof.
  • the amount of chondroitin sulfate proteodarican or a part thereof that has undergone sulfation is measured.
  • the measurement can be performed by methods known to those skilled in the art. For example, it is possible to detect by measuring the amount of label using a labeled compound or antibody that binds to the structure of desulfurization oxidation remaining in chondroitin sulfate proteodarican or a part thereof. It can also be detected using chromatography or mass spectrometry.
  • human-derived proteodaricans (BGN, ISL, etc.) are prepared and coated on a 96-well plate at a concentration of 10 g / mL (Kawashima H et al.; J. Biol. Chem. 277: 12921-12930, 2002, etc.)). Add various test compounds to each well of this plate and detect CS-GAG change after 2 hours reaction at 37 ° C.
  • the detection method was carried out by desulfating the disaccharide structure of the desulfated fragment remaining on the core protein side of the proteodarican into anti-proteodarican A di4S antibody (clone; 2-B-6, 4 Sulfur in place Recognizes the part that has undergone oxidation) or anti-proteodarican ⁇ di6S (clone; 3-B-3, recognizes the part that has been sulfated at the 6-position, both manufactured by Seikagaku Corporation) By reacting, it is possible to easily detect the desulfated portion.
  • anti-proteodarican A di4S antibody clone; 2-B-6, 4 Sulfur in place Recognizes the part that has undergone oxidation
  • anti-proteodarican ⁇ di6S clone; 3-B-3, recognizes the part that has been sulfated at the 6-position, both manufactured by Seikagaku Corporation
  • FITC-labeled 2-B-6 and 3-B-3 antibodies can be reacted on the plate before and after mixed culture, and changes in fluorescence values can be easily detected.
  • a compound with increased fluorescence intensity before and after the reaction can be determined to be a substance that further promotes desulfation, and can be easily identified as a novel therapeutic candidate compound that satisfies this concept.
  • a method comprising a step of selecting a substance having a sulfation inhibitory action of chondroitin sulfate proteodarican.
  • the above method of the present invention comprises, for example, the following steps.
  • a test substance is brought into contact with chondroitin sulfate proteodarican or a part thereof.
  • the amount of chondroitin sulfate proteodarican or a part thereof that has undergone sulfation is measured.
  • the measurement can be performed by methods known to those skilled in the art. For example, it is possible to detect by measuring the amount of labeling using a labeled compound or antibody that binds to chondroitin sulfate proteodarican or a sulfated structure of a part thereof. Moreover, it can also detect using a chromatography method, a mass spectrometry, etc.
  • the cells and cell lines that promote sulfation of chondroitin sulfate match the cells and cell lines described in (c) above.
  • various test compounds are mixed, and the degree of sulfation before and after culturing is measured, for example, antibody (clone: LY111) for detecting sulfation at position 4 or position 6
  • An antibody that detects sulfation (clone; MC21C, 1 /, deviation is also available from Seikagaku Corporation) can be easily confirmed.
  • Fluorescence-labeled antibodies may be used to compare fluorescence values before and after culture.
  • detection methods using 2-B-6 and 3-B-3 antibodies may be performed before and after culture. Also good. Compounds that suppress the increase in sulfation after cell culture (LY111 and MC21C fluorescence P), or the progress of desulfation after cell culture (2-B-6 and 3-B-3 fluorescence increase calo) Can be easily determined as a candidate compound that satisfies this concept.
  • a cell line in which a gene of a sulfotransferase such as C4ST-1 or C6ST-1 is introduced into CHO cells or L cells by a well-known method and is expressed constantly. Can be created. By using such a cell line that constantly adds a sulfate group, a therapeutic candidate compound can be determined more clearly.
  • Another preferred embodiment of the present invention is a compound that decreases the expression level of the chondroitin sulfate proteodarican core protein, the synthase, the desulfase inhibitor protein, or the sulfotransferase gene of the present invention.
  • screening for a choroidal neovascularization inhibitor comprising the following steps (a) to (d), wherein a compound that increases the expression level of the chondroitin sulfate proteoglycan degradation promoting enzyme or desulfating enzyme gene is selected. Is the method.
  • test compound is brought into contact with a cell expressing a gene encoding a chondroitin sulfate proteodlican core protein, a synthetic enzyme, a desulfase inhibitor protein, a sulfotransferase, a degradation promoting enzyme, or a desulfase enzyme.
  • the gene is a chondroitin sulfate proteodarican core protein, synthase, desulfase inhibitor protein, or sulfotransferase
  • the expression level of the gene is reduced compared to the control! /
  • the gene is a chondroitin sulfate proteodarican degradation-promoting enzyme or a desulfating enzyme, selecting a compound in which the expression level of the gene is increased compared to the control
  • chondroitin sulfate proteodalycan core protein synthetic enzyme, desulfase inhibitor protein, sulfotransferase, degradation promoting enzyme, or cell expressing a gene encoding desulfase is expressed.
  • the test compound is brought into contact.
  • chondroitin sulfate proteodalycan core protein synthetic enzyme, desulfase inhibitor protein, sulfate transferase, degradation promoting enzyme, or desulfate enzyme
  • gene expression includes both transcription and translation. The gene expression level can be measured by methods known to those skilled in the art.
  • mRNA is extracted from cells expressing any of the above proteins according to a standard method, and Northern hybridization method, RT-PCR method, DNA array method or the like using this mRNA as a cage is performed.
  • the amount of transcription of the gene can be measured.
  • a protein fraction is collected from a cell expressing a gene encoding any of the above proteins, and the expression of any of the above! / And any of the proteins is detected by electrophoresis such as SDS-PAGE. It is also possible to measure the translation amount.
  • it is also possible to measure the amount of translation of a gene by detecting the expression of the protein by performing Western blotting using an antibody against any of the above proteins.
  • the antibody used for detecting the protein is not particularly limited as long as it is a detectable antibody. For example, both a monoclonal antibody and a polyclonal antibody can be used.
  • the expression level of the gene is compared with that in the case where the test compound is not brought into contact with the test method!
  • the gene is a chondroitin sulfate proteodarican core protein, a synthase, a desulfase inhibitor protein, or a sulfotransferase
  • Select a compound that decreases (suppresses) the expression level of the gene compared to the control!
  • a compound that lowers (suppresses) becomes a drug for suppressing choroidal neovascularization or a candidate compound for treating choroidal neovascularization.
  • the gene is a chondroitin sulfate proteodarican degradation-promoting enzyme or a desulfation enzyme
  • a compound in which the expression level of the gene is increased (enhanced) compared to the control is used.
  • the compound to be increased (enhanced) is a drug for suppressing retina choroidal neovascularization or a candidate compound for treating retina choroidal neovascularization.
  • the expression level of the core protein, synthase, desulfase inhibitor protein, or sulfotransferase gene of the chondroitin sulfate proteodarican of the present invention is reduced.
  • a method of selecting a compound that increases the expression level of the chondroitin sulfate proteodarican degradation-promoting enzyme or desulfating enzyme gene using the expression of the reporter gene as an index includes, for example, the following steps (a) to (d).
  • the transcriptional regulatory region of a gene encoding a chondroitin sulfate proteodarican core protein, a synthetic enzyme, a desulfase inhibitor protein, a sulfotransferase, a degradation-promoting enzyme, or a desulfase enzyme and the reporter gene are functional.
  • the reporter gene is functionally linked to the core protein, synthase, desulfase inhibitor protein, or sulfotransferase of chondroitin sulfate proteodarican, the expression level of the reporter gene If the reporter gene is functionally linked to a chondroitin sulfate proteodalican degradation-promoting enzyme or desulfating enzyme, the expression level of the reporter gene Selecting a compound that is elevated relative to a control
  • chondroitin sulfate proteodalycan core protein synthesis A cell or a cell extract containing DNA having a structure in which a transcriptional regulatory region of a gene encoding an enzyme, a desulfurase inhibitor protein, a sulfotransferase, a degradation-promoting enzyme, or a desulfurization oxidase-encoding gene and a reporter gene are functionally linked And a test compound are brought into contact with each other.
  • “functionally linked” refers to a gene encoding chondroitin sulfate proteodarican core protein, synthase, desulfase inhibitor protein, sulfate transferase, degradation promoting enzyme, or desulfase So that transcription factor binds to the transcriptional regulatory region of the protein and induces the expression of the reporter gene, chondroitin sulfate proteodalycan core protein, synthase, desulfase inhibitor protein, sulfate transferase, accelerated degradation It means that a transcriptional regulatory region of an enzyme or a gene encoding a desulfating enzyme is linked to a reporter gene.
  • the reporter gene is linked to other genes and forms a fusion protein with other gene products, chondroitin sulfate proteodlican core protein, synthase, desulfase inhibitor protein, sulfate If the expression of the fusion protein is induced by binding of a transcription factor to the transcriptional regulatory region of a gene encoding a transferase, a degradation promoting enzyme, or a desulfating enzyme, the above-mentioned "functionally bound" Is included.
  • the reporter gene used in the present method is not particularly limited as long as its expression can be detected, for example, CAT gene, lacZ gene, luciferase gene, GFP gene and the like.
  • a structure in which a transcriptional regulatory region of a gene encoding a chondroitin sulfate proteodarican core protein, a synthetic enzyme, a desulfase inhibitor protein, a sulfotransferase, a degradation-promoting enzyme, or a desulfase enzyme and a reporter gene are functionally linked.
  • Examples of the “cell containing a DNA having” include a cell into which a vector having such a structure inserted is introduced. Such vectors are constructed by methods well known to those skilled in the art.
  • the power S can be made.
  • the introduction of the vector into the cell can be carried out by a general method such as a calcium phosphate precipitation method, an electric pulse perforation method, a lipofussion method, or a microinjection method.
  • a general method such as a calcium phosphate precipitation method, an electric pulse perforation method, a lipofussion method, or a microinjection method.
  • “A structure in which the transcriptional regulatory region of a gene encoding a chondroitin sulfate proteodlican core protein, synthase, desulfase inhibitor protein, sulfate transferase, degradation-promoting enzyme, or desulfase is functionally linked to a reporter gene
  • the “cell containing DNA having a” includes a cell in which the structure is inserted into a chromosome.
  • the introduction of a DNA structure into a chromosome can be performed by a method generally used by those skilled in the art, for example,
  • Transcriptional regulatory region of a gene encoding chondroitin sulfate proteodlican core protein, synthetic enzyme, desulfase inhibitor protein, sulfotransferase, degradation promoting enzyme, or desulfase enzyme and the reporter gene are functional.
  • the cell extract containing DNA having a structure bonded to is, for example, a chondroitin sulfate proteodlican core protein, synthase, desulfated enzyme inhibitory protein added to a cell extract contained in a commercially available in vitro transcription translation kit.
  • DNA having a structure in which a transcriptional regulatory region of a gene encoding a sulfotransferase and a reporter gene are functionally linked.
  • contact means "chondroitin sulfate proteodarican core protein, synthetic enzyme, desulfase inhibitor protein, sulfotransferase, degradation promoting enzyme, or transcriptional regulatory region of a gene encoding a desulfase enzyme.
  • the expression level of the reporter gene is measured by! /, And then! /.
  • the expression level of the reporter gene can be measured by methods known to those skilled in the art depending on the type of the reporter gene.
  • the reporter gene is a CAT gene
  • the expression level of the reporter gene can be measured by detecting acetylation of chloramphenicol by the gene product.
  • Reporter gene is lac
  • the coloration of the dye compound is detected by the catalytic action of the gene expression product.
  • the luciferase gene the fluorescence of the fluorescent compound is detected by the catalytic action of the gene expression product.
  • the expression level of the reporter gene can be measured by detecting fluorescence from the GFP protein.
  • the reporter gene is a gene encoding a chondroitin sulfate proteodalican core protein, a synthase, a desulfase inhibitor protein, or a sulfotransferase.
  • a compound that reduces (suppresses) the expression level of the reporter gene compared to the control is selected.
  • the compound to be reduced (suppressed) is a drug for suppressing retina choroidal neovascularization or a candidate compound for treating retina choroidal neovascularization.
  • the reporter gene when the reporter gene is functionally linked to a chondroitin sulfate proteodarican degradation-promoting enzyme or a desulfase enzyme, the expression level of the reporter gene is higher than that of the control. Increase (enhance) the compound! The compound to be increased (enhanced) becomes a drug for suppressing retina choroidal neovascularization or a candidate compound for treating retina choroidal neovascularization.
  • the retina choroidal neovascularization inhibitor found in the screening method of the present invention is preferably for the treatment or prevention of a retina choroidal neovascularization disease.
  • the present invention also provides a kit containing various drugs, reagents and the like used for carrying out the screening method of the present invention.
  • the kit of the present invention can be appropriately selected from, for example, the above-mentioned various reagents of the present invention according to the screening method to be performed.
  • the kit of the present invention can comprise the chondroitin sulfate proteodarican of the present invention as a constituent element.
  • the kit of the present invention can further contain various reagents, containers and the like used in the method of the present invention.
  • anti-chondroitin sulfate proteodarican antibody, probe, various reaction reagents, cells, culture solution, control sample, buffer solution, instructions describing how to use, etc. are included as appropriate That's the power S.
  • the present invention is a screening method for an agent for suppressing choroidal neovascularization, comprising the step of detecting whether the production or accumulation of chondroitin sulfate proteodarican is inhibited. Therefore, in the screening method, for example, a probe for a gene encoding the core protein of chondroitin sulfate proteoglycan that can be used for detection of chondroitin sulfate proteoglycan, a primer for amplifying an arbitrary region of the gene, etc.
  • an antibody recognizing chondroitin sulfate proteodarican can be included in the components of the kit for screening an inhibitor of choroidal angiogenesis of the present invention. Monkey.
  • the oligonucleotide specifically hybridizes to the DNA of the Versican core protein gene of the present invention, for example.
  • “specifically hybridize” means normal hybridization conditions, preferably stringent hybridization conditions (for example, Sambrook et al., Molecular Cloning, Cold Spring Harbor). In the Laboratory Press, New York, USA, 2nd edition, 1989), it means that cross-hybridization does not occur significantly with DNA encoding other proteins. If specific hybridization is possible, the oligonucleotide does not have to be completely complementary to the base sequence of the Versican core protein gene of the present invention.
  • hybridization conditions include, for example, “2 X SSC, 0.1% SDS, 50 ° C.”, “2 X SSC, 0.1% SDS, 42 ° C.”, “1 X SSC” , 0.1% SDS, 37 ° C '' and more stringent conditions as ⁇ 2 X SSC, 0.1% SDS, 65 ° C '', ⁇ 0.5 X SSC, 0.1% SDS, 42 ° C '' and ⁇ 0.2 X SSC '' , 0.1% SDS, 65 ° C. ”.
  • pre-hybridization is performed at 68 ° C for 30 minutes or more, and then a probe is added to attain 68 ° C for 1 hour or more. And then hybridize, followed by 3 washes for 20 minutes at room temperature in 2 X SSC, 0.1% SDS, followed by 3 washes for 20 minutes at 37 ° C in 1 X SSC, 0.1% SDS. Finally, it can be washed twice in 1 X SSC, 0.1% SDS at 50 ° C for 20 minutes.
  • the oligonucleotide can be used as a probe or primer in the above-described screening kit of the present invention.
  • the length is usually 15 bp to 100 bp, preferably 17 bp to 30 bp.
  • the primer is not particularly limited as long as it can amplify at least part of the DNA of the gene of the present invention described above, for example, the force described in SEQ ID NO: 71 or 72.
  • the present invention also provides a method for treating or preventing a choroidal neovascularization disease, comprising the step of administering the agent of the present invention to an individual (eg, a patient).
  • the subject of the prevention or treatment method of the present invention is not particularly limited as long as it is an organism capable of developing a retina choroidal neovascular disease, but is preferably a human.
  • administration to an individual can be performed by methods known to those skilled in the art, such as intraarterial injection, intravenous injection, and subcutaneous injection.
  • the dose varies depending on the weight and age of the patient, the administration method, etc., but a person skilled in the art (such as a doctor, veterinarian, pharmacist, etc.) can appropriately select an appropriate dose.
  • the present invention relates to the use of the agent of the present invention in the production of a retina choroidal neovascularization inhibitor.
  • Example 1 Effect of chondroitin desulfase in StreiDtozotocin-induced type 2 diabetic retinopathy model mouse: attenuation of sulfated CSPG:
  • C57BL / 6JcL mice (CLEA Japan) were bred and given birth, and two days after birth, female C57BL / 6JcL mice (CLEA Japan), each with Streptozocin 10 mg / mL (manufactured by SIGMA) 20 L / head, and fed with CE_2 (manufactured by CLEA Japan) and sterilized water until 4 weeks of age, and fed High Fat Diet diet (manufactured by CLEA Japan) and sterile water from 4 weeks of age for 2 weeks. Raised.
  • chondroitin 4 desulfase (20 units / ml; manufactured by Seikagaku Corporation) at 4 units / mouse and solvent (phosphate buffer) twice a week for intraperitoneal administration (lsh ot / Treatment was performed 4 times (1 week) (2 weeks).
  • solvent phosphate buffer
  • the eyeballs of both groups of mice were removed and subjected to immunohistological studies.
  • a frozen block 'section was prepared with the removed eye. Sections were fixed with acetone (Sigma Aldrich Japan) for 10 minutes, washed with phosphate buffer, and anti-chondroitin sulfate proteoglycan (CSPG) antibody (clone CS56, mouse monoclonal antibody, 1 O ⁇ g) as the primary antibody. / mL, manufactured by Seikagaku Corporation) and reacted at room temperature for 1 hour. Subsequently, a secondary antibody reaction was performed using a Histofine mouse stin kit (manufactured by Nichirei; used for mouse monoclonal antibody), and then DAB substrate (manufactured by Nichirei) was added to perform an enzyme dye reaction. . This specimen was observed using an optical microscope (manufactured by Leica).
  • CSPG anti-chondroitin sulfate proteoglycan
  • CS56 is an antibody that recognizes not only the 4-position but also the 6-position sulfate group, suggesting that this attenuation reflects the attenuation of the 4-position sulfate group. From the above, it was revealed that CSPG deposition in the retinal tissue induced in this model mouse is modified and suppressed by in vivo administration of chondroitin 4 desulfating enzyme.
  • Example 2 Strei3to Z otocin induced type 2 diabetic retinopathy chondroitin 4 desulfation enzymes in mouse model effect: vascular endothelial fine ⁇ bovine braking:
  • the section obtained by the same method as in Example 1 was acetone (manufactured by Sigma-Aldrich Japan). After fixing for 10 minutes, washed with a phosphate buffer, rat-derived anti-vascular endothelial cell antibody (CD31; 1: 200 dilution; manufactured by Pharmingen) was added as a primary antibody, and allowed to react at room temperature for 1 hour. Next, a peroxidase-labeled donkey-derived anti-rab HgG (1: 200 dilution; manufactured by Biosource), which is a secondary antibody, was added and reacted at room temperature for 30 minutes. DAB substrate (Nichirei) was added to the sample after the reaction. This specimen was observed using an optical microscope (manufactured by Leica).
  • the obtained tissue image is shown in Fig. 2 (the original image is in color).
  • the number of CD31-positive cells on the retinal vitreous side increased, and an image that partially protruded into the vitreous was also observed. This is considered to reflect the stage of preproliferative retinopathy of diabetic retinopathy, indicating the effectiveness of the model.
  • the number of CD31 positive cells at the same site was clearly reduced.
  • Example 3 StreT3t OZO t 0 d n induced matter type 2 diabetes chondroitin in matters retinopathy model mice 4-de ⁇ mosquito: collagen, M ⁇ values JMU:
  • Example 2 A section obtained in the same manner as in Example 1 was fixed with acetone (manufactured by Sigma Aldrich Japan) for 10 minutes, washed with a phosphate buffer, and a rabbit antibody-derived anti-type IV collagen antibody (1: 250) as a primary antibody. Dilution; Sigma) was added and allowed to react at room temperature for 1 hour. Next, a peroxidase-labeled anti-rabbit IgG (1: 200 dilution; manufactured by Jackson ImmunoResearch) as a secondary antibody was added and reacted at room temperature for 30 minutes. DAB substrate (manufactured by Nichirei Co., Ltd.) was added to the sample after the reaction. This specimen was observed using an optical microscope (manufactured by Leica).
  • the obtained tissue image is shown in Fig. 3 (the original image is in color).
  • the untreated group positive findings of type IV collagen were observed on the retinal vitreous side, and findings parallel to the boundary membrane of the retina were observed. This suggests an increase in collagen, that is, a change in fibrosis, along with abnormal venous morphology.
  • the enzyme treatment group the growth of type IV collagen at the same site was markedly suppressed. From the above results, it was revealed that in the type 2 diabetes model, the ability to recognize retinal collagen growth was suppressed by administration of chondroitin 4 desulfase.
  • Example 4 Versica in StreiDtozotocin-induced type 2 diabetic retinopathy model mouse Gene silencing effect: Suppression of enhanced versican expression:
  • C57BL / 6JcL mice (CLEA Japan) were bred and given birth, and two days after birth C57BL / 6JcL mice female (CLEA Japan), each with Streptozocin 10 mg / mL (manufactured by SIGMA) 20 a Inject subcutaneously into L / head, feed CE_2 (manufactured by CLEA Japan) and sterilized water up to 4 weeks of age, and feed high fat diet (CLEA Japan) and sterilized water from 4 weeks of age. 2 Raised for a week.
  • versican siRNA cocktail (5 '_ATGAAAGGCATCTTATGGAT GTGCTCA-3, (SEQ ID NO: 67); 5,-ATTACTAACCCATGCACTACATCAA-3, (SEQ ID NO: 68); 5,-GGCAGCCACCAGCAGGTACACTCTG-3' (SEQ ID NO: 69) 5;-CTGCTCAACAGGCTTGTTTGGATAT-3 '(SEQ ID NO: 70), 1 ⁇ g / animal, Geneworld), or PBS mixed with atelocollagen (Kohken) diluted 10-fold with PBS in advance 200 ⁇ 1 was injected intraperitoneally. The treatment was performed twice (2 weeks), once per week and intraperitoneally (lshot / 1 week). On day 14, the versican SiRNA effect was examined by PCR.
  • the collected eyeballs were frozen in 1.5 ml tubes, especially with liquid nitrogen.
  • tissue To 50 mg of tissue, add 1 ml of RNA-Bee (TEL-TEST), homogenize the suspension, add chloroform 200 ⁇ 1 (Sigma Aldrich Japan), mix gently, and cool on ice for about 5 minutes. Centrifugation was carried out using a centrifugal separator (Centrifbge 5417R, manufactured by Pendorf 3 ⁇ 4) at 12,000 rpm, 4 ° C. for 15 minutes. Transfer the supernatant 5001 after centrifugation to another 1.5 ml tube and apply 500 ⁇ l of isopropannol (Sigma Aldrich Japan) in the same volume as the supernatant!
  • RNA concentration in the sample extracted by POWER Wave XS was calculated.
  • RNA sample was adjusted to a concentration of 50013 ⁇ 4 / 201, heated at 68 ° C. for 3 minutes with BLOCK INCUBATOR (manufactured by ASTEC), and cooled on ice for 10 minutes. After cooling with ice, the RT Pre Mix solution prepared in advance (Yarn and Adult: 25 mM MgCl 18.64 l (Invitrogen), 5 X Buffer 20 ⁇ 1 (Invitrogen), 0 ⁇ 1 ⁇ DTT 6.6 ⁇ 1 (Invitrogen) 1), 1 OmM dNTP mix 10 1 (Invitrogen), RNase Inhibitor 21 (Invitrogen), MM LV Reverse transcriptase 1.2 ⁇ 1 (Invitrogen), Random primer 2 ⁇ 1 (Invitrogen), sterile distilled water 19.56 1 80 1 (Otsuka distilled water: manufactured by Otsuka Pharmaceutical Co., Ltd.) was added, and the mixture was heated with a BLOCK INC UBATOR at 42 ° C
  • PCR Buffer 2 ⁇ 1 [Composition: 166 mM (NH) SO (Sigma Aldrich Japan), 670 mM Tris p
  • IX LoTE Composition: 3 mM Tris-HCl (pH7.5) (Invitrogen), 0.2 mM EDTA (pH7.5) (Sigma Aldrich Japan)] Ethydium Bromide (Invitrogen) After shaking for 20 to 30 minutes in a staining solution, gel expression was confirmed with EXILIM (CASIO) installed in I-Scope WD (ADVANCE) to confirm gene expression.
  • Fig. 4 shows the results of semi-quantitative PCR, in which the dilution ratio of cDNA is roughly divided into 9-fold and 18-fold (1/9, 1/18).
  • the ability to enhance versican mRNA expression in the untreated group with diabetes The versican siRNA treatment group had no ability to enhance versican mRNA expression. This suppression of expression is markedly observed at a dilution ratio of 18 times. From the above, it was proved that administration of versican siRNA markedly suppresses the enhanced expression of versican associated with diabetic retinopathy.
  • Example 5 Versican gene silencing effect in Strei3tozotocin-induced type 2 diabetic retinopathy model mice: Suppression of CSPG fertilization:
  • Example 4 the eyeballs were removed in the same manner as in Example 1, and the frozen block was cut. Created a piece.
  • the sections were fixed with acetone (manufactured by Sigma-Aldrich Japan) for 10 minutes, washed with a phosphate buffer, and anti-chondroitin sulfate proteodarican (C SPG) antibody (clone CS56, mouse monoclonal antibody, lO / ig / mL; manufactured by Seikagaku Corporation) was added and reacted at room temperature for 1 hour.
  • C SPG anti-chondroitin sulfate proteodarican
  • a secondary antibody reaction was performed using a histofine mouse stain kit (manufactured by Nichirei; used for mouse monoclonal antibodies), and then DAB substrate (manufactured by Nichirei) was added to perform an enzyme dye reaction. .
  • This specimen was observed using an optical microscope (manufactured by Leica). The results are shown in Fig. 5 (original image is in color). Since CS56 recognizes C SPG in general, versican is also recognized. In the type 2 diabetes model mouse-untreated group, CSPG increased and accumulated in the vitreous retina, whereas in the versican SiRNA-treated group, this increase in CSPG was almost completely suppressed. ! / This result shows that not only gene expression but also enhanced expression at the glycoprotein level was almost completely suppressed by versican SiRNA gene silencing.
  • Example 6 StreT3t OZO t 0 d n induced matter type 2 Bashika in diabetic matter retinopathy model mice emissions I cloud silencing mosquito ⁇ ⁇ "values JMU:
  • Example 5 A section obtained in the same manner as in Example 5 was fixed with acetone (manufactured by Sigma-Aldrich Japan) for 10 minutes, washed with a phosphate buffer, and rat-derived antivascular endothelial cell antibody (CD31; 1: 200 dilution; manufactured by Pharmingen) was added and allowed to react at room temperature for 1 hour. Next, a peroxidase-labeled donkey-derived anti-rab HgG (1: 200 dilution; manufactured by Biosource), which is a secondary antibody, was added and reacted at room temperature for 30 minutes. DAB substrate (Nichirei) was added to the sample after the reaction. This specimen was observed using an optical microscope (manufactured by Leica).
  • the obtained tissue image is shown in Fig. 6 (the original image is in color).
  • the number of CD31 positive cells on the retinal vitreous side increased, whereas in the SiRNA treated group, the increase in CD31 positive cells at the same site was almost completely suppressed.
  • Example 7 Strei3to Z otocin induced type 2 Bashika in diabetic retinopathy model mice emissions gene silencing: IV collagen hyperplasia suppression:
  • Example 5 A section obtained in the same manner as in Example 5 was acetone (manufactured by Sigma-Aldrich Japan). After fixing for 10 minutes, the mixture was washed with a phosphate buffer, a rabbit antibody-derived anti-type IV collagen antibody (1: 250 dilution; manufactured by Sigma) was added as a primary antibody, and the mixture was reacted at room temperature for 1 hour. Next, a peroxidase-labeled anti-rabbit IgG (1: 200 dilution; manufactured by Jackson ImmunoResearch) as a secondary antibody was added and reacted at room temperature for 30 minutes. DAB substrate (manufactured by Nichirei Co., Ltd.) was added to the sample after the reaction. This specimen was observed using an optical microscope (manufactured by Leica).
  • the obtained tissue image is shown in Fig. 7 (the original image is in color).
  • type IV collagen augmentation was observed in the vitreous omentum, whereas in the SiRNA treated group, it was markedly suppressed.
  • the above results revealed that retinal collagen growth in type 2 diabetes model can be suppressed by versican gene silencing treatment.
  • the same versican siRNA cocktail as in Example 4 (5′-ATGAAAGGCATCTTATGGATGTGCTCA-3 ′ (SEQ ID NO: 67); 5′-ATTACT AACCCATGCACTACATCAA-3 ′ (SEQ ID NO: 68); 5, -GGCAGCCACCAGCAGGT ACACTCTG-3 , (SEQ ID NO: 69); 5,-CTGCTCAACAGGCTTGTTTGGATAT-3 (SEQ ID NO: 70), 1 H g / mouse, Gene World), or atelocollagen in which PBS has been diluted 10 times in advance with PBS (Koken) 100 1 was injected intraperitoneally.
  • Versican siRNA containing the core site sequence of Versican, one of chondroitin sulfate proteoglycans, as an example of examining the effect of chondroitin sulfate proteoglycan (CSPG) accumulation has the effect of treating or preventing diabetic retinopathy and retinopathy of prematurity by suppressing the accumulation of chondroitin sulfate proteodarican in the retina choroid and inhibiting angiogenesis.
  • the retina-choroidal neovascularization inhibitor according to the present invention has the effect of suppressing the accumulation of chondroitin sulfate proteodarican around the reticulum by suppressing the expression of Versican by the administration of Versican siRNA, It is very useful in suppressing angiogenesis.
  • a method of treating or preventing diabetic retinopathy and retinopathy of prematurity by administering a retina choroidal neovascularization inhibitor having an inhibitory effect on the accumulation of chondroitin sulfate proteodarican of the present invention has an unprecedented mechanism of action, Because the lesion can be effectively improved by drug therapy, it can be an excellent therapy useful for further improvement of patients' QOL and medical care.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Molecular Biology (AREA)
  • Public Health (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Epidemiology (AREA)
  • Biochemistry (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Ophthalmology & Optometry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Immunology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Investigating Or Analysing Biological Materials (AREA)

Abstract

La présente invention concerne un inhibiteur de néovascularisation choriorétinale adapté au traitement ou à la prévention des maladies de néovascularisation choriorétinale, tel que l'ARNsi de versicane contenant une séquence de sites centraux de versicane, qui est l'un des protéoglycanes à chondroïtine sulfate, ou chondroïtine-4-désulfatase qui désulfate le groupe sulfate en position 4 dudit protéoglycane en tant qu'exemple de l'examen d'un effet de l'accumulation dudit protéoglycane (CSPG). L'invention concerne également un procédé d'inhibition de la néovascularisation choriorétinale sur la base de l'inhibition de l'accumulation dudit protéoglycane (CSPG) par l'administration d'ARNsi de versicane, de chondroïtine-4-désulfatase ou analogue à un sujet, et un procédé de traitement ou de prévention desdites maladies telles que la rétinopathie diabétique l'utilisant.
PCT/JP2007/067369 2006-09-08 2007-09-06 Inhibiteur de néovascularisation fibreuse oculaire WO2008029868A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
JP2006-244531 2006-09-08
JP2006244531A JP2009286695A (ja) 2006-09-08 2006-09-08 眼線維性血管新生抑制剤

Publications (1)

Publication Number Publication Date
WO2008029868A1 true WO2008029868A1 (fr) 2008-03-13

Family

ID=39157292

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2007/067369 WO2008029868A1 (fr) 2006-09-08 2007-09-06 Inhibiteur de néovascularisation fibreuse oculaire

Country Status (2)

Country Link
JP (1) JP2009286695A (fr)
WO (1) WO2008029868A1 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2238987A1 (fr) * 2007-12-27 2010-10-13 Stelic Institute Of Regenerative Medicine, Stelic Institute & Co. Gène apparenté à une chaîne de sucre et son utilisation
WO2020038971A1 (fr) 2018-08-23 2020-02-27 Roche Innovation Center Copenhagen A/S Oligonucléotides antisens ciblant la vcan

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
CATTARUZZA S. ET AL.: "Distribution of PG-M/versican variants in human tissues and de novo expression of isoform V3 upon endothelial cell activation, migration, and neoangiogenesis in vitro", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 277, no. 49, 2002, pages 47626 - 47635, XP003021624 *
MATHEWS M.K. ET AL.: "Vascular endothelial growth factor and vascular permeability changes in human diabetic retinopathy", INVESTIGATIVE OPHTHALMOLOGY & VISUAL SCIENCE, vol. 38, no. 13, 1997, pages 2729 - 2741, XP003021623 *
OSHITARI T. ET AL.: "SiRNA strategy against overexpression of extracellular matrix in diabetic retinopathy", EXPERIMENTAL EYE RESEARCH, vol. 81, no. 1, 2005, pages 32 - 37, XP004939249 *
REICH S.J. ET AL.: "Small interfering RNA (siRNA) targeting VEGF effectively inhibits ocular neovascularization in a mouse model", MOLECULAR VISION, vol. 9, 2003, pages 210 - 216, XP002467858 *
ZHENG P.S. ET AL.: "Versican G3 domain promotes blood coagulation through suppressing the activity of tissue factor pathway inhibitor-1", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 281, no. 12, 2006, pages 8175 - 8182, XP003021626 *
ZHENG P.S. ET AL.: "Versican/PG-M G3 domain promotes tumor growth and angiogenesis", FASEB JOURNAL, 2004, XP003021625, Retrieved from the Internet <URL:http://www.sebj.org/cgi/reprint/18/6/754> *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2238987A1 (fr) * 2007-12-27 2010-10-13 Stelic Institute Of Regenerative Medicine, Stelic Institute & Co. Gène apparenté à une chaîne de sucre et son utilisation
EP2238987A4 (fr) * 2007-12-27 2011-11-02 Stelic Inst Of Regenerative Medicine Stelic Inst & Co Gène apparenté à une chaîne de sucre et son utilisation
EP3045178A1 (fr) * 2007-12-27 2016-07-20 Stelic Institute Of Regenerative Medicine, Stelic Institute & Co. Gène apparenté à une chaîne de sucre et son utilisation
WO2020038971A1 (fr) 2018-08-23 2020-02-27 Roche Innovation Center Copenhagen A/S Oligonucléotides antisens ciblant la vcan

Also Published As

Publication number Publication date
JP2009286695A (ja) 2009-12-10

Similar Documents

Publication Publication Date Title
KR101926292B1 (ko) 당쇄 관련 유전자, 및 그의 이용
AU2016201644B2 (en) Detection and treatment of fibrosis
Lyzogubov et al. Role of ocular complement factor H in a murine model of choroidal neovascularization
JP2012508247A (ja) 蛋白尿腎疾患の病因における可溶性ｕＰＡＲの役割
JP4101276B2 (ja) 慢性閉塞性肺疾患改善剤
JP4147264B2 (ja) 神経線維性変性抑制剤
JP2008273955A (ja) 炎症性腸疾患改善剤
EP1941906A1 (fr) Inhibiteur de fibrose hepatique
WO2008029868A1 (fr) Inhibiteur de néovascularisation fibreuse oculaire
WO2008156561A1 (fr) Procédés et compositions pour le traitement et le diagnostic de la myopathie induite par la statine
JP2009292725A (ja) 腎疾患改善剤
JP2009234916A (ja) コンドロイチン硫酸プロテオグリカン蓄積制御に基づくインスリン抵抗性抑制剤
WO2008029871A1 (fr) Inhibiteur de la dégénérescence des fibres nerveuses
JP2009108033A (ja) 肝線維化抑制剤

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 07806810

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 07806810

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: JP