WO2008014410A2 - Zimlig2 polynucleotides and polypeptides and methods of use - Google Patents

Zimlig2 polynucleotides and polypeptides and methods of use Download PDF

Info

Publication number
WO2008014410A2
WO2008014410A2 PCT/US2007/074509 US2007074509W WO2008014410A2 WO 2008014410 A2 WO2008014410 A2 WO 2008014410A2 US 2007074509 W US2007074509 W US 2007074509W WO 2008014410 A2 WO2008014410 A2 WO 2008014410A2
Authority
WO
WIPO (PCT)
Prior art keywords
seq
zimlig2
amino acid
cells
isolated polypeptide
Prior art date
Application number
PCT/US2007/074509
Other languages
French (fr)
Other versions
WO2008014410A3 (en
Inventor
Paul O. Sheppard
Robert R. West
Michael R. Stamm
Mark W. Appleby
Janine Bilsborough
Penny J. Thompson
Kathleen M. Walker
Original Assignee
Zymogenetics, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Zymogenetics, Inc. filed Critical Zymogenetics, Inc.
Publication of WO2008014410A2 publication Critical patent/WO2008014410A2/en
Publication of WO2008014410A3 publication Critical patent/WO2008014410A3/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the immune system is the body's natural defense against a host of diseases.
  • a healthy immune system reacts against harmful pathogens, and failure of an immune system to respond appropriately can result in unchecked infection, disease, or growth of tumor cells.
  • Putting immunotherapy into practice is a highly desired goal in the treatment of such human diseases.
  • T cells possess complex and subtle systems for controlling their interactions, utilizing numerous receptors and soluble factors for the process. Thus there is a need to produce such agents that can enhance T cell proliferation.
  • the present invention provides a Zimlig2 protein and a novel use of Zimlig2 to enhance the immune response, to regulate inflammation, enhance T cell proliferation, enhance tumor killing or rejection and other uses that should be apparent to those skilled in the art from the teachings herein.
  • the present invention provides an isolated polypeptide consisting of an amino acid sequence having at least 90% identity to amino acid residues 71 to 148 of SEQ ID NO:2, truncated Zimlig2.
  • the present invention provides an isolated polypeptide comprising residues 71 through 148 of SEQ ID NO:2.
  • the present invention provides an isolated polypeptide consisting of residues 71 through 148 of SEQ ID NO:2.
  • the isolated polypeptide consisting of residues 71 through 148 of SEQ ID NO:2 may encompass modifications.
  • the present invention provides an isolated polypeptide comprising the amino acid residues of SEQ ID NO:5.
  • the present invention provides an isolated polypeptide consisting of the amino acid residues of SEQ ID NO:5.
  • the present invention provides an 11 KDa isolated mature polypeptide consisting of an amino acid sequence having at least 90% identity to amino acid residues 32 to 148 of SEQ ID NO:2.
  • the present invention provides an isolated polypeptide comprising residues 32 through 148 of SEQ ID NO:2.
  • the present invention provides an isolated polypeptide consisting of residues 32 through 148 of SEQ ID NO:2.
  • the isolated polypeptide consisting of residues 32 through 148 of SEQ ID NO:2 may encompass modifications.
  • between one and six of the amino acid residues at positions 114, 115, 118, 123, 145, and 148 of SEQ ID NO:2 are tyrosine residues.
  • between one and six of the tyrosine residues at positions 114, 115, 118, 123, 145, and 148 of SEQ ID NO:2 are modified.
  • between one and six of the tyrosine residues at positions 114, 115, 118, 123, 145, and 148 of SEQ ID NO:2 are modified by sulfation.
  • between one and six of the tyrosine residues at positions 114, 115, 118, 123, 145, and 148 of SEQ ID NO:2 are modified by phosphation.
  • between one and six of the tyrosine residues at positions 114, 115, 118, 123, 145, and 148 of SEQ ID NO:2 are modified by sulfation or phosphation.
  • the amino acid residues at positions 123, 145, and 148 of SEQ ID NO:2 are tyrosine residues, and one or more of the amino acid residues at positions 114, 115, and 118 of SEQ ID NO:2 are tyrosine residues.
  • the tyrosine residues at positions 123, 145, and 148 of SEQ ID NO:2 are modified, and one or more of the tyrosine residues at positions 114, 115, and 118 of SEQ ID NO:2 are modified.
  • the modification to the tyrosine residues at positions 123, 145, and 148 of SEQ ID NO:2 is sulfation, and the modification to one or more of the tyrosine residues at positions 114, 115, and 118 of SEQ ID NO:2 is sulfation.
  • the modification to the tyrosine residues at positions 123, 145, and 148 of SEQ ID NO:2 is a phosphation
  • the modification to one or more of the tyrosine residues at positions 114, 115, and 118 of SEQ ID NO:2 is a phosphation
  • the amino acid residues at positions 123, 145, and 148 of SEQ ID NO:2 are tyrosine residues.
  • the tyrosine residues at positions 123, 145, and 148 of SEQ ID NO:2 are modified.
  • the modification to the tyrosine residues at positions 123, 145, and 148 of SEQ ID NO:2 is sulfation.
  • the modification to the tyrosine residues at positions 123, 145, and 148 of SEQ ID NO:2 is phosphation.
  • the amino acid residue at position 142 of SEQ ID NO:2 is a serine.
  • the amino acid residue at position 142 of SEQ ID NO:2 is modified.
  • the serine residue at position 142 of SEQ ID NO:2 has an O-glycosylation.
  • the serine residue at position 142 of SEQ ID NO:2 is linked to a carbohydrate epitope such as Sle x (sialyl lewis x oligosaccharide) or another sialyl lewis.
  • the amino acid at position 71 of SEQ ID NO:2 is a glutamine.
  • the amino acid at position 71 of SEQ ID NO:2 is pyroglutamine.
  • the amino acid residues at positions 123, 145, and 148 of SEQ ID NO:2 are sulfated tyrosine, and the amino acid at position 142 of SEQ ID NO:2 has an O- glycosylation.
  • the amino acid residues at positions 123, 145, and 148 of SEQ ID NO:2 are sulfated tyrosine, the amino acid at position 142 of SEQ ID NO:2 has an O- glycosylation, and the amino acid at position 71 of SEQ ID NO:2 is a pyroglutamine.
  • the isolated polypeptide is covalently linked to an affinity tag or to an immunoglublulin constant region. [5]
  • the present invention provides an isolated polynucleotide that encodes an isolated polypeptide consisting of an amino acid sequence having at least 90% identity to amino acid residues 71 to 148 of SEQ ID NO:2, truncated Zimlig2.
  • the isolated polynucleotide is a polynucleotide that begins at position 290 of SEQ ID NO: 6 and ends at position 523 of SEQ ID NO: 1.
  • the present invention provides an isolated polynucleotide that encodes an isolated polypeptide comprising residues 71 through 148 of SEQ ID NO:2.
  • the present invention provides an isolated polynucleotide that encodes an isolated polypeptide consisting of residues 71 through 148 of SEQ ID NO:2.
  • the isolated polypeptide consisting of residues 71 through 148 of SEQ ID NO:2 may encompass modifications.
  • the present invention provides an isolated polynucleotide that encodes an isolated polypeptide comprising the amino acid residues of SEQ ID NO:5.
  • the present invention provides an isolated polynucleotide that encodes an isolated polypeptide consisting of the amino acid residues of SEQ ID NO:5.
  • the present invention provides an isolated polynucleotide that encodes an 11 KDa isolated mature polypeptide consisting of an amino acid sequence having at least 90% identity to amino acid residues 32 to 148 of SEQ ID NO:2.
  • the isolated polynucleotide that encodes mature Zimlig2 begins at position 173 of SEQ ID NO: 1 and ends at position 523 of SEQ ID NO: 1.
  • the present invention provides an isolated polypeptide comprising residues 32 through 148 of SEQ ID NO:2.
  • the present invention provides an isolated polynucleotide that encodes an isolated polypeptide consisting of residues 32 through 148 of SEQ ID NO:2.
  • the encoded isolated polypeptide consisting of residues 32 through 148 of SEQ ID NO:2 may encompass modifications.
  • 114, 115, 118, 123, 145, and 148 of SEQ ID NO:2 are tyrosine residues.
  • between one and six of the encoded tyrosine residues at positions 114, 115, 118, 123, 145, and 148 of SEQ ID NO:2 are modified.
  • between one and six of the encoded tyrosine residues at positions 114, 115, 118, 123, 145, and 148 of SEQ ID NO:2 are modified by sulfation.
  • SEQ ID NO:2 are modified by phosphation.
  • between one and six of the encoded tyrosine residues at positions 114, 115, 118, 123, 145, and 148 of SEQ ID NO:2 are modified by sulfation or phosphation.
  • the encoded amino acid residues at positions 123, 145, and 148 of SEQ ID NO:2 are tyrosine residues, and one or more of the amino acid residues at positions 114, 115, and 118 of SEQ ID NO:2 are tyrosine residues.
  • the encoded tyrosine residues at positions 123, 145, and 148 of SEQ ID NO:2 are modified, and one or more of the tyrosine residues at positions 114, 115, and 118 of SEQ ID NO:2 are modified.
  • the modification to the encoded tyrosine residues at positions 123, 145, and 148 of SEQ ID NO:2 is sulfation, and the modification to one or more of the tyrosine residues at positions 114, 115, and 118 of SEQ ID NO:2 is sulfation.
  • the modification to the encoded tyrosine residues at positions 123, 145, and 148 of SEQ ID NO:2 is a phosphation
  • the modification to one or more of the encoded tyrosine residues at positions 114, 115, and 118 of SEQ ID NO:2 is a phosphation
  • the encoded amino acid residues at positions 123, 145, and 148 of SEQ ID NO:2 are tyrosine residues.
  • the encoded tyrosine residues at positions 123, 145, and 148 of SEQ ID NO:2 are modified.
  • the modification to the encoded tyrosine residues at positions 123, 145, and 148 of SEQ ID NO:2 is sulfation.
  • the modification to the encoded tyrosine residues at positions 123, 145, and 148 of SEQ ID NO:2 is phosphation.
  • the encoded amino acid residue at position 142 of SEQ ID NO:2 is a serine.
  • the encoded amino acid residue at position 142 of SEQ ID NO:2 is modified.
  • the encoded serine residue at position 142 of SEQ ID NO:2 has an O-glycosylation.
  • the encoded serine residue at position 142 of SEQ ID NO:2 is linked to a carbohydrate epitope such as Sle x (sialyl lewis x oligosaccharide) or another sialyl lewis.
  • the encoded amino acid at position 71 of SEQ ID NO:2 is a glutamine.
  • the encoded amino acid at position 71 of SEQ ID NO:2 is pyroglutamine.
  • the encoded amino acid residues at positions 123, 145, and 148 of SEQ ID NO:2 are sulfated tyrosine, and the encoded amino acid at position 142 of SEQ ID NO:2 has an O-glycosylation.
  • the encoded amino acid residues at positions 123, 145, and 148 of SEQ ID NO:2 are sulfated tyrosine, the encoded amino acid at position 142 of SEQ ID NO:2 has an O-glycosylation, and the encoded amino acid at position 71 of SEQ ID NO:2 is a pyroglutamine.
  • the isolated polypeptide is covalently linked to an affinity tag or to an immunoglublulin constant region.
  • the present invention provides an isolated murine polypeptide consisting of an amino acid sequence having at least 90% identity to amino acid residues 71 to 148 of SEQ ID NO:7, truncated murine Zimlig2.
  • the present invention provides an isolated murine polypeptide comprising residues 71 through 148 of SEQ ID NO:7.
  • the present invention provides an isolated murine polypeptide consisting of residues 71 through 148 of SEQ ID NO:7.
  • the isolated murine polypeptide consisting of residues 71 through 148 of SEQ ID NO:7 may encompass modifications.
  • the present invention provides an isolated murine polypeptide comprising the amino acid residues of SEQ ID NO: 10.
  • the present invention provides an isolated murine polypeptide consisting of the amino acid residues of SEQ ID NO: 10.
  • the present invention provides an 11 KDa isolated mature murine polypeptide consisting of an amino acid sequence having at least 90% identity to amino acid residues 32 to 148 of SEQ ID NO:7.
  • the present invention provides an isolated murine polypeptide comprising residues 32 through 148 of SEQ ID NO:7.
  • the present invention provides an isolated murine polypeptide consisting of residues 32 through 148 of SEQ ID NO:7.
  • the isolated murine polypeptide consisting of residues 32 through 148 of SEQ ID NO:7 may encompass modifications.
  • between one and six of the amino acid residues at positions 114, 115, 118, 123, 145, and 148 of SEQ ID NO:7 are tyrosine residues.
  • between one and six of the tyrosine residues at positions 114, 115, 118, 123, 145, and 148 of SEQ ID NO:7 are modified.
  • between one and six of the tyrosine residues at positions 114, 115, 118, 123, 145, and 148 of SEQ ID NO:7 are modified by sulfation.
  • between one and six of the tyrosine residues at positions 114, 115, 118, 123, 145, and 148 of SEQ ID NO: 7 are modified by phosphation.
  • between one and six of the tyrosine residues at positions 114, 115, 118, 123, 145, and 148 of SEQ ID NO:7 are modified by sulfation or phosphation.
  • the amino acid residues at positions 123, 145, and 148 of SEQ ID NO: 7 are tyrosine residues, and one or more of the amino acid residues at positions 114, 115, and 118 of SEQ ID NO:7 are tyrosine residues.
  • the tyrosine residues at positions 123, 145, and 148 of SEQ ID NO:7 are modified, and one or more of the tyrosine residues at positions 114, 115, and 118 of SEQ ID NO:7 are modified.
  • the modification to the tyrosine residues at positions 123, 145, and 148 of SEQ ID NO:7 is sulfation, and the modification to one or more of the tyrosine residues at positions 114, 115, and 118 of SEQ ID NO: 7 is sulfation.
  • the modification to the tyrosine residues at positions 123, 145, and 148 of SEQ ID NO:7 is a phosphation
  • the modification to one or more of the tyrosine residues at positions 114, 115, and 118 of SEQ ID NO:7 is a phosphation
  • the amino acid residues at positions 123, 145, and 148 of SEQ ID NO:7 are tyrosine residues.
  • the tyrosine residues at positions 123, 145, and 148 of SEQ ID NO:7 are modified.
  • the modification to the tyrosine residues at positions 123, 145, and 148 of SEQ ID NO:7 is sulfation.
  • the modification to the tyrosine residues at positions 123, 145, and 148 of SEQ ID NO:7 is phosphation.
  • the amino acid residue at position 142 of SEQ ID NO:7 is a serine.
  • the amino acid residue at position 142 of SEQ ID NO: 7 is modified.
  • the serine residue at position 142 of SEQ ID NO: 7 has an O-glycosylation.
  • the serine residue at position 142 of SEQ ID NO: 7 is linked to a carbohydrate epitope such as Sle x (sialyl lewis x oligosaccharide) or another sialyl lewis.
  • the amino acid at position 71 of SEQ ID NO: 7 is a glutamine.
  • the amino acid at position 71 of SEQ ID NO: 7 is pyroglutamine.
  • the amino acid residues at positions 123, 145, and 148 of SEQ ID NO:7 are sulfated tyrosine, and the amino acid at position 142 of SEQ ID NO:7 has an O-glycosylation.
  • amino acid residues at positions 123, 145, and 148 of SEQ ID NO:7 are sulfated tyrosine, the amino acid at position 142 of SEQ ID NO: 7 has an O-glycosylation, and the amino acid at position 71 of SEQ ID NO:2 is a pyroglutamine.
  • the isolated murine polypeptide is covalently linked to an affinity tag or to an immunoglublulin constant region.
  • the present invention provides an isolated polynucleotide that encodes an isolated murine polypeptide consisting of an amino acid sequence having at least 90% identity to amino acid residues 71 to 148 of SEQ ID NO:7, truncated murine Zimlig2.
  • the isolated polynucleotide is a polynucleotide that begins at position 290 of SEQ ID NO: 6 and ends at position 523 of SEQ ID NO: 6.
  • the present invention provides an isolated polynucleotide that encodes an isolated murine polypeptide comprising residues 71 through 148 of SEQ ID NO:7.
  • the present invention provides an isolated polynucleotide that encodes an isolated murine polypeptide consisting of residues 71 through 148 of SEQ ID NO:7.
  • the isolated murine polypeptide consisting of residues 71 through 148 of SEQ ID NO: 7 may encompass modifications.
  • the present invention provides an isolated polynucleotide that encodes an isolated murine polypeptide comprising the amino acid residues of SEQ ID NO: 10.
  • the present invention provides an isolated polynucleotide that encodes an isolated murine polypeptide consisting of the amino acid residues of SEQ ID NO: 10.
  • the present invention provides an isolated polynucleotide that encodes an 11 KDa isolated mature murine polypeptide consisting of an amino acid sequence having at least 90% identity to amino acid residues 32 to 148 of SEQ ID NO:7.
  • the isolated polynucleotide that encodes mature murine Zimlig2 begins at position 173 of SEQ ID NO:6 and ends at position 523 of SEQ ID NO:6.
  • the present invention provides an isolated polypeptide comprising residues 32 through 148 of SEQ ID NO:7.
  • the present invention provides an isolated polynucleotide that encodes an isolated murine polypeptide consisting of residues 32 through 148 of SEQ ID NO:7.
  • the encoded isolated murine polypeptide consisting of residues 32 through 148 of SEQ ID NO:7 may encompass modifications.
  • between one and six of the encoded amino acid residues at positions 114, 115, 118, 123, 145, and 148 of SEQ ID NO:7 are tyrosine residues.
  • between one and six of the encoded tyrosine residues at positions 114, 115, 118, 123, 145, and 148 of SEQ ID NO:7 are modified.
  • between one and six of the encoded tyrosine residues at positions 114, 115, 118, 123, 145, and 148 of SEQ ID NO:7 are modified by sulfation.
  • between one and six of the encoded tyrosine residues at positions 114, 115, 118, 123, 145, and 148 of SEQ ID NO: 7 are modified by phosphation.
  • between one and six of the encoded tyrosine residues at positions 114, 115, 118, 123, 145, and 148 of SEQ ID NO:7 are modified by sulfation or phosphation.
  • the encoded amino acid residues at positions 123, 145, and 148 of SEQ ID NO:7 are tyrosine residues, and one or more of the amino acid residues at positions 114, 115, and 118 of SEQ ID NO:7 are tyrosine residues.
  • the encoded tyrosine residues at positions 123, 145, and 148 of SEQ ID NO:7 are modified, and one or more of the tyrosine residues at positions 114, 115, and 118 of SEQ ID NO:7 are modified.
  • the modification to the encoded tyrosine residues at positions 123, 145, and 148 of SEQ ID NO:7 is sulfation, and the modification to one or more of the tyrosine residues at positions 114, 115, and 118 of SEQ ID NO:7 is sulfation.
  • the modification to the encoded tyrosine residues at positions 123, 145, and 148 of SEQ ID NO:7 is a phosphation
  • the modification to one or more of the encoded tyrosine residues at positions 114, 115, and 118 of SEQ ID NO: 7 is a phosphation
  • the encoded amino acid residues at positions 123, 145, and 148 of SEQ ID NO:7 are tyrosine residues.
  • the encoded tyrosine residues at positions 123, 145, and 148 of SEQ ID NO: 7 are modified.
  • the modification to the encoded tyrosine residues at positions 123, 145, and 148 of SEQ ID NO: 7 is sulfation.
  • the modification to the encoded tyrosine residues at positions 123, 145, and 148 of SEQ ID NO:7 is phosphation.
  • the encoded amino acid residue at position 142 of SEQ ID NO:7 is a serine.
  • the encoded amino acid residue at position 142 of SEQ ID NO: 7 is modified.
  • the encoded serine residue at position 142 of SEQ ID NO: 7 has an O-glycosylation.
  • the encoded serine residue at position 142 of SEQ ID NO: 7 is linked to a carbohydrate epitope such as Sle x (sialyl lewis x oligosaccharide) or another sialyl lewis.
  • the encoded amino acid at position 71 of SEQ ID NO:7 is a glutamine.
  • the encoded amino acid at position 71 of SEQ ID NO: 7 is pyroglutamine.
  • the encoded amino acid residues at positions 123, 145, and 148 of SEQ ID NO:7 are sulfated tyrosine, and the encoded amino acid at position 142 of SEQ ID NO:7 has an O- glycosylation.
  • the encoded amino acid residues at positions 123, 145, and 148 of SEQ ID NO:7 are sulfated tyrosine, the encoded amino acid at position 142 of SEQ ID NO:7 has an O-glycosylation, and the encoded amino acid at position 71 of SEQ ID NO:7 is a pyroglutamine.
  • the isolated murine polypeptide is covalently linked to an affinity tag or to an immunoglublulin constant region.
  • the present invention provides an expression vector, comprising an isolated polynucleotide as described herein.
  • the present invention provides an expression vector comprising a transcription promoter, an isolated polynucleotide as described herein, and a transcription terminator, wherein the promoter, the isolated polynucleotide, and the transcription terminator are operably linked.
  • the present invention provides an expression vector comprising a transcription promoter, an isolated polynucleotide as described herein, an affinity tag, and a transcription terminator, wherein the promoter, the isolated polynucleotide, the affinity tag, and the transcription terminator are operably linked.
  • the present invention provides a recombinant host cell comprising an expression vector as described herein, wherein the host cell is a bacterium, yeast cell, fungal cell, insect cell, mammalian cell, or plant cell.
  • the present invention provides a method of producing an isolated polypeptide comprising culturing recombinant host cells that comprise an expression vector as described herein, and that produce an isolated polypeptide as described herein, and isolating the isolated polypeptide from the cultured recombinant host cells.
  • the present invention provides a polypeptide produced by a method described herein.
  • the present invention provides a cultured cell into which has been introduced an expression vector as disclosed herein, wherein the cell expresses the polypeptide encoded by the DNA segment.
  • the cell can be used within a method of producing a polypeptide, wherein the method comprises culturing the cell, whereby the cell expresses the polypeptide encoded by the DNA segment, and recovering the expressed polypeptide.
  • the invention provides a method for regulating the immune response, comprising administering an isolated polypeptide as described herein to a mammal, wherein administration of the polypeptide results in a clinically significant improvement in the inflammatory condition of the mammal.
  • the clinically significant improvement of the inflammatory condition may be an increase in an inflammatory response, where the inflammatory response was turned down or is not present.
  • the present invention provides a method for enhanced tumor killing and/or tumor rejection by aiding the immune response by administering an isolated polypetide as described herein.
  • the increase in the immune response is an increase in T cell population.
  • the present invention provides a method for increasing T cell population by administering an isolated polypeptide as described herein.
  • the present invention provides a method for increasing T cell proliferation by administering an isolated polypeptide as described herein.
  • the present invention provides a method for enhancing Leukocyte adhesion to endothelail cells comprising administering an isolated polypeptide as described herein.
  • the isolated polypeptide enhances Leukocyte adhesion to endothelial cells by binding to a selectin.
  • the isolated polypeptide enhances Leukocyte adhesion to endothelial cells by binding to a P-selectin.
  • the present invention provides an antagonist to an isolated protein as described herein.
  • the antagonist comprises a monoclonal antibody, polyclonal antibody, or fragment or fragments thereof that binds to an epitope of an isolated protein as described herein.
  • the antagonist consists of a monoclonal antibody, polyclonal antibody, or fragment or fragments thereof that binds to an epitope of an isolated protein as described herein.
  • the antagonist inhibits or prevents an immune response.
  • the decrease in the immune response is a decrease in inflammation.
  • the antagonist inhibits or prevents Leukocyte adhesion to endothelial cells.
  • the antagonist inhibits or prevents T cell proliferation.
  • the present invention provides a method of producing an antibody that specifically binds to an isolated polypeptide as described herein comprising: inoculating an animal with the polypeptide to elicit an immune response in the animal to produce the antibody; and isolating the antibody from the animal.
  • the present invention provides an antibody produced by a method as described herein.
  • the present invention provides an antibody that specifically binds to an epitope of an isolated protein as described herein.
  • the epitope comprises or consists of the amino acid residues from position 74-79 of SEQ ID NO:2.
  • the epitope comprises or consists of the amino acid residues from position 93-98 of SEQ ID NO:2.
  • the epitope comprises or consists of the amino acid residues from position 106-111 of SEQ ID NO:2.
  • the epitope comprises or consists of the amino acid residues from position 107-112 of SEQ ID NO:2.
  • the epitope comprises or consists of the amino acid residues from position 131-136 of SEQ ID NO:2.
  • the epitope comprises or consists of 73-80 contiguous amino acids of SEQ ID NO:2. Within another embodiment, the epitope comprises or consists of 81- 90 contiguous amino acid residues of SEQ ID NO:2. Within another embodiment, the epitope comprises or consists of 91-100 contiguous amino acids residues of SEQ ID NO:2.
  • the present invention provides an antibody that specifically binds to an epitope of an isolated murine protein as described herein.
  • the epitope comprises or consists of the amino acid residues from position 74-79 of SEQ ID NO:7.
  • the epitope comprises or consists of the amino acid residues from position 93-98 of SEQ ID NO:7.
  • the epitope comprises or consists of the amino acid residues from position 106-111 of SEQ ID NO:7.
  • the epitope comprises or consists of the amino acid residues from position 107-112 of SEQ ID NO:7.
  • the epitope comprises or consists of the amino acid residues from position 121-126 of SEQ ID NO:7.
  • the epitope comprises or consists of the amino acid residues from position 131-136 of SEQ ID NO:7.
  • the epitope comprises or consists of 73-80 contiguous amino acids of SEQ ID NO:7.
  • the epitope comprises or consists of 81-90 contiguous amino acid residues of SEQ ID NO:7.
  • the epitope comprises or consists of 91-100 contiguous amino acids residues of SEQ ID NO:7.
  • the present invention provides a method for regulating an immune response comprising administering an antibody as described herein, wherein administration of the antibody results in a decrease in immune response.
  • the decrease in the immune response is a decrease in T cell proliferation.
  • the present invention provides a method for inhibiting or preventing Leukocyte adhesion to endothelial cells comprising administering an antibody as described herein.
  • the present invention provides a method for inhibiting or preventing T cell proliferation comprising administering an antibody as described herein.
  • affinity tag is used herein to denote a polypeptide segment that can be attached to a second polypeptide to provide for purification or detection of the second polypeptide or provide sites for attachment of the second polypeptide to a substrate.
  • affinity tag any peptide or protein for which an antibody or other specific binding agent is available can be used as an affinity tag.
  • Affinity tags include a poly-histidine tract, protein A (Nilsson et al., EMBO J. 4: 1075, 1985; Nilsson et al., Methods Enzymol. 198:3.
  • allelic variant is used herein to denote any of two or more alternative forms of a gene occupying the same chromosomal locus. Allelic variation arises naturally through mutation, and may result in phenotypic polymorphism within populations. Gene mutations can be silent (no change in the encoded polypeptide) or may encode polypeptides having altered amino acid sequence.
  • allelic variant is also used herein to denote a protein encoded by an allelic variant of a gene.
  • amino-terminal and “carboxyl-terminal” are used herein to denote positions within polypeptides.
  • truncated Zimlig2 describes a soluble protein that results from enzymatic cleavages of the full-length protein, such as removal of the signal sequence (residues 1-31 of SEQ ID NO:2) and the removal of residues 32 to 71 of SEQ ID NO:2.
  • An example of a post translationally modifed amino acid sequence of the truncated Zimlig2 is shown in SEQ ID NO:5.
  • a truncated Zimlig2 molecule may comprise some or all of the embodiments described herein.
  • truncated murine Zimlig2 describes a soluble protein that results from enzymatic cleavages of the full-length protein, such as removal of the signal sequence (residues 1-31 of SEQ ID NO:2) and the removal of residues 32 to 71 of SEQ ID NO:7.
  • An example of a post translationally modifed amino acid sequence of the truncated murine Zimlig2 is shown in SEQ ID NO: 10.
  • a truncated murine Zimlig2 molecule may comprise some or all of the embodiments described herein.
  • complement/anti-complement pair denotes non-identical moieties that form a non-covalently associated, stable pair under appropriate conditions.
  • biotin and avidin are prototypical members of a complement/anti-complement pair.
  • Other exemplary complement/anti-complement pairs include receptor/ligand pairs, antibody/antigen (or hapten or epitope) pairs, sense/antisense polynucleotide pairs, and the like.
  • the complement/anti-complement pair preferably has a binding affinity of ⁇ l ⁇ " M ⁇ l.
  • degenerate nucleotide sequence denotes a sequence of nucleotides that includes one or more degenerate codons (as compared to a reference polynucleotide molecule that encodes a polypeptide).
  • Degenerate codons contain different triplets of nucleotides, but encode the same amino acid residue (i.e., GAU and GAC triplets each encode Asp).
  • expression vector is used to denote a DNA molecule, linear or circular, that comprises a segment encoding a polypeptide of interest operably linked to additional segments that provide for its transcription.
  • additional segments include promoter and terminator sequences, and may also include one or more origins of replication, one or more selectable markers, an enhancer, a polyadenylation signal, etc.
  • Expression vectors are generally derived from plasmid or viral DNA, or may contain elements of both.
  • a "cloning vector” is a nucleic acid molecule, such as a plasmid, cosmid, or bacteriophage, that has the capability of replicating autonomously in a host cell.
  • Cloning vectors typically contain one or a small number of restriction endonuclease recognition sites that allow insertion of a nucleic acid molecule in a determinable fashion without loss of an essential biological function of the vector, as well as nucleotide sequences encoding a marker gene that is suitable for use in the identification and selection of cells transformed with the cloning vector.
  • Marker genes typically include genes that provide tetracycline resistance or ampicillin resistance.
  • isolated when applied to a polynucleotide, denotes that the polynucleotide has been removed from its natural genetic milieu and is thus free of other extraneous or unwanted coding sequences, and is in a form suitable for use within genetically engineered protein production systems.
  • isolated molecules are those that are separated from their natural environment and include cDNA and genomic clones.
  • Isolated DNA molecules of the present invention are free of other genes with which they are ordinarily associated, but may include naturally occurring 5' and 3' untranslated regions such as promoters and terminators. The identification of associated regions will be evident to one of ordinary skill in the art (see for example, Dynan and Tiian. Nature 316:774-78. 1985).
  • an "isolated" polypeptide or protein is a polypeptide or protein that is found in a condition other than its native environment, such as apart from blood and animal tissue.
  • the isolated polypeptide is substantially free of other polypeptides, particularly other polypeptides of animal origin. It is preferred to provide the polypeptides in a highly purified form, i.e. greater than 95% pure, or greater than 99% pure.
  • the term "isolated” does not exclude the presence of the same polypeptide in alternative physical forms, such as dimers or alternatively glycosylated or derivatized forms.
  • mature Zimlig2 describes a protein comprising or consisting of residue 32 to residue 148 of SEQ ID NO:2 and is also shown in SEQ ID NO:4.
  • mature murine Zimlig2 describes a protein comprising or consisting of residues 32 to residue 148 of SEQ ID NO:7 and is also shown in SEQ ID NO:9.
  • operably linked when referring to DNA segments, indicates that the segments are arranged so that they function in concert for their intended purposes, e.g., transcription initiates in the promoter and proceeds through the coding segment to the terminator.
  • ortholog denotes a polypeptide or protein obtained from one species that is the functional counterpart of a polypeptide or protein from a different species. Sequence differences among orthologs are the result of speciation.
  • a "polynucleotide” is a single- or double-stranded polymer of deoxyribonucleotide or ribonucleotide bases read from the 5' to the 3' end.
  • Polynucleotides include RNA and DNA, and may be isolated from natural sources, synthesized in vitro, or prepared from a combination of natural and synthetic molecules. Sizes of polynucleotides are expressed as base pairs (abbreviated "bp"), nucleotides ("nt”), or kilobases ("kb"). Where the context allows, the latter two terms may describe polynucleotides that are single-stranded or double-stranded.
  • double- stranded molecules When the term is applied to double- stranded molecules it is used to denote overall length and will be understood to be equivalent to the term "base pairs". It will be recognized by those skilled in the art that the two strands of a double- stranded polynucleotide may differ slightly in length and that the ends thereof may be staggered as a result of enzymatic cleavage; thus all nucleotides within a double-stranded polynucleotide molecule may not be paired.
  • a "polypeptide” is a polymer of amino acid residues joined by peptide bonds, whether produced naturally or synthetically. Polypeptides of less than about 10 amino acid residues are commonly referred to as “peptides”.
  • promoter is used herein for its art-recognized meaning to denote a portion of a gene containing DNA sequences that provide for the binding of RNA polymerase and initiation of transcription. Promoter sequences are commonly, but not always, found in the 5' non-coding regions of genes.
  • a "protein” is a macromolecule comprising one or more polypeptide chains.
  • a protein may also comprise non-peptidic components, such as carbohydrate groups. Carbohydrates and other non-peptidic substituents may be added to a protein by the cell in which the protein is produced, and will vary with the type of cell. Proteins are defined herein in terms of their amino acid backbone structures; substituents such as carbohydrate groups are generally not specified, but may be present nonetheless.
  • receptor denotes a cell-associated protein that binds to a bioactive molecule (i.e., a ligand) and mediates the effect of the ligand on the cell.
  • a bioactive molecule i.e., a ligand
  • Membrane-bound receptors are characterized by a multi-peptide structure comprising an extracellular ligand-binding domain and an intracellular effector domain that is typically involved in signal transduction. Binding of ligand to receptor results in a conformational change in the receptor that causes an interaction between the effector domain and other molecule(s) in the cell. This interaction in turn leads to an alteration in the metabolism of the cell.
  • Metabolic events that are linked to receptor-ligand interactions include gene transcription, phosphorylation, dephosphorylation, increases in cyclic AMP production, mobilization of cellular calcium, mobilization of membrane lipids, cell adhesion, hydrolysis of inositol lipids and hydrolysis of phospholipids.
  • receptors can be membrane bound, cytosolic or nuclear; monomeric (e.g., thyroid stimulating hormone receptor, beta-adrenergic receptor) or multimeric (e.g., PDGF receptor, growth hormone receptor, IL-3 receptor, GM-CSF receptor, G-CSF receptor, erythropoietin receptor and IL-6 receptor).
  • a "recombinant host” is a cell that contains a heterologous nucleic acid molecule, such as a cloning vector or expression vector.
  • a recombinant host is a cell that produces a Zimlig2 peptide or polypeptide from an expression vector.
  • polypeptides can be produced by a cell that is a "natural source" of Zimlig2 and that lacks an expression vector.
  • secretory signal sequence denotes a DNA sequence that encodes a polypeptide (a "secretory peptide") that, as a component of a larger polypeptide, directs the larger polypeptide through a secretory pathway of a cell in which it is synthesized.
  • the larger polypeptide is commonly truncated to remove the secretory peptide during transit through the secretory pathway.
  • splice variant is used herein to denote alternative forms of RNA transcribed from a gene. Splice variation arises naturally through use of alternative splicing sites within a transcribed RNA molecule, or less commonly between separately transcribed RNA molecules, and may result in several mRNAs transcribed from the same gene. Splice variants may encode polypeptides having altered amino acid sequence. The term splice variant is also used herein to denote a protein encoded by a splice variant of an mRNA transcribed from a gene.
  • the present invention is directed to novel compositions and uses of a secreted polypeptide, Zimlig2.
  • Zimlig2, as well as variants and fragments thereof can be used to increase a host's immune response.
  • Zimlig2, as well as variants and fragments thereof can be used to increase T-cell proliferation .
  • Zimlig2 was initially identified using an Electronic -northern (E-northern) analysis designed to detect transcripts that are over-represented in tissues of immunologic significance.
  • E-northern Electronic -northern
  • the E- northern results suggest over-representation of Zimlig2 in cartilage, chondrocytes, and fibroblasts, and in osteoarthritis compared with non-disease sources.
  • E-northern results Zimlig2 is also under- represented in cancer, consistent with the cancer disease profiling array described in Example 2.
  • E-northern methods of analysis are known in the art.
  • the ZGEN E-northern analysis tool is similar to eVOC as described by Kelso et. al. in Genome Res. 2003 Jun;l 3(6A): 1222-30 (PMID: 12799354).
  • each EST library included in the analysis is manually annotated with medical subject heading (MESH) terms based on limited annotation provided by authors of different data sets.
  • MESH medical subject heading
  • Each EST then is placed in various MESH categories according to its parent library. ESTs whose sequences overlap known genes are grouped by gene. Any single gene can then be evaluated for its relationship to biologies and disease states as defined by MESH categories and the number of occurrences of that gene's ESTs in those categories.
  • the present invention provides methods of using human Zimlig2 polypeptides and nucleic acid molecules that encode human Zimlig2 polypeptides.
  • An illustrative nucleic acid molecule containing a sequence that encodes the Zimlig2 polypeptide has the nucleotide sequence of SEQ ID NO: 1 and the encoded polypeptide has the amino acid sequence as shown in SEQ ID NO:2.
  • the Zimlig2 nucleotide sequence described herein encodes an 11 KDa polypeptide of 148 amino acids as shown in SEQ ID NO: 2.
  • the Zimlig2 gene resides in chromosome 2ql2.2.
  • the degenerate polynucleotide sequence for Zimlig2 is shown in SEQ ID NO: 3.
  • the putative signal sequences of Zimlig2 polypeptide reside at amino acid residues 1 to 29, 1 to 30, and 1 to 31, of SEQ ID NO:2.
  • Polynucleotides and/or polypeptides of Zimlig2 have been previously described in references including: WO0166748; WO03091280; Su T. et a!.. Zhonghua Zhong Liu Za Zhi. 20f4):254-7. 1998; Steck et al., Biochemical and Biophysical Research Communications 299:109-115. 2002; Yue CM, et al., World J Gastroenterol 9(6): 1174-8, 2003; Clark H.F. et al., Genome Research 13:2265-2270, 2003.
  • novel compositions of Zimlig2 described herein include a mature form of the polypeptide comprising residues 32 through 148 of SEQ ID NO:2.
  • the polynucleotide encoding the novel mature polypeptide begins at position 173 of SEQ ID NO: 1 and ends at position 523 of SEQ ID NO: 1.
  • a novel truncated form of Zimlig2 comprising residues 71 through 148 of SEQ ID NO:2 has been identified.
  • the Zimlig2 polypeptide may include post-translational modifications.
  • the tyrosine residues at positions 123, 145, and 148 of SEQ ID NO:2 may be sulfated.
  • the tyrosine residues at positions 123, 145, and 148 of SEQ ID NO:2 may be phosphated.
  • Mass spectrometry peptide map analysis indicated that SEQ ID NO:2 comprises a serine at residue 142, and that this serine has a modification that may be an O- glycosylation, or the serine may be linked to a carbohydrate epitope, such as, for example, a sialyl lewis x oligosaccharide or another lewis acid.
  • Post translational modifications are common on mature active proteins.
  • One such post translational modification is tyrosine sulfation.
  • Many tyrosine sulfated proteins participate in protein-protein interactions that are driven at least in part by recognition of the sulfate group itself; in fact, in the past few years, tyrosine sulfation has been identified as a key modulator of protein-protein interactions that mediate inflammatory leukocyte adhesion. (Kehoe and Bertozzi, Ibid.).
  • sulfo-tyrosyl containing proteins see Hsu, et al., Autoimmunity Reviews 4:429-435, 2005.
  • the selectins are a family of cell surface glycoproteins with high homology: E-, L-, and P- selectin.
  • L-selectin is responsible for lymphocyte homing and is present on all granulocytes and monocytes and most lymphocytes.
  • P-selectin is responsible for neutrophil recruitment and is stored in alpha-granules of platelets and weibel-palade bodies of endothelial cells and is translocated on activated endothelial cells and platelets.
  • E-selectin expression is limited to the endothelium, it is only expressed under baseline condition skin microvessels; it is rapidly induced in inflammation.
  • PSGL-I binds to P-selectin and L-selectin under inflammatory conditions.
  • a motif of 20 amino acid residues of P-selectin glycoprotein ligand-1 was shown to be required for high affinity binding to P-selectin.
  • This motif is described as three tyrosine sulfate (TyrSO 3 ) residues and a monosialylated, core 2-based O-glycan with a sialyl Lewis x (C2-O-sLe x ) motif at a specific Thr residue.
  • TyrSO 3 tyrosine sulfate residues and a monosialylated, core 2-based O-glycan with a sialyl Lewis x (C2-O-sLe x ) motif at a specific Thr residue.
  • C2-O-sLe x sialyl Lewis x
  • Zimlig2 The post translational modifications of cleaved Zimlig2 are markedly similar to the post translational modifications of PSGL-I that play a critical role in P-selectin binding.
  • Zimlig2 encompasses similar post translational modifications: three sulfated tyrosine residues, at positions 123, 145, and 148 of SEQ ID NO:2, and an ⁇ -glycosylated serine residue, at position 142 of SEQ ID NO:2, linked to a carbohydrate epitope, possibly sialyl lewis x oligosaccharide or another sialyl lewis.
  • Zimlig2 is a soluble protein that can enhance the activity of a selectin-type molecule.
  • the isolated polypeptides of the present invention may be used to increase T cell proliferation.
  • T cells belong to a group of white blood cells known as lymphocytes and play a role in cell mediated immunity. Several different subsets of T cells have been described, each with a distinct function.
  • CD4+ T cells or helper T cells, divide rapidly when activated and secrete cytokines, such as interferon gamma, that regulate the immune response.
  • cytokines such as interferon gamma
  • lymphocytes Another subset of lymphocytes is cytotoxic T cells (CD8+ T cells). They destroy virally infected cells and tumor cells, and are also implicated in transplant rejection. CD8+ lymphocytes also secrete cytokines, including interferon gamma. They have been known as lymphocytes capable of specifically killing tumor cells. Brandacher et al. Curr Drug Metab. "Antitumoral activity of interferon gamma involved in impaired immune function in cancer patients. 2006 Aug; 7(6):599-612.
  • Interferons such as gamma interferon, are natural proteins produced by cells of the immune system of most vertebrates in response to challenges by foreign agents such as viruses, bacteria, parasites and tumor cells. They assist the immune response by activating other cells, such as natural killer lymphocytes and macrophages, that can assist in immune surveillance and tumor cell lysis. Watanabe, Y (2004) “Fifty Years of Interference” Nature Immunology 5(12):1193
  • the level of identity between amino acid sequences can also be determined using the "FASTA” similarity search algorithm disclosed by Pearson and Lipman (Proc. Natl. Acad. Sci. USA 85:2444, 1988) and by Pearson (Meth. Enzymol. 183:63, 1990).
  • the present invention provides a variety of nucleic acid molecules, including DNA and RNA molecules that encode the Zimlig2 polypeptides disclosed herein. Those skilled in the art will readily recognize that, in view of the degeneracy of the genetic code, considerable sequence variation is possible among these polynucleotide molecules.
  • SEQ ID NO:3 is a degenerate nucleotide sequences that encompasses all nucleic acid molecules that encode the Zimlig2 polypeptides of the present invention.
  • the present invention further provides variant polypeptides and nucleic acid molecules that represent counterparts from other species (orthologs). These species include, but are not limited to mammalian including porcine, ovine, bovine, canine, feline, equine, murine, and other primates, avian, amphibian, reptile, fish, insect, and other vertebrate and invertebrate species.
  • Orthologs of human Zimlig2 can be cloned using information and compositions provided by the present invention in combination with conventional cloning techniques. For example, a cDNA can be cloned using mRNA obtained from a tissue or cell type that expresses Zimlig2. Suitable sources of mRNA can be identified by probing northern blots with probes designed from the sequences disclosed herein. A library is then prepared from mRNA of a positive tissue or cell line.
  • the isolated nucleic acid molecules can hybridize under stringent conditions to nucleic acid molecules comprising nucleotide sequences disclosed herein.
  • nucleic acid molecules can hybridize under stringent conditions to nucleic acid molecules consisting of the nucleotide sequence of SEQ ID NO: 1, to nucleic acid molecules consisting of the nucleotide sequence of nucleotides 173 to 523 of SEQ ID NO: 1, to nucleic acid molecules consisting of the nucleotide sequence of nucleotides 290 to 523 of SEQ ID NO: 1, or to nucleic acid molecules consisting of nucleotide sequences that are the complements of such sequences.
  • stringent conditions are selected to be about 5°C lower than the thermal melting point (T m ) for the specific sequence at a defined ionic strength and pH.
  • T m is the temperature (under defined ionic strength and pH) at which 50% of the target sequence hybridizes to a perfectly matched probe.
  • a pair of nucleic acid molecules can hybridize if the nucleotide sequences have some degree of complementarity.
  • Hybrids can tolerate mismatched base pairs in the double helix, but the stability of the hybrid is influenced by the degree of mismatch.
  • the T m of the mismatched hybrid decreases by 1°C for every 1-1.5% base pair mismatch. Varying the stringency of the hybridization conditions allows control over the degree of mismatch that will be present in the hybrid. The degree of stringency increases as the hybridization temperature increases and the ionic strength of the hybridization buffer decreases.
  • Stringent hybridization conditions encompass temperatures of about 5-25°C below the T m of the hybrid and a hybridization buffer having up to 1 M Na + . Higher degrees of stringency at lower temperatures can be achieved with the addition of formamide which reduces the T m of the hybrid about 1°C for each 1% formamide in the buffer solution.
  • such stringent conditions include temperatures of 20-70 0 C and a hybridization buffer containing up to 6x SSC and 0-50% formamide.
  • a higher degree of stringency can be achieved at temperatures of from 40-70 0 C with a hybridization buffer having up to 4x SSC and from 0-50% formamide.
  • Highly stringent conditions typically encompass temperatures of 42-70 0 C with a hybridization buffer having up to Ix SSC and 0-50% formamide.
  • Different degrees of stringency can be used during hybridization and washing to achieve maximum specific binding to the target sequence.
  • the washes following hybridization are performed at increasing degrees of stringency to remove non-hybridized polynucleotide probes from hybridized complexes.
  • the above conditions are meant to serve as a guide and it is well within the abilities of one skilled in the art to adapt these conditions for use with a particular polypeptide hybrid.
  • the T m for a specific target sequence is the temperature (under defined conditions) at which 50% of the target sequence will hybridize to a perfectly matched probe sequence.
  • T m Those conditions that influence the T m include, the size and base pair content of the polynucleotide probe, the ionic strength of the hybridization solution, and the presence of destabilizing agents in the hybridization solution.
  • Numerous equations for calculating T m are known in the art, and are specific for DNA, RNA and DNA-RNA hybrids and polynucleotide probe sequences of varying length (see, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, Second Edition (Cold Spring Harbor Press 1989); Ausubel et al., (eds.), Current Protocols in Molecular Biology (John Wiley and Sons, Inc.
  • Sequence analysis software such as OLIGO 6.0 (LSR; Long Lake, MN) and Primer Premier 4.0 (Premier Biosoft International; Palo Alto, CA), as well as sites on the Internet, are available tools for analyzing a given sequence and calculating T m based on user defined criteria. Such programs can also analyze a given sequence under defined conditions and identify suitable probe sequences. Typically, hybridization of longer polynucleotide sequences, >50 base pairs, is performed at temperatures of about 20-25 0 C below the calculated T m . For smaller probes, ⁇ 50 base pairs, hybridization is typically carried out at the T m or 5- 10 0 C below. This allows for the maximum rate of hybridization for DNA-DNA and DNA-RNA hybrids.
  • Hybridization buffers generally contain blocking agents such as Denhardt's solution (Sigma Chemical Co., St. Louis, Mo.), denatured salmon sperm DNA, tRNA, milk powders (BLOTTO), heparin or SDS, and a Na + source, such as SSC (Ix SSC: 0.15 M sodium chloride, 15 mM sodium citrate) or SSPE (Ix SSPE: 1.8 M NaCl, 10 mM NaH 2 PO 4 , 1 mM EDTA, pH 7.7).
  • SSC Denhardt's solution
  • denatured salmon sperm DNA DNA
  • tRNA milk powders
  • BLOTTO milk powders
  • heparin or SDS milk powders
  • Na + source such as SSC (Ix SSC: 0.15 M sodium chloride, 15 mM sodium citrate) or SSPE (Ix SSPE: 1.8 M NaCl, 10 mM NaH 2 PO 4 , 1 mM EDTA, pH 7.7).
  • hybridization buffers typically contain from between 10 mM - 1 M Na + .
  • destabilizing or denaturing agents such as formamide, tetralkylammonium salts, guanidinium cations or thiocyanate cations to the hybridization solution will alter the T m of a hybrid.
  • formamide is used at a concentration of up to 50% to allow incubations to be carried out at more convenient and lower temperatures. Formamide also acts to reduce non-specific background when using RNA probes.
  • a nucleic acid molecule encoding a variant Zimlig2 polypeptide can be hybridized with a nucleic acid molecule having the nucleotide sequence of SEQ ID NO: 1 (or its complement) at 42°C overnight in a solution comprising 50% formamide, 5xSSC (IxSSC: 0.15 M sodium chloride and 15 mM sodium citrate), 50 mM sodium phosphate (pH 7.6), 5x Denhardt's solution (10Ox Denhardt's solution: 2% (w/v) Ficoll 400, 2% (w/v) polyvinylpyrrolidone, and 2% (w/v) bovine serum albumin), 10% dextran sulfate, and 20 ⁇ g/ml denatured, sheared salmon sperm DNA.
  • 5xSSC IxSSC: 0.15 M sodium chloride and 15 mM sodium citrate
  • 50 mM sodium phosphate pH 7.6
  • 5x Denhardt's solution (10Ox Denhardt
  • hybridization mixture can be incubated at a higher temperature, such as about 65°C, in a solution that does not contain formamide.
  • a higher temperature such as about 65°C
  • premixed hybridization solutions are available (e.g., EXPRESSHYB Hybridization Solution from CLONTECH Laboratories, Inc.), and hybridization can be performed according to the manufacturer's instructions.
  • the nucleic acid molecules can be washed to remove non- hybridized nucleic acid molecules under stringent conditions, or under highly stringent conditions.
  • Typical stringent washing conditions include washing in a solution of 0.5x - 2x SSC with 0.1% sodium dodecyl sulfate (SDS) at 55 - 65°C.
  • nucleic acid molecules encoding particular variant Zimlig2 polypeptides can remain hybridized with a nucleic acid molecule consisting of the nucleotide sequence of nucleotides 173 to 523 of SEQ ID NO: 1, the nucleotide sequence of nucleotides 290 to 523 of SEQ ID NO: 1, or their complements, following washing under stringent washing conditions, in which the wash stringency is equivalent to 0.5x - 2x SSC with 0.1% SDS at 55 - 65°C, including 0.5x SSC with 0.1% SDS at 55°C, or 2xSSC with 0.1% SDS at 65°C.
  • One of skill in the art can readily devise equivalent conditions, for example, by substituting SSPE for SSC in the wash solution.
  • Typical, highly stringent washing conditions include washing in a solution of 0.1 x - 0.2x SSC with 0.1% sodium dodecyl sulfate (SDS) at 50 - 65°C.
  • SDS sodium dodecyl sulfate
  • nucleic acid molecules encoding particular variant Zimlig2 polypeptides can remain hybridized with a nucleic acid molecule consisting of the nucleotide sequence of nucleotides 290 to 523 of SEQ ID NO: 1, the nucleotide sequence of nucleotides encoding at least the truncated Zimlig2 polypeptide, or their complements, following washing under highly stringent washing conditions, in which the wash stringency is equivalent to O. lx - 0.2x SSC with 0.1% SDS at 50 - 65°C, including O. lx SSC with 0.1% SDS at 50 0 C, or 0.2xSSC with 0.1% SDS at 65°C.
  • the present invention also provides isolated Zimlig2 polypeptides that have a substantially similar sequence identity to the polypeptides of SEQ ID NO:2, or their orthologs (e.g. SEQ ID NO:7).
  • substantially similar sequence identity is used herein to denote polypeptides having 85%, 90%, 95% or greater than 95% sequence identity to the sequences shown in SEQ ID NO: 2, or its orthologs.
  • the present invention also contemplates Zimlig2 variant nucleic acid molecules that can be identified using two criteria: a determination of the similarity between the encoded polypeptide with the amino acid sequence of SEQ ID NOs:2, 4, 5, 7, 9, or 10, and a hybridization assay, as described above.
  • certain Zimlig2 gene variants include nucleic acid molecules (1) that remain hybridized with a nucleic acid molecule consisting of the nucleotide sequence of SEQ ID NO: 1, the nucleotide sequence of nucleotides 173 to 523 of SEQ ID NO: 1, the nucleotide sequence of nucleotides 290 to 523 of SEQ ID NO: 1, or their complements, following washing under stringent washing conditions, in which the wash stringency is equivalent to 0.5x - 2x SSC with 0.1% SDS at 55 - 65°C, and (2) that encode a polypeptide having 85%, 90%, 95% or greater than 95% sequence identity to the amino acid sequence of SEQ ID NO:2, 4, 5, 7, 9, or 10.
  • certain Zimlig2 variant genes can be characterized as nucleic acid molecules (1) that remain hybridized with a nucleic acid molecule consisting of the nucleotide sequence of SEQ ID NO: 1, the nucleotide sequence of nucleotides 173 to 523 of SEQ ID NO: 1, the nucleotide sequence of nucleotides 290 to 523 of SEQ ID NO: 1, or their complements, following washing under highly stringent washing conditions, in which the wash stringency is equivalent to 0. Ix - 0.2x SSC with 0.1% SDS at 50 - 65°C, and (2) that encode a polypeptide having 85%, 90%, 95% or greater than 95% sequence identity to the amino acid sequence of SEQ ID NO:2, 4, 5, 7, 9, or 10.
  • the present invention includes nucleic acid molecules that encode a polypeptide having a conservative amino acid change, compared with the amino acid sequence of SEQ ID NOs:2, 4, 5, 7, 9, or 10. That is, variants can be obtained that contain one or more amino acid substitutions of SEQ ID NOs:2, 4, 5, 7, 9, or 10, in which an alkyl amino acid is substituted for an alkyl amino acid in a Zimlig2 amino acid sequence, an aromatic amino acid is substituted for an aromatic amino acid in a Zimlig2 amino acid sequence, a sulfur-containing amino acid is substituted for a sulfur-containing amino acid in a Zimlig2 amino acid sequence, a hydroxy-containing amino acid is substituted for a hydroxy-containing amino acid in a Zimlig2 amino acid sequence, an acidic amino acid is substituted for an acidic amino acid in a Zimlig2 amino acid sequence, a basic amino acid is substituted for a basic amino acid in a Zimlig2 amino acid sequence, or a dibasic monocarboxylic amino acid is
  • a “conservative amino acid substitution” is illustrated by a substitution among amino acids within each of the following groups: (1) glycine, alanine, valine, leucine, and isoleucine, (2) phenylalanine, tyrosine, and tryptophan, (3) serine and threonine, (4) aspartate and glutamate, (5) glutamine and asparagine, and (6) lysine, arginine and histidine.
  • Variants of Zimlig2 are characterized by having at least 70%, at least 80%, at least 85%, at least 90%, at least 95% or greater than 95% sequence identity to a corresponding amino acid sequence disclosed herein, wherein the variation in amino acid sequence is due to one or more conservative amino acid substitutions.
  • Conservative amino acid changes in a Zimlig2 gene can be introduced by substituting nucleotides for the nucleotides recited in SEQ ID NOs: 2, 4, 5, 7, 9, or 10.
  • Such "conservative amino acid” variants can be obtained, for example, by oligonucleotide-directed mutagenesis, linker-scanning mutagenesis, mutagenesis using the polymerase chain reaction, and the like (see Ausubel (1995) at pages 8-10 to 8-22; and McPherson (ed.), Directed Mutagenesis: A Practical Approach (IRL Press 1991)).
  • the proteins of the present invention can also comprise non-naturally occurring amino acid residues.
  • Non-naturally occurring amino acids include, without limitation, trans-3- methylproline, 2,4-methanoproline, cw-4-hydroxyproline, ?ra «,y-4-hydroxyprolme, N-methylglycine, ⁇ //o-threonine, methylthreonine, hydroxyethylcysteine, hydroxyethylhomocysteine, nitroglutamine, homoglutamine, pipecolic acid, thiazolidine carboxylic acid, dehydroproline, 3- and 4-methylproline, 3,3-dimethylproline, fert-leucine, norvaline, 2-azaphenylalanine, 3-azaphenylalanine, 4- azaphenylalanine, and 4-fluorophenylalanine.
  • a second method translation is carried out in Xenopus oocytes by microinjection of mutated mRNA and chemically aminoacylated suppressor tRNAs (Turcatti et al, J. Biol. Chem. 271: 19991 (1996)).
  • E. coli cells are cultured in the absence of a natural amino acid that is to be replaced (e.g., phenylalanine) and in the presence of the desired non-naturally occurring amino acid(s) (e.g., 2-azaphenylalanine, 3-azaphenylalanine, 4-azaphenylalanine, or 4- fluorophenylalanine).
  • non-naturally occurring amino acid is incorporated into the protein in place of its natural counterpart. See, Koide et al, Biochem. 33:1410 (1994). Naturally occurring amino acid residues can be converted to non-naturally occurring species by in vitro chemical modification. Chemical modification can be combined with site-directed mutagenesis to further expand the range of substitutions (Wynn and Richards, Protein Sci. 2:395 (1993)).
  • a limited number of non-conservative amino acids, amino acids that are not encoded by the genetic code, non-naturally occurring amino acids, and unnatural amino acids may be substituted for Zimlig2 amino acid residues.
  • Essential amino acids in the polypeptides of the present invention can be identified according to procedures known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis (Cunningham and Wells, Science 244: 1081 (1989), Bass et al, Proc. Natl Acad. Sci. USA 55:4498 (1991), Coombs and Corey, "Site-Directed Mutagenesis and Protein Engineering,” in Proteins: Analysis and Design, Angeletti (ed.), pages 259-311 (Academic Press, Inc. 1998)).
  • Substantially homologous proteins and polypeptides are characterized as having one or more amino acid substitutions, deletions or additions. These changes are preferably of a minor nature, that is conservative amino acid substitutions and other substitutions that do not significantly affect the folding or activity of the protein or polypeptide; small deletions, typically of one to about 30 amino acids; and small amino- or carboxyl-terminal extensions, such as an amino-terminal methionine residue, a small linker peptide of up to about 20-25 residues, or a small extension that facilitates purification (an affinity tag), such as a poly-histidine tract, protein A (Nilsson et al., EMBO J.
  • amino acid sequence changes can be made in the Zimlig2 sequence shown in amino acid residues 71 to 148 of SEQ ID NO:2 to obtain other Zimlig2 proteins. These changes are made so as to minimize disruption of higher order structure essential to biological activity. In particular, the arrangement of ⁇ -strands and loops will not be disrupted, thus it is preferred to make conservative amino acid substitutions within the ⁇ -strands, particularly when replacing hydrophobic residues. Those skilled in the art will recognize that hydrophobic and aromatic residues can sometimes substitute for each other in a sequence.
  • Essential amino acids in the proteins of the present invention can be identified according to procedures known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis (Cunningham and Wells, Science 244. 1081-1085, 1989; Bass et al., Proc. Natl. Acad. Sci. USA 88:4498-4502, 1991).
  • site-directed mutagenesis or alanine-scanning mutagenesis Cunningham and Wells, Science 244. 1081-1085, 1989; Bass et al., Proc. Natl. Acad. Sci. USA 88:4498-4502, 1991.
  • single alanine mutations are introduced at every residue in the molecule, and the resultant mutant molecules are tested for biological activity or other properties to identify amino acid residues that are critical to the activity of the molecule.
  • Cell activation can be assayed by measuring the expression of adhesion molecules or cytokines by responsive cells.
  • Adhesion molecules such as ICAM, VCAM, and E-selectin on endothelial cells are known to be induced by cytokines (Collins et al., J. Biol. Chem. 266:2466-2473. 1991; Iademarco et al., J. Biol. Chem. 267: 1623-16329, 1992; Voraberger et al., J. Immunol. 147: 2777-2786, 1991).
  • these and other molecules support leukocyte adhesion to the vessel wall and extravasation, which are key steps in the response to infection, inflammation, and tissue injury (Bevilacqua, Annu. Rev. Immunol. JJ_:767-804, 1993).
  • Human umbilical vein endothelial cells (HUVECs) are harvested from umbilical cord veins and established in primary culture by methods that are well known in the art. Up-regulation of adhesion molecules can be measured by flow cytometric methods utilizing antibodies specific for these cell surface markers, by an ELISA-type assay, or by measuring the adherence of immune cells such as monocytes, T-cells, or neutrophils.
  • Isolated cells can be used for this purpose, as can immortalized cells derived from these lineages, such as THP-I, U-937, HL-60, or Jurkat cells. Expression of these adhesion molecules can be measured in the presence or absence of IL-I ⁇ or other cytokines.
  • T cells, natural killer (NK) cells, and monocytes/macrophages are the main producers of cytokines (Cassatella, Immunology Today 16:21-26, 1995). Cytokine release can be induced in these cells by various inflammatory stimuli and can be measured by assay as disclosed by Parrilo, N. Engl. J. Med. 328: 1471-1477. 1993 or Eperon and Jungi, J. Immunol. Methods.
  • LPS lipopolysaccharride
  • THP-I monocytic cell line
  • Cytokine release can be detected by immunoassay, such as an ELISA using antibodies specific for the cytokine of interest. Both activation and inhibition of cytokine release can be measured by these methods. See, Sandborg et al., J. Immunol. 155:5206-5212. 1995.
  • the proteins of the present invention can further comprise amino- or carboxyl- terminal extensions, such as an amino-terminal methionine residue, a small linker peptide of up to about 20-25 residues, or an affinity tag as disclosed above. Two or more affinity tags may be used in combination. Polypeptides comprising affinity tags can further comprise a polypeptide linker and/or a proteolytic cleavage site between the Zimlig2 polypeptide and the affinity tag.
  • the present invention further provides a variety of other polypeptide fusions.
  • a Zimlig2 polypeptide can be prepared as a fusion to a dimerizing protein as disclosed in U.S. Patents Nos. 5,155,027 and 5,567,584.
  • Preferred dimerizing proteins in this regard include immunoglobulin constant region domains.
  • Immunoglobulin-Zimlig2 polypeptide fusions can be expressed in genetically engineered cells to produce a variety of multimeric Zimlig2 analogs.
  • a Zimlig2 polypeptide can be joined to another bioactive molecule, such as a cytokine, to provide a multi-functional molecule.
  • Zimlig2 polypeptide can be joined to another cytokine to enhance or otherwise modify its biological properties.
  • Auxiliary domains can be fused to Zimlig2 polypeptides to target them to specific cells, tissues, or macromolecules (e.g., collagen).
  • a Zimlig2 polypeptide or protein can be targeted to a predetermined cell type by fusing a Zimlig2 polypeptide to a ligand that specifically binds to a receptor on the surface of the target cell. In this way, polypeptides and proteins can be targeted for therapeutic or diagnostic purposes.
  • a Zimlig2 polypeptide can be fused to two or more moieties, such as an affinity tag for purification and a targeting domain. Polypeptide fusions can also comprise one or more cleavage sites, particularly between domains. See, Tuan et al., Connective Tissue Research 3 ⁇ :1-9, 1996.
  • Polypeptide fusions of the present invention will generally contain not more than about 1,500 amino acid residues, not more than about 1,200 residues, or not more than about 1,000 residues, and may in many cases be considerably smaller.
  • a truncated Zimlig2 polypeptide of 78 residues e.g. amino acid residues 71 to 148 of SEQ ID NO:2 or SEQ ID NO:5
  • E. coli /?-galactosidase (1,021 residues; see Casadaban et al., J. Bacteriol. 143:971-980. 1980
  • a 10-residue spacer e.g. amino acid residues 71 to 148 of SEQ ID NO:2 or SEQ ID NO:5
  • the present invention further provides polynucleotide molecules, including DNA and RNA molecules, encoding a truncated and mature Zimlig2.
  • the polynucleotides of the present invention include the sense strand; the anti-sense strand; and the DNA as double-stranded, having both the sense and anti-sense strand annealed together by hydrogen bonds.
  • a DNA sequence encoding truncated Zimlig2 is set forth beginning at position 290 of SEQ ID NO: 1 and ending at position 523 of SEQ ID NO: 1. Counterpart RNA sequences can be generated by substitution of U for T.
  • SEQ ID NO: 3 is a degenerate DNA sequence that encompasses all DNAs that encode the Zimlig2 polypeptide of SEQ ID NO: 2.
  • SEQ ID NO:8 is a degenerate DNA sequence that encompasses all DNAs that encode the Zimlig2 polypeptide of SEQ ID NO:7.
  • the degenerate sequence also provides all RNA sequences by substituting U for T.
  • the degenerate Zimlig2 polynucleotide consisting of SEQ ID NO:3, portions of degenerate polynucleotide encoding shorter Zimlig2 proteins, such as the mature and truncated Zimlig2 polypeptide as disclosed above, and the respective RNA equivalents are contemplated by the present invention.
  • WSN can, in some circumstances, encode arginine
  • MGN degenerate codon for arginine
  • AGY encode serine
  • the isolated polynucleotides will hybridize to similar sized regions of SEQ ID NO:4 or a sequence complementary thereto under stringent conditions.
  • stringent conditions are selected to be about 5°C lower than the thermal melting point (T m ) for the specific sequence at a defined ionic strength and pH.
  • T m is the temperature (under defined ionic strength and pH) at which 50% of the target sequence hybridizes to a perfectly matched probe.
  • Typical stringent conditions are those in which the salt concentration is up to about 0.03 M at pH 7 and the temperature is at least about 60 0 C.
  • Preferred codons for a particular species can be introduced into the polynucleotides of the present invention by a variety of methods known in the art. Introduction of preferred codon sequences into recombinant DNA can, for example, enhance production of the protein by making protein translation more efficient within a particular cell type or species. Therefore, the degenerate codon sequences disclosed in SEQ ID NO: 3 serves as templates for optimizing expression of polynucleotides in various cell types and species commonly used in the art and disclosed herein. Sequences containing preferred codons can be tested and optimized for expression in various host cell species, and tested for functionality as disclosed herein.
  • Zimlig2 polynucleotides provided by the present invention include DNA and RNA. Methods for preparing DNA and RNA are well known in the art. In general, RNA is isolated from a tissue or cell that produces large amounts of Zimlig2 RNA. Such tissues and cells are readily identified by Northern blotting (Thomas, Proc. Natl. Acad. Sci. USA 77:5201, 1980), and include bone marrow, fetal brain, fetal lung, lymph node, glioblastoma, monocytes, Daudi cells (a human Burkitt lymphoma cell line), and umbilical vein endothelial cells (HUVEC).
  • Total RNA can be prepared using guanidine-HCl extraction followed by isolation by centrifugation in a CsCl gradient (Chirgwin et al., Biochemistry 18:52-94, 1979).
  • Poly (A) + RNA is prepared from total RNA using the method of Aviv and Leder (Proc. Natl. Acad. Sci. USA 69:1408-12, 1972).
  • Complementary DNA (cDNA) is prepared from poly(A) + RNA using known methods. In the alternative, genomic DNA can be isolated. Polynucleotides encoding Zimlig2 polypeptides are then identified and isolated by, for example, hybridization or polymerase chain reaction (PCR).
  • polynucleotides of the present invention can also be synthesized using automated equipment ("gene machines") according to methods known in the art. See, for example, Glick and Pasternak, Molecular Biotechnology. Principles & Applications of Recombinant DNA. ASM Press, Washington, D.C., 1994; Itakura et al., Annu. Rev. Biochem. 53: 323-356, 1984; and Climie et al., Proc. Natl. Acad. Sci. USA 87:633-637. 1990.
  • the Zimlig2 polynucleotide sequence disclosed herein can be used to isolate polynucleotides encoding other Zimlig2 proteins.
  • Such other proteins include alternatively spliced cDNAs (including cDNAs encoding secreted Zimlig2 proteins) and counterpart polynucleotides from other species (orthologs).
  • orthologous polynucleotides can be used, inter alia, to prepare the respective orthologous proteins.
  • Other species of interest include, but are not limited to, mammalian, avian, amphibian, reptile, fish, insect and other vertebrate and invertebrate species.
  • Zimlig2 polynucleotides and proteins from other mammalian species including non- human primate, murine, porcine, ovine, bovine, canine, feline, and equine polynucleotides and proteins.
  • Orthologs of human Zimlig2 can be cloned using information and compositions provided by the present invention in combination with conventional cloning techniques.
  • a cDNA can be cloned using mRNA obtained from a tissue or cell type that expresses Zimlig2. Suitable sources of mRNA can be identified by PCR or by probing Northern blotting (Thomas, Proc. Natl. Acad. Sci.
  • a library is then prepared from mRNA of a positive tissue or cell line.
  • a Zimlig2-encoding cDNA can then be isolated by a variety of methods, such as by probing with a complete or partial human cDNA or with one or more sets of degenerate probes based on the disclosed sequences. Hybridization will generally be done under low stringency conditions, wherein washing is carried out in 1 x SSC with an initial wash at 40 0 C and with subsequent washes at 5°C higher intervals until background is suitably reduced.
  • a cDNA can also be cloned using the polymerase chain reaction, or PCR (Mullis, U.S. Patent No.
  • the cDNA library can be used to transform or transfect host cells, and expression of the cDNA of interest can be detected with an antibody to Zimlig2 polypeptide. Similar techniques can also be applied to the isolation of genomic clones.
  • SEQ ID NO: 1 represents a single allele of human Zimlig2, and that natural variation, including allelic variation and alternative splicing may occur. Allelic variants of this sequence can be cloned by probing cDNA or genomic libraries from different individuals according to standard procedures. Allelic variants of the DNA sequence shown in SEQ ID NO: 1, including those containing silent mutations and those in which mutations result in amino acid sequence changes, are within the scope of the present invention, as are allelic variations that encode proteins such as those comprising the amino acid sequences of SEQ ID NOs: 4, 5, 9, and 10. cDNAs generated from alternatively spliced mRNAs, which retain the immune modulating activity of Zimlig2 are included within the scope of the present invention, as are polypeptides encoded by such cDNAs and mRNAs.
  • Allelic variants and splice variants of these sequences can be cloned by probing cDNA or genomic libraries from different individuals or tissues according to standard procedures known in the art.
  • any Zimlig2 polypeptide including variants and fusion proteins
  • one of ordinary skill in the art can readily generate a fully degenerate polynucleotide sequence encoding that variant.
  • those of skill in the art can use standard software to devise Zimlig2 variants based upon the nucleotide and amino acid sequences described herein.
  • the present invention thus provides a computer-readable medium encoded with a data structure that provides at least one of the following sequences: SEQ ID NOs: 1 to 17 and portions thereof.
  • Suitable forms of computer-readable media include magnetic media and optically -readable media.
  • magnétique media examples include a hard or fixed drive, a random access memory (RAM) chip, a floppy disk, digital linear tape (DLT), a disk cache, and a ZIPTM disk.
  • Optically readable media are exemplified by compact discs (e.g., CD-read only memory (ROM), CD-rewritable (RW), and CD-recordable), and digital versatile/video discs (DVD) (e.g., DVD-ROM, DVD-RAM, and DVD+RW).
  • compact discs e.g., CD-read only memory (ROM), CD-rewritable (RW), and CD-recordable
  • DVD digital versatile/video discs
  • the proteins of the present invention can be produced in genetically engineered host cells according to conventional techniques.
  • Suitable host cells are those cell types that can be transformed or transfected with exogenous DNA and grown in culture, and include bacteria, fungal cells, and cultured higher eukaryotic cells. Eukaryotic cells, particularly cultured cells of multicellular organisms, are preferred.
  • a DNA sequence encoding a truncated Zimlig2 protein is operably linked to other genetic elements required for its expression, generally including a transcription promoter and terminator, within an expression vector.
  • the vector will also commonly contain one or more selectable markers and one or more origins of replication, although those skilled in the art will recognize that within certain systems selectable markers may be provided on separate vectors, and replication of the exogenous DNA may be provided by integration into the host cell genome. Selection of promoters, terminators, selectable markers, vectors and other elements is a matter of routine design within the level of ordinary skill in the art. Many such elements are described in the literature and are available through commercial suppliers.
  • a secretory signal sequence (also known as a leader sequence, prepro sequence or pre sequence) is provided in the expression vector.
  • the secretory signal sequence may be that of a Zimlig2 gene, or may be derived from another secreted protein (e.g., t-PA) or synthesized de novo.
  • the secretory signal sequence is operably linked to the truncated Zimlig2 DNA sequence, i.e., the two sequences are joined in the correct reading frame and positioned to direct the newly synthesized polypeptide into the secretory pathway of the host cell.
  • Secretory signal sequences are commonly positioned 5' to the DNA sequence encoding the polypeptide of interest, although certain signal sequences may be positioned elsewhere in the DNA sequence of interest (see, e.g., Welch et al., U.S. Patent No. 5,037,743; Holland et al., U.S. Patent No. 5,143,830).
  • a Zimlig2 protein is expressed cytoplasmically and is isolated after lysing the host cells.
  • An expression vector can be introduced into host cells using a variety of standard techniques including calcium phosphate transfection, liposome-mediated transfection, microprojectile- mediated delivery, electroporation, and the like. Transfected cells can be selected and propagated to provide recombinant host cells that comprise the gene of interest stably integrated in the host cell genome.
  • Cultured mammalian cells are suitable hosts for use within the present invention.
  • Methods for introducing exogenous DNA into mammalian host cells include calcium phosphate- mediated transfection (Wigler et al., Cell 14:725, 1978; Corsaro and Pearson, Somatic Cell Genetics 7:603, 1981; and Graham and Van der Eb, Virology 52:456, 1973), electroporation (Neumann et al., EMBO J.
  • Suitable cultured mammalian cells include the COS-I (ATCC No. CRL 1650), COS-7 (ATCC No. CRL 1651), BHK (ATCC No. CRL 1632), BHK 570 (ATCC No. CRL 10314), 293 (ATCC No. CRL 1573; Graham et al., J. Gen. Virol. 36:59-72, 1977) and Chinese hamster ovary (e.g. CHO-Kl; ATCC No. CCL 61) cell lines. Additional suitable cell lines are known in the art and available from public depositories such as the American Type Culture Collection, Rockville, Maryland. In general, strong transcription promoters are preferred, such as promoters from SV-40 or cytomegalovirus.
  • promoters include those from metallothionein genes (U.S. Patent Nos. 4,579,821 and 4,601,978) and the adenovirus major late promoter.
  • Drug selection is generally used to select for cultured mammalian cells into which foreign DNA has been inserted. Such cells are commonly referred to as “transfectants”. Cells that have been cultured in the presence of the selective agent and are able to pass the gene of interest to their progeny are referred to as “stable transfectants.”
  • An exemplary selectable marker is a gene encoding resistance to the antibiotic neomycin. Selection is carried out in the presence of a neomycin-type drug, such as G-418 or the like.
  • Selection systems can also be used to increase the expression level of the gene of interest, a process referred to as "amplification.” Amplification is carried out by culturing transfectants in the presence of a low level of the selective agent and then increasing the amount of selective agent to select for cells that produce high levels of the products of the introduced genes.
  • An exemplary amplifiable selectable marker is dihydrofolate reductase, which confers resistance to methotrexate.
  • Other drug resistance genes e.g. hygromycin resistance, multidrug resistance, puromycin acetyltransferase
  • drug resistance genes e.g. hygromycin resistance, multidrug resistance, puromycin acetyltransferase
  • the amino acid sequence of interest can be produced by a eukaryotic cell, such as a mammalian cell, fungal cell, plant cell, insect cell, avian cell, and the like.
  • a mammalian host cells include African green monkey kidney cells (Vero; ATCC CRL 1587), human embryonic kidney cells (293-HEK; ATCC CRL 1573), baby hamster kidney cells (BHK-21, BHK- 570; ATCC CRL 8544, ATCC CRL 10314), canine kidney cells (MDCK; ATCC CCL 34), Chinese hamster ovary cells (CHO-Kl; ATCC CCL61; CHO DG44 (Chasin et al, Som. Cell. Molec. Genet.
  • rat pituitary cells GHl; ATCC CCL82
  • HeLa S3 cells ATCC CCL2.2
  • rat hepatoma cells H-4-II-E; ATCC CRL 1548
  • COS-I SV40-transformed monkey kidney cells
  • NIH-3T3 ATCC CRL 1658
  • Insect cells can be infected with recombinant baculovirus, commonly derived from Autographa californica nuclear polyhedrosis virus (AcNPV). See, King and Possee, The Baculovirus Expression System: A Laboratory Guide. London, Chapman & Hall; O'Reilly et al., Baculovirus Expression Vectors: A Laboratory Manual. New York, Oxford University Press., 1994; and Richardson, Ed., Baculovirus Expression Protocols. Methods in Molecular Biology. Humana Press, Totowa, NJ, 1995. Recombinant baculovirus can also be produced through the use of a transposon- based system described by Luckow et al. (J. Virol.
  • This system which utilizes transfer vectors, is commercially available in kit form (Bac-to-BacTM kit; Life Technologies, Rockville, MD).
  • the transfer vector e.g., pFastBaclTM; Life Technologies
  • the transfer vector contains a Tn7 transposon to move the DNA encoding the protein of interest into a baculovirus genome maintained in E. coli as a large plasmid called a "bacmid.” See, Hill-Perkins and Possee, J. Gen. Virol. 71 :971-976, 1990; Bonning et al., J. Gen. Virol. 75: 1551-1556, 1994; and Chazenbalk and Rapoport, J. Biol.
  • transfer vectors can include an in-frame fusion with DNA encoding a polypeptide extension or affinity tag as disclosed above.
  • a transfer vector containing a truncated Zimlig2-encoding sequence is transformed into E. coli host cells, and the cells are screened for bacmids which contain an interrupted lacZ gene indicative of recombinant baculovirus.
  • the bacmid DNA containing the recombinant baculovirus genome is isolated, using common techniques, and used to transfect Spodoptera frugiperda cells, such as Sf9 cells.
  • Recombinant virus that expresses Zimlig2 protein is subsequently produced.
  • Recombinant viral stocks are made by methods commonly used the art.
  • the recombinant virus is used to infect host cells, typically a cell line derived from the fall armyworm, Spodoptera frugiperda (e.g., Sf9 or Sf21 cells) or Trichoplusia ni (e.g., High FiveTM cells; Invitrogen, Carlsbad, CA).
  • host cells typically a cell line derived from the fall armyworm, Spodoptera frugiperda (e.g., Sf9 or Sf21 cells) or Trichoplusia ni (e.g., High FiveTM cells; Invitrogen, Carlsbad, CA).
  • Spodoptera frugiperda e.g., Sf9 or Sf21 cells
  • Trichoplusia ni e.g., High FiveTM cells; Invitrogen, Carlsbad, CA.
  • Serum- free media are used to grow and maintain the cells. Suitable media formulations are known in the art and can be obtained from commercial suppliers.
  • the cells are grown up from an inoculation density of approximately 2-5 x 10 5 cells to a density of 1 -2 x 10 6 cells, at which time a recombinant viral stock is added at a multiplicity of infection (MOI) of 0.1 to 10, more typically near 3.
  • MOI multiplicity of infection
  • Fungal cells including yeast cells, can also be used within the present invention.
  • Yeast species of particular interest in this regard include Saccharomyces cerevisiae, Pichia pastoris, and Pichia methanolica.
  • Methods for transforming S. cerevisiae cells with exogenous DNA and producing recombinant polypeptides there from are disclosed by, for example, Kawasaki, U.S. Patent No. 4,599,311; Kawasaki et al., U.S. Patent No. 4,931,373; Brake, U.S. Patent No. 4,870,008; Welch et al., U.S. Patent No. 5,037,743; and Murray et al., U.S. Patent No.
  • Transformed cells are selected by phenotype determined by the selectable marker, commonly drug resistance or the ability to grow in the absence of a particular nutrient (e.g., leucine).
  • a preferred vector system for use in Saccharomyces cerevisiae is the POTl vector system disclosed by Kawasaki et al. (U.S. Patent No. 4,931,373), which allows transformed cells to be selected by growth in glucose-containing media.
  • Suitable promoters and terminators for use in yeast include those from glycolytic enzyme genes (see, e.g., Kawasaki, U.S. Patent No. 4,599,311; Kingsman et al., U.S. Patent No. 4,615,974; and Bitter, U.S. Patent No.
  • Pichia methanolica as host for the production of recombinant proteins is disclosed by Raymond, U.S. Patent No. 5,716,808, Raymond, U.S. Patent No. 5,736,383, Raymond et al., Yeast .14: 11-23 (1998), and in international publication Nos. WO 97/17450, WO 97/17451, WO 98/02536, and WO 98/02565.
  • DNA molecules for use in transforming P. methanolica will commonly be prepared as double-stranded, circular plasmids, which are preferably linearized prior to transformation. For polypeptide production in P.
  • the promoter and terminator in the plasmid can be that of a P. methanolica gene, such as a P. methanolica alcohol utilization gene (AUGl or AUG2).
  • P. methanolica alcohol utilization gene such as a P. methanolica alcohol utilization gene (AUGl or AUG2).
  • Other useful promoters include those of the dihydroxyacetone synthase (DHAS), formate dehydrogenase (FMD), and catalase (CAT) genes.
  • DHAS dihydroxyacetone synthase
  • FMD formate dehydrogenase
  • CAT catalase
  • P. methanolica cells can be transformed by electroporation using an exponentially decaying, pulsed electric field having a field strength of from 2.5 to 4.5 kV/cm, preferably about 3.75 kV/cm, and a time constant (t) of from 1 to 40 milliseconds, preferably about 20 milliseconds.
  • Prokaryotic host cells including strains of the bacteria Escherichia coli, Bacillus and other genera are also useful host cells within the present invention. Techniques for transforming these hosts and expressing foreign DNA sequences cloned therein are well known in the art (see, e.g., Sambrook et al., ibid.). When expressing a truncated Zimlig2 polypeptide in bacteria such as E. coli, the polypeptide may be retained in the cytoplasm, either in soluble form or as insoluble granules, or may be directed to the periplasmic space by a bacterial secretion sequence.
  • the cells are lysed, and the granules are recovered and denatured using, for example, guanidine isothiocyanate or urea.
  • the denatured polypeptide can then be refolded and dimerized by diluting the denaturant, such as by dialysis against a solution of urea and a combination of reduced and oxidized glutathione, followed by dialysis against a buffered saline solution.
  • the polypeptide can be recovered from the periplasmic space in a soluble and functional form by disrupting the cells (by, for example, sonication or osmotic shock) to release the contents of the periplasmic space and recovering the protein, thereby obviating the need for denaturation and refolding.
  • Expression vectors can also be introduced into plant protoplasts, intact plant tissues, or isolated plant cells.
  • Methods for introducing nucleic acid molecules into plant tissue include the direct infection or co-cultivation of plant tissue with Agrobacterium tumefaciens, microprojectile-mediated delivery, DNA injection, electroporation, and the like. See, for example, Horsch et al., Science 227:1229 (1985), Klein et al., Biotechnology 10:268 (1992), and Miki et al, "Procedures for Introducing Foreign DNA into Plants," in Methods in Plant Molecular Biology and Biotechnology, Glick et al (eds.), pages 67-88 (CRC Press, 1993).
  • Transformed or transfected host cells are cultured according to conventional procedures in a culture medium containing nutrients and other components required for the growth of the chosen host cells.
  • suitable media including defined media and complex media, are known in the art and generally include a carbon source, a nitrogen source, essential amino acids, vitamins and minerals. Media may also contain such components as growth factors or serum, as required.
  • the growth medium will generally select for cells containing the exogenously added DNA by, for example, drug selection or deficiency in an essential nutrient which is complemented by the selectable marker carried on the expression vector or co-transfected into the host cell.
  • polypeptides of the present invention can be synthesized by exclusive solid phase synthesis, partial solid phase methods, fragment condensation or classical solution synthesis. These synthesis methods are well-known to those of skill in the art (see, for example, Merrifield, J. Am. Chem. Soc. 85:2149 (1963), Stewart et al, "Solid Phase Peptide Synthesis” (2nd Edition), (Pierce Chemical Co. 1984), Bayer and Rapp. Chem. Pept. Prot.
  • Zimlig2 peptides may be synthesized by solid phase peptide synthesis using a model 43 IA Peptide Synthesizer (Applied Biosystems/Perkin Elmer, Foster City, CA). Flouren-9- ylmethoxycarbonyl (Fmoc)-Glutamine resin (0.63 mmol/g; Advanced Chemtech, Louisville, KY) is used as the initial support resin. 1 mmol amino acid cartridges (Anaspec, Inc. San Jose, CA) are used for synthesis.
  • HBTU 2(l-Hbenzotriazol-y-yl 1,1,3,3-tetrahmethylhyluronium hexafluorophosphate
  • HOBt 1 -hydroxybenzotriazol
  • 2m N,N-Diisolpropylethylamine, N- Methylpyrrolidone, Dichloromethane (all from Applied Biosystems/Perkin Elmer) and piperidine (Aldrich Chemical Co., St. Louis, MO), are used for synthesis reagents.
  • the Peptide Companion software (Peptides International, Louisville, KY) is used to predict the aggregation potential and difficulty level for synthesis for the these peptides. Synthesis is performed using single coupling programs, according to the manufacturer's specifications.
  • the peptide is truncated from the solid phase following standard TFA cleavage procedure (according to Peptide Cleavage manual, Applied Biosystems/Perkin Elmer). Purification of the peptide is done by RP-HPLC using a Cl 8, 10 ⁇ m semi-peparative column (Vydac, Hesperial, CA). Eluted fractions from the column are collected and analyzed for correct mass and purity by electrospray mass spectrometry.
  • One or more serine residues of a Zimlig2 protein may be modified to include an O- glycosylation or carbohydrate epitope such as Sle x (sialyl lewis x oligosaccharide) or other sialyl lewis.
  • Sle x sialyl lewis x oligosaccharide
  • the peptide is synthesized by Fmoc chemistry with all of the amino acids protected, except for the hydroxyl group of the serine in position 142 of SEQ ID NO:2. While still attached to the resin, this hydroxyl group of serine is acylated to add the modification. After reaction, the peptide is truncated from the resin and protection groups removed. Then the peptide is purified by reverse phase HPLC.
  • One or more tyrosine residues of the Zimlig2 protein may be sulfated.
  • the peptide is synthesized by Fmoc chemistry: the sulfated peptide chain is directly constructed on 2-chlorotrityl resin with Fmoc-based solid-phase chemistry using Fmoc-Tyr(SO 3 Na)-OH as a building block.
  • Kitagawa Kouki et al., The Journal of Organic Chemistry 66(l):l-10 (2001).
  • the protected peptide -resin is treated with 90% aqueous TFA at 0 0 C for an appropriate period of time for cleavage and deprotection.
  • the peptide may be synthesized by Fmoc chemistry but with all the amino acid residues protected except for the tyrosine residues to be sulfated.
  • the tyrosine sulfation my be aided by using addition of tyrosylprotein sulfotransferase (TPST).
  • TPST tyrosylprotein sulfotransferase
  • Truncated Zimlig2 protein may be produced by Fmoc synthesis, using the methods described above, but without further serine modification to include an O-glycosylation or carbohydrate epitope such as Sle x (sialyl lewis x oligosaccharide) or other sialyl lewis; and without further tyrosine sulfations.
  • Sle x sialyl lewis x oligosaccharide
  • sialyl lewis sialyl lewis
  • one or more of the tyrosine residues of the Zimlig2 protein may be phosphated instead of sulfated. Hofsteenge, Jan et al. shows that, on Hirudin, replacing tyrosine sulfates with phosphates restores all of the activity lost by prior removal of the sulfation modifications to tyrosine.
  • proteins of the present invention it is preferred to purify the proteins of the present invention to >80% purity, to >90% purity, >95% purity, or a pharmaceutically pure state, that is greater than 99.9% pure with respect to contaminating macromolecules, particularly other proteins and nucleic acids, and free of infectious and pyrogenic agents.
  • a purified protein is substantially free of other proteins, particularly other proteins of animal origin.
  • Zimlig2 proteins (including fusion proteins) are purified by conventional protein purification methods, typically by a combination of chromatographic techniques. See, in general, Affinity Chromatography: Principles & Methods, Pharmacia LKB Biotechnology, Uppsala, Sweden, 1988; and Scopes, Protein Purification: Principles and Practice, Springer- Verlag, New York, 1994.
  • Proteins comprising a polyhistidine affinity tag are purified by affinity chromatography on an immobilized nickel or cobalt resin. See, for example, Houchuli et al., Bio/Technol. 6: 1321-1325, 1988. Proteins comprising a glu-glu tag can be purified by immunoaffinity chromatography according to conventional procedures. See, for example, Grussenmeyer et al., ibid. Maltose binding protein fusions are purified on an amylose column according to methods known in the art.
  • Animal models of psoriasis include the analysis of histological alterations in adult mouse tail epidermis (Hofbauer et al, Brit. J. Dermatol. 118:85-89. 1988; Bladon et al., Arch Dermatol. Res. 277: 121-125, 1985).
  • anti-psoriatic activity is indicated by the induction of a granular layer and orthokeratosis in areas of scale between the hinges of the tail epidermis.
  • a topical ointment is applied daily for seven consecutive days, then the animal is sacrificed, and tail skin is examined histologically.
  • inflammation is induced in guinea pig epidermis by topically applying phorbol ester (phorbol-12-myristate-13-acetate; PMA), typically at ca. 2 g/ml in acetone, to one ear and vehicle to the contralateral ear.
  • PMA phorbol ester
  • Test compounds are applied concurrently with the PMA, or may be given orally. Histological analysis is performed at 96 hours after application of PMA. This model duplicates many symptoms of human psoriasis, including edema, inflammatory cell diapedesis and infiltration, high LTB4 levels and epidermal proliferation.
  • EAE allergic encephalomyelitis
  • Wound-healing models include the linear skin incision model of Mustoe et al. (Science 237: 1333. 1987). In a typical procedure, a 6-cm incision is made in the dorsal pelt of an adult rat, then closed with wound clips. Test substances and controls (in solution, gel, or powder form) are applied before primary closure. It is preferred to limit administration to a single application, although additional applications can be made on succeeding days by careful injection at several sites under the incision. Wound breaking strength is evaluated between 3 and 21 days post wounding. In a second model, multiple, small, full-thickness excisions are made on the ear of a rabbit.
  • the cartilage in the ear splints the wound, removing the variable of wound contraction from the evaluation of closure.
  • Experimental treatments and controls are applied.
  • the geometry and anatomy of the wound site allow for reliable quantification of cell ingrowth and epithelial migration, as well as quantitative analysis of the biochemistry of the wounds (e.g., collagen content). See, Mustoe et al., J. Clin. Invest. 87:694, 1991.
  • the rabbit ear model can be modified to create an ischemic wound environment, which more closely resembles the clinical situation (Ahn et al., Ann. Plast. Surg. 24: 17. 1990).
  • Impaired wound healing models are also known in the art (e.g., Cromack et al., Surgery 113:36. 1993; Pierce et al., Proc. Natl. Acad. Sci. USA 86:2229, 1989; Greenhalgh et al., Amer. J. Pathol. 136:1235. 1990).
  • Delay or prolongation of the wound healing process can be induced pharmacologically by treatment with steroids, irradiation of the wound site, or by concomitant disease states (e.g., diabetes). Linear incisions or full-thickness excisions are most commonly used as the experimental wound. Endpoints are as disclosed above for each type of wound.
  • Subcutaneous implants can be used to assess compounds acting in the early stages of wound healing (Broadley et al., Lab. Invest. 61:571, 1985; Sprugel et al., Amer. J. Pathol. 129: 601, 1987).
  • Implants are prepared in a porous, relatively non-inflammatory container (e.g., polyethylene sponges or expanded polytetrafluoroethylene implants filled with bovine collagen) and placed subcutaneously in mice or rats.
  • the interior of the implant is empty of cells, producing a "wound space" that is well- defined and separable from the preexisting tissue. This arrangement allows the assessment of cell influx and cell type as well as the measurement of vasculogenesis/angiogenesis and extracellular matrix production.
  • Microarrays provide a common platform for analysis of transcriptional regulation that can be applied to cells subjected to a variety of stimuli, to whole tissues for assessment of normal expression profiles, and to diseased tissues in comparison with their normal counterparts.
  • the Gene Expression Omnibus (GEO) is a public repository that archives and freely distributes microarray and other forms of high-throughput data submitted by the scientific community.
  • GEO Gene Expression Omnibus
  • Zimlig2 expression is lost or radically reduced during tumor progression, which may indicate selective pressure favoring growth of Zimlig2 -negative cells. Thus Zimlig2 expression may inhibit tumor metastasis.
  • the activity of Zimlig2 proteins can be measured with a silicon-based biosensor microphysiometer that measures the extracellular acidification rate or proton excretion associated with receptor binding and subsequent physiologic cellular responses.
  • a silicon-based biosensor microphysiometer that measures the extracellular acidification rate or proton excretion associated with receptor binding and subsequent physiologic cellular responses.
  • An example of such a device is the CytosensorTM Microphysiometer manufactured by Molecular Devices, Sunnyvale, CA.
  • a variety of cellular responses, such as cell proliferation, ion transport, energy production, inflammatory response, regulatory and receptor activation, and the like, can be measured by this method. See, for example, McConnell et al., Science 257: 1906-1912, 1992; Pitchford et al., Meth. Enzymol. 228:84-108, 1997; Arimilli et al., J. Immunol. Meth.
  • the microphysiometer can be used for assaying adherent or non-adherent eukaryotic or prokaryotic cells. By measuring extracellular acidification changes in cell media over time, the microphysiometer directly measures cellular responses to various stimuli, including Zimlig2 proteins, their agonists, and antagonists. The microphysiometer is used to measure responses of a Zimlig2- responsive eukaryotic cell, compared to a control eukaryotic cell that does not respond to Zimlig2 polypeptide.
  • Zimlig2 -responsive eukaryotic cells comprise cells into which a receptor for Zimlig2 has been transfected, thereby creating a cell that is responsive to Zimlig2, as well as cells naturally responsive to Zimlig2. Differences, measured by a change, for example, an increase or diminution in extracellular acidification, in the response of cells exposed to Zimlig2 polypeptide, relative to a control not exposed to Zimlig2, are a direct measurement of Zimlig2-modulated cellular responses. Moreover, such Zimlig2-modulated responses can be assayed under a variety of stimuli.
  • the present invention thus provides methods of identifying agonists and antagonists of Zimlig2 proteins, comprising providing cells responsive to a Zimlig2 polypeptide, culturing a first portion of the cells in the absence of a test compound, culturing a second portion of the cells in the presence of a test compound, and detecting a change, for example, an increase or diminution, in a cellular response of the second portion of the cells as compared to the first portion of the cells.
  • the change in cellular response is shown as a measurable change in extracellular acidification rate.
  • Culturing a third portion of the cells in the presence of a Zimlig2 protein and the absence of a test compound provides a positive control for the Zimlig2 -responsive cells and a control to compare the agonist activity of a test compound with that of the Zimlig2 polypeptide.
  • Antagonists of Zimlig2 can be identified by exposing the cells to Zimlig2 protein in the presence and absence of the test compound, whereby a reduction in Zimlig2-stimulated activity is indicative of antagonist activity in the test compound.
  • the activity of truncated Zimlig2 can also be measured using assays known in the art. Assays are known that can be used to measure Zimlig2's effect on endothelial to leukocyte binding. (Vedder, Nicholas B. and Harlan, John M., J. Clin. Invest. 81:676-682 (1988)). Assays are also known in the art that can be used to measure Zimlig2's binding to L-selectin, implicated in lymphocyte homing; P-selectin implicated in neutrophil recruitment; and E-selectin the binding to which is induced in inflammation.
  • Zimlig2 proteins and epitope-bearing portions thereof can be used to generate antibodies that specifically bind to Zimlig2.
  • An "epitope" is a region of a protein to which an antibody can bind. See, for example, Geysen et al., Proc. Natl. Acad. Sci. USA 81:3998-4002, 1984.
  • Epitopes can be linear or conformational, the latter being composed of discontinuous regions of the protein that form an epitope upon folding of the protein. Linear epitopes are generally at least 6 amino acid residues in length. Relatively short synthetic peptides that mimic part of a protein sequence are routinely capable of eliciting an antiserum that reacts with the partially mimicked protein.
  • Antibodies that recognize short, linear epitopes are particularly useful in analytic and diagnostic applications that employ denatured protein, such as Western blotting (Tobin, Proc. Natl. Acad. Sci. USA 76:4350-4356, 1979), or in the analysis of fixed cells or tissue samples.
  • Antibodies to linear epitopes are also useful for detecting fragments of Zimlig2 in, for example, body fluids or cell culture media.
  • Antigenic, epitope-bearing polypeptides contain a sequence of at least six or at least nine contiguous amino acid residues of the truncated Zimlig2 protein (amino acid residues 71 to 148 of SEQ ID NO:2). Polypeptides comprising a larger portion of a Zimlig2 protein, i.e. from 15 to 30 residues or up to the entire sequence, can also be used.
  • the amino acid sequence of the epitope- bearing polypeptide is selected to provide substantial solubility in aqueous solvents, that is the sequence includes relatively hydrophilic residues, and hydrophobic residues are substantially avoided.
  • antibodies includes polyclonal antibodies, monoclonal antibodies, antigen-binding fragments thereof such as F(ab')2 and Fab fragments, single chain antibodies, and the like, including genetically engineered antibodies.
  • Non-human antibodies can be humanized by grafting only non-human CDRs onto human framework and constant regions, or by incorporating the entire non-human variable domains (optionally "cloaking” them with a human-like surface by replacement of exposed residues, wherein the result is a "veneered” antibody).
  • humanized antibodies may retain non-human residues within the human variable region framework domains to enhance proper binding characteristics.
  • humanizing antibodies biological half-life may be increased, and the potential for adverse immune reactions upon administration to humans is reduced.
  • One skilled in the art can generate humanized antibodies with specific and different constant domains (i.e., different Ig subclasses) to facilitate or inhibit various immune functions associated with particular antibody constant domains.
  • Alternative techniques for generating or selecting antibodies useful herein include in vitro exposure of lymphocytes to a Zimlig2 protein, and selection of antibody display libraries in phage or similar vectors (for instance, through use of immobilized or labeled Zimlig2 polypeptide).
  • Antibodies are defined to be specifically binding if they bind to a Zimlig2 protein with an affinity at least 10-fold greater than the binding affinity to control (non-Zimlig2) polypeptide.
  • the antibodies should exhibit a binding affinity (K a ) of 10 M or greater, 10 M or greater, 10 M or greater, or 10 M or greater.
  • K a binding affinity
  • the affinity of a monoclonal antibody can be readily determined by one of ordinary skill in the art (see, for example, Scatchard. Ann. NY Acad. Sci. 51 : 660-672, 1949).
  • Methods for preparing polyclonal and monoclonal antibodies are well known in the art (see for example, Hurrell, J. G. R., Ed., Monoclonal Hybridoma Antibodies: Techniques and Applications, CRC Press, Inc., Boca Raton, FL, 1982).
  • polyclonal antibodies can be generated from a variety of warm-blooded animals such as horses, cows, goats, sheep, dogs, chickens, rabbits, mice, and rats.
  • the immunogenicity of a Zimlig2 protein may be increased through the use of an adjuvant such as alum (aluminum hydroxide) or Freund's complete or incomplete adjuvant.
  • Polypeptides useful for immunization also include fusion polypeptides, such as fusions of a Zimlig2 protein or a portion thereof with an immunoglobulin polypeptide or with maltose binding protein.
  • the polypeptide immunogen may be a full-length molecule or a portion thereof.
  • polypeptide portion is "hapten-like"
  • such portion may be advantageously joined or linked to a macromolecular carrier (such as keyhole limpet hemocyanin (KLH), bovine serum albumin (BSA) or tetanus toxoid) for immunization.
  • a macromolecular carrier such as keyhole limpet hemocyanin (KLH), bovine serum albumin (BSA) or tetanus toxoid
  • a variety of assays known to those skilled in the art can be used to detect antibodies that specifically bind to a Zimlig2 protein. Exemplary assays are described in detail in Antibodies: A Laboratory Manual, Harlow and Lane (Eds.), Cold Spring Harbor Laboratory Press, 1988. Representative examples of such assays include concurrent Immunoelectrophoresis, radioimmunoassays, radio-immunoprecipitations, enzyme-linked immunosorbent assays (ELISA), dot blot assays, Western blot assays, inhibition or competition assays, and sandwich assays.
  • ELISA enzyme-linked immunosorbent assays
  • Antibodies to Zimlig2 may be used for affinity purification of Zimlig2 proteins; within diagnostic assays for determining circulating levels of Zimlig2 proteins; for detecting or quantitating soluble Zimlig2 protein as a marker of underlying pathology or disease; for immunolocalization within whole animals or tissue sections, including immunodiagnostic applications; for immunohistochemistry; for screening expression libraries; and for other uses that will be evident to those skilled in the art. For certain applications, including in vitro and in vivo diagnostic uses, it is advantageous to employ labeled antibodies.
  • Suitable direct tags or labels include radionuclides, enzymes, substrates, cofactors, inhibitors, fluorescent markers, chemiluminescent markers, magnetic particles and the like; indirect tags or labels may feature use of biotin-avidin or other complement/anti-complement pairs as intermediates.
  • the antibodies or antibody fragments as described herein that bind to Zimlig2 may also be used as Zimlig2 antagonists.
  • the antibodies may be used to inhibit or prevent an immune response, to inhibit or prevent Leukocyte adhesion to endothelial cells, and/or to inhibit or prevent T cell proliferation.
  • the present invention also provides polynucleotide reagents for diagnostic use.
  • a Zimlig2 gene, a probe comprising Zimlig2 DNA or RNA, or a subsequence thereof can be used to determine if the Zimlig2 gene is present on chromosome 2 of a human patient or if a mutation has occurred.
  • Detectable chromosomal aberrations at the Zimlig2 gene locus include, but are not limited to, aneuploidy, gene copy number changes, insertions, deletions, restriction site changes and rearrangements.
  • Such aberrations can be detected using polynucleotides of the present invention by employing molecular genetic techniques, such as restriction fragment length polymorphism (RFLP) analysis, short tandem repeat (STR) analysis employing PCR techniques, and other genetic linkage analysis techniques known in the art (Sambrook et al., ibid.; Ausubel et. al., ibid.; AJ. Marian, Chest 108:255-265, 1995).
  • molecular genetic techniques such as restriction fragment length polymorphism (RFLP) analysis, short tandem repeat (STR) analysis employing PCR techniques, and other genetic linkage analysis techniques known in the art (Sambrook et al., ibid.; Ausubel et. al., ibid.; AJ. Marian, Chest 108:255-265, 1995).
  • the proteins of the present invention are formulated for local, including topical, or parenteral, including intravenous, subcutaneous, or intraperitoneal delivery according to conventional methods.
  • Intravenous administration will be by injection or infusion. In many instances it will be beneficial to administer the protein by infusion or multiple injections per day over a period of several days to several weeks, sometimes preceded by a bolus injection.
  • pharmaceutical formulations will include a Zimlig2 protein in combination with a pharmaceutically acceptable vehicle, such as saline, buffered saline, 5% dextrose in water or the like.
  • Formulations may further include one or more excipients, preservatives, solubilizers, buffering agents, albumin to prevent protein loss on vial surfaces, etc.
  • excipients such as, but not limited to, KCl, KCl, KCl, KCl, KCl, KCl, KCl, KCl, KCl, KCl, KCl, KCl, KCl, KCl, glycerin, etc.
  • Therapeutic doses will generally be in the range of 0.1 to 100 ⁇ g/kg of patient weight per day, or 0.5-20 mg/kg per day, with the exact dose determined by the clinician according to accepted standards, taking into account the nature and severity of the condition to be treated, patient traits, etc. Determination of dose is within the level of ordinary skill in the art.
  • the proteins may be administered for acute treatment, over one week or less, often over a period of one to three days or may be used in chronic treatment, over several months or years.
  • a therapeutically effective amount of Zimlig2 polypeptide is an amount sufficient to produce a clinically significant effect.
  • Example 1 Expression of murine Zimlig2 mRNA on Northern Blots
  • Murine Zimlig2 mRNA was cut with EcoRI and Pstl in buffer H to generate a 270bp fragment for use in northern blots. The following was combined: 30 ⁇ l murine Zimlig2 mRNA, l ⁇ l each of the restriction enzymes EcoRI and Pstl (New England BioLab, Ipswich, MA), 4 ⁇ l buffer H (New England BioLab, Ipswich, MA), and 4 ⁇ l sterile water. The reaction was then incubated at 37°C for one hour and was run in 2% agarose gel. The fragment was purified using Qiagen gel purification columns (Qiagen, Valencia, CA) according to the manufacturer's instructions.
  • Qiagen gel purification columns Qiagen, Valencia, CA
  • fragment was then quantitated by a spectrophotometer reading. 50 or 25ng of fragment was labeled using Prime-It II reagents (Stratagene, La Jolla, CA) according to the manufacturer's instructions, and separated from unincorporated nucleotides using an S-200 microspin column (Amersham, Piscataway, NJ) according to the manufacturer's protocol.
  • Prime-It II reagents Stratagene, La Jolla, CA
  • S-200 microspin column Amersham, Piscataway, NJ
  • the blots to be probed with murine Zimlig2 (specifically Mouse Multiple Tissue Northern Blots I, II and Mouse Embryo Multiple Tissue Northern Blot, all from BD Biosciences, Clontech, Palo Alto, CA) were prehybridized overnight at 55°C in ExpressHyb (BD Biosciences, Clontech Palo Alto, CA) in the presence of 100ug/ml salmon sperm DNA (Stratagene, La Jolla, CA) and 6ug/ml cot-I DNA (Invitrogen, Carlsbad, CA), all of which were boiled and snap-chilled prior to adding to the blots.
  • murine Zimlig2 specifically Mouse Multiple Tissue Northern Blots I, II and Mouse Embryo Multiple Tissue Northern Blot, all from BD Biosciences, Clontech, Palo Alto, CA
  • Radiolabeled murine Zimlig2, salmon sperm DNA, and cot-1 DNA were mixed together and boiled for 5 minutes, followed by a snap chilling on ice.
  • the final concentrations of the salmon sperm DNA and the cot- 1 DNA were the same as in the prehybridization step and the final concentration of the radiolabeled murine Zimlig2 was 1x10 6 cpm/ml.
  • the blots were hybridized overnight in a roller oven at 55°C, then washed copiously at room temperature in 2X SSC, 0.1% SDS, with several buffer changes, then at 65°C. The final wash was at 65°C in 0.1X SSC, 0.1%SDS. Blots were then exposed to film with intensifying screens for 14 days.
  • the Mouse Multiple Tissue Northern Blots I, II and Mouse Embryo Multiple Tissue Northern Blot were then probed with a transferrin receptor probe, generated as follows: IuI of sense primer, zclO565 (5' TTTGCAGAAAAGGTTGCAAATGC 3', SEQ ID NO: 11) and IuI of antisense primer, zclO651 (5' AGCTTTTCTGCAGCAGCTCT 3', SEQ ID NO: 12) were used in a 50ul PCR reaction with 5ul 1 OX Advantage 2 buffer, 1 ul Advantage 2 cDNA polymerase mix (BD Biosciences, Clontech, Palo Alto, CA), 5ul 1OX Redi-Load (Invitrogen, Carlsbad CA), 4ul 2.5mM dNTPs (Applied Biosystems, Foster City, CA), and 5ul mouse placenta marathonTM cDNA (BD Biosciences, Clontech, Palo Alto, CA).
  • a transferrin receptor probe generated as follows:
  • PCR cycling conditions were as follows: one cycle at 94°C for 2 hours; 35 cycles of 94°C for 20 minutes, 57°C for 20 minutes, 72°C for 45 minutes; and one cycle at 72°C for 7 minutes, followed by a 4°C hold.
  • the reaction was run in an agarose gel and the fragment were purified using Qiagen gel purification columns (Qiagen, Valencia, CA) according to the manufacturer's instructions. The fragment was quantitated by a spectrophotometer reading.
  • the transferrin receptor fragment was labeled and used to probe the Mouse Multiple Tissue Northern Blots I, II and Mouse Embryo Multiple Tissue Northern Blots. The Blots were exposed to film with intensifying screens for 2 weeks.
  • 50 or 25ng of fragment was labeled using Prime-It II reagents (Stratagene, La Jolla, CA) according to the manufacturer's instructions, and separated from unincorporated nucleotides using an S-200 microspin column (Amersham, Piscataway, NJ) according to the manufacturer's protocol.
  • the blots to be probed with Zimlig2 were prehybridized overnight at 55°C in ExpressHyb (BD Biosciences, Clontech Palo Alto, CA) in the presence of 100ug/ml salmon sperm DNA (Stratagene, La Jolla, CA) and 6ug/ml cot-I DNA (Invitrogen, Carlsbad, CA), all of which were boiled and snap-chilled prior to adding to the blots.
  • Radiolabeled Zimlig2, salmon sperm DNA, and cot-1 DNA were mixed together and boiled for 5 minutes, followed by a snap chilling on ice.
  • the final concentrations of the salmon sperm DNA and the cot-1 DNA were the same as in the prehybridization step and the final concentration of radiolabeled Zimlig2 was 1x10 6 cpm/ml.
  • the blots were hybridized overnight in a roller oven at 55°C, then washed copiously at room temperature in 2X SSC, 0.1% SDS, with several buffer changes, then at 65°C.
  • the final wash was at 65°C in 0.1X SSC, 0.1%SDS. Blots were then exposed to film with intensifying screens for 10 days.
  • Cycling conditions were as follows: one cycle at 94°C for 2 hours; 35 cycles of 94°C for 20 minutes, 57°C for 20 minutes, 72°C for 45 minutes; and one cycle at 72°C for 7 hours, followed by a 4°C hold.
  • the reaction was run in an agarose gel and the fragment were purified using Qiagen gel purification columns (Qiagen, Valencia, CA) according to the manufacturer's instructions. The fragment was quantitated by a spectrophotometer reading.
  • the transferrin receptor fragment was labeled and used to probe the Fetal Tissue Northern Blot and Multiple Tissue Northern Blots I, II, and III.
  • the Fetal Tissue Northern Blot was exposed to film with intensifying screens for 1 week.
  • the Multiple Tissue Northern Blots I, II, and III were exposed to film with intensifying screens for 2 weeks.
  • results of probing multiple tissue northern blots with Zimlig2 indicated that Zimlig2 mRNA was robustly expressed in stomach, thyroid, spinal cord, trachea and adrenal gland. Expression level was also high in lymph node testis, heart, lung skeletal muscle and pancreas. The expression was low to moderate in brain, placenta, liver, spleen, prostate, colon, small intestine, fetal lung and fetal kidney. The expression was very low in fetal brain, and ovary.
  • Zimlig2 mRNA expression was lower in cancerous tissue than in normal tissue in the following tissues: uterus, cervix, rectum, testis, skin, small intestine, pancreas, breast, ovary, colon, stomach lung, kidney, trachea, bladder, liver, vulva, and prostate.
  • Zimlig2 mRNA was moderately expressed in normal donors in mononuclear cell and CD3 T-cell associated. The expression level was low in CD 14 monocyte or macrophage associated cells, CD 19 B-cell associated, polymorphonuclear cell and total leukocyte.
  • a panel of first strand cDNAs from human cells and tissues was screened for Zimlig2 expression using PCR.
  • the panel was purchased from BD Bioscience (Palo Alto, CA) and contained 10 cDNA samples from various human blood cells and tissues.
  • the first strand cDNAs were quality control tested by PCR with G3PDH control primers by BD BioScience (Palo Alto, CA).
  • the panel was set up in a 96-well format that included 1 positive control sample, human thyroid first strand cDNA. A dilution series was performed. Each well contained either 5ul of cDNA and 8.0 ul of water, IuI of cDNA and 12.0 ul of water, or IuI of a 1 :5 dilution of cDNA and 12.0 ul water.
  • the PCR reactions were set up using 0.5 ⁇ l of 20 uM each of the sense oligonucleotide zc50165 (5' GGAAATAAACTCAAGCTGATGCTTCAA 3', SEQ ID NO: 13) and the antisense oligonucleotide zc50451 (5' GTTGGTAGTAATCGCCATAGTATTCAT 3', SEQ ID NO: 14), 2.5ul Opti- Prime 1OX buffer #7 (Stratagene, La Jolla, CA) 0.5ul Advantage 2 cDNA polymerase mix (BD Biosciences Clontech, Palo Alto, CA), IuI 2.5mM dNTP mix (Applied Biosystems, Foster City, CA), and IX Rediload dye (Invitrogen, Carlsbad, CA) in a final volume of 25ul.
  • the sense oligonucleotide zc50165 5' GGAAATAAACTCAAGCTGATGCTTCAA 3', SEQ ID NO: 13
  • the amplification was carried out as follows: 1 cycle at 94°C for 2 minutes; 35 cycles of 94°C for 30 seconds, 70 0 C for 30 seconds, and 72°C for 45 seconds; followed by 1 cycle at 72°C for 5 minutes.
  • About 10 ⁇ l of the PCR reaction product was subjected to Standard agarose gel electrophoresis using a 2% agarose gel.
  • a band of 271bp in size indicated the expression of Zimlig2 mRNA.
  • the genomic band is 500bp in size. See Table 1 below for expression profile and tissues screened.
  • Zimlig2 mRNA had a moderate expression in resting CD4+ T-helper/inducer cells and resting CD8+ T-suppressor/cytotoxic cells.
  • the expression level was very low in activated CD4+ cells, activated CD8+, activated mononuclear cells and mononuclear cells (B- & T-cells and monocytes). It was not expressed in activated CD 19+ cells and resting CD 19+ cells.
  • a panel of DNAs from cDNA libraries made in-house was screened for Zimlig2 expression using PCR.
  • the panel contained 45 DNA samples from cDNA libraries made from various human tissues (normal, cancer, and diseased) and resting or stimulated cell lines.
  • the in-house cDNA libraries were quality control tested by PCR: with vector oligonucleotides for average insert size, PCR for alpha tubulin or G3PDH for full length cDNA using 5' vector oligonucloetide and 3' gene specific oligonucleotide, and with sequencing for ribosomal or mitochondrial DNA contamination.
  • the panel was set up in a 96-well format that included a lOOpg human genomic DNA (BD Biosciences Clontech, Palo Alto, CA) positive control sample. Each well contained 5ul of cDNA library DNA and 8.0 ul of water.
  • the PCR reactions were set up using 0.5 ⁇ l of 20 uM each of the sense oligonucleotide zc50165 (5' GGAAATAAACTCAAGCTGATGCTTCAA 3', SEQ ID NO: 13) and the antisense oligonucleotide zc50451 (5' GTTGGTAGTAATCGCCATAGTATTCAT 3', SEQ ID NO: 14), 2.5ul Opti-Prime 1OX buffer #7 (Stratagene, La Jolla, CA), 0.5ul Advantage 2 cDNA polymerase mix (BD Biosciences Clontech, Palo Alto, CA), IuI 2.5mM dNTP mix (Applied Biosystems, Foster City, CA) and IX Rediload dye (Invitrogen, Carlsbad, CA) in a final volume of 25ul.
  • the sense oligonucleotide zc50165 5' GGAAATAAACTCAAGCTGATGCTTCAA 3', SEQ ID NO: 13
  • the amplification was carried out as follows: 1 cycle at 94°C for 2 minutes; 35 cycles of 94°C for 30 seconds, 70 0 C for 30 seconds, and 72°C for 45 seconds; followed by 1 cycle at 72°C for 5 minutes.
  • About 10 ⁇ l of the PCR reaction product was subjected to standard agarose gel electrophoresis using a 2% agarose gel.
  • a band of 271bp in size indicated the expression of Zimlig2 and the genomic band is 500bp in size. See Table 2 below for expression profile and tissues screened.
  • PBMC-2 peripheral blood mononuclear cells
  • PBMC-I peripheral blood mononuclear cells
  • Zimlig2 polypeptide was expressed as a fusion with a C- terminal His tag (CH6) through transient transfection.
  • a 125 mL shaker flask was seeded with 25 mL of 293FT (Invitrogen, cat# R700-07) cells at 1E6 c/mL and were set aside. 500 ⁇ L of OptiMEM (Invitrogen, cat# 31985- 070) was placed in each of two 1.5 mL tubes.
  • the Zimlig2 polypeptide with the C-terminal His tag from Example 5 was purified as follows. After transfection and expression, conditioned media from 293FT cells expressing Zimlig2- CH6 was filtered using a 0.22 ⁇ m SteriflipTM filter (Millipore, Cat. No. SCGP00525). Batch purification was accomplished by adding 250 ⁇ l of Ni-NTA Superflow beads (Qiagen, cat# 30410), to the -25 mLs of 293FT conditioned media. The media-bead mixture was rocked overnight at 4°C. The beads were spun out of the media at 1000 RPM for 10 minutes in a Beckman GS6R centrifuge.
  • the beads were washed with 1 mL cell lysis buffer (15OmM Sodium Chloride, 50 mM Tris pH 8.0, and 1% NP-40). The beads were then suspended in 500 ⁇ l cell lysis buffer and submitted for N- terminal sequencing.
  • cell lysis buffer 15OmM Sodium Chloride, 50 mM Tris pH 8.0, and 1% NP-40. The beads were then suspended in 500 ⁇ l cell lysis buffer and submitted for N- terminal sequencing.
  • the upper band (at approximately 15 kDa) showed the mature experimental start to be at residue 32 of SEQ ID NO:2. Cyanogen bromide treatment of this band liberated a sequence beginning at residue 91 of SEQ ID NO:2, which is post methionine. No post methionine sequence was liberated at residue 38 of SEQ ID NO:2. This shows that this methionine was completely sequenced through in the initial run, and that no pre-residue 38 N-terminally blocked form of the protein was detectable. [170] The lower band (at approximately 9 kDa) appeared N-terminally ragged around residue 61 of SEQ ID NO:2.
  • the 15kDa band confirmed the previously determined upper band mature beginning at residue 32 of SEQ ID NO:2.
  • the 1OkDa band confirmed the previously determined lower band sequence beginning at residue 61 of SEQ ID NO:2.
  • the 9kDa band showed a second lower band sequence starting at residue 72 of SEQ ID NO:2.
  • Zimlig2 mRNA levels were normalized to the expression of the murine hypoxanthine guanine phosphoribosyl transferase mRNA and determined by the comparative threshold cycle method (User Bulletin 2; PE Applied Biosystems).
  • the primer and probe sequences for murine Zimlig2 are: forward primer, (5'- GGCTGGCTCTGCTCCTTCT-3', SEQ ID NO: 11), reverse primer (5'- CGTTTCTGGAGCATCTTCTTGAG-3', SEQ ID NO: 12), and probe (5'- TGTTTCCACTTATGCCATCTGGACCCA-3', SEQ ID NO: 13).
  • DSS colitis studies are designed as acute, recovery or chronic protocols. Mice in acute colitis studies receive DSS in their drinking water for a period of 5-7 days, and are then euthanized. Mice in recovery colitis studies receive DSS in their drinking water for 5-7 days and are then placed back on normal drinking water for a period 2-5 days and are then euthanized. Mice in chronic colitis studies are given DSS in drinking water for 5-7 days, allowed to recover 95-100% of their pre-study body weight while on regular water (usually 12 - 18 days), after which they are placed on DSS again for a total of 3 cycles.
  • Zimlig2 may be administered either by intravenous (IV), subcutaneous (SC), intramuscular (IM) or intraperitoneal (IP.) injection.
  • IV intravenous
  • SC subcutaneous
  • IM intramuscular
  • IP intraperitoneal
  • the test article may be delivered by mini-osmotic pump.
  • the Zimlig2 gene may be adenovirally administered. Blood sampling may occur during study depending on study protocol.
  • DAI Disease Activity Index
  • Body Weight Score a score of 0 for no body weight loss; a score of 1 for 0-5% bodyweight loss; a score of 2 for 5- 10% body weight loss; a score of 3 for 10-15% body weight loss, and a score of 4 for more than 15% body weight loss.
  • Stool Consistency Score a score of 0 if normal; a score of 2 if stool is soft; a score of 4 if diarrhea is present.
  • Hemocult Score a score of 0 if normal; a score of 2 if no visible blood is present in feces or anus, but hemocult slide is positive; a score of 4 if visible blood is observed in feces.
  • Zimlig2 mRNA expression in the proximal and distal colon in DSS-treated mice compared to water fed control animals.
  • Zimlig2 was highly expressed in hind foot.
  • the expression of Zimlig2 in the mesenteric lymph nodes did not differ between mice treated with DSS or water.
  • mice There are a variety of ways to induce a model of asthma in mice.
  • the mouse is sensitized to an antigen (usually ovalbumin) with or without adjuvant (usually alum), and then challenged at a later date one or more times with the same antigen.
  • an antigen usually ovalbumin
  • adjuvant usually alum
  • a treatment protein or adenovirally-delivered gene may be administered.
  • the routes, timings and numbers of sensitizations, challenges, and treatments may vary with each study depending on the expected action of the protein being tested. (Zhang et al., Am. J. respire. Crit. Care. Med. 155:661-669. 1997).
  • mice are inoculated with 10 ⁇ g ovalbumin (OVA) in 50% alum, LP. in a volume of 100 ⁇ l.
  • OVA ovalbumin
  • the mice are challenged with either 20 ⁇ g OVA intranasally (i.n.) in 50 ⁇ l volume or 50 ⁇ l of PBS; the mice are under anaesthesia and in dorsal recumbancy.
  • unanaesthetised and unrestrained mice may be challenged by 30 min to 1 h exposure to either aerosolized OVA or PBS in the morning and afternoon of the same day.
  • Evans blue dye (1.25%, 50 ⁇ l in sterile saline) may be administered intravenously (i.v.) in restrained mice.
  • the mice are sacrificed.
  • Zimlig2 Before, or during this time, the mice are treated with test article Zimlig2.
  • Zimlig2 may be administered either by intravenous (IV), subcutaneous (SC), intramuscular (IM) or intraperitoneal (IP.) injection.
  • the test article may be delivered by mini-osmotic pump.
  • the Zimlig2 gene may be adenovirally administered. Blood sampling may occur during study depending on study protocol.
  • Penh is a dimensionless value that represents a function of the proportion of maximal expiratory to maximal inspiratory box pressure signals and a function of the timing of expiration. It correlates closely with pulmonary resistance. Penh was used as a measure of airway responsiveness to allergen and methacholine (MCh), a non-specific bronchoconstrictive stimulant that is used to assess lung function in human patients.
  • MCh methacholine
  • Whole-body plethysmography has several potential advantages compared to invasive means for measuring lung resistance: it is technically less demanding, allows measurements of airway responsiveness to aerosolized stimulants, and can be used for repeated, long-term measurement of AR for the evaluation of kinetics and treatment protocols.
  • Bronchoalveolar lavage (BAL) fluid is collected post-mortem to assess mucus production, cytokine content and to perform differential cell counts for eosinophils, neutrophils, macrophages, and lymphocytes.
  • Blood is drawn by retro-orbital bleeds under isofluorane anesthesia in amounts no greater than 1% of the animal's body weight within a two-week period, or at the time of sacrifice for serum. Serum is used to assess circulating levels of cytokines and allergen-specific IgE.
  • EAE represents a mouse model of multiple sclerosis and is induced in mice by immunization with a T helper peptide epitope derived from rat myelin oligodendrocyte glycoprotein, MOG 33-55 in adjuvant. Briefly, mice are shaved on two sites on their flank and immunized subcutaneously with lOOug rat MOG35-55 (MEVGWYRSPFSRVVHLYRNGK) emulsified in RIBI adjuvant on day 0. On day 2 mice are injected intravenously with 200ng pertussis toxin (List Biologicals, Campbell, CA) in a volume of 200ul to perturb the blood-brain barrier. This immunization protocol results in self-reactive T cells that can enter the central nervous system and initiate inflammation resulting in progressive paralysis.
  • T helper peptide epitope derived from rat myelin oligodendrocyte glycoprotein, MOG 33-55 in adjuvant.
  • mice are s
  • Zimlig2 may be administered either by intravenous (IV), subcutaneous (SC), intramuscular (IM) or intraperitoneal (IP.) injection. In some studies the test article may be delivered by mini-osmotic pump. Alternatively, the Zimlig2 gene may be adenovirally administered. Blood sampling may occur during study depending on study protocol. [188] In a protocol similar to the EAE model described above, tissues (brain, lymph node, and spinal cord) were harvested for analysis at the end of the study. Mice tested in methods similar to those described above showed increased expression of Zimlig2 in the spinal cord with increased disease severity. However, there appeared to be no significant difference in expression of Zimlig2 in brain or lymph nodes with disease severity.
  • Psoriasis is induced by adoptive transfer of CD4+CD25- na ⁇ ve T cells, isolated by magnetic bead separation from the spleen and lymph nodes of B10.D2 (H-2 d ), into minor histocompatability mismatched or synergeneic mice.
  • Immunocompromised CB- 17 SCID mice (H2d) are injected intravenously with 0.5 million enriched CD4+CD25- T cells on day 0. On day 1, all mice receiving the cells are injected with lOug staphylococcal enterotoxin B (SEB, Sigma) in lOOul volume via i.p injection.
  • DAI Disease Activity Index
  • Zimlig2 may be administered either by intravenous (IV), subcutaneous (SC), intramuscular (IM) or intraperitoneal (IP.) injection.
  • IV intravenous
  • SC subcutaneous
  • IM intramuscular
  • IP intraperitoneal
  • the test article may be delivered by mini-osmotic pump.
  • the Zimlig2 gene may be adenovirally administered. Blood sampling may occur during study depending on study protocol.
  • the CIA model is a well-described model in mice that depends on the initiation of an immune response against the self antigen, collagen that results in the induction of an inflammatory cascade that results in disease. This complex chain of events cannot readily be duplicated in vitro, and the model is an important tool in the evaluation of potential new therapeutics for immune or inflammatory diseases. (Hegen et al., J. Exp. Med. 197: 1297-1302, 2003)
  • mice are injected subcutaneously at the base of the tail on day 0 with a homogenate consisting of Complete Freund's Adjuvant (CFA) and Type II collagen (50- 100ml, prepared as 2mg/ml of collagen).
  • CFA Complete Freund's Adjuvant
  • IFA Incomplete Freund's Adjuvant
  • clinical symptoms of arthritis red, swollen paws or digits
  • Qualitative clinical scores are calculated using measurements of paw thickness. Paw evaluations begin following the second collagen injection, and paws were scored daily thereafter.
  • Zimlig2 may be administered either by intravenous (IV), subcutaneous (SC), intramuscular (IM) or intraperitoneal (IP.) injection.
  • IV intravenous
  • SC subcutaneous
  • IM intramuscular
  • IP intraperitoneal
  • the test article may be delivered by mini-osmotic pump.
  • the Zimlig2 gene may be adenovirally administered. Blood sampling may occur during study depending on study protocol.
  • Tissues including foot and lymph node
  • mice tested in methods similar to those described above were collected and analysis of Zimlig2 mRNA expression was performed.
  • CM Conditioned media
  • Eulck promoter a rodent Multi- Analyte Profile Screening Panel
  • Gamma interferon levels were also assayed by ELISA using a mouse IFN- ⁇ ELISA using, cat # 88-7314-22 from eBioscience (6042 Cornerstone Court West, San Diego, CA 92121, USA). Two transgenic lines were evaluated, one high expressing and the other low expressing.
  • Cells were grown in appropriate media (recommended by the supplier) in 37°C incubator until they were 80%- 90% confluent in 75 cm2 tissue culture flasks.
  • Cells grown in monolayer These cells were either collected as cell pellets by trypsinizing prior to the lysis step. Or cells were lysed directly in the flask by aspirating the medium, adding lysis buffer (supplied in the QIAGEN kit) and then scraping the cells.
  • RNAs were then DNAsed using DNA-free reagents (Ambion, Inc, Austin, TX) according to the manufacturer's instructions.
  • the RNAs were quantitated by three independent measurements on a spectrophometer, and the quality of the RNA was assessed by running an aliquot on an Agilent Bioanalyzer. Presence of contaminating genomic DNA was assessed by a PCR assay on an aliquot of the RNA with zc41011 (5'CTCTCCATCCTTATCTTTCATCAACS '; SEQ ID NO: 18) and zc41012 (5'CTCTCTGCTGGCTAAACAAAACACS ' ; SEQ ID NO: 19), primers that amplify a single site of intergenic genomic DNA.
  • the PCR conditions for the contaminating genomic DNA assay were as follows: 2.5ul 1OX buffer and 0.5ul Advantage 2 cDNA polymerase mix (BD Biosciences Clontech, Palo Alto, CA), 2ul 2.5mM dNTP mix (APPLIED BIOSYSTEMS®, Foster City, CA), 2.5ul 1OX Rediload (Invitrogen, Carlsbad, CA), and 0.5ul 2OuM zc41011 and zc41012, in a final volume of 25 ul. Cycling parameters were 94oC 20", 40 cycles of 94oC 20" 60oC 1 '20" and one cycle of 72oC 7'.
  • Zimlig2 standard curve preparation For murine Zimlig2 standards, we used universal murine RNA at 200, 100 and 50ng/ul concentrations. Since Zimlig2 expression is very high in thyroid, total RNA was isolated from thyroid used for human Zimlig2 standard curve preparation. Dilutions were prepared in DEPC treated water at 200, 100 and 50ng/ul.
  • Primer and the probe sets were designed for both human and murine Zimlig2. As an endogenous control, human glucuronidase (GUS) expression was tested. Primer and probe set for GUS were available in-house.
  • the Human Zimlig2 primers used were as follows: Sense: 5'- TCAAAAACGAGAAGCACCTGTTC-3' (SEQ ID NO:20); Antisense: 5'-
  • the Murine Zimlig2 primers used were as follows: Sense: 5'-GGCTGGCTCTGCTCCTTCT-S ' (SEQ ID NO:23); Antisense: 5'-CGTTTCTGGAGCATCTTCTTGAG-S ' (SEQ ID NO:24); and Probe: 5'- TGTTTCCACTTATGCCATCTGGACCCA-3' (SEQ ID NO: 25).
  • RNA samples were thawed in ice and then diluted to 50ng/ul in RNase-free water (Invitrogen, Cat# 750023). Diluted RNA samples were kept in ice until use.
  • TAQMAN® EZ RT-PCR Core reagents (APPLIED BIOSYSTEMS®, Cat# N808- 0236) was used to prepare master mixes for Zimlig2(human or murine) and GUS (human or murine) (See Table 4 below).
  • RNA sample and controls were aliquoted into optical tube strips (APPLIED BIOSYSTEMS®, Cat# 4316567).
  • positive control human testes standard curve dilutions were used.
  • negative control 3.5 ⁇ l of RNase-free water (no template control) was used.
  • 84 ⁇ l of PCR multiplex master mix added and mixed well by pipetting.
  • MICRO AMP® Optical 96-well plate (APPLIED BIOSYSTEMS®, Cat# N801 -0560) was placed on ice and 25 ⁇ l of RNA/master mix was added in triplicates to the appropriate wells.
  • optical adhesive cover (APPLIED BIOSYSTEMS®, Cat# 4311971) was applied to the plate surface with the applicator and then the plate was spun for two minutes at 3000rpm in the QIAGEN® Sigma 4-15 centrifuge. A compression pad (APPLIED BIOSYSTEMS®, Cat# 4312639) was put on top of the plate.
  • Sequence detector was launched and it was set to real time PCR. Fluorochromes were set to FAM® (5' fluorescence reporter of choice for human Zimlig2, murine Zimlig2), FAM®/TAMRA® (5 'fluorescence reporter / 3' quencher for human GUS) and to VIC® (5' fluorescence reporter of choice for murine GUS). Plate template was set indicating where standards and where the unknowns were. Thermocycling conditions were: hold-1 at 50 0 C for 2 minutes, hold-2 at 60 0 C for 30 minutes, hold-3 at 95 0 C for 5 min, and 40 cycles at 94 0 C for 20 seconds, and 60 0 C for 1 minute. After the experiment was over, data analysis was performed according to the manufacturer's user bulletin #2.
  • Ct threshold cycle number
  • the Ct value is the point at which the fluorochrome level or RT-PCR product (a direct reflection of RNA abundance) was amplified to a level, which exceeded the threshold or background level.
  • a Ct value of 40 means that there is no product measured and should result in a mean expression value of zero.
  • Ct values for Zimlig2 and housekeeping gene was determined.
  • Results are respresented as % of GUS
  • the Zimlig2 expression levels are ranked in Table 5 from highest to lowest in the thirty eight cell lines evaluated. The highest expression, 26.9% of GUS, was detected in normal human articular chondrocytes. Additional cells with high levels of Zimlig2 expression were normal human neural progenitor cells (15.5% of GUS), and smooth muscle cells derived from spleen (4.2% of GUS). Human mammary epithelial cells and aortic adventitial fibroblasts expressed Zimlig2 at 1.5 and 1.2% respectively. The remaining cell types expressed Zimlig2 at below 1% of GUS. Renal proximal tubule epithelial cells expressed Zimlig2 at 0.8% of GUS.
  • Bronchial smooth muscle cells, bladder epithelial cells, skeletal muscle cells and retinal pericytes all expressed Zimlig2 at 0.4-0.3% of GUS.
  • Cholera toxin activated small airway epithelial cells, umbilical artery smooth muscle cells, prostate epithelial cells, lung fibroblasts, and renal epithelial cells all expressed Zimlig2 at between 0.13 and 0.075% of GUS.
  • Coronary artery smooth muscle cells, bronchial epithelial cells, pulmonary artery smooth muscle cells, aortic smooth muscle cells and bladder smooth muscle cells all expressed Zimlig2 at between 0.62 and 0.48% of GUS.
  • Prostate smooth muscle, umbilical artery smooth muscle, prostate stromal, bronchial epithelial cells, pulmonary artery endothelial cells and coronary artery endothelial cells express Zimlig2 at between 0.02 and 0.008%.
  • Renal epithelial cells, ureter smooth muscle cells, and aortic endothelial cells all express Zimlig2 at between 0.006 and 0.002% of GUS. No Zimlig2 expression was detected in renal artery smoth muscle cells or in umbilical artery endothelial cells. Zimlig2 was primarily expressed in the CD3+ T cell populations.
  • Results are respresented as % of GUS cell line info Zimlig2
  • Zimlig2 expression was reduced in the CD4+ and CD8+ cells that were activated.
  • Zimlig2 expression was highest in the resting, unstimulated cells.
  • Zimlig2 expression in resting CD4+ and CD8+ T cells is about 25% of GUS. Expression drops to about 5% following activity with CD3/CD28, and to about 2.5% following Phytohaemagglutinin (PHA) and Ionomycin (P+I) treatment.
  • PHA Phytohaemagglutinin
  • P+I Ionomycin
  • HEC Human umbilicial vein endothelial cells
  • BEC bovine aortic endothelial cells
  • All cell lines are maintained in endotoxin- free RPMI 1640 medium (M. A. Bioproducts, Walkersville, MD) supplemented with 20% FCS and heparin (90 mg/ml) and endothelial cell growth factor as described in Thronton et al. (Thornton et al., Science (Wash.
  • Endothelial cell growth factor is prepared from bovine hypothalamus as described by Maciag et al. (Maciag, T. et al., Proc. Natl. Acad. Sci. USA 76:5674-5678, 1979.). HEC and BEC are harvested with 0.05% trypsin and 0.02% EDTA in HBSS (Gibco Laboratories, Gibco Div., Chagrin Falls, OH) without calcium magnesium (HBSS-).
  • the cells are then plated in 11-mm-daim wells in 48-well plats (Cluster 3548; Costar, Data Packaging Corp., Cambridge, MA) at 5 x 10 4 cells/well in RPMI 1640 with 20% FCS. Visually confluent monolayers are formed after overnight incubation.
  • Peripheral blood from healthy donors is obtained by venipuncture and collected in syringes containing heparin, 10 U/ml.
  • Leukocytes are isolated by Ficoll-Hypaque density gradient centrifugation followed by 3% dextran sedimentation and hypotonic saline lysis of erythrocyte (B ⁇ yum, A., Scand. J. Clin. Lab. Invest. 2_l ⁇ 97):77-79, 1968).
  • Leukocytes for adherence experiments are suspended in PBS and labeled with 51 Cr as sodium chromate (New England Nuclear, Boston, MA) 1 ⁇ Ci/10 6 cells for 60 min at 37°C (Gallin, J.I., R. A. Clark, and H. R. Kimball. 1973. J. Immunol. 110:233-240.). After labeling, the cells are washed three times in PBS.
  • the purified 51 Cr-labeled leukocytes are suspended in endotoxin- free RPMI 1640 medium with 5% FCS at a concentration of 2 x 10 6 cells/ml (FCS prevents nonspecific detachment of endothelial cell monolayers from the tissue culture plastic).
  • FCS prevents nonspecific detachment of endothelial cell monolayers from the tissue culture plastic.
  • the cells are then treated with medium (control) or Zimlig2 (O. lng to lug/ml) at 37 0 C in a 5% CO 2 incubator for 4 hours or overnight.
  • medium control
  • Zimlig2 O. lng to lug/ml
  • the 48-well HEC or BEC plate is decanted and fresh medium is added: RPMI 1640 with 5% FCS with or without varying concentrations of Zimlig2 (O. lng- lug/ml). Then, 200 ⁇ l of the neutrophil suspension is added to each well followed immediately by 50 ⁇ l of medium (control), PMA (final concentration 100 ng/ml), A23187 (final concentration 10 "5 M), or FMLP (final concentration 10 "5 M). Plates are incubated for 30 min at 37°C in a 5% CO 2 incubator. Non-adherent leukocytes are removed with two well volume exchanges of PBS with 5% FCS.
  • Total 51 Cr cpm added is determined by counting 200- ⁇ l samples of the leukocyte suspension. The results are confirmed qualitatively by microscopic analysis. In experiments using unlabeled cells, results are quantified by counting adherent leukocytes in photomicrographs and by assaying for myeloperoxidase (MPO) activity as described by Lundquist and Josefsson (Lundquist, L, and J-O Josefsson. Anal. Biochem. 41 :567-577. 1971.).
  • MPO myeloperoxidase
  • TRBMEC Transformed Bone Marrow Endothelial Cells
  • Falcon 96-well tissue clusters
  • MVGS Microvascular Growth Supplement
  • M 199 Gibco-Life Technologies
  • Fetal Bovine Serum Hyclone
  • Human recombinant Zimlig2 test reagent is added at various concentrations (from 1 ng/mL to 1 ⁇ g/mL), to test for the effect of the protein on immune cell-endothelial cell interactions resulting in adhesion.
  • TNFalpha R&D Systems Tumor Necrosis Factor
  • cytokine a known pro-inflammatory cytokine
  • Zimlig2 a known pro-inflammatory cytokine
  • TNFalpha at 0.3ng/ml alone is used as positive control and the concentration used represents approximately 70% of the maximal TNFalpha effect in this system, i.e., it does not induce maximal adherence of U937 cells (a human monocyte-like cell line) to the endothelium. For this reason, this setup can detect both upregulation and downregulation of the TNFalpha effects. Basal levels of adhesion both with and without TNFalpha are used as baseline to assess effect of test reagents.
  • Zimlig2 may heighten monocyte or macrophage adhesion to a site of proinflammatory activity. Activated monocytes and macrophages are important in many inflammatory diseases. Therefore Zimlig2 antagonists may be useful to inhibit monocyte/macrophage adhesion. As such Zimlig2 antagonists may be useful for treating lung diseases, vascular diseases, autoimmunity, tumor metastasis, disease involving allergic reactions, wound healing and diseases of the skin including contact, allergic or non-allergic dermatistic or psoriasis and inflammatory bowel disease.
  • Tumor cells Prior to injection of tumor cells, the animal's flanks are shaved. Tumor cells are prepared using sterile technique. They are suspended in phosphate buffered saline at a concentration up to 107 cell/ml, and up to 0.1 ml is injected subcutaneously into the flank region of mice.
  • estrogen-containing pellets For estrogen responsive tumors, 60-day release estrogen pellets (17-beta-estradiol, 0.72 mg/pellet) are implanted subcutaneously.
  • mice General health of the mice is assessed daily, and body condition score monitored. Moribund mice are euthanized. Tumor size is monitored at least 3 times weekly. Mice may be bled during the study.
  • tumor cells are injected intravenously in order to simulate metastasis of cells.
  • a pilot study is carried out to determine the number of cells to be injected in order to achieve interpretable experimental results without development of moribund signs in mice prior to the scheduled endpoint (10 - 20 days).
  • Tumor cells are prepared using sterile technique, suspended in phosphate buffered saline and up to 5 x 10 6 cells are injected in the tail vein in a volume not to exceed 0.1 ml.
  • mice General health of the mice is assessed daily, and the body condition score is monitored. Moribund mice are euthanized. Mice may be bled during the study. Intraperitoneal Injection of Tumors
  • tumor cells are injected intraperitoneally in order to simulate metastasis or peritoneal growth of cells.
  • IV injection a pilot study is carried out for each new cell line used in this way. Growth of the tumor is monitored by increase in body weight, abdominal distension and health status of the animal.
  • mice General health of the mice is assessed daily, and the body condition score is monitored. Moribund mice are euthanized. Mice may be bled during the study.
  • mice may be injected with non- viable (irradiated) tumor cells prior to live cell injection.
  • the purpose for this is to initiate a host immune response before tumor challenge as described above.
  • Non- viable tumor cells are injected, with or without adjuvant, subcutaneously in a volume of 100 ⁇ l.
  • Spleen cells derived from syngeneic mice are labeled with the intracellular fluorescent dye Carboxyfluorescein diacetate succinimidyl ester (CFSE, Molecular Probes) using standard labeling protocol.
  • the cells are prepared from donor mice in the same facility as the host mice. All procedures including CFSE labeling are performed under sterile conditions within the animal facility or within a tissue culture facility under sterile conditions and with pathogen-free reagents.
  • Splenocytes are prepared for injection to mice in a suspension of physiological buffer such as PBS at a concentration of approximately 107 cells/mL. Recipient mice are injected intravenously via the tail vein with no greater than 0.15 mL of the suspension.
  • NK cells may be depleted using a (rabbit anti-bovine) polyclonal antibody directed to NK cell marker GM-I;
  • Granulocytes may be depleted using a monocolonal antibody directed to cell marker GR-I; or Macrophages may be depleted using clodronate formulated in liposomes.
  • Purified Zimlig2 is administered by the IV, SC, or IP route. The dosing schedule is determined for each individual experiment.
  • Tumor cells are injected by the intravenous, subcutaneous, or intraperitoneal route in a volume of approximately 0.1 ml.
  • non- viable tumor cells are injected subcutaneously, with or without adjuvant, in a volume of 0.1 mL.
  • Splenocytes are prepared for injection to mice in a suspension of physiological buffer such as PBS at a concentration of approximately 10 7 cells/mL. Recipient mice are injected intravenously via the tail vein with no greater than 0.15 mL of the suspension.
  • Tumor killing and/or tumor rejection is measured by a reduction in tumor size and/or an improvement of the general health or body condition of the mice.
  • PBMCs Peripheral Blood Mononuclear Cells
  • Ficoll/Hypaque separation separates the red blood cells from the PBMCs.
  • soluble Zimlig2 protein is added in a relevant dose curve range, beginning at 4 ⁇ g/ml.
  • a non-related protein produced in an equivalent fashion is also tested at equal molar ratio. Stimulations are set up in triplicate.
  • Example 16 Preparation of Cells expressing mouse Zimlig2 or VEGFA into SW620, SW480 or CT- 26 tumor cells
  • a Zimlig2 polypeptide of the present invention is PCR amplified out from a template using the Advantage 2 PCR Kit (BD Biosciences). Amplification conditions are: 94 0 C x 1 min, [94 0 C x 15 sec, 68 0 C x 1 min] x 30, 70 0 C x 5 min, and held at 4 0 C. Following amplification, reactions are cleaned up using Qiagen PCR Purification Kit according to manufacturers' instructions. Double digest with EcoRI and BamHI in NEB Buffer #2 is performed on amplified fragments. After digestion, samples are run out on a 1% agarose gel, correct bands are excised and purified with Qiagen Gel Purification Kit per mfg. instructions.
  • CT26 mouse colon carcinoma ATCC, Manassas, Virginia
  • SW480 human colorectal adenocarcinoma ATCC, Manassas, Virginia
  • SW620 human colorectal adenocarcinoma— lymph node metastatic site ATCC, Manassas, Virginia
  • 293FT cells SV40 T-antigen expressing
  • DMEM 10% FBS
  • IX GlutaMax IX GlutaMax
  • 293FT cells are plated in 6-well standard tissue culture plates at a density of 700,000 cells per well and allowed to attach overnight. Transient transfections are set up using FuGene-6 (Roche) according to manufacturer's, protocol at a 3: 1 FuGene:DNA ratio. 3 ⁇ g DNA is transfected per well consisting of 1 ⁇ g retroviral vector construct, 1 ⁇ g pVPack gag-pol, and 1 ⁇ g pVPack vsvg (Stratagene). The next day the medium is replaced with 1 mL fresh medium and cells are examined for GFP expression by fluorescent microscopy. The following day, retroviral supernatant is collected, filtered through a 0.45 ⁇ m syringe filter and immediately used for transduction or frozen at -80 0 C.
  • CT26 cells are plated in 6-well plates at a density of 80,000 per well and allowed to attach overnight.
  • SW620 and SW480 cells are plated in 6-well plates at a density of 100,000 cells per well and allowed to attach overnight.
  • Culture medium is aspirated and replaced with either a 1:2 or 1 : 10 dilution of above-produced retroviral supernatant containing 4 ⁇ g/mL polybrene (Sigma) from 100OX stock. Infection is allowed to proceed overnight. The next day cells are examined for GFP expression and are split 1 :3 with one subset placed on puromycin selection at 20 ⁇ g/mL for CT26 cells and 1 ⁇ g/mL for SW620 and SW480. Analysis of Stable GFP Expression
  • ELISA' s are performed on 72-hour conditioned medium from the Zimlig2 polypeptide and VEGFA stable producing cell lines with appropriate controls using standard ELISA procedures.
  • VEGFA capture antibody is NF-493 (R&D Systems) and detection antibody is BAF-493 (R&D Systems).
  • Mouse VEGFA from in-house cytokine bank (Lot# RQ018111) is used as a standard.
  • capture antibody is used and detection antibody is freshly biotinylated with EZ-Link sulfoNHS-LC-Biotin (Pierce).
  • ELISA's were read on a SpectraMax instrument and analyzed with SOFTMax Pro.
  • the Zimlig2 polypeptide capture antibody is diluted to 250ng/ml in ELISA A buffer.
  • the plate is coated with the antibody (lOOul/well in Nunc 96-well ELISA plates) and the plates are sealed and incubated overnight at 4oC.
  • the plates are washed with 250ul/well 3X in ELISA C buffer, then blocked with ELISA-B (ELISA-C + 2% BSA), 200ul/well and incubated for 15min at RT, after which the plates are flicked to empty.
  • the plates are washed again with 250ul/well 3X in ELISA C buffer.
  • Standard curve dilutions are prepared using the Zimlig2 polypeptide.
  • CMs conditioned medias
  • samples are usually tested as is, plus with couple serial dilution points. If the sample volume is limited then the starting dilution is made at lowest possible point (1 : 1 or 1 :2, etc) since protein level is not known.
  • the standard curve and the dilutions of the samples are made in the culture media at the following concentrations: 30.0000 ng/ml (1 :3); 10.0000 ng/ml (1 :3); 3.3333 ng/ml (1 :3); 1.1111 ng/ml (1 :3); 0.3704 ng/ml (1 :3); 0.1235 ng/ml (1:3); 0.0412 ng/ml (1 :3); 0.0137 ng/ml (1 :3); 0.0046 ng/ml (1 :3); 0.0015 ng/ml (1 :3); 0.0005 ng/ml (1 :3); and diluent only.
  • the samples and the standards are added to the plate and incubate on a plate shaker for 1.5 hours at 37°C, then washed 3X in ELISA C buffer, 250ul/well.
  • the biotinylated Zimlig2 detection antibody is used at a concentration of 250ng/ml.
  • One hundred uL/well is added and the plates are incubated for 1.5hr, 37°C.
  • the plates are washed 3X in ELISA C, 250ul/well.
  • SA-HRP is diluted to 1 :3000 in ELISA B and plated at SA-HRP, lOOul/well and incubated for lhr at 37°C. The plates are washed 3X in ELISA C buffer, 250ul/well. and TMB solution is added at 100ul/well. The plates are developed for 3 minutes at RT, on the bench. Color development is stopped by plating BioFX 450 Stop reagent, 100ul/well, and read at OD at 450nm, within 15 minutes of stop.
  • Stably-transduced CT26 cells are expanded, trypsinized, washed 2X with PBS, passed through a 40 ⁇ m cell strainer, counted by trypan blue exclusion, and diluted to a concentration of 2 million cells per mL. These are placed on ice prior to inoculation in mice.
  • SW620 and SW480 cells are expanded, trypsinized, washed 2X with PBS, passed through a 40 ⁇ m cell strainer, counted by trypan blue exclusion, and diluted to a concentration of 10 million cells per mL. These are placed on ice prior to inoculation in mice.
  • Blood is collected for a CBC on all animals prior to beginning the study, on day 7 and at study termination. Animals are euthanized at the discretion of the study monitor as the tumors reach a given size or the tumors are ulcerating the skin. At the time of euthanasia, blood is collected for CBC and serum, tumor tissue collected for RNA analysis (frozen on dry ice) and histology (10%NBF for 24 hrs then into 70% ETOH) and the spleen collected for histology. ELISA assay for the Zimlig2 polypeptide and VEGFA are performed on the serum. RNA from each tumor is isolated and assayed for the Zimlig2 polypeptide and VEGFA expression by Taqman RTPCR. Table 7 Study Groups
  • Example 17 Generation of transgenic mice expressing murine zimlig2
  • TG transgenic
  • E ⁇ Lck immunoglobulin heavy chain enhancer
  • Oligonucleotides were designed to generate a PCR fragment containing a consensus Kozak sequence and the murine zimlig2 open reading frame. These oligonucleotides were designed with an Fsel site at the 5' end and an Ascl site at the 3' end (SEQ ID NO: 6) to facilitate cloning into E ⁇ Lck, our standard TG vector.
  • PCR reactions were carried out with about 200 ng murine zimlig2 template and oligonucleotides designed to amplify the full-length open reading frame of murine zimlig2.
  • PCR reaction conditions were determined using methods known in the art. PCR products were separated by agarose gel electrophoresis and purified using a QiaQuickTM (Qiagen) gel extraction kit. The isolated, correct sized DNA fragment was digested with Fsel and Ascl (New England Biolabs), ethanol precipitated and ligated into E ⁇ Lck, previously digested with Fsel and Ascl.
  • About one microliter of ligation reaction was electroporated into DHlOB ElectroMax
  • TM competent cells (GIBCO BRL, Gaithersburg, MD) according to manufacturer's directions and plated onto LB plates containing 100 ⁇ g/ml ampicillin, and incubated overnight. Colonies were picked and grown in LB media containing 100 ⁇ g/ml ampicillin. Miniprep DNA was prepared from the picked colonies and screened for the murine zimlig2 insert by restriction digestion Fsel and Ascl and subsequent agarose gel electrophoresis. The TG construct with correct cDNA inserts were confirmed by sequencing analysis. Maxipreps of the correct zimlig2 were performed.
  • a Notl fragment of about 6.95 Kb in length was isolated from the TG vector containing 5' and 3' flanking sequences of the lymphocyte specific E ⁇ Lck promoter/enhancer, murine zimlig2 cDNA, and the human growth hormone (hGH) poly adenylation signal sequences. [260] The isolated fragment was used for microinjection into fertilized B6C3fl (Taconic,
  • Germantown, NY murine oocytes. Microinjection and production of TG mice were produced as described in Hogan, B. et al. Manipulating the Mouse Embryo, 2 nd ed., Cold Spring Harbor Laboratory Press, NY, 1994.
  • PCR was utilized to genotype offspring. Primers which anneal and amplify a 368bp region in the hGH poly adenylation region were used to identify TG mice. Primer 18358: GTGGCCATGGAAAGACTTCTCACCTC (SEQ ID NO:26) and primer 18359: TGGGCCTCCCTTGCCCTTTTCTTTTG (SEQ ID NO:27) were used to amplify a 190 bp genomic fragment control for both wt and TG genotypes. This PCR product served as a PCR control.
  • Primer 17251 TCTGGACGTCCTCCTGCTGGTATAG (SEQ ID NO:28) and primer 17252: GGTATGGAGCAAGGGGCAAGTTGGG (SEQ ID NO:29) were used to amplify a 368 bp fragment from the hGH mini gene.
  • This PCR product confirmed the presence of the TG construct.
  • Primer 17156: GAGTGGCAACTTCCAGGGCCAGGAGAG (SEQ ID NO:30) and primer 17157: CTTTTGCTAGCCTCAACCCTGACTATC (SEQ ID NO:31) were used to amplify a 520 bp fragment containing murine zimlig2 cDNA sequence. This PCR product confirmed the size of the cDNA.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Immunology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pharmacology & Pharmacy (AREA)
  • General Chemical & Material Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Toxicology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

Novel Zimlig2 polypeptides, polynucleotides and antibodies have inflammation modulating activity and tumor rejection and killing abilities, and are useful within related research and therapeutic applications.

Description

PATENT 06-2 IPC
ZIMLIG2 POLYNUCLEOTIDES AND POLYPEPTIDES AND METHODS OF USE
BACKGROUND OF THE INVENTION
[1] The immune system is the body's natural defense against a host of diseases. A healthy immune system reacts against harmful pathogens, and failure of an immune system to respond appropriately can result in unchecked infection, disease, or growth of tumor cells. Putting immunotherapy into practice is a highly desired goal in the treatment of such human diseases.
[2] The basis for immunotherapy is the manipulation of immune responses, for example the responses of T cells. T cells possess complex and subtle systems for controlling their interactions, utilizing numerous receptors and soluble factors for the process. Thus there is a need to produce such agents that can enhance T cell proliferation.
[3] The present invention provides a Zimlig2 protein and a novel use of Zimlig2 to enhance the immune response, to regulate inflammation, enhance T cell proliferation, enhance tumor killing or rejection and other uses that should be apparent to those skilled in the art from the teachings herein.
SUMMARY OF THE INVENTION
[4] Within one aspect, the present invention provides an isolated polypeptide consisting of an amino acid sequence having at least 90% identity to amino acid residues 71 to 148 of SEQ ID NO:2, truncated Zimlig2. Within one embodiment, the present invention provides an isolated polypeptide comprising residues 71 through 148 of SEQ ID NO:2. Within another embodiment, the present invention provides an isolated polypeptide consisting of residues 71 through 148 of SEQ ID NO:2. The isolated polypeptide consisting of residues 71 through 148 of SEQ ID NO:2 may encompass modifications. Within another embodiment, the present invention provides an isolated polypeptide comprising the amino acid residues of SEQ ID NO:5. Within another embodiment, the present invention provides an isolated polypeptide consisting of the amino acid residues of SEQ ID NO:5. Within another embodiment, the present invention provides an 11 KDa isolated mature polypeptide consisting of an amino acid sequence having at least 90% identity to amino acid residues 32 to 148 of SEQ ID NO:2. Within one embodiment, the present invention provides an isolated polypeptide comprising residues 32 through 148 of SEQ ID NO:2. Within another embodiment, the present invention provides an isolated polypeptide consisting of residues 32 through 148 of SEQ ID NO:2. The isolated polypeptide consisting of residues 32 through 148 of SEQ ID NO:2 may encompass modifications. Within another embodiment, between one and six of the amino acid residues at positions 114, 115, 118, 123, 145, and 148 of SEQ ID NO:2 are tyrosine residues. Within another embodiment, between one and six of the tyrosine residues at positions 114, 115, 118, 123, 145, and 148 of SEQ ID NO:2 are modified. Within another embodiment, between one and six of the tyrosine residues at positions 114, 115, 118, 123, 145, and 148 of SEQ ID NO:2 are modified by sulfation. Within another embodiment, between one and six of the tyrosine residues at positions 114, 115, 118, 123, 145, and 148 of SEQ ID NO:2 are modified by phosphation. Within another embodiment, between one and six of the tyrosine residues at positions 114, 115, 118, 123, 145, and 148 of SEQ ID NO:2 are modified by sulfation or phosphation. Within another embodiment, the amino acid residues at positions 123, 145, and 148 of SEQ ID NO:2 are tyrosine residues, and one or more of the amino acid residues at positions 114, 115, and 118 of SEQ ID NO:2 are tyrosine residues. Within another embodiment, the tyrosine residues at positions 123, 145, and 148 of SEQ ID NO:2 are modified, and one or more of the tyrosine residues at positions 114, 115, and 118 of SEQ ID NO:2 are modified. Within another embodiment, the modification to the tyrosine residues at positions 123, 145, and 148 of SEQ ID NO:2 is sulfation, and the modification to one or more of the tyrosine residues at positions 114, 115, and 118 of SEQ ID NO:2 is sulfation. Within another embodiment, the modification to the tyrosine residues at positions 123, 145, and 148 of SEQ ID NO:2 is a phosphation, and the modification to one or more of the tyrosine residues at positions 114, 115, and 118 of SEQ ID NO:2 is a phosphation. Within another embodiment, the amino acid residues at positions 123, 145, and 148 of SEQ ID NO:2 are tyrosine residues. Within another embodiment, the tyrosine residues at positions 123, 145, and 148 of SEQ ID NO:2 are modified. Within another embodiment, the modification to the tyrosine residues at positions 123, 145, and 148 of SEQ ID NO:2 is sulfation. Within another embodiment, the modification to the tyrosine residues at positions 123, 145, and 148 of SEQ ID NO:2 is phosphation. Within another embodiment, the amino acid residue at position 142 of SEQ ID NO:2 is a serine. Within another embodiment, the amino acid residue at position 142 of SEQ ID NO:2 is modified. Within another embodiment, the serine residue at position 142 of SEQ ID NO:2 has an O-glycosylation. Within another embodiment, the serine residue at position 142 of SEQ ID NO:2 is linked to a carbohydrate epitope such as Slex (sialyl lewisx oligosaccharide) or another sialyl lewis. Within another embodiment, the amino acid at position 71 of SEQ ID NO:2 is a glutamine. Within another embodiment, the amino acid at position 71 of SEQ ID NO:2 is pyroglutamine. Within another embodiment, the amino acid residues at positions 123, 145, and 148 of SEQ ID NO:2 are sulfated tyrosine, and the amino acid at position 142 of SEQ ID NO:2 has an O- glycosylation. Within another embodiment, the amino acid residues at positions 123, 145, and 148 of SEQ ID NO:2 are sulfated tyrosine, the amino acid at position 142 of SEQ ID NO:2 has an O- glycosylation, and the amino acid at position 71 of SEQ ID NO:2 is a pyroglutamine. Within another embodiment, the isolated polypeptide is covalently linked to an affinity tag or to an immunoglublulin constant region. [5] Within another aspect, the present invention provides an isolated polynucleotide that encodes an isolated polypeptide consisting of an amino acid sequence having at least 90% identity to amino acid residues 71 to 148 of SEQ ID NO:2, truncated Zimlig2. Within one embodiment, the isolated polynucleotide is a polynucleotide that begins at position 290 of SEQ ID NO: 6 and ends at position 523 of SEQ ID NO: 1. Within another embodiment, the present invention provides an isolated polynucleotide that encodes an isolated polypeptide comprising residues 71 through 148 of SEQ ID NO:2. Within another embodiment, the present invention provides an isolated polynucleotide that encodes an isolated polypeptide consisting of residues 71 through 148 of SEQ ID NO:2. The isolated polypeptide consisting of residues 71 through 148 of SEQ ID NO:2 may encompass modifications. Within another embodiment, the present invention provides an isolated polynucleotide that encodes an isolated polypeptide comprising the amino acid residues of SEQ ID NO:5. Within another embodiment, the present invention provides an isolated polynucleotide that encodes an isolated polypeptide consisting of the amino acid residues of SEQ ID NO:5. Within another embodiment, the present invention provides an isolated polynucleotide that encodes an 11 KDa isolated mature polypeptide consisting of an amino acid sequence having at least 90% identity to amino acid residues 32 to 148 of SEQ ID NO:2. Within another embodiment, the isolated polynucleotide that encodes mature Zimlig2 begins at position 173 of SEQ ID NO: 1 and ends at position 523 of SEQ ID NO: 1. Within another embodiment, the present invention provides an isolated polypeptide comprising residues 32 through 148 of SEQ ID NO:2. Within another embodiment, the present invention provides an isolated polynucleotide that encodes an isolated polypeptide consisting of residues 32 through 148 of SEQ ID NO:2. The encoded isolated polypeptide consisting of residues 32 through 148 of SEQ ID NO:2 may encompass modifications. Within another embodiment, between one and six of the encoded amino acid residues at positions
114, 115, 118, 123, 145, and 148 of SEQ ID NO:2 are tyrosine residues. Within another embodiment, between one and six of the encoded tyrosine residues at positions 114, 115, 118, 123, 145, and 148 of SEQ ID NO:2 are modified. Within another embodiment, between one and six of the encoded tyrosine residues at positions 114, 115, 118, 123, 145, and 148 of SEQ ID NO:2 are modified by sulfation. Within another embodiment, between one and six of the encoded tyrosine residues at positions 114,
115, 118, 123, 145, and 148 of SEQ ID NO:2 are modified by phosphation. Within another embodiment, between one and six of the encoded tyrosine residues at positions 114, 115, 118, 123, 145, and 148 of SEQ ID NO:2 are modified by sulfation or phosphation. Within another embodiment, the encoded amino acid residues at positions 123, 145, and 148 of SEQ ID NO:2 are tyrosine residues, and one or more of the amino acid residues at positions 114, 115, and 118 of SEQ ID NO:2 are tyrosine residues. Within another embodiment, the encoded tyrosine residues at positions 123, 145, and 148 of SEQ ID NO:2 are modified, and one or more of the tyrosine residues at positions 114, 115, and 118 of SEQ ID NO:2 are modified. Within another embodiment, the modification to the encoded tyrosine residues at positions 123, 145, and 148 of SEQ ID NO:2 is sulfation, and the modification to one or more of the tyrosine residues at positions 114, 115, and 118 of SEQ ID NO:2 is sulfation. Within another embodiment, the modification to the encoded tyrosine residues at positions 123, 145, and 148 of SEQ ID NO:2 is a phosphation, and the modification to one or more of the encoded tyrosine residues at positions 114, 115, and 118 of SEQ ID NO:2 is a phosphation. Within another embodiment, the encoded amino acid residues at positions 123, 145, and 148 of SEQ ID NO:2 are tyrosine residues. Within another embodiment, the encoded tyrosine residues at positions 123, 145, and 148 of SEQ ID NO:2 are modified. Within another embodiment, the modification to the encoded tyrosine residues at positions 123, 145, and 148 of SEQ ID NO:2 is sulfation. Within another embodiment, the modification to the encoded tyrosine residues at positions 123, 145, and 148 of SEQ ID NO:2 is phosphation. Within another embodiment, the encoded amino acid residue at position 142 of SEQ ID NO:2 is a serine. Within another embodiment, the encoded amino acid residue at position 142 of SEQ ID NO:2 is modified. Within another embodiment, the encoded serine residue at position 142 of SEQ ID NO:2 has an O-glycosylation. Within another embodiment, the encoded serine residue at position 142 of SEQ ID NO:2 is linked to a carbohydrate epitope such as Slex (sialyl lewisx oligosaccharide) or another sialyl lewis. Within another embodiment, the encoded amino acid at position 71 of SEQ ID NO:2 is a glutamine. Within another embodiment, the encoded amino acid at position 71 of SEQ ID NO:2 is pyroglutamine. Within another embodiment, the encoded amino acid residues at positions 123, 145, and 148 of SEQ ID NO:2 are sulfated tyrosine, and the encoded amino acid at position 142 of SEQ ID NO:2 has an O-glycosylation. Within another embodiment, the encoded amino acid residues at positions 123, 145, and 148 of SEQ ID NO:2 are sulfated tyrosine, the encoded amino acid at position 142 of SEQ ID NO:2 has an O-glycosylation, and the encoded amino acid at position 71 of SEQ ID NO:2 is a pyroglutamine. Within another embodiment, the isolated polypeptide is covalently linked to an affinity tag or to an immunoglublulin constant region.
[6] Within one aspect, the present invention provides an isolated murine polypeptide consisting of an amino acid sequence having at least 90% identity to amino acid residues 71 to 148 of SEQ ID NO:7, truncated murine Zimlig2. Within one embodiment, the present invention provides an isolated murine polypeptide comprising residues 71 through 148 of SEQ ID NO:7. Within another embodiment, the present invention provides an isolated murine polypeptide consisting of residues 71 through 148 of SEQ ID NO:7. The isolated murine polypeptide consisting of residues 71 through 148 of SEQ ID NO:7 may encompass modifications. Within another embodiment, the present invention provides an isolated murine polypeptide comprising the amino acid residues of SEQ ID NO: 10. Within another embodiment, the present invention provides an isolated murine polypeptide consisting of the amino acid residues of SEQ ID NO: 10. Within another embodiment, the present invention provides an 11 KDa isolated mature murine polypeptide consisting of an amino acid sequence having at least 90% identity to amino acid residues 32 to 148 of SEQ ID NO:7. Within one embodiment, the present invention provides an isolated murine polypeptide comprising residues 32 through 148 of SEQ ID NO:7. Within another embodiment, the present invention provides an isolated murine polypeptide consisting of residues 32 through 148 of SEQ ID NO:7. The isolated murine polypeptide consisting of residues 32 through 148 of SEQ ID NO:7 may encompass modifications. Within another embodiment, between one and six of the amino acid residues at positions 114, 115, 118, 123, 145, and 148 of SEQ ID NO:7 are tyrosine residues. Within another embodiment, between one and six of the tyrosine residues at positions 114, 115, 118, 123, 145, and 148 of SEQ ID NO:7 are modified. Within another embodiment, between one and six of the tyrosine residues at positions 114, 115, 118, 123, 145, and 148 of SEQ ID NO:7 are modified by sulfation. Within another embodiment, between one and six of the tyrosine residues at positions 114, 115, 118, 123, 145, and 148 of SEQ ID NO: 7 are modified by phosphation. Within another embodiment, between one and six of the tyrosine residues at positions 114, 115, 118, 123, 145, and 148 of SEQ ID NO:7 are modified by sulfation or phosphation. Within another embodiment, the amino acid residues at positions 123, 145, and 148 of SEQ ID NO: 7 are tyrosine residues, and one or more of the amino acid residues at positions 114, 115, and 118 of SEQ ID NO:7 are tyrosine residues. Within another embodiment, the tyrosine residues at positions 123, 145, and 148 of SEQ ID NO:7 are modified, and one or more of the tyrosine residues at positions 114, 115, and 118 of SEQ ID NO:7 are modified. Within another embodiment, the modification to the tyrosine residues at positions 123, 145, and 148 of SEQ ID NO:7 is sulfation, and the modification to one or more of the tyrosine residues at positions 114, 115, and 118 of SEQ ID NO: 7 is sulfation. Within another embodiment, the modification to the tyrosine residues at positions 123, 145, and 148 of SEQ ID NO:7 is a phosphation, and the modification to one or more of the tyrosine residues at positions 114, 115, and 118 of SEQ ID NO:7 is a phosphation. Within another embodiment, the amino acid residues at positions 123, 145, and 148 of SEQ ID NO:7 are tyrosine residues. Within another embodiment, the tyrosine residues at positions 123, 145, and 148 of SEQ ID NO:7 are modified. Within another embodiment, the modification to the tyrosine residues at positions 123, 145, and 148 of SEQ ID NO:7 is sulfation. Within another embodiment, the modification to the tyrosine residues at positions 123, 145, and 148 of SEQ ID NO:7 is phosphation. Within another embodiment, the amino acid residue at position 142 of SEQ ID NO:7 is a serine. Within another embodiment, the amino acid residue at position 142 of SEQ ID NO: 7 is modified. Within another embodiment, the serine residue at position 142 of SEQ ID NO: 7 has an O-glycosylation. Within another embodiment, the serine residue at position 142 of SEQ ID NO: 7 is linked to a carbohydrate epitope such as Slex (sialyl lewisx oligosaccharide) or another sialyl lewis. Within another embodiment, the amino acid at position 71 of SEQ ID NO: 7 is a glutamine. Within another embodiment, the amino acid at position 71 of SEQ ID NO: 7 is pyroglutamine. Within another embodiment, the amino acid residues at positions 123, 145, and 148 of SEQ ID NO:7 are sulfated tyrosine, and the amino acid at position 142 of SEQ ID NO:7 has an O-glycosylation. Within another embodiment, the amino acid residues at positions 123, 145, and 148 of SEQ ID NO:7 are sulfated tyrosine, the amino acid at position 142 of SEQ ID NO: 7 has an O-glycosylation, and the amino acid at position 71 of SEQ ID NO:2 is a pyroglutamine. Within another embodiment, the isolated murine polypeptide is covalently linked to an affinity tag or to an immunoglublulin constant region.
[7] Within another aspect, the present invention provides an isolated polynucleotide that encodes an isolated murine polypeptide consisting of an amino acid sequence having at least 90% identity to amino acid residues 71 to 148 of SEQ ID NO:7, truncated murine Zimlig2. Within one embodiment, the isolated polynucleotide is a polynucleotide that begins at position 290 of SEQ ID NO: 6 and ends at position 523 of SEQ ID NO: 6. Within another embodiment, the present invention provides an isolated polynucleotide that encodes an isolated murine polypeptide comprising residues 71 through 148 of SEQ ID NO:7. Within another embodiment, the present invention provides an isolated polynucleotide that encodes an isolated murine polypeptide consisting of residues 71 through 148 of SEQ ID NO:7. The isolated murine polypeptide consisting of residues 71 through 148 of SEQ ID NO: 7 may encompass modifications. Within another embodiment, the present invention provides an isolated polynucleotide that encodes an isolated murine polypeptide comprising the amino acid residues of SEQ ID NO: 10. Within another embodiment, the present invention provides an isolated polynucleotide that encodes an isolated murine polypeptide consisting of the amino acid residues of SEQ ID NO: 10. Within another embodiment, the present invention provides an isolated polynucleotide that encodes an 11 KDa isolated mature murine polypeptide consisting of an amino acid sequence having at least 90% identity to amino acid residues 32 to 148 of SEQ ID NO:7. Within another embodiment, the isolated polynucleotide that encodes mature murine Zimlig2 begins at position 173 of SEQ ID NO:6 and ends at position 523 of SEQ ID NO:6. Within another embodiment, the present invention provides an isolated polypeptide comprising residues 32 through 148 of SEQ ID NO:7. Within another embodiment, the present invention provides an isolated polynucleotide that encodes an isolated murine polypeptide consisting of residues 32 through 148 of SEQ ID NO:7. The encoded isolated murine polypeptide consisting of residues 32 through 148 of SEQ ID NO:7 may encompass modifications. Within another embodiment, between one and six of the encoded amino acid residues at positions 114, 115, 118, 123, 145, and 148 of SEQ ID NO:7 are tyrosine residues. Within another embodiment, between one and six of the encoded tyrosine residues at positions 114, 115, 118, 123, 145, and 148 of SEQ ID NO:7 are modified. Within another embodiment, between one and six of the encoded tyrosine residues at positions 114, 115, 118, 123, 145, and 148 of SEQ ID NO:7 are modified by sulfation. Within another embodiment, between one and six of the encoded tyrosine residues at positions 114, 115, 118, 123, 145, and 148 of SEQ ID NO: 7 are modified by phosphation. Within another embodiment, between one and six of the encoded tyrosine residues at positions 114, 115, 118, 123, 145, and 148 of SEQ ID NO:7 are modified by sulfation or phosphation. Within another embodiment, the encoded amino acid residues at positions 123, 145, and 148 of SEQ ID NO:7 are tyrosine residues, and one or more of the amino acid residues at positions 114, 115, and 118 of SEQ ID NO:7 are tyrosine residues. Within another embodiment, the encoded tyrosine residues at positions 123, 145, and 148 of SEQ ID NO:7 are modified, and one or more of the tyrosine residues at positions 114, 115, and 118 of SEQ ID NO:7 are modified. Within another embodiment, the modification to the encoded tyrosine residues at positions 123, 145, and 148 of SEQ ID NO:7 is sulfation, and the modification to one or more of the tyrosine residues at positions 114, 115, and 118 of SEQ ID NO:7 is sulfation. Within another embodiment, the modification to the encoded tyrosine residues at positions 123, 145, and 148 of SEQ ID NO:7 is a phosphation, and the modification to one or more of the encoded tyrosine residues at positions 114, 115, and 118 of SEQ ID NO: 7 is a phosphation. Within another embodiment, the encoded amino acid residues at positions 123, 145, and 148 of SEQ ID NO:7 are tyrosine residues. Within another embodiment, the encoded tyrosine residues at positions 123, 145, and 148 of SEQ ID NO: 7 are modified. Within another embodiment, the modification to the encoded tyrosine residues at positions 123, 145, and 148 of SEQ ID NO: 7 is sulfation. Within another embodiment, the modification to the encoded tyrosine residues at positions 123, 145, and 148 of SEQ ID NO:7 is phosphation. Within another embodiment, the encoded amino acid residue at position 142 of SEQ ID NO:7 is a serine. Within another embodiment, the encoded amino acid residue at position 142 of SEQ ID NO: 7 is modified. Within another embodiment, the encoded serine residue at position 142 of SEQ ID NO: 7 has an O-glycosylation. Within another embodiment, the encoded serine residue at position 142 of SEQ ID NO: 7 is linked to a carbohydrate epitope such as Slex (sialyl lewisx oligosaccharide) or another sialyl lewis. Within another embodiment, the encoded amino acid at position 71 of SEQ ID NO:7 is a glutamine. Within another embodiment, the encoded amino acid at position 71 of SEQ ID NO: 7 is pyroglutamine. Within another embodiment, the encoded amino acid residues at positions 123, 145, and 148 of SEQ ID NO:7 are sulfated tyrosine, and the encoded amino acid at position 142 of SEQ ID NO:7 has an O- glycosylation. Within another embodiment, the encoded amino acid residues at positions 123, 145, and 148 of SEQ ID NO:7 are sulfated tyrosine, the encoded amino acid at position 142 of SEQ ID NO:7 has an O-glycosylation, and the encoded amino acid at position 71 of SEQ ID NO:7 is a pyroglutamine. Within another embodiment, the isolated murine polypeptide is covalently linked to an affinity tag or to an immunoglublulin constant region.
[8] Within another aspect, the present invention provides an expression vector, comprising an isolated polynucleotide as described herein. Within one embodiment, the present invention provides an expression vector comprising a transcription promoter, an isolated polynucleotide as described herein, and a transcription terminator, wherein the promoter, the isolated polynucleotide, and the transcription terminator are operably linked. Within another embodiment, the present invention provides an expression vector comprising a transcription promoter, an isolated polynucleotide as described herein, an affinity tag, and a transcription terminator, wherein the promoter, the isolated polynucleotide, the affinity tag, and the transcription terminator are operably linked.
[9] Within another aspect, the present invention provides a recombinant host cell comprising an expression vector as described herein, wherein the host cell is a bacterium, yeast cell, fungal cell, insect cell, mammalian cell, or plant cell.
[10] Within another aspect, the present invention provides a method of producing an isolated polypeptide comprising culturing recombinant host cells that comprise an expression vector as described herein, and that produce an isolated polypeptide as described herein, and isolating the isolated polypeptide from the cultured recombinant host cells.
[11] Within another aspect, the present invention provides a polypeptide produced by a method described herein.
[12] Within another aspect, the present invention provides a cultured cell into which has been introduced an expression vector as disclosed herein, wherein the cell expresses the polypeptide encoded by the DNA segment. The cell can be used within a method of producing a polypeptide, wherein the method comprises culturing the cell, whereby the cell expresses the polypeptide encoded by the DNA segment, and recovering the expressed polypeptide.
[13] Within another aspect, the invention provides a method for regulating the immune response, comprising administering an isolated polypeptide as described herein to a mammal, wherein administration of the polypeptide results in a clinically significant improvement in the inflammatory condition of the mammal. Within another embodiment, the clinically significant improvement of the inflammatory condition may be an increase in an inflammatory response, where the inflammatory response was turned down or is not present.
[14] Within another aspect, the present invention provides a method for enhanced tumor killing and/or tumor rejection by aiding the immune response by administering an isolated polypetide as described herein. Within one embodiment, the increase in the immune response is an increase in T cell population.
[15] Within another aspect, the present invention provides a method for increasing T cell population by administering an isolated polypeptide as described herein. Within one embodiment, the present invention provides a method for increasing T cell proliferation by administering an isolated polypeptide as described herein.
[16] Within another aspect, the present invention provides a method for enhancing Leukocyte adhesion to endothelail cells comprising administering an isolated polypeptide as described herein. Within one embodiment, the isolated polypeptide enhances Leukocyte adhesion to endothelial cells by binding to a selectin. Within another embodiment, the isolated polypeptide enhances Leukocyte adhesion to endothelial cells by binding to a P-selectin. [17] Within another aspect, the present invention provides an antagonist to an isolated protein as described herein. Within one embodiment, the antagonist comprises a monoclonal antibody, polyclonal antibody, or fragment or fragments thereof that binds to an epitope of an isolated protein as described herein. Within one embodiment, the antagonist consists of a monoclonal antibody, polyclonal antibody, or fragment or fragments thereof that binds to an epitope of an isolated protein as described herein. Within another embodiment, the antagonist inhibits or prevents an immune response. Within another embodiment, the decrease in the immune response is a decrease in inflammation. Within another embodiment, the antagonist inhibits or prevents Leukocyte adhesion to endothelial cells. Within another embodiment, the antagonist inhibits or prevents T cell proliferation.
[18] Within another aspect, the present invention provides a method of producing an antibody that specifically binds to an isolated polypeptide as described herein comprising: inoculating an animal with the polypeptide to elicit an immune response in the animal to produce the antibody; and isolating the antibody from the animal.
[19] Within another aspect, the present invention provides an antibody produced by a method as described herein.
[20] Within another aspect, the present invention provides an antibody that specifically binds to an epitope of an isolated protein as described herein. Within one embodiment, the epitope comprises or consists of the amino acid residues from position 74-79 of SEQ ID NO:2. Within another embodiment, the epitope comprises or consists of the amino acid residues from position 93-98 of SEQ ID NO:2. Within another embodiment, the epitope comprises or consists of the amino acid residues from position 106-111 of SEQ ID NO:2. Within another embodiment, the epitope comprises or consists of the amino acid residues from position 107-112 of SEQ ID NO:2. Within another embodiment, the epitope comprises or consists of the amino acid residues from position 131-136 of SEQ ID NO:2. Within another embodiment, the epitope comprises or consists of 73-80 contiguous amino acids of SEQ ID NO:2. Within another embodiment, the epitope comprises or consists of 81- 90 contiguous amino acid residues of SEQ ID NO:2. Within another embodiment, the epitope comprises or consists of 91-100 contiguous amino acids residues of SEQ ID NO:2.
[21] Within another aspect, the present invention provides an antibody that specifically binds to an epitope of an isolated murine protein as described herein. Within one embodiment, the epitope comprises or consists of the amino acid residues from position 74-79 of SEQ ID NO:7. Within another embodiment, the epitope comprises or consists of the amino acid residues from position 93-98 of SEQ ID NO:7. Within another embodiment, the epitope comprises or consists of the amino acid residues from position 106-111 of SEQ ID NO:7. Within another embodiment, the epitope comprises or consists of the amino acid residues from position 107-112 of SEQ ID NO:7. Within another embodiment, the epitope comprises or consists of the amino acid residues from position 121-126 of SEQ ID NO:7. Within another embodiment, the epitope comprises or consists of the amino acid residues from position 131-136 of SEQ ID NO:7. Within another embodiment, the epitope comprises or consists of 73-80 contiguous amino acids of SEQ ID NO:7. Within another embodiment, the epitope comprises or consists of 81-90 contiguous amino acid residues of SEQ ID NO:7. Within another embodiment, the epitope comprises or consists of 91-100 contiguous amino acids residues of SEQ ID NO:7.
[22] Within another embodiment, the present invention provides a method for regulating an immune response comprising administering an antibody as described herein, wherein administration of the antibody results in a decrease in immune response. Within another embodiment, the decrease in the immune response is a decrease in T cell proliferation.
[23] Within another embodiment, the present invention provides a method for inhibiting or preventing Leukocyte adhesion to endothelial cells comprising administering an antibody as described herein.
[24] Within another embodiment, the present invention provides a method for inhibiting or preventing T cell proliferation comprising administering an antibody as described herein.
DESCRIPTION OF THE INVENTION
[25] The following definitions are provided to facilitate understanding of the invention described herein.
[26] The term "affinity tag" is used herein to denote a polypeptide segment that can be attached to a second polypeptide to provide for purification or detection of the second polypeptide or provide sites for attachment of the second polypeptide to a substrate. In principal, any peptide or protein for which an antibody or other specific binding agent is available can be used as an affinity tag. Affinity tags include a poly-histidine tract, protein A (Nilsson et al., EMBO J. 4: 1075, 1985; Nilsson et al., Methods Enzymol. 198:3. 1991), glutathione S transferase (Smith and Johnson, Gene 67:31, 1988), Glu-Glu affinity tag (Grussenmeyer et al., Proc. Natl. Acad. Sci. USA 82:7952-4, 1985), substance P, Flag™ peptide (Hopp et al., Biotechnology 6:1204-10, 1988), streptavidin binding peptide, or other antigenic epitope or binding domain. See, in general, Ford et al., Protein Expression and Purification 2: 95-107, 1991. DNAs encoding affinity tags are available from commercial suppliers (e.g., Pharmacia Biotech, Piscataway, NJ).
[27] The term "allelic variant" is used herein to denote any of two or more alternative forms of a gene occupying the same chromosomal locus. Allelic variation arises naturally through mutation, and may result in phenotypic polymorphism within populations. Gene mutations can be silent (no change in the encoded polypeptide) or may encode polypeptides having altered amino acid sequence. The term allelic variant is also used herein to denote a protein encoded by an allelic variant of a gene. [28] The terms "amino-terminal" and "carboxyl-terminal" are used herein to denote positions within polypeptides. Where the context allows, these terms are used with reference to a particular sequence or portion of a polypeptide to denote proximity or relative position. For example, a certain sequence positioned carboxyl-terminal to a reference sequence within a polypeptide is located proximal to the carboxyl terminus of the reference sequence, but is not necessarily at the carboxyl terminus of the complete polypeptide.
[29] The term "truncated Zimlig2" describes a soluble protein that results from enzymatic cleavages of the full-length protein, such as removal of the signal sequence (residues 1-31 of SEQ ID NO:2) and the removal of residues 32 to 71 of SEQ ID NO:2. An example of a post translationally modifed amino acid sequence of the truncated Zimlig2 is shown in SEQ ID NO:5. A truncated Zimlig2 molecule may comprise some or all of the embodiments described herein.
[30] The term "truncated murine Zimlig2" describes a soluble protein that results from enzymatic cleavages of the full-length protein, such as removal of the signal sequence (residues 1-31 of SEQ ID NO:2) and the removal of residues 32 to 71 of SEQ ID NO:7. An example of a post translationally modifed amino acid sequence of the truncated murine Zimlig2 is shown in SEQ ID NO: 10. A truncated murine Zimlig2 molecule may comprise some or all of the embodiments described herein.
[31] The term "complement/anti-complement pair" denotes non-identical moieties that form a non-covalently associated, stable pair under appropriate conditions. For instance, biotin and avidin (or streptavidin) are prototypical members of a complement/anti-complement pair. Other exemplary complement/anti-complement pairs include receptor/ligand pairs, antibody/antigen (or hapten or epitope) pairs, sense/antisense polynucleotide pairs, and the like. Where subsequent dissociation of the complement/anti-complement pair is desirable, the complement/anti-complement pair preferably has a binding affinity of <lθ" M~l.
[32] The term "degenerate nucleotide sequence" denotes a sequence of nucleotides that includes one or more degenerate codons (as compared to a reference polynucleotide molecule that encodes a polypeptide). Degenerate codons contain different triplets of nucleotides, but encode the same amino acid residue (i.e., GAU and GAC triplets each encode Asp).
[33] The term "expression vector" is used to denote a DNA molecule, linear or circular, that comprises a segment encoding a polypeptide of interest operably linked to additional segments that provide for its transcription. Such additional segments include promoter and terminator sequences, and may also include one or more origins of replication, one or more selectable markers, an enhancer, a polyadenylation signal, etc. Expression vectors are generally derived from plasmid or viral DNA, or may contain elements of both.
[34] A "cloning vector" is a nucleic acid molecule, such as a plasmid, cosmid, or bacteriophage, that has the capability of replicating autonomously in a host cell. Cloning vectors typically contain one or a small number of restriction endonuclease recognition sites that allow insertion of a nucleic acid molecule in a determinable fashion without loss of an essential biological function of the vector, as well as nucleotide sequences encoding a marker gene that is suitable for use in the identification and selection of cells transformed with the cloning vector. Marker genes typically include genes that provide tetracycline resistance or ampicillin resistance.
[35] The term "isolated", when applied to a polynucleotide, denotes that the polynucleotide has been removed from its natural genetic milieu and is thus free of other extraneous or unwanted coding sequences, and is in a form suitable for use within genetically engineered protein production systems. Such isolated molecules are those that are separated from their natural environment and include cDNA and genomic clones. Isolated DNA molecules of the present invention are free of other genes with which they are ordinarily associated, but may include naturally occurring 5' and 3' untranslated regions such as promoters and terminators. The identification of associated regions will be evident to one of ordinary skill in the art (see for example, Dynan and Tiian. Nature 316:774-78. 1985).
[36] An "isolated" polypeptide or protein is a polypeptide or protein that is found in a condition other than its native environment, such as apart from blood and animal tissue. In a preferred form, the isolated polypeptide is substantially free of other polypeptides, particularly other polypeptides of animal origin. It is preferred to provide the polypeptides in a highly purified form, i.e. greater than 95% pure, or greater than 99% pure. When used in this context, the term "isolated" does not exclude the presence of the same polypeptide in alternative physical forms, such as dimers or alternatively glycosylated or derivatized forms.
[37] The term "mature Zimlig2" describes a protein comprising or consisting of residue 32 to residue 148 of SEQ ID NO:2 and is also shown in SEQ ID NO:4.
[38] The term "mature murine Zimlig2" describes a protein comprising or consisting of residues 32 to residue 148 of SEQ ID NO:7 and is also shown in SEQ ID NO:9.
[39] The term "operably linked", when referring to DNA segments, indicates that the segments are arranged so that they function in concert for their intended purposes, e.g., transcription initiates in the promoter and proceeds through the coding segment to the terminator.
[40] The term "ortholog" denotes a polypeptide or protein obtained from one species that is the functional counterpart of a polypeptide or protein from a different species. Sequence differences among orthologs are the result of speciation.
[41] "Paralogs" are distinct but structurally related proteins made by an organism. Paralogs are believed to arise through gene duplication. For example, α-globin, β-globin, and myoglobin are paralogs of each other.
[42] A "polynucleotide" is a single- or double-stranded polymer of deoxyribonucleotide or ribonucleotide bases read from the 5' to the 3' end. Polynucleotides include RNA and DNA, and may be isolated from natural sources, synthesized in vitro, or prepared from a combination of natural and synthetic molecules. Sizes of polynucleotides are expressed as base pairs (abbreviated "bp"), nucleotides ("nt"), or kilobases ("kb"). Where the context allows, the latter two terms may describe polynucleotides that are single-stranded or double-stranded. When the term is applied to double- stranded molecules it is used to denote overall length and will be understood to be equivalent to the term "base pairs". It will be recognized by those skilled in the art that the two strands of a double- stranded polynucleotide may differ slightly in length and that the ends thereof may be staggered as a result of enzymatic cleavage; thus all nucleotides within a double-stranded polynucleotide molecule may not be paired.
[43] A "polypeptide" is a polymer of amino acid residues joined by peptide bonds, whether produced naturally or synthetically. Polypeptides of less than about 10 amino acid residues are commonly referred to as "peptides".
[44] The term "promoter" is used herein for its art-recognized meaning to denote a portion of a gene containing DNA sequences that provide for the binding of RNA polymerase and initiation of transcription. Promoter sequences are commonly, but not always, found in the 5' non-coding regions of genes.
[45] A "protein" is a macromolecule comprising one or more polypeptide chains. A protein may also comprise non-peptidic components, such as carbohydrate groups. Carbohydrates and other non-peptidic substituents may be added to a protein by the cell in which the protein is produced, and will vary with the type of cell. Proteins are defined herein in terms of their amino acid backbone structures; substituents such as carbohydrate groups are generally not specified, but may be present nonetheless.
[46] The term "receptor" denotes a cell-associated protein that binds to a bioactive molecule (i.e., a ligand) and mediates the effect of the ligand on the cell. Membrane-bound receptors are characterized by a multi-peptide structure comprising an extracellular ligand-binding domain and an intracellular effector domain that is typically involved in signal transduction. Binding of ligand to receptor results in a conformational change in the receptor that causes an interaction between the effector domain and other molecule(s) in the cell. This interaction in turn leads to an alteration in the metabolism of the cell. Metabolic events that are linked to receptor-ligand interactions include gene transcription, phosphorylation, dephosphorylation, increases in cyclic AMP production, mobilization of cellular calcium, mobilization of membrane lipids, cell adhesion, hydrolysis of inositol lipids and hydrolysis of phospholipids. In general, receptors can be membrane bound, cytosolic or nuclear; monomeric (e.g., thyroid stimulating hormone receptor, beta-adrenergic receptor) or multimeric (e.g., PDGF receptor, growth hormone receptor, IL-3 receptor, GM-CSF receptor, G-CSF receptor, erythropoietin receptor and IL-6 receptor). [47] A "recombinant host" is a cell that contains a heterologous nucleic acid molecule, such as a cloning vector or expression vector. In the present context, an example of a recombinant host is a cell that produces a Zimlig2 peptide or polypeptide from an expression vector. In contrast, such polypeptides can be produced by a cell that is a "natural source" of Zimlig2 and that lacks an expression vector.
[48] The term "secretory signal sequence" denotes a DNA sequence that encodes a polypeptide (a "secretory peptide") that, as a component of a larger polypeptide, directs the larger polypeptide through a secretory pathway of a cell in which it is synthesized. The larger polypeptide is commonly truncated to remove the secretory peptide during transit through the secretory pathway.
[49] The term "splice variant" is used herein to denote alternative forms of RNA transcribed from a gene. Splice variation arises naturally through use of alternative splicing sites within a transcribed RNA molecule, or less commonly between separately transcribed RNA molecules, and may result in several mRNAs transcribed from the same gene. Splice variants may encode polypeptides having altered amino acid sequence. The term splice variant is also used herein to denote a protein encoded by a splice variant of an mRNA transcribed from a gene.
[50] Molecular weights and lengths of polymers determined by imprecise analytical methods (e.g., gel electrophoresis) will be understood to be approximate values. When such a value is expressed as "about" X or "approximately" X, the stated value of X will be understood to be accurate to ±10%.
[51] These and other aspects of the invention will become evident upon reference to the following detailed description of the invention.
[52] All references cited herein are incorporated by reference in their entirety.
[53] The present invention is directed to novel compositions and uses of a secreted polypeptide, Zimlig2. As discussed herein, Zimlig2, as well as variants and fragments thereof, can be used to increase a host's immune response. For example, Zimlig2, as well as variants and fragments thereof can be used to increase T-cell proliferation .
[54] Zimlig2 was initially identified using an Electronic -northern (E-northern) analysis designed to detect transcripts that are over-represented in tissues of immunologic significance. The E- northern results suggest over-representation of Zimlig2 in cartilage, chondrocytes, and fibroblasts, and in osteoarthritis compared with non-disease sources. In E-northern results, Zimlig2 is also under- represented in cancer, consistent with the cancer disease profiling array described in Example 2.
[55] E-northern methods of analysis are known in the art. The ZGEN E-northern analysis tool is similar to eVOC as described by Kelso et. al. in Genome Res. 2003 Jun;l 3(6A): 1222-30 (PMID: 12799354). In general each EST library included in the analysis is manually annotated with medical subject heading (MESH) terms based on limited annotation provided by authors of different data sets. Each EST then is placed in various MESH categories according to its parent library. ESTs whose sequences overlap known genes are grouped by gene. Any single gene can then be evaluated for its relationship to biologies and disease states as defined by MESH categories and the number of occurrences of that gene's ESTs in those categories.
[56] The present invention provides methods of using human Zimlig2 polypeptides and nucleic acid molecules that encode human Zimlig2 polypeptides. An illustrative nucleic acid molecule containing a sequence that encodes the Zimlig2 polypeptide has the nucleotide sequence of SEQ ID NO: 1 and the encoded polypeptide has the amino acid sequence as shown in SEQ ID NO:2. Thus, the Zimlig2 nucleotide sequence described herein encodes an 11 KDa polypeptide of 148 amino acids as shown in SEQ ID NO: 2. The Zimlig2 gene resides in chromosome 2ql2.2. The degenerate polynucleotide sequence for Zimlig2 is shown in SEQ ID NO: 3. The putative signal sequences of Zimlig2 polypeptide reside at amino acid residues 1 to 29, 1 to 30, and 1 to 31, of SEQ ID NO:2. Polynucleotides and/or polypeptides of Zimlig2 have been previously described in references including: WO0166748; WO03091280; Su T. et a!.. Zhonghua Zhong Liu Za Zhi. 20f4):254-7. 1998; Steck et al., Biochemical and Biophysical Research Communications 299:109-115. 2002; Yue CM, et al., World J Gastroenterol 9(6): 1174-8, 2003; Clark H.F. et al., Genome Research 13:2265-2270, 2003. The novel compositions of Zimlig2 described herein include a mature form of the polypeptide comprising residues 32 through 148 of SEQ ID NO:2. The polynucleotide encoding the novel mature polypeptide begins at position 173 of SEQ ID NO: 1 and ends at position 523 of SEQ ID NO: 1. Furthermore, as shown herein, a novel truncated form of Zimlig2, comprising residues 71 through 148 of SEQ ID NO:2 has been identified. As further described herein, the Zimlig2 polypeptide may include post-translational modifications.
[57] Initial analysis of the SEQ ID NO:2 polypeptide sequence indicated that residues 1 through 31 form a secretory polypeptide and residues 32 through 148 form the mature polypeptide. Further N-terminal sequencing and whole mass spectrometry analysis indicated that residues 71 through 148 form a novel truncated Zimlig2 polypeptide. The polynucleotide encoding the truncated Zimlig2 polypeptide begins at position 290 of SEQ ID NO: 1 and ends at position 523 of SEQ ID NO: 1. An example of a post translationally modifed amino acid sequence of the truncated Zimlig2 is shown in SEQ ID NO:5. Initial analysis of the truncated Zimlig2 polypeptide indicated that residue 71 of SEQ ID NO:2 is a glutamine residue. N-terminal sequencing analysis of the truncated Zimlig2 polypeptide indicated that residue 71 of SEQ ID NO:2 may be a pyroglutamate. Peptide map analysis also indicated potential tyrosine sulfation sites at residues 114, 115, 118, 123, 145, and 148 of SEQ ID NO:2. One to four of the tyrosines at these positions may be sulfated. Three or four of the tyrosines at these positions may be sulfated. Specifically, the tyrosine residues at positions 123, 145, and 148 of SEQ ID NO:2 may be sulfated. Alternatively, the tyrosine residues at positions 123, 145, and 148 of SEQ ID NO:2 may be phosphated. Mass spectrometry peptide map analysis indicated that SEQ ID NO:2 comprises a serine at residue 142, and that this serine has a modification that may be an O- glycosylation, or the serine may be linked to a carbohydrate epitope, such as, for example, a sialyl lewisx oligosaccharide or another lewis acid.
[58] Post translational modifications are common on mature active proteins. One such post translational modification is tyrosine sulfation. (Kehoe and Bertozzi, Chemistry & Biology 7:R57-R61, 2000). Many tyrosine sulfated proteins participate in protein-protein interactions that are driven at least in part by recognition of the sulfate group itself; in fact, in the past few years, tyrosine sulfation has been identified as a key modulator of protein-protein interactions that mediate inflammatory leukocyte adhesion. (Kehoe and Bertozzi, Ibid.). For a review of sulfo-tyrosyl containing proteins, see Hsu, et al., Autoimmunity Reviews 4:429-435, 2005.
[59] The selectins are a family of cell surface glycoproteins with high homology: E-, L-, and P- selectin. L-selectin is responsible for lymphocyte homing and is present on all granulocytes and monocytes and most lymphocytes. P-selectin is responsible for neutrophil recruitment and is stored in alpha-granules of platelets and weibel-palade bodies of endothelial cells and is translocated on activated endothelial cells and platelets. E-selectin expression is limited to the endothelium, it is only expressed under baseline condition skin microvessels; it is rapidly induced in inflammation. (See Kansas, G., Blood 88(9):3259-3287, 1996; see also Ley, K., Trends in Molecular Medicine 9(6):263-268, 2003.). PSGL-I binds to P-selectin and L-selectin under inflammatory conditions. (See Leppanen, A. et al., J. Biol. Chem. 274:24838-24848, 1999.).
[60] A motif of 20 amino acid residues of P-selectin glycoprotein ligand-1 (PSGL-I) was shown to be required for high affinity binding to P-selectin. (Leppanen, et al, & Cummings, R.D., J1 Biol. Chem. 274:24838-24848, 1999). This motif is described as three tyrosine sulfate (TyrSO3) residues and a monosialylated, core 2-based O-glycan with a sialyl Lewis x (C2-O-sLex) motif at a specific Thr residue. (Leppanen, et al, & Cummings, R.D., Ibid.). One such motif has been identified in the Zimlig2 polypeptide sequence described herein. This motif comprises residues 120 to 148 of SEQ ID NO:2.
[61] The post translational modifications of cleaved Zimlig2 are markedly similar to the post translational modifications of PSGL-I that play a critical role in P-selectin binding. Zimlig2 encompasses similar post translational modifications: three sulfated tyrosine residues, at positions 123, 145, and 148 of SEQ ID NO:2, and an ^-glycosylated serine residue, at position 142 of SEQ ID NO:2, linked to a carbohydrate epitope, possibly sialyl lewisx oligosaccharide or another sialyl lewis. Thus, Zimlig2 is a soluble protein that can enhance the activity of a selectin-type molecule.
[62] As described herein, the isolated polypeptides of the present invention may be used to increase T cell proliferation. T cells belong to a group of white blood cells known as lymphocytes and play a role in cell mediated immunity. Several different subsets of T cells have been described, each with a distinct function. CD4+ T cells , or helper T cells, divide rapidly when activated and secrete cytokines, such as interferon gamma, that regulate the immune response. Abbas. A.K., "Cellular and Molecular Immunology, 2nd Edition" W.B. Saunders Company, 1994.
[63] Another subset of lymphocytes is cytotoxic T cells (CD8+ T cells). They destroy virally infected cells and tumor cells, and are also implicated in transplant rejection. CD8+ lymphocytes also secrete cytokines, including interferon gamma. They have been known as lymphocytes capable of specifically killing tumor cells. Brandacher et al. Curr Drug Metab. "Antitumoral activity of interferon gamma involved in impaired immune function in cancer patients. 2006 Aug; 7(6):599-612.
[64] Interferons, such as gamma interferon, are natural proteins produced by cells of the immune system of most vertebrates in response to challenges by foreign agents such as viruses, bacteria, parasites and tumor cells. They assist the immune response by activating other cells, such as natural killer lymphocytes and macrophages, that can assist in immune surveillance and tumor cell lysis. Watanabe, Y (2004) "Fifty Years of Interference" Nature Immunology 5(12):1193
[65] Those skilled in the art will recognize that minor modifications can be made in the proteins of the present invention without altering biological function. It is preferred to limit the extent of amino acid substitutions, insertions, and deletions so that the resulting proteins are at least 90% identical to amino acid residues 71 to 148 of SEQ ID NO:2. It is preferred to limit the extent of amino acid substitutions, insertions, and deletions so that the resulting proteins maintain the same activity. Percent sequence identity is determined by conventional methods. See, for example, Altschul et al., Bull. Math. Bio. 48:603-616, 1986, and Henikoff and Henikoff, Proc. Natl. Acad. Sci. USA 89:10915-10919, 1992. The level of identity between amino acid sequences can also be determined using the "FASTA" similarity search algorithm disclosed by Pearson and Lipman (Proc. Natl. Acad. Sci. USA 85:2444, 1988) and by Pearson (Meth. Enzymol. 183:63, 1990).
[66] The present invention provides a variety of nucleic acid molecules, including DNA and RNA molecules that encode the Zimlig2 polypeptides disclosed herein. Those skilled in the art will readily recognize that, in view of the degeneracy of the genetic code, considerable sequence variation is possible among these polynucleotide molecules. SEQ ID NO:3 is a degenerate nucleotide sequences that encompasses all nucleic acid molecules that encode the Zimlig2 polypeptides of the present invention.
[67] Different species can exhibit "preferential codon usage." In general, see, Grantham et al, Nuc. Acids Res. 5: 1893 (1980), Haas et al Curr. Biol. 6:315 (1996), Wain-Hobson et al., Gene 13:355 (1981), Grosjean and Fiers, Gene 18:199 (1982), Holm, Nuc. Acids Res. 14:3075 (1986), Ikemura, J. MoI. Biol. 158:513 (1982), Sharp and Matassi, Curr. Opin. Genet. Dev. 4:851 (1994), Kane, Curr. Opin. Biotechnol. 6:494 (1995), and Makrides, Microbiol. Rev. 60:512 (1996).
[68] The present invention further provides variant polypeptides and nucleic acid molecules that represent counterparts from other species (orthologs). These species include, but are not limited to mammalian including porcine, ovine, bovine, canine, feline, equine, murine, and other primates, avian, amphibian, reptile, fish, insect, and other vertebrate and invertebrate species. Orthologs of human Zimlig2 can be cloned using information and compositions provided by the present invention in combination with conventional cloning techniques. For example, a cDNA can be cloned using mRNA obtained from a tissue or cell type that expresses Zimlig2. Suitable sources of mRNA can be identified by probing northern blots with probes designed from the sequences disclosed herein. A library is then prepared from mRNA of a positive tissue or cell line.
[69] Within certain embodiments of the invention, the isolated nucleic acid molecules can hybridize under stringent conditions to nucleic acid molecules comprising nucleotide sequences disclosed herein. For example, such nucleic acid molecules can hybridize under stringent conditions to nucleic acid molecules consisting of the nucleotide sequence of SEQ ID NO: 1, to nucleic acid molecules consisting of the nucleotide sequence of nucleotides 173 to 523 of SEQ ID NO: 1, to nucleic acid molecules consisting of the nucleotide sequence of nucleotides 290 to 523 of SEQ ID NO: 1, or to nucleic acid molecules consisting of nucleotide sequences that are the complements of such sequences. In general, stringent conditions are selected to be about 5°C lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH. The Tm is the temperature (under defined ionic strength and pH) at which 50% of the target sequence hybridizes to a perfectly matched probe.
[70] A pair of nucleic acid molecules, such as DNA-DNA, RNA-RNA and DNA-RNA, can hybridize if the nucleotide sequences have some degree of complementarity. Hybrids can tolerate mismatched base pairs in the double helix, but the stability of the hybrid is influenced by the degree of mismatch. The Tm of the mismatched hybrid decreases by 1°C for every 1-1.5% base pair mismatch. Varying the stringency of the hybridization conditions allows control over the degree of mismatch that will be present in the hybrid. The degree of stringency increases as the hybridization temperature increases and the ionic strength of the hybridization buffer decreases. Stringent hybridization conditions encompass temperatures of about 5-25°C below the Tm of the hybrid and a hybridization buffer having up to 1 M Na+. Higher degrees of stringency at lower temperatures can be achieved with the addition of formamide which reduces the Tm of the hybrid about 1°C for each 1% formamide in the buffer solution. Generally, such stringent conditions include temperatures of 20-700C and a hybridization buffer containing up to 6x SSC and 0-50% formamide. A higher degree of stringency can be achieved at temperatures of from 40-700C with a hybridization buffer having up to 4x SSC and from 0-50% formamide. Highly stringent conditions typically encompass temperatures of 42-700C with a hybridization buffer having up to Ix SSC and 0-50% formamide. Different degrees of stringency can be used during hybridization and washing to achieve maximum specific binding to the target sequence. Typically, the washes following hybridization are performed at increasing degrees of stringency to remove non-hybridized polynucleotide probes from hybridized complexes. [71] The above conditions are meant to serve as a guide and it is well within the abilities of one skilled in the art to adapt these conditions for use with a particular polypeptide hybrid. The Tm for a specific target sequence is the temperature (under defined conditions) at which 50% of the target sequence will hybridize to a perfectly matched probe sequence. Those conditions that influence the Tm include, the size and base pair content of the polynucleotide probe, the ionic strength of the hybridization solution, and the presence of destabilizing agents in the hybridization solution. Numerous equations for calculating Tm are known in the art, and are specific for DNA, RNA and DNA-RNA hybrids and polynucleotide probe sequences of varying length (see, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, Second Edition (Cold Spring Harbor Press 1989); Ausubel et al., (eds.), Current Protocols in Molecular Biology (John Wiley and Sons, Inc. 1987); Berger and Kimmel (eds.), Guide to Molecular Cloning Techniques, (Academic Press, Inc. 1987); and Wetmur, Crit. Rev. Biochem. MoI. Biol. 26:221 (1990)). Sequence analysis software such as OLIGO 6.0 (LSR; Long Lake, MN) and Primer Premier 4.0 (Premier Biosoft International; Palo Alto, CA), as well as sites on the Internet, are available tools for analyzing a given sequence and calculating Tm based on user defined criteria. Such programs can also analyze a given sequence under defined conditions and identify suitable probe sequences. Typically, hybridization of longer polynucleotide sequences, >50 base pairs, is performed at temperatures of about 20-250C below the calculated Tm. For smaller probes, <50 base pairs, hybridization is typically carried out at the Tm or 5- 100C below. This allows for the maximum rate of hybridization for DNA-DNA and DNA-RNA hybrids.
[72] The ionic concentration of the hybridization buffer also affects the stability of the hybrid. Hybridization buffers generally contain blocking agents such as Denhardt's solution (Sigma Chemical Co., St. Louis, Mo.), denatured salmon sperm DNA, tRNA, milk powders (BLOTTO), heparin or SDS, and a Na+ source, such as SSC (Ix SSC: 0.15 M sodium chloride, 15 mM sodium citrate) or SSPE (Ix SSPE: 1.8 M NaCl, 10 mM NaH2PO4, 1 mM EDTA, pH 7.7). By decreasing the ionic concentration of the buffer, the stability of the hybrid is increased. Typically, hybridization buffers contain from between 10 mM - 1 M Na+. The addition of destabilizing or denaturing agents such as formamide, tetralkylammonium salts, guanidinium cations or thiocyanate cations to the hybridization solution will alter the Tm of a hybrid. Typically, formamide is used at a concentration of up to 50% to allow incubations to be carried out at more convenient and lower temperatures. Formamide also acts to reduce non-specific background when using RNA probes.
[73] As an illustration, a nucleic acid molecule encoding a variant Zimlig2 polypeptide can be hybridized with a nucleic acid molecule having the nucleotide sequence of SEQ ID NO: 1 (or its complement) at 42°C overnight in a solution comprising 50% formamide, 5xSSC (IxSSC: 0.15 M sodium chloride and 15 mM sodium citrate), 50 mM sodium phosphate (pH 7.6), 5x Denhardt's solution (10Ox Denhardt's solution: 2% (w/v) Ficoll 400, 2% (w/v) polyvinylpyrrolidone, and 2% (w/v) bovine serum albumin), 10% dextran sulfate, and 20 μg/ml denatured, sheared salmon sperm DNA. One of skill in the art can devise variations of these hybridization conditions. For example, the hybridization mixture can be incubated at a higher temperature, such as about 65°C, in a solution that does not contain formamide. Moreover, premixed hybridization solutions are available (e.g., EXPRESSHYB Hybridization Solution from CLONTECH Laboratories, Inc.), and hybridization can be performed according to the manufacturer's instructions.
[74] Following hybridization, the nucleic acid molecules can be washed to remove non- hybridized nucleic acid molecules under stringent conditions, or under highly stringent conditions. Typical stringent washing conditions include washing in a solution of 0.5x - 2x SSC with 0.1% sodium dodecyl sulfate (SDS) at 55 - 65°C. For example, nucleic acid molecules encoding particular variant Zimlig2 polypeptides can remain hybridized with a nucleic acid molecule consisting of the nucleotide sequence of nucleotides 173 to 523 of SEQ ID NO: 1, the nucleotide sequence of nucleotides 290 to 523 of SEQ ID NO: 1, or their complements, following washing under stringent washing conditions, in which the wash stringency is equivalent to 0.5x - 2x SSC with 0.1% SDS at 55 - 65°C, including 0.5x SSC with 0.1% SDS at 55°C, or 2xSSC with 0.1% SDS at 65°C. One of skill in the art can readily devise equivalent conditions, for example, by substituting SSPE for SSC in the wash solution.
[75] Typical, highly stringent washing conditions include washing in a solution of 0.1 x - 0.2x SSC with 0.1% sodium dodecyl sulfate (SDS) at 50 - 65°C. As an illustration, nucleic acid molecules encoding particular variant Zimlig2 polypeptides can remain hybridized with a nucleic acid molecule consisting of the nucleotide sequence of nucleotides 290 to 523 of SEQ ID NO: 1, the nucleotide sequence of nucleotides encoding at least the truncated Zimlig2 polypeptide, or their complements, following washing under highly stringent washing conditions, in which the wash stringency is equivalent to O. lx - 0.2x SSC with 0.1% SDS at 50 - 65°C, including O. lx SSC with 0.1% SDS at 500C, or 0.2xSSC with 0.1% SDS at 65°C.
[76] The present invention also provides isolated Zimlig2 polypeptides that have a substantially similar sequence identity to the polypeptides of SEQ ID NO:2, or their orthologs (e.g. SEQ ID NO:7). The term "substantially similar sequence identity" is used herein to denote polypeptides having 85%, 90%, 95% or greater than 95% sequence identity to the sequences shown in SEQ ID NO: 2, or its orthologs.
[77] The present invention also contemplates Zimlig2 variant nucleic acid molecules that can be identified using two criteria: a determination of the similarity between the encoded polypeptide with the amino acid sequence of SEQ ID NOs:2, 4, 5, 7, 9, or 10, and a hybridization assay, as described above. For example, certain Zimlig2 gene variants include nucleic acid molecules (1) that remain hybridized with a nucleic acid molecule consisting of the nucleotide sequence of SEQ ID NO: 1, the nucleotide sequence of nucleotides 173 to 523 of SEQ ID NO: 1, the nucleotide sequence of nucleotides 290 to 523 of SEQ ID NO: 1, or their complements, following washing under stringent washing conditions, in which the wash stringency is equivalent to 0.5x - 2x SSC with 0.1% SDS at 55 - 65°C, and (2) that encode a polypeptide having 85%, 90%, 95% or greater than 95% sequence identity to the amino acid sequence of SEQ ID NO:2, 4, 5, 7, 9, or 10. Alternatively, certain Zimlig2 variant genes can be characterized as nucleic acid molecules (1) that remain hybridized with a nucleic acid molecule consisting of the nucleotide sequence of SEQ ID NO: 1, the nucleotide sequence of nucleotides 173 to 523 of SEQ ID NO: 1, the nucleotide sequence of nucleotides 290 to 523 of SEQ ID NO: 1, or their complements, following washing under highly stringent washing conditions, in which the wash stringency is equivalent to 0. Ix - 0.2x SSC with 0.1% SDS at 50 - 65°C, and (2) that encode a polypeptide having 85%, 90%, 95% or greater than 95% sequence identity to the amino acid sequence of SEQ ID NO:2, 4, 5, 7, 9, or 10.
[78] The present invention includes nucleic acid molecules that encode a polypeptide having a conservative amino acid change, compared with the amino acid sequence of SEQ ID NOs:2, 4, 5, 7, 9, or 10. That is, variants can be obtained that contain one or more amino acid substitutions of SEQ ID NOs:2, 4, 5, 7, 9, or 10, in which an alkyl amino acid is substituted for an alkyl amino acid in a Zimlig2 amino acid sequence, an aromatic amino acid is substituted for an aromatic amino acid in a Zimlig2 amino acid sequence, a sulfur-containing amino acid is substituted for a sulfur-containing amino acid in a Zimlig2 amino acid sequence, a hydroxy-containing amino acid is substituted for a hydroxy-containing amino acid in a Zimlig2 amino acid sequence, an acidic amino acid is substituted for an acidic amino acid in a Zimlig2 amino acid sequence, a basic amino acid is substituted for a basic amino acid in a Zimlig2 amino acid sequence, or a dibasic monocarboxylic amino acid is substituted for a dibasic monocarboxylic amino acid in a Zimlig2 amino acid sequence.
[79] Among the common amino acids, for example, a "conservative amino acid substitution" is illustrated by a substitution among amino acids within each of the following groups: (1) glycine, alanine, valine, leucine, and isoleucine, (2) phenylalanine, tyrosine, and tryptophan, (3) serine and threonine, (4) aspartate and glutamate, (5) glutamine and asparagine, and (6) lysine, arginine and histidine.
[80] Variants of Zimlig2 are characterized by having at least 70%, at least 80%, at least 85%, at least 90%, at least 95% or greater than 95% sequence identity to a corresponding amino acid sequence disclosed herein, wherein the variation in amino acid sequence is due to one or more conservative amino acid substitutions.
[81] Conservative amino acid changes in a Zimlig2 gene can be introduced by substituting nucleotides for the nucleotides recited in SEQ ID NOs: 2, 4, 5, 7, 9, or 10. Such "conservative amino acid" variants can be obtained, for example, by oligonucleotide-directed mutagenesis, linker-scanning mutagenesis, mutagenesis using the polymerase chain reaction, and the like (see Ausubel (1995) at pages 8-10 to 8-22; and McPherson (ed.), Directed Mutagenesis: A Practical Approach (IRL Press 1991)).
[82] The proteins of the present invention can also comprise non-naturally occurring amino acid residues. Non-naturally occurring amino acids include, without limitation, trans-3- methylproline, 2,4-methanoproline, cw-4-hydroxyproline, ?ra«,y-4-hydroxyprolme, N-methylglycine, α//o-threonine, methylthreonine, hydroxyethylcysteine, hydroxyethylhomocysteine, nitroglutamine, homoglutamine, pipecolic acid, thiazolidine carboxylic acid, dehydroproline, 3- and 4-methylproline, 3,3-dimethylproline, fert-leucine, norvaline, 2-azaphenylalanine, 3-azaphenylalanine, 4- azaphenylalanine, and 4-fluorophenylalanine. Several methods are known in the art for incorporating non-naturally occurring amino acid residues into proteins. For example, an in vitro system can be employed wherein nonsense mutations are suppressed using chemically aminoacylated suppressor tRNAs. Methods for synthesizing amino acids and aminoacylating tRNA are known in the art. Transcription and translation of plasmids containing nonsense mutations is typically carried out in a cell-free system comprising an E. coli S30 extract and commercially available enzymes and other reagents. Proteins are purified by chromatography. See, for example, Robertson et al, J. Am. Chem. Soc. 113:2122 (1991), Ellman et al, Methods Enzymol. 202:301 (1991), Chung et al, Science 259:806 (1993), and Chung et al, Proc. Natl Acad. ScL USA 90: 10145 (1993).
[83] In a second method, translation is carried out in Xenopus oocytes by microinjection of mutated mRNA and chemically aminoacylated suppressor tRNAs (Turcatti et al, J. Biol. Chem. 271: 19991 (1996)). Within a third method, E. coli cells are cultured in the absence of a natural amino acid that is to be replaced (e.g., phenylalanine) and in the presence of the desired non-naturally occurring amino acid(s) (e.g., 2-azaphenylalanine, 3-azaphenylalanine, 4-azaphenylalanine, or 4- fluorophenylalanine). The non-naturally occurring amino acid is incorporated into the protein in place of its natural counterpart. See, Koide et al, Biochem. 33:1410 (1994). Naturally occurring amino acid residues can be converted to non-naturally occurring species by in vitro chemical modification. Chemical modification can be combined with site-directed mutagenesis to further expand the range of substitutions (Wynn and Richards, Protein Sci. 2:395 (1993)).
[84] A limited number of non-conservative amino acids, amino acids that are not encoded by the genetic code, non-naturally occurring amino acids, and unnatural amino acids may be substituted for Zimlig2 amino acid residues.
[85] Essential amino acids in the polypeptides of the present invention can be identified according to procedures known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis (Cunningham and Wells, Science 244: 1081 (1989), Bass et al, Proc. Natl Acad. Sci. USA 55:4498 (1991), Coombs and Corey, "Site-Directed Mutagenesis and Protein Engineering," in Proteins: Analysis and Design, Angeletti (ed.), pages 259-311 (Academic Press, Inc. 1998)). In the latter technique, single alanine mutations are introduced at every residue in the molecule, and the resultant mutant molecules are tested for biological activity, such as the ability to bind to an antibody, to identify amino acid residues that are critical to the activity of the molecule. See also, Hilton et al., J. Biol. Chem. 271:4699 (1996).
[86] Substantially homologous proteins and polypeptides are characterized as having one or more amino acid substitutions, deletions or additions. These changes are preferably of a minor nature, that is conservative amino acid substitutions and other substitutions that do not significantly affect the folding or activity of the protein or polypeptide; small deletions, typically of one to about 30 amino acids; and small amino- or carboxyl-terminal extensions, such as an amino-terminal methionine residue, a small linker peptide of up to about 20-25 residues, or a small extension that facilitates purification (an affinity tag), such as a poly-histidine tract, protein A (Nilsson et al., EMBO J. 4: 1075, 1985; Nilsson et al., Methods Enzymol. 198:3. 1991), glutathione S transferase (Smith and Johnson, Gene 67:31, 1988), maltose binding protein (Kellerman and Ferenci, Methods Enzymol. 90:459-463. 1982; Guan et al., Gene 67:21-30, 1987), thioredoxin, ubiquitin, cellulose binding protein, T7 polymerase, or other antigenic epitope or binding domain. See, in general Ford et al., Protein Expression and Purification 2: 95-107, 1991, which is incorporated herein by reference. DNAs encoding affinity tags are available from commercial suppliers (e.g., Pharmacia Biotech, Piscataway, NJ; New England Biolabs, Beverly, MA).
[87] Within the present invention amino acid sequence changes can be made in the Zimlig2 sequence shown in amino acid residues 71 to 148 of SEQ ID NO:2 to obtain other Zimlig2 proteins. These changes are made so as to minimize disruption of higher order structure essential to biological activity. In particular, the arrangement of β-strands and loops will not be disrupted, thus it is preferred to make conservative amino acid substitutions within the β-strands, particularly when replacing hydrophobic residues. Those skilled in the art will recognize that hydrophobic and aromatic residues can sometimes substitute for each other in a sequence. The effects of amino acid sequence changes can be predicted by computer modeling using available software (e.g., the Insight II® viewer and homology modeling tools; MSI, San Diego, CA) or determined by alignment and analysis of crystal structures. (See, Priestle et al., EMBO J. 7:339-343, 1988; Priestle et al., Proc. Natl. Acad. Sci. USA 86:9667-9671. 1989; Finzel et al.. J. MoI. Biol. 209:779-791. 1989; Graves et al., Biochem. 29:2679-2684, 1990; Clore and Gronenborn, J. MoI. Biol. 221:47-53, 1991; Vigers et al., J. Biol. Chem. 269: 12874-12879, 1994; Schreuder et al., Eur. J. Biochem. 227:838-847, 1995; and Schreuder et al., Nature 386:194-200. 1997). Those skilled in the art will recognize that hydrophobicity and hydrophilicity will be taken into account when designing alterations in the amino acid sequence of a Zimlig2 polypeptide, so as not to disrupt the overall profile.
[88] Essential amino acids in the proteins of the present invention can be identified according to procedures known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis (Cunningham and Wells, Science 244. 1081-1085, 1989; Bass et al., Proc. Natl. Acad. Sci. USA 88:4498-4502, 1991). In the latter technique, single alanine mutations are introduced at every residue in the molecule, and the resultant mutant molecules are tested for biological activity or other properties to identify amino acid residues that are critical to the activity of the molecule.
[89] Multiple amino acid substitutions can be made and tested using known methods of mutagenesis and screening, such as those disclosed by Reidhaar-Olson and Sauer (Science 241 :53-57, 1988) or Bowie and Sauer (Proc. Natl. Acad. Sci. USA 86:2152-2156, 1989). Briefly, these authors disclose methods for simultaneously randomizing two or more positions in a polypeptide, selecting for functional polypeptide, and then sequencing the mutagenized polypeptides to determine the spectrum of allowable substitutions at each position. Other methods that can be used include phage display (e.g., Lowman et al., Biochem. 30: 10832-10837, 1991; Ladner et al., U.S. Patent No. 5,223,409; Huse, WIPO Publication WO 92/06204) and region-directed mutagenesis (Derbyshire et al.. Gene 46:145. 1986: Ner et al.. DNA 7:127. 1988).
[90] Cell activation can be assayed by measuring the expression of adhesion molecules or cytokines by responsive cells. Adhesion molecules such as ICAM, VCAM, and E-selectin on endothelial cells are known to be induced by cytokines (Collins et al., J. Biol. Chem. 266:2466-2473. 1991; Iademarco et al., J. Biol. Chem. 267: 1623-16329, 1992; Voraberger et al., J. Immunol. 147: 2777-2786, 1991). In various combinations, these and other molecules support leukocyte adhesion to the vessel wall and extravasation, which are key steps in the response to infection, inflammation, and tissue injury (Bevilacqua, Annu. Rev. Immunol. JJ_:767-804, 1993). Human umbilical vein endothelial cells (HUVECs) are harvested from umbilical cord veins and established in primary culture by methods that are well known in the art. Up-regulation of adhesion molecules can be measured by flow cytometric methods utilizing antibodies specific for these cell surface markers, by an ELISA-type assay, or by measuring the adherence of immune cells such as monocytes, T-cells, or neutrophils. Isolated cells can be used for this purpose, as can immortalized cells derived from these lineages, such as THP-I, U-937, HL-60, or Jurkat cells. Expression of these adhesion molecules can be measured in the presence or absence of IL-I β or other cytokines. T cells, natural killer (NK) cells, and monocytes/macrophages are the main producers of cytokines (Cassatella, Immunology Today 16:21-26, 1995). Cytokine release can be induced in these cells by various inflammatory stimuli and can be measured by assay as disclosed by Parrilo, N. Engl. J. Med. 328: 1471-1477. 1993 or Eperon and Jungi, J. Immunol. Methods. 194:121-129. 1996. One such assay utilizes lipopolysaccharride (LPS) to induce cytokine release in the monocytic cell line, THP-I. Cytokine release can be detected by immunoassay, such as an ELISA using antibodies specific for the cytokine of interest. Both activation and inhibition of cytokine release can be measured by these methods. See, Sandborg et al., J. Immunol. 155:5206-5212. 1995.
[91] The proteins of the present invention can further comprise amino- or carboxyl- terminal extensions, such as an amino-terminal methionine residue, a small linker peptide of up to about 20-25 residues, or an affinity tag as disclosed above. Two or more affinity tags may be used in combination. Polypeptides comprising affinity tags can further comprise a polypeptide linker and/or a proteolytic cleavage site between the Zimlig2 polypeptide and the affinity tag.
[92] The present invention further provides a variety of other polypeptide fusions. For example, a Zimlig2 polypeptide can be prepared as a fusion to a dimerizing protein as disclosed in U.S. Patents Nos. 5,155,027 and 5,567,584. Preferred dimerizing proteins in this regard include immunoglobulin constant region domains. Immunoglobulin-Zimlig2 polypeptide fusions can be expressed in genetically engineered cells to produce a variety of multimeric Zimlig2 analogs. In addition, a Zimlig2 polypeptide can be joined to another bioactive molecule, such as a cytokine, to provide a multi-functional molecule. One or more helices of a Zimlig2 polypeptide can be joined to another cytokine to enhance or otherwise modify its biological properties. Auxiliary domains can be fused to Zimlig2 polypeptides to target them to specific cells, tissues, or macromolecules (e.g., collagen). For example, a Zimlig2 polypeptide or protein can be targeted to a predetermined cell type by fusing a Zimlig2 polypeptide to a ligand that specifically binds to a receptor on the surface of the target cell. In this way, polypeptides and proteins can be targeted for therapeutic or diagnostic purposes. A Zimlig2 polypeptide can be fused to two or more moieties, such as an affinity tag for purification and a targeting domain. Polypeptide fusions can also comprise one or more cleavage sites, particularly between domains. See, Tuan et al., Connective Tissue Research 3^:1-9, 1996.
[93] Polypeptide fusions of the present invention will generally contain not more than about 1,500 amino acid residues, not more than about 1,200 residues, or not more than about 1,000 residues, and may in many cases be considerably smaller. For example, a truncated Zimlig2 polypeptide of 78 residues (e.g. amino acid residues 71 to 148 of SEQ ID NO:2 or SEQ ID NO:5) can be fused to E. coli /?-galactosidase (1,021 residues; see Casadaban et al., J. Bacteriol. 143:971-980. 1980), a 10-residue spacer, and a 4-residue factor Xa cleavage site to yield a polypeptide of 1,113 residues.
[94] The present invention further provides polynucleotide molecules, including DNA and RNA molecules, encoding a truncated and mature Zimlig2. The polynucleotides of the present invention include the sense strand; the anti-sense strand; and the DNA as double-stranded, having both the sense and anti-sense strand annealed together by hydrogen bonds. A DNA sequence encoding truncated Zimlig2 is set forth beginning at position 290 of SEQ ID NO: 1 and ending at position 523 of SEQ ID NO: 1. Counterpart RNA sequences can be generated by substitution of U for T.
[95] Those skilled in the art will readily recognize that, in view of the degeneracy of the genetic code, considerable sequence variation is possible among these polynucleotide molecules. SEQ ID NO: 3 is a degenerate DNA sequence that encompasses all DNAs that encode the Zimlig2 polypeptide of SEQ ID NO: 2. Similarly, SEQ ID NO:8 is a degenerate DNA sequence that encompasses all DNAs that encode the Zimlig2 polypeptide of SEQ ID NO:7. Those skilled in the art will recognize that the degenerate sequence also provides all RNA sequences by substituting U for T. Thus, the degenerate Zimlig2 polynucleotide consisting of SEQ ID NO:3, portions of degenerate polynucleotide encoding shorter Zimlig2 proteins, such as the mature and truncated Zimlig2 polypeptide as disclosed above, and the respective RNA equivalents are contemplated by the present invention. One of ordinary skill in the art will appreciate that some ambiguity is introduced in determining a degenerate codon, representative of all possible codons encoding each amino acid. For example, the degenerate codon for serine (WSN) can, in some circumstances, encode arginine (AGR), and the degenerate codon for arginine (MGN) can, in some circumstances, encode serine (AGY). A similar relationship exists between codons encoding phenylalanine and leucine. Thus, some polynucleotides encompassed by the degenerate sequence may encode variant amino acid sequences, but one of ordinary skill in the art can easily identify such variant sequences by reference to the amino acid sequence shown in SEQ ID NO:3. Variant sequences can be readily tested for functionality as described herein.
[96] Within embodiments of the invention the isolated polynucleotides will hybridize to similar sized regions of SEQ ID NO:4 or a sequence complementary thereto under stringent conditions. In general, stringent conditions are selected to be about 5°C lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH. The Tm is the temperature (under defined ionic strength and pH) at which 50% of the target sequence hybridizes to a perfectly matched probe. Typical stringent conditions are those in which the salt concentration is up to about 0.03 M at pH 7 and the temperature is at least about 600C.
[97] One of ordinary skill in the art will also appreciate that different species can exhibit preferential codon usage. See, in general, Grantham et al., Nuc. Acids Res. 8.:1893-912, 1980; Haas et al., Curr. Biol. 6:315-24, 1996; Wain-Hobson et al., Gene 11:355-64, 1981; Grosjean and Fiers, Gene 18: 199-209, 1982: Holm. Nuc. Acids Res. 14:3075-87. 1986: and Ikemura. J. MoI. Biol. 158:573-97. 1982. Preferred codons for a particular species can be introduced into the polynucleotides of the present invention by a variety of methods known in the art. Introduction of preferred codon sequences into recombinant DNA can, for example, enhance production of the protein by making protein translation more efficient within a particular cell type or species. Therefore, the degenerate codon sequences disclosed in SEQ ID NO: 3 serves as templates for optimizing expression of polynucleotides in various cell types and species commonly used in the art and disclosed herein. Sequences containing preferred codons can be tested and optimized for expression in various host cell species, and tested for functionality as disclosed herein.
[98] As previously noted, Zimlig2 polynucleotides provided by the present invention include DNA and RNA. Methods for preparing DNA and RNA are well known in the art. In general, RNA is isolated from a tissue or cell that produces large amounts of Zimlig2 RNA. Such tissues and cells are readily identified by Northern blotting (Thomas, Proc. Natl. Acad. Sci. USA 77:5201, 1980), and include bone marrow, fetal brain, fetal lung, lymph node, glioblastoma, monocytes, Daudi cells (a human Burkitt lymphoma cell line), and umbilical vein endothelial cells (HUVEC). Total RNA can be prepared using guanidine-HCl extraction followed by isolation by centrifugation in a CsCl gradient (Chirgwin et al., Biochemistry 18:52-94, 1979). Poly (A)+ RNA is prepared from total RNA using the method of Aviv and Leder (Proc. Natl. Acad. Sci. USA 69:1408-12, 1972). Complementary DNA (cDNA) is prepared from poly(A)+ RNA using known methods. In the alternative, genomic DNA can be isolated. Polynucleotides encoding Zimlig2 polypeptides are then identified and isolated by, for example, hybridization or polymerase chain reaction (PCR).
[99] The polynucleotides of the present invention can also be synthesized using automated equipment ("gene machines") according to methods known in the art. See, for example, Glick and Pasternak, Molecular Biotechnology. Principles & Applications of Recombinant DNA. ASM Press, Washington, D.C., 1994; Itakura et al., Annu. Rev. Biochem. 53: 323-356, 1984; and Climie et al., Proc. Natl. Acad. Sci. USA 87:633-637. 1990.
[100] The Zimlig2 polynucleotide sequence disclosed herein can be used to isolate polynucleotides encoding other Zimlig2 proteins. Such other proteins include alternatively spliced cDNAs (including cDNAs encoding secreted Zimlig2 proteins) and counterpart polynucleotides from other species (orthologs). These orthologous polynucleotides can be used, inter alia, to prepare the respective orthologous proteins. Other species of interest include, but are not limited to, mammalian, avian, amphibian, reptile, fish, insect and other vertebrate and invertebrate species. Of particular interest are Zimlig2 polynucleotides and proteins from other mammalian species, including non- human primate, murine, porcine, ovine, bovine, canine, feline, and equine polynucleotides and proteins. Orthologs of human Zimlig2 can be cloned using information and compositions provided by the present invention in combination with conventional cloning techniques. For example, a cDNA can be cloned using mRNA obtained from a tissue or cell type that expresses Zimlig2. Suitable sources of mRNA can be identified by PCR or by probing Northern blotting (Thomas, Proc. Natl. Acad. Sci. USA 77:5201, 1980) with probes designed from the sequences disclosed herein. A library is then prepared from mRNA of a positive tissue or cell line. A Zimlig2-encoding cDNA can then be isolated by a variety of methods, such as by probing with a complete or partial human cDNA or with one or more sets of degenerate probes based on the disclosed sequences. Hybridization will generally be done under low stringency conditions, wherein washing is carried out in 1 x SSC with an initial wash at 400C and with subsequent washes at 5°C higher intervals until background is suitably reduced. A cDNA can also be cloned using the polymerase chain reaction, or PCR (Mullis, U.S. Patent No. 4,683,202), using primers designed from the representative human Zimlig2 sequence disclosed herein. Within an additional method, the cDNA library can be used to transform or transfect host cells, and expression of the cDNA of interest can be detected with an antibody to Zimlig2 polypeptide. Similar techniques can also be applied to the isolation of genomic clones.
[101] Those skilled in the art will recognize that the sequence disclosed in SEQ ID NO: 1 represents a single allele of human Zimlig2, and that natural variation, including allelic variation and alternative splicing may occur. Allelic variants of this sequence can be cloned by probing cDNA or genomic libraries from different individuals according to standard procedures. Allelic variants of the DNA sequence shown in SEQ ID NO: 1, including those containing silent mutations and those in which mutations result in amino acid sequence changes, are within the scope of the present invention, as are allelic variations that encode proteins such as those comprising the amino acid sequences of SEQ ID NOs: 4, 5, 9, and 10. cDNAs generated from alternatively spliced mRNAs, which retain the immune modulating activity of Zimlig2 are included within the scope of the present invention, as are polypeptides encoded by such cDNAs and mRNAs.
[102] Allelic variants and splice variants of these sequences can be cloned by probing cDNA or genomic libraries from different individuals or tissues according to standard procedures known in the art.
[103] For any Zimlig2 polypeptide, including variants and fusion proteins, one of ordinary skill in the art can readily generate a fully degenerate polynucleotide sequence encoding that variant. Moreover, those of skill in the art can use standard software to devise Zimlig2 variants based upon the nucleotide and amino acid sequences described herein. The present invention thus provides a computer-readable medium encoded with a data structure that provides at least one of the following sequences: SEQ ID NOs: 1 to 17 and portions thereof. Suitable forms of computer-readable media include magnetic media and optically -readable media. Examples of magnetic media include a hard or fixed drive, a random access memory (RAM) chip, a floppy disk, digital linear tape (DLT), a disk cache, and a ZIP™ disk. Optically readable media are exemplified by compact discs (e.g., CD-read only memory (ROM), CD-rewritable (RW), and CD-recordable), and digital versatile/video discs (DVD) (e.g., DVD-ROM, DVD-RAM, and DVD+RW).
[104] The proteins of the present invention, including the truncated and mature proteins, full-length proteins, variant proteins, and fusion proteins can be produced in genetically engineered host cells according to conventional techniques. Suitable host cells are those cell types that can be transformed or transfected with exogenous DNA and grown in culture, and include bacteria, fungal cells, and cultured higher eukaryotic cells. Eukaryotic cells, particularly cultured cells of multicellular organisms, are preferred. Techniques for manipulating cloned DNA molecules and introducing exogenous DNA into a variety of host cells are disclosed by Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989, and Ausubel et al., eds., Current Protocols in Molecular Biology, Green and Wiley and Sons, NY, 1993. [105] In general, a DNA sequence encoding a truncated Zimlig2 protein is operably linked to other genetic elements required for its expression, generally including a transcription promoter and terminator, within an expression vector. The vector will also commonly contain one or more selectable markers and one or more origins of replication, although those skilled in the art will recognize that within certain systems selectable markers may be provided on separate vectors, and replication of the exogenous DNA may be provided by integration into the host cell genome. Selection of promoters, terminators, selectable markers, vectors and other elements is a matter of routine design within the level of ordinary skill in the art. Many such elements are described in the literature and are available through commercial suppliers.
[106] To direct a Zimlig2 protein into the secretory pathway of a host cell, a secretory signal sequence (also known as a leader sequence, prepro sequence or pre sequence) is provided in the expression vector. The secretory signal sequence may be that of a Zimlig2 gene, or may be derived from another secreted protein (e.g., t-PA) or synthesized de novo. The secretory signal sequence is operably linked to the truncated Zimlig2 DNA sequence, i.e., the two sequences are joined in the correct reading frame and positioned to direct the newly synthesized polypeptide into the secretory pathway of the host cell. Secretory signal sequences are commonly positioned 5' to the DNA sequence encoding the polypeptide of interest, although certain signal sequences may be positioned elsewhere in the DNA sequence of interest (see, e.g., Welch et al., U.S. Patent No. 5,037,743; Holland et al., U.S. Patent No. 5,143,830). In the alternative, a Zimlig2 protein is expressed cytoplasmically and is isolated after lysing the host cells.
[107] An expression vector can be introduced into host cells using a variety of standard techniques including calcium phosphate transfection, liposome-mediated transfection, microprojectile- mediated delivery, electroporation, and the like. Transfected cells can be selected and propagated to provide recombinant host cells that comprise the gene of interest stably integrated in the host cell genome.
[108] Cultured mammalian cells are suitable hosts for use within the present invention. Methods for introducing exogenous DNA into mammalian host cells include calcium phosphate- mediated transfection (Wigler et al., Cell 14:725, 1978; Corsaro and Pearson, Somatic Cell Genetics 7:603, 1981; and Graham and Van der Eb, Virology 52:456, 1973), electroporation (Neumann et al., EMBO J. 1:841-845, 1982), DEAE-dextran mediated transfection (Ausubel et al., ibid.), and liposome-mediated transfection (Hawley-Nelson et al., Focus 15:73, 1993; Ciccarone et al., Focus 15:80, 1993). The production of recombinant polypeptides in cultured mammalian cells is disclosed by, for example, Levinson et al., U.S. Patent No. 4,713,339; Hagen et al., U.S. Patent No. 4,784,950; Palmiter et al., U.S. Patent No. 4,579,821; and Ringold, U.S. Patent No. 4,656,134. Suitable cultured mammalian cells include the COS-I (ATCC No. CRL 1650), COS-7 (ATCC No. CRL 1651), BHK (ATCC No. CRL 1632), BHK 570 (ATCC No. CRL 10314), 293 (ATCC No. CRL 1573; Graham et al., J. Gen. Virol. 36:59-72, 1977) and Chinese hamster ovary (e.g. CHO-Kl; ATCC No. CCL 61) cell lines. Additional suitable cell lines are known in the art and available from public depositories such as the American Type Culture Collection, Rockville, Maryland. In general, strong transcription promoters are preferred, such as promoters from SV-40 or cytomegalovirus. See, e.g., U.S. Patent No. 4,956,288. Other suitable promoters include those from metallothionein genes (U.S. Patent Nos. 4,579,821 and 4,601,978) and the adenovirus major late promoter.
[109] Drug selection is generally used to select for cultured mammalian cells into which foreign DNA has been inserted. Such cells are commonly referred to as "transfectants". Cells that have been cultured in the presence of the selective agent and are able to pass the gene of interest to their progeny are referred to as "stable transfectants." An exemplary selectable marker is a gene encoding resistance to the antibiotic neomycin. Selection is carried out in the presence of a neomycin-type drug, such as G-418 or the like. Selection systems can also be used to increase the expression level of the gene of interest, a process referred to as "amplification." Amplification is carried out by culturing transfectants in the presence of a low level of the selective agent and then increasing the amount of selective agent to select for cells that produce high levels of the products of the introduced genes. An exemplary amplifiable selectable marker is dihydrofolate reductase, which confers resistance to methotrexate. Other drug resistance genes (e.g. hygromycin resistance, multidrug resistance, puromycin acetyltransferase) can also be used.
[110] The amino acid sequence of interest can be produced by a eukaryotic cell, such as a mammalian cell, fungal cell, plant cell, insect cell, avian cell, and the like. Examples of suitable mammalian host cells include African green monkey kidney cells (Vero; ATCC CRL 1587), human embryonic kidney cells (293-HEK; ATCC CRL 1573), baby hamster kidney cells (BHK-21, BHK- 570; ATCC CRL 8544, ATCC CRL 10314), canine kidney cells (MDCK; ATCC CCL 34), Chinese hamster ovary cells (CHO-Kl; ATCC CCL61; CHO DG44 (Chasin et al, Som. Cell. Molec. Genet. 12:555, 1986)), rat pituitary cells (GHl; ATCC CCL82), HeLa S3 cells (ATCC CCL2.2), rat hepatoma cells (H-4-II-E; ATCC CRL 1548) SV40-transformed monkey kidney cells (COS-I; ATCC CRL 1650) and murine embryonic cells (NIH-3T3; ATCC CRL 1658).
[Ill] Insect cells can be infected with recombinant baculovirus, commonly derived from Autographa californica nuclear polyhedrosis virus (AcNPV). See, King and Possee, The Baculovirus Expression System: A Laboratory Guide. London, Chapman & Hall; O'Reilly et al., Baculovirus Expression Vectors: A Laboratory Manual. New York, Oxford University Press., 1994; and Richardson, Ed., Baculovirus Expression Protocols. Methods in Molecular Biology. Humana Press, Totowa, NJ, 1995. Recombinant baculovirus can also be produced through the use of a transposon- based system described by Luckow et al. (J. Virol. 67:4566-4579, 1993). This system, which utilizes transfer vectors, is commercially available in kit form (Bac-to-Bac™ kit; Life Technologies, Rockville, MD). The transfer vector (e.g., pFastBacl™; Life Technologies) contains a Tn7 transposon to move the DNA encoding the protein of interest into a baculovirus genome maintained in E. coli as a large plasmid called a "bacmid." See, Hill-Perkins and Possee, J. Gen. Virol. 71 :971-976, 1990; Bonning et al., J. Gen. Virol. 75: 1551-1556, 1994; and Chazenbalk and Rapoport, J. Biol. Chem. 270: 1543-1549, 1995. In addition, transfer vectors can include an in-frame fusion with DNA encoding a polypeptide extension or affinity tag as disclosed above. Using techniques known in the art, a transfer vector containing a truncated Zimlig2-encoding sequence is transformed into E. coli host cells, and the cells are screened for bacmids which contain an interrupted lacZ gene indicative of recombinant baculovirus. The bacmid DNA containing the recombinant baculovirus genome is isolated, using common techniques, and used to transfect Spodoptera frugiperda cells, such as Sf9 cells. Recombinant virus that expresses Zimlig2 protein is subsequently produced. Recombinant viral stocks are made by methods commonly used the art.
[112] For protein production, the recombinant virus is used to infect host cells, typically a cell line derived from the fall armyworm, Spodoptera frugiperda (e.g., Sf9 or Sf21 cells) or Trichoplusia ni (e.g., High Five™ cells; Invitrogen, Carlsbad, CA). See, in general, Glick and Pasternak, Molecular Biotechnology: Principles and Applications of Recombinant DNA, ASM Press, Washington, D. C, 1994. See also, U.S. Patent No. 5,300,435. Serum- free media are used to grow and maintain the cells. Suitable media formulations are known in the art and can be obtained from commercial suppliers. The cells are grown up from an inoculation density of approximately 2-5 x 105 cells to a density of 1 -2 x 106 cells, at which time a recombinant viral stock is added at a multiplicity of infection (MOI) of 0.1 to 10, more typically near 3. Procedures used are generally described in available laboratory manuals (e.g., King and Possee, ibid.; O'Reilly et al., ibid.; Richardson, ibid.).
[113] Fungal cells, including yeast cells, can also be used within the present invention. Yeast species of particular interest in this regard include Saccharomyces cerevisiae, Pichia pastoris, and Pichia methanolica. Methods for transforming S. cerevisiae cells with exogenous DNA and producing recombinant polypeptides there from are disclosed by, for example, Kawasaki, U.S. Patent No. 4,599,311; Kawasaki et al., U.S. Patent No. 4,931,373; Brake, U.S. Patent No. 4,870,008; Welch et al., U.S. Patent No. 5,037,743; and Murray et al., U.S. Patent No. 4,845,075. Transformed cells are selected by phenotype determined by the selectable marker, commonly drug resistance or the ability to grow in the absence of a particular nutrient (e.g., leucine). A preferred vector system for use in Saccharomyces cerevisiae is the POTl vector system disclosed by Kawasaki et al. (U.S. Patent No. 4,931,373), which allows transformed cells to be selected by growth in glucose-containing media. Suitable promoters and terminators for use in yeast include those from glycolytic enzyme genes (see, e.g., Kawasaki, U.S. Patent No. 4,599,311; Kingsman et al., U.S. Patent No. 4,615,974; and Bitter, U.S. Patent No. 4,977,092) and alcohol dehydrogenase genes. See also U.S. Patents Nos. 4,990,446; 5,063,154; 5,139,936 and 4,661,454. Production in yeast requires co-transfection with a sulfo- transferase. [114] Transformation systems for other yeasts, including Hansenula polymorpha, Schizosaccharomyces pombe, Kluyveromyces lactis, Kluyveromyces fragilis, Ustilago maydis, Pichia pastoris, Pichia methanolica, Pichia guillermondii and Candida maltosa are known in the art. See, for example, Gleeson et al., J. Gen. Microbiol. 132:3459-3465, 1986; Cregg, U.S. Patent No. 4,882,279; and Raymond et al., Yeast J_4: 11-23, 1998. Aspergillus cells may be utilized according to the methods of McKnight et al., U.S. Patent No. 4,935,349. Methods for transforming Acremonium chrysogenum are disclosed by Sumino et al., U.S. Patent No. 5,162,228. Methods for transforming Neurospora are disclosed by Lambowitz, U.S. Patent No. 4,486,533. Production of recombinant proteins in Pichia methanolica is disclosed in U.S. Patents No. 5,716,808, 5,736,383, 5,854,039, and 5,888,768; and WIPO publications WO 99/14347 and WO 99/14320.
[115] For example, the use of Pichia methanolica as host for the production of recombinant proteins is disclosed by Raymond, U.S. Patent No. 5,716,808, Raymond, U.S. Patent No. 5,736,383, Raymond et al., Yeast .14: 11-23 (1998), and in international publication Nos. WO 97/17450, WO 97/17451, WO 98/02536, and WO 98/02565. DNA molecules for use in transforming P. methanolica will commonly be prepared as double-stranded, circular plasmids, which are preferably linearized prior to transformation. For polypeptide production in P. methanolica, the promoter and terminator in the plasmid can be that of a P. methanolica gene, such as a P. methanolica alcohol utilization gene (AUGl or AUG2). Other useful promoters include those of the dihydroxyacetone synthase (DHAS), formate dehydrogenase (FMD), and catalase (CAT) genes. To facilitate integration of the DNA into the host chromosome, it is preferred to have the entire expression segment of the plasmid flanked at both ends by host DNA sequences. For large-scale, industrial processes where it is desirable to minimize the use of methanol host cells can be used in which both methanol utilization genes (AUGl and AUG2) are deleted. For production of secreted proteins, host cells can be used that are deficient in vacuolar protease genes (PEP4 and PRBl). Electroporation is used to facilitate the introduction of a plasmid containing DNA encoding a polypeptide of interest into P. methanolica cells. P. methanolica cells can be transformed by electroporation using an exponentially decaying, pulsed electric field having a field strength of from 2.5 to 4.5 kV/cm, preferably about 3.75 kV/cm, and a time constant (t) of from 1 to 40 milliseconds, preferably about 20 milliseconds.
[116] Prokaryotic host cells, including strains of the bacteria Escherichia coli, Bacillus and other genera are also useful host cells within the present invention. Techniques for transforming these hosts and expressing foreign DNA sequences cloned therein are well known in the art (see, e.g., Sambrook et al., ibid.). When expressing a truncated Zimlig2 polypeptide in bacteria such as E. coli, the polypeptide may be retained in the cytoplasm, either in soluble form or as insoluble granules, or may be directed to the periplasmic space by a bacterial secretion sequence. When the protein is present as insoluble granules, the cells are lysed, and the granules are recovered and denatured using, for example, guanidine isothiocyanate or urea. The denatured polypeptide can then be refolded and dimerized by diluting the denaturant, such as by dialysis against a solution of urea and a combination of reduced and oxidized glutathione, followed by dialysis against a buffered saline solution. In the latter case, the polypeptide can be recovered from the periplasmic space in a soluble and functional form by disrupting the cells (by, for example, sonication or osmotic shock) to release the contents of the periplasmic space and recovering the protein, thereby obviating the need for denaturation and refolding.
[117] Expression vectors can also be introduced into plant protoplasts, intact plant tissues, or isolated plant cells. Methods for introducing nucleic acid molecules into plant tissue include the direct infection or co-cultivation of plant tissue with Agrobacterium tumefaciens, microprojectile-mediated delivery, DNA injection, electroporation, and the like. See, for example, Horsch et al., Science 227:1229 (1985), Klein et al., Biotechnology 10:268 (1992), and Miki et al, "Procedures for Introducing Foreign DNA into Plants," in Methods in Plant Molecular Biology and Biotechnology, Glick et al (eds.), pages 67-88 (CRC Press, 1993).
[118] Transformed or transfected host cells are cultured according to conventional procedures in a culture medium containing nutrients and other components required for the growth of the chosen host cells. A variety of suitable media, including defined media and complex media, are known in the art and generally include a carbon source, a nitrogen source, essential amino acids, vitamins and minerals. Media may also contain such components as growth factors or serum, as required. The growth medium will generally select for cells containing the exogenously added DNA by, for example, drug selection or deficiency in an essential nutrient which is complemented by the selectable marker carried on the expression vector or co-transfected into the host cell.
[119] As an alternative, polypeptides of the present invention can be synthesized by exclusive solid phase synthesis, partial solid phase methods, fragment condensation or classical solution synthesis. These synthesis methods are well-known to those of skill in the art (see, for example, Merrifield, J. Am. Chem. Soc. 85:2149 (1963), Stewart et al, "Solid Phase Peptide Synthesis" (2nd Edition), (Pierce Chemical Co. 1984), Bayer and Rapp. Chem. Pept. Prot. 3:3 (1986), Atherton et al, Solid Phase Peptide Synthesis: A Practical Approach (IRL Press 1989), Fields and Colowick, "Solid-Phase Peptide Synthesis," Methods in Enzymology Volume 289 (Academic Press 1997), and Lloyd- Williams et al, Chemical Approaches to the Synthesis of Peptides and Proteins (CRC Press, Inc. 1997)). Variations in total chemical synthesis strategies, such as "native chemical ligation" and "expressed protein ligation" are also standard (see, for example, Dawson et al, Science 266:776 (1994), Hackeng et al, Proc. Nat'l Acad. Sci. USA 94:7845 (1997), Dawson, Methods Enzvmol. 287: 34 (1997), Muir et al, Proc. Nat'l Acad. Sci. USA 95:6705 (1998), and Severinov and Muir. J. Biol. Chem. 273:16205 (1998)).
[120] Zimlig2 peptides may be synthesized by solid phase peptide synthesis using a model 43 IA Peptide Synthesizer (Applied Biosystems/Perkin Elmer, Foster City, CA). Flouren-9- ylmethoxycarbonyl (Fmoc)-Glutamine resin (0.63 mmol/g; Advanced Chemtech, Louisville, KY) is used as the initial support resin. 1 mmol amino acid cartridges (Anaspec, Inc. San Jose, CA) are used for synthesis. A mixture of 2(l-Hbenzotriazol-y-yl 1,1,3,3-tetrahmethylhyluronium hexafluorophosphate (HBTU), 1 -hydroxybenzotriazol (HOBt), 2m N,N-Diisolpropylethylamine, N- Methylpyrrolidone, Dichloromethane (all from Applied Biosystems/Perkin Elmer) and piperidine (Aldrich Chemical Co., St. Louis, MO), are used for synthesis reagents.
[121] The Peptide Companion software (Peptides International, Louisville, KY) is used to predict the aggregation potential and difficulty level for synthesis for the these peptides. Synthesis is performed using single coupling programs, according to the manufacturer's specifications.
[122] The peptide is truncated from the solid phase following standard TFA cleavage procedure (according to Peptide Cleavage manual, Applied Biosystems/Perkin Elmer). Purification of the peptide is done by RP-HPLC using a Cl 8, 10 μm semi-peparative column (Vydac, Hesperial, CA). Eluted fractions from the column are collected and analyzed for correct mass and purity by electrospray mass spectrometry.
[123] One or more serine residues of a Zimlig2 protein may be modified to include an O- glycosylation or carbohydrate epitope such as Slex (sialyl lewisx oligosaccharide) or other sialyl lewis. For example, the peptide is synthesized by Fmoc chemistry with all of the amino acids protected, except for the hydroxyl group of the serine in position 142 of SEQ ID NO:2. While still attached to the resin, this hydroxyl group of serine is acylated to add the modification. After reaction, the peptide is truncated from the resin and protection groups removed. Then the peptide is purified by reverse phase HPLC.
[124] One or more tyrosine residues of the Zimlig2 protein may be sulfated. For example, in a method similar to that described in Kitagawa et al., the peptide is synthesized by Fmoc chemistry: the sulfated peptide chain is directly constructed on 2-chlorotrityl resin with Fmoc-based solid-phase chemistry using Fmoc-Tyr(SO3Na)-OH as a building block. Kitagawa, Kouki et al., The Journal of Organic Chemistry 66(l):l-10 (2001). Then later the protected peptide -resin is treated with 90% aqueous TFA at 0 0C for an appropriate period of time for cleavage and deprotection. Id. Alternatively, the peptide may be synthesized by Fmoc chemistry but with all the amino acid residues protected except for the tyrosine residues to be sulfated. Then, in a method similar to that described in Arruda et al., while the peptide is still attached to the resin, the tyrosine sulfation my be aided by using addition of tyrosylprotein sulfotransferase (TPST). Arruda, Valder R. et al., Blood 96(11 Part l):212a-213a (2000).
[125] Truncated Zimlig2 protein may be produced by Fmoc synthesis, using the methods described above, but without further serine modification to include an O-glycosylation or carbohydrate epitope such as Slex (sialyl lewisx oligosaccharide) or other sialyl lewis; and without further tyrosine sulfations. Literature on the tyrosine sulfation of Hirudin, has shown that removal of sulfation from tyrosine residues resulted in a 10 fold decrease in activity, but did not totally remove Hirudin activity. See Hofsteenge, Jan et al., Eur. J. Biochem. 188:55-59 (1990); see also Niehrs, Christof et al., The Journal of Biological Chemistry 265(16):9314-9318 (1990); and Maraganore, John, M. et al.. The Journal of Biological Chemistry 264(15):8692-8698 (1989). Or alternatively, one or more of the tyrosine residues of the Zimlig2 protein may be phosphated instead of sulfated. Hofsteenge, Jan et al. shows that, on Hirudin, replacing tyrosine sulfates with phosphates restores all of the activity lost by prior removal of the sulfation modifications to tyrosine.
[126] Using the methods disclosed above, one of ordinary skill in the art can identify and/or prepare a variety of truncated Zimlig2 proteins having immunomodulatory activity.
[127] It is preferred to purify the proteins of the present invention to >80% purity, to >90% purity, >95% purity, or a pharmaceutically pure state, that is greater than 99.9% pure with respect to contaminating macromolecules, particularly other proteins and nucleic acids, and free of infectious and pyrogenic agents. A purified protein is substantially free of other proteins, particularly other proteins of animal origin. Zimlig2 proteins (including fusion proteins) are purified by conventional protein purification methods, typically by a combination of chromatographic techniques. See, in general, Affinity Chromatography: Principles & Methods, Pharmacia LKB Biotechnology, Uppsala, Sweden, 1988; and Scopes, Protein Purification: Principles and Practice, Springer- Verlag, New York, 1994. Proteins comprising a polyhistidine affinity tag (typically about 6 histidine residues) are purified by affinity chromatography on an immobilized nickel or cobalt resin. See, for example, Houchuli et al., Bio/Technol. 6: 1321-1325, 1988. Proteins comprising a glu-glu tag can be purified by immunoaffinity chromatography according to conventional procedures. See, for example, Grussenmeyer et al., ibid. Maltose binding protein fusions are purified on an amylose column according to methods known in the art.
[128] One of ordinary skill in the art can use animal models of disease to measure the effect of Zimlig2 proteins inflammation modulation.
[129] Animal models of psoriasis include the analysis of histological alterations in adult mouse tail epidermis (Hofbauer et al, Brit. J. Dermatol. 118:85-89. 1988; Bladon et al., Arch Dermatol. Res. 277: 121-125, 1985). In this model, anti-psoriatic activity is indicated by the induction of a granular layer and orthokeratosis in areas of scale between the hinges of the tail epidermis. Typically, a topical ointment is applied daily for seven consecutive days, then the animal is sacrificed, and tail skin is examined histologically. An additional model is provided by grafting psoriatic human skin to congenitally athymic (nude) mice (Krueger et al., J. Invest. Dermatol. 64:307-312, 1975). Such grafts have been shown to retain the characteristic histology for up to eleven weeks. As in the mouse tail model, the test composition is applied to the skin at predetermined intervals for a period of one to several weeks, at which time the animals are sacrificed and the skin grafts examined histologically. A third model has been disclosed by Fretland et al. (Inflammation J_4:727-739, 1990; incorporated herein by reference). Briefly, inflammation is induced in guinea pig epidermis by topically applying phorbol ester (phorbol-12-myristate-13-acetate; PMA), typically at ca. 2 g/ml in acetone, to one ear and vehicle to the contralateral ear. Test compounds are applied concurrently with the PMA, or may be given orally. Histological analysis is performed at 96 hours after application of PMA. This model duplicates many symptoms of human psoriasis, including edema, inflammatory cell diapedesis and infiltration, high LTB4 levels and epidermal proliferation.
[130] Mouse models for experimental allergic encephalomyelitis (EAE) have been used as a tool to investigate both the mechanisms of immune -mediated disease, and methods of potential therapeutic intervention. The model resembles human multiple sclerosis, and produces demyelination as a result of T-cell activation to neuroproteins such as myelin basic protein (MBP), or proteolipid protein (PLP). Inoculation with antigen leads to induction of CD4+, class II MHC-restricted T-cells (ThI). Changes in the protocol for EAE can produce acute, chronic-relapsing, or passive-transfer variants of the model (Weinberg et al., J. Immunol. 162: 1818-26. 1999; Mijaba et al., Cell. Immunol. 186:94-102, 1999; and Glabinski. Meth. Enzvm. 288: 182-90. 1997).
[131] Wound-healing models include the linear skin incision model of Mustoe et al. (Science 237: 1333. 1987). In a typical procedure, a 6-cm incision is made in the dorsal pelt of an adult rat, then closed with wound clips. Test substances and controls (in solution, gel, or powder form) are applied before primary closure. It is preferred to limit administration to a single application, although additional applications can be made on succeeding days by careful injection at several sites under the incision. Wound breaking strength is evaluated between 3 and 21 days post wounding. In a second model, multiple, small, full-thickness excisions are made on the ear of a rabbit. The cartilage in the ear splints the wound, removing the variable of wound contraction from the evaluation of closure. Experimental treatments and controls are applied. The geometry and anatomy of the wound site allow for reliable quantification of cell ingrowth and epithelial migration, as well as quantitative analysis of the biochemistry of the wounds (e.g., collagen content). See, Mustoe et al., J. Clin. Invest. 87:694, 1991. The rabbit ear model can be modified to create an ischemic wound environment, which more closely resembles the clinical situation (Ahn et al., Ann. Plast. Surg. 24: 17. 1990). Within a third model, healing of partial-thickness skin wounds in pigs or guinea pigs is evaluated (LeGrand et al., Growth Factors £:307, 1993). Experimental treatments are applied daily on or under dressings. Seven days after wounding, granulation tissue thickness is determined. This model is preferred for dose response studies, as it is more quantitative than other in vivo models of wound healing. A full thickness excision model can also be employed. Within this model, the epidermis and dermis are removed down to the panniculus carnosum in rodents or the subcutaneous fat in pigs. Experimental treatments are applied topically on or under a dressing, and can be applied daily if desired. The wound closes by a combination of contraction and cell ingrowth and proliferation. Measurable endpoints include time to wound closure, histologic score, and biochemical parameters of wound tissue.
[132] Impaired wound healing models are also known in the art (e.g., Cromack et al., Surgery 113:36. 1993; Pierce et al., Proc. Natl. Acad. Sci. USA 86:2229, 1989; Greenhalgh et al., Amer. J. Pathol. 136:1235. 1990). Delay or prolongation of the wound healing process can be induced pharmacologically by treatment with steroids, irradiation of the wound site, or by concomitant disease states (e.g., diabetes). Linear incisions or full-thickness excisions are most commonly used as the experimental wound. Endpoints are as disclosed above for each type of wound. Subcutaneous implants can be used to assess compounds acting in the early stages of wound healing (Broadley et al., Lab. Invest. 61:571, 1985; Sprugel et al., Amer. J. Pathol. 129: 601, 1987). Implants are prepared in a porous, relatively non-inflammatory container (e.g., polyethylene sponges or expanded polytetrafluoroethylene implants filled with bovine collagen) and placed subcutaneously in mice or rats. The interior of the implant is empty of cells, producing a "wound space" that is well- defined and separable from the preexisting tissue. This arrangement allows the assessment of cell influx and cell type as well as the measurement of vasculogenesis/angiogenesis and extracellular matrix production.
[133] Further use of models of disease to measure the effect of Zimlig2 proteins inflammation modulation are described below in Example 8.
[134] Microarrays provide a common platform for analysis of transcriptional regulation that can be applied to cells subjected to a variety of stimuli, to whole tissues for assessment of normal expression profiles, and to diseased tissues in comparison with their normal counterparts. The Gene Expression Omnibus (GEO) is a public repository that archives and freely distributes microarray and other forms of high-throughput data submitted by the scientific community. On GEO, we found a dataset describing Zimlig2 variation in primary and metastatic prostate cancer, compared with control normal prostate tissue. Zimlig2 is expressed at very high levels (>90Λ percentile) in normal prostate samples. Message levels were slightly lower in the primary prostate cancer samples, but were dramatically reduced in the metastatic cancers. Three of the four metastatic samples were called absent for Zimlig2, and the fourth expressed at less than the 75th percentile, lower than all the primary and normal prostate samples. These data suggest that Zimlig2 expression is lost or radically reduced during tumor progression, which may indicate selective pressure favoring growth of Zimlig2 -negative cells. Thus Zimlig2 expression may inhibit tumor metastasis.
[135] The activity of Zimlig2 proteins can be measured with a silicon-based biosensor microphysiometer that measures the extracellular acidification rate or proton excretion associated with receptor binding and subsequent physiologic cellular responses. An exemple of such a device is the Cytosensor™ Microphysiometer manufactured by Molecular Devices, Sunnyvale, CA. A variety of cellular responses, such as cell proliferation, ion transport, energy production, inflammatory response, regulatory and receptor activation, and the like, can be measured by this method. See, for example, McConnell et al., Science 257: 1906-1912, 1992; Pitchford et al., Meth. Enzymol. 228:84-108, 1997; Arimilli et al., J. Immunol. Meth. 212:49-59, 1998; and Van Liefde et al., Eur. J. Pharmacol. 346:87- 95, 1998. The microphysiometer can be used for assaying adherent or non-adherent eukaryotic or prokaryotic cells. By measuring extracellular acidification changes in cell media over time, the microphysiometer directly measures cellular responses to various stimuli, including Zimlig2 proteins, their agonists, and antagonists. The microphysiometer is used to measure responses of a Zimlig2- responsive eukaryotic cell, compared to a control eukaryotic cell that does not respond to Zimlig2 polypeptide. Zimlig2 -responsive eukaryotic cells comprise cells into which a receptor for Zimlig2 has been transfected, thereby creating a cell that is responsive to Zimlig2, as well as cells naturally responsive to Zimlig2. Differences, measured by a change, for example, an increase or diminution in extracellular acidification, in the response of cells exposed to Zimlig2 polypeptide, relative to a control not exposed to Zimlig2, are a direct measurement of Zimlig2-modulated cellular responses. Moreover, such Zimlig2-modulated responses can be assayed under a variety of stimuli. The present invention thus provides methods of identifying agonists and antagonists of Zimlig2 proteins, comprising providing cells responsive to a Zimlig2 polypeptide, culturing a first portion of the cells in the absence of a test compound, culturing a second portion of the cells in the presence of a test compound, and detecting a change, for example, an increase or diminution, in a cellular response of the second portion of the cells as compared to the first portion of the cells. The change in cellular response is shown as a measurable change in extracellular acidification rate. Culturing a third portion of the cells in the presence of a Zimlig2 protein and the absence of a test compound provides a positive control for the Zimlig2 -responsive cells and a control to compare the agonist activity of a test compound with that of the Zimlig2 polypeptide. Antagonists of Zimlig2 can be identified by exposing the cells to Zimlig2 protein in the presence and absence of the test compound, whereby a reduction in Zimlig2-stimulated activity is indicative of antagonist activity in the test compound.
[136] The activity of truncated Zimlig2 can also be measured using assays known in the art. Assays are known that can be used to measure Zimlig2's effect on endothelial to leukocyte binding. (Vedder, Nicholas B. and Harlan, John M., J. Clin. Invest. 81:676-682 (1988)). Assays are also known in the art that can be used to measure Zimlig2's binding to L-selectin, implicated in lymphocyte homing; P-selectin implicated in neutrophil recruitment; and E-selectin the binding to which is induced in inflammation. (Theoret, Jean-Francois et al., The Journal of Pharmacology and Experimental Therapeutics 298:658-664 (2001); Goetz, Douglas J. et al., The Journal of Cell Biology 137(2):509-519 (1997); and Walcheck, Bruce. J. Clin. Invest. 98f5U081-1087 (1996)).
[137] Zimlig2 proteins and epitope-bearing portions thereof can be used to generate antibodies that specifically bind to Zimlig2. An "epitope" is a region of a protein to which an antibody can bind. See, for example, Geysen et al., Proc. Natl. Acad. Sci. USA 81:3998-4002, 1984. Epitopes can be linear or conformational, the latter being composed of discontinuous regions of the protein that form an epitope upon folding of the protein. Linear epitopes are generally at least 6 amino acid residues in length. Relatively short synthetic peptides that mimic part of a protein sequence are routinely capable of eliciting an antiserum that reacts with the partially mimicked protein. See, Sutcliffe et al., Science 219:660-666, 1983. Antibodies that recognize short, linear epitopes are particularly useful in analytic and diagnostic applications that employ denatured protein, such as Western blotting (Tobin, Proc. Natl. Acad. Sci. USA 76:4350-4356, 1979), or in the analysis of fixed cells or tissue samples. Antibodies to linear epitopes are also useful for detecting fragments of Zimlig2 in, for example, body fluids or cell culture media.
[138] Antigenic, epitope-bearing polypeptides contain a sequence of at least six or at least nine contiguous amino acid residues of the truncated Zimlig2 protein (amino acid residues 71 to 148 of SEQ ID NO:2). Polypeptides comprising a larger portion of a Zimlig2 protein, i.e. from 15 to 30 residues or up to the entire sequence, can also be used. The amino acid sequence of the epitope- bearing polypeptide is selected to provide substantial solubility in aqueous solvents, that is the sequence includes relatively hydrophilic residues, and hydrophobic residues are substantially avoided.
[139] As used herein, the term "antibodies" includes polyclonal antibodies, monoclonal antibodies, antigen-binding fragments thereof such as F(ab')2 and Fab fragments, single chain antibodies, and the like, including genetically engineered antibodies. Non-human antibodies can be humanized by grafting only non-human CDRs onto human framework and constant regions, or by incorporating the entire non-human variable domains (optionally "cloaking" them with a human-like surface by replacement of exposed residues, wherein the result is a "veneered" antibody). In some instances, humanized antibodies may retain non-human residues within the human variable region framework domains to enhance proper binding characteristics. Through humanizing antibodies, biological half-life may be increased, and the potential for adverse immune reactions upon administration to humans is reduced. One skilled in the art can generate humanized antibodies with specific and different constant domains (i.e., different Ig subclasses) to facilitate or inhibit various immune functions associated with particular antibody constant domains. Alternative techniques for generating or selecting antibodies useful herein include in vitro exposure of lymphocytes to a Zimlig2 protein, and selection of antibody display libraries in phage or similar vectors (for instance, through use of immobilized or labeled Zimlig2 polypeptide). Antibodies are defined to be specifically binding if they bind to a Zimlig2 protein with an affinity at least 10-fold greater than the binding affinity to control (non-Zimlig2) polypeptide. The antibodies should exhibit a binding affinity (Ka) of 10 M or greater, 10 M or greater, 10 M or greater, or 10 M or greater. The affinity of a monoclonal antibody can be readily determined by one of ordinary skill in the art (see, for example, Scatchard. Ann. NY Acad. Sci. 51 : 660-672, 1949). [140] Methods for preparing polyclonal and monoclonal antibodies are well known in the art (see for example, Hurrell, J. G. R., Ed., Monoclonal Hybridoma Antibodies: Techniques and Applications, CRC Press, Inc., Boca Raton, FL, 1982). As would be evident to one of ordinary skill in the art, polyclonal antibodies can be generated from a variety of warm-blooded animals such as horses, cows, goats, sheep, dogs, chickens, rabbits, mice, and rats. The immunogenicity of a Zimlig2 protein may be increased through the use of an adjuvant such as alum (aluminum hydroxide) or Freund's complete or incomplete adjuvant. Polypeptides useful for immunization also include fusion polypeptides, such as fusions of a Zimlig2 protein or a portion thereof with an immunoglobulin polypeptide or with maltose binding protein. The polypeptide immunogen may be a full-length molecule or a portion thereof. If the polypeptide portion is "hapten-like", such portion may be advantageously joined or linked to a macromolecular carrier (such as keyhole limpet hemocyanin (KLH), bovine serum albumin (BSA) or tetanus toxoid) for immunization.
[141] A variety of assays known to those skilled in the art can be used to detect antibodies that specifically bind to a Zimlig2 protein. Exemplary assays are described in detail in Antibodies: A Laboratory Manual, Harlow and Lane (Eds.), Cold Spring Harbor Laboratory Press, 1988. Representative examples of such assays include concurrent Immunoelectrophoresis, radioimmunoassays, radio-immunoprecipitations, enzyme-linked immunosorbent assays (ELISA), dot blot assays, Western blot assays, inhibition or competition assays, and sandwich assays.
[142] Antibodies to Zimlig2 may be used for affinity purification of Zimlig2 proteins; within diagnostic assays for determining circulating levels of Zimlig2 proteins; for detecting or quantitating soluble Zimlig2 protein as a marker of underlying pathology or disease; for immunolocalization within whole animals or tissue sections, including immunodiagnostic applications; for immunohistochemistry; for screening expression libraries; and for other uses that will be evident to those skilled in the art. For certain applications, including in vitro and in vivo diagnostic uses, it is advantageous to employ labeled antibodies. Suitable direct tags or labels include radionuclides, enzymes, substrates, cofactors, inhibitors, fluorescent markers, chemiluminescent markers, magnetic particles and the like; indirect tags or labels may feature use of biotin-avidin or other complement/anti-complement pairs as intermediates.
[143] The antibodies or antibody fragments as described herein that bind to Zimlig2 may also be used as Zimlig2 antagonists. The antibodies may be used to inhibit or prevent an immune response, to inhibit or prevent Leukocyte adhesion to endothelial cells, and/or to inhibit or prevent T cell proliferation.
[144] The present invention also provides polynucleotide reagents for diagnostic use. For example, a Zimlig2 gene, a probe comprising Zimlig2 DNA or RNA, or a subsequence thereof can be used to determine if the Zimlig2 gene is present on chromosome 2 of a human patient or if a mutation has occurred. Detectable chromosomal aberrations at the Zimlig2 gene locus include, but are not limited to, aneuploidy, gene copy number changes, insertions, deletions, restriction site changes and rearrangements. Such aberrations can be detected using polynucleotides of the present invention by employing molecular genetic techniques, such as restriction fragment length polymorphism (RFLP) analysis, short tandem repeat (STR) analysis employing PCR techniques, and other genetic linkage analysis techniques known in the art (Sambrook et al., ibid.; Ausubel et. al., ibid.; AJ. Marian, Chest 108:255-265, 1995).
[145] For pharmaceutical use, the proteins of the present invention are formulated for local, including topical, or parenteral, including intravenous, subcutaneous, or intraperitoneal delivery according to conventional methods. Intravenous administration will be by injection or infusion. In many instances it will be beneficial to administer the protein by infusion or multiple injections per day over a period of several days to several weeks, sometimes preceded by a bolus injection. In general, pharmaceutical formulations will include a Zimlig2 protein in combination with a pharmaceutically acceptable vehicle, such as saline, buffered saline, 5% dextrose in water or the like. Formulations may further include one or more excipients, preservatives, solubilizers, buffering agents, albumin to prevent protein loss on vial surfaces, etc. Methods of formulation are well known in the art and are disclosed, for example, in Remington: The Science and Practice of Pharmacy. Gennaro, ed., Mack Publishing Co., Easton, PA, 19th ed., 1995.
[146] Therapeutic doses will generally be in the range of 0.1 to 100 μg/kg of patient weight per day, or 0.5-20 mg/kg per day, with the exact dose determined by the clinician according to accepted standards, taking into account the nature and severity of the condition to be treated, patient traits, etc. Determination of dose is within the level of ordinary skill in the art. The proteins may be administered for acute treatment, over one week or less, often over a period of one to three days or may be used in chronic treatment, over several months or years. In general, a therapeutically effective amount of Zimlig2 polypeptide is an amount sufficient to produce a clinically significant effect.
[147] The invention is further illustrated by the following non-limiting examples.
EXAMPLES
Example 1 : Expression of murine Zimlig2 mRNA on Northern Blots
[148] Murine Zimlig2 mRNA was cut with EcoRI and Pstl in buffer H to generate a 270bp fragment for use in northern blots. The following was combined: 30μl murine Zimlig2 mRNA, lμl each of the restriction enzymes EcoRI and Pstl (New England BioLab, Ipswich, MA), 4μl buffer H (New England BioLab, Ipswich, MA), and 4μl sterile water. The reaction was then incubated at 37°C for one hour and was run in 2% agarose gel. The fragment was purified using Qiagen gel purification columns (Qiagen, Valencia, CA) according to the manufacturer's instructions. The fragment was then quantitated by a spectrophotometer reading. 50 or 25ng of fragment was labeled using Prime-It II reagents (Stratagene, La Jolla, CA) according to the manufacturer's instructions, and separated from unincorporated nucleotides using an S-200 microspin column (Amersham, Piscataway, NJ) according to the manufacturer's protocol.
[149] The blots to be probed with murine Zimlig2 (specifically Mouse Multiple Tissue Northern Blots I, II and Mouse Embryo Multiple Tissue Northern Blot, all from BD Biosciences, Clontech, Palo Alto, CA) were prehybridized overnight at 55°C in ExpressHyb (BD Biosciences, Clontech Palo Alto, CA) in the presence of 100ug/ml salmon sperm DNA (Stratagene, La Jolla, CA) and 6ug/ml cot-I DNA (Invitrogen, Carlsbad, CA), all of which were boiled and snap-chilled prior to adding to the blots. Radiolabeled murine Zimlig2, salmon sperm DNA, and cot-1 DNA were mixed together and boiled for 5 minutes, followed by a snap chilling on ice. The final concentrations of the salmon sperm DNA and the cot- 1 DNA were the same as in the prehybridization step and the final concentration of the radiolabeled murine Zimlig2 was 1x106 cpm/ml. The blots were hybridized overnight in a roller oven at 55°C, then washed copiously at room temperature in 2X SSC, 0.1% SDS, with several buffer changes, then at 65°C. The final wash was at 65°C in 0.1X SSC, 0.1%SDS. Blots were then exposed to film with intensifying screens for 14 days.
[150] The Mouse Multiple Tissue Northern Blots I, II and Mouse Embryo Multiple Tissue Northern Blot were then probed with a transferrin receptor probe, generated as follows: IuI of sense primer, zclO565 (5' TTTGCAGAAAAGGTTGCAAATGC 3', SEQ ID NO: 11) and IuI of antisense primer, zclO651 (5' AGCTTTTCTGCAGCAGCTCT 3', SEQ ID NO: 12) were used in a 50ul PCR reaction with 5ul 1 OX Advantage 2 buffer, 1 ul Advantage 2 cDNA polymerase mix (BD Biosciences, Clontech, Palo Alto, CA), 5ul 1OX Redi-Load (Invitrogen, Carlsbad CA), 4ul 2.5mM dNTPs (Applied Biosystems, Foster City, CA), and 5ul mouse placenta marathon™ cDNA (BD Biosciences, Clontech, Palo Alto, CA). PCR cycling conditions were as follows: one cycle at 94°C for 2 hours; 35 cycles of 94°C for 20 minutes, 57°C for 20 minutes, 72°C for 45 minutes; and one cycle at 72°C for 7 minutes, followed by a 4°C hold. The reaction was run in an agarose gel and the fragment were purified using Qiagen gel purification columns (Qiagen, Valencia, CA) according to the manufacturer's instructions. The fragment was quantitated by a spectrophotometer reading. The transferrin receptor fragment was labeled and used to probe the Mouse Multiple Tissue Northern Blots I, II and Mouse Embryo Multiple Tissue Northern Blots. The Blots were exposed to film with intensifying screens for 2 weeks.
[151] The results of probing mouse multiple tissue northern blots and mouse embryo multiple tissue northern blot with murine Zimlig2 indicated that murine Zimlig2 mRNA was highly expressed in thyroid and moderately expressed in salivary gland. Expression level was moderately low in prostate and expression was low in uterus as well as 17-day-embryo. The expression was very low in 7-day embryo and 15-day embryo. Example 2: Expression of Zimlig2 on Northern Blots and Disease Profiling Arrays
[152] Human Zimlig2 mRNA was cut with EcoRI and BgIII in buffer H to generate a 370bp fragment for use in northern blots. The following was combined: 40ul Zimlig2 mRNA, 0.5ul each of the restriction enzymes EcoRI and BgIII (Roche Applied Science, Indianapolis, IN), and 4.5ul buffer H (Roche Applied Science, Indianapolis, IN). The reaction was incubated at 37°C for one hour and was run in 2% agarose gel. The fragment was purified using Qiagen gel purification columns (Qiagen, Valencia, CA) according to the manufacturer's instructions. The fragment was quantitated by a spectrophotometer reading. 50 or 25ng of fragment was labeled using Prime-It II reagents (Stratagene, La Jolla, CA) according to the manufacturer's instructions, and separated from unincorporated nucleotides using an S-200 microspin column (Amersham, Piscataway, NJ) according to the manufacturer's protocol.
[153] The blots to be probed with Zimlig2 (specifically Autoimmune and Blood Disease Profiling Arrays, Cancer Profiling Array II, Cancer Cell Line Profiling Array, Multiple Tissue Northern Blots I, II, and III, and Multiple Fetal Tissue Northern Blots, all from BD Biosciences, Clontech, Palo Alto, CA) were prehybridized overnight at 55°C in ExpressHyb (BD Biosciences, Clontech Palo Alto, CA) in the presence of 100ug/ml salmon sperm DNA (Stratagene, La Jolla, CA) and 6ug/ml cot-I DNA (Invitrogen, Carlsbad, CA), all of which were boiled and snap-chilled prior to adding to the blots. Radiolabeled Zimlig2, salmon sperm DNA, and cot-1 DNA were mixed together and boiled for 5 minutes, followed by a snap chilling on ice. The final concentrations of the salmon sperm DNA and the cot-1 DNA were the same as in the prehybridization step and the final concentration of radiolabeled Zimlig2 was 1x106 cpm/ml. The blots were hybridized overnight in a roller oven at 55°C, then washed copiously at room temperature in 2X SSC, 0.1% SDS, with several buffer changes, then at 65°C. The final wash was at 65°C in 0.1X SSC, 0.1%SDS. Blots were then exposed to film with intensifying screens for 10 days.
[154] The Fetal Tissue Northern Blot and Multiple Tissue Northern Blots I, II, and III were then probed with a transferrin receptor probe, generated as follows: IuI of sense primer, zclO565 (5' TTTGCAGAAAAGGTTGCAAATGC 3', SEQ ID NO:11) and 1 ul of antisense primer, zclO651 (5' AGCTTTTCTGCAGCAGCTCT 3', SEQ ID NO: 12) were used in a 50ul PCR reaction with 5ul 1OX Advantage 2 buffer, 1 ul Advantage 2 cDNA polymerase mix (BD Biosciences, Clontech, Palo Alto, CA), 5ul 1OX Redi-Load (Invitrogen, Carlsbad CA), 4ul 2.5mM dNTPs (Applied Biosystems, Foster City, CA), and 5ul placenta marathon™ cDNA (BD Biosciences, Clontech, Palo Alto, CA). Cycling conditions were as follows: one cycle at 94°C for 2 hours; 35 cycles of 94°C for 20 minutes, 57°C for 20 minutes, 72°C for 45 minutes; and one cycle at 72°C for 7 hours, followed by a 4°C hold. The reaction was run in an agarose gel and the fragment were purified using Qiagen gel purification columns (Qiagen, Valencia, CA) according to the manufacturer's instructions. The fragment was quantitated by a spectrophotometer reading. The transferrin receptor fragment was labeled and used to probe the Fetal Tissue Northern Blot and Multiple Tissue Northern Blots I, II, and III. The Fetal Tissue Northern Blot was exposed to film with intensifying screens for 1 week. The Multiple Tissue Northern Blots I, II, and III were exposed to film with intensifying screens for 2 weeks.
[155] Results of probing multiple tissue northern blots with Zimlig2 indicated that Zimlig2 mRNA was robustly expressed in stomach, thyroid, spinal cord, trachea and adrenal gland. Expression level was also high in lymph node testis, heart, lung skeletal muscle and pancreas. The expression was low to moderate in brain, placenta, liver, spleen, prostate, colon, small intestine, fetal lung and fetal kidney. The expression was very low in fetal brain, and ovary.
[156] In Cancer Profiling Array, the expression level of Zimlig2 mRNA ranged from low to high in normal tissues. The expression was down regulated in most of the cancerous tissues with the exception of thyroid gland, which showed an equally robust expression in both normal and cancerous tissues. Specifically, Zimlig2 mRNA expression was lower in cancerous tissue than in normal tissue in the following tissues: uterus, cervix, rectum, testis, skin, small intestine, pancreas, breast, ovary, colon, stomach lung, kidney, trachea, bladder, liver, vulva, and prostate.
[157] In Blood Disease Profiling Array and Autoimmune Diseae Profiling Array, Zimlig2 mRNA was moderately expressed in normal donors in mononuclear cell and CD3 T-cell associated. The expression level was low in CD 14 monocyte or macrophage associated cells, CD 19 B-cell associated, polymorphonuclear cell and total leukocyte.
[158] In disease donors, expression of Zimlig2 mRNA in lymph node was high. The expression level ranged from low to high in disease donors such as Hodgkin's disease, Von Willebrand disease, acute myelogenous leukemie, chronic myelogenous leukemia, multiple sclerosis.
[159] In Cancer Cell Line Profiling Array, there was no expression of Zimlig2 mRNA in majority of the cell line and there was very low expression in a few cell lines such as lung cell line treated with aphidicoline as well as gamma irradiation; bone cell lines treated with L-mimosine; brain cell line treated with N-L-aspartate and cervix cell line treated with demecolcine.
Example 3 : Tissue Distribution in Blood Fraction panel using PCR
[160] A panel of first strand cDNAs from human cells and tissues was screened for Zimlig2 expression using PCR. The panel was purchased from BD Bioscience (Palo Alto, CA) and contained 10 cDNA samples from various human blood cells and tissues. The first strand cDNAs were quality control tested by PCR with G3PDH control primers by BD BioScience (Palo Alto, CA).
[161] The panel was set up in a 96-well format that included 1 positive control sample, human thyroid first strand cDNA. A dilution series was performed. Each well contained either 5ul of cDNA and 8.0 ul of water, IuI of cDNA and 12.0 ul of water, or IuI of a 1 :5 dilution of cDNA and 12.0 ul water. The PCR reactions were set up using 0.5 μl of 20 uM each of the sense oligonucleotide zc50165 (5' GGAAATAAACTCAAGCTGATGCTTCAA 3', SEQ ID NO: 13) and the antisense oligonucleotide zc50451 (5' GTTGGTAGTAATCGCCATAGTATTCAT 3', SEQ ID NO: 14), 2.5ul Opti- Prime 1OX buffer #7 (Stratagene, La Jolla, CA) 0.5ul Advantage 2 cDNA polymerase mix (BD Biosciences Clontech, Palo Alto, CA), IuI 2.5mM dNTP mix (Applied Biosystems, Foster City, CA), and IX Rediload dye (Invitrogen, Carlsbad, CA) in a final volume of 25ul. The amplification was carried out as follows: 1 cycle at 94°C for 2 minutes; 35 cycles of 94°C for 30 seconds, 700C for 30 seconds, and 72°C for 45 seconds; followed by 1 cycle at 72°C for 5 minutes. About 10 μl of the PCR reaction product was subjected to Standard agarose gel electrophoresis using a 2% agarose gel. A band of 271bp in size indicated the expression of Zimlig2 mRNA. The genomic band is 500bp in size. See Table 1 below for expression profile and tissues screened.
[162] The results indicated that Zimlig2 mRNA had a moderate expression in resting CD4+ T-helper/inducer cells and resting CD8+ T-suppressor/cytotoxic cells. The expression level was very low in activated CD4+ cells, activated CD8+, activated mononuclear cells and mononuclear cells (B- & T-cells and monocytes). It was not expressed in activated CD 19+ cells and resting CD 19+ cells.
Table 1 cDNA's made Zimlig2
Activated CD4+ BD Bioscience Yes
Resting CD4+ BD Bioscience Yes
Activated CD8+ BD Bioscience Yes
Resting CD8+ BD Bioscience Yes
Activated CD 19+ BD Bioscience No
Resting CD 19+ BD Bioscience No
Activated Mononuclear BD Bioscience Yes
Mononuclear BD Bioscience Yes
Example 4: Tissue Distribution of Zimlig2 in cDNA Library Panels using PCR
[163] A panel of DNAs from cDNA libraries made in-house was screened for Zimlig2 expression using PCR. The panel contained 45 DNA samples from cDNA libraries made from various human tissues (normal, cancer, and diseased) and resting or stimulated cell lines. The in-house cDNA libraries were quality control tested by PCR: with vector oligonucleotides for average insert size, PCR for alpha tubulin or G3PDH for full length cDNA using 5' vector oligonucloetide and 3' gene specific oligonucleotide, and with sequencing for ribosomal or mitochondrial DNA contamination.
[164] The panel was set up in a 96-well format that included a lOOpg human genomic DNA (BD Biosciences Clontech, Palo Alto, CA) positive control sample. Each well contained 5ul of cDNA library DNA and 8.0 ul of water. The PCR reactions were set up using 0.5 μl of 20 uM each of the sense oligonucleotide zc50165 (5' GGAAATAAACTCAAGCTGATGCTTCAA 3', SEQ ID NO: 13) and the antisense oligonucleotide zc50451 (5' GTTGGTAGTAATCGCCATAGTATTCAT 3', SEQ ID NO: 14), 2.5ul Opti-Prime 1OX buffer #7 (Stratagene, La Jolla, CA), 0.5ul Advantage 2 cDNA polymerase mix (BD Biosciences Clontech, Palo Alto, CA), IuI 2.5mM dNTP mix (Applied Biosystems, Foster City, CA) and IX Rediload dye (Invitrogen, Carlsbad, CA) in a final volume of 25ul. The amplification was carried out as follows: 1 cycle at 94°C for 2 minutes; 35 cycles of 94°C for 30 seconds, 700C for 30 seconds, and 72°C for 45 seconds; followed by 1 cycle at 72°C for 5 minutes. About 10 μl of the PCR reaction product was subjected to standard agarose gel electrophoresis using a 2% agarose gel. A band of 271bp in size indicated the expression of Zimlig2 and the genomic band is 500bp in size. See Table 2 below for expression profile and tissues screened. [165] The results indicated that Zimlig2 was highly expressed in some of the cDNA libraries such as brain, spinal cord, pancreas, pituitary, kidney, thyroid, prostate and tonsil. Expression in fetal thymus, CD4+ T-helper cells and NK natural killer cells was moderate. The expression was also moderate in peripheral blood mononuclear cells (PBMC-2) stimulated with LPS, IFNgamma, PWM and TNFalpha, however, there was no expression in peripheral blood mononuclear cells (PBMC-I) stimulated with PHA, IL-2, PMA, ionomycin, IL-4 and TNFalpha. Expression was low in SkLu-I lung adenocarcinoma cells, HaCat keratinocyte cell line, CaCO2 colon adenocarcinoma cell line and myelomonocyte.
Table 2 cDNA's source Zimlig2
HL-60 vitD 12, 3, 96 hrs in-house No
HL-60 Ret. Acidl2, 3, 96 hrs in-house No
HL-60 Butyric Acidl2, 3, 96 hrs in-house No
THP-I #2 IFNg 13, 39 hrs in-house No
HT-29 in-house No
Fetal brain in-house Yes
Brain in-house Yes
Spinal cord in-house Yes
Pancreas in-house Yes
Islet in-house Yes
Pituitary in-house Yes
Kidney in-house Yes
Thyroid in-house Yes
Fetal thymus in-house Yes
Prostate SMC in-house No Prostate 0.5- 1.6KB in-house Yes
Prostate > 1.6KB in-house Yes
Fetal liver in-house No
Tonsil in-house Yes
Inflamed tonsil in-house Yes
HaCat in-house Yes
KG-I in-house Maybe
CaCO-2 colon adeno carcinoma in-house Maybe
SKLU- 1 lung adeno carcinoma in-house Yes
REH pre B cell in-house No
RPMI 1788 B-lymphoblast in-house No
HL60 + PMA in-house No
HL60 + PMA in-house No
K562 in-house No
THP-I monocyte in-house No
THP-I monocyte in-house No
U-937 monocytes in-house No
U-937 PMA 12, 36 hrs monocytes in-house No
PBMC-I in-house Yes
PBMC-2 in-house No
CD4+ T helper in-house Yes
CD4+ T helper in-house Yes
CD3+ T cell in-house No
CD19+ B cell in-house No
CD19+ PMA/Iono. B cell in-house No
CD 14+ monocytes in-house No
CD 14+ IFNg/LPS monocytes in-house No
Dendritic Cell in-house No
Dendritic Cell, stimulated in-house No
NK-cell PMA/Ionomycin In-house Yes
Example 5: Expression of Zimlig2 polypeptide
[166] Zimlig2 polypeptide was expressed as a fusion with a C- terminal His tag (CH6) through transient transfection. A 125 mL shaker flask was seeded with 25 mL of 293FT (Invitrogen, cat# R700-07) cells at 1E6 c/mL and were set aside. 500 μL of OptiMEM (Invitrogen, cat# 31985- 070) was placed in each of two 1.5 mL tubes. 33 μL of Lipofectamine 2000 (Invtirogen, cat# 11668- 019 ) was mixed into one of the OptiMEM containing tubes and 25 μg of the Zimlig2 CH6 pExpress4 expression plasmid was placed in the other tube. The tubes were inverted several times and allowed to incubate for 5 minutes at room temperature. The two tubes were then mixed together, inverted several times, and allowed to incubate for 30 minutes at room temperature. The DNA-Lipofectamine 2000 mixture was then added into the 125 mL shaker flask while swirling the cell culture. The flask was then placed in an incubator on a shaker at 37°C, 6% CO2, and shaking at 120 RPM. The culture was harvested 96 hours later for processing.
Example 6: Purification of Zimlig2 polypeptide
[167] The Zimlig2 polypeptide with the C-terminal His tag from Example 5 was purified as follows. After transfection and expression, conditioned media from 293FT cells expressing Zimlig2- CH6 was filtered using a 0.22 μm Steriflip™ filter (Millipore, Cat. No. SCGP00525). Batch purification was accomplished by adding 250 μl of Ni-NTA Superflow beads (Qiagen, cat# 30410), to the -25 mLs of 293FT conditioned media. The media-bead mixture was rocked overnight at 4°C. The beads were spun out of the media at 1000 RPM for 10 minutes in a Beckman GS6R centrifuge. The beads were washed with 1 mL cell lysis buffer (15OmM Sodium Chloride, 50 mM Tris pH 8.0, and 1% NP-40). The beads were then suspended in 500 μl cell lysis buffer and submitted for N- terminal sequencing.
Example 7: Native Leader Processing
[168] Native leader processing was used to determine the sequence of the amino terminus of the processed protein. A 40 μl slurry of purified Zimlig2 protein, linked C-terminally by a GS linker to a His tag, on Ni NTA beads in PBS was processed as follows. The PBS buffer was pipetted off the Ni NTA beads and then reducing SDS PAGE buffer was added while heating in a boiling water bath. This was run on a SDS PAGE gradient gel. The gel was transferred to a PVDF membrane and stained with coomassie blue. The result was two visible bands, an upper band at approximately 15kDa and a lower band at approximately 9kDa. Each band was excised and subjected to N-terminal protein sequencing. Each band was collected and treated with cyanogen bromide to liberate any post methionine sequence and subjected to N-terminal protein sequencing again. Capture on Ni-NTA beads implied that the C-terminus was intact.
[169] The upper band (at approximately 15 kDa) showed the mature experimental start to be at residue 32 of SEQ ID NO:2. Cyanogen bromide treatment of this band liberated a sequence beginning at residue 91 of SEQ ID NO:2, which is post methionine. No post methionine sequence was liberated at residue 38 of SEQ ID NO:2. This shows that this methionine was completely sequenced through in the initial run, and that no pre-residue 38 N-terminally blocked form of the protein was detectable. [170] The lower band (at approximately 9 kDa) appeared N-terminally ragged around residue 61 of SEQ ID NO:2. Cyanogen bromide treatment of this band liberated sequence at residue 91 of SEQ ID NO:2, which is post methionine, at a level much stronger than that of the initial ragged starts. This showed that a majority of this band was N-terminally blocked. In the cyanogen bromide treated sample, the presence of residue 91, and the lack of residue 38, both post methionine residues, showed that the majority of the protein was N-terminally blocked somewhere between residues 38 and 91.
[171] The initial Zimlig2 native leader processing study showed strong evidence of further processing indicating a second lower band species that was N-terminally blocked. Upon further investigation of the N-terminal ragged start of the lower band, a possible furan cleavage site N- terminal to the glutamine at residue 71 of SEQ ID NO:2 was identified. In a follow-up study, pyroglutamate amino peptidase (PGAP) was added prior to electrophoresis to investigate whether this furan cleavage site was N-terminally blocked by conversion to pyroglutamic acid.
[172] A 40 μl slurry of purified tagged Zimlig2 protein, linked C-terminally by a GS linker to a His tag, on Ni NTA beads in PBS was processed. The PBS buffer was pipetted off of and PGAP enzyme (1 mU) in Ix PGAP buffer was added to the beads. This reaction was run for 15 minutes at 95°C. Enzymatic treatment was followed by addition of reducing SDS PAGE buffer, heating in a boiling water bath, and running on a SDS PAGE gradient gel. The gel was transferred to a PVDF membrane and stained with coomassie blue. The result was three visible bands with apparent SDS PAGE molecular weights of 15kDa, 1OkDa, and 9kDa. Each band was excised and subjected to N- terminal protein sequencing.
[173] The 15kDa band confirmed the previously determined upper band mature beginning at residue 32 of SEQ ID NO:2. The 1OkDa band confirmed the previously determined lower band sequence beginning at residue 61 of SEQ ID NO:2. The 9kDa band showed a second lower band sequence starting at residue 72 of SEQ ID NO:2. By the addition of PGAP to remove the n-terminally blocked residue 71 of SEQ ID NO:2, this follow-up study confirmed that the mature Zimlig2 protein is further processed to a truncated form of Zimlig2 protein starting with a glutamine at residue 71 of SEQ ID NO:2.
Example 8: Disease model analysis of Zimlig2 activity
[174] Expression of murine Zimlig2 mRNA was determined by quantitative real-time PCR in murine models of disease and in non-diseased control tissue. Tissues were obtained from the following murine models of disease: Colitis, Asthma, Experimental Allergic Encephalomyelitis (EAE), Psoriasis and Collagen Induced Arthritis (CIA). Animal models were run following standard procedures and included appropriate non-diseased controls. Tissue Collection and RNA isolation
[175] RNA was isolated from all tissues using standard procedures. In brief, tissues were collected and immediately frozen in liquid N2 and then transferred to -800C until processing. For processing, tissues were placed in Qiazol reagent (Qiagen, Valencia, CA) and RNA was isolated using the Qiagen Rneasy kit according to manufacturer's recommendations. Expression of murine Zimlig2 mRNA was measured with multiplex real-time quantitative RT-PCR method (TaqMan) and the ABI PRISM 7900 sequence detection system (PE Applied Biosystems). Zimlig2 mRNA levels were normalized to the expression of the murine hypoxanthine guanine phosphoribosyl transferase mRNA and determined by the comparative threshold cycle method (User Bulletin 2; PE Applied Biosystems). The primer and probe sequences for murine Zimlig2 are: forward primer, (5'- GGCTGGCTCTGCTCCTTCT-3', SEQ ID NO: 11), reverse primer (5'- CGTTTCTGGAGCATCTTCTTGAG-3', SEQ ID NO: 12), and probe (5'- TGTTTCCACTTATGCCATCTGGACCCA-3', SEQ ID NO: 13).
Colitis Model
[176] Mice are given dextran sodium sulfate (DSS) as a wt/vol (%) solution in the drinking water, 2 - 5% depending upon the mouse strain being studied. DSS colitis studies are designed as acute, recovery or chronic protocols. Mice in acute colitis studies receive DSS in their drinking water for a period of 5-7 days, and are then euthanized. Mice in recovery colitis studies receive DSS in their drinking water for 5-7 days and are then placed back on normal drinking water for a period 2-5 days and are then euthanized. Mice in chronic colitis studies are given DSS in drinking water for 5-7 days, allowed to recover 95-100% of their pre-study body weight while on regular water (usually 12 - 18 days), after which they are placed on DSS again for a total of 3 cycles.
[177] Before, or during this time, the mice are treated with test article Zimlig2. Zimlig2 may be administered either by intravenous (IV), subcutaneous (SC), intramuscular (IM) or intraperitoneal (IP.) injection. In some studies the test article may be delivered by mini-osmotic pump. Alternatively, the Zimlig2 gene may be adenovirally administered. Blood sampling may occur during study depending on study protocol.
[178] Disease Activity Index (DAI) scores are determined for colitis as a cumulative score of body weight loss, stool consistency and hemocult determination (blood in feces). Body Weight Score: a score of 0 for no body weight loss; a score of 1 for 0-5% bodyweight loss; a score of 2 for 5- 10% body weight loss; a score of 3 for 10-15% body weight loss, and a score of 4 for more than 15% body weight loss. Stool Consistency Score: a score of 0 if normal; a score of 2 if stool is soft; a score of 4 if diarrhea is present. Hemocult Score: a score of 0 if normal; a score of 2 if no visible blood is present in feces or anus, but hemocult slide is positive; a score of 4 if visible blood is observed in feces. [179] In a protocol similar to the colitis model described above, tissues (distal colon, proximal colon, and mesenteric lymph node) were harvested for analysis at the end of the study. Analysis of Zimlig2 mRNA expression in the colon and mesenteric lymph nodes indicated that Zimlig2 did not appear to be expressed at high levels compared to the internal house-keeping gene. There appeared to be a slight decrease in the level of Zimlig2 mRNA expression in the proximal and distal colon in DSS-treated mice compared to water fed control animals. Zimlig2 was highly expressed in hind foot. The expression of Zimlig2 in the mesenteric lymph nodes did not differ between mice treated with DSS or water.
Asthma Model
[180] There are a variety of ways to induce a model of asthma in mice. The mouse is sensitized to an antigen (usually ovalbumin) with or without adjuvant (usually alum), and then challenged at a later date one or more times with the same antigen. At some time, a treatment protein or adenovirally-delivered gene may be administered. The routes, timings and numbers of sensitizations, challenges, and treatments may vary with each study depending on the expected action of the protein being tested. (Zhang et al., Am. J. respire. Crit. Care. Med. 155:661-669. 1997).
[181] On days 0 and 5 mice are inoculated with 10 μg ovalbumin (OVA) in 50% alum, LP. in a volume of 100 μl. On day 12 the mice are challenged with either 20 μg OVA intranasally (i.n.) in 50 μl volume or 50 μl of PBS; the mice are under anaesthesia and in dorsal recumbancy. Alternatively, unanaesthetised and unrestrained mice may be challenged by 30 min to 1 h exposure to either aerosolized OVA or PBS in the morning and afternoon of the same day. Evans blue dye (1.25%, 50 μl in sterile saline) may be administered intravenously (i.v.) in restrained mice. On day 14, the mice are sacrificed.
[182] Before, or during this time, the mice are treated with test article Zimlig2. Zimlig2 may be administered either by intravenous (IV), subcutaneous (SC), intramuscular (IM) or intraperitoneal (IP.) injection. In some studies the test article may be delivered by mini-osmotic pump. Alternatively, the Zimlig2 gene may be adenovirally administered. Blood sampling may occur during study depending on study protocol.
[183] At the end of each experiment, airway responsiveness of unanesthetized animals is assessed using a single-chamber, whole-body plethysmograph (Buxco Electronics Inc., Troy, New York, USA) (Hamelmann E. et al., Am. J. Respir. Crit. Care Med. 156:766-775. 1997). In this system, an unrestrained and spontaneously breathing mouse is placed into the main chamber of the plethysmograph, and pressure differences between this chamber and a reference chamber are recorded. The box pressure signal is caused by volume and resultant changes in pressure during the respiratory cycle of the animal. A low-pass filter in the wall of the main chamber allows thermal compensation. From these box pressure signals, the phases of the respiratory cycle, tidal volumes, and the enhanced pause (Penh) can be calculated. Penh is a dimensionless value that represents a function of the proportion of maximal expiratory to maximal inspiratory box pressure signals and a function of the timing of expiration. It correlates closely with pulmonary resistance. Penh was used as a measure of airway responsiveness to allergen and methacholine (MCh), a non-specific bronchoconstrictive stimulant that is used to assess lung function in human patients. Whole-body plethysmography has several potential advantages compared to invasive means for measuring lung resistance: it is technically less demanding, allows measurements of airway responsiveness to aerosolized stimulants, and can be used for repeated, long-term measurement of AR for the evaluation of kinetics and treatment protocols.
[184] Bronchoalveolar lavage (BAL) fluid is collected post-mortem to assess mucus production, cytokine content and to perform differential cell counts for eosinophils, neutrophils, macrophages, and lymphocytes. Blood is drawn by retro-orbital bleeds under isofluorane anesthesia in amounts no greater than 1% of the animal's body weight within a two-week period, or at the time of sacrifice for serum. Serum is used to assess circulating levels of cytokines and allergen-specific IgE.
[185] In a protocol similar to the asthma model described above, tissues (lung, spleen, and lymph node) were harvested for analysis at the end of the study. Expression of Zimlig2 mRNA in the lung, the lung-draining lymph node and spleen of OVA-sensitized and challenged mice was measured. These data showed that Zimlig2 appeared to be expressed at lower levels in the lung and spleen of antigen-sensitized animals compared to the control mice. Levels in the lung-draining lymph node did not appear to differ between OVA and PBS challenged animals.
Experimental Allergic Encephalomyelitis (EAE) Model
[186] EAE represents a mouse model of multiple sclerosis and is induced in mice by immunization with a T helper peptide epitope derived from rat myelin oligodendrocyte glycoprotein, MOG 33-55 in adjuvant. Briefly, mice are shaved on two sites on their flank and immunized subcutaneously with lOOug rat MOG35-55 (MEVGWYRSPFSRVVHLYRNGK) emulsified in RIBI adjuvant on day 0. On day 2 mice are injected intravenously with 200ng pertussis toxin (List Biologicals, Campbell, CA) in a volume of 200ul to perturb the blood-brain barrier. This immunization protocol results in self-reactive T cells that can enter the central nervous system and initiate inflammation resulting in progressive paralysis.
[187] Before, or during this time, the mice are treated with test article Zimlig2. Zimlig2 may be administered either by intravenous (IV), subcutaneous (SC), intramuscular (IM) or intraperitoneal (IP.) injection. In some studies the test article may be delivered by mini-osmotic pump. Alternatively, the Zimlig2 gene may be adenovirally administered. Blood sampling may occur during study depending on study protocol. [188] In a protocol similar to the EAE model described above, tissues (brain, lymph node, and spinal cord) were harvested for analysis at the end of the study. Mice tested in methods similar to those described above showed increased expression of Zimlig2 in the spinal cord with increased disease severity. However, there appeared to be no significant difference in expression of Zimlig2 in brain or lymph nodes with disease severity.
Psoriasis Model
[189] Adoptive transfer of naive T cells into minor histocompatibility mismatched or syngeneic immunocompromised mice leads to development of colitis (Leach M.W. et al., J. Exp. Med. 190(7):995-1003. 1999) as well as skin lesions resembling psoriasis (Schon M.P. et al., Nature Medicine £(4):366-372, 2002; Davenport CM. et al., International Immunopharmacology 2:653-672, 2002). Transplantation of as few as 0.2 million CD4+CD45RBW T cells from B10.D2 mice into immunocompromised CB- 17 SCID mice followed by an intraperitoneal injection of staphylococcal enterotoxin B (SEB) (10 μg) results in weight loss, hemoccult positive stool and development of skin lesions. These symptoms normally arise in mice between 7-10 weeks after transplantation. SEB or LPS/IL-12 is given to accelerate the model in "cleaner" mouse facilities.
[190] Psoriasis is induced by adoptive transfer of CD4+CD25- naϊve T cells, isolated by magnetic bead separation from the spleen and lymph nodes of B10.D2 (H-2d), into minor histocompatability mismatched or synergeneic mice. Immunocompromised CB- 17 SCID mice (H2d) are injected intravenously with 0.5 million enriched CD4+CD25- T cells on day 0. On day 1, all mice receiving the cells are injected with lOug staphylococcal enterotoxin B (SEB, Sigma) in lOOul volume via i.p injection.
[191] Recipient mice are evaluated twice a week for 7-10 weeks for weight loss and presence of skin lesions. Disease Activity Index (DAI) scores are determined for psoriasis. A score of 0 is given for normal skin, 1 for mild lesions on the neck, 2, for severe lesions on the neck and mild lesions on the trunk, and 3 for severe lesions on the neck and the trunk (throughout the body).
[192] Before, or during this time, the mice are treated with test article Zimlig2. Zimlig2 may be administered either by intravenous (IV), subcutaneous (SC), intramuscular (IM) or intraperitoneal (IP.) injection. In some studies the test article may be delivered by mini-osmotic pump. Alternatively, the Zimlig2 gene may be adenovirally administered. Blood sampling may occur during study depending on study protocol.
[193] In a protocol similar to the psoriasis model described above, skin was harvested for analysis at the end of the study. Analysis of Zimlig2 mRNA levels in the skin of diseased and non- diseased mice was assessed. Data suggested that Zimlig2 mRNA levels decrease when skin becomes diseased. Collagen Induced Arthritis (CIA) Model
[194] The CIA model is a well-described model in mice that depends on the initiation of an immune response against the self antigen, collagen that results in the induction of an inflammatory cascade that results in disease. This complex chain of events cannot readily be duplicated in vitro, and the model is an important tool in the evaluation of potential new therapeutics for immune or inflammatory diseases. (Hegen et al., J. Exp. Med. 197: 1297-1302, 2003)
[195] The mice are injected subcutaneously at the base of the tail on day 0 with a homogenate consisting of Complete Freund's Adjuvant (CFA) and Type II collagen (50- 100ml, prepared as 2mg/ml of collagen). On day 21, a second injection of collagen is given in Incomplete Freund's Adjuvant (IFA). Typically, clinical symptoms of arthritis (red, swollen paws or digits) are seen within 1-2 weeks of the second collagen injection, but the disease course is variable, and may take up to 4 weeks to develop. Qualitative clinical scores (scale 0-3) are calculated using measurements of paw thickness. Paw evaluations begin following the second collagen injection, and paws were scored daily thereafter.
[196] Before, or during this time, the mice are treated with test article Zimlig2. Zimlig2 may be administered either by intravenous (IV), subcutaneous (SC), intramuscular (IM) or intraperitoneal (IP.) injection. In some studies the test article may be delivered by mini-osmotic pump. Alternatively, the Zimlig2 gene may be adenovirally administered. Blood sampling may occur during study depending on study protocol.
[197] Tissues (including foot and lymph node) were harvested for analysis at the end of the study. Tissues from mice tested in methods similar to those described above were collected and analysis of Zimlig2 mRNA expression was performed.
[198] In a protocol similar to the CIA model described above, Zimlig2 appeared to be highly expressed in normal tissues. In addition, the expression of Zimlig2 in the footpad decreased with increasing disease severity. The level of expression of Zimlig2 in the draining lymph node was approximately 50 fold lower than that found in the footpad (but was similar to the levels observed in most of the other tissues we have tested) and did not change significantly with increasing disease severity. Example 9: T-cell Proliferation is Enhanced in Zimlig2 Transgenic Mice
[199] Lines of transgenic animals carrying a Zimlig2 transgene under the control of the Eμ enhancer and lck proximal promoter were generated in a protocol similar to Iritani et al. (EMBO J. J_6(23):7019-7031 , 1997). Spleens were collected from transgenic animals and from age and sex matched non-transgenic controls. Single cell suspensions of splenocytes were prepared by physical dissociation of the spleens followed by red blood cell lysis. One hundred thousand to two hundred thousand splenocytes per well were transferred to round bottomed 96 well plates and stimulated with anti-CD3 and anti-CD28 (final concentration 50ng/ml and 1 μg/ml respectively). Stimulations were set up in triplicate. After 48 hours in culture cells were pulsed with H-thymidine (lμCi/ml final concentration). Proliferation was measured by overnight incorporation of 3H-thymidine.
[200] Progeny from two independently generated lines of Zimlig2 transgenic animals described above exhibited elevated proliferative responses when splenocyte suspensions were stimulated with antibodies to CD3 and CD28. Other mitogenic responses in these splenocytes were near normal in these animals. This data suggested that the exposure of lymphocytes to Zimlig2 yields a population of cells capable of mounting an exagerated T cell proliferative response under certain stimulatory conditions. Specifically, this data showed that exposure of lymphocytes to Zimlig2 yields a population of cells capable of mounting an exaggerated T-cell proliferative response when stimulated with antibodies to CD3 and CD28.
Example 10: Overexpression of Zimlig2 Induces Elevated Secretion of Gamma Interferon
[201] Conditioned media (CM) from cultured splenocytes from Zimlig2 transgenic animals (Eulck promoter) and wild type controls were evaluated for release of cytokines in a Rodent Multi- Analyte Profile Screening Panel (Rules Based Medicine, Inc. 3300 Duval Rd. # 110, Austin TX 78759) that includes sixty cytokines and cell-associated proteins. Gamma interferon levels were also assayed by ELISA using a mouse IFN-γELISA using, cat # 88-7314-22 from eBioscience (6042 Cornerstone Court West, San Diego, CA 92121, USA). Two transgenic lines were evaluated, one high expressing and the other low expressing. Splenocytes were plated at 100-200,000 cells/well and stimulated with anti-CD3 and anti Cd28 . Following a 48 hour incubation, cells were pulsed overnight with 3H thymidine to measure proliferation. CM was collected from matched wells and evaluated for cytokine release and T-cell proliferation. Results are shown in Table 3. Table 3
Figure imgf000057_0001
Figure imgf000057_0002
Figure imgf000057_0003
Figure imgf000057_0004
samples with the same number were pooled to provide sufficient volume
[202] Only the cultured T cell conditioned media from the high expressing animals, 4 Nl and 1 N2, had elevated cytokine levels, especially gamma interferon (approximately 6 times higher than the wild type controls). Serum collected from all of the animals (both wild type and transgenic) were also screened for analytes and nothing out of the normal range was observed. All of the high expressing animals and some of the low expressing transgenic animals exhibited increased T cell proliferation. Example 11: Human and murineZimlig2 Expression Profiling of Cell lines
Zimlig2 Expression Profiling of cell lines using TaqMan RT-PCR
[203] Cell Cultures: Cells were grown in appropriate media (recommended by the supplier) in 37°C incubator until they were 80%- 90% confluent in 75 cm2 tissue culture flasks.
1. Cells grown in monolayer: These cells were either collected as cell pellets by trypsinizing prior to the lysis step. Or cells were lysed directly in the flask by aspirating the medium, adding lysis buffer (supplied in the QIAGEN kit) and then scraping the cells.
2. Cells grown in suspension: Appropriate number of cells were pelleted down by centrifuging for 5 minutes at 300 x g. Media was aspirated carefully and cells were disrupted with lysis buffer.
[204] Total RNA was purified from the cell lines using QIAGEN® RNeasy Mini or Midi kit (Cat # 74104, #75142) following the protocol supplied by the manufacturer.
[205] The RNAs were then DNAsed using DNA-free reagents (Ambion, Inc, Austin, TX) according to the manufacturer's instructions. The RNAs were quantitated by three independent measurements on a spectrophometer, and the quality of the RNA was assessed by running an aliquot on an Agilent Bioanalyzer. Presence of contaminating genomic DNA was assessed by a PCR assay on an aliquot of the RNA with zc41011 (5'CTCTCCATCCTTATCTTTCATCAACS '; SEQ ID NO: 18) and zc41012 (5'CTCTCTGCTGGCTAAACAAAACACS ' ; SEQ ID NO: 19), primers that amplify a single site of intergenic genomic DNA. The PCR conditions for the contaminating genomic DNA assay were as follows: 2.5ul 1OX buffer and 0.5ul Advantage 2 cDNA polymerase mix (BD Biosciences Clontech, Palo Alto, CA), 2ul 2.5mM dNTP mix (APPLIED BIOSYSTEMS®, Foster City, CA), 2.5ul 1OX Rediload (Invitrogen, Carlsbad, CA), and 0.5ul 2OuM zc41011 and zc41012, in a final volume of 25 ul. Cycling parameters were 94oC 20", 40 cycles of 94oC 20" 60oC 1 '20" and one cycle of 72oC 7'. lOul of each reaction was subjected to agarose gel electrophoresis and gels were examined for presence of a PCR product from contaminating genomic DNA. If contaminating genomic DNA was observed, the total RNA was DNAsed again, then retested as described above.
[206] Because DNA and RNA have very similar chemical properties, it is almost impossible to isolate RNA without some DNA contamination. DNase treatment was performed using Superase-In DNase-free kit (Ambion), following manufacturer's instructions.
[207] Quality of the RNA samples were determined on HP-Bioanalyzer, using eukaryotic total RNA nano protocol from the assays menu. For quantity determination, absorbances at 260nm are read and using the following formula, concentrations are determined: Quantity of sample X = OD26o * DF * 40ng/μl; DF= I/dilution; and 1 unit of 260 reading = 40ng/μl. Expression analysis
[208] Zimlig2 standard curve preparation: For murine Zimlig2 standards, we used universal murine RNA at 200, 100 and 50ng/ul concentrations. Since Zimlig2 expression is very high in thyroid, total RNA was isolated from thyroid used for human Zimlig2 standard curve preparation. Dilutions were prepared in DEPC treated water at 200, 100 and 50ng/ul.
[209] Primer and the probe sets were designed for both human and murine Zimlig2. As an endogenous control, human glucuronidase (GUS) expression was tested. Primer and probe set for GUS were available in-house. The Human Zimlig2 primers used were as follows: Sense: 5'- TCAAAAACGAGAAGCACCTGTTC-3' (SEQ ID NO:20); Antisense: 5'-
CAGGCTGCCAAGGAATTCTT-3'; (SEQ ID NO:21) and Probe: 5'- AGACTAAAGTGGCCGTTGATGAGAATAAAGCC-3' (SEQ ID NO:22). The Murine Zimlig2 primers used were as follows: Sense: 5'-GGCTGGCTCTGCTCCTTCT-S ' (SEQ ID NO:23); Antisense: 5'-CGTTTCTGGAGCATCTTCTTGAG-S ' (SEQ ID NO:24); and Probe: 5'- TGTTTCCACTTATGCCATCTGGACCCA-3' (SEQ ID NO: 25).
[210] RNA samples were thawed in ice and then diluted to 50ng/ul in RNase-free water (Invitrogen, Cat# 750023). Diluted RNA samples were kept in ice until use.
[211] TAQMAN® EZ RT-PCR Core reagents (APPLIED BIOSYSTEMS®, Cat# N808- 0236) was used to prepare master mixes for Zimlig2(human or murine) and GUS (human or murine) (See Table 4 below).
Table 4 human (or murine) Zimlig2 Master Mix:
Component Volume/Tube Final
(μL) Concentration
Rnase-free water 9.73 -
5x TaqMan EZ Buffer 5 Ix
25 mM Manganese acetate 3 3 mM lO mM deoxyATP 0.75 300 μM lO mM deoxyCTP 0.75 300 μM lO mM deoxyGTP 0.75 300 μM
20 mM deoxyUTP 0.75 600 μM
Forward Primer: huZimlig2 1 80O nM
(20pMoles/λ)
Reverse Primer: huZimlig2 (20pMoles/ 1 80O nM λ)
Probe: huZimlig2 (FAM/NFQ) 0.025 10O nM
(lOOpMoles/λ)
AmpErase UNG 0.25 0.01 U/μL τTth DNA Polymerase 1 0.1 U/μL
Total 24 -
human (or murine) GUS Master Mix:
Component Volume/Tube Final
(μL) Concentration
Rnase-free water 11.48 -
5x TaqMan EZ Buffer 5 Ix
25 mM Manganese acetate 3 3 mM lO mM deoxyATP 0.75 300 μM lO mM deoxyCTP 0.75 300 μM lO mM deoxyGTP 0.75 300 μM
20 mM deoxyUTP 0.75 600 μM
Forward Primer: huGUS (20pMoles/ λ) 0.125 10O nM
Reverse Primer: huGUS (20pMoles/ λ) 0.125 10O nM
Probe: huGUS (FAM/TAM) 0.025 10O nM
(lOOpMoles/ λ)
AmpErase UNG 0.25 0.01 U/μL τTth DNA Polymerase 1 0.1 U/μL
Total 24 -
[212] To assay samples in triplicate, 3.5μl of each RNA sample and controls were aliquoted into optical tube strips (APPLIED BIOSYSTEMS®, Cat# 4316567). For positive control, human testes standard curve dilutions were used. For negative control, 3.5μl of RNase-free water (no template control) was used. Then 84 μl of PCR multiplex master mix added and mixed well by pipetting. [213] MICRO AMP® Optical 96-well plate (APPLIED BIOSYSTEMS®, Cat# N801 -0560) was placed on ice and 25μl of RNA/master mix was added in triplicates to the appropriate wells. Then optical adhesive cover (APPLIED BIOSYSTEMS®, Cat# 4311971) was applied to the plate surface with the applicator and then the plate was spun for two minutes at 3000rpm in the QIAGEN® Sigma 4-15 centrifuge. A compression pad (APPLIED BIOSYSTEMS®, Cat# 4312639) was put on top of the plate.
[214] Sequence detector was launched and it was set to real time PCR. Fluorochromes were set to FAM® (5' fluorescence reporter of choice for human Zimlig2, murine Zimlig2), FAM®/TAMRA® (5 'fluorescence reporter / 3' quencher for human GUS) and to VIC® (5' fluorescence reporter of choice for murine GUS). Plate template was set indicating where standards and where the unknowns were. Thermocycling conditions were: hold-1 at 50 0C for 2 minutes, hold-2 at 60 0C for 30 minutes, hold-3 at 95 0C for 5 min, and 40 cycles at 94 0C for 20 seconds, and 60 0C for 1 minute. After the experiment was over, data analysis was performed according to the manufacturer's user bulletin #2.
[215] Expression for each sample was reported as a Ct (threshold cycle number) value. The Ct value is the point at which the fluorochrome level or RT-PCR product (a direct reflection of RNA abundance) was amplified to a level, which exceeded the threshold or background level. The lower the Ct value, the higher the expression level was: RT-PCR of a highly expressing sample results in a greater accumulation of fluorochrome/product which crosses the threshold sooner. A Ct value of 40 means that there is no product measured and should result in a mean expression value of zero. For each sample being tested, Ct values for Zimlig2 and housekeeping gene (GUS, glucuronidase) was determined. Zimlig2 expression levels are represented in Table 5 below as percent ratio to GUS, which was calculated by the following formula: Percent Ratio to GUS = (2"Ct of G01 / 2" Ct OΪHKG) * 100. Where GOI was the Gene of Interest, (Zimlig2); and where HKG was House Keeping Gene (GUS). The results are shown in Table 5 below.
Table 5
Primary Human RNA TaqMan RT-PCR Results: Results are respresented as % of GUS
Figure imgf000062_0001
[216] The Zimlig2 expression levels are ranked in Table 5 from highest to lowest in the thirty eight cell lines evaluated. The highest expression, 26.9% of GUS, was detected in normal human articular chondrocytes. Additional cells with high levels of Zimlig2 expression were normal human neural progenitor cells (15.5% of GUS), and smooth muscle cells derived from spleen (4.2% of GUS). Human mammary epithelial cells and aortic adventitial fibroblasts expressed Zimlig2 at 1.5 and 1.2% respectively. The remaining cell types expressed Zimlig2 at below 1% of GUS. Renal proximal tubule epithelial cells expressed Zimlig2 at 0.8% of GUS. Bronchial smooth muscle cells, bladder epithelial cells, skeletal muscle cells and retinal pericytes all expressed Zimlig2 at 0.4-0.3% of GUS. Cholera toxin activated small airway epithelial cells, umbilical artery smooth muscle cells, prostate epithelial cells, lung fibroblasts, and renal epithelial cells all expressed Zimlig2 at between 0.13 and 0.075% of GUS. Coronary artery smooth muscle cells, bronchial epithelial cells, pulmonary artery smooth muscle cells, aortic smooth muscle cells and bladder smooth muscle cells all expressed Zimlig2 at between 0.62 and 0.48% of GUS. Cardiac stromal cells, hepatic vein smooth muscle cells, umbilical vein endothelial cells, renal cortex epithelial cells, small airway epithelial cells, renal vein smooth muscle, and iliac artery endothelial cells all express Zimlig2 at between 0.04 and 0.023% of GUS. Prostate smooth muscle, umbilical artery smooth muscle, prostate stromal, bronchial epithelial cells, pulmonary artery endothelial cells and coronary artery endothelial cells express Zimlig2 at between 0.02 and 0.008%. Renal epithelial cells, ureter smooth muscle cells, and aortic endothelial cells all express Zimlig2 at between 0.006 and 0.002% of GUS. No Zimlig2 expression was detected in renal artery smoth muscle cells or in umbilical artery endothelial cells. Zimlig2 was primarily expressed in the CD3+ T cell populations.
Further Analysis
[217] CD4+ and CD8+ fractions of T cells from two donors, C2 and E12, were treated with CD3/CD28 or PHA/lonomycin to induce proliferation. The results are shown in table 6 below.
Table 6
Primary Human RNA TaqMan RT-PCR Results: Results are respresented as % of GUS cell line info Zimlig2
C2 CD4+ T CELL T=O 25.867
C2 CD4+ T CELL T=4H UNSTIM 15.457
C2 CD4+ T CELL T=4H ACD3ACD28 4.227
C2 CD4+ T CELL T=4H P+I 1.571
C2 CD4+ T CELL T= 12H UNSTIM 1.154
C2 CD4+ T CELL T= 1 2H ACD3ACD28 0.753
C2 CD4+ T CELL T= 1 2H P+I 0.390
C2 CD4+ T CELL T=24H UNSTIM 0.341
C2 CD4+ T CELL T=24H ACD3ACD28 0.289
C2 CD4+ T CELL T=24H P+I 0.251
C2 CD8+ T CELL T=4H UNSTIM 0.130
C2 CD8+ T CELL T=4H ACD3ACD28 0.125
C2 CD8+ T CELL T=4H P+I 0.104
C2 CD8+ T CELL T= 1 2H UNSTIM 0.095
C2 CD8+ T CELL T= 1 2H ACD3ACD28 0.075
C2 CD8+ T CELL T= 1 2H P+I 0.062
C2 CD8+ T CELL T=24H UNSTIM 0.061
C2 CD8+ T CELL T=24H ACD3ACD28 0.058
C2 CD8+ T CELL T=24H P+I 0.049
E 1 2 CD4+T 3H UNSTIM 0.048
E 1 2 CD4+T 3H ACD3 0.040
E 1 2 CD4+T 3H ACD3ACD28 0.040
E 1 2 CD4+T 24H ACD3ACD28 0.032
E 1 2 CD4+T 48H ACD3ACD28 0.028
E 1 2 CD8+T T=0 0.026
E 1 2 CD8+T 3H UNSTIM 0.023
E 1 2 CD8+T 3H ACD3 0.023
E 1 2 CD8+T 3H ACD3ACD28 0.022
E 1 2 CD8+T 24H ACD3ACD28 0.020
C2 CD4+ T CELL T=O 0.015
C2 CD4+ T CELL T=4H UNSTIM 0.009
C2 CD4+ T CELL T=4H ACD3ACD28 0.008
C2 CD4+ T CELL T=4H P+I 0.008
C2 CD4+ T CELL T= 1 2H UNSTIM 0.006
C2 CD4+ T CELL T= 1 2H ACD3ACD28 0.004
C2 CD4+ T CELL T= 1 2H P+I 0.002
C2 CD4+ T CELL T=24H UNSTIM 0.000
C2 CD4+ T CELL T=24H ACD3ACD28 0.000
[218] In all instances, Zimlig2 expression was reduced in the CD4+ and CD8+ cells that were activated. Zimlig2 expression was highest in the resting, unstimulated cells. Zimlig2 expression in resting CD4+ and CD8+ T cells is about 25% of GUS. Expression drops to about 5% following activity with CD3/CD28, and to about 2.5% following Phytohaemagglutinin (PHA) and Ionomycin (P+I) treatment.
Example 12: Leukocvte/Endothelial Cell Adherence
Cell Culture
[219] Human umbilicial vein endothelial cells (HEC) and bovine aortic endothelial cells (BEC) are prepared by collagenase treatment of vessels as described in (Wall, R. T. et al., J. Cell. Physiol. 96:203-213, 1978; and Schwartz, S. M., In Vitro. 14:966-980, 1978.). All cell lines are maintained in endotoxin- free RPMI 1640 medium (M. A. Bioproducts, Walkersville, MD) supplemented with 20% FCS and heparin (90 mg/ml) and endothelial cell growth factor as described in Thronton et al. (Thornton et al., Science (Wash. DC) 222:623-625, 1983.). Endothelial cell growth factor is prepared from bovine hypothalamus as described by Maciag et al. (Maciag, T. et al., Proc. Natl. Acad. Sci. USA 76:5674-5678, 1979.). HEC and BEC are harvested with 0.05% trypsin and 0.02% EDTA in HBSS (Gibco Laboratories, Gibco Div., Chagrin Falls, OH) without calcium magnesium (HBSS-). The cells are then plated in 11-mm-daim wells in 48-well plats (Cluster 3548; Costar, Data Packaging Corp., Cambridge, MA) at 5 x 104 cells/well in RPMI 1640 with 20% FCS. Visually confluent monolayers are formed after overnight incubation.
Leukocyte Isolation and Labeling
[220] Peripheral blood from healthy donors is obtained by venipuncture and collected in syringes containing heparin, 10 U/ml. Leukocytes are isolated by Ficoll-Hypaque density gradient centrifugation followed by 3% dextran sedimentation and hypotonic saline lysis of erythrocyte (Bδyum, A., Scand. J. Clin. Lab. Invest. 2_l{97):77-79, 1968). Leukocytes for adherence experiments are suspended in PBS and labeled with 51Cr as sodium chromate (New England Nuclear, Boston, MA) 1 μCi/106 cells for 60 min at 37°C (Gallin, J.I., R. A. Clark, and H. R. Kimball. 1973. J. Immunol. 110:233-240.). After labeling, the cells are washed three times in PBS.
Adherence Assay
[221] The purified 51Cr-labeled leukocytes are suspended in endotoxin- free RPMI 1640 medium with 5% FCS at a concentration of 2 x 106 cells/ml (FCS prevents nonspecific detachment of endothelial cell monolayers from the tissue culture plastic). The cells are then treated with medium (control) or Zimlig2 (O. lng to lug/ml) at 37 0C in a 5% CO2 incubator for 4 hours or overnight. As a positive control, some wells are treated with TNF alpha at 10ng/ml. Following the Zimlig2 incubation, the 48-well HEC or BEC plate is decanted and fresh medium is added: RPMI 1640 with 5% FCS with or without varying concentrations of Zimlig2 (O. lng- lug/ml). Then, 200 μl of the neutrophil suspension is added to each well followed immediately by 50 μl of medium (control), PMA (final concentration 100 ng/ml), A23187 (final concentration 10"5 M), or FMLP (final concentration 10"5 M). Plates are incubated for 30 min at 37°C in a 5% CO2 incubator. Non-adherent leukocytes are removed with two well volume exchanges of PBS with 5% FCS. Adherent leukocytes are lysed with 1 N NH4OH. The lysates are then counted in a gamma spectrophotomerter (Micromedic ME Plus, Micromedic Systems Inc., Horsham, PA). Leukocyte adherence is calculated for each well and expressed as a percentage of the 51Cr counts that remain adhered to the endothelial monolayer: % adherence = (51Cr cpm in lysate)/total 51Cr cpm added) x 100.
[222] Total 51Cr cpm added is determined by counting 200-μl samples of the leukocyte suspension. The results are confirmed qualitatively by microscopic analysis. In experiments using unlabeled cells, results are quantified by counting adherent leukocytes in photomicrographs and by assaying for myeloperoxidase (MPO) activity as described by Lundquist and Josefsson (Lundquist, L, and J-O Josefsson. Anal. Biochem. 41 :567-577. 1971.).
Example 13: U937 Monocyte Adhesion to Transformed Bone Marrow Endothelial Cell (TRBMEC) Monolayer
[223] Transformed Bone Marrow Endothelial Cells (TRBMEC) are seeded in 96-well tissue clusters (Falcon) at a density of 25,000/well in medium Ml 31 (Cascade Biologies) supplemented with Microvascular Growth Supplement (MVGS) (Cascade Biologies). At confluence (24 hours later), cells are switched to M 199 (Gibco-Life Technologies) supplemented with 1% Fetal Bovine Serum (Hyclone). Human recombinant Zimlig2 (test reagent) is added at various concentrations (from 1 ng/mL to 1 μg/mL), to test for the effect of the protein on immune cell-endothelial cell interactions resulting in adhesion. Some wells receive 0.3ng/ml Tumor Necrosis Factor (TNFalpha R&D Systems), a known pro-inflammatory cytokine, in addition to Zimlig2, to test an effect of the protein on endothelial cells under inflammatory conditions. TNFalpha at 0.3ng/ml alone is used as positive control and the concentration used represents approximately 70% of the maximal TNFalpha effect in this system, i.e., it does not induce maximal adherence of U937 cells (a human monocyte-like cell line) to the endothelium. For this reason, this setup can detect both upregulation and downregulation of the TNFalpha effects. Basal levels of adhesion both with and without TNFalpha are used as baseline to assess effect of test reagents.
[224] After overnight incubation of the endothelial cells with the test reagents (Zimlig2 ± TNFalpha), U937 cells, stained with 5μM Calcein-AM fluorescent marker (Molecular Probes), the cells are suspended in RPMI 1640 (no phenol-red) supplemented with 1% FBS and plated at 100,000 cells/well on the rinsed TRBMEC monolayer. Fluorescence levels at excitation/emission wavelengths of 485/538nm (Molecular Devices micro-plate reader, CytoFluor application) are measured 30 minutes later, before and after rinsing the well three times with warm RPMI 1640 (no phenol-red), to remove non-adherent U937. Pre -rinse (total) and post-rinse (adherence- specific) fluorescence levels are used to determine percent adherence (net adherent/net total x 100 = % adherence).
[225] Zimlig2 may heighten monocyte or macrophage adhesion to a site of proinflammatory activity. Activated monocytes and macrophages are important in many inflammatory diseases. Therefore Zimlig2 antagonists may be useful to inhibit monocyte/macrophage adhesion.. As such Zimlig2 antagonists may be useful for treating lung diseases, vascular diseases, autoimmunity, tumor metastasis, disease involving allergic reactions, wound healing and diseases of the skin including contact, allergic or non-allergic dermatistic or psoriasis and inflammatory bowel disease.
Example 14: Effects of Zimlig2 Protein Therapeutics on Tumor Growth and Metastasis
Subcutaneous Implantation of Tumors
[226] Prior to injection of tumor cells, the animal's flanks are shaved. Tumor cells are prepared using sterile technique. They are suspended in phosphate buffered saline at a concentration up to 107 cell/ml, and up to 0.1 ml is injected subcutaneously into the flank region of mice.
[227] Certain cell lines are dependent on continuous estrogen exposure for growth. Several research groups have used subcutaneous implantation of estrogen-containing pellets to enable study of such tumors. For estrogen responsive tumors, 60-day release estrogen pellets (17-beta-estradiol, 0.72 mg/pellet) are implanted subcutaneously.
[228] General health of the mice is assessed daily, and body condition score monitored. Moribund mice are euthanized. Tumor size is monitored at least 3 times weekly. Mice may be bled during the study.
Intravenous Injection of Tumors
[229] In another method, tumor cells are injected intravenously in order to simulate metastasis of cells. With each new model (cell line) carried out in this manner, a pilot study is carried out to determine the number of cells to be injected in order to achieve interpretable experimental results without development of moribund signs in mice prior to the scheduled endpoint (10 - 20 days). Tumor cells are prepared using sterile technique, suspended in phosphate buffered saline and up to 5 x 106 cells are injected in the tail vein in a volume not to exceed 0.1 ml.
[230] General health of the mice is assessed daily, and the body condition score is monitored. Moribund mice are euthanized. Mice may be bled during the study. Intraperitoneal Injection of Tumors
[231] In another method, tumor cells are injected intraperitoneally in order to simulate metastasis or peritoneal growth of cells. As with IV injection, a pilot study is carried out for each new cell line used in this way. Growth of the tumor is monitored by increase in body weight, abdominal distension and health status of the animal.
[232] General health of the mice is assessed daily, and the body condition score is monitored. Moribund mice are euthanized. Mice may be bled during the study.
Tumor immunization
[233] In some cases, mice may be injected with non- viable (irradiated) tumor cells prior to live cell injection. The purpose for this is to initiate a host immune response before tumor challenge as described above. Non- viable tumor cells are injected, with or without adjuvant, subcutaneously in a volume of 100 μl.
Injection of CFSE-labeled splenocytes to tumor bearing mice
[234] Spleen cells derived from syngeneic mice are labeled with the intracellular fluorescent dye Carboxyfluorescein diacetate succinimidyl ester (CFSE, Molecular Probes) using standard labeling protocol. The cells are prepared from donor mice in the same facility as the host mice. All procedures including CFSE labeling are performed under sterile conditions within the animal facility or within a tissue culture facility under sterile conditions and with pathogen-free reagents. Splenocytes are prepared for injection to mice in a suspension of physiological buffer such as PBS at a concentration of approximately 107 cells/mL. Recipient mice are injected intravenously via the tail vein with no greater than 0.15 mL of the suspension.
[235] In some studies it is necessary to transiently deplete mice of specific cell populations in order for tumors to develop or to determine mechanism of drug action. This is accomplished by treatment with an antibody or other reagent designed to specifically deplete the cell population. For example: NK cells may be depleted using a (rabbit anti-bovine) polyclonal antibody directed to NK cell marker GM-I; Granulocytes may be depleted using a monocolonal antibody directed to cell marker GR-I; or Macrophages may be depleted using clodronate formulated in liposomes.
Treatment with Zimlig2
[236] Purified Zimlig2 is administered by the IV, SC, or IP route. The dosing schedule is determined for each individual experiment.
[237] Tumor cells are injected by the intravenous, subcutaneous, or intraperitoneal route in a volume of approximately 0.1 ml. For immunization, non- viable tumor cells are injected subcutaneously, with or without adjuvant, in a volume of 0.1 mL. [238] Splenocytes are prepared for injection to mice in a suspension of physiological buffer such as PBS at a concentration of approximately 107 cells/mL. Recipient mice are injected intravenously via the tail vein with no greater than 0.15 mL of the suspension.
[239] Tumor killing and/or tumor rejection is measured by a reduction in tumor size and/or an improvement of the general health or body condition of the mice.
Example 15: Addition of Zimlig2 Enhances T-cell Proliferation in Human Peripheral Blood Mononuclear Cells
[240] Soluble human Zimlig2 protein enhances T cell proliferation as measured by incorporation of [3 H] -thymidine.
[241] Peripheral Blood Mononuclear Cells (PBMCs) are isolated from whole blood by standard Ficoll/Hypaque separation, which separates the red blood cells from the PBMCs. Once isolated, one hundred and fifty thousand cells per well are transferred to round bottomed 96 well plates and stimulated with anti-CD3 and anti-CD28 at a final concentration 3 ng/ml and 1 Dg/ml respectively. To such cultures, soluble Zimlig2 protein is added in a relevant dose curve range, beginning at 4 μg/ml. As a control, a non-related protein produced in an equivalent fashion is also tested at equal molar ratio. Stimulations are set up in triplicate. After 72 hours in culture, cells are pulsed with [3 H] -thymidine (l DCi/ml final concentration). Proliferation is measured by overnight incorporation of 3H-thymidine by harvesting cells on GF/c Unifilter plates and measuring cpm (counts per minute) on the TopCount® instrument. Results demonstrate increased cpm in the cultures that receive Zimlig2 over the non-related control protein corresponding to increases in T cell proliferation.
Example 16: Preparation of Cells expressing mouse Zimlig2 or VEGFA into SW620, SW480 or CT- 26 tumor cells
Cloning of mouse Zimlig2
[242] A Zimlig2 polypeptide of the present invention is PCR amplified out from a template using the Advantage 2 PCR Kit (BD Biosciences). Amplification conditions are: 94 0C x 1 min, [94 0C x 15 sec, 68 0C x 1 min] x 30, 70 0C x 5 min, and held at 4 0C. Following amplification, reactions are cleaned up using Qiagen PCR Purification Kit according to manufacturers' instructions. Double digest with EcoRI and BamHI in NEB Buffer #2 is performed on amplified fragments. After digestion, samples are run out on a 1% agarose gel, correct bands are excised and purified with Qiagen Gel Purification Kit per mfg. instructions. Ligation reactions are set up for each vector and insert using T4 DNA Ligase (Promega). Following over night incubation at 14 0C, 1 μl ligation mixture is transformed into electrocompetent TOPlO E. CoIi (Invitrogen) using a standard electroporation protocol. Cloning of mouse VEGFA
[243] An aliquot of a vector containing the full-length murine VEGFA (164) with flanking 5' Fsel and 3' Ascl sites is generated. Fsel and Ascl restriction digests are performed on the vector in NEB Buffer #4. After digestion, samples are run out on a 1% agarose gel, correct bands are excised and purified with Qiagen Gel Purification Kit per manufacturers' instructions. Ligation reactions are set up for each vector using T4 DNA Ligase. Following over night incubation at 14 0C, 1 μl ligation mixture is transformed into electrocompetent TOPlO E. CoIi (Invitrogen) using a standard electroporation protocol. The following day colonies are submitted for sequencing.
Cell Culture
[244] CT26 mouse colon carcinoma (ATCC, Manassas, Virginia), SW480 human colorectal adenocarcinoma (ATCC, Manassas, Virginia), and SW620 human colorectal adenocarcinoma— lymph node metastatic site (ATCC, Manassas, Virginia) cultures are obtained from in-house stocks and expanded according to ATCC protocol. 293FT cells (SV40 T-antigen expressing) are obtained from in-house stocks and expanded in DMEM, 10% FBS, IX GlutaMax (Invitrogen) according to ATCC protocol.
Viral Production
[245] For viral production, 293FT cells are plated in 6-well standard tissue culture plates at a density of 700,000 cells per well and allowed to attach overnight. Transient transfections are set up using FuGene-6 (Roche) according to manufacturer's, protocol at a 3: 1 FuGene:DNA ratio. 3 μg DNA is transfected per well consisting of 1 μg retroviral vector construct, 1 μg pVPack gag-pol, and 1 μg pVPack vsvg (Stratagene). The next day the medium is replaced with 1 mL fresh medium and cells are examined for GFP expression by fluorescent microscopy. The following day, retroviral supernatant is collected, filtered through a 0.45 μm syringe filter and immediately used for transduction or frozen at -80 0C.
Retroviral-Mediated Transduction of Tumor Cell Lines
[246] CT26 cells are plated in 6-well plates at a density of 80,000 per well and allowed to attach overnight. SW620 and SW480 cells are plated in 6-well plates at a density of 100,000 cells per well and allowed to attach overnight. Culture medium is aspirated and replaced with either a 1:2 or 1 : 10 dilution of above-produced retroviral supernatant containing 4 μg/mL polybrene (Sigma) from 100OX stock. Infection is allowed to proceed overnight. The next day cells are examined for GFP expression and are split 1 :3 with one subset placed on puromycin selection at 20 μg/mL for CT26 cells and 1 μg/mL for SW620 and SW480. Analysis of Stable GFP Expression
[247] Initial analysis of stable GFP -producing cells is performed using fluorescence microscopy using an appropriate filter for GFP detection. Subsequent analysis is performed by flow cytometry on a FACSCaliber instrument with CellQuest software (BD Biosciences). Briefly, after 7 days of expansion, cells are harvested by trypsin, washed 2X with PBS, and flow cytometry is performed. FLl intensity is compared between transduced cells and parentals.
Analysis ofZimlig2 and VEGFA Expression
[248] ELISA' s are performed on 72-hour conditioned medium from the Zimlig2 polypeptide and VEGFA stable producing cell lines with appropriate controls using standard ELISA procedures. VEGFA capture antibody is NF-493 (R&D Systems) and detection antibody is BAF-493 (R&D Systems). Mouse VEGFA from in-house cytokine bank (Lot# RQ018111) is used as a standard. For the Zimlig2 polypeptide, capture antibody is used and detection antibody is freshly biotinylated with EZ-Link sulfoNHS-LC-Biotin (Pierce). ELISA's were read on a SpectraMax instrument and analyzed with SOFTMax Pro.
Method for detecting human a Zimlig2 Polypeptide Detection ELISA in Conditioned Media
[249] The Zimlig2 polypeptide capture antibody is diluted to 250ng/ml in ELISA A buffer. The, the plate is coated with the antibody (lOOul/well in Nunc 96-well ELISA plates) and the plates are sealed and incubated overnight at 4oC. The plates are washed with 250ul/well 3X in ELISA C buffer, then blocked with ELISA-B (ELISA-C + 2% BSA), 200ul/well and incubated for 15min at RT, after which the plates are flicked to empty. The plates are washed again with 250ul/well 3X in ELISA C buffer.
[250] Standard curve dilutions are prepared using the Zimlig2 polypeptide. When measuring the Zimlig2 polypeptide levels in conditioned medias (CMs), samples are usually tested as is, plus with couple serial dilution points. If the sample volume is limited then the starting dilution is made at lowest possible point (1 : 1 or 1 :2, etc) since protein level is not known. The standard curve and the dilutions of the samples are made in the culture media at the following concentrations: 30.0000 ng/ml (1 :3); 10.0000 ng/ml (1 :3); 3.3333 ng/ml (1 :3); 1.1111 ng/ml (1 :3); 0.3704 ng/ml (1 :3); 0.1235 ng/ml (1:3); 0.0412 ng/ml (1 :3); 0.0137 ng/ml (1 :3); 0.0046 ng/ml (1 :3); 0.0015 ng/ml (1 :3); 0.0005 ng/ml (1 :3); and diluent only.
[251] The samples and the standards (100ul/well) are added to the plate and incubate on a plate shaker for 1.5 hours at 37°C, then washed 3X in ELISA C buffer, 250ul/well. The the Zimlig2 polypeptide detection antibody is freshly biotinylated by adding 2.5ug of antibody for each plate (for 2 plates= 3.79uL of antibody), IuL of lmg/ml Biotin (EZ-Link sulfoNHS-LC-Biotin, PIERCE) per ug of antibody (for 2 plates= 5uL) is added, and incubated at room temperature for 45 minute (mixing at low speed). The biotinylation reaction is stopped by adding 5OuL of 2M glycine, and the volume is brought to desired amount with ELISA B ( for 2 plates = 20ml). The biotinylated Zimlig2 detection antibody is used at a concentration of 250ng/ml. One hundred uL/well is added and the plates are incubated for 1.5hr, 37°C. The plates are washed 3X in ELISA C, 250ul/well.
[252] SA-HRP is diluted to 1 :3000 in ELISA B and plated at SA-HRP, lOOul/well and incubated for lhr at 37°C. The plates are washed 3X in ELISA C buffer, 250ul/well. and TMB solution is added at 100ul/well. The plates are developed for 3 minutes at RT, on the bench. Color development is stopped by plating BioFX 450 Stop reagent, 100ul/well, and read at OD at 450nm, within 15 minutes of stop.
Preparation of Cells for in vivo Use
[253] Stably-transduced CT26 cells are expanded, trypsinized, washed 2X with PBS, passed through a 40 μm cell strainer, counted by trypan blue exclusion, and diluted to a concentration of 2 million cells per mL. These are placed on ice prior to inoculation in mice.
[254] Stably-transduced SW620 and SW480 cells are expanded, trypsinized, washed 2X with PBS, passed through a 40 μm cell strainer, counted by trypan blue exclusion, and diluted to a concentration of 10 million cells per mL. These are placed on ice prior to inoculation in mice.
Injection of transfected cells into mouse tumor model
[255] Pooled SW620, SW480 and CT-26 tumor cells transfected with retrovirus carrying the Zimlig2 polypeptide + GFP, VEGFA+GFP, or GFP alone are tested in this study. Treatment groups are injected with an inoculum of 0.5X106 cells for the SW620 or SW480 cell lines and 0.1X106 cells for the CT-26 cell line as described in Table 7, below. Each animal receives 5OuL solution of cells using a 0.5mL insulin syringe with a 30G needle. The injections are given into the mammary fat pad. Tumor measurements (length and width in mm) are made with a digital caliper and are recorded once the size exceeds 10mm square. Blood is collected for a CBC on all animals prior to beginning the study, on day 7 and at study termination. Animals are euthanized at the discretion of the study monitor as the tumors reach a given size or the tumors are ulcerating the skin. At the time of euthanasia, blood is collected for CBC and serum, tumor tissue collected for RNA analysis (frozen on dry ice) and histology (10%NBF for 24 hrs then into 70% ETOH) and the spleen collected for histology. ELISA assay for the Zimlig2 polypeptide and VEGFA are performed on the serum. RNA from each tumor is isolated and assayed for the Zimlig2 polypeptide and VEGFA expression by Taqman RTPCR. Table 7 Study Groups
Figure imgf000073_0001
Example 17: Generation of transgenic mice expressing murine zimlig2
a). Construct for expressing murine zimlig2 from the murine EμLck promoter /enhancer. [256] In order to investigate the biological function of zimlig2 in vivo, a transgenic (TG) construct was made, in which murine zimlig2 expression was controlled by a murine Lck promoter and immunoglobulin heavy chain enhancer (EμLck). Oligonucleotides were designed to generate a PCR fragment containing a consensus Kozak sequence and the murine zimlig2 open reading frame. These oligonucleotides were designed with an Fsel site at the 5' end and an Ascl site at the 3' end (SEQ ID NO: 6) to facilitate cloning into EμLck, our standard TG vector.
[257] PCR reactions were carried out with about 200 ng murine zimlig2 template and oligonucleotides designed to amplify the full-length open reading frame of murine zimlig2. PCR reaction conditions were determined using methods known in the art. PCR products were separated by agarose gel electrophoresis and purified using a QiaQuick™ (Qiagen) gel extraction kit. The isolated, correct sized DNA fragment was digested with Fsel and Ascl (New England Biolabs), ethanol precipitated and ligated into EμLck, previously digested with Fsel and Ascl. [258] About one microliter of ligation reaction was electroporated into DHlOB ElectroMax
™ competent cells (GIBCO BRL, Gaithersburg, MD) according to manufacturer's directions and plated onto LB plates containing 100 μg/ml ampicillin, and incubated overnight. Colonies were picked and grown in LB media containing 100 μg/ml ampicillin. Miniprep DNA was prepared from the picked colonies and screened for the murine zimlig2 insert by restriction digestion Fsel and Ascl and subsequent agarose gel electrophoresis. The TG construct with correct cDNA inserts were confirmed by sequencing analysis. Maxipreps of the correct zimlig2 were performed.
b) Generation and genotyping of murine EμLck zimlig2 transgenic mice.
[259] A Notl fragment of about 6.95 Kb in length was isolated from the TG vector containing 5' and 3' flanking sequences of the lymphocyte specific EμLck promoter/enhancer, murine zimlig2 cDNA, and the human growth hormone (hGH) poly adenylation signal sequences. [260] The isolated fragment was used for microinjection into fertilized B6C3fl (Taconic,
Germantown, NY) murine oocytes. Microinjection and production of TG mice were produced as described in Hogan, B. et al. Manipulating the Mouse Embryo, 2nd ed., Cold Spring Harbor Laboratory Press, NY, 1994.
c) Genotyping of TG mice.
[261] PCR was utilized to genotype offspring. Primers which anneal and amplify a 368bp region in the hGH poly adenylation region were used to identify TG mice. Primer 18358: GTGGCCATGGAAAGACTTCTCACCTC (SEQ ID NO:26) and primer 18359: TGGGCCTCCCTTGCCCTTTTCTTTTG (SEQ ID NO:27) were used to amplify a 190 bp genomic fragment control for both wt and TG genotypes. This PCR product served as a PCR control. Primer 17251 : TCTGGACGTCCTCCTGCTGGTATAG (SEQ ID NO:28) and primer 17252: GGTATGGAGCAAGGGGCAAGTTGGG (SEQ ID NO:29) were used to amplify a 368 bp fragment from the hGH mini gene. This PCR product confirmed the presence of the TG construct. Primer 17156: GAGTGGCAACTTCCAGGGCCAGGAGAG (SEQ ID NO:30) and primer 17157: CTTTTGCTAGCCTCAACCCTGACTATC (SEQ ID NO:31) were used to amplify a 520 bp fragment containing murine zimlig2 cDNA sequence. This PCR product confirmed the size of the cDNA.
[262] From the foregoing, it will be appreciated that, although specific embodiments of the invention have been described herein for purposes of illustration, various modifications may be made without deviating from the spirit and scope of the invention. Accordingly, the invention is not limited except as by the appended claims.

Claims

CLAIMS What is claimed is:
1. An isolated polypeptide consisting of an amino acid sequence having at least 90% identity to amino acid residues 71 to 148 of SEQ ID NO:2.
2. The isolated polypeptide according to claim 1, wherein the amino acid residues at positions 123, 145, and 148 of SEQ ID NO:2 are tyrosine residues.
3. The isolated polypeptide according to claim 2, wherein the tyrosine residues are sulfated.
4. The isolated polypeptide according to claim 2, wherein the tyrosine residues are phosphated.
5. The isolated polypeptide according to claim 1, wherein the amino acid residue at position 142 of SEQ ID NO:2 is a serine.
6. The isolated polypeptide according to claim 5, wherein the serine has an O- glycosylation.
7. The isolated polypeptide according to claim 5, wherein the serine is linked to a carbohydrate epitope such as Slex (sialyl lewisx oligosaccharide) or another sialyl lewis.
8. The isolated polypeptide according to claim 1, wherein the amino acid at position 71 of SEQ ID NO:2 is a glutamine.
9. The isolated polypeptide according to claim 8, wherein the glutamine is pyroglutamine.
10. The isolated polypeptide according to claim 1, wherein the amino acid residues at positions 123, 145, and 148 of SEQ ID NO:2 are sulfated tyrosine, wherein the amino acid at position 142 of SEQ ID NO:2 is O-glycosylated, and wherein the amino acid at position 71 of SEQ ID NO:2 is a pyroglutamine.
11. The isolated polypeptide according to claim 1 , wherein the isolated polypeptide is covalently linked to an affinity tag or to an immunoglublulin constant region.
12. An isolated polypeptide consisting of amino acid residues 71 to 148 of SEQ ID NO:2.
13. An isolated polypeptide consisting of amino acid residues 32 to 148 of SEQ ID NO:2.
14. An isolated polynucleotide that encodes an isolated polypeptide consisting of an amino acid sequence having at least 90% identity to amino acid residues 71 to 148 of SEQ ID NO:2.
15. An expression vector, comprising the isolated polynucleotide according to claim 14.
16. The expression vector according to claim 15 further comprising a transcription promoter, and a transcription terminator, wherein the promoter, the isolated polynucleotide, and the transcription terminator are operably linked.
17. A recombinant host cell comprising the expression vector of claim 16 wherein the host cell is a bacterium, yeast cell, fungal cell, insect cell, mammalian cell, or plant cell.
18. A method of producing an isolated polypeptide, the method comprising culturing recombinant host cells that comprise the expression vector of claim 16, and that produce the isolated polypeptide, and isolating the isolated polypeptide from the cultured recombinant host cells.
19. A polypeptide produced by the method according to claim 18.
20. An isolated polynucleotide that encodes an isolated polypeptide consisting of amino acid residues 71 to 148 of SEQ ID NO:2.
21. An isolated polynucleotide that encodes an isolated polypeptide consisting of amino acid residues 32 to 148 of SEQ ID NO:2.
22. A method for tumor rejection, comprising increasing the immune response by administering the isolated polypeptide according to claim 1.
23. A method for regulating an immune response, comprising administering the isolated polypeptide according to claim 1 , wherein administration of the polypeptide results in an increase in T cell population.
24. A method for enhancing Leukocyte adhesion to endothelial cells, comprising administering the isolated polypeptide according to claim 1.
25. The method according to claim 24, wherein the isolated polypeptide enhances Leukocyte adhesion to endothelial cells by binding to P-selectin.
26. A method of increasing T cell proliferation, comprising administering the isolated polypeptide according to claim 1.
27. A method for producing an antibody that specifically binds to the isolated polypeptide according to claim 1 comprising the following steps: inoculating an animal with the isolated polypeptide such that the isolated polypeptide elicits an immune response in the animal to produce the antibody, and isolating the antibody from the animal.
28. An antibody produced by the method according to claim 27.
29. A method for regulating an immune response, comprising administering the antibody according to claim 28, wherein administration of the antibody results in a decrease in T cell population.
30. A method of inhibiting or preventing Leukocyte adhesion to endothelial cells, comprising administering the antibody according to claim 28.
31. A method of inhibiting or preventing T cell proliferation, comprising administering the antibody according to claim 28.
PCT/US2007/074509 2006-07-26 2007-07-26 Zimlig2 polynucleotides and polypeptides and methods of use WO2008014410A2 (en)

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US82047306P 2006-07-26 2006-07-26
US60/820,473 2006-07-26
US82890306P 2006-10-10 2006-10-10
US60/828,903 2006-10-10
US91397607P 2007-04-25 2007-04-25
US60/913,976 2007-04-25

Publications (2)

Publication Number Publication Date
WO2008014410A2 true WO2008014410A2 (en) 2008-01-31
WO2008014410A3 WO2008014410A3 (en) 2008-05-02

Family

ID=38982353

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2007/074509 WO2008014410A2 (en) 2006-07-26 2007-07-26 Zimlig2 polynucleotides and polypeptides and methods of use

Country Status (1)

Country Link
WO (1) WO2008014410A2 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2015004248A2 (en) * 2013-07-12 2015-01-15 B.R.A.H.M.S Gmbh Augurin immunoassay

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000012708A2 (en) * 1998-09-01 2000-03-09 Genentech, Inc. Further pro polypeptides and sequences thereof
WO2003091280A1 (en) * 2002-04-26 2003-11-06 Kirin Beer Kabushiki Kaisha Polypeptide having an activity to support proliferation or survival of hematopoietic stem cell or hematopoietic progenitor cell, and dna coding for the same

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000012708A2 (en) * 1998-09-01 2000-03-09 Genentech, Inc. Further pro polypeptides and sequences thereof
WO2003091280A1 (en) * 2002-04-26 2003-11-06 Kirin Beer Kabushiki Kaisha Polypeptide having an activity to support proliferation or survival of hematopoietic stem cell or hematopoietic progenitor cell, and dna coding for the same

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
BI M ET AL: "Homo sapiens esophageal cancer related gene 4 protein (ECRG4) mRNA, complete cds" EMBL, 26 December 2000 (2000-12-26), XP002220992 *
SU TAO ET AL: "Cloning and identification of cDNA fragments related to human esophageal cancer" ZHONGHUA ZHONGLIU ZAZHI, vol. 20, no. 4, July 1998 (1998-07), pages 254-257, XP009096439 ISSN: 0253-3758 *
YUE CHUN-MEI ET AL: "Expression of ECRG4, a novel esophageal cancer-related gene, downregulated by CpG island hypermethylation in human esophageal squamous cell carcinoma." WORLD JOURNAL OF GASTROENTEROLOGY : WJG JUN 2003, vol. 9, no. 6, June 2003 (2003-06), pages 1174-1178, XP002470631 ISSN: 1007-9327 cited in the application *

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2015004248A2 (en) * 2013-07-12 2015-01-15 B.R.A.H.M.S Gmbh Augurin immunoassay
WO2015004248A3 (en) * 2013-07-12 2015-03-19 B.R.A.H.M.S Gmbh Augurin immunoassay
CN105474016A (en) * 2013-07-12 2016-04-06 勃拉姆斯有限公司 Augurin immunoassay
US20160146840A1 (en) * 2013-07-12 2016-05-26 B.R.A.H.M.S Gmbh Augurin immunoassay
JP2016526684A (en) * 2013-07-12 2016-09-05 ベー．エル．アー．ハー．エム．エス ゲゼルシャフト ミット ベシュレンクテル ハフツング Augrin immunoassay
US10024872B2 (en) 2013-07-12 2018-07-17 B.R.A.H.M.S Gmbh Augurin immunoassay

Also Published As

Publication number Publication date
WO2008014410A3 (en) 2008-05-02

Similar Documents

Publication Publication Date Title
JP3577586B2 (en) IL-17 homologous polypeptides and their therapeutic uses
JP2010213705A (en) Fibroblast growth factor-like polypeptide
AU2003240761A1 (en) OX4OR binding agents
JP2002533134A (en) Peptidoglycan recognition protein
JP2003525595A (en) Differentially expressed gene involved in angiogenesis, polypeptide encoded thereby, and method using the same
JP2007014331A (en) Interferon-like molecule and use thereof
US20080260746A1 (en) Erythropoietin Polypeptides and Uses Thereof
EP1364023B1 (en) Gene highly expressed in cartilage tissues
AU6112700A (en) Vgf polypeptides and methods of treating vgf-related disorders
WO2008014410A2 (en) Zimlig2 polynucleotides and polypeptides and methods of use
CA2372805A1 (en) Autotaxin variants and uses to treat diseases of metabolism
CA2471130A1 (en) Il-17 like molecules and uses thereof
JP2023509189A (en) RSPO1 protein and uses thereof
JP2009148256A (en) Secreted epithelial colon stromal-1 polypeptide, nucleic acid encoding the same, and use thereof
EP1325029A2 (en) Secreted proteins and their uses
KR100885545B1 (en) A polypeptide inhibiting RANK, pharmaceutical composition comprising the same, method of inhibiting osteoclast differentiation, a method of treating or preventing a disease caused by differentiation or activation of osteoclast, nucleic acid encoding the polypeptide, vector comprising the nucleic acid and a host cell transformed with the vector
EP1129194B1 (en) Interleukin-1 homolog zil1a4
JP2003505428A (en) VGF selective binding agents and methods of treating VGF-related disorders
AU781882B2 (en) Chordin-like molecules and uses thereof
AU2008201780B2 (en) Fibroblast growth factor-like polypeptides
US6756214B2 (en) Protein zlmda33
EP1330523A2 (en) Mammalian wnt polypeptide-5
JP2003516132A (en) Interleukin-1 receptor antagonist-like molecules and uses thereof
US20060142558A1 (en) Novel proteins and their uses
CA2360577A1 (en) Zlrr3: a human leucine-rich repeat protein

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 07813431

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase in:

Ref country code: DE

NENP Non-entry into the national phase in:

Ref country code: RU

122 Ep: pct application non-entry in european phase

Ref document number: 07813431

Country of ref document: EP

Kind code of ref document: A2