WO2008018555A1

WO2008018555A1 - HBsAg PARTICLE HAVING LOW ANTIGENICITY AND METHOD FOR PRODUCTION THEREOF

Info

Publication number: WO2008018555A1
Application number: PCT/JP2007/065646
Authority: WO
Inventors: Ichiro Yamada; Masaharu Seno; Hiroko Tada
Original assignee: National University Corporation Okayama University; Beacle Inc.
Priority date: 2006-08-11
Filing date: 2007-08-09
Publication date: 2008-02-14
Also published as: JP5147697B2; JPWO2008018555A1

Abstract

Disclosed are: a hollow nanoparticle having a lower antigenicity/immunogenicity; a protein constituting the hollow nanoparticle; a particle composed of the protein; and a method for preparing the particle. Specifically disclosed is a human hepatitis B virus surface antigen (HBsAg) protein mutant which has the deletion of at least amino acid residues lying between position-105 to position-148 in an S-polypeptide segment in an HBsAg protein that contains the S-polypeptide segment.

Description

Specification

Low antigenic HBsAg particles and method for producing the same

Technical field

The present invention relates to a low antigenic HBsAg particle and a method for producing the same.

Background art

[0002] In recent years, in the field of medicine, a drug delivery system (DDS) aimed at delivering an active ingredient such as a drug specifically to a target cell or target tissue and causing it to act only at the target site has attracted attention. /! As an effective DDS that can deliver drugs specifically to target cells or tissues, we use hollow nanoparticles in which bio-recognized sites are introduced into proteins with particle-forming ability to target cells. In addition, a method for specifically and safely transporting substances to tissues and tissues has been proposed (Patent Documents 1 to 4).

[0003] However, the viral coat protein used as a protein forming the hollow nanoparticles exhibits antigenicity and antibody inducing ability similar to those of viruses when administered into the human body. For this reason, 1) the virus-infected patients who already possess antiviral antibodies by administering the virus vaccine, the administered hollow nanoparticles are neutralized by the antiviral antibodies. In the case of continuous administration, the antibody against itself is induced and neutralized by the antibody, so that the administered hollow nanoparticles may not be able to exert the intended drug delivery ability. Furthermore, the concern of anaphylaxis cannot be excluded as a side effect. Therefore, overcoming this antigenicity and immunogenicity has been a challenge for pharmaceutical applications of hollow nanoparticles.

Patent Literature l: WO03 / 82344

Patent Document 2: JP 2003-286198 A

Patent Document 3: JP 2004-2313

Patent Document 4: WO03 / 82330

Disclosure of the invention

Problems to be solved by the invention

[0004] An object of the present invention is to provide hollow nanoparticles having a lower antigenicity / immunogenicity and a constituent tamper thereof. It is to provide a protein, a particle comprising the protein as a constituent element, and a preparation method thereof. Means for solving the problem

[0005] From the sequence of hepatitis B virus coat protein (hepatitis B virusless surface antigen protein: HBsAg), which has particle-forming ability, the present inventor is present on the surface of hollow particles and immediately forms an antigenic epitope. It was found that hollow nanoparticles with low antigenicity and immunogenicity can be formed by deleting sequences that do not impair the ability.

[0006] The present invention includes the following inventions.

1. A human hepatitis B virus surface antigen protein (HBsAg) containing an S polypeptide part, wherein at least amino acids at positions 105 to 148 of the S polypeptide part are deleted, HBsAg Protein variant.

2. The HBsAg protein variant according to Item 1, wherein the HBsAg protein variant further comprises a cell recognition moiety.

3. The HBsAg protein variant according to Item 1 or 2, wherein the S polypeptide portion further has at least one deletion of the following (a) to (c):

(a) a deletion of at least one amino acid from position 101 to 104;

(b) a deletion of at least one amino acid at positions 149-154,

(c) A deletion of at least one amino acid in the 54 polypeptides at the C-terminus of HBsAg.

4. HBsAg protein modification strength In addition to the S polypeptide portion, it contains a non-cell recognition site or a part of the PreS portion, and further, a hepatocyte recognition portion derived from the PreS portion, an antibody, a growth factor, a cyto force-in, Item 4. The HBsAg according to any one of Items 1 to 3, comprising at least one cell recognition moiety selected from the group consisting of a cell surface antigen, a tissue-specific antigen, a receptor, a molecule derived from a virus and a microorganism, and a sugar chain. Protein variant.

5. The HBsAg protein variant according to any one of Items 1 to 4, which has a linker peptide at a deletion site including positions 105 to 148.

6. The modified HBsAg protein according to item 5, wherein the linker peptide is composed of 2 to 4 amino acid residues.

7. Amino acid residues that break the helix (Gly, Pro, Asn, Tyr), amino acid residues with many turn structures (Asn, Gly, Pro, Asp, Ser, Trp), amino acids that are difficult to stay at the membrane interface Item 7. The modified HBsAg protein according to Item 5 or 6, comprising a combination of amino acids selected from the group consisting of acid residues (Glu, Asp, Lys, His, Arg, Gin, Pro, Asn).

8. The modified HBsAg protein according to any one of Items 5 to 7, wherein the linker peptide is PD, QE, PSSS, or PDNG.

9. An HBsAg hollow particle comprising the HBsAg protein variant according to any one of Items 1 to 8 as a constituent element.

10. An expression vector containing a gene encoding the HBsAg protein variant according to any one of Items 1 to 8 is introduced into a eukaryotic cell, the cell is transformed, and the resulting transformed cell is cultured. The method for producing HBsAg particles, wherein the HBsAg particles according to Item 9 are recovered.

11. Inside the HBsAg hollow particle according to Item 9, there is at least one selected from the group consisting of DNA, RNA, protein, lipid, carbohydrate, labeling substance, drug, and physiologically active substance that can function in cells. Material carrier with the following substances.

The invention's effect

[0007] According to the present invention, hollow nanoparticles with low antigenicity can be obtained in high yield, and the hollow nanoparticles are excellent in the ability to introduce substances such as genes and proteins into cells.

Brief Description of Drawings

[0008] [Figure 1] Structure of wild type envelope protein (HBsAg L protein) and MSL deletion mutant [Figure 2] Construction of various MSL deletion L protein expression vectors

[Fig.3] Reactivity of MSL-deficient mutants with goat anti-HBsAg antibody M6_d54-3xFLAG (HBsAg positive control, PC), MSL (108_148) / PD-d54, MSL (108_148) / QE-d54 mutant expression Cos7 cells transfected with the vector were analyzed by western blotting using anti-FLAG-tag antibody and western blotting using goat anti-HBsAg antibody. Compared to the positive control M6_d54-3xFLAG mutant, the MSL-deficient mutant protein was detected to the same extent by the anti-FLAG antibody, but was hardly detected by the anti-HBsAg antibody.

[Figure 4] WT-d54-3xFLAG, MSL ( 105_148) / PD-d54, MSL (105_152) / PD-d54, MSL (1 05_15 4 / PD) -d5 4 particles Anti-HBsAg antibodies (the lower) anti-FLAG Detection was performed by Western plotting with an antibody (upper). In the right table, the darkness of each band in the left figure is quantified with image software, The positive control (WT-d54-3xFLAG) was expressed as 100. The band of the deletion mutant decreased in response to the force anti-HBsAg antibody, which reacted more than or equal to WT-d54-3xFLAG.

BEST MODE FOR CARRYING OUT THE INVENTION

[0009] Examples of mutant proteins that can be used for the formation of the above hollow nanoparticles include human hepatitis B virus coat protein (surface antigen protein, HBsAg).

[0010] Hepatitis B virus surface antigen L protein (HBsAgL) has the ability to form particles and recognize target cells. HBsAgL protein consists of N-terminal PreS region and C-terminal S protein region. Of these, the PreS region bears the ability to recognize target cells (human hepatocytes), but is replaced with another target recognition sequence when creating hollow nanoparticles with converted target tissues. Therefore, the PreS region is not a region common to all hollow nanoparticles. On the other hand, since the S protein part is involved in particle structure formation, it is common to all hollow nanoparticles.

S protein (226 amino acids), which is included in HBsAg and is a component of S particles, has particle-forming ability! Pre-S2 consisting of 55 amino acids added to S protein is M protein (M particle constituent protein), and Pre-Si consisting of 108 amino acids (subtype y) or 119 amino acids (subtype d) is added to M protein. This is the L protein (the protein that constitutes the L particle). In the present specification, unless otherwise specified, the numbering of amino acid positions in the Pre-Sl region is based on a subtype y of 108 amino acids.

[0011] There are three types of HBsAg: adr type, adw type, and ayw type. Pre-Si adr type is 108 a. A.

The adw type is 115 a.a. and the ayw type is 119 a.a. Pre_S2 is 55 a.a for all adr, adw and ayw types. Furthermore, S is 226 a.a. for all adr, adw, and ayw types.

[0012] The adr type L protein (SEQ ID NO: 45) is a 389 amino acid protein consisting of Pre-S1 (108 a.a.), Pre-S2 (55 a.a.) and S (226 a.a.) forces.

[0013] In this specification, pGLDLIIP39_RcT L protein (Pre_Sl → 108 aa, Pre-S2 → 49 aa, S → 226 aa) is positions 152 to 15 7 in the adr type L protein of SEQ ID NO: 45 The 6 amino acid residues of SIFSRT (protease sensitive self-sequence) are deleted.

[0014] L protein and M protein have the ability to form particles, similar to S protein. Therefore, the two regions of PreSl and PreS2 may be arbitrarily substituted, attached, deleted, or inserted. For example, by using a modified protein in which a hepatocyte recognition site contained in amino acids 3 to 77 of the Pre-Sl region is deleted, hollow particles that have lost the ability to recognize hepatocytes can be obtained. In addition, since the PreS2 region includes a site that recognizes hepatocytes via albumin! /, This albumin recognition site can also be deleted.

[0015] In the case of hollow bio-nanoparticles composed of hepatitis B virus protein or a protein capable of recognizing hepatocytes, such as L protein and M protein, it is not necessary to introduce a cell recognition site. On the other hand, a hollow bio-nanoparticle composed of a modified protein lacking the hepatocyte recognition site contained in amino acid residues 3 to 77 of the Pre-Sl region or a protein lacking both the PreSl and PreS2 regions. In this case, since cell recognition cannot be performed as it is, cell recognition sites can be introduced to recognize any cell other than hepatocytes, and the polymer / nucleic acid complex can be introduced into various target cells. Examples of such cell recognition sites for recognizing specific cells include cells and tissues such as cell function regulatory molecules, cell surface antigens, tissue-specific antigens, receptors, etc. composed of polypeptides such as growth factors and cytoforce-ins. Polypeptide molecules for identification, polypeptide molecules derived from viruses and microorganisms, antibodies, sugar chains and the like are preferably used. Specifically, antibodies against EGF receptor and IL 2 receptor that appear specifically in cancer cells, EGF, and receptors presented by HBV are also included. Alternatively, a protein capable of binding an antibody Fc domain (for example, a ZZ tag), a strept tag showing biotin-like activity to display a biorecognition molecule labeled with biotin via streptavidin, and the like can also be used.

[0016] When the cell recognition site is a polypeptide, a DNA encoding a hepatitis B virus protein or a variant thereof and a DNA encoding a cell recognition site, if necessary, a DNA encoding a spacer peptide A hollow bio-nanoparticle recognizing an arbitrary target cell can be obtained by linking it in frame, incorporating it into a vector or the like, and expressing it in a eukaryotic cell.

[0017] When the cell recognition site is an antibody, the DNA encoding the hepatitis B virus protein or a variant thereof and the DNA encoding the ZZ tag are optionally passed through the DNA encoding the spacer peptide. Connected in-frame and incorporated into a vector etc. The desired hollow bionanoparticles can be obtained by mixing the hollow bionanoparticles that are expressed in the vesicles and an antibody that can recognize the target cells.

[0018] When the cell recognition site is a sugar chain, it is obtained by linking a sugar chain capable of recognizing cells such as Sialyl Lewis X to a hollow bionanoparticle having no cell recognition ability using a glycosyltransferase. That's the power S.

[0019] The Pre-S (Pre_Sl, Pre_S2) of the HBsAg L protein plays an important role when HBV binds to hepatocytes. On the other hand, the S protein part has the ability to form a particle structure. S protein has transmembrane 1! 6 (& 113016011 ^ & 116 sequence, TM1 and TM2 from the N-terminal side) at 8-26 residue and 80-98 residue, C-terminal 156-226 residue In addition, it has a membrane interaction region that exhibits very high hydrophobicity. The region sandwiched between TM2 and the C-terminal hydrophobic region (99 to 154 residues of S protein) appears outside the HBsAg particle, and therefore there are many epitopes recognized by anti-HBsAg antibodies in this region. It is called major surface loop (hereinafter abbreviated as MSL) or major antigenic loop. An antibody recognition epitope is also mapped to the C-terminal hydrophobic region (156-226). When HBsAg L protein, HBsAg M protein, or HBsAg S protein is expressed in eukaryotic cells, the protein is synthesized and accumulated as a membrane protein on the endoplasmic reticulum membrane, and then aggregates between molecules, causing the endoplasmic reticulum membrane to While taking up, it is released as particles to the lumen side in the form of budding, and finally it is separated into the culture supernatant.

[0020] As a method for removing an antibody recognition site, it has been reported that antigenicity and immunogenicity can be attenuated by substituting amino acid residues corresponding to a specific major antigen epitope, but it has been reported at multiple sites over a wide range. Although it has little effect on other antigenic epitopes present, the possibility that the sequence after substitution mutation introduction shows antigenicity cannot be ruled out although it has weakened.

[0021] Therefore, as a result of examining the creation of hollow nanoparticles in which the sequences encoding these antibody recognition sites themselves were deleted as much as possible, 44 amino acids corresponding to almost the entire major hydrophilic region (105-148) And if necessary, (a) positions 101 to 104, (b) positions 149 to 154, (c) the absence of at least one amino acid from the C-terminal 71 (156-226) polypeptide of HBsA g. The HBsAg mutant combined with the loss can form particles and has a sufficiently high particle expression level. I put it out.

In the present invention, in addition to 105-148, part or all of 101-104 and 149-154 can be deleted, and a linker-amino acid / linker peptide can be introduced as necessary. Preferred linker lengths include 2 to 4 amino acids.

In the example of the present invention, a substitution sequence derived from a restriction enzyme site introduced for convenience of DNA construction (one amino acid (Gly (G)) on the N-terminal side and the C-terminal side on both sides of the MSL to be deleted) 2 amino acids Ser-Trp (SW); substitution of a total of 3 residues). In this case, when considering the linker sequence, the MSL (108_148) PD variant (MSL108-148 deficient PD linker insertion) is integrated into the MSL (107_150) GPDSW variant (MSL107- 150 deficient GPDSW linker purchase). Such substitution sequences derived from restriction enzyme sites that can be introduced on both sides of the linker can vary depending on the selection of restriction enzymes (sites), the nucleotide sequences on both sides of the deleted amino acid sequence, and the like.

[0023] As shown in FIG. 1, when MSL is deleted, TM2 (transmembrane helix 2) and the C-terminal hydrophobic region are linked. Between these two structures, we first stop the TM2 helix structure, pull its C-terminal part out of the membrane, and then turn to introduce a sequence that goes back into the membrane and connects to the C-terminal hydrophobic region. Is desirable.

[0024] The length of the linker is preferably exemplified by 2 to 4 residues because the so-called folded structure has 4 residues but may not be completely folded. Amino acids introduced as linkers include amino acid residues that break the helix (Gly, Pro, Asn, Tyr), amino acid residues that are many in the turn structure (^, Glv. Pro. ASP. Ser. Tro), membrane interface Examples include combinations of amino acid residues (Sl, As ^, Lys, His, Arg, Gki, Pro, Agn) that are difficult to stay (prone to go out of the membrane), and are not particularly limited. Specific examples include Pro-Asp (PD), Gln_Glu (QE), Pro-Asp-A sn-Gly (PDNG), Pro_Ser-Ser-Ser (PSSS), Pro_Lys, Asp-Pro, and the like.

[0025] In the present invention, the Cys residue contained in the S protein portion can be substituted with other amino acids such as Ser and Ala. Specifically, Cys at positions 76, 90, 107, 137, and 149 can be substituted with other amino acids such as Ser and Ala. Examples of preferred substitutions include Cys76 / Ala, Cys 90 / Ala, Cys 107 / Ser, Cys 137 / Ser, Cys 139 / Ser, Cys 149 / Ser, and Cys 221 / Ala. [0026] Non-Patent Document 1 describes the ability to delete S-protein 107-146 for its production efficiency, usefulness as a substance introduction agent, etc.! It is not listed. Rather, it has been described that the efficiency of gene transfer is reduced by this deletion. Non-patent literature l: 0'Malley B, Lazinski D. J Virol. 2002 Oct; 76 (19): 10060-3

[0027] In the present invention, 105-148 can be deleted with respect to the major antigen loop, and 101-104, 149-154 amino acids, and also the lack of the 54 amino acid residue region on the C-terminal side of the C-terminal hydrophobic region. Loss is possible. For example, deletion of the amino acid sequence (101-154) or (105-154) is particularly preferred. For the purposes of the present invention, the more deleted regions, the more desirable.

[0028] Proteins that constitute particles such as HBsAg mutant protein are linked to S protein directly or through a linker, or introduced into the PreS region by targeting a molecule that recognizes a specific cell. Substances can also be introduced specifically into tissues. Examples of such molecules that recognize specific cells include cell function regulatory molecules such as growth factors and cytokines, cell surface antigens, tissue-specific antigens, molecules for identifying cells and tissues such as receptors, Molecules derived from viruses and microorganisms, antibodies, sugar chains (eg, Sialyl Lewis X) and the like are preferably used. Specifically, it includes antibodies to EGF receptor and IL2 receptor that appear specifically in cancer cells, EGF, and receptors presented by HBV. Alternatively, a protein capable of binding an antibody Fc domain (for example, a ZZ tag), a strept tag showing biotin-like activity to display a biorecognition molecule labeled with biotin via streptavidin, and the like can also be used. These are appropriately selected according to the target cell or tissue. Cell recognition molecules can be introduced into HBsAg mutant proteins according to known methods!

[0029] Examples of the low antigenic particles of the present invention include those obtained by expressing HBsAg mutein in eukaryotic cells. The method for producing particles is described in Patent Documents 1 to 4, etc., and the preparation method for H BsAg is Vaccine. 2001 Apr 30; 19 (23-24): 3154-63 · Physicochemical an a immunological cnaractenzation or nepatitis B virus envelope particles exclusively c onsisting of the entire L (pre ~ Sl + pre ~ S2 + S) protein. Yamada T, Iwabuki H, anno T, Tanaka H, awai, Fukuda H, ondo A, Seno M, Tanizawa, uroda 5. (This is written. [0030] When the HBsAg mutant protein of the present invention is expressed in a eukaryotic cell, the protein is preferably expressed and accumulated as a membrane protein on the endoplasmic reticulum membrane and released as a nanoparticle. Examples of eukaryotic cells include animal cells such as mammals (for example, CHO cells), insect cells (such as expression systems using baculowinoles), and yeast. Such particles are extremely safe for the human body because they do not contain any HBV genome. Moreover, the cell selectivity of the nanoparticle of the present invention for hepatocytes or other cells can be enhanced by introducing a cell recognition molecule into at least a part of the protein constituting the particle as necessary.

Example

[0031] Embodiments of the present invention will now be described in more detail with reference to the accompanying drawings. Of course, the present invention is not limited to the following examples. It goes without saying that various aspects are possible.

[0032] In Fig. 1 below, HBsAg represents hepatitis B virus surface antigen (H mark atitis B virus surface Antigen) which is a coat protein of HBV. HBsAg contains an S protein composed of 226 amino acids. M protein has 55 amino acids (Pre_S2 peptide) added to the N-terminal side of S protein, and L protein has 108 or 119 amino acids (PreSl p-marked tide) added to the N-terminal side of M protein ( The addition of 108 amino acids is shown in Figure 1). In the following examples, as a L protein, a secretory signal sequence was added to the N-terminus, and a protease-sensitive sequence IJ (six amino acids at positions 152-157 of SEQ ID NO: 45) in the PreS2 region was removed. I used something.

Example 1 · Construction of major surface loop (MSL) -deficient L protein expression vector

(1) Construction of an HBsAg L protein expression plasmid with a detection FLAG tag sequence added to the C-terminus

Prior to the creation of the MSL deletion mutant, an L protein was prepared by fusing a C-terminal detection epitope tag sequence. That is, the plasmid pB0747 for animal expression of a mutant (L-d54-FLAG) in which the C-terminal 54 amino acids of the wild-type L protein were deleted and the FL AG tag sequence was fused was cleaved with Xho I and the FLAG-tag sequence twice The plasmid pB0982 for expression of the protein (L-d54-3xFLAG) in which the FLAG-tag sequence was fused three times was constructed by inserting and ligating the synthetic DNA (SEQ ID NO: 1 & 2). Furthermore, using the obtained plasmid pB0982 as a cage, L-d54_3xFLAG A plasmid pB0851 for expressing a mutant (M6_d54-3xFLAG) in which 6 of 13 Cys residues in the S region of the protein were replaced with Ser residues or Ala residues was constructed. Specifically, substitution mutations of Cys76 / Ala, Cys 90 / Ala, Cys 107 / Ser, Cys 137 / Ser, Cys 139 / Ser, Cys 147 / Ser, and Cys 149 / Ser were introduced. The subsequent amino acid sequence numbers are the S protein sequence numbers.

[0034] (2) Construction of MSL-deficient L protein expression vector

Using the above-mentioned plasmid pB0851 for M6_d54-3xFLAG expression as a saddle type, site-directed mutagenesis using synthetic DNA SEQ ID NOs: 3 & 4 (Table 1), the restriction enzyme Apal site was introduced into the Cysl07 residue equivalent position. Furthermore, by using synthetic DNA SEQ ID NOs: 5 & 6 (Table 1)! /, Repeated site-specific mutagenesis was performed to obtain plasmid PBO900 in which the restriction enzyme PvuII site was introduced at the position corresponding to Cysl49 residue. . After cutting this pBO900 with restriction enzymes Apal and PvuII, the synthetic DNA 4 strands of IJ numbers 7 & 8, 9 & 10, 11 & 12, and 13 & 14 shown in Table 2 were inserted and ligated, respectively. Delete residues 108-148 of the protein and use Pr 0- Asp (PD), Gin- Glu (QE), Pro- Asp-Asn_Gly (PDNG), or Pro- Ser- Ser- Ser ( 4 MSL deletion L protein variants (MSL (108_148) / QE-d54, MSL (108-148) / PD-d54, MSL (108-148) / PDNG_d54, or MSL) (108-148) / PSSS_d54) Expression vectors (pBO940, pB0941, pB0942, pB0943) were constructed.

[0035] Similarly, the above-mentioned MSL (108_148) / PD-d54 expression plasmid pB0941 is a saddle type, and site characteristics using 3 sets of synthetic DNAs shown in Table 1, SEQ ID NOs: 15 & 16, 17 & 18, or 19 & 20. By introducing the second restriction enzyme Apal site into the position corresponding to Leu98, TyrlOO, and Glyl02, respectively, by introducing different mutations, the resulting plasmid DNA was cleaved with Apal and recombined, so that the S protein MSL Three MSL deletion L proteins (MSL (99) with deletion of residues 99-148, 101-148, or 103-148, respectively, and a PD linker sequence inserted. -148) / PD-d54, MSL (101-148) / PD_d54, MSL (103_148) / PD-d54) expression vectors (pB0987, pB0989, pB0991) were constructed.

[0036] Further, site-directed mutagenesis using synthetic DNA SEQ ID NOs: 21 & 22 shown in Table 1 should be added to the plasmid DNAs pB0987, pB0989, pB0991, and pB0941 prepared above! To introduce a restriction enzyme PvuII site into the Serl55 residue equivalent position. Obtained plus After cleaving the DNA with restriction enzymes Apal and PvuII, the synthetic DNA SEQ ID NOs: 9 and 10 in Table 2 were inserted and ligated, so that residues 99-154, 101-154, and 103- A total of four MSL-deleted L proteins (MSL (99_154) / PD-d54, MSL (101-154)) with 154 residues or residues 108-154 deleted and a PD linker sequence inserted. / PD_d54, MSL (103_154) / PD-d54, MSL (108_154) / PD-d54) expression vectors (pB0995, pB0997, pB0999, BO1003) were constructed.

[0037] Furthermore, the above-mentioned plasmids for expression of MSL (108_148) / PD-d54 and MSL (108_154) / PD-d54 (pB0941, pBO1003) were used as a saddle type, and the synthetic DNA sequence numbers 21 & 22 shown in Table 1 were used. By deleting three residues (Prol05, Vail 06, Glyl07 residues) by site-specific mutagenesis, residues 105-148 or 105-154 of S protein were deleted, Construction of two MSL-deleted L proteins (MSL (105_148) / PD-d54, MSL (105_154) / PD-d54) expression vectors (ρΒ0993, ρ 各々), each of which incorporates PD linker IJ did.

[0038] It should be noted that other mutant HBsAg included in the present invention can be obtained by replacing the synthetic DNA used for site-directed mutagenesis by the same method as described above.

[0039] Table 3 shows the name of the MSL-deleted L protein expression vector constructed as described above, the name of the encoded MS L-deleted L protein, and the amino acid sequence around the deletion site.

[0040] Example 2

(1) Expression of MSL-deficient L protein particles by animal cells

The monkey kidney-derived cell line COS 7 was cultured in Danolebecko's modified Eagle's medium (DMEM) containing 5% ushi fetal serum (FBS) in the presence of 37 ° C and 5% C02. COS7 cells were suspended in 10% FBS-containing DMEM so as to have lxlO ⁵ cells / ml, seeded in 2 ml in 3.5 cm dishes, and cultured for 14 to 16 hours. After mixing DMEM 95 1 and the transfection reagent FuGene6 (Roche Diagnostics) 41 in a 1.5 ml tube, each MSL-deleted L protein expression plasmid DNA constructed in Example 1 (1 μg / 1 solution) 1 μl) was added and mixed. After leaving at room temperature for 15 minutes to form a complex, the entire amount was added to the COS7 cells. After culturing for 14 to 16 hours, the medium was replaced with 1.5 ml of serum-free medium CHO-S-SFMII (Invitrogen), and further cultured for 2 days, and then the culture supernatant and cells were collected.

[0041] (2) MSL-deficient L particles by enzyme immunoassay (FLAG-ELISA) using anti-FLAG antibody Quantitative

Enzyme immunization using mouse anti-FLAG M2 antibody (Sigma) in solid phase and biotinylated anti-FLAG M2 antibody (Sigma) and horse radish peroxidase (HRP) labeled streptavidin (Prozyme) in liquid phase The concentration of MSL-deleted L particles in the culture supernatant or cell extract was measured by the measurement method (FLAG-ELISA). TBS (150 mM NaCl, 10 mM Tris-HCl, pH 7.5) containing 1% ushi serum albumin (BSA) was used to dilute the test sample, liquid phase antibody, and liquid phase label. TBS containing 5% skim milk was used for blocking. A 0-phenylenediamine solution (0.4 mg / ml o_phenylenediamine, 23 mM citrate, 51.4 mM Na2HP04, 0.0012% H 2 O 2) was used as the HRP substrate, and quantified by measuring the absorbance at 495 nm. Wild-type L particle-expressing COS7 cell culture supernatant was used as a negative control, and L-d54-3xFLAG particle-expressing COS7 cell culture supernatant was used as a positive control.

[0042] Tables 4 and 5 show the results of measuring each of the collected MSL-deleted L protein-expressing COS7 cell culture supernatants by 2-fold to 4-fold dilution and measuring by the above FLAG-ELISA. When comparing the effects of insertion linker sequences in MSL (108_148) deletions (Table 4), 2 amino acid residue insertion type (QE, PD) rather than 4 amino acid residue insertion type (PSSS, P DNG) ) Had more particle secretion. When comparing the MSL deletion region in the PD insertion type (Table 5), the MSL (105_154) deletion L protein showed the highest particle secretion (1.65 times that of WT-d54-3xFLAG). On the other hand, the secreted amounts of MSL (99_148) and MS U99-154) -deleted L protein and MSL (108_148) and MSL (108-154) -deleted L protein were low. Others showed 59-108% particle secretion of WT-d54-3xFLAG.

Example 3 Reactivity of MSL-deficient L particles with anti-HBsAg antibody

(l) Detection with HBsAg diagnostic kit

The IMX HBsAg Atsy system (Dynabot) is an automated HBsAg measurement system based on an enzyme immunoassay using mouse anti-HBsAg monoclonal antibody, biotinylated anti-HBsAg polyclonal antibody and alkaline phosphatase (AP) -labeled anti-biotin antibody. Yes, it is used for blood diagnosis of HBV infection. Using this system, the reactivity of various MSL-deleted L particles secreted into the culture supernatant and anti-HBsAg antibody was measured. MS recovered L-depleted L protein expression COS7 cell culture supernatant was diluted with Dulbecco's phosphate buffer (PBS) containing 1% FBS and measured. As a result, V and misplaced MSL-deleted L particles were also determined to be HBsAg-negative. (Tables 4 and 5). Therefore, the anti-HBs Ag antibody response value per L particle amount of the MSL mutant that showed good particle secretion was 1 to 4% or less of L-d54-3xFLAG, and anti-HBsAg antibody reactivity due to MSL deletion Was significantly reduced.

[0044] (2) Detection by Western blotting

The collected M6_d54-3xFLAG particle-expressing COS7 cells or MSL-deficient L protein expressing COS7 cells were subjected to SDS-polyacrylamide gel electrophoresis and then transferred to a PVDF membrane. After blocking PV DF membrane with 5% skim milk, analysis using biotinylated anti-FLAG M2 antibody or biotinylated anti-HBsAg polyclonal antibody (Dynabot MX HBsAg Atsy system liquid phase antibody) and HRP-labeled streptavidin (Figure 3). M6_d54-3xFL AG showed a clear band around 40 kDa when detected with anti-FLAG antibody and with anti-HB sAg antibody. However, the MSL-deleted L protein mutants (MSL (108-148) / QE-d54 and MSL (108_148) / PD-d54) detected a clear band with anti-FLAG antibody, but with anti-HBsAg antibody Was not detected, indicating decreased reactivity to goat anti-HBsAg polyclonal antibody.

More extensive deletion region, MSL (105_152) / PD-d54, MSL (105_154) / PD-d54 is more reactive to goat anti-HBs polyclonal antibody than MSL (105-148) / PD-d54 (Figure 4, Table 1).

[0045] [Table 1]

[0046] (3) Reactivity with human anti-HBsAg serum

Hebsbrin (Wuerfid) is an anti-HB sAg human immunoglobulin product prepared from sera of anti-HBsAg antibody positive patients. Whether this human anti-HBsAg polyclonal antibody recognizes MSL-deficient L particles by Western blotting and enzyme immunoassay. taking measurement.

[0047] First, L-d54-3xFLAG protein-expressing COS7 cells or MSL-deficient L protein SL (105_154) / PD-d54] -expressing COS7 cells were subjected to SDS-polyacrylamide gel electrophoresis and then transferred to a PVDF membrane. After blocking the PVDF membrane with 5% skim milk, it is reacted with a herbsulin solution, and further detected with an HRP-labeled-anti-HgG (H + L) antibody. The PVDF membrane is then reprobed with biotinylated anti-FLAG antibody and HRP-labeled streptavidin. As a result, biotinylated anti-FLAG antibody reacts with L-d54-3xFLAG and MSL-deficient L protein to the same extent and shows a clear band around 40 kDa. However, hebsbrin (human anti-H BsAg polyclonal antibody) reacts with L-d54-3xFLAG and reacts little with MSL-deleted L protein.

[0048] L-d54-3xFLAG particle expression COS7 cells or MSL-deficient L protein [MSL (105_154) / PD-d54] expression COS7 cell culture supernatant was added with anti-FLAG antibody-agarose gel (Sigma), 4 After reacting at ° C, recover the agarose gel. The obtained gel is washed with TBST (0.1% Tween 20, 150 mM NaCL, lOmMTris-HCl buffer ρΗ7.5), and then TBST containing 5% skim milk is added and reacted at 4 ° C for 2 hours. After washing with TBST, add hebrin solution and react at 4 ° C for 2 hours. After washing with TBST, AP labeled anti-HgG (H + L) antibody is further added and allowed to react at room temperature for 1 hour. After collecting and washing the agarose gel, add 200 L of AP chromogenic substrate solution (CDP-star, New England BioLabs) to the precipitate, suspend well, and measure AP activity with a noreluminometer. As a result, the reaction between MSL-deficient L particles and hebusulin (human anti-HBsAg polyclonal antibody) is significantly lower than that with L-d54-FLAG particles.

[0049] (4) Reactivity with anti-HBsAg antibody for protection against human infection

WT-d54-3xFLAG particle-expressing COS7 cells are available! /, Is an MSL-deleted L protein [MSL (105-154) / PD-d54] -expressing COS7 cells solubilized with l% TritonX-100-PBS It was diluted with 1% FBS-TBS (150 mM NaCl, 50 mM Tris_HCl buffer ρΗ5 · 5). This was measured by an enzyme immunoassay using an anti-FLAG antibody as a solid phase and a human anti-HBsAg antibody (Hevesbulin) and an HRP-labeled anti-HgG antibody (Prozyme) in the liquid phase. As a result, WT -d54-3xFLAG showed a binding reaction with an absorbance of 0.051 when 9 ng particles were added, but MSL (105_154) / PD-d54 had a detection limit. It was below the boundary (negative control Cos7 cell extract).

[0050] (5) Detection with HBsAg subtype diagnostic antibody

Anti-HBs antigenic determinant d Monoclonal antibody (Special Immunology Laboratories) or anti-HBs antigenic determinant r Monoclonal antibody (Special Immunology Laboratories) in solid phase, biotinylated anti-FLAG M2 antibody and HRP-labeled streptavidin MSL-deficient L protein-expressing Cos7 cell culture supernatants were measured using the enzyme immunoassay used for the phases (subtype d-ELISA and subtype r-ELISA, respectively). Anti-subtype d monoclonal antibody reactivity of MSL (105_152) / PD-d54 particles and MSL (105_154) / PD-d54 particles is 1-3% of WT-d54-3xFLAG particles, anti-subtype r Monoclonal antibody reaction Sex dropped to 13-14%.

[0051] [Table 2] Types of anti-HBsAg antibodies Relative reactivity (% to WT) ^a)

MSL (105-152) / PD MSL (105-154 / PD)

HBsAg diagnostic kit _EIA ^b ) 1.0 0 0. 2 1. 7 Sat 0.3 subtype d -ELISA ^c) 1.3 3 0. 9 3. 2 Sat 2. 0 subtype r-ELISA ^d) 12. 8 people 2. 6 14. 4 ± 2. 9

[0052] a) WT_d54_3xFLAG, MSL (105_152) / PD-d54, with the same particle concentration by FLAG-ELISA,

MSL (105_154 / PD) -d54 sample was measured by each ELISA, and the reactivity to each antibody (reaction value per particle amount (absorbance)) was calculated. The relative reactivity of each mutant to the reactivity of WT-d54-3xFLAG is shown.

b) Dynabot Mx-HBsAg kit; mainly recognizes common antigenic determinant a.

c) Reactivity detection with anti-HBs monoclonal antibody (antigenic determinant d) and anti-FLAG antibody. (Epitope in the defect area.)

d) Reactivity detection with anti-HBs monoclonal antibody (antigenic determinant r) and anti-FLAG antibody. (Epitope is adjacent outside the defect area.)

Example 4 Mass preparation of MSL-deficient L particles

All of the MSL-deleted L protein expression vectors constructed in Example 1 are the L protein C A FLAG-tag for detecting the expressed protein is added to the end. Therefore, first, FLAGtag added to the C-terminus of MSL-deleted L protein by site-directed mutagenesis using MSL-deleted L protein [MSL (105_154) / PD-d54] expression vector and synthetic DNA SEQ ID NO: 25 & 26 A stop codon is inserted in front of the sequence to construct a vector pBO1077 for expressing the absence of the C-terminal FLAGtag sequence and the MSL-deleted L protein [MSL (105_154) / PD-d54]. By inserting the obtained MSL-deleted L protein gene downstream of the GLD promoter of plasmid pGLDLIIP39_RcT for yeast expression described in J. Biol. Chem. Vol. 267 (3) pl953_1961 (1992) The L protein [MSL (105_154) / PD-d54] expression vector pBO1077 is constructed. This was introduced into the Sac charomyces serevisiae AH22R strain, and transformant colonies were selected according to leu requirements. Among the obtained transformant clones, select a clone with high expression of MSL-deleted L particles. The obtained high expression strain was mass-cultured in the same manner as wild-type HBsL particles, and the ultracentrifugation method described in J. Biol. Chem. Vol. 267 (3) pl953-1961 (1992) Purify the MSL-deficient L particles using.

[0054] Example 5 Antibody Inducibility of MSL-Deleted L Particles

Dissolve 100 g of purified MSL-deficient particles or wild-type particles in 0.2 ml of Dulbecco's phosphate buffered saline (PBS). This is administered 5 times every 2 weeks to the tail vein of four 6-week-old female BALB mice. Two weeks after the administration of the particles, blood is collected from each mouse to obtain serum. For the serum obtained, the induction of antibodies against wild-type L particles and MSL-deleted L particles was measured by the method shown in Reference Example 1 according to Vaccine Vol.19 (23-24) p.3154-3163 (2001).疋.

[0055] In the wild-type L particle-administered mouse antiserum, antibodies against wild-type L particles are strongly induced from 6 weeks after the first administration. In antisera of mice administered with MSL-deleted L particles, antibodies against wild-type L particles and MSL-deleted L particles are hardly detected.

[0056] Reference Example 1 Enzyme-linked immunosorbent assay for antibodies to wild-type L particles and MSL-deficient L particles

In the enzyme immunoassay for anti-wild-type L particle antibody, first, the purified wild-type L particle was dissolved in PBS to a concentration of 20 g / ml, and then dispensed into a 96-well plate at 100 1 / well, at 4 ° C Soot was adsorbed. After washing with PBS containing 0.05% Tween 80 (PBST), 150% PBS containing 5% Block Ace (snow mark) was dispensed and stored at 4 ° C. Mouse antiserum for dilution (containing 10% FBS) Diluted 20 times to 20,000 times with PBST), added to each well, and allowed to react at room temperature for 2 hours. After washing with PBST, add HRP-labeled-spig mouse IgG (H + L) antibody diluted 5000-fold with the dilution solution, and incubate for 2 hours at room temperature. After washing with PBST solution, substrate solution (0.4mg / ml _0- phenylenediamine, 23mM citrate, 51.4mM Na2HP04, 0.0012% HO) was added for 50μ1 and allowed to react for 30 minutes. Stop the reaction with 2Μ H 2 SO and absorb at 495 nm

twenty four

Measure the degree.

[0057] In the enzyme immunoassay for anti-MSL-deficient particle antibody, first, purified MSL-deficient particles were dissolved in PBS to a concentration of 20 μg / ml, and then poured into a 96-well plate at 100 1 / well. Adsorb at ~ ° C. Thereafter, mouse antibodies bound to the MSL-deleted L particles are detected by the same operation as the above-described enzyme immunoassay for anti-wild type HBsAgL particle antibodies.

[0058] [Table 3]

Table 3. Synthetic DNA List for Restriction Enzyme Introduction / Deficiency Introduction Sequence ID Reference Number Sequence Comment

3 975 GGTATGTTGCCCGTGGGCCCTCTACTTCC Apal size at107

4 976 GGAAGTAGAGGGCCCACGGGCAACATACC

5 977 GGACGGAAACAGCACCAGCTGGCCCATCCCATCATCC Pvull size at149

6 978 GGATGATGGGATGGGCCAGCTGGTGCTG I I I CCGTCC

15 1117 CTTGTTGGTTCTGGGCCCCTACCAAGGTATGTTGCCC Apal size at98

16 1118 GGGCAACATACCTTGGTAGGGGCCCAGAACCAACAAG

17 1119 GTTGGTTCTTCTGGAGGGCCCAGGTATGTTGCCCG Apal site at101

18 1120 CGGGCAACATACCTGGGCCCTCCAGAAGAACCAAC

19 1121 CTTCTGGACTACCAGGGCCCGTTGCCCGTGGG Apal site at108

20 1122 CCCACGGGCAACGGGCCCTGGTAGTCCAGAAG

21 1115 CTGGCCCATCCCATCCAGCTGGGC I I I CGC Pvull site at155

22 1116 GCGAAAGCCCAGCTGGATGGGATGGGCCAG

23 1123 CTGGACTACCAAGGTATGGGCCCAGACTCCTGGCCCATCCC For 105-107 defect

24 1124 GGGATGGGCCAGGAGTCTGGGCCCATACCTTGGTAGTCCAG

25 1207 G i l l CTCCTGGCTCTAGGGTGGCTCGAG stop For codon introduction

26 1208 CTCGAGCCACCCTAGAGCCAGGAGAAAC

Table 4. Synthetic DNA for linker insertion

Sequence number Reference number Array Comment

1 965 TCGAGTGACTACAAAGACCATGACGGTGATTATAAAGATCATGAC 2XFLAG insertion linker

2 966 TCGAGTCATGATCTTTATAATCACCGTCATGGTCTTTGTAGTCAC

7 1043 AGGAGTC QE insertion

8 1044 GACTCCTGGCC

9 1045 CAGACTC For PD insertion

10 1046 GAGTCTGGGCC

11 1047 CAGATAACGGTTC PDNG insertion

12 1048 GAACCGTTATCTGGGCC

13 1049 CATCCTCCTCCTC PSSS insertion

14 1050 GAGGAGGAGGATGGGCC

] (^ 0061

Table 5 MSL-deleted L protein expression plasmid

Plasmid Protein Amino acid Sequence (90th-160th residue of S protein)

Expression vectors for animal cells 90 107 149 160

... UFLL VLLDY QGMLPVCPLL PGTSTTSTGP CKTCTIPAQG TS FPSCCCT KPSDGNCTCI pB0441 L protein (WT) P \ PSS ^ lAFAR ...

... UFLL VLLDY QGMLPVCPLL PGTSTTSTGP CKTCTIPAQG TSMFPSCCCT KPSDGNCTCI pB0982 WTd54-3xFLAG P \ PSSIA / AFAR ...

... UFLL VLLDY QG LPVSPLL PGTSTTSTGP SKTSTIPAQG TS FPSSCST KPSDGNSTSI pB0851 6d54-3xFLAG P \ PSS I \ AFAR ...

(MSL deletion mutants with 3xFLAG-tag)

pBO940 MSL (108-148) / QE-d54 .UFLLVLLDY QGMLPVGQES \ NP \ PSS AFA R ..

pB0941 MSL (108-148) / PD-d54 ... UFLLVLLDY QG LPVGPDS WPIPSSH ^ F ^ R ...

pB0942 MSL (108-148) / PDNG-d54 ... UFLLVLLDY QGMLPVGPDN GSWPIPSS WA FAR ..

e.B0943 MSL (108-148) / PSSS-d54 ... UFLLVLLDY QG LPVGPSS SSWPIPSS i 4 FAR ...

pB0993 MSL (105-148) / PD-d54 ..ilFLLVLLU ^ QQ GPDSWP \ P WAFAR ...

pB0991 MSL (103-148) / PD-d54 • "UFLLVU Y QGPDSWPIPS SWAFAR ...

pB0989 MSL (101-148) / PD-d54 .. 丄 IFLL VLLEG PDSWPIPSS ίΦΤ? ...

pB0987 MSU99-148) / PD-d54 ... LIFLL VLQPO SWPIPSS H ^ ^ ...

PBO1003 MSL (108-154) / PD-d54 ... UFLL VLLDY QGMLPVGPDS WAFAR ..

pBO1001 MSL (105-154) / PD-d54 ... UFLL VLLDY QGMGPDS iA ^ AFAR ...

pB0999 MSL (103-154) / PD-d54 ... UFLLVLLDY QGPDS Ι / AFAR ...

pB0997 MSL (101-154) / PD-d54 ... UFLLVUEG PDS i l / AFAR ...

pB0995 MSLj99-154) _ / PD-d54 ... UFLLVLQPD S WAFAR ...

(MSL deletion mutants without 3xFLAG-tag)

pBO1056 MSL (101-154) / PD-d54 .LIFLL EG PDS WAFAR .. (without 3xFLAG) _

Expression vector for yeast (MSL deletion mutant without 3x FLAG-tag)

― PBO1077 SL (101-154) / PD-d54 ... LIFLL VLLEG PDSWAFAR .. (without 3xFLAG)

1) MSL deletion mutants: MSL ([deletion region]) / [linker sequence] -d [number of C-terminal deletion residues]

2) Italic letters: Hydrophobic region (lipid bilayer binding site), underline: Substituent mutation residue due to linker sequence and restriction enzyme introduction, Standard characters: major surface loop (MSL) site

] [^ A0060 Particle secretion and HBs antigenicity of MSL-deficient mutants (1)

HBsAg mutant Particle secretion concentration (A405) HBsAg concentration (RATE)

M6d54-3xFLAG 0.313 12.6

MSL (l08-148) / QE-d54 0.336 7.2

MSL (l08-148) / PD-d54 0.297 9.0

MSL (l08-148) / PSSS-d54 0.144 5.0

MSL (l08-148) / PDNG-d54 0.131 5.0

a) The COS7 cell culture supernatant was diluted 2-fold, and the amount of particles was measured by FLAG-ELISA. Absorbance at 405 nm when measured using a diluted solution as blank was shown.

b) The COS7 cell culture supernatant was diluted 2-fold and the amount of HBsAg was measured using the IMx-HBsAg kit. The value obtained by subtracting the RATE value of the negative control solution included in the kit from the measured value (RATE value) of each sample is shown. At this time, HBsAg was determined to be negative for RATE 6.0 or lower. [Table 7]

Table 7 A. Particle secretion and HBs antigenicity of MSL-deficient mutants (1)

HBsAg mutant Particle secretion concentration

(ng / ml)

WT (26.4)

WTd54-3xFLAG 20.8

MSL (99-148) / PD-d54 7.2 ± 1.3

MSL (l01-148) / PD-d54 12.2 ± 3.4

MSL (l03-148) / PD-d54 13.5 ± 5.1

MSL (l05-148) / PD-d54 22.5 ± 5.1

MSL (l08-148) / PD-d54 8.5 ± 2.2

MSL (99-154) / PD-d54 8.1 ± 2.2

MSL (l01-154) / PD-d54 13.9 ± 5.0

MSL (l03-154) / PD-d54 13.9 ± 5.7

MSL (l05-154) / PD-d54 34.3 ± 3.9

MSL (l08-154) / PD-d54 7.4 ± 1.3 Table 7 B. Particle secretion and HBs antigenicity of MSL-deficient mutants (1)

HBsAg mutant HBsAg concentration HBsAg 1 particle ratio

(RATE) (WT = 100%)

WT 229 100

WTd54-3xFLAG 180 100

MSL (99-148) / PD-d54 1.7 ± 0.1 3.9

MSL (l05-148) / PD-d54 1 ± 1 ± 0 ・ 7 1.1

MSL (l08-148) / PD-d54 0.7 ± 0.3 1.0

MSL (99-154) / PD-d54 1.9 ± 0.1 7.6

MSL (l05-154) / PD-d54 2.3 ± 0.5 1.5

A) Purified WT granule from yeast with known protein concentration. Using WTd54-3xFLAG culture supernatant as the standard sample, determine the particle concentration (ng / ml) of the WTd54-3xFLAG culture supernatant using the IMx-HBsAg kit, and use the WTd54-3xFLAG culture supernatant as the standard sample. The particle concentration (ng / ml) of each mutant culture supernatant was measured by FLAG-ELISA. The secretory particle concentration of the WT particle culture supernatant was measured with the IMx-HBsAg kit.

B) The culture supernatant of each mutant was diluted 2-fold, and the amount of HBsAg was measured using the IMx-HBsAg kit. The value obtained by subtracting the measured value (RATE) of the Cos7 culture supernatant from the measured value (RATE) of each sample is shown. Samples with a negative control solution supplied with the kit that are twice the RATE value (RATE = 2) or less are usually judged negative for HBsAg.

Claims

The scope of the claims

[1] A human hepatitis B virus surface antigen protein (HBsAg) containing an S polypeptide portion is characterized by lacking at least amino acids at positions 105 to 148 of the S polypeptide portion. A modified HBsAg protein.

[2] The HBsAg protein variant according to [1], wherein the HBsAg protein variant further comprises a cell recognition moiety.

[3] The HBsAg protein variant according to claim 1, further comprising at least one deletion of the following (a) to (c) in the S polypeptide portion:

(a) a deletion of at least one amino acid from position 101 to 104;

(b) a deletion of at least one amino acid at positions 149-154,

[4] HBsAg protein modification strength In addition to the S polypeptide portion, it contains a non-cell recognition site or part of the PreS portion, and further, a hepatocyte recognition portion derived from the PreS portion, antibody, growth factor, cyto force 2. The HBsAg protein variant according to claim 1, comprising at least one cell recognition moiety selected from the group consisting of: a cell surface antigen, a tissue-specific antigen, a receptor, a molecule derived from a virus and a microorganism, and a sugar chain.

[5] The modified HBs Ag protein according to claim 1, which has a linker peptide at a deletion site including positions 105 to 148.

6. The modified HBsAg protein according to claim 5, wherein the linker peptide consists of 2 to 4 amino acid residues.

[7] Linker peptide has amino acid residues that break the helix (Gly, Pro, Asn, Tyr), amino acid residues that are many in the turn structure (Asn, Gly, Pro, Asp, Ser, Trp), and hardly stays at the membrane interface 6. The modified HBsAg protein according to claim 5, comprising a combination of amino acids selected from the group consisting of amino acid residues (Glu, Asp, Lys, His, Arg, Gin, Pro, Asn).

[8] The HBsAg protein variant according to claim 5, wherein the linker peptide is PD, QE, PSSS or PDNG.

[9] An HBsAg hollow particle comprising the HBsAg protein variant according to any one of claims 1 to 8 as a constituent element.

[10] An transformed vector obtained by introducing an expression vector containing a gene encoding the HBsAg protein variant according to any one of claims 1 to 8 into a eukaryotic cell, and transforming the cell. A method for producing HBsAg particles, wherein the HBsAg particles according to claim 9 are collected.

[11] Inside the HBsAg hollow particle according to claim 9, at least 1 selected from the group consisting of DNA, RNA, protein, lipid, carbohydrate, labeling substance, drug, and physiologically active substance that can function in a cell. A substance carrier with a seed substance.