WO2008021149A2 - Compositions, devices and methods for treatment of huntington's disease through intracranial delivery of sirna - Google Patents

Compositions, devices and methods for treatment of huntington's disease through intracranial delivery of sirna Download PDF

Info

Publication number
WO2008021149A2
WO2008021149A2 PCT/US2007/017659 US2007017659W WO2008021149A2 WO 2008021149 A2 WO2008021149 A2 WO 2008021149A2 US 2007017659 W US2007017659 W US 2007017659W WO 2008021149 A2 WO2008021149 A2 WO 2008021149A2
Authority
WO
WIPO (PCT)
Prior art keywords
small interfering
interfering rna
disease
rna
strand
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2007/017659
Other languages
English (en)
French (fr)
Other versions
WO2008021149A3 (en
Inventor
William F. Kaemmerer
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Medtronic Inc
Original Assignee
Medtronic Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Medtronic Inc filed Critical Medtronic Inc
Priority to US12/376,940 priority Critical patent/US7994149B2/en
Priority to CA2660153A priority patent/CA2660153C/en
Priority to CN2007800371052A priority patent/CN101522202B/zh
Priority to EP07811194.5A priority patent/EP2056840B1/en
Priority to JP2009523836A priority patent/JP2010500357A/ja
Publication of WO2008021149A2 publication Critical patent/WO2008021149A2/en
Publication of WO2008021149A3 publication Critical patent/WO2008021149A3/en
Anticipated expiration legal-status Critical
Priority to US13/028,638 priority patent/US8957198B2/en
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/713Double-stranded nucleic acids or oligonucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/0075Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the delivery route, e.g. oral, subcutaneous
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/0012Galenical forms characterised by the site of application
    • A61K9/0085Brain, e.g. brain implants; Spinal cord
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61MDEVICES FOR INTRODUCING MEDIA INTO, OR ONTO, THE BODY; DEVICES FOR TRANSDUCING BODY MEDIA OR FOR TAKING MEDIA FROM THE BODY; DEVICES FOR PRODUCING OR ENDING SLEEP OR STUPOR
    • A61M37/00Other apparatus for introducing media into the body; Percutany, i.e. introducing medicines into the body by diffusion through the skin
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/14Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/111General methods applicable to biologically active non-coding nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • C12N2310/111Antisense spanning the whole gene, or a large part of it
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/50Physical structure
    • C12N2310/53Physical structure partially self-complementary or closed
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/30Special therapeutic applications
    • C12N2320/32Special delivery means, e.g. tissue-specific

Definitions

  • Patent Application 11/501,147 filed on August 8, 2006 which is a continuation-in-part of U.S. application 10/721,693 filed on November 25, 2003, which claims priority to provisional application 60/444,614 filed on February 3,
  • This invention relates to devices, systems, and methods for treating neurodegenerative disorders by brain infusion of small interfering RNA or vectors containing the DNA encoding for small interfering RNA.
  • This invention provides novel devices, systems, and methods for delivering small interfering RNA to targeted sites in the brain to inhibit or arrest the development and progression of neurodegenerative disorders .
  • neurodegenerative diseases such as Parkinson's disease, Alzheimer's disease, Huntington's disease, Spinocerebellar Ataxia Type 1, Type 2, and Type 3, and dentatorubral pallidoluysian atrophy (DRLPA)
  • DRLPA dentatorubral pallidoluysian atrophy
  • the neurodegenerative process in Parkinson's disease and Alzheimer's disease is characterized by extensive loss of selected neuronal cell populations accompanied by synaptic injury and astr ⁇ gliosis .
  • Pathological hallmarks of Alzheimer's disease include formation of amyloid plaques, neurofibrillary tangles and neuropil thread formation; pathological hallmarks of Parkinson's diseases include the formation of intraneuronal inclusions called Lewy bodies and the loss of dopaminergic neurons in the substantia nigra.
  • alpha-synuclein Parkinson's disease
  • APP amyloid precursor protein
  • BACEl amyloid precursor protein
  • Alpha-synuclein has been implicated in Parkinson's disease because it is abundantly found in Lewy Bodies, its overexpression in transgenic mice leads to Parkinson's disease-like pathology, and mutations within this molecule are associated with familial Parkinson's disease.
  • Alpha- synuclein which belongs to a larger family of molecules including ⁇ and ⁇ synuclein, is a 140 amino acid non-amyloid synaptic protein which is a precursor of the 35 amino acid non-amyloid component protein found in amyloid plaques.
  • Alzheimer's disease is a progressive degenerative disorder of the brain characterized by mental deterioration, memory loss, confusion, and disorientation.
  • the cellular mechanisms contributing to this pathology are two types of fibrillar protein deposits in the brain: intracellular neurofibrillary tangles composed of polymerized tau protein, and abundant extracellular fibrils comprised largely of ⁇ -amyloid.
  • Beta-amyloid also known as A ⁇ , arises from the proteolytic processing of the amyloid precursor protein (APP) at the the ⁇ - and y- secretase cleavage sites giving rise to the cellular toxicity and amyloid-forming capacity of the two major forms of A ⁇ (A ⁇ 40 and A ⁇ 42 ) .
  • APP amyloid precursor protein
  • preventing APP processing into plaque- producing forms of amyloid may critically influence the formation and progression of the disease making BACEl (including variants thereof, e.g. variants A, B, C, and D) a clinical target for inhibiting or arresting this disease. Similar reports suggest presenilins are candidate targets for redirecting aberrant processing.
  • Huntington's disease is a fatal, hereditary neurodegenerative disorder characterized by involuntary "ballistic" movements, depression, and dementia.
  • the cause has been established to be a mutation in a single gene consisting of an excessively long series of C, A, G, C, A, G
  • C, A, G nucleotides -in the DNA.
  • the CAG repeat is in the region of the gene that codes for the protein the gene produces .
  • the resulting huntingtin protein is also "expanded, " containing an excessively long region made of the amino acid glutamine, for which "CAG” encodes. Shortly after this mutation was pinpointed as the cause of
  • RNAs were also able to show that constructed double stranded RNAs were able to rescue induced caspase-3 activation.
  • Xia, Haibin, et al . (Nature Biotechnology, 20: 1006-1010 (2002)) tested the inhibition of polyglutamine (CAG) expression of engineered neural PC12 clonal cell lines that express a fused polyglutamine-fluorescent protein using constructed recombinant adenovirus expressing siRNAs targeting the mRNA encoding green fluorescent protein.
  • CAG polyglutamine
  • the above patents do not disclose use of delivery devices or any method of delivery or infusion of small interfering RNA vectors to the brain.
  • the above patents do not disclose or suggest a method of delivery or infusion of small interfering RNA vectors to the brain by an . intracranial delivery device .
  • the foregoing prior art does not disclose any technique for infusing into the brain small interfering RNA vectors, nor does the prior art disclose whether small interfering RNA vectors, upon infusion into the brain, are capable of entering neurons and producing the desired small interfering RNA, which is then capable of reducing production of at least one protein involved in the pathogenesis of neurodegenerative disorders.
  • the prior art describes direct systemic delivery of ribozymes . This approach for treatment of neurodegenerative disorders would appear neither possible nor desirable.
  • interfering RNAs are distinctly different than ribozyraes.
  • small RNA molecules delivered systemically will not persist in vivo long enough to reach the desired target, nor are they likely to cross the blood- brain barrier.
  • the approach taken by the prior art may be impractical because of the large quantity of small interfering RNA that might have to be administered by this method to achieve an effective quantity in the brain. Even when the blood-brain barrier is temporarily opened, the vast majority of oligonucleotide delivered via the bloodstream may be lost to other organ systems in the body, especially the liver.
  • U.S. Pat. Nos. 5,735,814 and 6,042,579 disclose the use of drug infusion for the treatment of Huntington's disease, but the drugs specifically identified in these patents pertain to agents capable of altering the level of excitation of neurons, and do not specifically identify agents intended to enter the cell and alter protein production within cells.
  • the present invention solves prior problems existing in the prior art relating to systemic delivery of nucleic acids by directly delivering small interfering RNA in the form of DNA encoding the small interfering RNA to target cells of the brain using viral vectors . Directed delivery of the small interfering RNA vectors to the affected region of the brain infusion overcomes previous obstacles related to delivery.
  • the present invention provides a unique targeting and selectivity profile by customizing the active small interfering RNA agents to specific sites in the mRNA coding sequences for the offending proteins .
  • the present invention provides devices, systems, methods for delivering small interfering RNA for the treatment of neurodegenerative disorders.
  • a first objective of the described therapies is to deliver specifically tailored small interfering RNA as therapeutic agents for treatment of Parkinson's disease.
  • Specifically tailored small interfering RNA for Parkinson's disease target the mRNA for the alpha-synuclein protein in order to reduce the amount of alpha-synuclein protein produced in neurological cells.
  • the present invention provides devices that specifically access the substantia nigra for delivery of anti-alpha-synuclein small interfering RNA.
  • a second objective of the described therapies is to deliver specifically tailored small interfering RNA as therapeutic agents for treatment of Alzheimer's disease.
  • Specifically tailored small interfering RNA for Alzheimer's disease target the mRNA for BACEl (including variants thereof, e.g. variants A, B, C, and D) in order to reduce the amount of BACEl (including variants thereof, e.g. variants A, B, C, and D) protein produced in neurological cells and thereby interfere with the production of beta- amyloid.
  • the present invention provides devices that specifically access the nucleus basalis of Meynart and the cerebral cortex for delivery of anti-BACEl (including variants thereof, e.g. variants A, B, C, and D) small interfering RNA.
  • a third objective of the described therapies is to deliver specifically tailored small interfering RNA as therapeutic agents for treatment of Huntington's disease.
  • Specifically tailored small interfering RNA for Huntington's disease target the mRNA for huntingtin protein to reduce the amount of huntingtin protein produced in neurological cells.
  • the present invention provides devices that specifically access the caudate nucleus and putamen (collectively known as the striatum) for delivery of anti-huntingtin small interfering RNA.
  • siRNAs for treatment of Huntington's disease, or vectors encoding these siRNAs comprise a first strand comprising at least 19 contiguous nucleotides encoded by the group consisting of SEQ' ID NO: 24 or SEQ ID NO: 25.
  • a fourth objective of the described therapies is to deliver specifically tailored small interfering RNA as therapeutic agents for treatment of Spinocerebellar Ataxia Type 1 (SCAl) .
  • Specifically tailored small interfering RNA for Spinocerebellar Ataxia Type 1 target the mRNA for ataxinl protein to reduce the amount of ataxinl protein produced in neurological cells .
  • the present invention provides devices that specifically access the dentate nucleus, eboliform nucleus, globus nucleus, and fastigial nucleus of the cerebellum, (collectively known as the deep cerebellar nuclei) , for delivery of anti-ataxin-1 small interfering RNA.
  • a fifth objective of the described therapies is to deliver specifically tailored small interfering RNA as therapeutic agents for treatment of Spinocerebellar Ataxia Type 3 (SCA3) , also known as Machado-Joseph' s Disease.
  • SCA3 Spinocerebellar Ataxia Type 3
  • Specifically tailored small interfering RNA for Spinocerebellar Ataxia Type 3 target the mRNA for ataxin3 protein to reduce the amount of ataxin3 protein produced in neurological cells .
  • the present invention provides devices that specifically access the dentate nucleus, ebolifbrm nucleus, globus nucleus, and fastigial nucleus of the cerebellum, (collectively known as the deep cerebellar nuclei) , the subthalamic region, and the substantia nigra for delivery of anti-ataxin-3-small interfering RNA.
  • a sixth objective of the described therapies is to deliver specifically tailored small interfering RNA as therapeutic agents for treatment of dentatorubral- pallidoluysian atrophy (DRPLA) .
  • Specifically tailored small interfering RNA for DRPLA target the mRNA for atrophin-1 protein to reduce the amount of atrophin-1 protein produced in neurological cells.
  • the present invention provides devices that specifically access the dentate nucleus, eboliform nucleus, globus nucleus, and fastigial nucleus of the cerebellum, (collectively known as the deep cerebellar nuclei) , the globus pallidus, and the red nucleus for delivery of anti-DRPLA small interfering RNA.
  • the present invention provides a delivery system for a small interfering RNA vector therapy for neurodegenerative diseases that permits targeted delivery of small interfering RNA or vectors containing DNA encoding for small interfering RNA (small interfering RNA vectors) to targeted sites in the brain for brief durations of time or over an extended period of care for the patient.
  • small interfering RNA vectors are infused into targeted sites of the brain wherein the small interfering RNA vectors are taken up by neurons and transported to the nucleus of targeted cells .
  • the small interfering RNA vectors are then transcribed into RNA by the host cellular machinery to produce small interfering RNA that prevent production of the targeted neurodegenerative protein.
  • the present invention also provides methods of using neurosurgical devices to deliver therapeutic small interfering RNA vectors to selected regions of the brain.
  • the present invention provides methods that use surgically implanted catheters for singular, repeated, or chronic delivery of small interfering RNA vectors to the brain.
  • the small interfering RNA vectors introduced into the affected cells have the necessary DNA sequences for transcription of the required small interfering RNA by the cells, including a promoter sequence, the small interfering RNA sequence, and optionally flanking regions allowing defined ends of the therapeutic small interfering RNA to be produced, and optionally a polyadenylation signal sequence.
  • FIG. 1 shows the assay (using a quantitative RT-PCR method known to those practiced in the art) of the ataxinl mRNA obtained from HEK293H cells that have been transfected with plasmid containing an anti-ataxinl ribozyme (top lanes in FIG. 1) or with siRNA against ataxinl (bottom lanes of FIG. 1) .
  • FIG. 2 shows the assay (using the same quantitative RT- PCR method known to those practiced in the art) of the ataxin-1 mRNA obtained from HEK293H cells that have been transfected with anti-ataxin-1 small interfering RNA (bottom lanes) compared to the mRNA obtained from HEK293H cells that have been transfected with a control siRNA that targets the mRNA for glyceraldehyde-3 -phosphate dehydrogenase (GAPDH) .
  • GPDH glyceraldehyde-3 -phosphate dehydrogenase
  • FIG. 3 shows the construction of the adeno-associated virus expression vector pAAV- siRNA.
  • FIG. 4 illustrates an investigational device (by Medtronic, Inc. of Minneapolis, Minn. Model 8506), which can be implanted subcutaneousIy on the cranium, and provides an access port through which therapeutic agents may be delivered to the brain.
  • FIG. 5 illustrates an investigational device (by Medtronic, Inc.- of Minneapolis, Minn. --schematic of Model 8506) , which can be implanted subcutaneousIy on the cranium, and provides an access port through which therapeutic agents may be delivered to the brain.
  • FIG. 6 illustrates the relation of various neurodegenerative diseases described herein, and the location of treatment with small interfering RNA vectors directed to their intended targeted gene product .
  • the present invention solves two problems in the prior art at the same time: (1) the problem of how to treat neurodegenerative diseases caused by the production in neurons of a protein that has pathogenic properties and (2) the problem of delivery of therapeutic small interfering RNA to affected neurons .
  • alpha-synuclein BACEl (including variants thereof, e.g. variants A, B, C, and D), huntingtin, ataxin-1, ataxin- 3, and/or atrophin-l proteins” is meant, a protein or a mutant protein derivative thereof, comprising the amino-acid sequence expressed and/or encoded by alpha-synuclein
  • Ataxin-1 Spinocerebellar Ataxia Type 1
  • ataxin-3 Spinocerebellar Ataxia Type 3 or Machado-Joseph 1 s
  • DRPIJA dentatorubral-pallidoluysian atrophy
  • cell is used in its usual biological sense, and does not refer to an entire multicellular organism.
  • the cell may be present in an organism which may be a human but is preferably of mammalian origin, e.g., such as humans, cows, sheep, apes, monkeys, swine, dogs, cats, and the like.
  • mammalian origin e.g., such as humans, cows, sheep, apes, monkeys, swine, dogs, cats, and the like.
  • prokaryotic cells e.g., bacterial cell
  • eukaryotic cell e.g., mammalian cell
  • BACEl including variants thereof, e.g. variants A, B, C, and D
  • huntingtin, ataxin-1, ataxin-3, and/or atrophin-l it is meant to • include those naturally occurring DNA molecules having homology (partial or complete) to DNA encoding for alpha-synuclein, BACEl (including variants thereof, e.g. variants A, B, C, and D) , huntingtin, ataxin-1, ataxin-3 and/or atrophin-l proteins or encoding for proteins with similar function as alpha-symiclein, BACEl (including variants thereof, e.g.
  • variants A, B, C, and D huntingtin, ataxin-1, ataxin-3 and/or atrophin-1 in various organisms, including human, rodent, primate, rabbit, pig # and microorganisms .
  • the equivalent DNA sequence also includes regions such as the 5 ' -untranslated region, the 3 ' - untranslated region, introns, intron-exon junctions, small interfering RNA targeted site and the like, optionally incorporated into the DNA of infective viruses , such as adeno-associated virus (AAV) .
  • AAV adeno-associated virus
  • the term “functional equivalent” refers to any derivative that is functionally similar to the reference sequence or protein.
  • the term “functional equivalent” includes derivatives in which the nucleotide bases (s) have been added, deleted, or replaced without a significant adverse effect on biological function.
  • gene it is meant a region of DNA that controls the production of RNA.
  • this definition includes the necessary DNA sequence information encompassing the DNA sequences encoding the small interfering RNA, noncoding regulatory sequence and any included introns. The present definition does not exclude the possibility that additional genes encoding proteins may function in association or in tandem with the genes encoding small interfering RNA.
  • vector is commonly known in the art and defines a plasmid DNA, phage DNA, viral DNA and the like, which can serve as a DNA vehicle into which DNA of the present invention can be inserted, and from which RNA can be transcribed.
  • vectors refers to any of these nucleic acid and/or viral-based techniques used to deliver a desired nucleic acid. Numerous types of vectors exist and are well known in the art.
  • RNA RNA
  • expression vector defines a vector or vehicle as described above but designed to enable the expression of an inserted sequence following transformation into a host.
  • the cloned gene (inserted sequence) is usually placed under the control of control element sequences such as promoter sequences.
  • control element sequences such as promoter sequences.
  • the placing of a cloned gene under such control sequences is often referred to as being operably linked to control elements or sequences.
  • Promoter refers to a DNA regulatory region capable of binding directly or indirectly to RNA polymerase in a cell and initiating transcription of a downstream (3 ' direction) coding sequence.
  • the promoter is bound at its 3 ' terminus by the transcription initiation site and extends upstream (5 1 direction) to include the minimum number of bases or elements necessary to initiate transcription at levels detectable above background.
  • a transcription initiation site (conveniently defined by mapping with Sl nuclease) , as well as protein binding domains (consensus sequences) responsible for the binding of RNA polymerase.
  • Eukaryotic promoters will often, but not always, contain "TATA" boxes and "CCAT" boxes.
  • Prokaryotic promoters contain-10 and -35 consensus sequences, which serve to initiate transcription.
  • homoology it is meant that the nucleotide sequence of two or more nucleic acid molecules is partially or completely identical.
  • highly conserved sequence region it is meant that a nucleotide sequence of one or more regions in a target gene does not vary significantly from one generation to the other or from one biological system to the other.
  • inhibitor or “inhibitory” it is meant that the activity of the target genes or level of mRNAs or equivalent RNAs encoding target genes is reduced below that observed in the absence of the provided small interfering RNA.
  • the inhibition is at least 10% less, 25% less, 50% less, or 75% less, 85% less, or 95% less than in the absence of the small interfering RNA.
  • inhibitors By “inhibited expression” it is meant that the reduction of alpha-synuclein, BACEl (including variants thereof, e.g. variants A, B, C, and D), huntingtin, ataxin- 1, ataxin-3 and/or atrophin-1 mRNA levels and thus reduction in the level of the respective protein to relieve, to some extent, the symptoms of the disease or condition.
  • BACEl including variants thereof, e.g. variants A, B, C, and D
  • huntingtin ataxin- 1, ataxin-3 and/or atrophin-1 mRNA levels and thus reduction in the level of the respective protein to relieve, to some extent, the symptoms of the disease or condition.
  • RNA is meant ribonucleic acid, a molecule consisting of ribonucleotides connected via a phosphate- ribose (sugar) backbone.
  • ribonucleotide is meant guanine, cytosine, uracil, or adenine or some a nucleotide with a hydroxyl group at the 2 ' position of a ⁇ -D-ribo- furanose moiety.
  • the genetic code uses thymidine as a base in DNA sequences and uracil in RNA.
  • One skilled in the art knows how to replace thymidine with uracil in a nucleic acid sequence to convert a DNA sequence into RNA, or vice versa.
  • a patient is meant an organism, which is a donor or recipient of explanted cells or the cells themselves.
  • a patient also refers to an organism to which the nucleic acid molecules of the invention can be administered.
  • a patient is a mammal or mammalian cells, e.g., such as humans, cows, sheep, apes, monkeys, swine, dogs, cats, and the like, or cells of these animals used for transplantation. More preferably, a patient is a human or human cells .
  • the term “synuclein” may refer to alpha-synuclein (especially human or mouse) or beta-synuclein (especially human or mouse) .
  • the full nucleotide sequence encoding human alpha-synuclein is available under Accession No AF163864 (SEQ ID NO: 7) .
  • Two variants of the human alpha-synuclein sequence are available under Accession No NM000345 (SEQ ID NO: 14) and Accession No NM_007308 (SEQ ID NO: 23) .
  • the mouse alpha-synuclein is available under Accession No. AF163865 (SEQ ID NO: 10) .
  • BACEl may refer to beta-site amyloid precursor protein cleaving enzyme type 1 (especially human or mouse) .
  • BACEl beta-site amyloid precursor protein cleaving enzyme type 1 (especially human or mouse) .
  • variants A, B, C, and D have been sequenced, including variants A, B, C, and D.
  • BACEl is also known as ASP2 and Memapsin2.
  • the full nucleotide sequences encoding human BACEl, and variants related thereto, are available under Accession No. NM__13897l
  • NM_012104 (SEQ ID NO: 18) .
  • the sequence for a mouse homolog is available under accession number NM_011792 (SEQ ID NO: 22) .
  • huntingtin may refer to the protein product encoded by the Huntington's Disease gene (IT-15) (especially human or mouse) .
  • IT-15 Huntington's Disease gene
  • the full nucleotide sequence encoding human IT-15 is available under Accession No AH003045 (SEQ ID NO: 9) .
  • the mouse sequence is available under Accession No. U24233 (SEQ ID NO: 12) .
  • ataxin-1 may refer to the protein product encoded by the Spinocerebellar Ataxia Type 1 gene
  • ataxin-3 may refer to the protein product encoded by the Spinocerebellar Ataxia Type 3 gene (especially human or mouse) .
  • the full nucleotide sequence encoding human SCA3 is available under Accession No NM_004993 (splice variant 1) (SEQ ID NO:16), and NM_030660 (splice variant 2) (SEQ ID NO: 17) . (The sequence for a mouse homolog is not yet available) .
  • atrophin-1 may refer to the protein product encoded by the dentatorubral-pallidolysian atrophy (DRPLA) gene (especially human or mouse) .
  • DRPLA dentatorubral-pallidolysian atrophy
  • the full nucleotide sequence encoding human DRPLA is available under Accession No XM_032588 (SEQ ID NO: 8).
  • the mouse sequence is available under Accession No. XM_132846 (SEQ ID NO: 11) .
  • modification includes derivatives substantially similar to the reference sequence or protein.
  • nucleic acid molecule as used herein is meant a molecule having nucleotides.
  • the nucleic acid can be single, double, or multiple stranded and may comprise modified or unmodified nucleotides or non-nucleotides or various mixtures and combinations thereof .
  • An example of a nucleic acid molecule according to the invention is a gene which encodes for a small interfering RNA, even though it does not necessarily have its more common meaning for encoding for the production of protein.
  • small interfering RNA is meant a nucleic acid molecule which has complementarity in a substrate binding region to a specified gene target, and which acts to specifically guide enzymes in the host cell to cleave the target RNA. That is, the small interfering RNA by virtue of the specificity of its sequence and its homology to the RNA target, is able to cause cleavage of the RNA strand and thereby inactivate a target RNA molecule because it is no longer able to be transcribed. These complementary regions allow sufficient hybridization of. the small interfering RNA to the target RNA and thus permit cleavage. One hundred percent complementarity often necessary for biological activity and therefore is preferred, but complementarity as low as 90% may also be useful in this invention.
  • the specific small interfering RNA described in the present application are not meant to be limiting and those skilled in the art will recognize that all that is important in a small interfering RNA of this invention is that it have a specific substrate binding site which is complementary to one or more of the target nucleic acid regions .
  • Small interfering RNAs are double stranded RNA agents that have complementary to (i.e., able to base-pair with) a portion of the target RNA (generally messenger RNA) .
  • target RNA generally messenger RNA
  • complementarity is 100%, but can be less if desired, such as 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%.
  • 19 bases out of 21 bases may be base- paired.
  • 100% complementary to the target gene is required in order to effectively discern the target sequence from the other allelic sequence.
  • choice of length is also an important factor because it is the other factor involved in the percent complementary and the ability to differentiate between allelic differences.
  • the small interfering RNA sequence needs to be of sufficient length to bring the small interfering RNA and target RNA together through complementary base-pairing interactions.
  • the small interfering RNA of the invention may be of varying lengths .
  • the length of the small interfering RNA is preferably greater than or equal to ten nucleotides and of sufficient length to stably interact with the target RNA; specifically 15-30 nucleotides; more specifically any integer between 15 and 30 nucleotides, such as 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, and 30.
  • sufficient length is meant an oligonucleotide of greater than or equal to 15 nucleotides that is of a length great enough to provide the intended function under the expected condition.
  • stably interact is meant interaction of the small interfering RNA with target nucleic acid (e.g., by forming hydrogen bonds with complementary nucleotides in the target under physiological conditions) .
  • the present invention provides the means and tools for treating polyglutamine diseases (such as Huntington's disease and spinocerebellar ataxia type 1), Parkinson's disease, and Alzheimer's disease by intracranial delivery of vectors encoding small interfering RNAs designed to silence the expression of disease-causing or disease-worsening proteins, delivered through one or more implanted intraparenchymal catheters.
  • polyglutamine diseases such as Huntington's disease and spinocerebellar ataxia type 1
  • Parkinson's disease such as Huntington's disease and spinocerebellar ataxia type 1
  • Parkinson's disease e.g., Parkinson's disease
  • Alzheimer's disease by intracranial delivery of vectors encoding small interfering RNAs designed to silence the expression of disease-causing or disease-worsening proteins, delivered through one or more implanted intraparenchymal catheters.
  • the invention is
  • a method to treat Huntington's disease by the intracranial delivery of a vector encoding a small interfering RNA designed to silence expression of huntingtin protein (2) a method to treat spinocerebellar ataxia type 1 by the intracranial delivery of a vector encoding a small interfering RNA designed to silence expression of ataxinl protein; (3) a method to treat Parkinson's disease by the intracranial delivery of a vector encoding a small interfering RNA designed to silence expression of alpha- synuclein protein, and (4) a method to treat Alzheimer's disease by the intracranial delivery of a vector encoding a small interfering RNA designed to silence expression of beta-amyloid cleaving enzyme 1 (BACEl) .
  • BACEl beta-amyloid cleaving enzyme 1
  • the small interfering RNA (or siRNA) described herein, is a segment of double stranded RNA that is from 15 to 30 nucleotides in length. It is used to trigger a cellular reaction known as RNA interference.
  • RNA interference double-stranded RNA is digested by an intracellular enzyme . known as Dicer, producing siRNA duplexes.
  • Dicer an intracellular enzyme .
  • the siRNA duplexes bind to another intracellular enzyme complex which, is thereby activated to target whatever mRNA molecules are homologous (or complementary) to the siRNA sequence.
  • the activated enzyme complex cleaves the targeted mRNA, destroying it and preventing it from being used to direct the synthesis of its corresponding protein product.
  • RNA interference is an ancient, innate mechanism for not only, defense against viral infection (many viruses introduce foreign RNA into cells) but also gene regulation at very fundamental levels .
  • RNA interference has been found to occur in plants, insects, lower animals, and mammals, and has been found to be dramatically more effective than other gene silencing technologies, such as antisense or ribozymes .
  • siRNA Used as a biotechnology, siRNA involves introducing into cells (or causing cells to produce) short, double-stranded molecules of RNA similar to those that would be produced by the Dicer enzyme from an invading double-stranded RNA virus. The artificially-triggered RNA interference process then continues from that point .
  • the preferred method will be to introduce the DNA encoding for the siRNA, rather than the siRNA molecules themselves, into the cells of the brain.
  • the DNA sequence encoding for the particular therapeutic siRNA can be specified upon knowing (a) the sequence for a small and accessible portion of the target mRNA (available in public human genome databases) , and (b) well-known scientific rules for how to specify DNA that will result in production of a corresponding RNA sequence when the DNA is transcribed by cells.
  • the DNA sequence once specified, can be constructed in the laboratory from synthetic molecules ordered from a laboratory supplier, and inserted using standard molecular biology methods into one of several alternative "vectors" for delivery of DNA to cells .
  • RNA that becomes the therapeutic siRNA By transcribing the inserted DNA into RNA.
  • the result will be that the cells themselves produce the siRNA that will silence the targeted gene.
  • the result will be a reduction of the amount of the targeted protein produced by the cell.
  • small interfering RNA against specific mRNAs produced in the affected cells prevent the production of the disease related proteins in neurons .
  • in • accordance with the present invention is the use of specifically tailored vectors designed to deliver small interfering RNA to targeted cells. The success of the designed small interfering RNA is predicated on their successful delivery to the targeted cells of the brain to treat the neurodegenerative diseases .
  • Small interfering RNA have been shown to be capable of targeting specific MRNA molecules in human cells.
  • Small interfering RNA vectors can be constructed to transfect human cells and produce small interfering RNA that cause the cleavage of the target RNA and thereby interrupt production of the encoded protein.
  • a small interfering RNA vector of the present invention will prevent production of the pathogenic protein by suppressing production of the neuropathogenic protein itself or by suppressing production of a protein involved in the production or processing of the neuropathogenic protein.
  • Repeated administration of the therapeutic agent to the patient may be required to accomplish the change in a large enough number of neurons to improve the patient ' s quality of life. Within an individual neuron ' , however, the change is longstanding enough to provide a therapeutic benefit.
  • the desperate situation of many patients suffering from neurodegenerative disorders, such as Alzheimer's disease, Parkinson's disease, Huntington's disease, or Spinocerebellar Ataxia Type 1 provides a strong likelihood that the benefit from the therapy will outweigh the risks of the therapy delivery and administration.
  • the preferred vector for delivery of foreign DNA to neurons in the brain is adeno-associated virus (AAV) , such as recombinant adeno-associated- virus serotype 2 or recombinant' adeno-associated virus serotype 5.
  • AAV adeno-associated virus
  • other viral vectors such as herpes simplex virus, may be used for delivery of foreign DNA to central nervous system neurons.
  • non-viral vectors such as plasmid DNA delivered alone or complexed with liposomal compounds or polyethyleneamine, may be used to deliver foreign DNA to neurons in the brain.
  • interfering RNA illustrated here as well as the other small interfering RNAs for treating neurodegenerative disorders, are just but some examples of the embodiment of the invention. Experimentation using neurosurgical methods with animals, known to those practiced in neuroscience, can be used to identify the candidate small interfering RNAs. The target cleavage site and small interfering RNA identified by these empirical methods will be the one that will lead to the greatest therapeutic effect when administered to patients with the subject neurodegenerative disease.
  • the small interfering RNA are targeted to complementary sequences in the MRNA sequence coding for the production of the target protein, either within the actual protein coding sequence, or in the 5' untranslated region or the 3' untranslated region.
  • the host enzymes are capable of cleavage of the mRNA sequence. Perfect or a very high degree of complementarity is needed for the small interfering RNA to be effective.
  • a percent complementarity indicates the percentage of contiguous residues in a nucleic acid molecule that can form hydrogen bonds (e.g., Watson-Crick base pairing) with a second nucleic acid sequence (e.g., 5, 6, 7, 8, 9, 10 out of 10 being 50%, 60%, 70%, 80%, 90%, and 100% complementary) .
  • Perfectly complementary means that all the contiguous residues of a nucleic acid sequence will hydrogen bond with the same number of contiguous residues in a second nucleic acid sequence.
  • single mismatches, or base-substitutions, within .the siRNA sequence can substantially reduce the gene silencing activity of a small interfering RNA
  • the small interfering RNA that target the specified sites in alpha-synuclein, BACEl (including variants thereof, e.g. variants A, B, C, and D), huntingtin, ataxin-1, ataxin- 3 and/or atrophin-1 RNAs represent a novel therapeutic approach to treat Parkinson's disease, Alzheimer's disease, Huntington's disease, Spinocerebellar 1, Spinocerebellar Ataxia Type 3, and/or dentatorubral-pallidoluysian atrophy in a cell or tissue .
  • a small interfering RNA is 15 to 30 nucleotides in length.
  • the nucleic acid molecule is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length.
  • the length of the siRNA sequence can be between 19-30 base pairs, and more preferably between 21 and 25 base pairs, and more preferably between 21 and 23 basepairs .
  • the invention provides a method for producing a class of nucleic acid-based gene inhibiting agents that exhibit a high degree of specificity for the RNA of a desired target.
  • the small interfering RNA is preferably targeted to a highly conserved sequence region of target RNAs encoding alpha-synuclein, BACEl (including variants thereof, e.g. variants A, B, C, and D) , huntingtin, ataxin-1, ataxin-3 and/or atrophin-1 RNA such that specific treatment of a disease or condition can be provided with either one or several nucleic acid molecules of the invention.
  • interfering RNA sequences are selected by identifying regions in the target sequence that begin with a pair of adenine bases (AA) (see Examples) .
  • SiRNAs can be constructed in vitro or in vivo using appropriate transcription enzymes or expression vectors .
  • SiRNAs can be constructed in vitro using DNA oligonucleotides. These oligonucletides can be constructed to include an 8 base sequence complementary to the 5 ' end of the T7 promoter primer included in the Silencer siRNA (Atnbion Construction Kit 1620) . Each gene specific oligonucleotide is annealed to a supplied T7 promoter primer, and a fill-in reaction with Klenow fragment generates a full-length DNA template for transcription into RNA. Two in vitro transcribed RNAs (one the antisense to the other) are generated by in vitro transcription reactions then hybridized to each other to make double-stranded RNA. The double-stranded RNA product is treated with DNase (to remove the DNA transcription templates) and RNase (to polish the ends of the double-stranded RNA) , and column purified to provide the siRNA that can be delivered and tested in cells.
  • DNase to remove the DNA transcription templates
  • RNase to polish the ends of the double-stranded
  • siRNA vectors that express siRNAs within mammalian cells typically use an RNA polymerase III promoter to drive expression of a short hairpin RNA that mimics the structure of an siRNA.
  • the insert that encodes this hairpin is designed to have two inverted repeats separated by a short spacer sequence. One inverted repeat is complementary to the mRNA to which the siRNA is targeted. A string of thymidines added to the 3 ' end serves as a pol III transcription termination site.
  • the vector constitutiveIy expresses the hairpin RNA.
  • the hairpin RNA is processed into an siRNA which induces silencing of the expression of the target gene, which is . called RNA interference (RNAi) .
  • RNA interference RNA interference
  • RNA polymerase III RNA polymerase III promoters
  • these promoters include the well-characterized human and mouse U6 promoters and the human HI promoter.
  • RNA pol III was chosen to drive siRNA expression because it expresses ⁇ relatively large amounts of small RNAs in mammalian cells and it terminates transcription upon incorporating a string of 3-6 uridines.
  • the constructed nucleic acid molecules can be delivered exogenousIy to specific tissue or cellular targets as required.
  • the nucleic acid molecules e.g., small interfering RNA
  • the nucleic acid molecules can be expressed from DNA plasmid, DNA viral vectors, and/or RNA retroviral vectors that are delivered to specific cells.
  • the delivered small nuclear RNA sequences delivered to the targeted cells or tissues are nucleic acid-based inhibitors of alpha-synuclein, BACEl (including variants thereof, e.g. variants A, B, C, and D), huntingtin, ataxin- 1, ataxin-3 and/or atrophin-1 expression (e.g. translational inhibitors) are useful for the prevention of the neurodegenerative diseases including Parkinson's disease, Alzheimer's disease, Huntington's disease, Spinocerebellar Ataxia Type 1, Spinocerebellar Ataxia Type 3, and DRPLA and any other condition related to the level of alpha-synuclein, BACEl (including variants thereof, e.g.
  • nucleic acid-based inhibitors of the invention are added directly, or can be complexed with cationic lipids, packaged within liposomes, packaged within viral vectors, or otherwise delivered to target cells or tissues.
  • nucleic acid or nucleic acid complexes can be locally administered to relevant tissues ex vivo, or in vivo through injection, infusion pump or stent, with or without their incorporation in biopolymers .
  • the nucleic acid inhibitors comprise sequences which are a sufficient length and/or stably interact with their complementary substrate sequences identified in SEQ ID NOS: 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23. Examples of such small interfering RNA also are shown in SEQ IDS NOS : 1 and 2, 3 and 4, and 5 and 6 for SEQ IDS relating to Ataxinl .
  • the invention provides mammalian cells containing one or more nucleic acid molecules and/or expression vectors of this invention.
  • the one or more nucleic acid molecules may independently be targeted to the same or different sites.
  • small interfering RNA molecules that interact with target RNA molecules and inhibit alpha-synuclein, BACEl (including variants thereof, e.g. variants A, B, C, and D), huntingtin, ataxin-1, ataxin- 3 and/or atrophin-1 RNA activity are expressed from transcription units inserted into DNA or RNA vectors.
  • the recombinant vectors are preferably DNA plasmids or viral vectors.
  • Small interfering RNA expressed from viral vectors could be constructed based on, but not limited to, the vector sequences of adeno-associated virus, retrovirus, or adenovirus.
  • the recombinant vectors capable of expressing the small interfering RNA are delivered as described above, and persist in target cells.
  • viral vectors may be used that provide for transient expression of small interfering RNA. Such vectors might be repeatedly administered as necessary.
  • the small interfering RNA bind to the target RNA and through use of the host machinery inhibit its expression and thereby its function. Delivery of small interfering RNA expressing vectors, or the small interfering RNA themselves, is by use of intracranial access devices.
  • the nucleic acid molecules of the instant invention individually, or in combination or in conjunction with other drugs, can be used to treat diseases or conditions discussed above.
  • the patient may be treated, or other appropriate cells may be treated, as is evident to those skilled in the art, individually or in combination with one or more drugs under conditions suitable for the treatment .
  • the described small interfering RNA can be used in combination with other known treatments to treat conditions or diseases discussed above.
  • the invention provides nucleic acid-based inhibitors (e.g., small interfering RNA) and methods for their use to downregulate or inhibit the expression of RNA (e.g., alpha-synuclein, BACEl (including variants thereof, e.g. variants A, B, C, and D), huntingtin, ataxin-1, ataxin-3 and/or atrophin-1) coding for proteins involved in the progression and/or maintenance of Parkinson's disease/ Alzheimer's disease, Huntington 's disease, Spinocerebellar Ataxia Type 1, Spinocerebellar Ataxia Type 3, and dentatorubral-pallidoluysian atrophy.
  • RNA e.g., alpha-synuclein, BACEl (including variants thereof, e.g. variants A, B, C, and D), huntingtin, ataxin-1, ataxin-3 and/or atrophin-1
  • Parkinson's disease/ Alzheimer's disease Huntington
  • the present invention also provides nucleic acid molecules that can be expressed within cells from known eukaryotic promoters (e.g., Izant and Weintraub, 1985, Science, 229, 345; McGarry and Lindquist, 1986, Proc '. Natl. Acad. Sci., USA 83, 399,- Scanlon et al . , 1991, Proc. Natl. Acad. Sci. USA, 88, 10591-5; Kashani- ⁇ abet et al . , 1992, Antisense Res. Dev., 2, 3-15; Dropulic et al . , 1992, J Virol., 66, 1432- 41; Weerasinghe et al .
  • eukaryotic promoters e.g., Izant and Weintraub, 1985, Science, 229, 345; McGarry and Lindquist, 1986, Proc '. Natl. Acad. Sci., USA 83,
  • nucleic acids can be augmented by their • release from the primary transcript by ribozymes (Draper et al . , PCT WO 93/23569, and Sullivan et al., PCT WO 94/02595; Ohkawa et al . , 1992, Nucleic Acids Symp. Ser. , 27, 15-6; Taira et al . , 1991, Nucleic Acids Res., 19, 5125- 30; Ventura et al . , 1993, Nucleic Acids Res., 21, 3249-55; Chowrira et al. , 1994, J Biol. Chem. , 269, 25856; all of these references are hereby incorporated in their totality by reference herein) .
  • RNA molecules of the present invention are preferably expressed from transcription units (see, for example, Couture et al . , 1996, TIG., 12, 5 10) inserted into DNA or RNA vectors.
  • the recombinant vectors are preferably DNA plasmids or viral vectors .
  • Small interfering RNA expressing viral vectors could be constructed based on, but not limited to, adeno- associated virus, retrovirus, adenovirus, or alphavirus .
  • the recombinant vectors capable of expressing the nucleic acid molecules are delivered as described above, and persist in target cells.
  • viral vectors may be used that provide for transient expression of nucleic acid molecules .
  • Such vectors might be repeatedly administered as necessary.
  • the nucleic acid molecule binds to the target mRNA. Delivery of nucleic acid molecule expressing vectors could be by singular, multiple, or chronic delivery by use of the described intracranial access devices .
  • the invention features an expression vector comprising a nucleic acid sequence encoding at least one functional segment of the nucleic acid molecules of the instant invention.
  • the nucleic acid sequence encoding the nucleic acid molecule of the instant invention is operably linked in a manner which allows expression of that nucleic acid molecule .
  • the invention features an expression vector comprising: a) a transcription initiation region
  • a nucleic acid sequence encoding at least one of the nucleic acid agents of the instant invention
  • a transcription termination region e.g., eukaryotic pol I, II or III termination region
  • RNA polymerase I eukaryotic RNA polymerase I
  • polymerase II RNA polymerase II
  • polymerase III RNA polymerase III
  • All of these references are incorporated by reference herein.
  • RNA molecules can be expressed from such promoters can function in mammalian cells (e.g. Kashani-Sabet et al., 1992, Antisense Res. Dev., 2, 3-15; Ojwang et al . , 1992, Proc . NatL Acad Sci. USA, 89, 10802-6; Chen et al .
  • transcription units such as the ones derived from genes encoding U6 small nuclear (snRNA) , transfer RNA (tRNA) and adenovirus VA RNA are useful in generating high concentrations of desired RNA molecules such as small interfering RNA in cells (Thompson et al., supra; Couture and Stinchcomb, 1996, supra; Noonberg et al . , 1994, Nucleic Acid Res., 22, 2830; Noonberg et al . , U.S. Pat. No. 5,624,803; Good et al., 1997, Gene Ther., 4, 45; Beigelman et al., International PCT Publication No.
  • RNA transcription units can be incorporated into a variety of vectors for introduction into mammalian cells, including but not restricted to, plasmid DNA vectors, viral DNA vectors (such as adenovirus or adeno- associated virus vectors) , or viral RNA vectors (such as retroviral or alphavirus vectors) (for a review see Couture and Stinchcomb, 1996, supra).
  • viral DNA vectors such as adenovirus or adeno- associated virus vectors
  • viral RNA vectors such as retroviral or alphavirus vectors
  • Ataxia Type 1 is but one embodiment of the invention.
  • Other embodiments include the use of an anti-huntingtin small interfering RNA administered to the striatum of the human brain, for the treatment of Huntington's disease, and the use of an anti- alpha-synuclein small interfering RNA administered to the substantia nigra of the human brain, for the treatment of Parkinson's disease.
  • the exemplified methods for constructing the small interfering RNA to be used as the therapeutic agents in the invention are only two possible means for making the therapeutic small interfering RNA.
  • Other larger scale, more efficient methods for manufacturing small interfering RNA may be used to produce the clinical grade and clinical quantities used for treating human patients, without altering the essence of the invention.
  • compositions comprising the siRNA agent or precursors or derivatives thereof is formulated in accordance with standard procedure as a pharmaceutical composition adapted for delivered administration to human beings and other mammals.
  • compositions for intravenous administration are solutions in sterile isotonic aqueous buffer.
  • the composition may also include a solubilizing agent and a local anesthetic to ameliorate any pain at the site of the injection.
  • the ingredients are supplied either separately or mixed together in unit dosage form, for example, as a dry lyophilized powder or water free concentrate in a hermetically sealed container such as an ampule or sachette indicating the quantity of active agent.
  • the composition is to be administered by infusion, it can be dispensed with an infusion bottle containing sterile pharmaceutical grade water or saline.
  • an ampule of sterile water for injection or saline can be provided so that the ingredients may be mixed prior to administration.
  • the composition can contain minor amounts of wetting or emulsifying agents, or pH buffering agents.
  • the composition can be a liquid solution, suspension, emulsion, gel, polymer, or sustained release formulation.
  • the composition can be formulated with traditional binders and carriers, as would be known in the art.
  • Formulations can include standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharide, cellulose, magnesium carbonate, etc., inert carriers having well established functionality in the manufacture of pharmaceuticals .
  • RNA molecules can be formulated as neutral or salt forms .
  • Pharmaceutically acceptable salts include those formed with free amino groups such as those derived from hydrochloric, phosphoric, acetic, oxalic, tartaric acids and the like, and those formed with free carboxyl groups such as those derived from sodium, potassium, ammonium, calcium, ferric hydroxides, isopropylamine, thriethylamine, 2- ethylamino ethanol, histidine, procaine or similar.
  • the amount of the therapeutic of the present invention which will be effective in the treatment of a particular disorder or condition will depend on the nature of the disorder or condition, and can be determined by standard clinical techniques, well established in the administration of therapeutics.
  • the precise dose to be employed in the formulation will also depend on the route of administration, and the seriousness of the disease or disorder, and should be decided according to the judgment of the practitioner and the patient's needs.
  • Suitable dose ranges for intracranial administration are generally about 10 3 to 10 15 infectious units of viral vector per microliter delivered in 1 to 3000 microliters of single injection volume.
  • Addition amounts of infections units of vector per micro liter would generally contain about 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 infectious units of viral vector delivered in about 10, 50, 100, 200, 500, 1000, or 2000 microliters. Effective doses may be extrapolated from dose-responsive curves derived from in vitro or in vivo test systems.
  • multiple catheters having access ports can be implanted in a given patient for a complete therapy.
  • the access ports might optionally be explanted, and the catheters can be sealed and abandoned, or explanted as well .
  • the device material should not interfere with magnetic resonance imaging, and, of course, the small interfering RNA preparations must be compatible with the access port and catheter materials and any surface coatings .
  • the scientific and technological terms and nomenclature used herein have the same meaning as commonly understood by a person of ordinary skill to which this invention pertains .
  • the procedures for cell cultures, infection, molecular biology methods and the like are common methods used in the art . Such standard techniques can be found in reference manuals such as for example Sambrook et al . (1989, Molecular Cloning-A Laboratory Manual, Cold Spring Harbor.
  • PCR polymerase chain reaction
  • PCR involves a treatment of a nucleic acid sample (e.g., in the presence of a heat stable DNA polymerase) under hybridizing conditions, with one oligonucleotide primer for each strand of the specific sequence to be detected.
  • An extension product of each primer which is synthesized is complementary to each of the two nucleic acid strands, with the primers sufficiently complementary to each strand of the specific sequence to hybridize therewith.
  • the extension product synthesized from each primer can also serve as a template for further synthesis of extension products using the same primers. Following a sufficient number , of rounds of synthesis of extension products, the sample is analyzed to assess whether the sequence or sequences to be detected are present.
  • Detection of the amplified sequence may be carried out by visualization following EtBr staining of the DNA following gel electrophores, or using a detectable label in accordance with known techniques, and the like.
  • EtBr staining of the DNA following gel electrophores
  • a detectable label in accordance with known techniques, and the like.
  • the present invention also provides devices, systems, and methods for delivery of small interfering RNA to target locations of the brain.
  • the envisioned route of delivery is through the use of implanted, indwelling, intraparenchytnal catheters that provide a means for injecting small volumes of fluid containing AAV or other vectors directly into local brain tissue.
  • the proximal end of these catheters may be connected to an implanted, intracerebral access port surgically affixed to the patient's cranium, or to an implanted drug pump located in the patient's torso.
  • Examples of the delivery devices within the scope of the present invention include the Model 8506 investigational device (by Medtronic, Inc. of Minneapolis, Minn.), which can be implanted subcutaneousIy on the cranium, and provides an access port through which therapeutic agents may be delivered to the brain. Delivery occurs through a stereotactically implanted polyurethane catheter.
  • the Model 8506 is schematically depicted in FIGS. 4 and 5.
  • Two models of catheters that can function with the Model 8506 access port include the Model 8770 ventricular catheter by Medtronic, Inc., for delivery to the cerebral ventricles, which is disclosed in U.S. Pat. No.
  • the distal end of the catheter it is preferred to place some means for locating the distal end of the catheter during the access and location process. This is preferably done by applying a marker to the distal end of the catheter which is detected during the access and location process. If access and location is accomplished using some form of x-ray radiation, the marker is preferably radiopaque .
  • the radiopaque marker renders at least a portion of the distal tip opaque to x-rays, enabling the tip to be observed via fluoroscopy or via x-ray during access and location of the catheter.
  • the radiopaque marker comprises tantalum powder dispersed in a matrix composed of a biocompatible adhesive, such as those discussed above.
  • Other materials may also be suitable for the radiopaque marker, such as barium or platinum materials.
  • the radiopaque marker will be premolded onto the distal tip of the catheter.
  • the radiographic marker may be chosen of a material that has sufficient radiodensity for visualization during radiologic procedures, but in powdered form that is dispersed in the catheter' s distal tip at the time the catheter tip is molded.
  • the marker may be composed of a material that is compatible to nuclear magnetic resonance imaging (MRI) to enable the distal tip to be detected during an MRI scan.
  • MRI nuclear magnetic resonance imaging
  • Preferred material for such a marker is platinum, though barium, tantalum, and similar materials are also suitable.
  • the delivery of the small interfering RNA vectors in accordance with the present invention can be accomplished with a wide variety of devices, including but not limited to U.S. Pat. Nos . 5,735,814, 5,814,014, and 6,042,579, all of which are incorporated herein by reference. Using the teachings of the present invention and those of skill in the art will recognize that these and other devices and systems may be suitable for delivery of small interfering RNA vectors for the treatment of neurodegenerative diseases in accordance with the present invention.
  • the method further comprises the steps of implanting a pump outside the brain, the pump coupled to a proximal end of the catheter, and operating the pump to deliver the predetermined dosage of the at least one small interfering RNA or small interfering RNA vector through the discharge portion of the catheter.
  • a further embodiment comprises the further step of periodically refreshing a supply of the at least one small interfering RNA or small interfering RNA vector to the pump outside said brain.
  • the pre-determined location of the brain may be mapped by many methods.
  • the targeted area may be located by stereotactical or gross anatomical atlases.
  • other mapping means may be used;
  • Such mapping means include, without limitation, Positron Emission Tomography and Single Photon Emission Computed Tomography (PET and SPECT, respectively) , pharmacological Magnetic Resonance Imaging (phMRl) , functional MRI (fMRI) , and contrast-enhanced computerized tomography (CT) scan.
  • Computer-aided atlas-based functional neurosurgery methodology can be used to accurately and precisely inject the at least partially reversible gene therapy system of the present invention.
  • Such methodologies permit three-dimensional display and real-time manipulation of cerebral structures.
  • Neurosurgical planning with mutually preregistered multiple brain atlases in all three orthogonal orientations is therefore possible and permits increased accuracy of target definition for neurotoxin injection or implantation, reduced time of the surgical procedure by decreasing the number of tracts, and facilitates planning of more sophisticated trajectories. See e.g. Nowinski W. L. et al . , Computer-Aided Stereotactic Functional Neurosurgery Enhanced by the Use of the Multiple Brain Atlas Database, IEEE Trans Med Imaging 19(1),-62- 69:2000.
  • the mapping means also allow for the intra-operative verification of the placement of the distal tip of the catheter.
  • verification of the placement of the distal end of the catheter may be performed intra-operativeIy by MRI by use of an intra- operative MR image-guidance system, such as the PoleStar ® iMRI Navigation Suite or a comparable system..
  • a means for locating the distal end during the access and location process is by use of small infrared light-reflective spheres temporarily attached to the proximal portion of the catheter or the surgical instrument that the surgeon is using to insert the catheter into the patient's brain.
  • An infrared camera in the operating room positioned near the operating table emits and tracks infrared signals reflecting off these small spheres. The detected reflection then enables a software and computer system (such as the StealthStation®) to compute and display the position of the catheter's distal end superimposed on previously captured MRI images of this specific patient, intra-operatively, in real-time.
  • a means for locating the distal end during the access and location process is by use of infrared-emitting light emitting diodes (LEDs) temporarily attached to the proximal portion of the catheter or the surgical instrument that the surgeon is using to insert the catheter into the patient's brain.
  • LEDs infrared-emitting light emitting diodes
  • An infrared camera in the operating room positioned near the operating table detects the infrared beams emitted from these LEDs .
  • These detected, beams enable a software and computer system (such as the StealthStation®) to compute and display the position of the catheter's distal end superimposed on previously captured MRI images of this specific patient, intra- operatively, in real-time. (This is possible because the distal end of the catheter is a known linear distance from the proximal portion of the catheter to which the LEDs have been temporarily attached) .
  • a software and computer system such as the StealthStation®
  • the goal of utilizing infrared triangulation is to enable the operator to accurately detect the precise location of the tip to facilitate placement and intra-operative verification of the integrity and position of distal end of catheter.
  • the present invention includes the delivery of small interfering RNA vectors using an implantable pump and catheter, like that taught in U.S. Pat. Nos . 5,735,814 and 6,042,579, and further using a sensor as part of the infusion system to regulate the amount of small interfering RNA vectors delivered to the brain, like that taught in U.S. Pat. No. 5,814,014.
  • Other devices and systems can be used in accordance with the method of the present invention, for example, the devices and systems disclosed in U.S. Ser. No. 09/872,698 (filed Jun. 1, 2001) and Ser. No. 09/864,646 (filed May 23, 2001), which are incorporated herein by reference .
  • the present invention provides methods to deliver small interfering RNA vectors to the human central nervous system, and thus treat neurodegenerative diseases by reducing the production of a pathogenic protein within neurons .
  • the present invention is directed for use as a treatment , for neurodegenerative disorders and/or diseases, comprising Alzheimer's disease, Parkinson's disease, Huntington's disease, Spinocerebellar type 1, type 2, and type 3, and/or any neurodegenerative disease caused or aggravated by the production of a pathogenic protein, or any other neurodegenerative disease caused by the gain of a new, pathogenic function by a mutant protein.
  • neurodegenerative disorders and/or diseases comprising Alzheimer's disease, Parkinson's disease, Huntington's disease, Spinocerebellar type 1, type 2, and type 3, and/or any neurodegenerative disease caused or aggravated by the production of a pathogenic protein, or any other neurodegenerative disease caused by the gain of a new, pathogenic function by a mutant protein.
  • this small interfering RNA reduces the amount of mRNA for human ataxinl in human cells, in cell cultures.
  • SCAl Spinocerebellar Ataxia Type 1
  • this same small interfering RNA or a similar small interfering RNA will be delivered to the cells of the cerebellum in the patient's brain, using implanted access ports and catheters. The result will be a reduction in the amount of ataxinl protein in these cells, thereby slowing or arresting the progression of the patient ' s SCAl disease .
  • the small interfering RNA against human ataxinl was been constructed from the nucleotide sequence for human ataxinl .
  • the sequence from human ataxin 1 was retrieved from the publicly-accessible nucleotide database provided by NCBI, retrievable as NCBI accession number NM_000332 (SEQ ID NO: 15) .
  • a portion of the human mRNA sequence for ataxinl was identified as a potential site for small interfering RNA cleavage and also predicted to be single-stranded by MFOLD analysis.
  • accession NM_000332 accession NM_000332 (SEQ ID NO:15
  • three pairs of anti ataxinl siRNA targets were constructed: 1.
  • Anti-ataxinl siRNA targeting the mRNA sequence at sites numbered 2750-through 2770 SEQ ID NO: 5: 5 ⁇ - AAGCAACGACCTGAAGATCGA - 3 1
  • a series of six deoxyoligonucleotide fragments were designed, ordered and purchased from the MWG Biotech, Inc., custom oligonucleotide synthesis service to provide the six fragments making up the three target sites. Additionally, these oligonucletides were constructed to include an 8 base sequence complementary to the 5 ' end of the T7 promoter primer included in an siRNA construction kit (Ambion, Inc. catalog number 1620) . Each specific oligonucleotide was annealed to the supplied T7 promoter primer, and filled-in with Klenow fragment to generate a full-length DNA template for transcription into RNA.
  • RNAs Two in vitro transcribed RNAs (one that is antisense to the other) were generated by in vitro transcription reactions then hybridized to each other to make double-stranded RNA.
  • the double-stranded RNA product was treated with DNase (to remove the DNA transcription templates) and. RNase (to polish the ends of the double- stranded RNA) , and column purified to provide the three siRNAs that were delivered and tested in cells.
  • the constructed siRNA molecules 1-3 described in Example 1 were transfected into HEK293 cells.
  • the RNA produced by the transfected cells was harvested and assayed to measure the amount of human ataxinl mRNA.
  • FIG. 1 shows the results of a quantitative reverse- transcriptase polymerase chain reaction (qRT-PCR) assay for the amount of ataxinl messenger RNA.
  • mRNA ataxinl messenger RNA
  • the second were 293H cells that had been transiently transfected with siRNA against ataxinl mRNA at location 1671 in the ataxinl mRNA sequence.
  • the third were 293H cells transiently transfected with a plasmid containing a ribozyme against ataxinl mRNA (which cleaves ataxinl mRNA at position 1364 in the ataxinl mRNA sequence) .
  • the fourth were 293H cells transiently transfected with siRNA against ataxinl mRNA at location 0945. All cell populations were harvested concurrently for total cellular RNA, at a time point 48 hours after transfection.
  • the amplified DNA products of the RT-PCR reaction were separated by molecular size, using gel electrophoresis, and are visible as bands of varying intensity.
  • Each cell population described was assayed using a series of parallel reactions, shown as a set of lanes at the top or bottom of each gel .
  • Each set of lanes contains two bands per lane.
  • the top band is the DNA product amplified from a known quantity of DNA added to the reaction to compete with the endogenous cDNA reverse transcribed from the cellular mRNA. If the bands in a given lane are of the same intensity, then the amount of cellular mRNA in the original cell sample can be inferred to be equivalent to the amount of known quantity of DNA added to the reaction tube.
  • the amount of known DNA standard added was decreased, in the picogram amounts shown.
  • the assay is interpreted by looking for the set of lanes for which the intensity of the bands "crosses over" from being brightest for the DNA standard, to being brightest for the cellular product below it, indicating that the amount of DNA standard is now lower than the amount of cellular mRNA.
  • the top set of lanes is from the cells transfected with the ribozyme against ataxinl mRNA.
  • the comparison of the bands from this cellular sample to the bands from the DNA standards indicates that the amount of ataxinl mRNA in these cells is between 0.505 and 0.303 picograms per microgram of total cellular RNA.
  • the bottom set of lanes is from the cells transfected with siRNA against ataxinl at position 0945. Analysis of these lanes indicates that the amount of ataxinl mRNA in these cells is between 0.303 and 0.202 picograms per microgram of total cellular RNA.
  • the top set of lanes is from the cells transfected with a control siRNA against GAPDH.
  • the bottom set of lanes is from cells transfected with another siRNA against ataxinl, at position 1671. These lanes indicate that the amount of ataxinl mRNA in these cells is between 0.404 and 0.303 picograms per microgram of total cellular RNA.
  • siRNA In heterozygous patients, if a single nucleotide polymorphism (SNP) were to differ between the mutant and normal length allele, an appropriate siRNA might selectively reduce expression of only the mutant allele.
  • SNP single nucleotide polymorphism
  • HeLa cells express a 927C but no 927T allele, while 293 cells express a 927T but no 927C allele.
  • DAOY and SK-N-SH cells express both allelic variants.
  • a selectable reporter plasmid, pAAV-U6-Tracer is constructed for cloning siRNA. (See FIG. 3) .
  • the plasmid pAAV-U6-Tracer is constructed to contain the inverted terminal repeats (ITR) of adeno-associated virus, flanking the U6 RNA polymerase III promoter from pSilencer (Ambion) , and the EFl a promoter, green fluorescence protein, Zeocin r resistance, and SV40 poly A from pTracer (Invitrogen) .
  • the gene segments are cloned as shown in FIG. 3.
  • Oligonucleotides for expressing siRNA are cloned into the multiple cloning region just downstream in the 3" direction from the U6 RNA polymerase III promoter.
  • HEK293 Cells are cotransfected with pAAV-siRNA, pHelper, and pAAV-RC to make viral producer cells, where the pAAV-RC and pHelper plasmids are part of the three plasmid AAV production system Avigen, Inc.) .
  • the producer 293 cells are grown in culture are used to isolate recombinant viruses, which is used to transfect secondary cells: HeLa Cells, DAOY cells, and SK-N-SH cells.
  • Example 5 Injection of siRNA of SEQ ID NO: 24 locally and significantly reduces the amount of HD ITLRNA.
  • 3XlO 11 viral particles comprising AAV vectors including. siRNAs of SEQ ID. NO: 24.or SEQ. ID. NO: 25, shown in Table 3, or a control siRNA under regulation of
  • the amount of HD mRNA was decreased by about 65% to 70% in the GFP- expressing areas compared to the areas not expressing GFP, as measured by qRT-PCR of LMD sections.
  • the effect of the siRNA treatment was hemisphere-specific.
  • significant decrease of HD mRNA was observed in GFP-expressing areas of the right hemisphere (injected with a vector comprising SEQ ID NO: 24), as opposed to the GFP-expressing areas of the left hemisphere (injected with a vector comprising control siRNA) .
  • Example 6 Injection of siRNA of SEQ ID NO: 24 does not: cause great anatomical aberrations and does not impair endoplasmic reticules of the transduced cells .
  • the animals were injected according to the protocol of the previous example. Histopathological analyses were conducted by fluorescence microscopy for green fluorescent protein, hematoxylin-eosin (H&E) staining, fluorescence microscopy for huntingtin protein immunostaining, immunostaining for calnexin, and immunostaining for protein disulfide isomerase (PDI) .
  • H&E hematoxylin-eosin
  • PDI protein disulfide isomerase
  • the results of those studies show that HD suppression does not cause any detectable neuro-anatomical abnormalities in the injected areas. Some evidence of perivascular cuffing in virally transduced regions was observed, but this cuffing did not correlate with HD suppression. Further, staining for calnexin and PDI did not reveal any obvious alterations in the endoplasmic reticulum (ER) of the transduced cells.
  • ER endoplasmic reticulum
  • siRNA of SEQ ID NO: 24 does not alter spontaneous activity and tends to improve fine locomotor activity.
  • EthoVision is a commercially available video tracking system (EthoVision Pro, version 2.2, Noldus Information Technologies, Asheville, NC) that measures the distance traveled (cm) and whole body movement speed (cm/sec) of the animal during an observation period.
  • the mMAP equipment is an apparatus (named the automated monkey Movement Analysis Panel [mMAP] ) that is used to objectively measure the time of fine motor movements of the small hand muscles of the rhesus monkey in retrieving food items from platform placed, in a receptacle chamber.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Epidemiology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Neurology (AREA)
  • Neurosurgery (AREA)
  • Psychology (AREA)
  • Medical Informatics (AREA)
  • Hematology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Anesthesiology (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Dermatology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Infusion, Injection, And Reservoir Apparatuses (AREA)
PCT/US2007/017659 2003-02-03 2007-08-08 Compositions, devices and methods for treatment of huntington's disease through intracranial delivery of sirna Ceased WO2008021149A2 (en)

Priority Applications (6)

Application Number Priority Date Filing Date Title
US12/376,940 US7994149B2 (en) 2003-02-03 2007-08-08 Method for treatment of Huntington's disease through intracranial delivery of sirna
CA2660153A CA2660153C (en) 2006-08-08 2007-08-08 Compositions, devices and methods for treatment of huntington's disease through intracranial delivery of sirna
CN2007800371052A CN101522202B (zh) 2006-08-08 2007-08-08 通过颅内递送sirna治疗亨廷顿氏舞蹈症的组合物、装置和方法
EP07811194.5A EP2056840B1 (en) 2006-08-08 2007-08-08 Compositions, devices and methods for treatment of huntington's disease through intracranial delivery of siRNA
JP2009523836A JP2010500357A (ja) 2006-08-08 2007-08-08 頭蓋内のsiRNAの運搬を通じたハンチントンの疾患治療用の組成物、デバイス及び方法
US13/028,638 US8957198B2 (en) 2003-02-03 2011-02-16 Compositions, devices and methods for treatment of Huntington's disease through intracranial delivery of sirna

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US11/501,147 US7732591B2 (en) 2003-11-25 2006-08-08 Compositions, devices and methods for treatment of huntington's disease through intracranial delivery of sirna
US11/501,147 2006-08-08

Related Parent Applications (2)

Application Number Title Priority Date Filing Date
US10/852,997 Continuation-In-Part US7829694B2 (en) 2002-11-26 2004-05-25 Treatment of neurodegenerative disease through intracranial delivery of siRNA
US11/501,147 Continuation-In-Part US7732591B2 (en) 2003-02-03 2006-08-08 Compositions, devices and methods for treatment of huntington's disease through intracranial delivery of sirna

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US12/376,940 A-371-Of-International US7994149B2 (en) 2003-02-03 2007-08-08 Method for treatment of Huntington's disease through intracranial delivery of sirna
US13/028,638 Continuation US8957198B2 (en) 2003-02-03 2011-02-16 Compositions, devices and methods for treatment of Huntington's disease through intracranial delivery of sirna

Publications (2)

Publication Number Publication Date
WO2008021149A2 true WO2008021149A2 (en) 2008-02-21
WO2008021149A3 WO2008021149A3 (en) 2008-12-04

Family

ID=39082586

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2007/017659 Ceased WO2008021149A2 (en) 2003-02-03 2007-08-08 Compositions, devices and methods for treatment of huntington's disease through intracranial delivery of sirna

Country Status (6)

Country Link
US (1) US7732591B2 (enExample)
EP (1) EP2056840B1 (enExample)
JP (1) JP2010500357A (enExample)
CN (1) CN101522202B (enExample)
CA (1) CA2660153C (enExample)
WO (1) WO2008021149A2 (enExample)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12350285B2 (en) 2016-11-10 2025-07-08 Ionis Pharmaceuticals, Inc. Compounds and methods for reducing ATXN3 expression

Families Citing this family (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7994149B2 (en) * 2003-02-03 2011-08-09 Medtronic, Inc. Method for treatment of Huntington's disease through intracranial delivery of sirna
US9375440B2 (en) * 2006-11-03 2016-06-28 Medtronic, Inc. Compositions and methods for making therapies delivered by viral vectors reversible for safety and allele-specificity
US8324367B2 (en) 2006-11-03 2012-12-04 Medtronic, Inc. Compositions and methods for making therapies delivered by viral vectors reversible for safety and allele-specificity
US8173614B2 (en) * 2007-01-03 2012-05-08 Medtronic, Inc. Therapeuting compositions comprising an RNAi agent and a neurotrophic factor and methods of use thereof
WO2011008982A1 (en) * 2009-07-15 2011-01-20 Sah Dinah W Y Treatment of neurological disorders
US20170102398A1 (en) * 2014-03-05 2017-04-13 Humanetics Corporation Predicting and reducing cognitive decline based on gsk-3 levels
US10786674B2 (en) * 2016-03-08 2020-09-29 Medtronic, Inc. Medical therapy target definition
US20210031034A1 (en) * 2018-02-14 2021-02-04 Neuroelectrics Corporation Systems and methods for treating brain disease using targeted neurostimulation
WO2019217708A1 (en) * 2018-05-09 2019-11-14 Ionis Pharmaceuticals, Inc. Compounds and methods for reducing atxn3 expression
WO2021087036A1 (en) * 2019-11-01 2021-05-06 Alnylam Pharmaceuticals, Inc. HUNTINGTIN (HTT) iRNA AGENT COMPOSITIONS AND METHODS OF USE THEREOF
CN113846122B (zh) * 2021-08-16 2023-08-25 中国医学科学院医学生物学研究所 一种过表达snca的腺相关病毒载体aav-snca、制备方法及其应用

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996018736A2 (en) 1994-12-13 1996-06-20 Ribozyme Pharmaceuticals, Inc. Method and reagent for treatment of arthritic conditions, induction of graft tolerance and reversal of immune responses
US5624803A (en) 1993-10-14 1997-04-29 The Regents Of The University Of California In vivo oligonucleotide generator, and methods of testing the binding affinity of triplex forming oligonucleotides derived therefrom
US5735814A (en) 1996-04-30 1998-04-07 Medtronic, Inc. Techniques of treating neurodegenerative disorders by brain infusion
US6042579A (en) 1997-04-30 2000-03-28 Medtronic, Inc. Techniques for treating neurodegenerative disorders by infusion of nerve growth factors into the brain

Family Cites Families (112)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4683195A (en) * 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
US4683202A (en) * 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US4965188A (en) * 1986-08-22 1990-10-23 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences using a thermostable enzyme
GB2181691B (en) * 1985-10-21 1990-05-23 Porvair Ltd Gloves
US4800159A (en) * 1986-02-07 1989-01-24 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences
US5702716A (en) * 1988-10-03 1997-12-30 Atrix Laboratories, Inc. Polymeric compositions useful as controlled release implants
CA2109955A1 (en) * 1991-05-24 1992-11-26 Toru Hayakawa Equipment for intracerebral administration of preparations
US5236908A (en) * 1991-06-07 1993-08-17 Gensia Pharmaceuticals, Inc. Methods of treating injury to the central nervous system
US5354326A (en) * 1993-01-27 1994-10-11 Medtronic, Inc. Screening cable connector for interface to implanted lead
CA2169292C (en) * 1993-08-12 2010-11-23 E. Edward Baetge Improved compositions and methods for the delivery of biologically active molecules using genetically altered cells contained in biocompatible immunoisolatory capsules
AU7676894A (en) * 1993-08-27 1995-03-21 Government Of The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services, The Convection-enhanced drug delivery
CA2179014C (en) * 1993-12-17 2003-07-29 Spinal Cord Society Method for inducing dna synthesis in neurons
EP0755454B1 (en) * 1994-04-13 2008-02-13 The Rockefeller University Aav-mediated delivery of dna to cells of the nervous system
US6294202B1 (en) * 1994-10-06 2001-09-25 Genzyme Corporation Compositions containing polyanionic polysaccharides and hydrophobic bioabsorbable polymers
US5534350A (en) * 1994-12-28 1996-07-09 Liou; Derlin Powerfree glove and its making method
WO1996033761A1 (en) * 1995-04-28 1996-10-31 Medtronic, Inc. Intraparenchymal infusion catheter system
US7069634B1 (en) * 1995-04-28 2006-07-04 Medtronic, Inc. Method for manufacturing a catheter
US5840059A (en) * 1995-06-07 1998-11-24 Cardiogenesis Corporation Therapeutic and diagnostic agent delivery
US5942455A (en) * 1995-11-14 1999-08-24 Drexel University Synthesis of 312 phases and composites thereof
JPH09268067A (ja) * 1996-03-29 1997-10-14 Asahi Glass Co Ltd 炭化ケイ素部材の製造方法
WO2000062828A1 (en) * 1996-04-30 2000-10-26 Medtronic, Inc. Autologous fibrin sealant and method for making the same
US5976109A (en) * 1996-04-30 1999-11-02 Medtronic, Inc. Apparatus for drug infusion implanted within a living body
US7189222B2 (en) * 1996-04-30 2007-03-13 Medtronic, Inc. Therapeutic method of treatment of alzheimer's disease
AU4266597A (en) * 1996-09-11 1998-04-14 General Hospital Corporation, The Use of a non-mammalian dna virus to express an exogenous gene in a mammalian cell
US5882561A (en) * 1996-11-22 1999-03-16 Drexel University Process for making a dense ceramic workpiece
GB9701684D0 (en) * 1997-01-28 1997-03-19 Smithkline Beecham Plc Novel compounds
US5968059A (en) * 1997-03-06 1999-10-19 Scimed Life Systems, Inc. Transmyocardial revascularization catheter and method
GB9706463D0 (en) * 1997-03-27 1997-05-14 Medical Res Council A model of inflamation in the central nervous system for use in the study of disease
US6436708B1 (en) * 1997-04-17 2002-08-20 Paola Leone Delivery system for gene therapy to the brain
US5931861A (en) * 1997-04-25 1999-08-03 Medtronic, Inc. Medical lead adaptor having rotatable locking clip mechanism
US5782892A (en) * 1997-04-25 1998-07-21 Medtronic, Inc. Medical lead adaptor for external medical device
US6110459A (en) * 1997-05-28 2000-08-29 Mickle; Donald A. G. Transplants for myocardial scars and methods and cellular preparations
US20050282198A1 (en) 1997-05-29 2005-12-22 Interleukin Genetics, Inc. Diagnostics and therapeutics for diseases associated with an IL-1 inflammatory haplotype
US6231969B1 (en) * 1997-08-11 2001-05-15 Drexel University Corrosion, oxidation and/or wear-resistant coatings
US6187906B1 (en) * 1997-08-11 2001-02-13 Aukland Uniservices Limited Methods to improve neural outcome
AU9692198A (en) * 1997-10-10 1999-05-03 Kevin J. Donahue Gene delivery compositions and methods
US6151525A (en) * 1997-11-07 2000-11-21 Medtronic, Inc. Method and system for myocardial identifier repair
US6436392B1 (en) * 1998-05-20 2002-08-20 University Of Iowa Research Foundation Adeno-associated virus vectors
ES2326893T3 (es) * 1998-05-27 2009-10-21 Genzyme Corporation Vectores aav para la fabricacion de medicamentos para administracion potenciada por conveccion.
US6245884B1 (en) * 1998-10-16 2001-06-12 Vivian Y. H. Hook Secretases related to alzheimer's dementia
US6313268B1 (en) * 1998-10-16 2001-11-06 Vivian Y. H. Hook Secretases related to Alzheimer's dementia
US6319905B1 (en) * 1998-12-29 2001-11-20 Cell Genesys, Inc. Method of controlling L-Dopa production and of treating dopamine deficiency
US6835194B2 (en) * 1999-03-18 2004-12-28 Durect Corporation Implantable devices and methods for treatment of pain by delivery of fentanyl and fentanyl congeners
WO2000065042A1 (en) * 1999-04-28 2000-11-02 The Board Of Trustees Of The Leland Stanford Junior University P element derived vector and methods for its use
GB9928248D0 (en) * 1999-12-01 2000-01-26 Gill Steven S An implantable guide tube for neurosurgery
US6310048B1 (en) * 1999-12-09 2001-10-30 St. Louis University Antisense modulation of amyloid beta protein expression
US6461989B1 (en) * 1999-12-22 2002-10-08 Drexel University Process for forming 312 phase materials and process for sintering the same
US20030092003A1 (en) * 1999-12-29 2003-05-15 Ribozyme Pharmaceuticals, Inc. Method and reagent for the treatment of Alzheimer's disease
WO2001049844A1 (en) 1999-12-30 2001-07-12 Rutgers, The State University Of New Jersey Compositions and methods for gene silencing
US20070026394A1 (en) * 2000-02-11 2007-02-01 Lawrence Blatt Modulation of gene expression associated with inflammation proliferation and neurite outgrowth using nucleic acid based technologies
US20050032733A1 (en) * 2001-05-18 2005-02-10 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (SiNA)
CA2400172C (en) * 2000-02-28 2010-04-20 Genesegues, Inc. Nanocapsule encapsulation system and method
US6468524B1 (en) * 2000-03-22 2002-10-22 The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services AAV4 vector and uses thereof
US6551290B1 (en) * 2000-03-31 2003-04-22 Medtronic, Inc. Catheter for target specific drug delivery
US6945969B1 (en) * 2000-03-31 2005-09-20 Medtronic, Inc. Catheter for target specific drug delivery
US6372250B1 (en) * 2000-04-25 2002-04-16 The Regents Of The University Of California Non-invasive gene targeting to the brain
US20020037281A1 (en) 2000-05-26 2002-03-28 Davidson Beverly L. Methods of transducing neural cells using lentivirus vectors
US20020042388A1 (en) * 2001-05-01 2002-04-11 Cooper Mark J. Lyophilizable and enhanced compacted nucleic acids
US20050209179A1 (en) * 2000-08-30 2005-09-22 Sirna Therapeutics, Inc. RNA interference mediated treatment of Alzheimer's disease using short interfering nucleic acid (siNA)
WO2002018003A1 (en) * 2000-08-30 2002-03-07 Biocoat Incorporated Bi-laminar, hyaluronan coatings with silver-based anti-microbial properties
US20030190635A1 (en) * 2002-02-20 2003-10-09 Mcswiggen James A. RNA interference mediated treatment of Alzheimer's disease using short interfering RNA
US6659995B1 (en) * 2000-11-17 2003-12-09 Syde A. Taheri Autologous myocyte micro granual retrieval and implantation (AMMGRI)
CA2327208A1 (en) * 2000-11-30 2002-05-30 The Government Of The United States Of America Methods of increasing distribution of therapeutic agents
RU2322500C2 (ru) 2000-12-01 2008-04-20 Макс-Планк-Гезелльшафт Цур Фердерунг Дер Виссеншафтен Е.Ф. Малые молекулы рнк, опосредующие интерференцию рнк
US7182944B2 (en) * 2001-04-25 2007-02-27 The United States Of America As Represented By The Department Of Health And Human Services Methods of increasing distribution of nucleic acids
US20030095958A1 (en) * 2001-04-27 2003-05-22 Bhisetti Govinda R. Inhibitors of bace
US20030152947A1 (en) * 2001-06-15 2003-08-14 Crossman David C. Methods for detecting and treating the early onset of aging-related conditions
US20030109476A1 (en) * 2001-08-07 2003-06-12 Kmiec Eric B. Compositions and methods for the prevention and treatment of Huntington's disease
US6944497B2 (en) * 2001-10-31 2005-09-13 Medtronic, Inc. System and method of treating stuttering by neuromodulation
US20030105047A1 (en) 2001-11-30 2003-06-05 Medtronic, Inc. Techniques for treating neurodegenerative disorders by brain infusion of mutational vectors
US20030120282A1 (en) * 2001-12-24 2003-06-26 Scouten Charles W. Stereotaxic manipulator with retrofitted linear scales and digital display device
US7294504B1 (en) * 2001-12-27 2007-11-13 Allele Biotechnology & Pharmaceuticals, Inc. Methods and compositions for DNA mediated gene silencing
US20050096284A1 (en) * 2002-02-20 2005-05-05 Sirna Therapeutics, Inc. RNA interference mediated treatment of polyglutamine (polyQ) repeat expansion diseases using short interfering nucleic acid (siNA)
US7270653B2 (en) * 2002-02-20 2007-09-18 Abbott Research Group Methods of treating abnormal biological conditions using metal oxides
US20030224512A1 (en) * 2002-05-31 2003-12-04 Isis Pharmaceuticals Inc. Antisense modulation of beta-site APP-cleaving enzyme expression
US20040023855A1 (en) * 2002-04-08 2004-02-05 John Constance M. Biologic modulations with nanoparticles
US20040018520A1 (en) * 2002-04-22 2004-01-29 James Thompson Trans-splicing enzymatic nucleic acid mediated biopharmaceutical and protein
WO2003099298A1 (en) 2002-05-24 2003-12-04 Max-Planck Gesellschaft zur Förderung der Wissenschaften e.V. Rna interference mediating small rna molecules
US7008403B1 (en) * 2002-07-19 2006-03-07 Cognitive Ventures Corporation Infusion pump and method for use
WO2004010787A1 (ja) 2002-07-25 2004-02-05 Nissei Kabushiki Kaisha ロールコーン製造装置
US20040023390A1 (en) * 2002-08-05 2004-02-05 Davidson Beverly L. SiRNA-mediated gene silencing with viral vectors
US20050106731A1 (en) * 2002-08-05 2005-05-19 Davidson Beverly L. siRNA-mediated gene silencing with viral vectors
US20050255086A1 (en) * 2002-08-05 2005-11-17 Davidson Beverly L Nucleic acid silencing of Huntington's Disease gene
US20050042646A1 (en) * 2002-08-05 2005-02-24 Davidson Beverly L. RNA interference suppresion of neurodegenerative diseases and methods of use thereof
DK2284266T3 (da) * 2002-11-14 2014-01-13 Thermo Fisher Scient Biosciences Inc sIRNA-MOLEKYLE MOD TP53
US20040265849A1 (en) 2002-11-22 2004-12-30 Applera Corporation Genetic polymorphisms associated with Alzheimer's disease, methods of detection and uses thereof
US7829694B2 (en) * 2002-11-26 2010-11-09 Medtronic, Inc. Treatment of neurodegenerative disease through intracranial delivery of siRNA
US20050048641A1 (en) * 2002-11-26 2005-03-03 Medtronic, Inc. System and method for delivering polynucleotides to the central nervous system
US7605249B2 (en) * 2002-11-26 2009-10-20 Medtronic, Inc. Treatment of neurodegenerative disease through intracranial delivery of siRNA
US8946151B2 (en) * 2003-02-24 2015-02-03 Northern Bristol N.H.S. Trust Frenchay Hospital Method of treating Parkinson's disease in humans by convection-enhanced infusion of glial cell-line derived neurotrophic factor to the putamen
US8512290B2 (en) * 2003-03-20 2013-08-20 Boston Scientific Scimed, Inc. Devices and methods for delivering therapeutic or diagnostic agents
US20040186528A1 (en) 2003-03-20 2004-09-23 Medtronic, Inc. Subcutaneous implantable medical devices with anti-microbial agents for chronic release
US20040198640A1 (en) 2003-04-02 2004-10-07 Dharmacon, Inc. Stabilized polynucleotides for use in RNA interference
PL1620133T3 (pl) 2003-05-01 2016-05-31 Genzyme Corp Terapia genowa dla zaburzeń neurometabolicznych
US20040258666A1 (en) 2003-05-01 2004-12-23 Passini Marco A. Gene therapy for neurometabolic disorders
US7917228B2 (en) 2003-05-13 2011-03-29 Medtronic, Inc. Medical lead adaptor assembly
US20060014165A1 (en) * 2003-07-14 2006-01-19 Decode Genetics Ehf. Methods of diagnosis and treatment for asthma and other respiratory diseases based on haplotype association
EP2821085B1 (en) 2003-09-12 2020-04-29 University of Massachusetts Rna interference for the treatment of gain-of-function disorders
US7678780B2 (en) * 2003-12-29 2010-03-16 Allan Mishra Method of treating cancer using platelet releasate
WO2005070104A2 (en) * 2004-01-09 2005-08-04 The University Of Tennessee Research Foundation REAL-TIME POLYMERASE CHAIN REACTION-BASED GENOTYPING ASSAY FOR β2-ADRENERGIC RECEPTOR SINGLE NUCLEODITE POLYMORPHISM
US20050202075A1 (en) * 2004-03-12 2005-09-15 Pardridge William M. Delivery of genes encoding short hairpin RNA using receptor-specific nanocontainers
AU2005248147A1 (en) 2004-05-11 2005-12-08 Alphagen Co., Ltd. Polynucleotides for causing RNA interference and method for inhibiting gene expression using the same
WO2006022639A1 (en) 2004-07-21 2006-03-02 Applera Corporation Genetic polymorphisms associated with alzheimer's disease, methods of detection and uses thereof
EP1807157A2 (en) * 2004-10-22 2007-07-18 Neurologix, Inc. Use of apoptosis inhibiting compounds in degenerative neurological disorders
NL1028134C2 (nl) * 2005-01-27 2006-07-31 Sara Lee De Nv Werkwijze voor het bereiden van een voor consumptie geschikte drank uit ten minste twee op te lossen en/of te extraheren ingredienten en een hoeveelheid vloeistof.
TW200635542A (en) * 2005-04-01 2006-10-16 Dharma Drum Mountain Method of establishing and using commemorative material
WO2006121960A2 (en) * 2005-05-06 2006-11-16 Medtronic, Inc. Methods and sequences to suppress primate huntington gene expression
US20080280843A1 (en) 2006-05-24 2008-11-13 Van Bilsen Paul Methods and kits for linking polymorphic sequences to expanded repeat mutations
GB0520235D0 (en) 2005-10-05 2005-11-16 Astrazeneca Ab Method
US7320965B2 (en) * 2005-10-28 2008-01-22 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of Huntingtin gene
US20080039415A1 (en) 2006-08-11 2008-02-14 Gregory Robert Stewart Retrograde transport of sirna and therapeutic uses to treat neurologic disorders
CN200970210Y (zh) 2006-10-12 2007-11-07 王会才 拖把清洗脱水机

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5624803A (en) 1993-10-14 1997-04-29 The Regents Of The University Of California In vivo oligonucleotide generator, and methods of testing the binding affinity of triplex forming oligonucleotides derived therefrom
WO1996018736A2 (en) 1994-12-13 1996-06-20 Ribozyme Pharmaceuticals, Inc. Method and reagent for treatment of arthritic conditions, induction of graft tolerance and reversal of immune responses
US5735814A (en) 1996-04-30 1998-04-07 Medtronic, Inc. Techniques of treating neurodegenerative disorders by brain infusion
US5814014A (en) 1996-04-30 1998-09-29 Medtronic Incorporated Techniques of treating neurodegenerative disorders by brain infusion
US6042579A (en) 1997-04-30 2000-03-28 Medtronic, Inc. Techniques for treating neurodegenerative disorders by infusion of nerve growth factors into the brain

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
GOOD ET AL., GENE THER., vol. 4, 1997, pages 45
L'HUILLIER ET AL., EMBO J, vol. 11, 1992, pages 4411 - 8
LISZIEWICZ ET AL., PROC. NATL. ACAD. SCI. U.S.A, vol. 90, 1993, pages 8000 - 4
NOONBERG ET AL., NUCLEIC ACID RES., vol. 22, 1994, pages 2830
See also references of EP2056840A4
SULLENGER; CECH, SCIENCE, vol. 262, 1993, pages 1566
THOMPSON ET AL., NUCLEIC ACIDS RES., vol. 23, 1995, pages 2259

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12350285B2 (en) 2016-11-10 2025-07-08 Ionis Pharmaceuticals, Inc. Compounds and methods for reducing ATXN3 expression

Also Published As

Publication number Publication date
EP2056840A4 (en) 2010-10-20
CN101522202A (zh) 2009-09-02
JP2010500357A (ja) 2010-01-07
EP2056840A2 (en) 2009-05-13
WO2008021149A3 (en) 2008-12-04
EP2056840B1 (en) 2013-06-19
US7732591B2 (en) 2010-06-08
US20070167389A1 (en) 2007-07-19
CA2660153A1 (en) 2008-02-21
CA2660153C (en) 2013-01-08
CN101522202B (zh) 2013-03-06

Similar Documents

Publication Publication Date Title
CA2660153C (en) Compositions, devices and methods for treatment of huntington's disease through intracranial delivery of sirna
US7605249B2 (en) Treatment of neurodegenerative disease through intracranial delivery of siRNA
US8415319B2 (en) Devices, systems and methods for improving memory and/or cognitive function through brain delivery of siRNA
US7829694B2 (en) Treatment of neurodegenerative disease through intracranial delivery of siRNA
US8957198B2 (en) Compositions, devices and methods for treatment of Huntington's disease through intracranial delivery of sirna
US8183219B2 (en) Therapeuting compositions comprising an RNAi agent and a neurotrophic factor and methods of use thereof
US20050048641A1 (en) System and method for delivering polynucleotides to the central nervous system
US8173614B2 (en) Therapeuting compositions comprising an RNAi agent and a neurotrophic factor and methods of use thereof
JP2008503590A (ja) 組成物を細胞にデリバリーするための医学用システム及び方法

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 200780037105.2

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 07811194

Country of ref document: EP

Kind code of ref document: A2

WWE Wipo information: entry into national phase

Ref document number: 2009523836

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: 492/KOLNP/2009

Country of ref document: IN

ENP Entry into the national phase

Ref document number: 2660153

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 12376940

Country of ref document: US

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2007811194

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: RU