JP2003525595A - Differentially expressed gene involved in angiogenesis, polypeptide encoded thereby, and method using the same - Google Patents

Abstract

  (57) [Summary] The present invention relates to nucleic acid sequences and the polypeptides encoded thereby, which are differentially expressed in angiogenesis. Also provided are methods of stimulating or inhibiting angiogenesis in mammals, including humans. Also provided are polypeptides, agonists or antagonists thereto. In addition, the present invention also provides methods for the diagnosis and treatment of angiogenic disorders, including but not limited to wound healing and cancer.

Description

Detailed Description of the Invention

BACKGROUND OF THE INVENTION Field of the Invention The present invention relates to compositions and methods useful for promoting or inhibiting angiogenesis and / or cardiovascularization in a mammal in need of such biological effects. Regarding This includes diagnosis and treatment of cardiovascular and carcinogenic diseases.

Background Description Heart Disease and Factors About 5 million Americans suffer from heart failure, with about 400,000 new heart failure patients each year. It is the most frequent cause of hospitalization for people over the age of 65 in the United States. Recent advances in the treatment of acute heart disease, including acute myocardial infarction, have resulted in an increasing number of patients who eventually develop chronic heart failure. From 1979 to 1995, the number of hospitalized patients with congestive heart failure (CHF) increased from 377,000 to 872,000 (a 130 percent increase) and CHF deaths increased by 116 percent. CHF is a syndrome characterized by left ventricular dysfunction, decreased exercise testing, poor living standards, and markedly reduced life expectancy. A prerequisite for heart failure is the inability of the heart to pump blood at a rate sufficient to meet the metabolic requirements of body tissues (in other words, lack of cardiac output).

At least four major compensatory mechanisms are activated in the case of heart failure, including peripheral vasoconstriction, increased heart rate, increased cardiac contractility, and increased plasma volume. These effects are mediated primarily by the sympathetic nervous system and the renin-angiotensin system. Eichhor
n, American Journal of Medicine, 104: 163-169 (1998). Increased output from the sympathetic nervous system increases vascular tone, heart rate and contractility. Angiotensin II 1) directly stimulates vascular smooth muscle contraction, 2) promotes plasma volume expansion by stimulating aldosterone and antidiuretic hormone secretion, 3) stimulates sympathetic nerve-mediated vascular tone, and 4) blood vessels. It raises blood pressure by catalyzing the denaturation of bradykinin, which has diastolic and natriuretic activity. Brown and Vaughan, Circulat
ion, 97: 1411-1420 (1998). As described below,
Angiotensin II induces myocyte necrosis (damages systolic function) and intracardiac fibrosis (
It has a direct detrimental effect on the heart by promoting diastole and, in some cases, impairing systolic function. Weber, Circulation, 96: 4065-4082 (1998
).

A common feature of congestive heart failure (CHF) is cardiac hypertrophy, an enlargement of the heart that is activated by both mechanical and hormonal stimulation and adapts the heart to increased cardiac output. Morgan and Baker, Circulation, 83: 13-25 (1991). This hypertrophic response is often accompanied by a variety of other medical conditions such as hypertension, aortic stenosis, myocardial infarction, cardiomyopathy, valvular insufficiency, and intracardiac shunts, all of which are associated with chronic hemodynamic overload. Becomes

Hypertrophy is generally defined as an increase in the size of an organ or structure that does not involve tumor formation and is unrelated to natural growth. Cardiac hypertrophy is due to either an increase in the mass of individual cells (myocytes) or an increase in the number of cells forming the tissue (hyperplasia), or both. The degree of expansion of the fetal heart depends on the increase in the number of myocytes (which lasts shortly after birth), and postnatal cardiac myocytes lose their proliferative capacity. Further growth occurs through hypertrophy of individual cells.

Adult myocyte hypertrophy is initially beneficial as a short-term response to impaired cardiac function by allowing a reduced load on individual muscle fibers. However, under severe and prolonged overload, the hypertrophic cells begin to deteriorate and die. Katz, "Hear
t Failure '': Katz AM, Physiology of the Heart (New York: Raven Press.
1992) pp.638-668. Cardiac hypertrophy is a significant risk factor for both mortality and morbidity in the clinical course of heart failure. Katz, Trends Cardiovasc. Med., 5: 37-44 (
1995). For more details on the causes and conditions of cardiac hypertrophy, see Heart Disease,
A Textbook of Cardiovascular Medicine, Braunwald, E. Ed. (WB Saunders Co.
, 1988), Chapter 14, "Pathophysiology of Heart Failure".

At the cellular level, the heart consists of surrounding supporting cells collectively called non-myocytes, called myocytes. Non-myocytes are primarily fibroblasts / mesenchymal cells, but they also include endothelial and smooth muscle cells. In fact, myocytes form the majority of adult myocardial mass, but they account for only about 30% of the total number of cells present in the heart.
In response to hormonal, physiological, hemodynamic and pathological stimuli, adult ventricular myocytes can adapt to increased work through activation of the hypertrophic process. This response is associated with contractile protein content of individual cardiomyocytes and cell size of myocytes without activation and cell division of fetal genes, including genes for atrial natriuretic peptide (ANP). Characterized by an increase. Chien et al.,
FASEB J., 5: 3037-3046 (1991): Chien et al., Annu. Rev. Physiol., 55: 77-95 (1
993). Increased myocardial mass as a result of increased myocyte size associated with accumulation of interstitial collagen around the intramyocardial coronary artery and in the extracellular matrix has been described in left ventricular hypertrophy following pressure overload in humans . Caspari et al., Cardiovasc. Res
., 11: 554-558 (1977); Schwarz et al., Am. J. Cardiol., 42: 895-903 (1978): Hes.
S. et al., Circulation, 63: 360-371 (1981); Pearlman et al., Lab. Invest., 46: 158-1.
64 (1982).

It has also been suggested that parasecretory factors produced by non-myocyte supporting cells are also involved in the development of cardiac hypertrophy, and are derived from various non-myocyte derived factors such as leukocyte inhibitory factor (LIF) and endothelin. Hypertrophic factors have been identified. Metcalf, Growth Fact
ors, 7: 169-173 (1992); Kurzrock et al., Endocrine Reviews, 12: 208-217 (1991).
Inoue et al., Proc. Natl. Acad. Sci. USA, 86: 2863-2867 (1989); Yanagisawa
Masaki, Trends Pharm. Sci., 10: 374-378 (1989); US Pat. No. 5,573,762 (199
Published November 12, 6). Additional exemplary factors identified as potential mediators of cardiac hypertrophy include cardiotrophin-1 (CT-1) (Pennica et al., Pro.
c. Nat. Acad. Sci. USA, 92: 1142-1146 (1995)), catecholamines, corticosteroids, angiotensin and prostaglandins.

Currently, the treatment of cardiac hypertrophy depends on the underlying heart disease. Factors identified as potential mediators of hypertrophy include catecholamines, corticosteroids, angiotensin, prostaglandins, LIF, endothelin (endothelin-1, -2 and -3, and large endothelin (big). endothelin)) and CT-1. For example, β-adrenergic receptor blocking agents (β-blockers such as propranolol, timolol, tartarolol (t
ertalolol), carteolol, nadolol, betaxolol, penbutolol,
Acetobutolol, atenolol, metoprolol, carvedilol and the like) and verapamil are widely used in the treatment of hypertrophic cardiomyopathy. The beneficial effects of β-blockers on symptoms (chest pain) and exercise tolerance are primarily due to a reduced heart rate with consequent prolonged diastole and increased passive ventricular filling. Thompson et al.
, Br. Heart J., 44: 488-98 (1980); Harrison et al., Circulation, 29: 84-98 (196
Four). Verapamil has been described to improve ventricular filling and possibly reduce myocardial ischemia. Bonow et al., Circulation, 72: 853-64 (1985).

Nifedipine and diltiazem are also sometimes used to treat hypertrophic cardiomyopathy.
Lorell et al., Circulation, 65: 499-507 (1982); Betocchi et al., Am. J. Cardiol., 78.
: 451-457 (1996). However, because of its strong vasodilatory properties, nifedipine can also be harmful, especially for patients with outflow obstruction. Disopyramide has been used to alleviate the symptoms of negative muscle contractility. Pollick, N. Engl.
J. Med., 307: 997-999 (1982). However, in many patients, the initial benefits diminish over time. Wigle et al., Circulation, 92: 1680-1692 (1995). Treatment with antihypertensive drugs has been reported to have beneficial effects on cardiac hypertrophy associated with elevated blood pressure. Examples of drugs used alone or in combination in antihypertensive therapy include calcium antagonists such as nitrendipine; adrenergic receptor blockers such as those listed above; angiotensin converting enzyme (ACE) inhibitors such as quinapril, captopril. , Enalapril, ramipril, benazepril, fosinopril and lisinopril; diuretics such as chlorothiazide, hydrochlorothiazide, hydroflumetazide, methylchlothiazide, benzthiazide, dichlorophenamide, acetazolamide, and thiadazem blocker; and calcium channel blocker. , Nifedipine, verapamil and nicardipine.

For example, treatment of hypertension with diltiazem and captopril has shown a reduction in left ventricular muscle mass, but did not normalize the Doppler index of diastolic function. Szlachcic et al., Am. J. Cardiol., 63: 198-201 (1989); Shahi et al., Lancet, 33.
6: 458-461 (1990). These findings are interpreted to indicate that excessive amounts of interstitial collagen will remain after remission of left ventricular hypertrophy. Rossi et al., Am. Heart J
., 124: 700-709 (1992). Rossi et al., Supra, investigated the effect of captopril on the prevention and regression of cardiomyocyte hypertrophy and interstitial fibrosis in pressure-induced cardiac hypertrophy in experimental rats.

Agents that directly increase cardiac contractility (inotropic agents) were initially thought to be beneficial to patients with heart failure because they improved cardiac output in the short term. However, all positive inotropic agents, with the exception of digoxigenin, have been found to result in increased mortality in the long term despite short-term improvements in cardiac performance. Massie,
Curr. Op. In Cardiology, 12: 209-217 (1997); Reddy et al., Curr. Opin. Cardiol
., 12: 233-241 (1997). Recently, the use of β-adrenergic receptor blockers for heart failure has been supported. Although clinical trial evidence suggests that improved cardiac function can be achieved without increasing mortality, improved patient survival has not yet been demonstrated. Insulin-like growth factor in the treatment of CHF-
See US Pat. Nos. 5,624,806; 5,661,122; 5,610,134; and WO 95/28173 for the use of I and / or growth hormone, or cardiotropin-1 or antagonists thereof. Another treatment modality is heart transplantation, which is limited by the availability of donor hearts.

Endothelin is a vasoconstrictor peptide containing 21 amino acids, isolated and structurally determined from porcine arterial endothelin culture supernatant. Yanagisawa et al., Nat
ure, 332 ,: 411-415 (1988). Later, endothelin was found to exhibit a variety of effects, and endothelin antibodies such as endothelin antagonists have proven to be effective in treating myocardial infarction, renal failure, and other diseases. Endothelin is present in the body and is expected to be an endogenous factor involved in the regulation of the circulatory system in order to exhibit a vasoconstrictor action, and high blood pressure, heart disease such as myocardial infarction,
And renal disease, such as acute renal failure. Endothelin antagonists are described, for example, in US Pat. No. 5,773,414; Japanese Patent Publication No. 3130299/1991, European Patent 457,195; European Patent 460,679; and European Patent 552,489. Novel endothelin B receptors for identifying endothelin receptor antagonists are described in US Pat. No. 5,773,223.

Current treatments for heart failure are primarily directed to the use of angiotensin converting enzyme (ACE) inhibitors such as captopril, and diuretics. These drugs improve hemodynamic properties and exercise tolerance and reduce morbidity and mortality in CHF patients. Kramer et al., Circulation, 67 (4): 807-816 (1983); Captopril Multicent
er Research Group, JACC, 2 (4): 755-763 (1983); The CONSENSUS Trial St
udy Group, N. Engl. J. Med., 316 (23): 1429-1435 (1987); The SOLVD Investi
gators, N. Engl. J. Med., 325 (5): 293-302 (1991). Furthermore, they are useful in the treatment of hypertension, left ventricular dysfunction, atherosclerosis, diabetic nephropathy. Brown and Vaughan, supra. However, despite their proven efficacy, their reactivity to ACE inhibitors is limited. For example, prolonging survival in the case of heart failure, but ACE inhibitors appear to delay progression to end-stage heart failure,
A significant number of patients with CE inhibitors have functional class III heart failure.

Furthermore, the improvement in functional ability and exercise time is slight, and the mortality rate is reduced but remains high. The CONSENSUS Trial Study Group, N. Engl. J. Med., 316 (23):
1429-1453 (1987); The SOLVD Investigators, N. Engl. J. Med., 325 (5): 293-
302 (1991); Cohn et al., N. Engl. J. Med., 325 (5): 303-310 (1991); The Captopri.
l-Digoxin Multicenter Research Group, JAMA, 259 (4): 539-544 (1988). Thus, ACE inhibitors do not appear to be able to alleviate symptoms in over 60% of heart failure patients at all times and reduce heart failure mortality by about 15-20%. See Brown and Vaughan, supra, for additional objectionable effects.

Alternatives to ACE inhibitors are specific AT1 receptor antagonists. Clinical studies are planned to compare the efficacy of the two modalities in the treatment of cardiovascular and renal diseases. However, animal model data show that ACE / A
The ngII pathway is clearly involved in cardiac hypertrophy, suggesting that it is not the only one or even the major pathway active in this role. Components of individual pathways have been tested in a mouse genetic "knockout" model. In one such model, the major cardiac receptor for AngII, A
Tsub1A is genetically deleted; these mice do not express hypertrophy when AngII is experimentally applied (confirming the model's fundamental success in extinguishing hypertrophy secondary to AngII). Yes). However, when the aorta is contracted in these animals, a model of hypertensive cardiac stress, the heart is still hypertrophic. This suggests that another signaling pathway unrelated to this receptor (ATsub1A) is activated in hypertension. Probably
ACE inhibitors would not be able to block these pathways. Harada et al., Ci
rculation, 97: 1952-1959 (1998). See also Homcy, Circulation, 97: 1890-1892 (1998) for mysteries related to the process and mechanism of cardiac hypertrophy.
).

Approximately 750,000 patients suffer from acute myocardial infarction (AMI) each year, and about a quarter of all deaths in the United States are due to AMI. Recently, thrombolytic agents such as streptokinase, urokinase, especially tissue plasminogen activator (t-PA) have significantly increased the survival rate of patients suffering myocardial infarction. When administered as a continuous intravenous infusion for 1.5-4 hours, t-PA opens the coronary artery in 90 minutes in 69% -90% of treated patients. Topol et al., Am. J
Cardiol., 61, 723-728 (1988); Neuhaus et al., J. Am. Coll. Cardiol., 12: 581.
-587 (1988); Neuhaus et al., J. Am. Coll. Cardiol., 14: 1566-1569 (1989). The highest patency rates have been reported with high dose or accelerated medication. Topol, J. Am. Coll.
Cardiol., 15: 922-924 (1990). T-PA may also be administered as a single bolus dose and has a relatively short half-life but is more suitable for infusion therapy. Tebbe et al., Am. J
Cardiol., 64: 448-453 (1989). A t-PA variant, TNKt-PA (T103N, N1) designed to have a particularly long half-life and very high fibrin specificity.
17Q, KHRR (296-299) AAAAt-PA mutant, Keyt et al., Proc. Natl. Acad.
Sci. USA, 91: 3670-3674 (1994)) is particularly suitable for bolus administration. However, despite all these advances, the long-term prognosis of patient survival is
It depends heavily on post-infarction monitoring and treatment of patients, which should include monitoring and treatment of cardiac hypertrophy.

Growth Factors Various naturally occurring polypeptides have been reported to induce endothelial cell proliferation. These polypeptides include basic and acidic fibroblast growth factor (F
GF) (Burgess and Maciag, Annual Rev. Biochem., 58: 575 (1989)), platelet-induced endothelial cell growth factor (PD-ECGF) (Ishikawa et al., Nature, 338: 557 (1989)),
And vascular endothelial growth factor (VEGF). Leung et al., Science, 24
6: 1306 (1989); Ferrara and Henzel, Biochem. Biophys. Res. Commun., 161: 851.
(1989); Tischer et al., Biochem. Biophys. Res. Commun., 165: 1198 (1989); 1996.
Patent No. 471,754 granted on July 31, 2010.

[0019] Capillary endothelial cell proliferation was promoted in media conditioned by cells transfected with human VEGF (hVEGF) cDNA, whereas control cells were not. Leung et al., Science, 246: 1306 (1989). Several additional cDNAs encoding human 121-, 189- and 206-amino acid isoforms of hVEGF (also collectively referred to as hVEGF-related proteins) are human cDNAs.
Have been identified in the library. 121-amino acid protein is hVEG
HVE in that the 44 amino acids between residues 116 and 159 in F are deleted.
Different from GF. The 189-amino acid protein has residue 11 in hVEGF.
It differs from hVEGF by the insertion of 24 amino acids in 6 and is clearly identical to human vascular penetrating factor (hVPF). 206-amino acid protein is hVEGF
Differs from hVEGF by the insertion of a 41 amino acid at residue 116 of Houck
Et al., Mol. Endocrin., 5: 1806 (1991); Ferrara et al., J. Cell. Biochem., 47: 211.
(1991); Ferrara et al., Endocrine Reviews, 13:18 (1992); Keck et al., Science, 246.
: 1309 (1989); Connolly et al., J. Biol. Chem., 264: 20017 (1989); May 1990, 30.
Published European patent No. 370,989.

It is now well established that angiogenesis associated with the formation of new blood vessels from pre-existing endothelium is involved in the pathogenesis of various diseases. These include solid tumors and metastases, atherosclerosis, posterior lens fibroplasia, hemangiomas, chronic inflammation,
Ocular neovascularization syndromes such as proliferative retinopathy, such as diabetic retinopathy, age-related macular degeneration (AMD), neovascular glaucoma, immune rejection of transplanted corneal tissue and other tissues, rheumatoid arthritis, and psoriasis. included. Folkman et al., J. Biol. Chem., 267: 10931-
10934 (1992); Klagsbrun et al., Annu. Rev. Physiol., 53: 217-239 (1991); and Ga.
rner A, "Vascular diseases". Pathobiology of Ocular Disease. A Dynamic
Approach, Garner A. Klintworth GK, eds., 2nd Edition (Marcel Dekker, NY,
1994) 1625-1710.

In the case of tumor growth, angiogenesis appears to be very important in the transition from hyperplasia to neoplasia and in providing nutrients for the growth of solid tumors. Folkman et al., Nat
ure, 339: 58 (1989). Neovascularization allows tumor cells to gain growth advantage and proliferative autonomy compared to normal cells. Thus, a correlation has been found between tumor site microvessel density and patient survival in breast cancer as well as some other tumors. We
idner et al., N. Engl. J. Med. 324: 1-6 (1991); Horak et al., Lancet, 340: 1120-112.
4 (1992); Macchiarini et al., Lancet, 340: 145-146 (1992).

By searching for positive regulators of angiogenesis, aFGF, bFGF, TGF-α, T
Many candidate drugs have been obtained including GF-β, HGF, TNF-α, angiogenin, IL-8 and the like. Folkman et al., JBC, and Klagsbrun et al., Supra. Negative regulators identified to date include thrombospondin (Good et al., Proc. Natl.
Acad. Sci. USA., 87: 6624-6628 (1990)), 16-kilodalton N-terminal fragment of prolactone (Clapp et al., Endocrinology, 133: 1292-1299 (1993)), angiostatin (angiostatin). (O'Reilly et al., Cell, 79: 315-328 (1994)) and endostatin. O'Reilly et al., Cell, 88: 277-285 (1996).

Studies conducted over the last few years have established an important role for VEGF not only in stimulating vascular endothelial cell proliferation, but also in inducing vascular permeability and angiogenesis. Ferrara et al., Endocr. Rev., 18: 4-25 (1997). One VE
The finding that loss of even the GF allele leads to fetal death indicates the irreplaceable role of this factor in vascular development and differentiation. Furthermore, VEG
F has been shown to be a key mediator of neovascularization associated with tumor and intraocular disease. Ferrara et al., Endocr. Rev., listed above. VEGF mRNA is overexpressed in many human tumors examined. Berkman et al., J. Clin. Invest., 91: 153-159 (199
3); Brown et al., Human Pathol., 26: 89-91 (1995); Brown et al., Cancer Res., 53: 4.
727-4735 (1993); Matten et al., Brit. J. Cancer, 73: 931-934 (1996); Dvorak et al.
Am. J. Pathol., 146: 1029-1039 (1995).

Also, the concentration level of VEGF in the ocular fluid is highly correlated with the presence of active proliferation of blood vessels in patients with diabetes and other ischemia-related retinopathy. Aiello etc.
, N. Engl. J. Med., 331: 1480-1487 (1994). Furthermore, according to recent research, AM
It has been shown that VEGF is localized in the choroidal neovascular membrane of patients affected by D. Lopez et al., Invest. Ophthalmol. Vis. Sci., 37: 855-868 (1996
).

Anti-VEGF neutralizing antibodies suppress the growth of various human tumor cell lines in nude mice (Kim et al., Nature, 362: 841-844 (1993); Warren et al., J. Clin. Inves).
t., 95: 1789-1797 (1995); Borgstrom et al., Cancer Res., 56: 4032-4039 (1996);
Melnyk et al., Cancer Res., 56: 921-924 (1996)) and also inhibit intraocular angiogenesis in a model of ischemic retinal disease. Adamis et al., Arch. Ophthalmol., 114: 66-71 (19
96). Therefore, anti-VEGF monoclonal antibodies or other inhibitors of VEGF action have been identified as candidate agents for the treatment of solid tumors and various intraocular neovascular diseases. Such antibodies are described, for example, in EP 817,648 and 19 published on January 14, 1998
It is described in PCT / US 98/06724, filed April 3, 1998.

Can rapidly induce a complex of genes expressed by certain cells,
There are several other growth and mitogens, including transforming oncogenes. Lau and Nathans. Molecular Aspects of Cellular Regulati
on, 6: 165-202 (1991). These genes, termed immediate early genes or early response genes, are transcriptionally activated within minutes after contact with growth or mitogens, independent of de novo protein synthesis. These groups of immediate-early genes encode secretory extracellular proteins that are required to coordinate complex biological processes such as differentiation and proliferation, regeneration, and wound healing. Ryseck et al., Cell Growth Differ.,
2: 235-233 (1991).

Highly related proteins belonging to this group include cef10 (Simmons et al.
, Proc. Natl. Acad. Sci. USA, 86: 1178-1182 (1989)), cyr61 (O'Brien et al., Mol. Cel, which is rapidly activated by serum- or platelet-derived growth factor (PDGF)).
L. Biol., 10: 3569-3577 (1990)), transforming growth factor β (TGF-β).
), It is secreted by human vascular endothelial cells at high levels and exhibits PDGF-like biological and immunological activities, and PDGF is directed to specific cell surface receptors.
Human connective tissue growth factor (CTGF), which competes with Bradham et al., J. Cell. Biol., 114.
: 1285-1294 (1991)), fisp-12 (Ryseck et al., Cell Growth Differ., 2: 235-
233 (1991)), human vascular IBP-like growth factor (VIGF) (WO96 / 17931), and normally quiescent in adult kidney cells and overexpressed in myeloblast-associated-virus type I-induced nephroblastoma. Nov which has been found to be included. Joloit et al., Mol. Cell. B
iol., 12: 10-21 (1992).

Expression of these immediate-early genes acts as a "third messenger" in the cascade of growth factor-induced events. Also, they are believed to be necessary to integrate and coordinate wound healing, where complex biological processes such as differentiation and cell proliferation are normal events. Insulin-like growth factor binding protein (IG
It has been shown that FBPs), in complex with insulin-like growth factor (IGF), stimulate IGF binding to fibroblast and smooth muscle cell surface receptors. Clemmons et al., J. Clin. Invest., 77: 1548 (1986). The inhibitory effects of IGFBPs on various in vitro IGF actions include stimulation of glucose transport by adipocytes, sulphate uptake by chondrocytes, and thymidine uptake in fibroblasts. Zapf et al., J. Clin. Invest., 63: 1077 (1979).
. Furthermore, IGFB in growth factor-mediated mitogen activity in normal cells
The inhibitory effect of P is shown.

Tumor Necrosis Factor Receptors and Ligands Various molecules such as tumor necrosis factor-α (“TNF-α”), tumor necrosis factor-β
("TNF-β" or "lymphotoxin-α"), lymphotoxin-β ("LT
-Β "), CD30 ligand, CD27 ligand, CD40 ligand, OX-4
0 ligand, 4-1BB ligand, Apo-1 ligand (Fas ligand or C
D95 ligand), and Apo-2 ligand (TRAI (TRAI)).
L)) has been identified as a member of the tumor necrosis factor (“TNF”) family of cytokines [eg Gruss and Dower, Blood, 85: 3378-3404 (
1995); Pitti et al., J. Biol. Chem., 271: 12687-12690 (1996); Wiley et al., Immunit.
y, 3: 673-682 (1995); Browning et al., Cell, 72: 847-856 (1993); Armitage et al. Nat.
ure, 357: 80-82 (1992), WO97 / 01633 published on January 16, 1997; WO97 / 25428 published on July 17, 1997].

The induction of various cellular responses by such TNF family cytokines is considered to be initiated by their binding to specific cell receptors. Two different TNF receptors, approximately 55-kDa (TNFR1) and 75-kDa (TNFR2) have been identified [Hohman et al., J. Biol. Chem., 264: 14927-14934 (
1989); Brockhaus et al., Proc. Natl. Acad. Sci., 87: 3127-3131 (1990); 1991 3
EP 417,563 published on 20th March], cD consistent with both receptor morphologies
NA has been identified and characterized [Loester et al., Cell, 61: 351 (1990); Schal.
l et al., Cell, 61: 361 (1990); Smith et al., Science, 248: 1019-1023 (1990); Lewis.
Et al., Proc. Natl. Acad. Sci., 88: 2830-2834 (1991); Goodwin et al., Mol. Cell. Bi.
ol., 11: 3020-3026 (1991)]. A wide variety of polymorphisms have been associated with both TNF receptor genes [see, eg, Takao et al., Immunogenetics, 37: 199-203 (1993)]. Both TNFRs share the canonical structure of cell surface receptors, including extracellular, transmembrane and intracellular regions. The extracellular portions of both receptors are also soluble T
Naturally found as an NF-binding protein [Nophar, Y et al., EMBO J., 9: 3269 (
1990); and Kohno, T. et al., Proc. Natl. Acad. Sci. USA, 87: 8331 (1990)].
More recently, cloning of recombinant soluble TNF receptors has been carried out in Hale (H
ale) et al. [J. Cell. Biochem. Supplement 15F, 1991, p.113 (P424).
].

The extracellular portion of the first and second forms of TNFR (TNFR1 and TNFR2) is N
Starting from the H ₂ terminus, there are four cysteine-rich domains (C
RD) repeated amino acid sequence pattern. Each CRD is approximately 40 amino acids long and contains 4-6 cysteine residues in well-conserved positions [Scha
ll et al., supra; Loetscher et al., supra; Smith et al., supra; Nophar et al., supra; Kohno et al.,
Above]. In TNFR1, the approximate boundaries of the four CRDs are: CRD1-14 to about 53 amino acids; CRD2-about 54 to about 97 amino acids; CRD3-about 98 to about 138 amino acids; CRD4. -Approximately 13
9 to about 167 amino acids. In TNFR2, CRD1 has 17 to about 54 amino acids, CRD2 has about 55 to about 97 amino acids; CRD
3 contains about 98 to about 140 amino acids; CRD4 contains about 141 to about 179 amino acids [Banner et al., Cell, 73: 431-435 (1993)]. Also, the potential role of CRD in ligand binding is described by Banner et al., Supra.

A similar repetitive pattern for CRD is found in the p75 nerve growth factor receptor (NGFR) [
Johnson et al., Cell, 47: 545 (1986); Radeke et al., Nature, 325: 593 (1987)], B cell antigen CD40 [Stamenkovic et al., EMBO J., 8: 1403 (1989)], T cell antigen OX.
40 [Mallet et al., EMBO J., 9: 1063 (1990)] and Fas antigen [Yonehara et al., Supra.
, And Itoh et al., Cell, 66: 233-243 (1991)], and are present in several other cell surface proteins. CRD has also been found in T2 proteins, such as the soluble forms of Shope and myxoma poxvirus TNFR (sTNFR) [Up.
ton et al., Virology, 160: 20-29 (1987); Smith et al., Biochem. Biophys. Res. Commu.
n., 176: 335 (1991); Upton et al., Virology, 184: 370 (1991)]. Optimal alignment of these sequences indicates that the position of cysteine residues is well conserved. These receptors are often collectively referred to as members of the TNF / NGF receptor superfamily. A recent study on p75NGFR showed a deletion of CRD1 [Welcher, AA et al., Proc. Natl. Acad. Sci. USA, 88.
: 159-163 (1991)] or insertion of a 5-amino acid in this domain [Yan. H and Ch.
ao, MV, J. Biol. Chem., 266: 12099-12104 (1991)] has been shown to have little or no effect on NGF binding [Yan. H and Chao, MV, supra. ]. p75NGFR is not involved in NGF binding and contains a proline-rich extension of approximately 60 amino acids between its CRD4 and transmembrane region [Peetre, C et al., Eur. J. Hemat.
ol., 41: 414-419 (1988); Seckinger, P. et al., J. Biol. Chem., 264: 11966-11973 (
1989); Yan. H and Chao, MV, supra]. Similar proline-rich regions are TNFR
Found in 2, but not in TNFR1.

Except for lymphotoxin-α, the TNF family of ligands identified to date are Form II transmembrane proteins whose C-termini are extracellular. In contrast, the TNF receptor (TNFR) family of receptors identified to date are Form I transmembrane proteins. However, in both the TNF ligand and receptor families, the identified homologies between family members are found primarily in the extracellular domain ("ECD"). TN
Some of the TNF family cytokines, including F-α, Apo-1 ligand and CD40 ligand, are proteolytically cleaved at the cell surface; the proteins obtained in each case typically function as soluble cytokines. To form a homotrimeric molecule. In addition, proteins of the TNF receptor family are usually proteolytically cleaved to release the soluble receptor ECD, which may function as an inhibitor of the cognate cytokine. Recently, other members of the TNFR family have been identified. Such newly identified members of TNFR are CAR1, HVEM and osteoprotegerin (OPG) [Brojatsch et al., Cell, 87: 845-855 (
1996); Montgomery et al., Cell, 87: 427-436 (1996); Marsters et al., J. Biol. Chem.,
272: 14029-14032 (1997); Simonet et al., Cell, 89: 309-319 (1997)]. Simonet et al., Supra, report that OPG does not contain a hydrophobic transmembrane-spanning sequence, unlike other well-known TNFR-like molecules. As discussed below, OPG is believed to act like a decoy receptor.

Furthermore, a novel member of the TNF / NGF receptor family has been identified in mice, and the receptor has been named “GITR” for “glucocorticoid-induced tumor necrosis factor receptor family-related genes” [Nocentini et al., Pro
c. Natl. Acad. Sci. USA 94: 6216-6221 (1997)]. The mouse GITR receptor is a 228 amino acid Form I transmembrane protein that is expressed in normal mouse T lymphocytes from the thymus, spleen and lymph nodes. Expression of the mouse GITR receptor is induced in T lymphocytes upon activation with anti-CD3 antibody, ConA or phorbol 12-myristate 13-acetate. The authors believe that the GITR receptor is involved in the regulation of T cell receptor-mediated cell death. In Marsters et al., Curr. Biol., 6: 750 (1996), researchers have shown similarities to the TNFR family in extracellular cysteine-rich repeats, including a cytoplasmic death domain sequence. Discloses a human polypeptide full-length native sequence designated Apo-3, which resembles TNFR1 and CD95 [Marst.
See also ers et al., Curr. Biol., 6: 1669 (1996)]. According to other researchers
Apo-3 is also known as DR3, wsl-1 and TRAMP [Chinnaiyan
Et al., Science, 274: 990 (1996); Kitson et al., Nature, 384: 372 (1996); Bodmer et al.
Immunity, 6:79 (1997)].

Pan et al. Have disclosed another member of the TNF receptor family called “DR4” [Pan et al., Science, 276: 111-113 (1997)]. DR4 was reported to contain an intracellular death domain capable of activating the cell suicide device. Pan et al. Disclose that DR4 is believed to be the receptor for the ligand known as Apo-2 ligand or TRAIL. Sheridan et al., Science, 277: 818-821 (1997) and Pan et al., Scienc.
e, 277: 815-818 (1997) describe other molecules that appear to be receptors for the Apo-2 ligand (TRAIL). This molecule is called DR5 (alternatively it is also called Apo-2). Like DR4, DR5 contains an intracellular death domain and is reported to be capable of signaling apoptosis. In Sheridan et al., DcR1 (or Apo-2DcR)
It is disclosed that the receptor referred to as is a potential decoy receptor of the receptor for Apo-2 ligand (TRAIL). Sheridan et al. Report that DcR1 can suppress Apo-2 ligand function in vitro. See also Pan et al., Supra, for disclosure on a decoy receptor called TRID. For more information on the TNF family of cytokines and their receptors, see Gruss and Dower, supra.

The Need for Further Treatment Given the role of vascular endothelial cell growth and angiogenesis in many diseases and disorders, there is a means to reduce or suppress one or more biological effects resulting from these processes. It is preferable that It is also desirable to have a means of testing for the presence of pathogenic polypeptides in normal and diseased conditions, especially cancer. Moreover, in certain aspects, the identification of factors that can prevent or reduce cardiac myocyte hypertrophy inhibit pathophysiological cardiac growth, as there is no generally applicable treatment for treating cardiac hypertrophy. It is of great importance in the development of new therapeutic strategies for Although there are several therapeutic modalities for various cardiovascular and oncogene disorders, further therapeutic approaches are still needed.

SUMMARY OF THE INVENTION Accordingly, the present invention is directed to compositions and methods for promoting or inhibiting angiogenesis and / or cardiovascularization in a mammal. Applicants have identified a cDNA clone that encodes a novel polypeptide, wherein the polypeptide is referred to by the applicant as "PR
They are referred to as "O364" and "PRO175". These novel proteins have tested positive in various angiogenesis assays that test promotion and inhibition of any biological activity. Therefore, where effects such as treatment for promoting or suppressing angiogenesis, stimulating growth or proliferation of vascular endothelial cells, suppressing tumor growth, suppressing angiogenesis-dependent tissue growth, etc. are desired, the protein is associated with disease It is considered to be a useful drug for diagnosis and / or treatment (including prevention).

[0038] In one embodiment, the invention is combined with a pharmaceutically acceptable carrier to provide PRO3.
Compositions comprising a 64 (hGITR) polypeptide are provided. In another aspect, the invention provides the use of PRO175 (hGITRL or GLI) mixed with a pharmaceutically acceptable carrier.
A composition comprising a TTER) polypeptide is provided. In one aspect, the composition contains a therapeutically effective amount of either or both polypeptides. In another aspect, the composition comprises an additional active ingredient, namely a cardiovascular, endothelial or angiogenic or anti-angiogenic agent, preferably an angiogenic or anti-angiogenic agent. Preferably the composition is sterile. The PRO364 or PRO175 polypeptides can be administered in the form of liquid pharmaceutical preparations, which can be preserved for extended storage stability. Preserved liquid pharmaceutical preparations may contain multiple doses of PRO364 or PRO175 polypeptides and are thus suitable for repeated use.

In a further embodiment, the invention provides such a composition useful in the treatment of cardiovascular, endothelial, and angiogenic disorders, comprising a carrier in admixture with a therapeutically effective amount of a PRO364 or PRO175 polypeptide. A method for preparing the same is provided. In yet a further aspect, the invention provides: (a) such a composition containing a therapeutically effective amount of a PRO364 or PRO175 polypeptide; (b) a container containing the composition; and (c) cardiovascular, endothelium. Or said PRO364 or PR in the treatment of angiogenic diseases
There is provided a pharmaceutical product having a label attached to the container or a package insert contained in the pharmaceutical product, which describes use of the O175 polypeptide. In a still further aspect, the invention provides a method of diagnosing a disease or susceptibility to a disease associated with a mutation in a PRO364 or PRO175 polypeptide nucleic acid sequence: Isolating the encoding nucleic acid sequence; and (b) determining a mutation in the PRO364 or PRO175 polypeptide nucleic acid sequence. In a still further aspect, the invention provides a diagnostic method comprising analyzing the presence of PRO364 or PRO175 polypeptide in a sample derived from a host.

In yet another aspect, the invention provides a method of diagnosing cardiovascular, endothelium, and angiogenic disorders in a mammal, comprising: (a) a test sample of tissue cells obtained from the mammal; ) PRO in control samples of known normal tissue cells of the same cell type
Analyzing the expression level of a gene encoding a 364 or PRO175 polypeptide, wherein a high or low expression level in a test sample indicates the presence of cardiovascular, endothelium, and angiogenic disease in the mammal from which the test tissue was obtained. Regarding the method. In yet another embodiment, the invention relates to a method of treating a cardiovascular, endothelial or angiogenic disorder in a mammal comprising administering to said mammal an effective amount of a PRO364 or PRO175 polypeptide. . Preferably, the disease is cardiac hypertrophy, trauma such as a wound or burn, or a type of cancer. In a further aspect, if the cardiovascular, endothelial, and angiogenic disease is a type of cancer, the mammal is
Further exposure to angioplasty or agents for treating cardiovascular, endothelium, and angiogenic disorders, such as ACE inhibitors, or chemotherapeutic agents. Preferably the mammal is a human, preferably a human at risk of developing cardiac hypertrophy, more preferably a human suffering from myocardial infarction. In another preferred embodiment, cardiac hypertrophy is characterized by the presence of elevated PGF _2α levels. Alternatively, cardiac hypertrophy is induced by myocardial infarction, wherein preferably administration of PRO364 or PRO175 polypeptide is initiated within 48 hours, preferably 24 hours, following myocardial infarction.

In another preferred embodiment, the cardiovascular, endothelial, and angiogenic disorder is cardiac hypertrophy and the PRO364 or PRO175 polypeptide is administered with a cardiovascular, endothelial or angiogenic agent. Preferred cardiovascular, endothelial or angiogenic agents for this purpose are selected from the group consisting of antihypertensive agents, ACE inhibitors, endothelin receptor antagonists and thrombolytic agents. When thrombolytics are administered,
Preferably, PRO364 or PRO175 polypeptides are administered after administration of such agents. More preferably, the thrombolytic agent is recombinant human tissue plasminogen activator. In another preferred embodiment, the cardiovascular, endothelial, and angiogenic disease is cardiac hypertrophy, and the PRO364 or PRO175 polypeptide is administered following primary angioplasty for the treatment of acute myocardial infarction, wherein, preferably, The mammal is further exposed to angioplasty or cardiovascular, endothelial or angiogenic agents. In another preferred embodiment, the cardiovascular, endothelial, and angiogenic disease is cancer and the PRO364 or PRO175 polypeptide is administered in combination with a chemotherapeutic agent, growth inhibitory agent, or cytotoxic agent.

In another embodiment, the invention provides a method of identifying an agonist of PRO364 or PRO175 polypeptide, comprising: (a) the cells and the compound to be screened, PRO364 or PRO175.
Contacting under conditions suitable for stimulating cell proliferation by the method of: (b) measuring cell proliferation to determine if the compound is an effective agonist. (c) The present invention further provides PRO364 or PRO175 identified by the above method.
Provides a polypeptide agonist. In another embodiment, the invention provides a PRO364 or PRO175 polypeptide comprising contacting a candidate compound with a PRO364 or PRO175 polypeptide under conditions and for a time sufficient for the compound to interact with the polypeptide. Methods of identifying compounds that inhibit expression or activity are provided. In a particularly preferred embodiment, either the candidate compound or the PRO364 or PRO175 polypeptide is immobilized on a solid support. In another preferred embodiment, the non-immobilized component carries a detectable label. Preferably, the method comprises: (a) combining the cells and the compound to be screened with PRO364 or PRO175.
Contacted in the presence of the polypeptide under conditions suitable for inducing cell proliferation by the PRO364 or PRO175 polypeptide; (b) measuring induction of cell proliferation to determine whether the compound is an effective antagonist. Including the step of In yet a further embodiment, the invention provides compounds that inhibit the expression or activity of PRO364 or PRO175 polypeptides, eg, compounds identified by the methods described above. In a further embodiment, the invention relates to a method of treating cardiovascular, endothelial, and angiogenic disorders in a mammal comprising administering to the mammal a therapeutically effective amount of an antagonist to PRO364 or PRO175 polypeptides. Preferably, the cardiovascular, endothelial, and angiogenic disease is cardiac hypertrophy, trauma, cancer, or age-related macular degeneration. Also preferably, the mammal is a human and an effective, effective amount of an angiogenesis or angiogenesis inhibitor is administered in combination with an antagonist.

One type of antagonist of PRO364 or 175 polypeptide that inhibits one or more functions or activities of PRO364 or 175 polypeptide is an antibody. Thus, in another aspect, the invention provides an isolated antibody that binds a PRO364 or 175 polypeptide. In addition, the invention provides isolated antibodies that bind to PRO364 or 175 polypeptides. In a preferred embodiment, the antibody is a monoclonal antibody, preferably having non-human complementarity determining region (CDR) residues and human framework region (FR) residues. The antibody may be labeled and may be immobilized on a solid support. In a further aspect, the antibody is an antibody fragment, a single chain antibody, or an anti-antibody.
-It is an idiotype antibody. In another embodiment, the invention exposes cells suspected of containing PRO364 or PRO175 polypeptides to anti-PRO364 or -PRO175 antibodies,
PRO364 or PRO1 comprising measuring binding of said antibody to said cells
Methods for measuring the presence of 75 polypeptides are provided. In a still further embodiment, the invention provides for: (a) contacting a test sample of tissue cells obtained from said mammal with anti-PRO364 or -PRO175 antibody, and (b) anti-PRO364 or -PRO364 in the test sample. -PRO175 antibody and PRO364 or PRO175
Provided is a method of diagnosing cardiovascular, endothelial or angiogenic disease in a mammal comprising detecting complex formation with a polypeptide. It can be qualitatively or quantitatively detected and carried out in comparison to monitoring complex formation in a control sample of known normal tissue cells of the same cell type. The magnitude of the amount of complex formed in the test sample indicates the presence of cardiovascular, endothelial and angiogenic dysfunction in the mammal from which the test tissue cells were obtained. The antibody preferably carries a detectable label. Complex formation can be monitored, for example, by light microscopy, flow cytometry, fluorometry, or other techniques known in the art. Test samples are usually obtained from individuals suspected of having cardiovascular, endothelial, and angiogenic disorders. In a further embodiment, the present invention provides a cancer diagnostic kit comprising anti-PRO364 or -PRO175 antibody and a carrier in a suitable package. Preferably the kit is
Further included is a description of the use of said antibody to detect PRO364 or PRO175 polypeptides. Preferably the carrier is eg a buffer. In a further embodiment, the invention provides an article of manufacture comprising: a container; a label on the container; and a composition comprising anti-PRO-364 or -175 antibody contained within the container, the label on the container. Show that the composition can be used to treat cardiovascular, endothelial, and angiogenic disorders.

In yet another embodiment, the invention provides for PRO364 in a mammal, comprising administering to the mammal a therapeutically effective amount of anti-PRO364 or -PRO175 antibody.
Alternatively, a method of inhibiting angiogenesis induced by a PRO175 polypeptide is provided. Preferably the mammal is a human, more preferably the mammal has a tumor or retinal disease. In yet a further embodiment, the invention provides a cardiovascular, endothelium or endothelium of a mammal suffering from a cardiovascular, endothelial or angiogenic disease, comprising administering to a mammal a gene encoding a PRO364 or PRO175 polypeptide, and Provided are methods of treating angiogenic disorders. In a preferred embodiment the mammal is a human. In another preferred embodiment, the gene is administered via ex vivo gene therapy. In a further preferred embodiment, the gene is contained within a vector, more preferably an adenovirus, adeno-associated virus, lentivirus or retroviral vector. In yet another aspect, the invention consists essentially of a promoter, PRO365 or P.
Provided is a recombinant retroviral particle comprising a retroviral vector comprising a nucleic acid encoding a RO175 polypeptide and a signal sequence for cellular secretion of the polypeptide, wherein the retroviral vector is associated with a retroviral structural protein. Preferably the signal sequence is of mammalian origin, eg native PRO36.
4 or PRO175 polypeptide. In yet a further embodiment, the present invention comprises a nucleic acid construct expressing a retroviral structural protein and also comprises a promoter, PRO364 or PRO1.
75. An ex vivo producer cell also comprising a nucleic acid molecule encoding a 75 polypeptide and a retroviral vector consisting essentially of a signal sequence for cellular secretion of the polypeptide, wherein the producer cell is a Provided is a retroviral vector associated with a structural protein that produces a retroviral particle.

(Detailed Description of the Invention) 1. Definitions The terms "cardiovascular, endothelial, and angiogenic disorders" and "cardiovascular, endothelial, and angiogenic dysfunction" are used interchangeably and refer to systemic disorders that affect blood vessels, such as diabetes mellitus, and blood vessels. , Part of the disease of the arteries, capillaries, veins, and / or lymphatic vessels themselves. This includes signs of stimulating angiogenesis and / or cardiovascularization, as well as signs of inhibiting angiogenesis and / or cardiovascularization. Such diseases include, for example, arterial diseases such as atherosclerosis, hypertension, inflammatory vasculitis, Raynaud's disease and Raynaud's phenomenon, aneurysms, and arterial restenosis; venous and lymphatic vessel diseases such as thrombotic veins. Inflammation, lymphangiitis, and lymphedema; and other vascular diseases such as peripheral vascular disease, cancer, such as hemangiomas, such as hemangiomas (capillary and cavernous), glomus tumor, telangiectasia, bacterial hemangiomatosis, Hemangioendothelioma, hemangiosarcoma, hemangiopericytoma, Kaposi's sarcoma, lymphangioma, and lymphangiosarcoma, tumor angiogenesis, trauma such as wounds, burns, and other damaged tissue, graft fixation, scarring, Includes ischemia-reperfusion injury, rheumatoid arthritis, cerebrovascular disease, kidney disease such as acute renal failure, and osteoporosis. Also included are angina (angina), myocardial infarction, such as acute myocardial infarction, cardiac hypertrophy, and heart failure, such as CHF.

“Hypertrophy” as used herein is defined as an increase in the size of a tissue or structure independent of normal growth that is not involved in tumorigenesis. Hypertrophy of an organ or tissue is due to either an increase in the size of individual cells (true hypertrophy), or an increase in the number of cells forming the tissue (hyperplasia), or both. Certain organs, such as the heart, lose their ability to divide shortly after birth. Thus, "cardiac hypertrophy" is defined as an increase in the size of the heart, and in adults, without concomitant cell division,
It is characterized by a contractile protein content and an increase in myocyte cell size. The characteristics of stress that cause hypertrophy (e.g., increased preload, increased afterload, loss of myocytes similar to those in myocardial infarction, primary contractility decline) are important in determining the nature of the response. It is clear that it plays a role. The early stages of cardiac hypertrophy are usually morphologically characterized by an increase in myofibril and mitochondrial size, and mitochondrial and nuclear expansion. At this stage, the myocytes are larger than normal and the tissue is well preserved. As the phase of cardiac hypertrophy progresses further, the number and size of certain organelles, such as mitochondria, increase preferentially and novel contractile elements are added to localized regions of cells in an irregular manner. Cells that have undergone hypertrophy for many years are in the cell body containing a fairly enlarged nucleus with a highly lobed membrane that replaces adjacent myofibrils and causes disruption of normal Z-membrane registration. Shows a more pronounced division. The term “cardiac hypertrophy” is used to include all stages in the progression of a medical condition, characterized by varying degrees of structural damage to the heart muscle, regardless of the underlying heart disease. Thus, the term also includes physiological conditions in the development of cardiac hypertrophy, such as elevated blood pressure, aortic stenosis, or myocardial infarction.

“Heart failure” refers to an abnormality of cardiac function in which the heart does not pump blood as fast as the demands of metabolizing tissues require. Heart failure can be due to many factors, including ischemia, congenital, rheumatic or idiopathic forms. "Congestive heart failure" (CHF) is the progression of the heart that is unable to provide sufficient cardiac output (the volume of blood pumped by the heart over time) to deliver oxygenated blood to peripheral tissues. It is a medical condition. As CHF progresses, structural and hemodynamic damage occurs. These damages appear in various ways, one characteristic sign of which is ventricular hypertrophy. CHF is a common end result of many heart diseases.

“Myocardial infarction” is commonly accepted to be the result of atherosclerosis of the coronary arteries, often with multiple coronary thrombosis. It can be of two types: intramural infarction with myocardial necrosis over the entire thickness of the ventricular wall, and without the necrosis extending into all the pathways through the ventricular wall to the epicardium, the subendothelial layer, within the myocardial wall, or It can be divided into accessory endocardial (non-intramural) infarcts. Myocardial infarction is known to be due to both altered hemodynamic effects and altered structures in the damaged and healthy areas of the heart. Thus, for example, myocardial infarction reduces the maximum outflow of the heart and the heart beat volume. In addition, in association with myocardial infarction, interstitial DNA synthesis is stimulated, resulting in increased collagen formation in the unaffected heart region.

In long-term hypertension, increased cardiac stress and pressure result in cardiac hypertrophy being associated with long-term “hypertension,” for example, increased total peripheral tolerance. A characteristic of hypertrophied ventricles as a result of chronic pressure is impaired diastolic performance. Fouad et al., J. Am. Coll. Cardiol., 4: 1500-1506 (1984); Smith
Et al., J. Am. Coll. Cardiol., 5: 869-874 (1985). Long-term left ventricular relaxation had premature instinct hypertension despite normal or abnormal systolic function. Hartford et al., Hypertension, 6: 329-338 (1984). However, there is no parallel close proximity between blood pressure levels and cardiac hypertrophy. In humans, improvement of left ventricular function in response to antihypertensive treatment has been reported, but diuretics (hydrochlorothiazide),
Patients treated with beta-blockers (prepanolol) or calcium channel blockers (diltiazem) have a relapse to left ventricular hypertrophy without improved diastolic function. Inouye et al., Am. J. Cardiol., 53: 1583-7 (1984).

Another complex heart disease associated with cardiac hypertrophy is “hypertrophic cardiomyopathy”. The condition is highly diverse in morphological, functional and clinical characteristics (Maron et al., N. Engl. J.
Med., 316: 780-789 (1987); Spirito et al., N. Engl. J. Med., 320: 749-755 (19
89); Louie and Edwards, Prog. Cardiovasc. Dis., 36: 275-308 (1994); Wigle
Et al., Circulation, 92: 1680-1692 (1995)), characterized by heterogeneity highlighted by facts that plague patients of all ages. Spirito et al., N. Engl. J. Med., 336: 77
5-785 (1997). Also, the factors that cause hypertrophic cardiomyopathy are diverse and poorly understood. Generally, mutations in the gene encoding the sarcomeric protein are involved in hypertrophic cardiomyopathy. Recent data suggests that β-myosin heavy chain mutations are estimated to account for approximately 30 to 40 percent of the causes of familial hypertrophic cardiomyopathy. Watkins et al., N. Engl. J. Med., 326: 1108-1114 (1992).
Schwartz et al., Circulation, 91: 532-540 (1995); Marian and Roberts, Circul.
ation, 92: 1336-1347 (1995); Thierfelder et al., Cell, 77: 701-712 (1994); Watk.
ins et al., Nat. Gen., 11: 434-437 (1995). In addition to β-myosin heavy chain, gene mutations at other positions include cardiac troponin T, alpha topomyosin, cardiac myosin binding protein C, essential myosin light chain, and regulatory myosin light chain. See Malik and Watkins, Curr. Opin. Cardiol., 12: 295-302 (1997).

The superior valve “aortic stenosis” is a hereditary vascular disease characterized by narrowing of the ascending aorta, but other arteries, including the pulmonary artery, may also be affected. Untreated aortic stenosis results in increased intracardiac pressure, resulting in cardiac hypertrophy, which in fact leads to heart failure and death. Although the etiology of this disease is not fully understood, hyperplasia and hypertrophy of intermediate smooth muscle are hallmarks of this disease. A molecular variant of the elastin gene has been implicated in the development and pathogenesis of aortic stenosis.
It is reported in U.S. Pat. No. 5,650,282 issued 22nd March. "Heart valve regurgitation" results from heart disease as a result of heart valve disease. Various conditions, such as rheumatic fever, cause contraction or pulling of the valve orifice, while other conditions include endocarditis, inflammation of the endocardium or the membrane inside the atrial orifice, and cardiac surgery. by. Defects, such as valve stenosis or proximity of a valve defect, result in the accumulation of blood in the heart chamber or regurgitation of blood through the valve. Failure to heal the valve stenosis or insufficiency for a long period of time will result in cardiac hypertrophy and myocardial related damage, eventually requiring replacement of the valve. Included in the invention is all of these, and other cardiovascular, endothelial, and angiogenic disorders that may or may not be associated with cardiac hypertrophy.

The terms “cancer”, “cancerous” and “malignant” refer to or describe the physiological condition in mammals that is typically characterized by unregulated cell growth. Examples of cancer include
Included, but not limited to, adenocarcinoma, lymphoma, blastoma, melanoma, sarcoma, and leukemia. More specific examples of such cancers include squamous cell carcinoma,
Small cell lung cancer, non-small cell lung cancer, gastric cancer, Hodgkin and non-Hodgkin lymphoma, pancreatic cancer,
Glioblastoma, cervical cancer, ovarian cancer, liver cancer, eg hepatic carcinoma
And hepatoma, bladder cancer, breast cancer, colorectal cancer, colorectal cancer, endometrial cancer, salivary gland cancer, renal cell carcinoma, Wilms tumor and other renal cancer, basal cell carcinoma, melanoma, prostate cancer, spawning mouth Includes cancer, thyroid cancer, testicular cancer, esophageal cancer, and various types of head and neck cancer. Cancers suitable for treatment herein include breast cancer, colon cancer, lung cancer, melanoma, ovarian cancer and the above-mentioned vascular tumors.

The term “cytotoxic drug” as used herein refers to a substance that inhibits or prevents the function of cells and / or causes destruction of cells. The term refers to radioisotopes (eg, ^{1 31} I, ¹²⁵ I, ⁹⁰ Y and ¹⁸⁶ Re), chemotherapeutic agents, and toxins, such as enzymatically active toxins of bacterial, fungal, plant or animal origin, or fragments thereof. Intended to include. A "chemotherapeutic agent" is a chemical compound useful in the treatment of cancer. Examples of chemotherapeutic agents are alkylating agents, folate antagonists, anti-metabolites of nucleic acid metabolism, antibiotics, pyrimidine analogs, 5-fluorouracil, cisplatin, purine nucleosides,
Included are amines, amino acids, triazole nucleosides, or corticosteroids. Specific examples include adriamycin, doxorubicin, 5-fluorouracil, cytosine arabinoside (“Ara-C”), cyclophosphamide, thiotepa, busulfan, cytoxin, taxol, toxotea, methotrexate, cisplatin, melphalan, vinblastine. , Bleomycin, etoposide, ifosfamide, mitomycin C, mitoxanthone, vincristine, vinorelbine, carboplatin, teniposide, daunomycin, carminomycin, aminopterin, dactinomycin, mitomycin, esperamycin (see U.S. Pat. No. 4,675,187), melphalan and Includes related nitrogen mustards. Also included in this definition are hormonal agents that function to regulate or inhibit hormonal action on tumors such as tamoxifen and onapristone.

“Growth inhibitor” as used herein refers to a compound or composition that inhibits the growth of cells, eg, Wnt-overexpressing cancer cells, in vitro or in vivo. That is, the growth inhibitor significantly reduces the percentage of malignant cells in the S phase. Examples of growth inhibitory agents include agents that block cell cycle progression (at a position other than S phase), such as agents that induce G1 arrest and M phase arrest. Classical M-phase blockers include vincas (vincristine and vinblastine), taxol, and topo II inhibitors such as doxorubicin, daunorubicin, etoposide, and bleomycin. These drugs that arrest G1 also spread to S-phase arrest,
For example, DNA alkylating agents such as tamoxifen, prednisone, dacarbazine, mechlorethamine, cisplatin, methotrexate, 5-fluorouracil and Ara-C. For more information, see The Molecular Basis of Cancer, Me
Ndelsohn and Israel, edited, Chapter 1, Murakami et al. entitled "Cell cycle reg
ulation, oncogenes, and antineoplastic drugs '' (WB Saunders: Philadelphia
, 1995), especially on page 13. Further examples are antibodies capable of inhibiting or neutralizing the angiogenic activity of tumor necrosis factor (TNF), acidic or basic FGF or hepatocyte growth factor (HGF), capable of inhibiting or neutralizing the coagulation activity of tissue factor Antibody, protein C
Alternatively, Protein S (see WO91 / 01753 published on February 21, 1991), or an antibody capable of binding to the HER2 receptor (WO89 / 06692), for example 4D5 antibody (and their functional equivalents) ( Examples include WO92 / 22653).

“Treatment” is intended to prevent the progression or modification of the pathological conditions of cardiovascular, endothelial and angiogenic diseases. The concept of treatment is used in its broadest sense and includes in particular the prevention (prevention), alleviation, reduction and cure of cardiovascular, endothelial and angiogenic diseases of any stage. Thus, “treatment” refers to both curative treatment and prophylactic or preventative measures,
Patients are prevented or delayed in cardiovascular, endothelial and angiogenic disorders such as hypertrophy. Those in need of treatment include those already with the disorder as well as those prone to have the disorder or those in whom the disorder has been prevented. Diseases are idiopathic, cardiotrophic (cardi
otrophic), or myotrophic causes, or as a result of any cause, including ischemia or ischemic stroke, eg, myocardial infarction. “Chronic” administration refers to the administration of the drug in a continuous form, unlike the acute mode, to maintain an initial effect, eg, an antihypertrophic effect, over an extended period of time. A "mammal" for purposes of treatment is classified as a human, domestic and agricultural animal, and any mammal classified as a zoo, sport, or pet animal, including dogs, horses, cats, cows, sheep, pigs, and the like. Of animals. Preferably the mammal is a human. Administration "in combination with" one or more additional therapeutic agents includes simultaneous (concurrent) and sequential administration in any order.

The term “cardiovascular, endothelial or angiogenic agent” generally refers to any agent that acts in the treatment of cardiovascular, endothelial and angiogenic disorders. Examples of cardiovascular agents include blood pressure,
All factors have a role in cardiovascular disease, promoting heart rate, cardiac contraction, and vascular homeostasis that regulates endothelial and smooth muscle biology. Specific examples of these include angiotensin-II receptor antagonists: endothelin receptor antagonists such as BOSENTAN ^™ and MOXONODIN ^™ , interferon-gamma (IFN-γ); des-asparatate-angiotensin I: thrombolytic agents such as streptokinase, Urokinase, t-PA, and TN, a t-PA variant with a longer half-life and designed to have very high fibrin specificity
K-t-PA (T103N, N117Q, KHRR (296-299) AAAAt-PA mutant, Keyt et al., Proc. Natl. Acad. Sci. USA, 91: 3670-3674 (1994)): Cardiotonic or hypertensive drug , Eg digoxigenin, and β-adrenergic receptor blocking agents such as propranolol, timolol, tartarolol, carteolol, nadolol, betaxolol, penbutolol, acetobutolol, atenolol, metoprolol, and carvedilol; angiotensin converting enzyme (ACE)
Inhibitors such as quinapril, captopril, enalapril, ramipril, benazepril, fosinopril, and lisinopril; diuretics such as chlorothiazide, hydrochlorothiazide, hydroflumetazide, methylclothiazide, benzthiazide, dichlorophenamide, acetazolamide, and indazamide. Included are calcium channel blockers such as diltiazem, nifedipine, verapamil, nicardipine. One preferred category of this kind is therapeutic agents used in the treatment of cardiac hypertrophy, or physiological conditions in the progression of cardiac hypertrophy, such as elevated blood pressure, aortic stenosis or myocardial infarction.

“Angiogenic agents” and “endothelial agents” are active agents that promote angiogenesis and / or endothelial cell growth or, where appropriate, tube formation. This includes factors that promote wound healing, such as growth hormone, insulin-like growth factor-I (IGF-I), VEG.
F, VIGF, PDGF, epidermal growth factor (EGF), CTGF and its family members, FGF, and TGF-α and TGF-β. "Angiogenesis inhibitors" are active agents that inhibit angiogenesis or tube formation, or inhibit or prevent cancer cell growth. Examples include antibodies to the angiogenic agents described above or other antagonists such as antibodies to VEGF. In addition, cytotherapeutic agents such as cytotoxic agents, chemotherapeutic agents, growth inhibitors, apoptotic agents, and other agents that treat cancer, such as anti-HER-2, anti-CD20, and bioactive and organic chemical agents included.

In the pharmacological sense of the invention, active agents such as PRO364 or PRO17
A "therapeutically effective amount" of a 5 polypeptide, or an antagonist thereof, refers to an amount effective for treating cardiovascular, endothelial, and angiogenic disorders. As used herein, the term "PRO364 polypeptide" refers to naturally occurring PRO3.
Native sequence PR having the same amino acid sequence as the 64 (SEQ ID NO: 3) polypeptide
O364 polypeptide is intended for use. Such a natural sequence PRO364
The polypeptide can be isolated from natural sources or can be produced by recombinant or synthetic means. The term specifically refers to naturally occurring truncated or secreted forms of PRO364 (eg, soluble forms including extracellular domain sequences and the like), naturally occurring mutant forms (eg, alternatively spliced forms) and PRO364 polypeptides. Naturally occurring allelic variants of. As used herein, "PRO364 polypeptide" and "PRO364" are referred to in the literature as "GITR".
Refers to the same polypeptide. In one embodiment of the invention the native sequence P
RO364 polypeptide is a mature or full length native sequence PRO364 polypeptide comprising amino acids 1 to 241 (SEQ ID NO: 3) of FIG1. In a further embodiment, it refers to a PRO364 polypeptide containing amino acids 26-241 of Fig2 (SEQ ID NO: 3). In another embodiment of the invention, the native sequence PRO364 polypeptide is the extracellular domain sequence of the full-length PRO364 protein, the Fig2 (
Full-length PRO36 containing amino acids 162-180 of the sequence shown in SEQ ID NO: 3)
It is a putative transmembrane domain of 4 proteins. Alternatively, the PRO364 polypeptide is the vector DNA47365- deposited under ATCC 209436.
Obtained or obtainable by expressing the polypeptide encoded by the 1206 cDNA insert. Thus, in a further embodiment of the invention Fi
Amino acids 1-161 or 26- of the amino acid sequence represented by g2 (SEQ ID NO: 3)
161.

The term “extracellular domain” when used in the intended use of PRO364 polypeptide refers to a form of PRO364 polypeptide that is substantially free of transmembrane and cytoplasmic domains. Generally, PRO polypeptide ECDs have less than 1% of their transmembrane and / or cytoplasmic domains, preferably less than 0.5% of such domains. Included are full length or ECD deletion variants or fragments in which one or more amino acids have been deleted from the N- or C-termini. Preferably, such deletion mutants or fragments have the desired activity as described herein. P of the present invention
It will be appreciated that any transmembrane domain identified for the RO364 polypeptide will be identified according to the criteria routinely used in the art to identify that type of hydrophobic domain. The exact boundaries of the transmembrane domain may vary, but are likely not to exceed about 5 amino acids from either end of the first identified domain. Accordingly, the PRO polypeptide ECD is optionally a Fi polypeptide.
It may contain amino acids Y to X of g2 (SEQ ID NO: 3), Y is any one of amino acid residues 1 to 26 of Fig2 (SEQ ID NO: 3), and X is amino acid residue 157.
1 to 167.

The term “variant” when intended for a PRO364 polypeptide is used to define the full-length native sequence PRO364 polypeptide or its extracellular domain sequence FIG2 (SEQ ID NO: 3), as defined below. A) has at least about 80% amino acid sequence identity with the PRO364 polypeptide having the deduced amino acid sequence shown in Figure 3). Such PRO364 polypeptide variants include, for example, PRO364 polypeptides in which one or more amino acid residues have been added or deleted at the N- or C-terminus of the full-length native amino acid sequence. Generally, a PRO364 polypeptide variant has at least about 80% amino acid sequence identity with the amino acid sequence of Figure2 (SEQ ID NO: 3), preferably at least about 85% amino acid sequence identity, more preferably at least about 90%. Of amino acid sequence identity, even more preferably at least about 95% amino acid sequence identity, even more preferably at least about 98% amino acid sequence identity.

As used herein, the term “PRO175 polypeptide” refers to naturally occurring PRO1.
75 (SEQ ID NO: 14) native sequence P having the same amino acid sequence as the polypeptide
RO175 polypeptide is intended for use. Such a natural sequence PRO17
The 5 polypeptide can be isolated from nature or can be produced by recombinant or synthetic means. The term specifically refers to naturally occurring truncated or secreted forms (eg, extracellular domain sequences), naturally occurring mutant forms (eg, alternatively spliced forms) and PRO175 polypeptides of a particular PRO175 polypeptide. Naturally occurring allelic variants are included. When used here "
"PRO175 polypeptide" and "PRO175" are referred to in the literature as "GLITTER".
Refers to the same polypeptide. In one embodiment of the invention, PRO
The native sequence polypeptide encoded by 175 is amino acids 1 to 17 of Fig5.
7 is a mature or full-length native sequence polypeptide comprising 7 (SEQ ID NO: 14). In a further embodiment, the PRO175 polypeptide comprises amino acids 52-177 of Figure 5 (SEQ ID NO: 14). In some cases, PRO175 polypeptide is AT
Obtained or obtainable by expressing the polypeptide encoded by the cDNA insert of the vector deposited as CC209466. Therefore, a further embodiment of the present invention refers to a polypeptide comprising 1 to 177 or 52 to 177 of the amino acid sequence shown in Fig5 (SEQ ID NO: 14).

The term “extracellular domain” when used in the intended use of a PRO175 polypeptide refers to a form of the PRO175 polypeptide that is substantially free of transmembrane and cytoplasmic domains. Generally, PRO polypeptide ECDs have less than 1% of their transmembrane and / or cytoplasmic domains, preferably less than 0.5% of such domains. Included are full length or ECD deletion variants or fragments in which one or more amino acids have been deleted from the N- or -C terminus. Preferably, such deletion mutants or fragments have the desired activity as described herein. P of the present invention
It will be appreciated that any transmembrane domain identified for the RO175 polypeptide will be identified according to the criteria routinely used in the art to identify that type of hydrophobic domain. The exact boundaries of the transmembrane domain may vary, but are likely not to exceed about 5 amino acids from either end of the first identified domain. Thus, the PRO175 polypeptide ECD may optionally include amino acids X to 177 of Fig5 (SEQ ID NO: 14), where X is F
ig5 (SEQ ID NO: 14), which is any one of amino acid residues 48 to 57. The term "variant" when used in the intended use of a PRO175 polypeptide is set forth in Figure 5 (SEQ ID NO: 14) of the full-length native sequence PRO175 polypeptide or its extracellular domain sequence, as defined below. There is at least about 80% amino acid sequence identity with the PRO175 polypeptide having the deduced amino acid sequence shown. PRO175 polypeptide variants include, for example, PRO175 polypeptides in which one or more amino acid residues have been added or deleted at the N- or C-terminus of the Fig5 (SEQ ID NO: 14) sequence. Usually PRO17
The 5 polypeptide variant has at least about 80% amino acid sequence identity with the amino acid sequence of Figure 5 (SEQ ID NO: 14), preferably at least about 85% amino acid sequence identity, more preferably at least about 90% amino acid sequence identity. It has sequence identity, even more preferably at least about 95% amino acid sequence identity, and even more preferably at least about 98% amino acid sequence identity.

“Percent (%) amino acid sequence identity” to a sequence identified herein, aligns the sequences and introduces gaps if necessary to obtain maximum percent sequence identity, and any conservative substitutions. It is defined as the percentage of amino acid residues in the candidate sequence that are identical to amino acid residues in the PRO364 or PRO175 polypeptide sequences, without considering them as part of sequence identity. Alignment for the purpose of determining percent amino acid sequence identity can be accomplished by a variety of methods within the skill of the art. One of ordinary skill in the art can determine the appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared. However, for the purposes herein, the% amino acid sequence identity values are set forth in the sequence comparison program ALIGN-2, the complete source code for which is given in Table 1, as described below. Is obtained by using. The ALIGN-2 sequence comparison computer program was created by Genentech, Inc. and the source code shown in Table 1 was submitted to the US Copyright Office, Washington DC, 20559 with user documentation and registered under US Copyright Registration Number TXU510087. Has been done. ALIGN-2 is Genentech, South San Fr.
Publicly available through ancisco, California. All sequence comparison parameters are set by ALIGN-2 and do not change. Methods for performing sequence alignments and determining sequence identity are well known to those of skill in the art and can be performed without undue experience, and% identity measurements can be consistently obtained.

“Isolated,” when used to describe the various polypeptides disclosed herein, refers to polypeptides that have been identified, separated and / or recovered from components of their natural environment. means. Contaminant components of its natural environment are materials that typically interfere with diagnostic or therapeutic uses for the polypeptide, and include enzymes, hormones, and other proteinaceous or nonproteinaceous solutes. In a preferred embodiment, the polypeptide is (1) sufficient to obtain an N-terminal or internal amino acid sequence of at least 15 residues by using a spinning cup sequenator, or (2) Coomassie blue or It is preferably purified to homogeneity by SDS-PAGE under non-reducing or reducing conditions using silver staining.
Isolated polypeptide includes polypeptide in situ within recombinant cells, since at least one component of the PRO364 or PRO175 ligand polypeptide natural environment will not be present. Ordinarily, however, isolated polypeptide will be prepared by at least one purification step. An "isolated" PRO364 or PRO175 nucleic acid molecule has been identified and
364 or PRO175 nucleic acid molecule separated from at least one contaminating nucleic acid molecule normally associated with the natural source of the nucleic acid. Isolated PRO364 or PRO1
A 75 nucleic acid molecule is in a form or setting other than that found in nature. Thus, an isolated PRO364 or PRO175 nucleic acid molecule is distinguished from the PRO364 or PRO175 nucleic acid molecule as it exists in natural cells. However, PRO36
4 or PRO175 nucleic acid molecules include, for example, PRO364 or PRO175 nucleic acid molecules contained in cells that normally express PRO364 or PRO175 at a chromosomal location different from that of natural cells.

The term “control sequence” refers to a DNA sequence necessary for the expression of an operably linked coding sequence in a particular host organism. The control sequences that are suitable for prokaryotes, for example, include a promoter, optionally an operator sequence, and a ribosome binding site. Eukaryotic cells are known to utilize promoters, polyadenylation signals and enhancers. Nucleic acid is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence. For example, the DNA of the pre-sequence or secretory leader, if expressed as a pre-protein that participates in the secretion of the polypeptide, is either PRO364 or PR.
Operably linked to the DNA of the O175 polypeptide; a promoter or enhancer is operably linked to the coding sequence if it affects the transcription of the sequence; or a ribosome binding site, if it translates Is operably linked to a coding sequence if it is in a position that facilitates Generally, "operably linked" means that the DNA sequences being linked are contiguous, and, in the case of a secretory leader, contiguous and in reading phase. However, enhancers do not necessarily have to be in close proximity. Binding is accomplished by ligation at convenient restriction sites. If such sites do not exist, then synthetic oligonucleotide adapters or linkers are used in accord with conventional practice.

The “stringency” of a hybridization reaction is readily determined by one of ordinary skill in the art and is an empirical calculation that generally depends on probe length, wash temperature, and salt concentration. Generally, longer probes require higher temperatures for proper annealing, while shorter probes require lower temperatures. Hybridization generally depends on the ability of denatured DNA to reanneal when complementary strands are present in an environment below their melting point. The higher the degree of desired homology between the probe and the hybridizable sequence, the higher the relative temperature that can be used. As a result, higher relative temperatures make the reaction conditions more stringent, while lower temperatures reduce stringency. Further details and explanations of the stringency of the hybridization reaction can be found in Ausubel et al., Cur.
rent Protocols in Molecular Biology (Wiley Interscience Publishers, 1995
)checking. "Stringent conditions" or "highly stringent conditions" as defined herein means (1) low ionic strength and high temperature for washing, eg, 0.015M sodium chloride / 0.0015M at 50 ° C. Using sodium citrate / 0.1% sodium dodecyl sulfate; (2) Denaturants such as formamide during hybridization, eg 50% (v / v) formamide and 0.1% bovine serum albumin at 42 ° C. / 0
． With 1% Ficoll / 0.1% polyvinylpyrrolidone / 50 mM sodium phosphate buffer pH 6.5 and 750 mM sodium chloride, 75 mM sodium citrate; (3) 50% formamide at 42 ° C., 5 × S.
SC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5x Denhard's solution, sonicated salmon sperm DNA (50 μg / ml), 0.1% SDS, and 1
0% dextran sulfate and 0.2xSSC (sodium chloride / 42 ° C)
Sodium citrate) and 50% formamide at 55 ° C., then 55
Identified by using a high stringency wash consisting of 0.1 x SSC with EDTA at ° C. “Moderate stringency conditions” are described in Sambrook et al., Molecular Cloning: A Laboratory.
Manual (New York: Cold Spring Harbor Laboratory Press, 1989), identified as described in Manual Washing Solutions and Hybridization Conditions below stringency.
(Eg temperature, ionic strength and% SDS). Examples of moderate stringency conditions include 20% formamide, 5xSSC (150 mM NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate pH 7.6, 5x denhard solution, 10% dextran sulfate, and 20 mg. / Ml denatured sheared salmon sperm DN
Incubation overnight at 37 ° C. in a solution containing A, then 37 in 1 × SSC
Conditions such as washing the filter at -50 ° C are included. One of ordinary skill in the art will recognize how to adjust temperature, ionic strength, etc. as needed to accommodate factors such as probe length.

The modifier "epitope tag," as used herein, refers to a chimeric polypeptide that comprises a PRO364 or PRO175 polypeptide fused to a "tag polypeptide." The tag polypeptide has a sufficient number of residues to provide an epitope against which the antibody can be produced, but its length is short enough so as not to interfere with the activity of the fused polypeptide. Also, the tag polypeptide is preferably fairly unique so that the antibody does not substantially cross-react with other epitopes. Suitable tag polypeptides generally have at least 6 amino acid residues, usually about 8-50.
Of amino acid residues (preferably about 10 to about 20 amino acid residues). "Active" and "active" in PRO364 or PRO175 mutants mean
Refers to a form of the PRO364 or PRO175 protein that retains the biological and / or immunological activity of the natural or naturally occurring PRO364 or PRO175 polypeptide. PRO364 identifiable by the screening assays disclosed herein
Or a molecule that antagonizes a PRO175 polypeptide (eg, a small organic or inorganic molecule,
"Biological activity" in peptides, etc.) refers to the binding or conjugation to the PRO364 or PRO175 polypeptides identified herein, or P to other cellular proteins.
Used to refer to the ability of such molecules to interfere with the interaction with RO364 or PRO175 polypeptides. Particularly preferred biological activities include systemic diseases affecting blood vessels, such as diabetes mellitus, and arterial, capillary, venous and / or lymphatic disease, and cardiac hypertrophic activity affecting cancer.

The term “antagonist” is used in its broadest sense and refers to one or more biological activities of a native PRO364 or PRO175 polypeptide disclosed herein, eg, its mitogenic or angiogenic activity, where appropriate. And any molecule that blocks, inhibits, or neutralizes. An antagonist of PRO364 or PRO175 polypeptide interferes with the binding of PRO364 or PRO175 polypeptide to a cellular receptor, inactivates or kills cells activated by PRO364 or PRO175 polypeptide, or causes PRO364 or PRO175 polypeptide to It acts by interfering with the activation of vascular endothelial cells after binding to the receptor. All of these points of mediation by a PRO364 or PRO175 polypeptide antagonist are considered equivalent to the purposes of this invention. Antagonists inhibit mitogenesis, angiogenesis, or other biological activity of PRO364 or PRO175 polypeptides, and thus tumors, particularly solid malignancies, rheumatoid arthritis, psoriasis, atherosclerosis, diabetes, other Retinopathy, posterior lens fibroplasia,
Of diseases or disorders characterized by undesired excessive neovascularization, including age-related plaque degeneration, neovascular glaucoma, hemangiomas, thyroid hyperplasia (Graves' disease), corneal and other tissue transplants, and chronic inflammation. Useful for treatment. Also, the antagonist is
Diseases or disorders characterized by undesired excessive vascular permeability, e.g. edema associated with brain tumors, ascites associated with malignant tumors, Mages syndrome, pneumonia, nephrotic syndrome, epicardial fluid (e.g. associated with pericarditis) It is useful for treating pleural effusion. Similarly, the term "agonist" is used in its broadest sense and includes any molecule that mimics the biological activity of a native PRO364 or PRO175 polypeptide disclosed herein. Suitable agonist or antagonist molecules include, among others, agonist or antagonist antibodies or antibody fragments, fragments or amino acid sequence variants of native PRO364 or PRO175 polypeptides, peptides, small organic molecules and the like.

“Antibodies” (Abs) and “immunoglobulins” (Igs) are glycoproteins having the same structural characteristics. Antibodies show binding specificity for specific antigens,
Immunoglobulins include both antibodies and other antibody-like molecules that lack antigen specificity. The latter type of polypeptide is produced, for example, at low levels by the lymphatic system and at increased levels by myeloma. The term "antibody" is used in its broadest sense and includes, but is not limited to, intact monoclonal antibodies, polyclonal antibodies, multispecific antibodies formed from at least two intact antibodies (
(Eg, bispecific antibodies), and antibody fragments so long as they exhibit the desired biological activity. "Natural antibodies" and "natural immunoglobulins" are heterotetrameric glycoproteins of about 150,000 daltons, usually composed of two identical light (L) chains and two identical heavy (H) chains. Each light chain is linked to the heavy chain by one covalent disulfide bond, and the number of disulfide bonds varies among heavy chains of different immunoglobulin isotypes. In addition, each heavy chain and light chain have regularly spaced interchain disulfide bonds. Each heavy chain has at one end a variable domain ( _VH ) followed by a number of constant domains. Each light chain has a variable domain ( _VL ) at one end and a constant domain at the other end; the constant domain of the light chain is aligned with the first constant domain of the heavy chain and the variable domain of the light chain is the heavy chain. Aligned with the variable domain of. Particular amino acid residues are believed to form the interface between the light and heavy chain variable domains.

The term “variable” refers to the fact that certain sites in the variable domain differ extensively in sequence among antibodies and are used in the binding and specificity of each particular antibody for its particular antigen. Refers to the facts. However, the variability is not evenly distributed over the variable domain of the antibody. It is concentrated in three segments called hypervariable regions or complementarity determining regions (CDRs) of both light and heavy chain variable domains. The more highly conserved portions of variable domains are called the framework region (FR). The variable domains of the natural heavy and light chains are predominantly in the β-sheet arrangement linked by three CDRs that bind the β-sheet structure and in some cases form a loop bond forming part of it 4. It contains two FR regions. The CDRs of each chain are bound in closer proximity by the FRs and, along with the CDRs of the other chains, contribute to the formation of the antibody's antigen-binding site. Kabat et al., NIH Publ.No.91-3242, Vol.I, 647-669
See page (1991). The constant domains are not directly involved in the binding of the antibody to the antigen, but exhibit various effector functions, such as the involvement of the antibody in antibody-dependent cellular cytotoxicity.

An “antibody fragment” comprises a portion of an intact antibody, preferably the antigen binding or variable region of the intact antibody. Examples of antibody fragments include Fab, Fab ′, F (ab ′) ₂ and F.
v fragment; diabodies; linear antibody (Zapata et al., Protein Eng. 8 (1
0): 1057-1062 (1995)); single chain antibody molecules; and multispecific antibodies formed from antibody fragments. Upon papain digestion of an antibody, two identical antigen-binding fragments, each called a "Fab" fragment, each having a single antigen-binding site, and a residual "Fc" fragment, whose name represents the ability to crystallize readily, are obtained. Produced. Pepsin treatment yields an F (ab ′) ₂ fragment that has two antigen-combining sites and is still capable of cross-linking antigen. "Fv" is the minimum antibody fragment that contains a complete antigen recognition and binding site. This region consists of a dimer of one heavy and one light chain variable domain in tight, non-covalent association. In this arrangement, the three CDRs of each variable domain interact to form an antigen binding site on the surface of the _VH - _VL dimer. Collectively, 6 CDs
R confers antigen binding specificity to the antibody. However, even a single variable domain (or half of an Fv containing only three CDRs specific for an antigen) has a lower affinity than the total binding site, but still has the ability to recognize and bind antigen. Have

The Fab fragment also contains the constant domain of the light chain and the first constant domain (CH1) of the heavy chain. Fab 'fragments differ from Fab fragments by the addition of a few residues at the carboxy terminus of the heavy chain CH1 region including one or more cysteines from the antibody hinge region. Fab'-SH is the designation herein for Fab 'in which the cysteine residue (s) of the constant domains carry a free thiol group. F (ab ′) ₂ antibody fragments were produced as pairs of Fab ′ fragments which have hinge cysteines between them. Other chemical couplings of antibody fragments are also known. The “light chain” of an antibody (immunoglobulin) from any vertebrate species is based on the amino acid sequence of its constant domain, in two distinct types called kappa (κ) and lambda (λ). One is assigned. Depending on the amino acid sequence of the constant domain of the heavy chain, immunoglobulins can be assigned to different classes. There are five major classes of immunoglobulins: IgA,
There are IgD, IgE, IgG and IgM, some of which are further subclasses
(Isotype), eg IgG1, IgG2, IgG3, IgG4, IgA and IgA2. The heavy chain constant domains that correspond to the different classes of immunoglobulins are called α, δ, ε, γ and μ, respectively. The subunit and three-dimensional structures of different classes of immunoglobulins are well known.

The term “monoclonal antibody” as used herein refers to an antibody that is obtained from a population of substantially homogeneous antibodies, ie, the individual antibodies that make up the population occur naturally in small amounts. Identical except for possible mutations. Monoclonal antibodies are highly specific, being directed against a single antigenic site. Moreover, different determinants
Each monoclonal antibody is directed against a single determinant on the antigen, as compared to conventional (polyclonal) antibodies that typically include different antibodies directed against (epitopes). In addition to their specificity, monoclonal antibodies are advantageous in that they are synthesized from hybridoma cultures uncontaminated by other immunoglobulins. The modifier "monoclonal" indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies, and does not mean that the antibody must be produced in any particular fashion. For example, the monoclonal antibody used in the present invention is
It can be made by the hybridoma method disclosed by Kohler et al., Nature 256, 495 (1975) or can be made by the recombinant DNA method (eg,
See U.S. Pat. No. 4,816,567). Also, "monoclonal antibody" refers to, for example, Clackson.
Et al., Nature 352: 624-628 (1991), and Marks et al., J. Mol. Biol. 222: 581-597 (1
It can also be isolated from a phage antibody library using the technique described in 991). Here, the monoclonal antibody has a part of the heavy chain and / or the light chain which is identical or homologous to the corresponding sequence of an antibody derived from a specific species or an antibody belonging to a specific antibody class or subclass, and the rest of the chains. A "chimeric" antibody (immunoglobulin) whose portion is identical or homologous to the corresponding sequence of an antibody from another species or an antibody of another antibody class or subclass, as well as which has the desired biological activity In particular, the fragments of these antibodies are specifically included. U.S. Pat.No. 4,816,567; Morrison et al., Proc. N
atl. Acad. Sci. USA, 81: 6851-6855 (1984).

[0074]   “Humanized” forms of non-human (eg, murine) antibodies include chimeric immunoglobulins, immuno
Globulin chains or fragments thereof (eg Fv, Fab, Fab ', F (ab'))
_TwoOr other antigen-binding subsequences of antibodies), which are derived from non-human immunoglobulin.
It contains the smallest incoming sequence. For the most part, humanized antibodies are
The residues of the CDRs have the desired specificity, affinity and affinity such as mouse, rat or rabbit.
Human immunity replaced by residues of CDRs of non-human species (donor antibody) with potential
Globulin (recipient antibody). In some cases, human immunoglobulin F
The vFR residue is replaced by the corresponding non-human residue. Furthermore, humanized antibodies are
Found in recipient antibody as well as imported CDR or framework sequences
It may also include residues that are not. These modifications further refine and optimize antibody properties
Is done to In general, humanized antibodies are used for all or almost all CDs.
The R region corresponds to that of a non-human immunoglobulin, and all or almost all F
At least one, typically 2 where the R region is of a human immunoglobulin sequence
Contains substantially all of the one variable domain. Humanized antibodies are optimally immune globulin
Constant region (Fc), typically at least one of the constant regions of human immunoglobulins.
Including parts. For further details, see Jones et al., Nature 321, 522-525 (1986); Reichmann et al.,
 Nature 332, 323-329 (1988); and Presta, Curr. Op. Struct. Biol. 2, 593-5.
See 96 (1992). Humanized antibodies are those in which the antigen-binding region of the antibody is the antigen of interest.
PRIMATIZED derived from antibodies produced by immunizing macaques^TMAnti
Including the body.

“Single chain Fv” or “sFv” antibody fragments are those that contain the V _H and V _L domains of the antibody, and these domains are present in the polypeptide single chain. Preferably,
The Fv polypeptide further comprises a polypeptide linker between the _VH and _VL domains which enables the sFv to form the desired structure for antigen binding. sFv
Reviews include, for example, Pluckthun, The Pharmacology of Monoclonal Antibo
dies, Vol.113, edited by Rosenburg and Moore (Springer-Verlag, New York, 1994) pp.2
See 69-315. The term "diabodies", small antibody fragments intended to refer to, fragments heavy chain variable domain (V _H) in the same polypeptide chain connected to a light-chain variable domain (V _L) with two antigen-binding sites ( _VH - _VL ). By using a linker that is so short that no pairing between the two domains on the same chain is allowed, the domain is forced to pair with the complementary domain of the other chain, creating two antigen binding sites. Diabodies are described in more detail, for example, in EP 404,097; WO 93/11161; and Hollinger et al., Proc. Natl. Acad. Sci. USA, 90: 6444-6448 (1993). An "isolated" antibody is one that has been identified and separated and / or recovered from a component of its natural environment. Contaminant components of its natural environment are materials that would interfere with its diagnostic or therapeutic use for the antibody, including enzymes, hormones, and other proteinaceous or nonproteinaceous solutes. In a preferred embodiment, the antibody is (1) Lowry method
Up to 95%, most preferably 99% by weight when measured by (Lowry method)
By using (2) Spinning cup sequenator until
Enough to obtain an N-terminal or internal amino acid sequence of at least 15 residues,
Alternatively, (3) it is purified to homogeneity by SDS-PAGE under non-reducing or reducing conditions using Coomassie blue or preferably silver staining. Isolated antibody includes the antibody in situ within recombinant cells since at least one component of the antibody's natural environment will not be present. Ordinarily, however, isolated antibody will be prepared by at least one purification step.

The term “label” as used herein refers to a detectable compound or other composition that is conjugated directly or indirectly to the antibody to produce a “labeled” antibody. The label may itself be detectable (eg a radioactive or fluorescent label) or, in the case of an enzymatic label, may catalyze the chemical conversion of a detectable substrate compound or composition. By "solid phase" is meant a non-aqueous matrix to which the antibodies of the invention can adhere. Examples of solid phases included herein include those formed partly or wholly from glass (eg, controlled pore glass), polysaccharides (eg, agarose), polyacrylamide, polystyrene, polyvinyl alcohol and silicone. In some embodiments, depending on the context, the solid phase can comprise the wells of the assay plate; in others, a purification column (eg, an affinity chromatography column).
Can also be The term also includes a discontinuous solid phase of discrete particles, such as those described in US Pat. No. 4,275,149.

“Liposomes” are small vesicles composed of various types of lipids, phospholipids and / or surfactants, which are drugs for mammalian administration (eg PRO364 or PRO175).
Polypeptides or antibodies disclosed herein, etc.). The components of the liposome are commonly arranged in a bilayer formation, similar to the lipid arrangement of biological membranes. The term “immunoadhesin” as used herein refers to antibody-like molecules that combine the binding specificity of a heterologous protein (“adhesin”) with the effector functions of immunoglobulin constant domains. Structurally, the immunoadhesin comprises a fusion of an immunoglobulin constant domain sequence with an amino acid sequence that has the desired binding specificity and is other than the antigen recognition and binding site of the antibody (ie, "heterologous"). . The adhesin portion of the immunoadhesin molecule is typically a contiguous amino acid sequence containing at least the binding site for the receptor or ligand. The immunoglobulin constant domain sequence of the immunoadhesin has an IgG-1, IgG-2, IgG-3 or IgG-4 subtype,
It can be obtained from any immunoglobulin such as IgA (including IgA-1 and IgA-2), IgE, IgD or IgM.

II. Compositions and Methods of the Invention A. Preparation of PRO364 or PRO175 Polypeptides The present invention refers to PRO364 (also PRO687 or UNQ319 in this application.
Is referred to as) or PRO175, and provides a newly identified and isolated nucleotide sequence. In particular, PRO364 and PR
A cDNA encoding the O175 polypeptide was identified and isolated as disclosed in further detail in the Examples below. Proteins made in separate expression rounds can be given different PRO numbers, but UNQ numbers can be given any D
It is unique to NA and the encoded protein and cannot change. The description below relates primarily to methods of producing PRO364 or PRO175 polypeptides by culturing cells transformed or transfected with a vector containing a nucleic acid encoding a PRO364 or PRO175 polypeptide. Of course, using other methods well known in the art, PRO364 or P
It is believed that RO175 can be prepared. For example, PRO364 or P
RO175 polypeptide sequences, or portions thereof, may be produced by direct peptide synthesis using solid phase techniques. For example, Stewart et al., Solid-Phase Peptide Synth
esis, WH Freeman Co., San Francisco, CA (1969); Merrifield, J. Am. Che
m. Soc., 85: 2149-2154 (1963). In vitro protein synthesis may be performed by manual techniques or by automation. Automated synthesis may be performed, for example, using an Applied Biosystems Peptide Synthesizer (Foster City, CA) according to the manufacturer's instructions. Various portions of PRO364 or PRO175 are chemically synthesized separately and combined using chemical or enzymatic methods to form full-length PRO364 or PRO175.
The polypeptide may be produced.

Isolation of DNA Encoding PRO364 or PRO175 DNA encoding the PRO364 or PRO175 polypeptide is PRO3
It can be obtained from a cDNA library prepared from tissue that possesses mRNA encoding 64 or PRO175 and is suspected of expressing it at detectable levels. Therefore, D encoding human PRO364 or human PRO175
NA can be conveniently obtained from a cDNA library prepared from human tissue, as described in the Examples. The gene encoding the PRO364 or PRO175 polypeptide can also be obtained from a genomic library or by a known synthetic method (eg, automated nucleic acid synthesis). Libraries can be screened with probes (such as antibodies to PRO364 or PRO175 polypeptides or oligonucleotides of at least about 20-80 bases) designed to identify the gene of interest or the protein encoded by that gene. Screening a cDNA or genomic library with selected probes can be performed using standard procedures, eg, described in Sambrook et al., Supra. PRO364 or PRO1
Another method of isolating the gene encoding 75 is using the PCR method.
Sambrook et al., Supra; Dieffenbach et al., PCR Primer: A Laboratory Manual (New York.
: Cold Spring Harbor Laboratory Press, 1995).

The following examples describe techniques for screening a cDNA library. The oligonucleotide sequences selected as probes should be of sufficient length and sufficiently unambiguous that false positives are minimized. The oligonucleotides are preferably detectably labeled upon hybridisation with the DNA in the library to be screened. Methods of labeling are well known in the art and include the use of radiolabels such as ³² P labeled ATP, biotinylation or enzyme labeling. Hybridization conditions, including moderate and high stringency, are given in Sambrook et al., Supra. Sequences identified in such library screening methods are GenBan
It can be compared and aligned with known sequences that have been deposited in public databases such as k or private sequence databases and are available to the public. Determining sequence identity (either at the amino acid or nucleotide level) within a determined region or over the entire length of a molecule through sequence alignment using computer software such as ALIGN, DNA STAR, and INHERIT. You can A nucleic acid having a protein coding sequence was used for the first time in the deduced amino acid sequence disclosed herein and, if necessary, in Sambrook et al. Obtained by screening the selected cDNA or genomic library using conventional primer extension methods as described.

In addition to the full-length native sequence PRO364 or PRO175 polypeptides described herein, PRO364 or PRO175 variants could be prepared. PRO
364 or PRO175 mutants are PRO364- or PRO175-encoding D
By introducing appropriate nucleotide changes into NA, or the desired PRO3
It can be prepared by synthesizing 64 or PRO175 polypeptide. One of ordinary skill in the art will appreciate that amino acid changes, such as changes in the number or position of glycosylation sites or changes in membrane anchoring properties, may alter post-translational processes of PRO364 or PRO175 polypeptides. Native full-length sequence PRO364 or PRO175 or PRO364 described herein.
Alternatively, mutations in various domains of the PRO175 polypeptide can be made, for example, using any of the techniques and guidelines for conservative and non-conservative mutations described in US Pat. No. 5,364,934. The mutation may be the native sequence PRO364 or P
It may be a substitution, deletion or insertion of one or more codons encoding a PRO364 or PRO175 polypeptide that results in a change in the amino acid sequence of PRO364 or PRO175 polypeptide as compared to RO175. In some cases, the mutation is the replacement of at least one amino acid with any other amino acid in one or more domains of the PRO364 or PRO175 polypeptide. A guideline for which amino acid residues are inserted, substituted or deleted without adversely affecting the desired activity is to compare the sequence of the PRO364 or PRO175 polypeptide with that of known homologous protein molecules and It is found by minimizing the number of amino acid sequence changes that are made in the more prominent regions. Amino acid substitutions can be the result of substitutions of one amino acid for another amino acid with similar structural and / or chemical properties, eg, replacement of leucine with serine, a conservative amino acid substitution. Insertions and deletions can optionally be within the range of about 1 to 5 amino acids. Permissible mutations are determined by systematically making amino acid insertions, deletions or substitutions in the sequence and testing the resulting mutants for activity in any of the in vivo assays described below.

Mutations can be made using techniques known in the art such as oligonucleotide-mediated (site-directed) mutagenesis, alanine scanning, and PCR mutagenesis. Site-directed mutagenesis [Carter et al., Nucl. Acids Res.
, 13: 4331 (1986); Zoller et al., Nucl. Acids Res., 10: 6487 (1987)], cassette mutagenesis [Wells et al., Gene, 34: 315 (1985)], restriction selective mutagenesis [W.
Ells et al., Philos. Trans. R. Soc. London SerA, 317: 415 (1986)] or other known techniques can be performed on cloned DNA to produce PRO364-encoding mutant DNA. Also, scanning amino acid analysis can be used to identify one or more amino acids along a flanking sequence. The preferred scanning amino acids are relatively small, neutral amino acids. Such amino acids include alanine, glycine,
Contains serine and cysteine. Alanine is typically the preferred scanning amino acid in this group because it excludes side chains above the beta carbon and does not alter the backbone structure of the mutant. Also, alanine is typically preferred because it is the most common amino acid. Moreover, it is often found in both buried and exposed locations [Creighton, The Proteins, (WH Freeman & Co., NY); Choth
ia, J. Mol. Biol., 150: 1 (1976)]. If alanine substitution does not yield a sufficient amount of variant, an isoteric amino acid can be used.

Modifications of PRO364 Covalent modifications of PRO364 or PRO175 polypeptides are included within the scope of this invention. One type of covalent modification is an organic derivatization reagent that is capable of reacting a targeted amino acid residue of a PRO364 or PRO175 polypeptide with a selected side chain or N- or C-terminal residue of a PRO364 or PRO175 polypeptide. Including reacting with. Derivatization with a bifunctional reagent is described, for example, in PRO364 or P
RO175 with water-insoluble support matrix or anti-PRO364 or -PRO1
Useful for cross-linking surfaces for use in purification methods for antibody 75 or vice versa. Commonly used cross-linking agents are, for example, 1,1-bis (diazoacetyl) -2-phenylethane, glutaraldehyde, N-hydroxysuccinimide ester such as 4-azidosalicylic acid, 3,3′-dithiobis (succinimidyl). Homobifunctional imide ester including disuccinimidyl ester such as (propionate), bis-
Bifunctional maleimides such as N-maleimide-1,8-octane, and methyl-3-[(p-
Includes reagents such as azidophenyl) -dithio] propioimidate. Other modifications include deamination of glutaminyl and asparaginyl residues to the corresponding glutamyl and aspartyl residues, hydroxylation of proline and lysine,
Phosphorylation of hydroxyl group of ceryl or threonyl residue, lysine, arginine,
And histidine side chain α-amino group methylation [TE Creighton, Proteins: Stru
cture and Molecular Properties, WH Freeman & Co., San Francisco, pp.79
-86 (1983)], acetylation of N-terminal amines, and amidation of optional C-terminal carboxyl groups.

Another type of covalent modification of the PRO364 or PRO175 polypeptides included within the scope of this invention comprises altering the native glycosylation pattern of the polypeptide. By "altered native glycosylation pattern" is intended for this purpose what is meant is the deletion of one or more carbohydrate moieties found in the native sequence PRO364 or PRO175 polypeptide, and / or the native sequence PRO364 or PRO175 polypeptide. Means the addition of one or more glycosylation sites not present in. Addition of glycosylation sites to the PRO364 or PRO175 polypeptides may be accompanied by amino acid sequence alterations. This modification may be made, for example, by the addition or substitution of one or more serine or threonine residues to the native sequence PRO364 or PRO175 polypeptide (O-linked glycosylation site). PRO36
4 or PRO175 amino acid sequence may optionally have changes at the DNA level,
In particular, D encoding a PRO364 or PRO175 polypeptide
NA may be altered through mutations at preselected bases to generate codons that are translated into the desired amino acid.

Another means of increasing the number of carbohydrate moieties on the PRO364 or PRO175 polypeptides is by chemical or enzymatic coupling of glycosides to the polypeptide. Such methods are described in this technical field, for example in W. W., published on September 11, 1987.
O 87/05330, and Aplin & Wriston, CRC Crit. Rev. Biochem., Pp. 259-306 (
1981). Removal of carbohydrate moieties present on PRO364 or PRO175 polypeptides may be accomplished chemically or enzymatically, or by mutational substitution of codons encoding amino acid residues presented as targets for glycosylation. Chemical deglycosylation techniques are known in the art, see, for example, Hakimuddin et al., Arch. Bi.
Ochem. Biophys., 259: 52 (1987) and Edge et al., Anal. Biochem., 118: 1.
31 (1981). Enzymatic cleavage of carbohydrate moieties on polypeptides is accomplished by using various endo and exoglycosidases, as described in Thotakura et al., Meth. Enzymol. 138: 350 (1987). Another type of covalent modification of PRO364 or PRO175 is described in US Pat. No. 4,640,835 to PRO364 or PRO175 polypeptides to various non-proteinaceous polymers such as polyethylene glycol, polypropylene glycol, or polyoxyalkylenes. No. 4,496,689; No. 4,301,144; No. 4,670,417
No. 4,791,192 or 4,179,337.

The PRO364 or PRO175 polypeptides of the present invention may also be modified in a manner to form chimeric molecules comprising PRO364 or PRO175 fused to other heterologous polypeptides or amino acid sequences. In one embodiment, such a chimeric molecule comprises a fusion of the PRO364 or PRO175 polypeptide with a tag polypeptide that provides an epitope to which an anti-tag antibody can selectively bind. The epitope tag is generally placed at the amino- or carboxyl-terminus of the PRO364 or PRO175 polypeptide. The presence of such epitope-tagged forms of PRO364 or PRO175 polypeptides can be detected using antibodies to the tag polypeptides. Also, provision of the epitope tag is provided by affinity purification using an anti-tag antibody or affinity purification using another type of affinity matrix that binds to the epitope tag.
Allows for easy purification of RO364 or PRO175 polypeptides. In another embodiment, the chimeric molecule comprises a fusion of a PRO364 or PRO175 polypeptide with an immunoglobulin or a particular region of an immunoglobulin. For bivalent forms of the chimeric molecule, such a fusion may be the Fc region of an IgG molecule. Optionally, the chimeric molecule comprises the PRO364 or PRO175ECD sequence fused to the Fc region of an IgG molecule. Various tag polypeptides and their respective antibodies are well known in the art. Examples are poly-histidine (poly-his) or poly-histidine-glycine (poly
-his-gly) tag; flu HA tag polypeptide and its antibody 12CA5 [Field etc., Mo
l. Cell. Biol., 8: 2159-2165 (1988)]; c-myc tag and 8F9 thereto,
3C7, 6E10, G4, B7 and 9E10 antibodies [Evan et al., Molecular and Cell
ular Biology, 5: 3610-3616 (1985)]; and herpes simplex virus glycoprotein D (gD) tag and its antibody [Paborsky et al., Protein Engineering, 3 (6): 547-553 (1).
990)] is included. Other tag polypeptides are flag peptides [Hopp et al., BioTechn
ology, 6: 1204-1210 (1988)]; KT3 epitope peptide [Martin et al., Science.
, 255: 192-194 (1992)]; α-tubulin epitope peptide [Skinner et al., J.
Biol. Chem., 266: 15163-15166 (1991)]; and T7 gene 10 protein peptide tag [Lutz-Freyermuth et al., Proc. Natl. Acad. Sci. USA, 87: 6393-6397 (1).
990)] is included. The PRO364 or PRO175 polypeptides of the present invention may be modified in a manner to form chimeric molecules comprising the PRO364 or PRO175 polypeptides fused to a leucine zipper. Various leucine zipper polypeptides have been described in the art. For example, Landschulz et al., Science, 240: 1759 (1988); WO 94/103.
08; Hoppe et al., FEBS Letters, 344: 1991 (1994); Maniatis et al., Nature, 341: 24.
See (1989). The use of leucine zippers fused to PRO364 or PRO175 polypeptides is believed to aid in dimerization or trimerization of soluble PRO364 or PRO175 polypeptides in solution. One of ordinary skill in the art will recognize that the leucine zipper is fused to either the N- or C-terminus of the PRO364 or PRO175 molecule.

Selection and Transformation of Host Cells Host cells are transfected or transformed with an expression or cloning vector for the production of PRO364 or PRO175 described herein to induce a promoter,
Transformants are selected or cultured in conventional nutrient medium that has been appropriately modified to amplify the gene encoding the desired sequence. Culture conditions such as medium, temperature, pH, etc. can be selected by those skilled in the art without undue experimentation. In general, the principles, protocols, and practical techniques for maximizing cell culture productivity are described by Mammalian.
Cell Biotechnology: a Practical Approach, edited by M. Butler (IRL Press, 1991) and Sambrook et al., Supra. For example, CaPO ₄ treatment and electroporation are known to those of skill in the art. Depending on the host cell used, transformation is done using standard methods appropriate to the cell. Calcium treatment with calcium chloride or electroporation as described in Sambrook et al., Supra, is generally used for prokaryotes. Infection with Agrobacterium tumefaciens was reported by Shaw et al., Gene,
23: 315 (1983) and WO 89/05859 published June 29, 1989,
Used in the transformation of certain plant cells. For mammalian cells without such cell walls, the calcium phosphate precipitation method of Graham and van der Eb, Virology, 52: 456-457 (1978) can be used. General aspects of mammalian cell host system transformations have been described in US Pat. No. 4,399,216. Transformation into yeast is typically performed by Van Solingen et al., J. Bact., 130: 946 (1977) and Hsiao et al., P.
Roc. Natl. Acad. Sci. USA, 76: 3829 (1979). However, other methods of introducing DNA into cells, such as nuclear microinjection, electroporation, intact cells, or bacterial protoplast fusion using polycations such as polybrene, polyornithine, etc., can also be used. For various techniques for transforming mammalian cells, see Keown et al., M.
ethods in Enzymology, 185: 527-537 (1990) and Mansour et al., Nature, 336: 348-.
See 352 (1988).

Suitable host cells for cloning or expressing the DNA in the vectors described herein are prokaryote, yeast, or higher eukaryote cells. Suitable prokaryotes include, but are not limited to, eubacteria, such as Gram-negative or Gram-positive organisms, for example, Enterobacteriaceae such as E. coli. Various E. coli strains are publicly available, for example E. coli K12 strain MM294 (ATCC31,446); E. coli X1776 (A
TCC31,537); E. coli strains W3110 (ATCC27,325) and K5772 (ATCC53,635). In addition to prokaryotes, eukaryotic microbes such as filamentous fungi or yeast are suitable cloning or expression hosts for PRO364 or PRO175 polypeptide-encoding vectors. Saccharomyces cerevisiae is a commonly used lower eukaryotic host microorganism. Suitable host cells for the expression of glycosylated PRO364 or PRO175 are derived from multicellular organisms. Examples of invertebrate cells include insect cells such as Drosophila S2 and Spodaspera Sf9, as well as plant cells. Examples of useful mammalian host cell lines include Chinese Hamster Ovary (CHO) and COS cells. Many specific examples are monkey kidney CV1 strains transformed with SV40 (
COS-7, ATCC CRL 1651); human embryonic kidney strain (293 cells subcloned for growth in 293 or suspension culture, Graham et al., J. Gen Virol., 36:59 (1977)); Chinese hamster ovary cells / -DHFR (CHO, Urlaub and Chasin, Proc. Natl. Acad.
Sci. USA, 77: 4216 (1980)); mouse Sertoli cells (TM4, Mather, Biol. Repro
d., 23: 243-251 (1980)) Human lung cells (W138, ATCC CCL 75); Human hepatocytes (Hep G2
, HB 8065); and mouse breast tumor cells (MMT 060562, ATTC CCL51). Selection of the appropriate host cell is within the skill of the art.

Selection and Use of Replicable Vectors A nucleic acid encoding PRO364 or PRO175 (eg, cDNA or genomic DNA) is inserted into a replicable vector for cloning (amplification of DNA) or expression. Various vectors are publicly available. The vector can be in the form of, for example, a plasmid, cosmid, viral particle, or phage. The appropriate nucleic acid sequence may be inserted into the vector by a variety of procedures. In general,
The DNA is inserted into the appropriate restriction endonuclease sites using techniques well known in the art. Vector components generally include, but are not limited to, one or more signal sequences, origins of replication, one or more marker genes, enhancer elements, promoters, and transcription termination sequences. Construction of suitable vectors containing one or more of these components employs standard ligation techniques known to those of ordinary skill in the art. PRO364 or PRO175 is not only directly produced by recombinant techniques, but also fused to a heterologous polypeptide which is a signal sequence or a mature protein or another polypeptide having a specific cleavage site at the N-terminus of the polypeptide. It is also produced as a peptide. Generally, the signal sequence is a component of the vector, or is part of DNA PRO364 or PRO175 that is inserted into the vector. The signal sequence may be, for example, a prokaryotic signal sequence selected from the group of alkaline phosphatase, penicillinase, lpp or thermostable enterotoxin II leaders. For yeast secretion, the signal sequence is a yeast invertase leader, alpha factor leader (including yeast (Saccharomyces) and Kluyveromyces alpha factor leaders, the latter being described in U.S. Pat.No. 5,010,182). , Or an acid phosphatase leader, a white body (C. albicans) glucoamylase leader (European Patent No. 362179 published April 4, 1990), or WO 90/13646 published November 15, 1990. It can be the signal described. In mammalian cell expression, mammalian signal sequences may be used for the direct secretion of proteins such as signal sequences from secreted polypeptides of the same or related species, as well as viral secretory leaders.

Both expression and cloning vectors contain a nucleic acid sequence that enables the vector to replicate in one or more selected host cells. Such sequences are common to many bacteria,
It is well known for yeasts and viruses. The origin of replication derived from plasmid pBR322 is suitable for most Gram-negative bacteria, the 2μ plasmid origin is suitable for yeast, and various viral origins (SV40, polyoma, adenovirus, VSV or BPV) are mammalian. It is useful as a cloning vector in animal cells. Expression and cloning vectors typically contain a selection gene, also termed a selectable marker. Typical selection genes are (a) ampicillin, neomycin,
Not resistant to antibiotics or other toxins such as methotrexate or tetracycline, (b) supplementing auxotrophic defects, or (c) obtained from complex media such as the gene code D-alanine racemase for Bacillus It encodes a protein that supplies important nutrients. Examples of suitable selectable markers for mammalian cells are those that can identify cellular components, such as DHFR or thymidine kinase, that can incorporate nucleic acids encoding PRO364 or PRO175. Suitable host cells using wild type DHFR are described by Urlaub et al., Proc. Natl. Acad. Sci. USA, 77:
CHO cell lines deficient in DHFR activity prepared and expanded as described in 4216 (1980). A preferred selection gene for use in yeast is the trp1 gene present in the yeast plasmid YRp7, Stinchcomb et al., Nature, 282.
: 39 (1979); Kingman et al., Gene, 7: 141 (1979); Tschemper et al., Gene, 10: 157 (19).
80). The trp1 gene is, for example, ATCC No. 44076 or PEP4-1.
Provide a selectable marker for a mutant strain of yeast that lacks the ability to grow in tryptophan, such as. Jones, Genetics, 85:12 (1977).

Expression and cloning vectors usually contain a promoter operably linked to the nucleic acid sequence encoding PRO364 or PRO175 to control mRNA synthesis. Promoters recognized by a variety of possible host cells are known. Suitable promoters for use in prokaryotic hosts are the β-lactamase and lactose promoter systems (Cahng et al., Nature, 275: 615 (1978); Goeddel et al., Nature, 281: 544.
(1979)), alkaline phosphatase, tryptophan (trp) promoter system [Goed
del, Nucleic Acids Res., 8: 4057 (1980); EP 36,776], and hybrid promoters such as the tac promoter. deBoer et al., Proc. N
atl. Acad. Sci. USA, 80: 21-25 (1983). The promoter used in bacterial systems is also P
It has a Shine-Dalgarno (SD) sequence operably linked to the DNA encoding RO364 or PRO175. Examples of suitable promoter sequences for use with yeast hosts include 3-phosphoglycerate kinase (Hitzeman et al., J. Biol. Chem., 255: 2073 (1980)) or other glycolytic enzymes (Hess et al., J. Adv. Enzyme Reg., 7: 149 (1968); Holland, Biochem
istry, 17: 4900 (1978)), for example, enolase, glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruvate decarboxylase, phosphofructokinase, glucose-6-phosphate isomerase, 3-phosphoglycerate mutase, Pyruvate kinase, trioselate isomerase, phosphoglucose isomerase, and glucokinase are included. Other yeast promoters are inducible promoters that have the additional effect of transcription being regulated by growth conditions, such as alcohol dehydrogenase 2, isocytochrome C, acid phosphatase, degradative enzymes associated with nitrogen metabolism, metallothionein, glycerin. There are promoter regions for aldehyde-3-phosphate dehydrogenase and enzymes that control the utilization of maltose and galactose. Vectors and promoters suitably used for expression in yeast are further described in EP 73,657. PRO364 or PRO175 nucleic acid transcription from a vector in a mammalian host cell may be obtained, for example, from polyoma virus, infectious epithelioma virus (UK 2,211,504 published Jul. 5, 1989), adenovirus (eg adenovirus 2), bovine papilloma. A promoter derived from the genome of a virus such as a virus, avian sarcoma virus, cytomegalovirus, retrovirus, hepatitis B virus and simian virus 40 (SV40), a heterologous mammalian promoter such as an actin promoter or an immunoglobulin promoter, and Promoters derived from heat shock promoters are controlled as long as such promoters are compatible with the host cell line.

Transcription of the DNA encoding the desired PRO364 or PRO175 by higher eukaryotes can be enhanced by inserting an enhancer sequence into the vector. Enhancers, usually about 10 to 300 base pairs, are cis-acting elements of DNA that act on promoters to enhance their transcription. Many enhancer sequences from mammalian genes are currently known (globin, elastase, albumin, α-fetoprotein and insulin). However, typically enhancers from eukaryotic viruses will be used. Examples include the SV40 enhancer on the late side of the replication origin (100-270 base pairs), the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and the adenovirus enhancer. The enhancer may be spliced into the vector at the 5'or 3'positions of the PRO364 or PRO175 coding sequences, but is preferably located 5'from the promoter. Expression vectors for use in eukaryotic host cells (yeast, fungi, insects, plants, animals, humans, or nucleated cells from other multicellular organisms) also include termination of transcription and mRNA.
It also contains the sequences required for the stabilization of Such sequences are used in eukaryotic or viral DNs.
It can be obtained from the A or cDNA, usually 5'and sometimes 3'untranslated regions. These regions contain nucleotide segments transcribed as polyadenylated fragments in the untranslated portion of the mRNA encoding PRO364 or PRO175. Other methods, vectors and host cells suitable for adapting the synthesis of PRO364 or PRO175 in recombinant vertebrate cell culture are described in Gething et al., Nature, 293: 620.
-625 (1981); Mantei et al., Nature, 281: 40-46 (1979); EP 117,060;
And EP 117,058.

Detection of Gene Amplification / Expression Amplification and / or expression of genes can be determined by appropriately labeled probes based on the sequences provided herein, eg, conventional Southern blotting, quantifying mRNA transcription. Northern blotting method (Thomas, Proc. Natl. Acad. Sci. USA, 77:52)
01-5205 (1980)), the dot blot method (DNA analysis), or the in situ hybridization method, and can be directly measured in a sample. Alternatively, DNA
It is also possible to use an antibody capable of recognizing a specific double strand, including a double strand, an RNA double strand and a DNA-RNA hybrid double strand or a DNA-protein double strand. The antibody can then be labeled and the assay performed, wherein the duplex is surface bound, such that the antibody bound to the duplex at the time of surface duplex formation. Presence can be detected. Alternatively, gene expression can also be measured by immunological methods that directly quantitate the expression of the gene product, such as immunohistochemical staining of cells or tissue sections and cell culture or body fluid assays. Antibodies useful for immunohistochemical staining and / or assay of sample fluids may be monoclonal or polyclonal and can be prepared in any mammal. Conveniently, the antibody is the native sequence PRO364.
Or to a PRO175 polypeptide, or to a synthetic peptide based on the DNA sequences provided herein, or to an exogenous sequence fused to the DNA encoding PRO364 or PRO175 and encoding a specific antibody epitope. Can be prepared.

Purification of Polypeptides Forms of PRO364 or PRO175 can be recovered from culture medium or lysates of host cells. If membrane-bound, it can be released from the membrane using a suitable detergent solution (e.g. Triton -X T ^{M 100)} or by enzymatic cleavage. PRO364
Alternatively, cells used to express a nucleic acid encoding a PRO175 polypeptide can be disrupted by various chemical or physical means such as freeze-thaw cycling, sonication, mechanical disruption, or cell lysing agents. It may be desirable to purify PRO364 or PRO175 polypeptides from recombinant cell proteins or polypeptides. Purified by the following procedure, which is an example of a suitable purification procedure: fractionation on an ion exchange column; ethanol precipitation; reverse phase H.
PLC; chromatography on silica or cation exchange resins such as DEAE; chromatofocusing; SDS-PAGE; ammonium sulfate precipitation; gel filtration using eg Sephadex G-75; Protein A Sepharose column to remove contaminants such as IgG; and PRO364 Or a metal chelation column that binds an epitope-tagged form of PRO175 polypeptide. Known in the art, eg Deutcher, Methodes in Enzymology, 182 (1990); Scopes, Protei
n Purification: Principles and Practice, (Springer-Verlag, New York 1982
Many protein purification methods described in ()) can be used. The purification process chosen will depend, for example, on the production method used and the nature of the particular PRO364 or PRO175 polypeptide produced.

Uses of PRO364 or PRO175 polypeptides i. Cardiovascular, Endothelial and Angiogenic Activity Assays Various assays can be used to test the cardiovascular, endothelial and angiogenic activity of the polypeptides described herein. Such assays include those provided in the Examples below. Assays for testing endothelin antagonist activity disclosed in US Pat. No. 5,773,414 include rat ventricular binding assay, rabbit renal artery smooth muscle cells, which tests the ability of a polypeptide in a receptor assay to inhibit iodinated endothelin-I binding. Endothelin-receptor binding assay to test the intact cell binding of radiolabeled endothelin-I, using a functional activity in Rat-I cells In the inositol phosphate accumulation assay measured, an in vivo (isolated tube) study using male New Zealand rabbit endothelium, and an in vitro study using Sprague-Dawley rats, added compounds were placed in cultured vascular smooth muscle. Ability to reduce released endothelin-stimulated arachidonic acid An arachidonic acid release assay that measures

Assays for tissue-generating activity are described in, but not limited to, WO95 / 16035 (bone, cartilage, tendon); WO95 / 05846 (nerve, neuron), and WO91 / 07491 (skin, endothelium). Included. Wound healing activity assays are described, for example, by Eaglelstein and Mertz, J. Invest. Der.
Matol., 71: 382-384 (1978), modified by Winter, Epidermal Wound.
Healing, Maibach, HI and Rovee, DT, edited (Year Book Medical Publishers. Inc.
, Chicago), pp71-112 are included. A screening molecule for a test molecule associated with a PRO364 or PRO175 polypeptide that binds to the endothelin B ₁ (ETB ₁ ) receptor polypeptide and modulates signal transduction activity is described in US Pat. No. 5,773,223 as described in US Pat. Host cells transformed with DNA encoding a B ₁ receptor polypeptide are provided, the cells are exposed to a test candidate drug, and endothelin B ₁ receptor signal transduction activity is measured. There are several cardiac hypertrophy assays. In vitro assays include induction of adult rat heart myocyte diffusion. In this assay, ventricular myocytes were identified by Piper et al., “Adult ventricular rat heart muscle cells”, Cell Culture.
Techniques in Heart and Vessel Research.HM Piper.ed (Berlin: Springe
r-Verlag, 1990), pp.36-60 and isolated essentially from a single (male Sprague-Dawley) rat according to a modified version of the procedure. This procedure allows the isolation of adult ventricular myocytes and long-term culture of rod phenotype cells. Phenylephrine and prostaglandin F _2α (PGF _2α ) have been shown to induce a metastatic response in these adult cells. The inhibition of myocyte metastasis induced by PGF _2α or PGF _2α analogs (eg fluprostenol) and phenylephrine by various potential inhibitors of cardiac hypertrophy is then tested.

One example of an in vivo assay is to test the inhibition of fluprostenol-induced cardiac hypertrophy in vivo. This pharmacological model shows that PR inhibits cardiac hypertrophy induced in rats (eg, male Wistar or Sprague-Dawley) by subcutaneous injection of fluprostenol (an agonist analog of PGF _2α ).
Test the potency of O364 or PRO175 polypeptides. It is known that PGF _2α in the myocardium is chronically elevated to a detectable level in rats with pathological hypertrophy of the heart induced by myocardial infarction. Lai et al., Am. J
Physiol. (Heart Circ. Physiol.), 271: H2197-H2208 (1996). Therefore, factors capable of inhibiting the influence of fluprostenol on myocardial growth in vivo may be useful in the treatment of cardiac hypertrophy. PRO364 or PRO in cardiac hypertrophy
Efficacy of 175 Polypeptides in Heart, Ventricle, and Left Ventricle versus Fluprostenol-Treated Rats Not Receiving PRO364 or PRO175 Polypeptides
It is determined by measuring the weight (normalized by body weight). Another example of an in vivo assay is the pressure overload cardiac hypertrophy assay. In in vivo studies, it is common to induce pressure overload cardiac hypertrophy by contraction of the abdominal aorta of test animals. In a typical protocol, rats (e.g. male Wistar
Or Sprague-Dawley) is anesthetized, and the abdominal aorta of each rat is stenotic to just below the diaphragm. Beznak M., Can. J. Biochem. Physiol., 33: 985-94 (1955). The aorta is exposed by surgical incision and a short thick needle is placed next to the tube. The aorta is ligated with silk thread around the needle, contracted and immediately removed, reducing the lumen of the aorta to the diameter of the needle.
This approach is described, for example, by Rossi et al., Am. Heart J., 124: 700-709 (1992) and O'R.
Ourke and Reibel, PSEMB, 200: 95-100 (1992).

In another in vivo assay, the effect on cardiac hypertrophy following experimentally induced myocardial infarction (MI) is measured. In rats, acute MI is induced by left coronary artery ligation, which is further confirmed by electrocardiography. Also, a simulated operation group of animals is prepared as a control animal. Early data showed that cardiac hypertrophy was present in the group with MI, revealing an 18% increase in heart weight relative to body weight. Lai and others listed above. Candidate blockers for cardiac hypertrophy, eg PR
These animals were treated with O364 or PRO175 polypeptides, providing valuable information on the therapeutic potential of the candidate drugs tested. Further assay testing in inducing cardiac hypertrophy using Sprague-Dawley rats is described in US Pat. No. 5,773,41.
No. 5 is disclosed. To further understand the role of the genes identified herein in the pathogenesis and progression of tumors against cancer, the efficacy of therapeutic candidates including antibodies to native PRO364 or PRO175 polypeptides and other antagonists, such as small molecule antagonists. Various well-known animal models can be used to test E. coli. The in vivo nature of such models makes human patients particularly prognostic in their response. Animal models of tumors and cancers (breast cancer, colon cancer, prostate cancer, lung cancer, etc.) include non-recombinant and recombinant (transgenic) animals. Non-recombinant animal models include, for example, rodents, such as murine models. Such models use standard techniques, such as subcutaneous injection, tail vein injection, spleen transplantation, peritoneal transplantation, subrenal capsule or orthopin transplantation, such as colon cancer cells transplanted into colon tissue, It can be prepared by transferring tumor cells into syngeneic mice. See, for example, PCT Publication No. WO97 / 33551 published September 18, 1997. Probably the most frequently used animal species for oncogene studies are immunodeficient mice, especially nude mice. The finding that nude mice with thymus stimulation / dysplasia successfully act as hosts for human tumor xenografts has led to their widespread use for this purpose. Autosomal recessive nu genes include, for example, ASW, A / He, AKR,
BALB / c, B10, LP, C17, CH3, C57BL, C57, CBA,
DBA, DDD, I / st, NC, NFR, NFS, NFS / N, NZB, NZ
Introduced into a large number of clearly homologous nude mice, including C, NZW, P, RIII and SJL. In addition to nude mice, a wide variety of other animals that have inherited immunological deficiencies are raised and used as recipients of tumor xenografts. Further details can be found in, for example, The Nude Mouse in Oncology Research, E. Boven and B. Wino.
See grad. eds. (CRC Press, Inc., 1991).

Cells introduced into such animals are well-known tumor / cancer cells, eg, any of the tumor cell lines listed above, eg, the B104-1-1 cell line (transfected with the neu proto-oncogene). Stable NIH-3T3 cell line); ras-transfected NIH-3T3 cells;
Caco-2 (ATCC HTB-37); or a moderately differentiated grade II human colon adenocarcinoma cell line, HT-29 (ATCC HTB-38), or from tumors and cancers. Tumor or cancer cell samples are used in standard conditions, including freezing and storage in liquid nitrogen, and can be obtained from patients by surgery. Ka
rmali et al., Br. J. Cancer. 48: 689-696 (1983). Tumor cells can be introduced into animals such as nude mice by various procedures.
The subcutaneous (sc) space of mice is very suitable for tumor implantation. Tumors can also be transplanted as solid blocks with needle biopsies, eg by use of trochars, or cell suspensions. Tumor tissue fragments of suitable size for solid block or trocar implantation are introduced into the subcutaneous space. Cell suspensions are prepared fresh from primary tumor or stable tumor cell lines and injected subcutaneously. Tumor cells can also be injected as a subcutaneous implant. In this position, the implant is applied between the bottom of the dermal connective tissue and the subcutaneous tissue.

Animal models of breast cancer are described in Drebin et al., Proc. Nat. Acad. Sci. USA, 83: 9129-913.
3 (1986), e.g., rat neuroblast cells (ne
u oncogene) or neu-transformed NIH-3T3 cells into nude mice. Similarly, animal models of colon cancer can be made by passing colon cancer cells into animals, eg, nude mice, and allowing these animals to develop tumors.
Orthotopic models of human colon cancer in nude mice are described, for example, in Wang et al., Cancer R
esearch, 54: 4726-4728 (1994) and Too et al., Cancer Research, 55: 681-684 (1995).
). This model is based on AntiCancer, Inc., (San Diego, Californi
Based on the so-called "METAMOUSE ^TM " sold by a). Tumors generated in animals are removed and can be cultured in vitro. The cells from the in vitro culture are then passed to the animal. Such tumors may be for further testing or drug screening. Alternatively, the tumors obtained by passage can be isolated and RNA of pre-passage cells and cells isolated after one or more passage steps analyzed for differential expression of the gene of interest. To be done. Such passaging techniques can be performed on any well known tumor or cancer cell line. For example, Meth A, CMS4, CMS5, CMS21 and WEHI-164.
Is a highly regulated model to chemically induce fibrosarcoma in BALB / c female mice (DeLeo et al., J. Exp. Med., 146: 720 (1977)) and study the antitumor activity of various drugs. Provide the system. Palladino et al., J. Immunol., 138: 4023-4032 (1987). Briefly, tumor cells are grown in vitro in cell culture. The cell lines are washed and suspended in buffer at a cell density of 10x10 ⁶ to 10x10 ⁷ cells / ml before injecting the animals. The animals are then injected subcutaneously with 10 to 100 μl of cell suspension, with tumors appearing in 1 to 3 weeks.

In addition, one of the most thoroughly studied trial tumors, the mouse Lewis lung
The (3LL) carcinoma can be used as a tumor model for research. The efficacy of this tumor model correlates with a favorable effect in treating human patients diagnosed with small cell carcinoma of the lung (SCCL). This tumor can be introduced into normal mice by injecting tumor fragments from diseased mice or cells in culture. Zupi et al., Br. J. Cancer, 41: suppl. 4. 30 (1980). Evidence showed that tumors started with single cell injections and that a fairly high proportion of infected tumor cells survived. For more information on this tumor model, see Zacharski, Haemostasis,
16: 300-320 (1986). One way to evaluate the efficacy of test compounds in animal models with transplanted tumors is to measure tumor size before or after treatment. Traditionally, the size of transplanted tumors is measured with two or three dimensional slide calipers. Measurements limited to two dimensions do not accurately reflect tumor size; thus, mathematical formulas are usually used and converted to the corresponding quantities. However, tumor size measurements are very inaccurate. The therapeutic effect of a candidate drug can be described as better if the treatment-induced growth is delayed and the specific growth is delayed. Another important variable in the description of tumor growth is the time to double tumor burden. Also, a computer program for calculating and describing tumor growth,
For example, Rygaard and Spang-Thomsen, Proc. 6th Int. Workshop on Immune-Defici
The program reported by ent Animals. Wu and Sheng. eds. (Basel. 1989), p. 301 is available. However, it should be noted that post-treatment necrosis and inflammatory response may actually result in increased tumor size, at least initially.
Therefore, these changes need to be carefully monitored by a combination of morphometry and flow cytometric analysis.

In addition, the recombinant (transgenic) animal model is based on the PRO identified herein.
The coding site for the 364 or PRO175 gene can be introduced into the genome of the animal of interest and engineered using standard techniques for making transgenic animals. Animals that can be provided as targets for transgenic manipulation include, but are not limited to, mice, rats, rabbits, guinea pigs, sheep, goats,
Pigs and non-human primates such as baboons, chimpanzees and monkeys are included. Techniques well known in the art for introducing transgenes into such animals include:
Pronuclear microinjection (US Pat. No. 4,873,191); Retrovirus-mediated gene transfer into the embryo (eg Van der Putten et al., Proc. Nat. Acad. Sci. USA, 82: 6148-615).
(1985)); Targeting genes in embryonic stem cells (Thompson et al., Cell, 56: 312-321 (19
89)); embryo electroporation (Lo, Mol. Cell. Biol., 3: 1803-1814 (1983)
)); And sperm-mediated gene transfer. Lavitrano et al., Cell, 57: 717-73 (19
89). See, for example, US Pat. No. 4,736,866 for reviews. For purposes of the present invention, transgenic animals include those carrying the transgene in only some of their cells ("mosaic animals"). The transgene can be integrated as a single transgene or as a concatemer, for example,
It can be installed in head-to-head or head-to-tail tandem. Also, selective introduction of the transgene into a particular cell line is described, for example, in Lasko et al., Proc. Nat. Acad.
Sci. USA, 89: 6232-636 (1992). Expression of the transgene in transgenic animals can be monitored by conventional techniques. For example, Southern blot analysis or PCR amplification can be used to verify transgene integration. The expression level of mRNA can then be analyzed using techniques such as in situ hybridization, Northern blot analysis, PCR or immunocytochemistry. Animals are further tested for signs of tumor or cancer progression.

Alternatively, by homologous recombination between the altered genomic DNA encoding the PRO364 or PRO175 polypeptide and the endogenous gene encoding the PRO364 or PRO175 polypeptide introduced into the embryonic cell of the animal, "Knockout" animals can be constructed that have a defective or altered gene that encodes the PRO364 or PRO175 polypeptide identified. For example, a specific PRO3
A cDNA encoding 64 or PRO175 polypeptide can be used to clone genomic DNA encoding the polypeptide according to established techniques.
A portion of the genomic DNA encoding the particular PRO364 or PRO175 polypeptide can be deleted or replaced with another gene, such as the gene encoding a selectable marker used to monitor integration. Vectors typically contain constant flanking DNA (both at the 5'and 3'ends) for several kilobases. For example, for homologous recombination vectors, Thomas and Capecchi, Cell, 51: 503 (198
See 7). The vector is introduced into embryonic stem cells (for example, by electroporation), and cells in which the introduced DNA is homologously recombined with the endogenous DNA are selected. See, eg, Li et al., Cell, 69: 915 (1992). The selected cells are then injected into the blastocyst of an animal (eg mouse or rat) to form an assembled chimera. For example, Bradley, Teratocarcinomas and Embryonic Stem Cells: A Practical Ap
See proach, EJ Robertson, ed. (IRL, Oxford, 1987), pp. 113-152. The chimeric embryos are then transplanted into a suitable pseudopregnant female nanny and at intervals, "knockout" animals are created. Offspring with DNA that has been homologously recombined into germ cells are identified by standard techniques and can be used to breed animals in which all cells of the animal contain homologously recombined DNA. . Knockout animals are PRO
It is characterized by the absence of 364 or PRO175 polypeptide and the ability to protect against certain pathological conditions and the progression of that pathological condition.

The effects of antibodies specifically binding the PRO364 or PRO175 polypeptides identified herein, and other drug candidates, can be further tested in the treatment of spontaneous animal tumors. A suitable target for this study is feline oral squamous cell carcinoma (SCC). The feline oral SCC is highly invasive, and this malignant tumor is considered to be the most common oral malignant tumor in cats, and it is measured that 60% or more of oral tumors are repeated in this species. Although it rarely metastasizes to distant sites, the low incidence of metastases is reflected in the short survival of cats bearing this tumor. These tumors cannot be usually surgically treated due primarily to the anatomy of the feline oral cavity. Currently, there is no effective treatment for this tumor. Prior to entry into the study, each cat is biopsied for a complete clinical trial and scanned by computed tomography (CT). Cats diagnosed with squamous cell tumors of the sublingual mouth are excluded from this study. The tongue is paralyzed as a result of such tumors, and the animals are unable to feed themselves when the tumor dies from treatment. Each cat is treated repeatedly over a long period of time. Tumors will be photographed daily and then rechecked during the treatment period. After treatment, each cat is subjected to another CT scan. CT scans and chest radiographs are evaluated every 8 weeks thereafter. Data is,
It was evaluated as different in survival rate, reactivity and toxicity from the control group. Positive reactions require evidence of tumor regression, preferably with improved quality of life and / or increased lifespan. In addition, spontaneous animal tumors of dogs, cats and baboons such as fibrosarcoma, adenocarcinoma, lymphoma, chondroma, or leiomyosarcoma can also be tested. Of course, canine and feline mammary adenocarcinomas are a preferred model, and their appearance and properties are very similar to those of humans. However, the use of this model is limited by the rare occurrence of this type of tumor in animals. Also other in vitro and in vivo cardiovascular, endothelial and angiogenic tests well known in the art are suitable here.

Ii. Tissue distribution The results of cardiovascular, endothelial and angiogenic assays can now be demonstrated by further study, eg by measuring mRNA expression in various human tissues. As mentioned above, amplification of genes and / or expression of genes in various tissues is based on the sequences provided herein, using appropriately labeled probes, eg,
Traditional Southern blotting, Northern blotting to quantify mRNA transcription
(Thomas, Proc. Natl. Acad. Sci. USA, 77: 5201-5205 (1980)), dot blot method (DNA analysis), or in situ hybridization method. Alternatively, an antibody capable of recognizing a specific double strand including a DNA double strand, an RNA double strand and a DNA-RNA hybrid double strand or a DNA-protein double strand can be used. Alternatively, gene expression in various tissues can be measured by immunological methods that directly quantitate the expression of gene products, such as immunohistochemical staining of tissue sections and cell culture or body fluid assays. Antibodies useful for immunohistochemical staining and / or assay of sample fluids may be monoclonal or polyclonal and can be prepared in any mammal. Conveniently, the antibody is a native sequence PR
DNA for or against the O364 or PRO175 polypeptides
For sequence-based synthetic peptides, or to PRO364 or PRO175
It can be prepared against exogenous sequences fused to DNA and encoding specific antibody epitopes. General techniques for antibody production, and specific protocols for in situ-hybridization are provided below.

Iii. Antibody binding studies Anti-PRO3 which inhibits the effects of PRO364 or PRO175 polypeptides on endothelial cells or other cells used in cardiovascular, endothelial and angiogenic assays.
The results of cardiovascular, endothelial and angiogenic studies testing the potency of 64 or -PRO175 antibodies can be demonstrated by studying antibody binding. Examples of antibodies include polyclonal, monoclonal, humanized, bispecific and heteroconjugate antibodies, the preparation of which is described below. Antibody binding studies can be performed in any of the well known assay methods, such as competitive binding assays, direct and indirect sandwich assays, and immunoprecipitation assays. Zola
, Monoclonal Antibodies: A Manual of Techniques, (CRC Press, Inc. 1987) p
p. 147-158. Competitive binding assays rely on the ability of a labeled standard to compete for a test sample in binding a finite amount of antibody. The amount of target protein in the test sample is inversely proportional to the amount of standard bound by the antibody. To facilitate measurement of the amount of bound standard, the antibody is preferably insolubilized before and after competition, and analyte and standard that bind to the antibody are conveniently separated from unbound residual standard and analyte. To do. The sandwich assay uses two antibodies that are capable of binding different immunogenic moieties, or epitopes, or proteins to be detected. In the sandwich assay, the test sample to be analyzed is a first support immobilized on a solid support.
Of the antibody, followed by binding of the second antibody to the analyte, thus forming an insoluble three-site complex. See, eg, US Pat. No. 4,376,100. The second antibody is a detectable moiety which may itself be labeled (direct sandwich assay) or may be measured using an anti-immunoglobulin antibody which is labeled with a detectable moiety (indirect sandwich assay). Assay). For example, one type of sandwich assay is an ELISA assay, where the detectable moiety is an enzyme. In immunohistochemistry, tissue samples can be fresh, frozen, embedded in paraffin, or fixed with a preservative, such as formalin.

Iv. Cell-Based Tumor Assays Cell-based assays and animal models for cardiovascular, endothelial and angiogenic diseases, eg tumors, here demonstrate the findings of the cardiovascular, endothelial and angiogenic assays and are further identified herein. Genes can be used to understand the relationship between unwanted genes and the progression and pathogenesis of unwanted cardiovascular, endothelial and angiogenic cell growth. The role of the gene products identified herein in unwanted cardiovascular, endothelial, and angiogenic cell growth, eg, tumor progression and pathogenesis, may be associated with cells or cell lines identified as being stimulated or inhibited by PRO364 or PRO175 polypeptides. Can be used and tested. Such cells include, for example, those shown in the following examples. In a different approach, the ability of cells of well-known cell types involved in certain cardiovascular, endothelial and angiogenic diseases to be transfected with cDNAs, which cDNAs induce excessive growth or inhibit growth. To analyze. Where the cardiovascular, endothelial and angiogenic disease is cancer, suitable tumor cells include, for example, stable tumor cell lines such as the B104-1 cell line (stable NIH-3T3 transfected with the neu protooncogene.
Cell lines) and ras-transfected NIH-3T3 cells, which are capable of transfecting the desired gene and capable of monitoring tumorigenic growth. Then, using such transfected cell lines, the poly- or monoclonal antibody or antibody composition exerts cytostatic or cytotoxic activity in the growth of the transfected cells, or antibody-dependent cellular cells. The ability to inhibit tumorigenic cell growth by mediating toxicity (ADCC) is tested. In addition, cells transfected with the coding sequences of the genes identified herein can be used to identify candidate drugs for the treatment of cardiovascular, endothelial and angiogenic disorders such as cancer. In addition, primary media obtained from tumors of transgenic animals (described above) can be used in cell-based assays, although stable cell lines are preferred. Techniques for deriving certain cell lines from transgenic animals are well known in the art. See, eg, Small et al., Mol. Cell. Biol., 5: 642-648 (1985).

V. Gene Therapy Here, PRO364 or PRO175 polypeptides, and polypeptide agonists and antagonists may be used in accordance with the present invention by expression of those polypeptides in vivo, which is often referred to as gene therapy. There are two main ways to get the nucleic acid (sometimes contained within a vector) into the cells of the patient: in vivo and ex vivo. For in vivo delivery,
The nucleic acid is usually the site where a PRO364 or PRO175 polypeptide is required, ie the synthetic site for the PRO364 or PRO175 polypeptide, and if known, the biological activity of the PRO364 or PRO175 polypeptide. At the site (eg, wound), it is directly injected into the patient. For ex vivo treatment, the patient's cells are removed, nucleic acids are introduced into these isolated cells, and the modified cells are administered to the patient either directly or encapsulated in, for example, a porous membrane implanted in the patient (US (See Patent Nos. 4,892,538 and 5,283,187). There are various techniques available for introducing nucleic acids into living cells. These techniques rely on whether the nucleic acid is transferred in vitro to cultured cells or in vivo to a host of interest. Suitable techniques for transferring nucleic acids to mammalian cells in vitro include liposomes, electroporation, microinjection, transduction, cell fusion, DEAE-dextran, calcium phosphate precipitation and the like. Transduction is replication defective, recombinant virus (preferably retrovirus)
It involves binding the particles to cell receptors and then introducing the nucleic acid contained in the particles into the cells. A commonly used vector for ex vivo delivery of genes is the retrovirus.

Presently preferred for in vivo nucleic acid transfer technology is a viral or non-viral vector.
(Adenovirus, lentivirus, herpes simplex I virus, or adeno-associated virus (AAV)), and lipid-based systems (lipids useful for lipid-mediated transfer of genes are, for example, DOTMA, DOPE, and DC-Chol). ; For example, Tonkins
on et al., Cancer Investigation, 14 (1): 54-65 (1996)). The most preferred vector for use in gene therapy is a virus, most preferably adenovirus, AAV, lentivirus, or retrovirus. Viral vectors, such as retroviral vectors, include at least one transcription promoter / enhancer or locator, or alternative splicing, nuclear RNA.
Other factors that regulate gene expression by export or other means such as post-translational modification of messengers are included. In addition, viral vectors such as retroviral vectors contain a nucleic acid molecule that, when transcribed in the presence of the gene encoding the PRO364 or PRO175 polypeptide, is operably linked thereto and functions as a translation initiation sequence. Such vector constructs also include packaging signals suitable for the virus used, terminal repeats (LTRs) or portions thereof, and positive and negative strand primer binding sites (if they are not already present in the viral vector). . In addition, these vectors typically contain a signal sequence that causes the PRO364 or PRO175 polypeptide to be secreted from the host cell in which they are located. Preferably, the signal sequence for this purpose is a mammalian signal sequence, most preferably the native signal sequence for the PRO364 or PRO175 polypeptides. Optionally, the vector construct also contains a signal that directs polyadenylation and one or more restriction sites and translation termination sequences. By way of example, such vectors typically include a 5'LTR, a tRNA binding site, a packaging signal, an origin of second strand DNA synthesis, and a 3'LTR or a portion thereof. Other non-viral vectors such as cationic lipids, polylysines, and dendrimers can also be used.

In some situations, it may be desirable to provide the nucleic acid source with reagents that target the target cells, such as cell surface membrane proteins or target cell-specific antibodies, ligands for receptors on the target cells, and the like. When liposomes are used, proteins that bind to cell surface membrane proteins associated with endocytosis are used to promote targeting and / or uptake, such as capsid proteins or fragments thereof for specific cell types, cycling. Are antibodies that undergo internalization in, and proteins that target intracellular localization and improve intracellular half-life. Techniques for receptor-mediated endocytosis include, for example, Wu et al.
, J. Biol. Chem., 262: 4429-4432 (1987); and Wagner et al., Proc. Natl. Acad.
Sci., 87: 3410-3414 (1990). For a review of currently known gene marking and gene therapy protocols, see Anderson et al., Science, 256.
: 808-813 (1992). See also WO 93/25673 and references cited therein. Suitable gene therapy and methods for making retroviral particles and structural proteins include
Found in US Pat. No. 5,681,746.

Vi. Uses of Genes as Diagnostic Methods The present invention also relates to uses of genes encoding PRO364 or PRO175 polypeptides as diagnostic methods. Variants in PRO364 or PRO175 polypeptides are responsible for tumors, so mutated forms of PRO364 or PRO1
75 polypeptides may be detected in cardiovascular, endothelium and angiogenic disorders, or cardiovascular,
It enables the diagnosis of infectivity to endothelium and angiogenic diseases such as tumors. Individuals carrying variants in the gene encoding human PRO364 or human PRO175 polypeptides will have DNA levels detected by a variety of techniques. Diagnostic nucleic acids can be obtained from patient cells, such as blood, urine, saliva, tissue biopsies, and autopsy materials. Genomic DNA is enzymatically amplified using PCR prior to analysis
(Saiki et al., Nature, 324: 163-166 (1986)) or can be used directly for detection. RNA or cDNA can be used for the same purpose. As an example, a PC complementary to a nucleic acid encoding a PRO364 or PRO175 polypeptide.
The R primer can be used to identify and analyze PRO364 or PRO175 polypeptide variants. For example, deletions and insertions can be detected by changes in the size of the amplification product compared to the normal genotype. Point mutations were identified by hybridizing amplified DNA to radiolabeled RNA encoding PRO364 or PRO175 polypeptides, or radiolabeled antisense DNA sequences encoding PRO364 or PRO175 polypeptides. can do. Preferred compatible sequences can be distinguished from non-compatible duplexes by RNase A digestion or different melting temperatures.

Genetic testing based on DNA sequence differences is based on DNA in gels with or without denaturing agents.
This is accomplished by detecting changes in the electrophoretic mobility of the fragment. Small sequence deletions and insertions can be visualized by high resolution gel electrophoresis. DNA fragments of different sequences are distinguished in denaturing formamidine gradient gels, and migration of different DNA fragments is inhibited at different positions of the gel by the particular melting or partial melting temperature. For example, Myers et al., Science, 230: 1242 (1985). Sequence changes at specific positions may also be accompanied by nuclease protection assays, such as RNase and SI protection, or chemical cleavage methods, such as Cotton et al., Proc. Nat. Acad. S.
ci. USA, 85: 4397-4401 (1985). Thus, deletion of a particular DNA sequence may result in hybridization, RNase protection, chemical cleavage, direct DNA sequencing, or use of restriction enzymes such as restriction fragment length polymorphism (RF
LP), and Southern blotting of genomic DNA.

Vii. Uses for detecting PRO364 or PRO175 polypeptide levels In addition to the more common gel electrophoresis and DNA sequencing, mutations can also be detected by in situ analysis. Expression of nucleic acids encoding PRO364 or PRO175 polypeptides is associated with vascular disease or neovascularization associated with tumorigenesis. PRO364 or P
When the RO175 polypeptide has a signal sequence, mRNA is highly expressed in endothelial cells, whereas it is low in smooth muscle cells, which indicates that PRO
It has been shown that 364 or PRO175 polypeptides are present in serum. Therefore, changes in the levels of this PRO364 or PRO175 polypeptide are indicative of vascular disease associated with tumorigenesis, or neovascularization.
Anti-PRO364 or -PRO175 polypeptide antibodies can be used in the diagnosis of such diseases. A competition assay may be used in which an antibody specific for PRO364 or PRO175 polypeptide is attached to a solid support and labeled PRO364 or PRO175 polypeptide and a sample derived from the host are passed over the solid support, The amount of detected label attached to the solid support can be correlated with the amount of PRO364 or PRO175 polypeptide in the sample.

Viii. Chromosome Mapping The sequences of the invention are also valuable for chromosome identification. The sequence is specifically targeted to and can hybridize to a specific location on an individual's human chromosome.
In addition, there is currently a need to identify specific sites on the chromosome. The actual array data (
Several chromosome marking reagents based on repeat polymorphisms) are currently available for marking chromosomal locations. The chromosomal DNA mapping of the present invention is an important first step in correlating its sequence with disease-related genes. Briefly, the sequence varies from cDNA to PCR primer (preferably 15-25
It can be mapped to a chromosome by preparing base pairs). Using computer analysis of the 3'-untranslated region, primers that are not spanned by more than one exon of genomic DNA are quickly selected, thus further complicating the amplification process. These primers are then used for PCR screening of somatic cell hybrids containing individual human chromosomes. Only hybrids containing the human gene corresponding to the primer will make an amplified fragment. PCR mapping of somatic cell hybrids is a rapid procedure for assigning specific DNA to specific chromosomes. Using similar oligonucleotide primers in the present invention, sub-localization can be achieved in a similar manner with pools of large genomic clones or panels of fragments from specific chromosomes. Similarly, other mapping methods available for mapping to that chromosome include:
Includes in situ hybridization, prescreening with labeled flow-sorted chromosomes, and preselection by hybridization to assemble a chromosome-specific cDNA library.

Fluorescence in situ hybridization of cDNA clones to metaphase chromosome expansion (F
ISH) can be used to provide the correct chromosomal location in one step. This technique can be used with cDNA as short as 500 or 600 bases;
Clones longer than 2000 base pairs are likely to bind to a unique chromosomal location with sufficient signal strength for simple detection. For FISH, PRO
The use of clones inducing genes encoding 364 or PRO175 polypeptides is required, the longer the better. For example, 2000 base pairs is good, 4000 base pairs is more preferred, and even above 4000 is probably not necessary to get good results for a reasonable percentage of the time. For a review of this technology, Verma et al., Human Chromosomes; a Manual of Basic Tec
See hniques (Pergamon Press, New York. 1988). Once the sequence is mapped to exact chromosomal locations, the physical location of the sequence on the chromosome is correlated with genetic map data. Such data is, for example, V. M.
cKusick, Mendelian Inheritance in Man (Johns Hopkins University Welch Med
(available online from the ical Library). The relationship between genes and diseases that map to the same chromosomal region is then identified by linkage assay (co-inheritance of physically adjacent genes). Next, it is necessary to determine the differences in the cDNA or genomic sequence between diseased and non-diseased individuals. A mutation is considered to be the cause of the disease if the mutation is found in some or all of the individuals affected by the disease and not in normal individuals. According to the current resolution of physical mapping and gene mapping techniques, a cDNA located exactly in a chromosomal region associated with a disease is one between 50 and 500 potentially causative genes (which means 1 megabase Mapping resolution of 20k
(It is assumed that there is one gene per b).

Ix. Screening Assays for Candidate Drugs The present invention also includes methods of screening compounds to identify those that mimic PRO364 or PRO175 polypeptides (agonists) or inhibit the effects of PRO364 or PRO175 polypeptides (antagonists). Screening assays for antagonist candidate drugs inhibit compounds that bind to or complex the PRO364 or PRO175 polypeptides encoded by the genes identified herein, or otherwise the interaction of the encoded polypeptides with other cellular proteins. Designed to identify compounds that Such screening assays include those applicable to high throughput screening of chemical libraries, making them particularly suitable for identifying small molecule drug candidates. This assay is performed in a variety of formats, including protein-protein binding assays, biochemical screening assays, immunoassays, and cell-based assays, which are well characterized in the art. All assays for antagonists involve contacting a candidate drug with a PRO364 or PRO175 polypeptide encoded by the nucleic acid identified herein under conditions and for a time and conditions sufficient for these two components to interact. Common in needing.

In binding assays, the interaction is binding and the complex formed is either isolated or detected in the reaction mixture. In a particular embodiment, a PRO364 or PRO175 polypeptide or candidate drug encoded by a gene identified herein is covalently or non-covalently immobilized to a solid phase, eg, a microtiter plate. Non-covalent attachment generally is accomplished by coating the solid surface with a solution of PRO364 or PRO175 polypeptide and drying. Alternatively, an immobilized antibody specific for the PRO364 or PRO175 polypeptide to be immobilized, eg, a monoclonal antibody, can be used to anchor it to a solid surface. The assay is performed by adding the non-immobilized component, which may be labeled with a detectable label, to the immobilized component, eg, the coated surface containing the anchored component. When the reaction is complete, unreacted components are removed, for example by washing, and the complex adhered to the solid surface is detected. When the first non-immobilized component carries a detectable label, detection of the label immobilized on the surface indicates that complex formation has occurred. If the first non-immobilized component has no label, complex formation can be detected, for example, by using a labeled antibody that specifically binds to the immobilized complex.

Specific PRs with which the candidate compound interacts but is encoded by the gene identified here
If it does not bind to O364 or PRO175 polypeptides, its interaction with the polypeptide can be assayed by well known methods to detect protein-protein interactions. Such assays include traditional techniques such as cross-linking, co-immunoprecipitation, and co-purification through gradients or chromatographic columns. In addition, protein-protein interactions are reported by Chevray and Nathans, Pro.
c.Natl. Acad. Sci. USA 89, 5789-5793 (1991), F
ields and collaborators (Fiels and Song, Nature (London) 340, 245-246 (1989);
It can be monitored by using the yeast-based gene system described in Chien et al., Proc. Natl. Acad. Sci. USA 88, 9578-9582 (1991)). Yeast GAL
Many transcriptional activators, such as 4, consist of two physically distinct modular domains, one acting as a DNA binding domain and the other functioning as a transcriptional activation domain. The yeast expression system described in the previous literature (generally referred to as the "2-hybrid system") takes advantage of this property and uses two hybrid proteins, while the target protein is the DNA binding domain of GAL4. On the other hand, the candidate activating protein is fused to the activation domain. GAL
Expression of the 1-lacZ reporter gene under the control of the GAL4-activating promoter depends on the reconstitution of GAL4 activity via protein-protein interactions. Colonies containing interacting polypeptides are detected with a chromogenic substance for β-galactosidase. Complete kit (MATC) for identifying protein-protein interactions between two specific proteins using 2-hybrid technology
HMAKER ^™ ) is commercially available from Clontech. This system can be extended to the mapping of protein domains involved in a particular protein interaction, as well as the identification of amino acid residues important for this interaction.

A compound that inhibits the interaction of a gene encoding a PRO364 or PRO175 polypeptide identified herein with an intracellular or extracellular component can be tested as follows: Usually, the reaction mixture is combined with the gene product. Extracellular or intracellular components
One product is prepared under conditions and for time of interaction and binding. To test the ability of a candidate compound to inhibit binding, the reaction is performed in the absence and presence of the test compound. In addition, placebo may be added to the third reaction mixture to provide a positive control. The binding (complex formation) between the test compound and intracellular or extracellular components present in the mixture is monitored as described above. The formation of the complex in the control reaction but not in the reaction mixture containing the test compound indicates that the test compound inhibits the interaction between the test compound and its binding partner. The PRO364 or PRO175 polypeptide is a co-mitogen ConA
If one has the ability to stimulate the proliferation of endothelial cells in the presence of, one example of a screening method will take advantage of this ability. In particular, in a proliferation assay, human umbilical vein endothelial cells were obtained, cultured in 96-well flat bottom culture dishes (Costar, Cambridge, MA), supplemented with an appropriate reaction mixture to facilitate cell proliferation, and the mixture was Con-A (
Calbiochem, La Jolla, CA). After adding Con-A and the compound to be screened and incubating at 37 ° C, the culture is labeled with ^3- H thymidine and collected on glass fiber filters (phD; Cambridge Technology, Cambridge Technology,
Watertown, MA). Average ^3- (H) thymidine incorporation (cpm) of 3 media is measured using a liquid scintillation counter (Beckman Instruments. Irvine. CA). Significant ^3- (H) thymidine contamination was shown in stimulating endothelial cell proliferation.

To assay for antagonists, the assay described above is performed, in which PRO364 or PRO175 polypeptide may be added along with the compound to be screened and the ^3- (H ) The ability of a compound to inhibit thymidine incorporation depends on whether the compound is PRO364
Or an antagonist of the PRO175 polypeptide. Alternatively,
Antagonists include PRO364 or PRO175 polypeptides and membrane-bound PR
Potential antagonists with O364 or PRO175 polypeptide receptors or recombinant receptors may be detected by binding under conditions suitable for competitive inhibition assays. The PRO364 or PRO175 polypeptide can be labeled, such as by radioactivity, and the number of PRO364 or PRO175 polypeptide molecules bound to the receptor can be used to determine the efficacy of a potential antagonist. The gene encoding the receptor can be identified by many methods known to those of skill in the art, such as ligand panning and FACS sorting. Coligan et al., Current Protocols
in Immun., 1 (2): Chapter 5 (1991). Preferably, expression cloning is used, polyadenylated RNA is prepared from cells responsive to PRO364 or PRO175 polypeptide, and the cDNA library generated from this RNA is distributed into pools to COS cells or PRO364 or PRO175 polypeptides. Used for transfection of other non-reactive cells. Transfected cells grown on glass slides are exposed to labeled PRO364 or PRO175 polypeptides. PR
The O364 or PRO175 polypeptides can be labeled by a variety of means including iodination or inclusion of recognition sites for site-specific protein kinases. After fixation and incubation, slides are subjected to autoradiographic analysis. Positive pools are identified and subpools are prepared and retransfected using an interactive subpooling and rescreening step, resulting in the generation of a single clone encoding the putative receptor.

As an alternative approach to receptor identification, labeled PRO364 or PRO175 polypeptides can be photoaffinity-linked with cell membrane or extract preparations that express the receptor molecule. The crosslinked material is dissolved in PAGE and exposed to X-ray film. Excitation of the labeled complex containing the receptor, separation into peptide fragments,
Protein microsequencing can be performed. The amino acid sequences obtained from the microsequences are used to design a set of degradable oligonucleotide probes that screen a cDNA library to identify genes encoding putative receptors. In another assay for antagonists, mammalian cells or membrane preparations expressing the receptor are incubated with labeled PRO364 or PRO175 polypeptide in the presence of the candidate compound. The ability of the compound to enhance or block this interaction is then measured. Compositions useful in the treatment of cardiovascular, endothelial and angiogenic disorders include, but are not limited to, antibodies, small organic and inorganic molecules, peptides, phosphopeptides that inhibit the activity and / or expression of target gene products, Includes antisense and ribozyme molecules, triple helix molecules. A more specific example of a potential antagonist is an oligonucleotide that binds to a fusion of an immunoglobulin and a PRO364 or PRO175 polypeptide, especially
Including, but not limited to, poly- and monoclonal antibodies and antibody fragments, single chain antibodies, anti-idiotypic antibodies, and chimeric or humanized forms of these antibodies or fragments, and antibodies including human antibodies and antibody fragments . Alternatively, the potential antagonist is a closely related protein, eg, a mutated form of a PRO364 or PRO175 polypeptide that recognizes but does not affect the receptor, thereby competitively inhibiting the action of the PRO364 or PRO175 polypeptide. Good.

Other potential PRO364 or PRO175 polypeptide antagonists or agonists are antisense RNA or D prepared using antisense technology.
An NA construct, eg, an antisense RNA or DNA molecule, is a target mRN.
It acts to directly block the translation of mRNA by hybridizing to A and interfering with protein translation. Antisense technology can be used to control gene expression through triple helix formation or antisense DNA or RNA, both of which methods are based on the binding of polynucleotides to DNA or RNA. For example, the 5'coding portion of the polynucleotide sequence encoding the mature PRO364 or PRO175 polypeptides herein is used in the design of antisense RNA oligonucleotides of about 10 to 40 base pairs in length. DNA oligonucleotides are designed to be complementary to regions of the gene involved in transcription (Triple Helix-Lee et al., Nucl, Acid Res., 6: 3073 (1979); Cooney et al., Science,
241: 456 (1988); Dervan et al., Science, 251: 1360 (1991)), which gives P
Prevents transcription and production of RO364 or PRO175 polypeptides. The antisense RNA oligonucleotide hybridizes to the mRNA in vivo and m
Block translation of RNA molecules into PRO364 or PRO175 polypeptides (
Antisense-Okano, Neurochem., 56: 560 (1991); Oligodeoxynucleotides a
s Antisense Inhibitors of Gene Expression (CRC Press: Boca Raton, FL, 19
88)). The oligonucleotides described above can also be delivered to cells to express antisense RNA or DNA in vivo and inhibit the production of PRO364 or PRO175 polypeptides. If antisense DNA is used, oligodeoxyribonucleotides derived from the translation initiation site, eg, between the -10 and +10 positions of the target gene nucleotide sequence, are preferred.

Potential antagonists bind to the active site, receptor binding site, or growth factor or other related binding site of PRO364 or PRO175 polypeptides, thereby blocking the normal biological activity of PRO364 or PRO175 polypeptides. Including small molecules. Examples of small molecules include, but are not limited to, small peptides or peptide-like molecules, preferably soluble peptides, and synthetic non-peptide organic or inorganic compounds. Ribozymes are enzymatic RNA molecules capable of catalyzing the specific cleavage of RNA. Ribozymes act by sequence-specific hybridization to complementary target RNA, followed by endonucleolytic cleavage. Specific ribozyme cleavage sites within potential RNA targets can be identified by known techniques. Further details can be found in, for example, Rossi, Current B
Biology 4: 469-471 (1994) and PCT Publication No. WO 97/33551 (Published September 18, 1997)
Please refer to. Nucleic acid molecules in triple-helix formation used to inhibit transcription are single-stranded and composed of deoxynucleotides. The basic composition of these oligonucleotides is designed to promote triple helix formation via Hoogsteen base pairing rules,
It generally requires resizable extension of purines or pyrimidines on one strand of the duplex. Further details can be found, for example, in PCT Publication No. WO 97/33551, cited above.
Please refer to. These small molecules can be identified by any one or more of the screening assays discussed above and / or by any other screening technique well known to those of skill in the art.

X. Types of Cardiovascular, Endothelial and Angiogenic Diseases Treated Having Activity in the Cardiovascular, Endothelial and Angiogenic Assays Described Here,
And / or their gene products have been found to be located in the cardiovascular system P
RO364 or PRO175 polypeptides or their agonists or antagonists are likely to have therapeutic applications in a variety of cardiovascular, endothelial and angiogenic disorders, including systemic disorders affecting blood vessels, such as diabetes mellitus. Their therapeutic effectiveness may include diseases of the arteries, capillaries, veins, and / or lymphatic vessels. Therapeutic examples below include muscle wasting disease treatment, osteoporosis treatment, transplant fixation aids to stimulate cell growth around the transplant, thus facilitating binding to its intended site, IGF stability in tissue or serum. And, where appropriate, increased binding to the IGF receptor (as it has been shown in vitro that IGF enhances the growth of human bone marrow erythroid and granulocyte progenitor cells). The PRO364 or PRO175 polypeptides or agonists or antagonists thereof also stimulate erythropoiesis or granulopoiesis, stimulate wound healing and tissue regeneration, and affect tissues such as connective tissue, skin, bone, cartilage, muscle, lung. Alternatively, it may be used in conjunction with renal regrowth-related therapies and to promote angiogenesis, stimulate or inhibit endothelial cell migration, and enhance vascular smooth muscle growth and endothelial cell production. P
Increased angiogenesis mediated by RO364 or PRO175 polypeptides or antagonists is beneficial in the ischemic tissue and the collateral coronary arteries of the heart following coronary stenosis. Antagonists inhibit the action of such polypeptides and, if the PRO364 or PRO175 polypeptides promote such production, limit excessive connective tissue production, for example during wound healing or embryonic fibrosis. Used for. This includes acute myocardial infarction and heart failure.

Furthermore, the present invention provides a therapeutically effective amount of PRO364 or PR regardless of cause.
Treatment of cardiac hypertrophy by administering O175 polypeptides, or agonists or antagonists thereof. PR if the goal is to treat human patients
The O364 or PRO175 polypeptide is preferably recombinant human PRO364.
Or a PRO175 polypeptide (rhPRO364 or PRO175 polypeptide). Treatment of cardiac hypertrophy can be performed at any of its various stages resulting in a wide variety of medical conditions, including myocardial infarction, hypertension, hypertrophic cardiomyopathy, and heart valve regurgitation. Treatment can be extended to all stages of the progression of cardiac hypertrophy, with or without structural damage to the myocardium, regardless of the underlying heart disease. Unlike antagonists of a molecule, the decision to use the molecule itself or its agonists for a particular indication is mainly determined by the molecule promoting cardiovascularization, endothelial cell development, or angiogenesis, or Depends on whether or not to inhibit the pathology of. For example, if the molecule promotes angiogenesis, its antagonists would be useful in the treatment of diseases where it is desired to limit or prevent angiogenesis. Examples of such diseases are associated with hemangiomas such as hemangiomas, tumor angiogenesis, retinal neovascularization, diabetic retinopathy or premature infantile retinopathy or macular degeneration and proliferative vitreoretinopathy. Choroid or cornea, rheumatoid arthritis, Crohn's disease, atherosclerosis, ovarian hyperstimulation, psoriasis, endometriosis associated with neovascularization, restenosis following balloon angioplasty, scar tissue overgrowth, eg surgery Such as later formed keloids, fibrosis after myocardial infarction, or fibrotic disorders associated with embryonic fibrosis. However, if the molecule inhibits angiogenesis, it is expected to be used directly in the treatment of the above mentioned pathologies.

On the other hand, if the molecule stimulates angiogenesis, itself (or an agonist thereof) may be, for example, peripheral vascular disease, hypertension, vasculitis, Raynaud's disease and Raynaud's phenomenon, aneurysm and arterial restenosis, thrombophlebitis. , Lymphangitis, lymphedema, wound healing and tissue repair,
It is used for indications where angiogenesis is desired, such as ischemia-reperfusion injury, angina, myocardial infarction, eg acute myocardial infarction, chronic heart disease, heart failure, eg congestive heart failure, and osteoporosis. However, if the molecule inhibits angiogenesis, its antagonists are used in the treatment of conditions in which angiogenesis is desired. Described below are specific types of diseases for which the PRO364 or PRO175 polypeptides or antagonists thereof will be useful as therapeutic targets for the prevention or treatment of diseases, or for targeted vascular agents. Atherosclerosis is a disease characterized by the accumulation of plaques in the thickened intima of the arteries due to fluid accumulation, smooth muscle cell proliferation, and the formation of fibrous tissue within the arterial wall. is there. The disease affects large, middle and small arteries in any organ. Altered endothelial and vascular smooth muscle cell function is known to play an important role in regulating the accumulation and relaxation of these plaques. Hypertension is characterized by elevated blood pressure in the systemic arteries, pulmonary arteries, or portal system. Elevated blood pressure results from or results in defective endothelial function and / or vascular disease.

Vasculitis includes giant cell arteritis, Takayas arteritis, polyarteritis nodosa (including microangiopathy forms), Kawasaki disease, micropolyangiitis, Wegener's granulomatosis, various infectious diseases. Included are associated vascular diseases, including Henoch-Schonlein purpura. Altered endothelial cell function has been shown to be important in these diseases. Raynaud's disease and phenomenon are those characterized by intermittent abnormal defects in the circulation through limbs exposed to cold air. Altered endothelial cell function has been shown to be important in these diseases. An aneurysm is a saccular or fusiform dilatation of an arterial or venous dendritic tree associated with altered endothelial cells and / or vascular smooth muscle cells. Arterial restenosis (arterial wall restenosis) follows angiogenesis as a result of altered endothelial and vascular smooth muscle cell proliferation and function. Thrombophlebitis and lymphangitis are inflammatory diseases of the veins and lymphatic vessels that result and / or result in altered endothelial cell function, respectively. Similarly, lymphedema is a condition associated with defects in the lymphatic vessels from endothelial cell function. The family of benign and malignant vascular tumors is characterized by abnormal growth and growth of cellular elements of the vasculature. For example, lymphangioma is a congenital, often benign tumor of the lymphatic system of the bladder, a lymphoid malformation that usually occurs in newborns. Bladder tumors tend to grow in adjacent tissues. Bladder tumors usually occur in the cervix and axilla. They also occur in the soft tissues of the extremities. The main manifestation is swelling, sometimes lymph cysts surrounded by reticularly structured lymphoid and connective tissue.
Lymphangioma has been hypothesized to result from improper binding to fetal lymphatic vessels or their deletions. The result is local damage to lymph drainage. Griener
Et al, Lymphology, 4: 140-144 (1971).

Another use of the PRO364 or PRO175 polypeptides or antagonists herein is in tumor angiogenesis, which is involved in angiogenesis of tumors that can grow and / or metastasize. This process depends on the growth of new blood vessels. Examples of related pathologies involving neoplasia and tumor angiogenesis include breast cancer, lung carcinoma, gastric carcinoma, esophageal carcinoma, colorectal carcinoma, liver carcinoma, ovarian carcinoma, tecoma, male embryonal tumor, cervical carcinoma, uterus. Endometrial carcinoma, endometrial hyperplasia, endometriosis, fibrosarcoma, choriocarcinoma, head and neck cancer, nasopharyngeal carcinoma, laryngeal carcinoma, hepatoblastoma, Kaposi's sarcoma, melanoma, skin carcinoma, blood vessels Tumor, marine hemangioma, hemangioblastoma, pancreatic carcinoma, retinal carcinoma, astrocytoma, glioblastoma, Schwannoma,
Oligodendroma, medulloblastoma, neuroblastoma, rhabdomyosarcoma, osteogenic sarcoma, leiomyosarcoma, urosarcoma, thyroid carcinoma, Wilms tumor, renal cell carcinoma, prostate carcinoma, nevus (phak)
abnormal blood vessel growth associated with omatoses, edema (eg, associated with brain tumors), and Meigs syndrome. Age-related macular degeneration (AMD) is the cause of severe visual loss in the elderly population. The exudative form of AMD is characterized by choroidal neovascularization and retinal pigment endothelial cell detachment. PR because choroidal neovascularization is associated with a dynamic decline in prognosis
The O364 or PRO175 polypeptides or their antagonists are expected to be useful in reducing severe AMD.

Also, wound healing, eg, wound healing and tissue repair, is described herein in PRO364.
Or, the intended use of PRO175 polypeptides or their antagonists. The formation and relaxation of new blood vessels is essentially tissue healing and repair. This category includes bone or cartilage, tendon, ligament, and / or nerve tissue growth or regeneration, as well as wound healing and tissue regeneration and replacement, and treatment of burns, amputations, and ulcers.
PRO364 that induces cartilage and / or bone growth in environments where bone is not formed properly
Alternatively, the PRO175 polypeptide or antagonists thereof is indicated for the treatment of bone fracture and cartilage damage, or human and other animal defects. PRO364 or PR
Such preparations using O175 polypeptides or antagonists thereof are prophylactically used in reducing fractures and improving fixation of artificial joints. New bone formation induced by osteogenic agents contributes to the repair of congenital, trauma-induced, or oncological, resection-induced cranial defects and is also useful in cosmetic plastic surgery. Moreover, PRO364 or PRO175 polypeptides or antagonists thereof are better and faster for treating unhealed wounds including, but not limited to, pressure ulcers, ulcers associated with vascular insufficiency, surgical or traumatic wounds, and the like. Useful for promoting occlusion. Still further, PRO364 or PRO175 polypeptides or antagonists thereof may be used in other tissues, such as organs (including, for example, pancreas, liver, intestine, kidney, skin or endothelium), muscles (smooth muscle, skeletal muscle or myocardium), and blood vessels. It may exhibit the activity of promoting the production or regeneration of tissues (including vascular endothelium), or the growth of cells containing such tissues. Part of the desired effect is to inhibit or regulate fibrotic scarring and regenerate normal tissue.

The PRO364 or PRO175 polypeptides or antagonists herein are also useful in the pathology from systemic cytokine damage, and in the reperfusion of wounds in various tissues, the treatment of lung or liver fibrosis, and the regeneration or protection. is there. Also, PR
The O364 or PRO175 polypeptides or antagonists thereof are useful for promoting or inhibiting differentiation of the aforementioned tissues from precursor tissues or cells, or for inhibiting the growth of the aforementioned tissues. In addition, PRO364 or PRO175 polypeptides or antagonists thereof can be used in the treatment of periodontal disease and other tooth repair processes. Such agents are provided in an environment that attracts osteogenic cells, stimulates the growth of osteogenic cells, or induces the differentiation of osteogenic cell progenitors. The PRO364 or PRO175 polypeptides or antagonists thereof herein stimulate osteoporosis or osteoarthritis, eg, bone and / or cartilage repair, as blood vessels play an important role in regulating bone rotation and growth. Alternatively, it is useful for treatment by blocking the process of tissue destruction (collagenase activity, osteoclasts, etc.) mediated by inflammatory processes or inflammation. Another category of tissue regeneration activity, herein referred to as the PRO364 or PRO175 polypeptides or its antagonists, is tendon / ligament formation. Proteins that induce the formation of tendon / ligament-like tissue or other tissues in environments where tissue is not normally formed are applied to the healing of tendon or ligament tears, malformations, and tendon or ligament defects in humans and other animals. It Such preparations are prophylactically used in the prevention of damage to tendon or ligament tissue, as well as the improved fixation of tendon or ligament to bone or other tissue, and the repair of tendon or ligament tissue defects. New Tendon / Ligament-Like Tissue Formation Induced by a Composition of PRO364 or PRO175 Polypeptides or Antagonists Thereof Contributes to Repair of Tendon or Ligament Defects of Congenital, Trauma-Induced, or Other Origin It is also useful in cosmetic plastic surgery for tendon or ligament attachment or repair. The composition herein attracts tendon- or ligament-forming cells, stimulates growth of tendon- or ligament-forming cells, induces differentiation of tendon- or ligament-forming cell progenitors, or recovers ex vivo, in vivo. Is provided in an environment that induces growth of tendon / ligament cells or progenitors in the tissue repair effect of. The compositions herein are also useful for tendinitis, carpal tunnel syndrome, and other tendon or ligament defects. In addition, the composition comprises the same suitable matrix and / or sequestrant as carriers well known in the art.

PRO364 or PRO175 polypeptides or antagonists thereof may be used for the proliferation of nerve cells and regeneration of nerve and brain tissue, ie degeneration of nerve cells or nerve tissue,
It is useful in the treatment of central and peripheral nervous system illnesses and neuropathy associated with death or trauma, as well as mechanical or traumatic disorders. In particular, PRO364 or PRO175 polypeptides or antagonists thereof are useful for treating diseases of the peripheral nervous system, such as peripheral nerve injury,
It is used in the treatment of peripheral and local neuropathy, and diseases of the central nervous system such as Alzheimer's disease, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis, and Shy-Drager syndrome. Additional medical conditions treated with the present invention include mechanical or traumatic disorders such as spinal cord disorders, head trauma and cerebrovascular disorders such as stroke. Also, peripheral neuropathy resulting from chemotherapy or other medical therapies,
Treatment is possible using PRO364 or PRO175 polypeptides or antagonists thereto. Ischemia-reperfusion injury is another sign. Endothelial cell dysfunction is important both in the initiation and regulation of sequelae of events that follow ischemia-reperfusion injury. Rheumatoid arthritis is a further sign. The target of inflammatory cells that cross the blood vessel growth and vasculature is an important factor in the pathogenesis of the rheumatoid and serum negative forms of arthritis.

The PRO364 or PRO175 polypeptides or antagonists thereof are also administered prophylactically to patients with cardiac hypertrophy to prevent progression of the condition and to avoid sudden death, including death of asymptomatic patients. Such prophylactic treatment is in the case of patients diagnosed with large left ventricular cardiac hypertrophy (maximum wall thickness of 35 mm or more in adults, or comparable in children), or of hemangiomas in the heart. This is especially justified in the case of particularly heavy loads. In addition, PRO364 or PRO175 polypeptides or antagonists thereof are useful in treating atrial fibrillation, which is expressed in a significant portion of patients diagnosed with hypertrophic cardiomyopathy. Further signs include angina, myocardial infarction, eg acute myocardial infarction, and heart failure,
For example, congestive heart failure is included. Further, non-neoplastic conditions include psoriasis, diabetes, and premature retinopathy, posterior lens fibroplasia, other proliferative retinopathy including neovascular glaucoma, thyroid hyperplasia (including Graves' disease), cornea and others. Tissue transplantation, chronic inflammation, pneumonia, nephrotic syndrome, preeclampsia, ascites, pericardial effusion (eg, associated with pericarditis), and pleural effusion. In view of the above, the PRO364 or PRO175 polypeptides described herein, or agonists or antagonists thereof, which have been shown to alter or impact endothelial cell function, proliferation and / or morphology, are Or, it plays an important role in the etiology and etiology of all diseases and could be provided as a vascular-related agent targeting these diseases, or as a therapeutic target to augment or inhibit these processes.

Xi. Administered Procotol, Schedule, Dose and Formulation The molecules described herein and their agonists and antagonists are pharmaceutically useful as prophylactic and therapeutic agents for the various diseases and conditions mentioned above. Therapeutic compositions of PRO364 or PRO175 polypeptides or agonists or antagonists include any desired pharmaceutically acceptable carrier, excipient, or stabilizer (Remington's Pharmaceutical Sciences, 16th edi.
Tion, Osol, A. Ed., (1980)) in the form of a freeze-dried preparation or an aqueous solution. Acceptable carriers, excipients, or stabilizers are
Buffers such as phosphates, citrates, and other organic acids that are non-toxic to the recipients at the doses and concentrations used; antioxidants including ascorbic acid and methionine; preservatives (octadecyldimethylbenzylammonium chloride). Hexamethonium chloride; benzalkonium chloride; benzethonium chloride; phenol, butyl or benzyl alcohol; alkylparabens such as methyl or propylparaben; catechol; resorcinol; cyclohexanol;
Pentanol; and m-cresol); low molecular weight (less than about 10 residues) polypeptide;
Proteins such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides containing glucose, mannose, or dextran, And other carbohydrates; chelating agents such as EDTA;
Sugars such as sucrose, mannitol, trehalose or sorbitol; salt forming counterions such as sodium; metal complexes (eg Zn-protein complexes); and / or T
Includes nonionic surfactants such as WEEN ^™ , PLURONICS ^™ or polyethylene glycol (PEG).

Further examples of such carriers are ion exchangers, alumina, aluminum stearate, lecithin, serum albumin such as human serum albumin, buffer substances such as phosphates, glycine, sorbic acid, potassium sorbate, Partial glyceride mixtures of saturated vegetable fatty acids, water, salts or electrolytes such as protamine sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, zinc salt, colloidal silica, magnesium trisilicate, polyvinylpyrrolidone, cellulose-based Substance, and propylene glycol. Gel-based forms of topical carriers or antagonists include polysaccharides such as sodium carboxymethyl cellulose or methyl cellulose, polyvinylpyrrolidone, polyacrylates, polyoxyethylene-polyoxypropylene block copolymers, polyethylene glycol, and mokuro alcohol. For any administration, conventional depot forms are preferably used. Such forms include, for example, microcapsules, nano-capsules, liposomes, plasters, inhalation forms, nasal sprays, sublingual tablets, and sustained release formulations. The PRO230, PRO216, or PRO302 polypeptide or agonist or antagonist is typically about 0.1 mg / ml in such a vehicle.
To 100 mg / ml.

Other preparations are included with the PRO364 or PRO175 polypeptides or their antagonists incorporated into the formed product. Such products can be used to regulate endothelial cell growth and angiogenesis. In addition, tumor invasion and metastasis may be regulated with these products. PRO364 or PRO175 polypeptides or antagonists used for in vivo administration must be sterile. This is easily accomplished by filtration through sterile filter membranes before or after lyophilization and reconstitution. PRO364 or PR
The O175 polypeptide is normally stored in lyophilized form or in solution when administered systemically. When in lyophilized form, the PRO364 or PRO175 polypeptide or agonist thereof is typically formulated in combination with other ingredients, including a suitable diluent at the time of use. Examples of liquid formulations of PRO364 or PRO175 polypeptides or antagonists are sterile, clear, colorless, fresh solutions filled in single-dose vials for subcutaneous injection. Preservative pharmaceutical compositions suitable for repeated use depend, for example, largely on the type and indication of the polypeptide: a) PRO364 or PRO175 polypeptides or agonists or antagonists thereof; b) Stability of the polypeptide or other molecule in solution. A buffer capable of maintaining a pH within the range of maximizing activity, preferably a pH of about 4-8; c) a detergent / surfactant that primarily stabilizes the polypeptide or molecule against agitation-induced assembly; d) an isotonicity agent; e) a preservative selected from the group of phenols, benzyl alcohol and benzethonium halides such as chlorides; and f) water.

If the cleaning agent used is nonionic, it is for example polysorbate.
(Eg, POLYSORBATE ^™ (TWEEN ^™ ) 20, 80, etc.), poloxamer (eg, POLOX
AMER ^™ 188 etc.). By using a nonionic surfactant,
The formulation can be exposed to shear of surface stress without causing protein denaturation. Furthermore, such surfactant-containing preparations can be used in aerosol devices, such as those used for pulmonary administration, and needless jet injection guns (see, eg, EP 257,956). Isotonic agents are present to ensure isotonicity of liquid compositions of PRO364 or PRO175 polypeptides or antagonists thereof, and are polyhydric sugar alcohols, preferably trihydric or higher sugar alcohols such as glycerin, erythritol, arabitol. , Xylitol, sorbitol and mannitol. These sugar alcohols can be used alone or in combination. Alternatively, sodium chloride or other suitable inorganic salt may be used to make the solution isotonic. The buffer may be an acetate, citrate, succinate or phosphate buffer, depending on the pH desired. One type of p for liquid formulations of the present invention
H is buffered in the range of about 4 to 8, preferably at about physiological pH. Preservatives, phenol, benzyl alcohol and benzethonium halides,
Chloride, for example, is a well known antimicrobial agent that can be used.

Therapeutic PRO364 or PRO175 polypeptide compositions are generally placed in a container having a sterile access port, such as an intravenous solution bag or a vial having a stopper pierceable by a hypodermic needle. The formulation is preferably administered repeatedly as an intravenous (iv), subcutaneous (sc) or intramuscular (im) injection, or as an aerosol formulation suitable for intranasal or intrapulmonary delivery. (For intrapulmonary delivery see, eg, EP 257,956). The PRO364 or PRO175 polypeptides can also be administered in the form of sustained release formulations. Suitable examples of sustained-release preparations include semipermeable matrices of solid hydrophobic polymers containing the protein, which matrices are in the form of shaped articles, eg films or microcapsules. Examples of sustained release matrices include polyesters, hydrogels (eg, Langer et al., J. Biomed. Mater. Res., 15: 167-277 (1981).
) And Langer, Chem. Tech., 12: 98-105 (1982), poly (2-hydroxyethyl-methacrylate), or poly (vinyl alcohol)), polyactide (US Pat. No. 3,773,919, Europe). No. 58,481), a copolymer of L-glutamic acid and gamma ethyl-L-glutamate (Sidman et al., Biopolymers, 22: 547-556.
(1983)), non-degradable ethylene-vinyl acetate (Langer et al., Supra), degradable lactic acid-glycolic acid copolymer, such as Lupron Depot ^™ (injectable microspheres consisting of lactic acid-glycolic acid copolymer and leuprolide acetate), And poly-D-(-)-3-hydroxybutyric acid (EP 133,988).

While polymers such as ethylene-vinyl acetate and lactic acid-glycolic acid enable release of molecules for over 100 days, certain hydrogels release proteins for shorter time periods. If the encapsulated protein remains in the body for a long period of time, it may be denatured or aggregated by exposure to water at 37 ° C., resulting in loss of physiological activity or alteration of immunogenicity. Rational measures are conceivable to obtain protein stability by such a mechanism. For example, if it was found that the aggregation mechanism was intermolecular SS bond by thio-disulfide exchange, the sulfhydryl residue was changed, freeze-dried from an acidic solution, the water content was adjusted, and an appropriate additive was used. Stability can be achieved by developing specific polymer matrix compounds. Sustained-release compositions of PRO364 or PRO175 polypeptides include liposomally encapsulated PRO364 or PRO175 polypeptides. PRO36
Liposomes containing 4 or PRO175 polypeptides are known per se, eg DE 3,218,121, Epstein et al., Proc. Natl. Acad. Sci. USA, 82:36.
88-3692 (1985), Hwang et al., Proc. Natl. Acad. Sci. USA, 77: 4030-4034 (1980).
EP 52,322; EP 36,676; EP 88,046; EP 143,949; EP 142,641
Japanese Patent Application No. 83-118008; US Patent Nos. 4,485,045 and 4,544,545; and European Patent No. 102,324. Usually, liposomes are microlamellar (about 200-800 angstrom) unilamellar with a lipid content of about 30 mol% or more cholesterol and the selected ratio is adjusted for optimal treatment.

A therapeutically effective amount of a PRO364 or PRO175 polypeptide or antagonist thereof will, of course, include the pathological condition to be treated (including prophylaxis), the mode of administration, the type of compound used in the treatment. It will depend on factors such as any co-treatment, age, weight of the patient, general medical condition, medical history, etc., which are well determined within the skill of the attending physician. Therefore, the therapist needs to titrate the dosage and modify the route of administration to obtain the maximum therapeutic effect. PRO364
Alternatively, a preparation containing human PRO364 or human PRO175 polypeptide, more preferably native sequence human PRO364 or human PRO175 polypeptide, for the treatment of human patients, provided that PRO175 polypeptide has a narrow host range. Is preferred. The clinician will administer the PRO364 or PRO175 polypeptide until the dosage achieves the desired effect in treating the condition. For example, if the goal is treatment of CHF, it is an amount that inhibits the progressive cardiac hypertrophy associated with this condition. The progress of this treatment is easily monitored by echocardiography. Similarly, patients with hypertrophic cardiomyopathy can be empirically administered PRO364 or PRO175 polypeptides. In the above guidelines, an effective dose is generally about 0.001 to about 1.0 mg / k.
g, preferably about 0.01-1.0 mg / kg, most preferably about 0.01-0.
． It is within the range of 1 mg / kg.

For parenteral use in the treatment of adult hypertension, about 0.01 to 50 mg, preferably about 0.05 to 20 mg, most preferably 1 to 20 mg of PRO364 or PRO175 polypeptide per kg body weight in the form of an injection. Is advantageously administered by intravenous injection 1 to 3 times daily. For oral administration, PRO364
Alternatively, a molecule based on PRO175 polypeptide is preferably administered at about 5 mg to 1 g / kg body weight, preferably about 10 to 100 mg, 1 to 3 times daily. Endotoxin contaminants should be kept at a minimum safe level, eg less than 0.5 ng / mg protein. Furthermore, for human administration, preparations are preferably sterile, pyrogenic, generally safe and purified as required by FDA Office and Biologics standards. The dosage regimen of the pharmaceutical composition containing the PRO364 or PRO175 polypeptide used for tissue regeneration depends on various factors that alter the action of the polypeptide, such as the tissue desired to be formed, the site of damage, the damaged tissue. Responsible for the patient's condition, wound size, damaged tissue type (e.g. bone), patient age, sex, diet, severity of infection, time of administration, and other clinical factors. It will be decided by the doctor. The dose may vary depending on the type of matrix used for reconstitution, other protein content of the pharmaceutical composition. For example, the addition of other well known growth factors such as IGF-I to the final composition further affects the dose. Progress may indicate tissue / bone growth and / or repair, eg X-ray, histomorphome.
It can be monitored by periodic assessment by tric determinations) and tetracycline labeling.

Routes of administration of PRO364 or PRO175 polypeptides or antagonists or agonists are according to known methods, eg intravenous, intramuscular, intracerebral, intraperitoneal, cerebrospinal, subcutaneous, intraocular, intraarticular, intrasynovial, By injection or infusion by intrathecal, oral, topical or inhalation routes, or by the sustained release system described below. Further, PRO364 or PRO175 polypeptide or an antagonist thereof is preferably administered by intratumoral, peritumoral, intralesional, or perilesional route, and exerts a therapeutic effect locally and systemically. The intraperitoneal route is expected to be particularly useful in the treatment of ovarian tumors, for example. When the peptide or small molecule is used as an antagonist or agonist,
Preferably, it is administered to a mammal orally or parenterally in liquid or solid form. Examples of pharmaceutically acceptable salts of molecules that form salts and are useful below include alkali metal salts (e.g. sodium salt, potassium salt), alkaline earth metal salts (e.g. calcium salt, magnesium salt), ammonium. Included are salts, organic base salts (eg pyridine salts, triethylamine salts), inorganic acid salts (eg hydrochloric acid, sulfates, nitrates) and organic acid salts (eg acetates, oxalates, p-toluenesulfonates). Methods of treatment in compositions described herein useful for bone, cartilage, tendon, or ligament regeneration include topically, systemically or locally as an implant or device.
y) administration of the composition is included. When administered, the therapeutic composition used is in a pyrogen-free, physiologically acceptable form. Further, it is desirable that the composition be injected or encapsulated in a viscous form that is delivered to the site of damage to bone, cartilage or tissue. Topical administration is suitable for wound healing and tissue repair. Preferably, for the formation of bone and / or cartilage, the composition delivers the protein-containing composition to the site of bone and / or cartilage damage, preferably developing resorbable bone and cartilage into the body. It includes a matrix that can provide a structure. Such matrices are made of materials used in other implantable medical applications.

The choice of matrix material is based on biocompatibility, biodegradability, mechanical properties, cosmetic appearance, and surface activity. The particular use of the composition will be defined by the appropriate formulation. The latent matrix of the composition is biodegradable and may be chemically defined calcium sulfate, tricalcium phosphate, hydroxyapatite, polylactic acid, polyglycolic acid, and polyanhydride. Other potential matrices are biodegradable and biologically well defined, eg bone or dermal collagen. The further matrix consists of pure proteins or extracellular matrix components. Other potential matrices are non-biodegradable and chemically defined, such as sintered hydroxyapatite, bioglass, aluminates, or other ceramics. The matrix may be of any type of material described above, for example a combination of polylactic acid and hydroxyapatite or collagen and tricalcium phosphate. The bioceramic may be altered in composition, for example, calcium-aluminate-phosphate, and may be processed to alter pore size, particle size, particle shape and biodegradability. In one particular embodiment, lactic acid and glycolic acid are 50:50 (molar weight) copolymers and are in the form of porous particles having diameters in the range of 150 to 180 microns. In some applications, sequestering agents such as carboxymethyl cellulose, or autologous clots are useful in protecting the composition from separation from the matrix. One suitable family of sequestrants is cellulosic materials such as alkylcelluloses (including hydroxyalkylcelluloses), including methylcellulose, ethylcellulose, hydroxyethylcellulose, hydroxypropylcellulose, hydroxypropylmethylcellulose and carboxymethylcellulose, preferably carboxymethylcellulose. It is a cation salt of (CMC). Other preferred sequestrants include hyaluronic acid, sodium alginate, poly (
Ethylene glycol), polyoxyethylene oxide, carboxyvinyl polymers, and poly (vinyl alcohol). The amount of sequestrant useful herein is 0.5-20% by weight, preferably 1-10% by weight, based on the total weight of the preparation.
And prevents the desorption of the polypeptide (or its antagonist) from the polymer matrix, imparts suitable operability to the composition, and further prevents the penetration of progenitor cells into the matrix, thus The amount required to confer on the antagonist the opportunity to promote osteogenic activity of progenitor cells.

Xii. Combination Therapy The efficacy of PRO364 or PRO175 polypeptides, or agonists or antagonists thereof, in preventing or treating the disease in question is combined with other agents effective for these purposes, either in the same composition or in separate compositions. Or improved by continuous administration of the active agent. For example, for the treatment of cardiac hypertrophy, PRO364 or PRO175 polypeptide treatment is a well-known inhibitor of myocardial myocyte hypertrophic factor, eg, an inhibitor of an α-adrenergic agonist such as phenylephrine; an endothelin-I inhibitor, eg BOSENT.
AN ^™ and MOXONODIN ^™ ; inhibitors for CT-1 (US Pat. No. 5,679,545); LI
Administration of an inhibitor to F; an ACE inhibitor; a des-asparatate-angiotensin I inhibitor (US Pat. No. 5,773,415) and an angiotensin II inhibitor can be combined. PRO364 or PRO175 for the treatment of cardiac hypertrophy associated with hypertension
Polypeptides, β-adrenergic receptor blocking agents, such as propranolol, timolol, tartarolol, carteolol, nadolol, betaxolol, penbutolol, acetobutolol, atenolol, metoprolol,
Or carvedilol; ACE inhibitors such as quinapril, captopril, enalapril, ramipril, benazepril, fosinopril or lisinopril; diuretics such as chlorothiazide, hydrochlorothiazide, hydroflumetazide, methylclothiazide, benzthiazide, dichlorophenamide,
It can be administered in combination with acetazolamide, or indapamide; and / or calcium channel blockers such as diltiazem, nifedipine, verapamil or nicardipine. Pharmaceutical compositions containing the therapeutic agents identified herein by generic name are commercially available and are administered according to the manufacturer's instructions for dosing, mode of administration, side effects, contraindications, etc. For example, Physicians'Desk Reference (Medical Economic
s Data Production Co .: Montvale, NJ, 1997), 51th Edition.

Preferred candidates for combination therapy in the treatment of hypertrophic cardiomyopathy include β-adrenergic receptor blocking agents (eg, propranolol, timolol, tartarolol, carteolol, nadolol, betaxolol, penbutolol, acetobutolol, atenolol, Metoprolol or Carvedilol), Verapamil, Difedipine, or Diltiazem. For the treatment of hypertrophy associated with hypertension, calcium channel blockers such as diltiazem, nifedipine, verapamil or nicardipine; β-adrenergic receptor blockers; diuretics such as chlorothiazide, hydrochlorothiazide, hydroflumetazide, methylclothiazide, benzthiazide. , Dichlorophenamide, acetazolamide, or indapamide; and / or an ACE inhibitor such as quinapril,
There is a need for the use of antihypertensive agents using captopril, enalapril, ramipril, benazepril, fosinopril or lisinopril. For other indications, PRO364 or PRO175 polypeptides or their antagonists may be combined with other agents useful in the treatment of bone and / or cartilage defects, wounds or tissues in the problem. Such agents include various growth factors such as EGF, PDGF, TGF-α or TGF-β, IGF, FGF, and CTG.
F is included. In addition, PRO364 or PRO175 polypeptides or their antagonists used in the treatment of cancer are combined with cytotoxic, chemotherapeutic or growth inhibitory agents as identified above. Also for treatment of cancer, PRO364 or PR
The O175 polypeptide or an antagonist thereof is suitably administered sequentially, or in combination with radiological treatment, with or without irradiation or administration of radioactive material. The effective amount of therapeutic agent administered in combination with the PRO364 or PRO175 polypeptide or antagonists thereof is at the discretion of the physician or veterinarian. Dosage and adjustments are made to achieve maximal therapeutic effect on the condition being treated. For example, in the treatment of hypertension these amounts would ideally be the use of diuretics or digitalis,
And take into account hypertension or hypotension, renal damage, etc. The dose depends on such factors as the particular patient being treated and the type of therapeutic agent used. Typically, the amount used is the same dose as when the therapeutic agent is not administered with the PRO364 or PRO175 polypeptide.

Xiii. Articles of Manufacture An article of manufacture, such as a kit, containing a PRO364 or PRO175 polypeptide or agonist or antagonist thereof useful in the diagnosis or treatment of the disorders described above comprises at least one container and label. Suitable containers include, for example, bottles, vials, syringes and test tubes. The container can be formed from various materials such as glass or plastic. The container holds a composition useful for diagnosing or treating a condition and may have a sterile access port (for example, the container may be an intravenous fluid bag or vial with a stopper pierceable by a hypodermic injection needle). ). The active agent in the composition is the PRO364 or PRO175 polypeptide or an agonist or antagonist thereof. The label on, or associated with, the container indicates that the composition is used for diagnosing or treating the condition of choice. The article of manufacture may further comprise a second container containing a pharmaceutically acceptable buffer such as phosphate buffered saline, Ringer's solution, and dextrose solution. In addition, including other buffers, diluents, filters, needles, syringes, and packaging inserts with instructions for use,
Other materials desirable from a commercial and user standpoint may be included. The article of manufacture may also include a second or third container containing the other activator described above.

E. Antibodies Some of the most promising drug candidates in the present invention are antibodies and antibody fragments that inhibit the production of the genes identified herein or the gene products and / or reduce the activity of the gene products. i. Polyclonal Antibodies Methods of preparing polyclonal antibodies are known to those of skill in the art. Polyclonal antibodies in mammals can be generated by one or more injections of, for example, an immunizing agent and, if desired, an adjuvant. Typically, the immunizing agent and / or adjuvant will be injected in the mammal by multiple subcutaneous or intraperitoneal injections. The immunizing agent may include the PRO364 or PRO175 polypeptide or a fusion protein thereof. It is useful to conjugate the immunizing agent to a protein known to be immunogenic in the immunized mammal. Examples of such immunogenic proteins include, but are not limited to, keyhole limpet hemocyanin, serum albumin, bovine thyroglobulin and soybean trypsin inhibitor. Examples of adjuvants that may be used include Freund's complete adjuvant and MPL-TDM adjuvant (monophosphoryl lipid A, synthetic trehalose dicorynomycolate). The immunization protocol will be selected by one of ordinary skill in the art without undue experimentation.

Ii. Alternatively, the anti-PRO364 or -PRO175 antibody may be a monoclonal antibody. Monoclonal antibodies are described by Kohler and Milstein, Nature, 256: 495 (1
975) and can be prepared using the hybridoma method. In the hybridoma method, mice, hamsters or other suitable host animals are typically immunized with an immunizing agent to produce lymphocytes that produce or are capable of producing antibodies that specifically bind to the immunizing agent. Induce. The lymphocytes can also be immunized in vitro. The immunizing agent will typically include the PRO364 or PRO175 polypeptide or a fusion protein thereof. Generally, peripheral blood lymphocytes ("PBLs") are used when cells of human origin are desired, or when non-human mammalian sources are desired,
Spleen cells or lymph node cells are used. The lymphocytes are then fused with an immortalized cell line using a suitable fusing agent such as polyethylene glycol to form hybridoma cells. Goding, Monoclonal Antibodies: Principles and Practice, (Ne
w York; Academic Press, 1986) pp. 59-103. Immortalized cell lines are usually transformed mammalian cells, particularly myeloma cells of rodent, bovine, and human origin. Usually, rat or mouse myeloma cell lines are used. The hybridoma cells are preferably cultured in a suitable medium that contains one or more substances that inhibit the survival or growth of the unfused, immortalized cells. For example, if the parental cell lacks the enzyme hypoxanthine guanine phosphoribosyl transferase (HGPRT or HPRT), the hybridoma medium typically comprises hypoxatin, aminoputilin and thymidine ("HAT medium"), This substance blocks the growth of HGPRT-deficient cells.

Preferred immortalized cell lines are those that fuse efficiently, support stable high level expression of antibody by the selected antibody-producing cells, and are sensitive to a medium such as HAT medium. A more preferred immortalized cell line is the mouse myeloma line, which is available, for example, from the Salk Institute Cell Distribution Center in San Diego, Calif. And the American Type Culture Collection in Manassas, Virginia. Human myeloma and mouse for producing human monoclonal antibodies-
Human xenomyeloma cell lines are also disclosed. Kozbor, J. Immunol., 133: 3001 (1
984); Brodeur et al., Monoclonal Antibody Production Techniques and Applicati
ons, (Marcel Dekker, Inc., New York, 1987) pp. 51-63. The culture medium in which the hybridoma cells are then cultured is changed to PRO364 or PRO.
Assay for the presence of monoclonal antibody to the 175 polypeptide. Preferably, the binding specificity of the monoclonal antibody produced by the hybridoma cells is determined by immunoprecipitation or radioimmunoassay (RIA) or enzyme-linked immunosorbent assay (ELI).
It is measured by an in vitro binding assay method such as SA). Such techniques and assays are known in the art. The binding affinity of the monoclonal antibody can be measured, for example, by the Scatchard analysis method by Munson and Pollard, Anal. Biochem., 107: 220 (1980).

After the desired hybridoma cells have been identified, clones can be subcloned by a limiting dilution step and grown by standard methods. Goding, supra. Suitable media for this purpose include, for example, Dulbecco's Modified Eagle's Medium and R
PMI-1640 medium is included. Alternatively, the hybridoma cells can be grown in vivo as ascites in a mammal. The monoclonal antibody secreted by the subclone is, for example, protein A
-Isolated or purified from the culture medium or ascites fluid by a conventional immunoglobulin purification method such as sepharose method, hydroxylapatite chromatography method, gel electrophoresis method, dialysis method or affinity chromatography.

Monoclonal antibodies can also be prepared by recombinant DNA methods, such as US Pat. No. 4,816,567.
It can be prepared by the method described in No. The DNA encoding the monoclonal antibody of the present invention can be easily prepared using a conventional method (for example, using an oligonucleotide probe capable of specifically binding to the genes encoding the heavy and light chains of mouse antibody). Can be isolated and sequenced. The hybridoma cells of the invention are a preferred source of such DNA. Once isolated, DNA
Can be placed in an expression vector, which is transfected into a host cell, such as monkey COS cells, Chinese hamster ovary (CHO) cells, or myeloma cells that do not produce immunoglobulin proteins, Monoclonal antibody can be synthesized with. The DNA may also be non-immunized with immunoglobulin coding sequences, for example, by substituting the coding sequences for human heavy and light chain constant domains in place of homologous mouse sequences (US Pat. No. 4,816,567; Morrison et al., Supra). It can be modified by covalently linking part or all of the coding sequence for the globulin polypeptide. Such non-immunoglobulin polypeptides can be substituted for the constant domain of the antibodies of the invention or for the variable domain of one of the antigen binding sites of the antibodies of the invention to produce chimeric, bivalent antibodies. The antibody may be a monovalent antibody. Methods for preparing monovalent antibodies are well known in the art. For example, one method involves recombinant expression of immunoglobulin light chain and modified heavy chain. The heavy chain is truncated generally at any point in the Fc region so as to prevent heavy chain crosslinking. Alternatively, the relevant cysteine residue is replaced or deleted with another amino acid residue to prevent cross-linking. In vitro methods are also suitable for preparing monovalent antibodies. Generation of fragments thereof, particularly Fab fragments, by digestion of the antibody can be accomplished using conventional techniques known in the art.

Iii. Human and Humanized Antibodies Anti-PRO364 or -PRO175 antibodies further include humanized or human antibodies. Humanized forms of non-human (eg, murine) antibodies are chimeric immunoglobulins, immunoglobulin chains or fragments thereof (eg, Fv, Fab, Fab ′, F (ab ′) ₂ or other antigen-binding subsequences of antibodies). It contains a minimal sequence derived from non-human immunoglobulin. Humanized antibodies are non-human species in which the CDR residues have the desired specificity, affinity and potency, such as mouse, rat or rabbit (donor antibody).
Human immunoglobulin (recipient antibody) substituted by residues of the CDR of In some examples, human immunoglobulin Fv framework residues are replaced by corresponding non-human residues. Humanized antibodies may also contain residues which are found neither in the recipient antibody nor in the imported CDR or framework sequences. Generally, a humanized antibody has at least one, and typically no, at least one, where all or almost all CDR regions correspond to those of a non-human immunoglobulin and all or almost all FR regions are of human immunoglobulin consensus sequences. Contains substantially all of the two variable domains. The humanized antibody optimally comprises at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin. Jones et al., Nature, 321: 522-525 (1986); Riechmann et al., Natu.
re, 332: 323-329 (1988); and Presta, Curr. Op Struct. Biol., 2: 593-596 (1
992). Methods for humanizing non-human antibodies are well known in the art. Generally, a humanized antibody has one or more amino acid residues introduced into it from a source that is non-human. These non-human amino acid residues are often referred to as "import" residues, which typically result from an "import" variable domain. Humanization is basically accomplished by substituting the relevant sequences of human antibodies with rodent CDRs or CDR sequences by winter and coworkers (Jones et al., Nature, 321: 522-525 (1986); Riechmann. Et al, Nature, 332: 323-327.
(1988); Verhoeyen et al., Science, 239: 1534-1536 (1988)). Thus, such "humanized" antibodies are chimeric antibodies (US Pat. No. 4,816,567) in which substantially less than the intact human variable domain has been replaced with the corresponding sequence from a non-human species. In practice, humanized antibodies are typically human antibodies in which some CDR residues and optionally some FR residues have been replaced by residues from similar sites in rodent antibodies.

Human antibodies can also be made using various techniques known in the art, including phage display libraries. Hoogenboom and Winter, J. Mol. Biol.,
227: 381 (1991); Marks et al., J. Mol. Biol., 222: 581 (1991). The methods of Cole et al. And Boerner et al. Can also be used for the preparation of human monoclonal antibodies. Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R. Liss. P. 77 (1
985) and Boerner et al., J. Immunol., 147 (1): 86-95 (1991). Similarly, human antibodies can be produced by introducing human immunoglobulin loci into transgenic animals, such as mice in which the endogenous immunoglobulin genes have been partially or completely inactivated. Upon administration, production of human antibodies is observed that is very similar to that found in humans in all respects, including gene rearrangement, assembly, and antibody repertoire. This approach is described, for example, in US Pat. Nos. 5,545,807;
No. 5,806; No. 5,569,825; No. 5,625,126; No. 5,633,425; No. 5,661,016.
Issue and the following scientific literature: Marks et al., Bio / Technology 10, 779-783 (1992); Lonber
g et al., Nature 368 856-859 (1994); Morrison, Nature 368, 812-813 (1994); Fi
shwild et al., Nature Biotechnology 14, 845-851 (1996); Neuberger, Nature Bio
technology 14, 826 (1996); Lonberg and Huszar, Intern. Rev. Immunol. 136.
5-93 (1995).

Iv. Bispecific Antibodies Bispecific antibodies are monoclonal antibodies, preferably human or humanized antibodies, that have binding specificities for at least two different antigens. In the present case, one of the binding specificities is for PRO364 or PRO175, the other one is for any other antigen, preferably a cell surface protein or receptor or receptor subunit. Methods of making bispecific antibodies are well known in the art. Traditionally, recombinant production of bispecific antibodies is based on the co-expression of two immunoglobulin heavy chain / light chain pairs, where the two heavy chains have different specificities. Milstein and Cuello, Nature,
305: 537-539 (1983). To randomly arrange the heavy and light chains of immunoglobulins,
These hybridomas (quadromas) produce a potential mixture of 10 different antibody molecules, of which only one has the correct bispecific structure. Purification of the correct molecule is usually accomplished by affinity chromatography steps. A similar procedure is described in WO 93/08829 published May 13, 1993, and Traunecker et al., EMBO J., 10: 3655-36.
56 (1991). Antibody variable domains with the desired binding specificities (antibody-antigen combining sites) can be fused to immunoglobulin constant domain sequences. The fusion is preferably with an immunoglobulin heavy chain constant domain, comprising at least the hinge region, and portions of the CH2 and CH3 regions. It is preferred to have the first heavy-chain constant region (CH1) containing the site necessary for light-chain binding present in at least one of the fusions. The DNA encoding the immunoglobulin heavy chain fusion, and, if desired, the immunoglobulin light chain, are inserted into separate expression vectors and cotransfected into a suitable host organism. For further details on making bispecific antibodies, see, eg, Suresh et al., Methods in Enzymology, 121: 210 (1986).

V. Heteroconjugate Antibodies Heteroconjugate antibodies are composed of two covalently joined antibodies. Such antibodies are used, for example, to target cells of the immune system to unwanted cells (US Pat.
, 676,980) and for the treatment of HIV infection (WO 91/00360; WO 92/200373; EP 03089). It is believed that this antibody can be prepared in vitro using known methods in synthetic protein chemistry, including those associated with cross-linking agents. For example, immunotoxins can be made using a disulfide exchange reaction or by forming a thioether bond. Examples of suitable reagents for this purpose include iminothiolate and methyl-4-mercaptobutyrimidate, and those disclosed, for example, in US Pat. No. 4,676,980.

Vi. Effector Function Processing It is desirable to modify the antibody of the present invention with respect to effector function, eg to improve the effectiveness of the antibody in treating cancer. For example, cysteine residue (s) may be introduced in the Fc region, thereby allowing interchain disulfide bond formation in this region. The homodimeric antibody thus produced has improved internalization capacity and / or
Or it may have increased complement-mediated cell killing and antibody-dependent cellular cytotoxicity (ADCC). Caron et al., J. Exp. Med. 176: 1191-1195 (1992) and Shopes, BJ Immunol.
148: 2918-2922 (1992). Allodimeric antibodies with improved anti-tumor activity can also be prepared using heterobifunctional crosslinks as described by Wolff et al., Cancer research 53: 2560-2565 (1993). Alternatively, the antibody can be engineered to have two Fc regions, thereby improving complement lysis and ADCC capabilities. See Stevenson et al., Anti-Cancer Drug Design 3: 219-230 (1989).

Vii. Immunoconjugates The present invention also includes chemotherapeutic agents, cytotoxic agents such as toxins (e.g., enzymatically active toxins of bacterial, fungal, plant or animal origin, or fragments thereof), or radioisotopes (i.e.,
An immunoconjugate comprising the antibody conjugated to a radioconjugate). Chemotherapeutic agents useful in generating such immunoconjugates have been described above. Enzymatically active toxins and fragments thereof that can be used include diphtheria A chain, non-binding active fragments of diphtheria toxin, exotoxin A chain (from Pseudomonas aeruginosa), ricin A chain, abrin A chain, modexin (m
odeccin) A chain, alpha-sarcin, Aleurites ford
ii) protein, dianthin protein, phythora americana (
Phytolaca americana protein (PAPI, PAPII, and PAP-S), momordica charantia inhibitor, curcin,
Crotin, sapaonaria oficinalis inhibitor, gelonin, mitogellin, restrictocin
ctocin), phenomycin, enomycin and trichothecene. Various radionucleotides are available for the production of radioconjugated antibodies. Examples include ²¹² Bi, ¹³¹ I, ¹³¹ In, ⁹⁰ Y and ¹⁸⁶ Re. Conjugates of antibodies and cytotoxic agents are labeled with various bifunctional protein coupling agents,
For example, N-succinimidyl-3- (2-pyridyldithiol) propionate (S
PDP), iminothiolane (IT), bifunctional derivative of imide ester (dimethyl adipimidate HCL, etc.), active ester (disuccinimidyl suberate, etc.), aldehyde (glutaraldehyde, etc.), bis-azide compound (eg, Bis (p-azidobenzoyl) hexanediamine etc.), bis-diazonium derivative (bis- (p-diazoniumbenzoyl) -ethylenediamine etc.), diisocyanate (triene 2,6-diisocyanate etc.), and bis-active fluorine compound (1, 5-difluoro-2,4-dinitrobenzene etc.). For example, ricin immunotoxins such as Vitetta
, Science 238: 1098 (1987). Carbon-14-labeled 1-isothiocyanatobenzyl-3-methyldiethylenetriaminepentaacetic acid (MX-DTPA) is an example of a chelating agent for conjugation of radionucleotide to the antibody. See WO 94/11026. In other embodiments, the antibody may be conjugated to a "receptor" (such as streptavidin) for use in tumor pre-targeting, the antibody-receptor conjugate is administered to a patient, and then a clarifying agent is added. Unbound conjugate is used to remove from circulation and then a "ligand" (such as avidin) conjugated to a cytotoxic drug (such as a radionucleotide).
Is administered.

Viii. Immunoliposomes The antibodies disclosed herein may also be prepared as immunoliposomes. Liposomes containing antibodies are described by Epstein et al., Proc. Natl. Acad. Sci. USA, 82: 3688 (1985).
Hwang et al., Proc. Natl. Acad. Sci. USA, 77: 4030 (1980); and U.S. Pat.
Prepared by methods known in the art, such as those described in 485,045 and 4,544,545. Liposomes with improved circulation time are disclosed in US Pat. No. 5,013,556. Particularly useful liposomes are phosphatidylcholine, cholesterol and PEG.
-Produced by the reverse phase evaporation method with a lipid composition containing derivatized phosphatidylethanolamine (PEG-PE). Liposomes are extruded through filters of defined size pores to produce liposomes with the desired size. Fa of the antibody of the present invention
The b'fragment can be conjugated to liposomes via a disulfide exchange reaction as described by Martin et al., J. Biol. Chem. 257: 286-288 (1982). Chemotherapeutic drugs
(Doxorubicin, etc.) is optionally contained within the liposome. Gabizon etc.,
See J. National Cancer Inst. 81 (19) 1484 (1989).

Ix. Pharmaceutical Compositions of Antibodies Antibodies that specifically bind the PRO364 or PRO175 polypeptides identified herein, as well as other molecules identified in the screening assays disclosed above, may be used in the treatment of various disorders described above and below. For, it can be administered in the form of a pharmaceutical composition. Internalized antibodies are preferred when the PRO364 or PRO175 polypeptide is intracellular and whole antibodies are used as inhibitors. However, lipofections or liposomes can also be used to introduce the antibody, or antibody fragment, into cells. When antibody fragments are used, the smallest inhibitory fragment that specifically binds to the binding domain of the target protein is preferred. For example, peptide molecules can be designed that retain the ability to bind to target protein sequences based on the variable region sequences of the antibody. Such peptides can be chemically synthesized and / or produced by recombinant DNA technology. For example, Ma
See Rasco et al., Proc. Natl. Acad. Sci. USA 90, 7889-7893 (1993). The formulation herein comprises one or more active compounds as necessary for the particular indication being treated,
Those having complementary activities that preferably do not adversely affect each other may also be included. Alternatively, or additionally, the composition comprises an agent that enhances its function, such as a cytotoxic agent,
It may include cytokines, chemotherapeutic agents or growth inhibitors. These molecules are suitably present in combination in amounts that are effective for the purpose intended. Alternatively, the active ingredient may be, for example, in microcapsules prepared by coacervation techniques or by interfacial polymerization, such as hydroxymethyl cellulose or gelatin-microcapsules and poly (methyl methacrylate) microcapsules, respectively.
It may be encapsulated in a colloidal drug delivery system (eg liposomes, albumin globules, microemulsions, nanoparticles and nanocapsules) or in microemulsions. These techniques are disclosed in Remington's Pharmaceutical Science, supra.

The formulations used for in vivo administration must be sterile. This is easily accomplished by filtration through a sterile filtration membrane. Sustained-release preparations may be prepared. Suitable examples of sustained release formulations include semipermeable matrices of solid hydrophobic polymers containing the antibody, which matrices are in the form of shaped articles, eg films, or microcapsules. Examples of sustained release matrices are polyesters, hydrogels (eg poly (2-hydroxyethyl-methacrylate) or poly (vinyl alcohol)), polylactides (US Pat. No. 3,773,919).
No.), copolymers of L-glutamic acid and γ-ethyl-L-glutamate, non-degradable ethylene-vinyl acetate, LUPRON DEPOT ^™ (injectable globules of lactic acid-glycolic acid copolymer and leuprolide acetate)- Glycolic acid copolymer,
Includes poly- (D) -3-hydroxybutyric acid. While polymers such as ethylene-vinyl acetate and lactic acid-glycolic acid enable release of molecules for over 100 days, certain hydrogels release proteins for shorter time periods. When the encapsulated antibodies remain in the body for a long time, they are denatured or aggregated by exposure to water at 37 ° C, resulting in reduced biological activity and possible altered immunogenicity. . Rational methods can be devised for stabilization depending on the mechanism involved. For example, the aggregation mechanism is intermolecular S--S through thio-disulfide exchange.
If found to be bond formation, stabilization is achieved by modification of sulfhydryl residues, lyophilization from acidic solutions, control of water content, addition of suitable additives, and development of specific polymer matrix compositions. Can be done.

X. Methods of Treatment Using Antibodies It is anticipated that antibodies against the PRO364 or PRO175 polypeptides may be used to treat the various cardiovascular, endothelial and angiogenic diseases described above. The antibody is administered to a mammal, preferably a human, by a well-known method, for example, intravenous administration as a bolus or by continuous infusion over a predetermined time, intramuscular, intraperitoneal, cerebrospinal, subcutaneous, interarticular, intrasynovial, It is administered by intrathecal, oral, topical, or inhalation routes.
Intravenous administration of the antibody is preferred. Other therapeutic regimens may be combined with, for example, administration of the antibodies of the invention. For example, when treating cancer with antibodies, patients treated with such antibodies may receive radiation therapy. Alternatively, or in addition, the patient may be administered a chemotherapeutic agent. The method of preparation and dose schedule for such chemotherapeutic agents will be used according to the manufacturer's instructions or empirically determined by the skilled practitioner. Preparations and dose schedules for such chemotherapy are also available in Chemotherapy Service MC.
Perry, (Williams & Wilkins, Baltimore, MD, 1992). The chemotherapeutic agent may be administered prior to, or following the administration of the antibody, or it may be administered concurrently therewith. The antibody may be an anti-estrogen compound such as tamoxifen or EVIST ^™ or an anti-progesterone such as onapristone (EP 616812).
No.) and known doses for those molecules. Also, when the antibody is used to treat cancer, antibodies against other tumor associated antigens, such as one or more ErbB2, EGFR, ErbB3, ErbB4, or VEGF.
It is also preferable to administer an antibody that binds to the receptor. It also includes the drugs mentioned above. The antibody is suitably administered sequentially, or in combination with radiological treatment, with or without irradiation or administration of radioactive material. Alternatively, or additionally, two or more antibodies disclosed herein and binding to the same or two or more different antigens may be co-administered to the patient. Sometimes it is also advantageous to administer one or more cytokines to the patient. In a preferred embodiment, the antibody herein is co-administered with a growth inhibitor. For example, the growth inhibitor is administered first, followed by the antibody of the invention. However, it is also conceivable to co-administer or to administer the anti-cancer agent of the invention first. Appropriate doses for growth inhibitors are those currently used, but combinations of growth inhibitors with this antibody (synergistic)
It can be reduced by the effect.

In one embodiment, tumor angiogenesis is attacked in combination therapy. Anti
-PRO364 or -PRO175 polypeptide antibodies and other antibodies (eg anti-VE
GF) is administered to a patient with a tumor in a therapeutically effective amount determined to show necrosis of the tumor or metastatic lesion, for example. This treatment is continued until a favorable effect is observed or there is no evidence of tumor or any metastatic lesions. Then,
TNF with adjuvants such as alpha-, beta- or gamma-interferon,
Anti-HER2 antibody, heregulin, anti-heregulin antibody, D-factor, interleukin-1 (IL-1), interleukin-2 (IL-2), granulocyte-macrophage colony stimulating factor (GM-CSF) , Or a microvascular coagulation promoting agent in a tumor, such as anti-protein C antibody, anti-protein S antibody, or C4b-binding protein (1
WO 91/01753) published Feb. 21, 991), or heat or radiation is administered alone or in combination. Adjuvants depend on their effectiveness and it is desirable to compare their impact on tumors by a matrix screened in a convenient manner. Anti-PRO3
Administration of 64 or -PRO175 polypeptide antibody and TNF is repeated until the desired clinical effect is achieved. The anti-PRO364 or -PRO175 polypeptide antibody is also administered with TNF, and optionally with an adjunct. In cases where solid tumors are found in the extremities or other locations that allow isolation from the general circulatory system,
The therapeutic agents described herein are administered to an isolated tumor or organ. In other embodiments, FGF or PDGF antagonists such as anti-FGF or anti-PDG
The F neutralizing agent is administered to the patient with the anti-PRO364 or -PRO175 polypeptide antibody. Treatment with the anti-PRO364 or -PRO175 polypeptide antibody is preferably discontinued during the period of wound healing or desired neovascularization.

Suitable doses of the antibodies herein for the prevention or treatment of cardiovascular, endothelial and angiogenic diseases are such that the type of disease treated, the severity and course of the disease as defined above, Whether a drug is administered for prophylactic or therapeutic purposes, prior treatment, patient clinical history and response to antibodies, and the discretion of the attending physician. The antibody is suitably administered to the patient once or over a series of treatments. For example, depending on the type and severity of the disease, about 1 μg / kg to 50 mg / kg (
For example, 0.1-20 mg / kg of antibody is the first candidate dose for administration to a patient, eg, in one or more separate doses or continuous infusion. A typical daily or weekly dose will be about 1 μg / k, depending on the factors mentioned above.
It may be from g to 100 mg / kg or more. For repeated administrations over several days or longer, depending on the condition, the treatment is continued until the desired suppression of symptoms of the disease appears. However, other dosage regimens may be useful. The progress of this treatment is
It is easily monitored by conventional techniques and assays including, for example, X-ray tumor imaging.

Xi. Articles of Manufacture Containing Antibodies Also provided are articles of manufacture that also include a container containing the antibody and a label. Such articles of manufacture have been described above, wherein the active agent is anti-PRO364 or -PRO175.
It is an antibody. xii. Diagnosis and Prognosis of Tumors Using Antibodies If the indication for which the antibodies are used is cancer, cell surface proteins such as growth receptors that are overexpressed in certain tumors may be used as candidates for drug or tumor (e.g., cancer) treatment. Although an excellent target, the same proteins as the PRO364 or PRO175 polypeptides have found further use in tumor diagnosis and prognosis. For example, PRO3
Antibodies directed against 64 or PRO175 polypeptides can be used in tumor diagnosis and prognosis. For example, antibodies, including antibody fragments, can be used for qualitative or quantitative detection of expression of genes, including genes encoding PRO364 or PRO175 polypeptides. The antibody is preferably provided with a detectable, eg fluorescent, label and binding can be monitored by light microscopy, flow cytometry, fluorometry, or other techniques known in the art. Such binding assays are performed substantially as described above. In situ detection of antibodies that bind to the marker gene product can be performed, for example, by immunofluorescence or immunoelectron microscopy. For this purpose, a labeled antibody is applied to it by removing a histological sample from the patient and preferably overlaying the biological sample with the antibody. This approach also allows the distribution of the marker gene product in the tissues tested to be determined. It will be apparent to those skilled in the art that a wide range of histological methods are readily available for in situ detection.

The following examples are provided by way of illustration only and are not intended to limit the scope of the invention in any way. The entire disclosure of all patents and literature references cited in the present specification are hereby incorporated by reference. EXAMPLES Commercially available reagents referred to in the examples were used according to manufacturer's instructions unless otherwise indicated. The source of cells identified throughout the following examples and specification by ATCC Registry Number is American Type Culture Collection, Manassas, VA. Unless otherwise stated, the present invention employed standard techniques of recombinant DNA technology, such as those described above and in the textbooks below: Sambrook, supra.
Et al; Ausubel et al, Current Protocols in Molecular Biology (Green Publishing A
ssociates and Wiley Interscience, NY, 1989); Innis et al., PCR Protocols: A
Guide to Methods and Applications (Academic Press, Inc .; NY, 1990); Ha
rlow et al., Antibodies: A Laboratory Manual (Cold Spring Harbor Press: Cold
Spring Harbor 1988); Gait, Oligonucleotide Synthesis (IRL Press, Oxford,
1984); Freshney, Animal Cell Culture, 1987; Coligan et al., Current Protocols
in Immunology, 1991.

Example 1 Isolation of a cDNA Clone Encoding Human PRO364 Expressed Sequence Tag (EST) DNA Database (LIFESEQ®, Incyte Pharm
aceuticals, Palo Alto, CA) and search for polypeptide tumor necrosis factor receptors
EST (Incyte EST number 3003460) showing homology with members of the (TNFR) family.
) Was identified. Then, using the BLAST repeat cycle, Incyte 3003460 EST and other ESTs
A consensus DNA sequence was constructed for the sequence. This consensus sequence is herein designated "consen01" in Fig3A-C. In addition, here, the “consen01” consensus sequence (SEQ ID NO: 4) shown in FIG. 3A-C was replaced with “DNA44825.
(See FIG. 4; SEQ ID NO: 4). Based on DNA44825 and the “consen01” consensus sequence as shown in FIG. Oligonucleotides were synthesized for use as probes. Forward and reverse PCR primers generally range from 20 to 30 nucleotides and are often designed to give PCR products of about 100-1000 bp in length. The probe sequence is typically 40-55 bp long. In some cases, additional oligonucleotides are synthesized when the consensus sequence is greater than about 1-1.5 kbp. To screen several libraries for full length clones, DNA from the libraries was analyzed by Ausubel et al., Current Protocols in Molecular Bis.
Screened by PCR amplification with PCR primer pairs according to ology. The positive library was then used to isolate clones encoding the gene of interest using the probe oligonucleotide and one of the primer pairs.

A PCR primer pair (forward and reverse) was synthesized: Forward PCR primer (44825.f1): 5'-CACAGCACGGGGCGATGGG-3 '(SEQ ID NO: 6).
) Forward PCR primer (44825.f2): 5'-GCTCTGCGTTCTGCTCTG-3 '(SEQ ID NO: 1
1) Forward PCR primer (44825.GITR.f): 5'-GGCACAGCACGGGGCGATGGGCGCGTTT-3
'(SEQ ID NO: 5) Reverse PCR primer (44825.r1): 5'-CTGGTCACTGCCACCTTCCTGCAC-3' (SEQ ID NO: 12) Reverse PCR primer (44825.r2): 5'-CGCTGACCCAGGCTGAG-3 '(SEQ ID NO: : 8) Reverse PCR primer (44825.GITR.r): 5'-GAAGGTCCCCGAGGCACAGTCGATACA-3 '(
SEQ ID NO: 10) Furthermore, a synthetic oligonucleotide hybridization probe was made from the consensus DNA44825 sequence, which had the following nucleotide sequence: Hybridization probe (44825.p1): 5'-GAGGAGTGCTGTTCCGAGTGGGACTGCATGTGTGTCCAGC-3 '(sequence No. 9) Hybridization probe (44825.GITR.p): 5'-AGCCTGGGTCAGCGCCCCACCGGGGGTCCCGGGTGCGGCC-3 '(SEQ ID NO: 7) DNA from the library to screen several libraries for the source of the full length clone. Was PCR amplified with the PCR primer pair identified above. The positive library was then used to isolate clones encoding the PRO364 gene using one of the probe oligonucleotides and PCR primers.

RNA for the construction of the cDNA library was isolated from human bone marrow tissue. c
The cDNA library used to isolate the DNA clones is Invitrogen,
Formed by standard methods using commercially available reagents such as those from San Diego, CA.
The cDNA was primed with an oligo dT containing a NotI site and blunted with SalI.
It binds to a hemikinase adaptor, divides it with NotI, and appropriately size-divides it by gel electrophoresis, and in a fixed direction, a suitable cloning vector (pRKB or pRKD, etc .; pRK5B is a precursor of pRK5D that does not have an SfiI site). Xho unique to Holmes et al., Science, 253: 1278-1280 (1991)).
Cloned at the I and NotI sites. The DNA sequence of the isolated clone as described above is the full-length DNA of PRO364.
Sequence [designated here as UNQ319 (DNA47365-1206)] (SEQ ID NO:
1) and the derived protein sequence of PRO364.

The entire nucleotide sequence of UNQ319 (DNA47365-1206) is
1 (SEQ ID NO: 1). Clone UNQ319 (DNA47365-120
6) has been deposited with the ATCC and has been assigned ATCC deposit no. Clone UNQ319 (DNA47365-1206) has nucleotide position 121-1.
Contains a single open reading frame with an apparent transcription start site at 23
[Kozak et al., Supra], terminating at the stop codon at nucleotide positions 844-846 (
Fig1; SEQ ID NO: 1). The predicted polypeptide precursor is 241 amino acids long (Fig2; SEQ ID NO: 3). Full-length PRO364 protein shown in Fig2
(SEQ ID NO: 3) has an estimated molecular weight of about 26,000 daltons and a pI of about 6.34.
Have. A potential N-glycosylation site lies between amino acids 146-149 of the amino acid sequence shown in Figure 2 (SEQ ID NO: 3). Hydropathy analysis (not shown) suggests a type 1 transmembrane pattern; the putative signal sequence is amino acids 1 to 25
And the potential transmembrane domain is between amino acids 162 and 180 of the sequence shown in Figure 2 (SEQ ID NO: 3). Analysis of the amino acid sequence of the full-length PRO364 polypeptide suggests that some of it has homology with members of the tumor necrosis factor receptor family, and thus P
It has been shown that RO364 is a novel member of the tumor necrosis factor receptor family. The intracellular domain of PRO364 is a motif similar to the minimal domain also present in the CD30 receptor shown to be required for TRAF2 binding and also in TNFR2 (Fig2; within the region of amino acids 207-214 of SEQ ID NO: 3). ) [Lee et al., Supra (1996)]. There are three apparent extracellular cysteine-rich domains characteristic of the TNFR family [Naismith and Sprang, Trends Bi
ochem. sci., 23: 74-79 (1998)], in which the third CRD has three rather than the four or six cysteines more typical of the TNFR family. Compared to mouse GITR (described below), the PRO364 amino acid sequence has 8 cysteines in CRD1 versus 5 cysteines in CRD1 of mouse GITR, and 4 potential N-linked glycosylation sites in mouse GITR. There is one potential N-linked glycosylation site in ECD compared to. A detailed examination of the deduced amino acid sequence of the full-length native PRO364 polypeptide and the nucleotide sequence encoding it has been found by Nocentini et al., Proc. Natl. Acad. Sci.
The sequence homology with the mouse GITR (mGITR) protein reported in USA 94: 6216-6221 (1997) becomes clear. Thus, PRO364 can represent the human counterpart or ortholog of the mouse GITR protein reported by Nocentini et al.

Example 2 Isolation of Human PRO175 The method described in Klein et al., PNAS, USA 93: 7108-7113 (1996) was used with the following modifications. Yeast transformation was performed with a limited amount of transforming DNA to reduce the number of yeast cells that were transformed multiple times. PCR analysis was performed on a single yeast population, as described in Klein et al., Supra, rather than transforming E. coli following isolation of the plasmid from yeast. This was accomplished by re-streaking the initial sucrose positive colonies in fresh sucrose medium to purify the positive colonies. A single purified colony was then used for PCR with the following primers: TGTAAAACGACGGCCAGTTTCTCTCAGAGAAACAAGCAAAAC (SEQ ID NO: 15) and CAGGAAACAGCTATGACCGAAGTGGACCAAAGGTCTATCGCTA (SEQ ID NO: 16). PC for amplifying inserts and small parts of the invertase gene (allowing the determination that the insert is within the frame of invertase) and loading the entire sequence primer site.
The R primer was duplicated.

A library of cDNA fragments derived from human HUVEC cells fused to invertase was transformed into yeast and transformants were selected on SC-URA medium. URA and transformants were replica plated on sucrose medium to identify clones secreting invertase. Retest positive clones, PC
The R product was sequenced. The sequence of one clone, DNA1840, was identified as containing the signal peptide coding sequence. Oligonucleotide primers and probes were designed using the nucleic acid sequence of DNA1840. Human umbilical vein endothelial cells (HUV
EC) titration of the full-length plasmid library of cDNA from
The cfu was plated in 96-well round bottom plates and 500 cfu / pool in 192 pools. The pool was grown overnight at 37 ° C. with shaking (200 rpm). PCR was performed with a probe specific for DNA1840 in each medium. Agarose gel electrophoresis was performed and positive wells were identified by visualization of bands of the expected size. For each positive clone, colony lift followed by ³² P-
Obtained by hybridization with a labeled oligonucleotide. These clones were characterized by PCR, restriction digests, and Southern blot analysis.

The cDNA clone (DNA119355) was fully sequenced. PRO17
The nucleic acid sequence of 5 is shown in FIG. 5 (SEQ ID NO: 13). Clone PRO17
5-1150 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 21-23 [Kozak et al., Supra] (Fig5;
SEQ ID NO: 13). The predicted polypeptide precursor is 177 amino acids long and has a calculated molecular weight of approximately 20,308 daltons. By hydropathic analysis, putative cytoplasmic region (amino acids 1-25); transmembrane region (amino acids 26-51);
And a type II type transmembrane protein having an extracellular region (amino acids 52-177) was suggested. Two potential N-linked glycosylation sites were identified at position 129 (Asn) and position 161 (Asn) in the sequence shown in Figure 5 (SEQ ID NO: 14). Clone PRO175-1150 has been deposited with the ATCC and is assigned ATCC deposit no. The PRO175 polypeptide is obtained or can be obtained by expressing the molecule encoded by the cDNA insert of the deposited ATCC 209466 vector. Digestion of the vector with XbaI and NotI restriction enzymes will yield a 1411 bp fragment and a 668 bp fragment.

Based on BLAST and FastA sequence alignment analysis of extracellular sequences (using the ALIGN computer program), PRO175 has amino acid sequence identity with several members of the TNF cytokine family, particularly human Apo-2L (19. 8
%), Fas / Apo1-ligand (19.0%), TNF-α (20.6%) and lymphotoxin-α (17.5%). Most amino acid sequence identity is found in the region corresponding to the β-strand of the crystal structure of TNF-α [Banner et al.
Cell, 73: 431-435 (1993); Eck et al., J. Biol. Chem., 264: 17595-605 (1989); L.
ewit-Bentley et al., J. Mol. Biol., 199: 389-92 (1988)]. The sequence of strand C is especially conserved in all members of the family. The sequence between the first β-strand of the PRO175 polypeptide and the putative transmembrane domain is TNF-α, CD
It is relatively short, including 5 residues, compared to about 30 to about 80 residues for 95L or Apo-2 ligand.

Example 3 Northern Blot Analysis of PRO175 Expression of PRO175 mRNA in human tissues and tumor cell lines was examined by Northern blot analysis (see FIG. 8). Human RNA blots were hybridized to an approximately 700 bp long ³² P-labeled DNA probe generated by digesting the pRK5 plasmid encoding the full-length PRO175 cDNA with Xba-I; this probe contained the entire coding sequence plus several fragments. Ranking 5
Corresponds to the'and 3'sequences. Human fetal, adult, or cancer cell line mRNA blot (Clontech)
Incubated with A probe in hybridization buffer (5X SSPE; 2X Denhard's solution; 100 mg / mL denatured sheared salmon sperm DNA; 50% formamide; 2% SDS) for 60 hours at 42 ° C. Blots were washed several times in 2X SSC; 0.05% SDS for 1 hour at room temperature, then 0
． 1X SSC; washed in 0.1% SDS at 50 ° C for 30 minutes. Blots were exposed overnight and then developed by phosphor imager analysis (Fuji). As shown in Figure 8, a predominant mRNA transcript of approximately 3.2 kB was detected in fetal kidney and lung, and adult small intestine. Expression was also detected in 6 of the 8 human tumor cell lines tested, which showed approximately the same 3.2 kB transcript, and also weaker expression of approximately 1.5 and 5 kB transcripts. Was done. The results show that PRO175 polypeptide mRNA expression is relatively suppressed in normal tissues but significantly increased in tumor cell lines from lymphoid as well as non-lymphoid origin.

Example 4: Assay to detect expression of PRO364 mRNA in human cells and tissues An assay was performed to test the expression of PRO364 mRNA in normal human tissues and cancer cell lines. Various human tissues and cancer cell lines (Clontech) for the detection of PRO364 transcripts.
Was tested by Northern blot hybridization and was not detected at all. Quantitative reverse transcriptase PCR was used to convert PRO364 mRNA into PBL, brain,
It was detected in bone marrow, spleen, thymus and lungs and at relatively low levels in kidney, heart, small intestine and liver tissues (see Figure 6). Relative mRNA expression level
O364 specific primer and fluorogenic probe: DNA47365.tm.f-CCACTGAAACCTTGGACAGA (SEQ ID NO: 17) DNA47365.tm.p-CCCAGTTCGGGTTTTCTCACTGTGTTCC (SEQ ID NO: 18) DNA47365.tm.r-ACAGCGTTGTGGGTCTTGTTC (SEQ ID NO: 19) were used. And quantitative PCR using the Taqman instrument (ABI) essentially as described in Heid et al., Genome Res., 6: 986-94 (1994). The authenticity of the PCR product was confirmed by Southern blot hybridization to the corresponding cDNA. Expression levels were normalized to small intestine tissue.

In another assay, primary human T cells (T cell enriched column (R & D Systems
) Was used to isolate) and monocytes / macrophages (isolated from donor whole blood by adherence to tissue culture flasks) in RPMI supplemented with 10% FBS and 2 mM glutamine. The cells were then PHA (1 microgram /
ml; Sigma), anti-CD3 antibody (1 microgram / ml; Pharmingen), LP
S (1 microgram / ml; Sigma), TNF-α (1 microgram / ml;
Pennica et al., Nature, 312: 724-729 (1984)), or soluble PRO175 ligand (5 microgram / ml) for 24 hours. Relative mRNA expression levels were then analyzed by the Taqman procedure described above. Expression levels were normalized to buffered T cells. The results are shown in Fig. 7. Substantial upregulation of PRO364 mRNA was observed in isolated blood T cells after stimulation with phytohemagglutinin (PHA) or anti-CD3 antibody. High levels of expression were observed in isolated monocytes / macrophages and this expression was further increased by LPS (see Figure 7).

Example 5 Expression of PRO175 in E. coli The extracellular region of the PRO175 polypeptide (amino acids 52-177 of Figure 5;
PCR primer containing the NdeI and XbaI restriction sites flanking the DNA sequence (SEQ ID NO: 14) (FIG. 5A-B; SEQ ID NO: 13): positive: 5 ′
-GAC GAC AAG CAT ATG TTA GAG ACT GCT AAG GAG CCC TG -3 '(SEQ ID NO: 20
); Reverse: 5'- TAG CAG CCG GAT CCT AGG AGA TGA ATT GGG GATT -3 '(SEQ ID NO:
21) and amplified. PCR digested, 12 (derived from plasmid)
Met Gly His ₁₀ sequence following an amino acid enterokinase cleavage site: Met Gly His His His His His His His His His Ser Ser Gly His Ile Asp
Asp Asp Asp Lys His Met (SEQ ID NO: 22) downstream and in-frame with plasmid p
It was cloned into the NdeI and XbaI sites of ET19B (Novagen). The resulting plasmid was used to transform E. coli strain JM109 (ATCC 53323) using the method described in Sambrook et al., Supra. Transformants were identified by PCR. Plasmid DNA was isolated and confirmed by restriction analysis and DNA sequence analysis. Selected clones were grown overnight in liquid culture medium LB supplemented with antibiotics. Subsequently, overnight medium was used to inoculate a larger culture. The cells are grown to a given optical density, during which the expression promoter is activated.

After culturing the cells for a few more hours, the cells were harvested by centrifugation. The cell pellet obtained by centrifugation was added with 0.1 M Tris, 0.2 M NaCl, 50 mM EDT.
It was solubilized in a buffer containing A, pH 8.0 using a microfluidizer. The solubilized PRO175 protein was purified using nickel-sepharose affinity chromatography. The PRO175 protein was analyzed by SDS-PAGE, then Western blot with nickel-conjugated horseradish peroxidase, followed by ECL detection (
Boehringer Mannheim). Three predominant protein bands were detected, corresponding to the sizes of the monomeric, homodimeric, and homotrimeric forms of the protein (Fig9). Based on this result, it is believed that the soluble PRO175 protein in its native form is capable of forming homotrimers without SDS denaturation.

Example 6 Binding Specificity of PRO175 to the PRO364 Receptor The PRO175 polypeptide (described in Examples 2, 3 and 5 above) was produced by Nocentini.
Et al., Proc. Natl. Acad. Sci., 94: 6216-6221 (1997).
PRO, which is believed to be the human ortholog of the R (mGITR) polypeptide
An assay was performed to determine if it interacts with 364 and specifically binds. To test binding, soluble immunoglobulin fusion protein containing the PRO364 extracellular domain (Fig2; see amino acids 1-161 of SEQ ID NO: 3) (
Immunoadhesin) was expressed in insect cells. PRO364ECD was expressed as a C-terminal IgG-Fc tagged form in insect cells using baculovirus. Soluble PRO175 was prepared by expressing ECD as described above in Example 5.

The soluble PRO175ECD molecule was labeled with ¹²⁵ I to test its ability to interact with the PRO364 immunoadhesin. For comparison, the following TNF
Receptor family members: CD95, DR4, DR5, TNFR1, TN
FR2 and Apo-3 immunoadhesin constructs were also prepared. CD95, DR
4, DR5, TNFR1, TNFR2, and Apo-3 immunoadhesin
As previously described for NFR1 [Ashkenazi et al., Proc. Natl. Acad.
Sci., 88: 10535-10539 (1991)], prepared by fusing the ECD of each receptor to the hinge or Fc portion of human IgG. Individual TNF receptor family members are described in the Background of the Invention Section (and related references cited). For simultaneous precipitation assay, with each immunoadhesin (5 microgram) was ^{12 5} I-labeled soluble PRO175 polypeptide (1 microgram) 24 ° C.
After incubating for 1 hour at 30 ° C., protein A-sepharose was added on ice for 30 minutes. The reaction mixture was spun down, washed several times with PBS, boiled in SDS-PAGE buffer containing 20 mM dithiothreitol, then SDS-PAGE.
Was redissolved in and autoradiographed.

The results are shown in FIG. The position of the molecular weight marker (kDa) is shown in the figure. PR
The O364-IgG binding bound to the radioiodinated soluble PRO175 polypeptide. However, PRO364-IgG does not bind to CD95, DR4, DR5, T
It did not bind to the immunoadhesin constructs of NFR1, TNFR2, and Apo-3. In another assay, human 293 cells were transiently transfected with full-length PRO175 and the ability of PRO364, TNFR1, HVEM, and DcR1 receptor immunoadhesin constructs to bind to these transfected cells was determined by FACS analysis. did. 293 cells contained 10% fetal bovine serum (FBS), 2 mM glutamine, 10%.
Maintained in high glucose DMEM medium supplemented with 0 microgram / ml penicillin, and 100 microgram / ml streptomycin. Transfected cells (
1 × 10 ⁵ ) were incubated for 60 minutes at 4 ° C. in 200 microliters of 2% FBS / PBS containing 1 microgram of each receptor or ligand immunoadhesin. The cells were then washed with 2% FBS / PBS and stained with R-phycoerythrin-conjugated goat anti-human antibody (Jackson Immunoresearch, West Grove, PA). The cells were then analyzed by FACS. To test the binding of individual immunoadhesins to transiently transfected cells, a CD4 expression vector (pRK5-C
D4; Smith et al., Science, 328: 1704-1707 (1987)) was co-transfected with the PRO175 expression vector (see above). Then, FITC-conjugated anti-CD4 (Pharmingen, San Di, to identify and gate the transfected cell population in FACS analysis.
ego, CA) was used.

As shown in FIG. 11A, PRO364-IgG specifically bound to the cell surface transfected with the expression plasmid encoding full-length PRO175. No such binding was observed with either TNFR1, HVEM or DcR1 immunoadhesins. PRO364-IgG did not bind to cells transfected with the control plasmid (data not shown). These results indicate that the PRO175 polypeptide specifically binds to PRO364, and that the PRO175 polypeptide does not interact with any of the other TNF receptor family members tested. PRO175 polypeptides were identified in a human umbilical vein endothelial cell (HUVEC) library and PRO175 polypeptide transcripts were HUVE by RT-PCR.
It was easily detectable in C (data not shown). PRO364-IgG
A FACS analytical assay was performed to test whether specific binding of HUVECs was demonstrated by FACS analysis. HUVEC is Cell System (Kirkland, WA
), 10% fetal bovine serum, 2 mM L-glutamine, 10 mM He.
pes, and grown in a 50:50 mixture of Ham's F12 containing 10 ng / ml basic FGF and low glucose DMEM medium. The cells were FACS sorted with PBS, PRO364-IgG, TNFR1-IgG or Fas-IgG as the primary antibody, and goat anti-human F (ab ') 2 was labeled with phycoerythrin (CalTag, Burlin).
game, CA). PRO364-IgG was found to bind specifically to HUVEC. (
(See FIG. 11B). Neither Fas-IgG nor TNFR1-IgG showed specific binding to endothelial cells.

Example 7 Chromosomal Mapping The chromosomal localization of the human PRO175 gene was examined by radioactive hybrid (RH) panel analysis. RH mapping was performed by PCR using a radiation hybrid panel of mouse-human cells (Research Genetics) and primers based on the coding region of PRO175 cDNA [Gelb et al., Hum. Genet., 98: 1.
41 (1996)]. PC using Stanford Human Genome Center Database
Analysis of R data showed that PRO175 binds to the STS marker D1S2790 and the geneton marker AFMb352xe9 and maps to human chromosome 1q23. Of note is that CD95L also maps to chromosome 1q23 [Takahashi et al., Int. Immunol., 6: 1567-1574 (1994)], whereas the OX40 ligand maps to chromosome 1q25 [Baum et al., EMBO. J., 13: 399
2-4001 (1994)]. Thus, these TNF family members may result from replication and divergence of common ancestral genes.

Example 8 Induction of c-fos in Endothelial Cells This assay shows that PRO364 (human GITR) c-fos in endothelial cells.
Was performed to determine whether it exhibits the ability to induce a. Growth medium (50% Ham's F12 w / o GHT: low glucose, and 50% DMEM without glycine: NaHCO ₃ , 1% glutamine, 10 mM HEPES, 10% FBS.
, Human venous umbilical vein endothelial cells (HUVEC, Cell Systems) in 10 ng / ml bFGF)
0 ⁴ were plated in 96-well microtiter plates at a cell density of cells / well. The day after plating, growth medium was removed and cells were starved by adding 100 μl / well serum-free medium (growth medium without FBS or bFGF).
After 24 hours, the serum-free medium was removed. 100 μl / well of test sample and control (positive control: growth medium; negative control: 10 mM H 2
Treated with EPES, 140 mM NaCl, 4% (w / v) mannitol, pH 6.8). Cells
Incubated for 30 minutes at 37 ° C. in 5% CO ₂ . Remove the sample, bD
The first part of the NA kit protocol (Chiron Diagnostics, cat. # 6005-037) was followed. Here, each capitalized reagent / buffer below was available from the kit. Briefly, the amount of TM Lysis Buffer and probe required for the test was calculated based on the information provided by the manufacturer. Appropriate amount of thaw probe was added to TM lysis buffer. Capture hybridization buffer (Capture
Hybridization Buffer) was warmed to room temperature. Set up bDNA strips in metal strip holders and 100 μl of capture hybridization buffer for each b-DN required
Add to well A and incubate for at least 30 minutes. The test plate with cells was removed from the incubator and the medium was gently removed using a vacuum manifold. Lysis hybridization buffer with 100 μl of probe was quickly pipetted into each well of the microtiter plate. The plates were then incubated for 15 minutes at 55 ° C. Removed from incubator, placed the plate in a vortex mixer equipped with a microtiter adapter head and vortexed at setting # 2 for 1 minute. 80 μl of lysate was removed and added to bDNA wells containing capture hybridization buffer and pipetted up and down to mix. The plates were incubated at 53 ° C for at least 16 hours.

The next day, the second part of the bDNA kit protocol was followed. Specifically, the plates were removed from the incubator, placed on the bench and cooled for 10 minutes. The volume of addition required was calculated based on the information provided by the manufacturer. Amplifier Concentration (Amplifier Conc) at 1: 100 dilution in AL Hybridization Buffer
Amplifier working solution was prepared by preparing the entrate) (20 fm / μl). The hybridization mixture was removed from the plate and washed twice with detergent A. 50
μl of amplifier working solution was added to each well and the wells were incubated for 30 minutes at 53 ° C. The plate was then removed from the incubator and cooled for 10 minutes. Labeled probe working solution was prepared by making a labeled concentrate (40 pmoles / μl) at a dilution of 1: 100 in AL hybridization buffer. After a 10 minute cooling period, the amplifier hybridizing mixture was removed and the plate was washed twice with detergent A. 50 μl of labeled probe working solution was added to each well and the wells were incubated at 53 ° C. for 15 minutes. The substrate solution is prepared by diluting the substrate enhancer 1: 100 with substrate buffer. The plate was cooled for 10 minutes, the labeled hybridization mixture was removed, and the plate was washed twice with detergent A and three times with detergent D. Substrate solution with 50 μl enhancer was added to each well. The plates were incubated for 30 minutes at 37 ° C and the RLU read on an appropriate luminometer. The replicates were averaged to determine the coefficient of variation. Negative control (HEP described above
Measurements of fold-increase activity versus ES buffer value were indicated by chemiluminescence units (RLU). A sample was considered positive if it showed at least twice the value of the negative control. PRO364 assay results: Negative control = 2.57 RLU Positive control = 29.57 RLU 0.01% PRO364 = 8.60 RLU 0.1% PRO364 = 9.66 RLU 1% PRO364 = 3.44 RLU 1. Negative control = 3.19 RLU Positive control = 18.22 RLU 0.01% PRO364 = 3.51 RLU 0.1% PRO364 = 4.54 LU 1% PRO364 = 6.98 RLU As described above, PRO364 doubles. It was assayed as positive, indicating its ability to induce c-fos expression in endothelial cells.

[0185] Example 9   This assay shows that PRO175 (hGLITTER) c-f in pericytes.
It is designed to determine whether it exhibits the ability to induce os.   On day 1, four T-25 tissues of bovine pericytes (VEC Technologies) in growth medium.
A culture flask was obtained. Remove all but 5 ml of medium and place the flask in 5% CO _Two , Placed in an incubator at 37 ° C. On the second day, pericytes were trypsinized and
Cardiac sedimented, growth medium (20% FBS, 1X penicillin and streptomycin and
And low glucose DMEM containing 1X and 1X fungizone)
Four 96 well microtiter plates were plated. Remove the medium on day 7,
100 μl of pericytes were used as test sample and control (assay diluent: DMEM + 5
% FBS; Positive control: DMEM + 5% serum +/− PDGF @ 50 ng / m
l; Negative control: treated with protein 32). Cells with 5% CO_Two
Incubated at 37 ° C. Remove the sample and bDNA kit (Chiron)
The first part of the protocol was followed.   The c-fos probe was used as a lysis buffer (Lysis Buf) included in the bDNA kit.
fer). After a 30 minute incubation, the medium is detached from the cells and c
100 μl of lysis buffer containing -fos probe was added to each well. Just
The plates were incubated for 15 minutes at 55 ° C. During this period, 100 μl of capture high
The Bridging Buffer (Capture Hybridization Buffer) was included in the kit
Add to b-DNA plate. After 15 minutes, remove the cells from the incubator.
Take out and vortex for 1 minute with a microtiter plate stirrer. 85 μl of lysis
Bacterial fluid was removed and 100 μl of capture hybridization buffer on bDNA plate
Was added to. The plates were incubated at 53 ° C for at least 16 hours.

The next day, the second part of the bDNA kit protocol was followed. All reagents were removed from the kit and brought to room temperature. Remove the plate from the incubator,
Cooled on the bench for 10 minutes. The amplifier was diluted 1: 100 with the amplifier / labeled probe diluent. After 10 minutes, the hybridization mixture was removed from the plate and washed twice with wash buffer A. 50 μl of diluted amplifier was added to each well and the plate was incubated at 53 ° C. for 30 minutes. The plate was then removed from the incubator and placed on the bench to cool for 10 minutes. The labeled probe was diluted 1: 100 with the amplifier / labeled probe diluent. After 10 minutes, the amplifier was removed and the plate washed again with wash buffer A twice. Add 50 μl of diluted labeled probe to each well,
The plates were incubated at 53 ° C for 15 minutes. The plate was then removed from the incubator and cooled for 10 minutes. Where 3 for each mole of substrate needed for the assay.
A substrate solution was prepared by adding μl of substrate enhancer. The labeled probe mixture was removed from the wells and the plate was washed twice with wash buffer A and three times with wash buffer B. 50 μl of substrate solution was added to each well and the plate was incubated at 37 ° C. for 30 minutes. The plate was read for chemiluminescence using a luminometer. Duplicates were averaged and the standard deviation / coefficient of variation was determined. The fold-increase activity relative to the negative control (protein 32) value was measured by chemiluminescence unit (RLU)
Indicated by A sample was considered positive if it showed at least twice the negative control value. The results of these analyzes are shown in Figure 12. As shown in FIG. 12, PRO175 was found to c-fos in bovine pericytes.
It was analyzed to be positive in inducing expression.

Material Deposits The following materials have been deposited with the American Type Culture Collection, 10801 University Boulevard, Manassas, Virginia USA (ATCC): Material ATCC Deposit Number Deposit Date DNA47365-1206 ATCC209436 Nov 7, 1997 DNA19355 -1150 ATCC209466 November 7, 1997 These deposits were made in accordance with the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the purposes of Patent Procedure and its Regulations (Budapest Treaty). This guarantees that the viable culture of the deposit will be maintained for 30 years from the date of deposit.
The deposit may be obtained from the ATCC in accordance with the terms of the Budapest Treaty and in accordance with the agreement between Genentech and ATCC, whichever comes first, at the time of issuance of the relevant U.S. patent or at any time. At the time of publication of a U.S. or foreign patent application, it is guaranteed that the progeny of the deposited culture will be permanently and unrestrictedly available, and will be subject to United States Patent Act Section 12235 USC and the Patent Office Commissioner Regulations accordingly (especially reference number 886OG.
(Including 37 CFR §1.14 of 638) guarantees that the descendants will be available to those who have been determined by the US Patent Office Commissioner to have rights. The assignee of this application shall promptly replace the material with another of the same at the time of notification should the culture of the deposited material be killed or lost or destroyed if cultured under appropriate conditions. Agree with. The availability of deposited material is not to be construed as a license to practice the invention in breach of any rights granted under the authority of any government pursuant to patent law. The written specification given above is considered sufficient to enable one skilled in the art to practice the invention. The deposited embodiment is intended as an illustration of one of the aspects of the invention and any functionally equivalent construct is within the scope of the invention, so that the deposited deposits are within the scope of the invention. It is not limited. The deposit of material herein is not an admission that the written description contained therein is sufficient to enable practice of any aspect of the invention, including its best mode. It is not to be construed as limiting the scope of the claims to the particular illustrations presented. Indeed, various modifications of the invention in addition to those shown and described herein will be apparent to those skilled in the art from the foregoing description and fall within the scope of the appended claims.

[Brief description of drawings]

[Fig1] Native sequence PRO364 cDNA (nucleotides 121-84
FIG. 3 is a view showing a nucleic acid sequence (SEQ ID NO: 1) containing the nucleic acid sequence (SEQ ID NO: 2) of 3), wherein the nucleic acid sequence (SEQ ID NO: 1) is “UNQ319” and / or “DNA”.
It is a clone designated as "47365-1206". In addition, the position of the initiator methionine residue is shown, as well as "47365.tm.f" and "47365.t".
m. The three oligonucleotide primers designated "p" and "47365.tm.r" are underlined. The putative transmembrane domain of the protein is encoded by nucleotides 604-660 in the figure.

FIG. 2 shows the amino acid sequence (SEQ ID NO: 3) derived from nucleotides 121-843 of the nucleic acid sequence shown in FIG 1 (SEQ ID NO: 2).
Potential transmembrane domains exist between and include amino acids 162 and 180 in the figure.

[Fig3A-C] Consensus nucleic acid sequence ("(consen01)"
It is a figure which shows SEQ ID NO: 4).

[Fig4] F designated as DNA44825 (SEQ ID NO: 4) in the present invention
FIG. 3 shows the “(consen01)” consensus nucleic acid sequence shown in ig3A-C. In addition, "44825.GITR.f" (SEQ ID NO: 5), "44825.f1" (
SEQ ID NO: 6), "44825.GITR.p" (SEQ ID NO: 7), "4482
5. r2 "(SEQ ID NO: 8)," 44825.p1 "(SEQ ID NO: 9)," 44 "
825. GITR. The positions of "r" (SEQ ID NO: 10), "44825.f2" (SEQ ID NO: 11) and "44825.r1" (SEQ ID NO: 12) are underlined.

[Fig5A-B] cDNA designated here PRO175-1150
It is a figure which shows the coding nucleic acid sequence (sequence number: 13) and deduced amino acid sequence (sequence number: 14) of a clone.

FIG. 6 shows the relative mRNA expression of PRO364 in various human cells and tissues as determined by quantitative reverse transcription PCR.

[Fig7] (Anti-CD3 antibody, as determined by quantitative reverse transcription PCR
FIG. 6 shows the relative mRNA expression of PRO364 in primary human T cells and monocytes (treated with PHA or LPS).

[Fig8] Human tissues (identified adult and fetal tissues) and tumor cell lines (HL60 promyelocytic leukemia, HeLa S3 cervical cancer, K562 chronic myelogenous leukemia, MOLT4 lymphoblastic leukemia, large Burkitt's) Lymphoma, SW48
0 colorectal adenocarcinoma, A549 lung cancer, and G361 melanoma) PRO175mRN
FIG. 3 shows Northern blot analysis of A expression.

FIG. 9 shows analysis of soluble PRO175 polypeptide by SDS-PAGE.

FIG. 10 shows the results of the co-precipitation assay described in Example 6 above. Autoradiograph of SDS-PAGE gel is PRO364-Ig
It was demonstrated that the G molecule bound to the radioiodinated DNA19355 polypeptide. No binding was observed with the other immunoadhesin constructs shown.

[FIG. 11A] FACS analysis of transfected 293 cells assayed for binding to the identified receptor or ligand immunoadhesin constructs.

FIG. 11B shows FACS analysis results of HUVEC cells assayed for binding to the identified immunoadhesin constructs.

FIG. 12 is a bar graph showing the effect of PRO175 ligand on c-fos expression in human pericytes.

[Procedure amendment]

[Submission date] July 2, 2002 (2002.7.2)

[Procedure Amendment 1]

[Document name to be amended] Statement

[Name of item to be amended] Detailed explanation of the invention

[Correction method] Change

[Contents of correction]

Detailed Description of the Invention

FIELD OF THE INVENTION The present invention relates generally to nucleic acids and their encoded intracellular proteins, the expression of which is modulated in cells undergoing angiogenesis and / or angiogenesis. These nucleic acids and proteins have not yet been identified as having a biological role in the process of angiogenesis or differentiation of endothelial cells into tube-like structures. The invention further relates to methods useful for promoting or inhibiting angiogenesis and / or cardiovascularization in a mammal in need of such effects. This includes diagnosis and treatment of cardiovascular disorders as well as oncological disorders. In addition to that, the present invention further
-The use of PA polypeptide antibodies as diagnostic probes or therapeutic agents, as well as the use of polynucleotide sequences encoding PA polypeptides as diagnostic probes or therapeutic agents.

BACKGROUND OF THE INVENTION Intracellular proteins play an important role in the formation, differentiation and maintenance of multicellular organisms, among others. The fate of many individual cells, eg, proliferation, migration, differentiation, or interaction with other cells, is typically governed by information received from other cells and / or the intermediate environment. This information is often transmitted through secreted proteins (eg, mitogenic factors, survival factors, cytotoxic factors, differentiation factors, neuropeptides, and hormones), which in turn are mediated by diverse cellular receptors or membrane-bound proteins. Recognized and activated. Each activation signal initiates a specific signal transduction pathway consisting of intracellular proteins (eg, protein kinases, DNA-binding regulatory proteins, protein processing proteins, proteases, glycosidases), which causes the fate of cells to respond to the signals. The activity, expression, or amount of other proteins associated with or required for it is altered up or down. For example,
Detectable changes in RNA or protein levels of intracellular proteins required for cell growth or differentiation in response to transduction of signals that regulate cell growth and differentiation include
It can be regulated in part by receptor-mediated phosphorylation of intracellular proteins involved in signal-inducing pathways.

Intracellular proteins and their genetic sequences have a variety of industrial applications, including drug targeting for medicine, diagnostics, pharmaceuticals, biosensors, and bioreactors. Most currently available protein drugs are secreted cytokines or their antibody analogs, and most targets of small molecules, peptides, or antisense drugs are intracellular proteins, or the intracellular genes that encode them. For example, those drugs interact with intracellular proteins to block activity and block associated signaling pathways, thereby stopping (or modulating) the cellular response or activity controlled by that pathway. To). Efforts are underway to identify new native intracellular proteins and their genes, the signaling pathways in which they function, and the intracellular proteins or genes that they modulate. Such genes and their proteins are typically discovered by binary comparison experiments in which differential analysis is done for RNA or protein in the response of cells or tissues to certain stimuli. There is a need for additional products, methods and assays that provide a means of controlling angiogenesis or modulating the cellular response to angiogenic stimuli and the tissue response to such stimuli. Such products, methods, assays will provide benefits in many medical conditions and methods.

SUMMARY OF THE INVENTION In one aspect, the invention includes a method of assessing the efficacy of treatment of an angiogenic disorder in a patient, the method comprising one or more of the PA: 1-27 nucleic acid sequences. Providing a test cell population capable of expressing; detecting expression of one or more of these nucleic acid sequences; comparing this expression with expression of the nucleic acid sequence in a reference cell population of known angiogenic stage; If present, identifying the difference in expression level between the test cell population and the reference cell population. In various embodiments, the patient is a mammal,
More preferably it can be human. In other embodiments, the test cell population is provided from a mammalian patient in vitro, ex vivo, or in vivo in a mammalian patient. Expression of the nucleic acid sequence is increased or decreased in the test cell population as compared to the reference cell population. In a further aspect, the invention includes a method of diagnosing an angiogenic disorder, the method providing a test cell population capable of expressing one or more of the PA: 1-27 nucleic acid sequences; Detecting the expression of one or more of the nucleic acid sequences; comparing this expression with the expression of the nucleic acid sequences in a reference cell population in which the angiogenic stage is known; Identifying differences in expression levels between In various embodiments, the patient can be a mammal, more preferably a human. In other embodiments, the test cell population is provided from a mammalian patient in vitro, ex vivo, or in vivo in a mammalian patient. Expression of the nucleic acid sequence is increased or decreased in the test cell population as compared to the reference cell population.

In another aspect, the invention includes a method of identifying a test therapeutic agent for treating an angiogenic disorder in a patient, which expresses one or more of the PA: 1-27 nucleic acid sequences. A test cell population is contacted with a test therapeutic agent; expression of one or more of these nucleic acid sequences is detected; this expression is expressed in a reference cell population whose angiogenic stage is known. Comparing to the expression of the nucleic acid sequence; and, if present, identifying the difference in expression level between the test cell population and the reference cell population. In various embodiments, the patient can be a mammal, more preferably a human. In addition, study treatments may include known anti-angiogenic or unknown anti-angiogenic agents.
It may be any of the angiogenic disorders. When the test therapeutic agent is a known anti-angiogenic agent, it is an agonist or antagonist of the native PA polypeptide. The agonist can be an anti-PA antibody. Similarly, antagonists are anti-PA
It can be an antibody. The angiogenic disorder treated may be selected from the following diseases or disorders: vascular tumor,
Proliferative vitreoretinopathy, rheumatoid arthritis, Crohn's disease, atherosclerosis, ovarian hyperstimulation, psoriasis, endometriosis with neovascularization, restenosis following balloon angioplasty, hyperplasia of scar tissue, Peripheral vasculopathy, hypertension, inflammatory vasculitis, Reynolds disease and Reynolds phenomenon, aneurysm, arterial restenosis, thrombophlebitis, lymphangitis, lymphedema, wound healing and tissue regeneration, ischemic reperfusion injury , Angina, myocardial infarction, chronic heart abnormalities, heart failure such as congestive heart failure, age-related macular degeneration, and osteoporosis.

In a further aspect, the invention includes a method of diagnosing or measuring susceptibility to an angiogenic disorder in a patient. In this aspect, the method comprises PA: 1-2
A test cell population capable of expressing one or more of the seven nucleic acid sequences; detecting one or more of these expressions; expressing this in a reference cell population whose angiogenic stage is known. Comparing the expression of the nucleic acid sequence; and, if present, identifying the difference in expression level between the test cell population and the reference cell population. The patient can be a mammal, more preferably a human. In an alternative aspect, the invention provides administering to a patient suffering from or at risk of developing an angiogenic disorder an agent that modulates one or more expression or activity of PA: 1-27 nucleic acid sequences. A method of treating an angiogenic disorder comprising: The agent may be one that reduces the expression or activity of one or more of PA: 5, 14 and 15. Alternatively, PA: 1-4, 6-13 and 16-26
It is also possible to increase the expression or activity of one or more of the above. Further, the agent may be an antibody to the polypeptide encoded by the PA nucleic acid sequence, an antisense nucleic acid molecule, a peptide, a PA polypeptide agonist, a PA polypeptide antagonist, a peptide analog, a small molecule, or other drug. .

The invention also provides a 1 for detecting two or more PA: 1-27 nucleic acid sequences.
Alternatively, a kit including a plurality of reagents is also included. Furthermore, the present invention relates to PA: 1-
It also includes an array of probe nucleic acids capable of detecting two or more of the 27 nucleic acid sequences. The polypeptides and nucleic acids of the invention can be used to treat angiogenic disorders in patients. Treatment of angiogenic disorders can be in mammals, preferably humans. In various embodiments, therapeutic compositions containing the polypeptides and nucleic acids of the invention can be used to treat angiogenic disorders. These therapeutic compositions can contain pharmaceutically acceptable carriers as well as active agents such as cardiovascular agents, endothelial agents, angiogenic agents, and vasodilators. Also provided is a kit comprising a pharmaceutically acceptable carrier together with a therapeutic composition for use in treating an angiogenic disorder, the therapeutic composition comprising a PA polypeptide, an agonist of a PA polypeptide, or It is an antagonist of PA polypeptide. In another aspect, the invention provides an isolated polypeptide that is at least 80% identical to a polypeptide having the amino acid sequence of SEQ ID NO: 72, or a fragment, derivative, analog, or homologue thereof. Furthermore, the invention relates to a polypeptide, fragment,
Antibodies to homologs, analogs and / or derivatives are also provided.

Also included in the invention is an isolated nucleic acid molecule comprising a nucleic acid sequence that encodes the polypeptide of SEQ ID NO: 72, or a nucleic acid sequence that is at least 75% identical to the complement of that nucleic acid sequence, and Vectors and host cells containing the nucleic acid sequences are included. In a still further aspect, the invention includes a pharmaceutical composition comprising an isolated nucleic acid or isolated polypeptide. Other embodiments include methods of detecting the presence of nucleic acids and polypeptides.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. Furthermore, the materials, methods, and examples are illustrative only and not intended to be limiting. Other features and advantages of the invention will be apparent from the following detailed description and claims.

DETAILED DESCRIPTION OF THE INVENTION One consequence of the generation of cellular responses to certain stimuli is the formation of new blood vessels. This can occur by two related mechanisms: (1) angiogenesis, the growth of new blood vessels from pre-existing blood vessels, and (2) angiogenesis, the formation of blood vessels through the aggregation of endothelial cells. The inner surface of all blood vessels is lined with endothelial cells.
Vascular endothelial cells are located at the interface between blood and the extravascular space and play a role in maintaining cardiovascular homeostasis and mediating pathophysiological responses to injury. For example, angiogenesis occurs in adults during events such as wound healing and ovulation. During angiogenesis, endothelial cells that respond to environmental stimuli undergo many cellular changes and reactions, including destruction of basement membranes by cellular proteases, permeabilization and migration of endothelial cells into the extracellular matrix, endothelial proliferation, And a series of complex steps involving the formation of interconnected vascular networks. The formation of this new blood vessel occurs at distinct stages, which include various intracellular proteins, extracellular matrix components, proteases and protease inhibitors,
Modulation or expression of inflammatory molecules, chemokines, and molecules involved in cell division and proliferation, cytoskeletal reorganization, adhesion molecules, and apoptosis of certain endothelial cell populations are required and dependent.

Endothelial cells also undergo angiogenesis during tumor growth and metastasis and neovascularization associated with various non-neoplastic diseases or disorders. In the case of tumor growth, angiogenesis was found to be very important in the transition from hyperplasia to neoplasia and in providing nutrients for growth of solid tumors (Folkman et al., Nature, 339: 58 (1989)). Angiogenesis allows the tumor to come into contact with the host's vascular bed, which in turn provides a pathway for metastasis of tumor cells. Indeed, solid tumor growth and metastatic progression depend on angiogenesis, for example the correlation between the number and density of microvessels and the presence of real distant metastases in histological sections of invasive human breast cancer. It is supported by studies that show a relationship (Weidner et al., New Engl. J. Med. 324: 1 (1991)). Recent data suggest that blockage of new blood vessels can delay tumor growth by blocking the supply of oxygen and nutrients. Without a new blood supply, tumors cannot grow larger than about 1-2 mm in diameter. Therefore, a new vascular rest (an
giostatic) treatment is desired. There is a need for additional products, methods and assays that provide a means of controlling angiogenesis or modulating the cellular response to angiogenic stimuli or the tissue response to such stimuli. Such products, methods, and assays provide benefits in many medical conditions and procedures.

In view of the role of vascular endothelial cell growth and angiogenesis in many diseases and disorders, these processes are provided to provide benefits such as promoting vascular repair or maintenance and attenuating or inhibiting cancer and tumor progression. It is desirable to have a means of modulating one or more of the biological effects that cause It is also desirable to have a means of assaying for the presence of pathogenic polypeptides in normal and disease states, especially cancer. further,
Identification of factors that can prevent or reduce cardiomyocyte hypertrophy is an emerging therapeutic strategy for the inhibition of pathophysiological heart growth, as there is no generally applicable treatment for the treatment of cardiac hypertrophy. Is of primary importance in the development of. Although there are currently several treatment modalities for various cardiovascular and oncological diseases,
There is still a need for additional treatment methods. Identification and characterization of novel intracellular polypeptides, herein termed "PRO-angiogenic" polypeptides (PA polypeptides), whose gene expression is modulated in cells undergoing angiogenesis or angiogenesis , Proved useful in meeting these demands.

Several known genes and gene products have been identified in the present invention, which are differentially either positive-sense or negative-sense when endothelial cells are incubated in angiogenic, tube-forming environment. (differentially) expressed. In the present application, they are named PA nucleic acid sequence and PA polypeptide, respectively, whose mRNA is
Identified polynucleotides (or collections of polynucleotides) and their encoded polypeptides that are modulated in endothelial cells that undergo tube formation, an essential step in vascular development during angiogenesis and angiogenesis Was done. Human umbilical cord endothelium undergoes tube formation in collagen gels in the presence of growth factors that mimic the angiogenic environment of endothelial cells in vivo, known as Gene Calling (trade name) technology Applied to cells (HUVECS). The use of three-dimensional gels is a prerequisite for endothelial cell differentiation and fusion. HUVECS grown on the surface of gelatin gels or on plastic does not undergo tube formation. The method used to quantify endothelial cell gene expression is described by quantitative expression analysis (“QEA
, US Pat. No. 5,871,697; Title "Methods and apparatus for identifying, classifying, or quantifying DNA sequences in a sample without sequencing"; Shimkets et al., Nature Biote.
chnology 17: 798-803 (1999)).

The Gene Calling ™ method has been used to identify over 100 differentially expressed genes in HUVECs in tube-forming environments.
It was already known that QEA is expressed in HUVECs during angiogenesis to show that QEA is indeed a valuable method for the identification of differentially expressed genes in the angiogenic setting. It was found that four genes were also differentially expressed in this experiment. These genes are as follows: 1-CD31 (PECAM-1) Genbank Registration: m28526 2-Thrombospondin Genbank Registration: x14787 3-Collagenase-1 (MMP-1) Genbank Registration: x05231 4-interleukin- 8 Genbank Registry: m28130 The present invention discloses 27 genes, and the proteins encoded by them, which were previously identified as being expressed in endothelial cells during differentiation in tube-like structures. There wasn't. For this reason, these genes and gene products represent important therapeutic modalities or targets for use in the clinical stimulation associated with angiogenesis. These include certain pathologies that suggest stimulation of angiogenesis on the one hand and inhibition of angiogenesis on the other.

Among the genes and gene products that are promoted are tissue factor pathway inhibitors-2 (
PA13), aggrecanase (ADAMTS-4) (PA12), protein K
IAA0188, placental growth factor (PIGF) (PA22), fibroblast growth factor 16
(FGF-16) (PA24), stanniocalcin precursor (PA23), tyrosine kinase receptor (epithelial cell ECK) (PA16), interleukin 6 signal transducer (gp130) (PA18), CD82 (PA19),
Podocalyxin-like protein (PA3), OX40 cell surface antigen (PA17),
Alpha-2 integrin (PA21), protein zero related protein (PA
20), T-plastin (PA7), moesin (PA4), dynein light chain (PA
9), myosin-IC (PA6), ankyrin-2 (PA10), actin packaging protein (PA8), osteonidogen (PA1), white protein homolog (PA25), cathepsin B (PA11), and laminin gamma-2. Chain (PA2
) Is included. Among the genes and gene products that are suppressed in the angiogenic environment are tyrosine kinase receptor ax1 (PA15), urokinase inhibitor (PA
I-2) (PA14), and mesothelial keratin K7 (type II) (PA5). In addition, additional genes or gene products differentially expressed in angiogenesis, which are considered pro-angiogenic for the purposes of the present invention, are ALG-2 interacting proteins (P
A26) and collagenase. In addition, the novel gene r0v0-176 (PA
27) is also differentially expressed.

A summary of these differentially expressed PA genes is included in Table 1. * The discrepancy in modulation between Gene Calling and TaqMan is due to a very steep time-dependent mRNA expression in which small experimental variations can result in the changes observed in the two methods. Let's do it.

In Table 1, the plus sign indicates up-regulation of gene expression and the minus sign indicates down-regulation. The time frame for these experiments was 24 hours versus 4 hours in a gel environment that encourages tube formation. "ND" means that the level of change could not be measured. A summary of differentially expressed sequences is shown in Table 1. The first column gives the trivial name of each of the genes according to their PA number, the second column lists the sequence database reference numbers, the third column gives the results of the Gene-Calling expression analysis, and the fourth column gives the TaqMan. (Trade name) Gives the results of expression analysis. One of skill in the art will recognize that the information in Table 1 can be used to identify a particular PA sequence. For example, if the sequence database reference number for a particular nucleic acid sequence is known, this reference number can be used to identify a particular PA sequence. Given PA
For a sequence, its expression can be measured using any method commonly known in the art. Based on all of these, one of skill in the art would be able to deduce the information needed to detect and measure the expression of each PA nucleic acid sequence, as required in each of the methods described herein.

These genes and the polypeptides that they encode are considered to be essential components, alone or separately, in the biological pathways associated with endothelial cell tube formation or angiogenesis. Angiogenesis, tumor growth and metastasis, rheumatoid arthritis, psoriasis, atherosclerosis, diabetic retinopathy, post lens fibroplasia, angiogenic glaucoma, age-related macular degeneration, hemangiomas, transplanted It is an important component of various diseases and disorders, including immune rejection of corneal and other tissues, and chronic inflammation. Accordingly, the present invention provides drugs useful in detecting, monitoring, analyzing, identifying or treating the development or progression of angiogenesis or angiogenesis in these and other related conditions, or in treating these and related conditions. , Providing means for identifying antisense, small molecules, antibodies, for example.

Some PA genes that are differentially expressed under angiogenic conditions have improved expression levels, and other differentially expressed PA genes have suppressed expression levels. Therefore, in the treatment of pathologies in which inhibition of new angiogenesis is desired, such as solid tumors, it is advantageous to administer a therapeutic agent that is an antagonist to the particular activity exhibited by the PA polypeptide such that its expression level is improved. Will. In pathologies where stimulation of angiogenesis is advantageous, such as wound healing or cardiomyopathy, a special P expression is promoted during angiogenesis.
It would be therapeutically advantageous to administer a pharmaceutical agent that provides an agonist to the A polypeptide and / or that exerts an antagonistic effect on the PA polypeptide whose expression is suppressed during angiogenesis. We have also shown that certain PA genes that are differentially expressed in angiogenesis have suppressed expression levels. Thus, in the treatment of pathologies in which inhibition of new angiogenesis is desired, such as solid tumors, a therapeutic agent that is an agonist for a particular activity exhibited by a PA polypeptide whose expression is suppressed to counter the suppression is administered. Would be advantageous. Similarly, in pathologies where angiogenesis is desired for therapeutic benefit, it may be advantageous to administer a therapeutic agent that is an antagonist to a PA polypeptide that is underexpressed in angiogenesis, thus enhancing the inhibition of PA polypeptide. Will. Below follows a further discussion of nucleic acid sequences that are differentially expressed in angiogenesis. In order to facilitate understanding, these PA nucleic acid sequences are characterized by their common features and / or
Or group according to characteristics.

Extracellular Matrix-Associated Proteins Osteonidogen (nidogen), acc: D86425 [PA1] Nidogen is normally associated with basement membrane and is associated with collagen I and cell-cell adhesion and basement membrane organization. Interacts with IV, laminin, and perlecan (Nicosia et al., Dev Biol, 164: 197-206, 1994; Kohfeldt et al., J Mol.
Biol 282, 99-109, 1998). TaqMan ™ analysis was performed as described in Example 19 using the primers and probes provided in Table 4. The result of osteonidogen gene expression is Fig.
3 shows. Osteonidogen expression was seen to be significantly enhanced over the 2 day course of cell growth; expression is somewhat higher in cell growth under conditions of tube formation.

Laminin gamma-2 chain, acc: U31201 [PA2] Laminin gamma-2 chain binds to proteins in the basement membrane. It is an A-chain (400
kD) and two B-chains (200 kD). Each subunit consists of at least 12 repeats of the EGF-like domain. Laminin induces adhesion and expansion of many cell types and promotes neurite outgrowth in culture. The major components of the basement membrane are the glycoproteins laminin and collagen IV, both of which are heterotrimers. Laminin is a cruciform protein trimer, termed A, B1, and B2 when isolated from the extracellular matrix of tumor cells, which are alpha-1, beta-1, and gamma-1, respectively. Will be named again. Several isomers of each chain have been identified. Laminins with gamma-1 chains have been shown to be important for cell differentiation, adhesion, migration, and neurite outgrowth (Hager et al., Neuroscience 86:
1145-54, 1998). Several peptides derived from laminin gamma-1 chain have the property of promoting endothelial cell adhesion and have angiogenic activity (Ponce et al., Cir R
es 84: 688-94, 1999). However, laminin, which has a gamma-2 chain,
It was not shown to be associated with these processes. TaqMan ™ analysis was performed as described in Example 19 using the primers and probes provided in Table 4. The results for laminin are shown in Fig4.
Expression of laminin gamma-2 chain is significantly enhanced under tube-forming conditions (gel) compared to cells grown under conditions that do not promote tube formation (membrane). Expression peaked at 16-24 hours, suggesting that laminin expression contributes to the early stages of growth.

Podocarixin-like protein, acc: U97519 [PA3] PA3 is similar to podocalyxin on glomerular filters and vascular endothelium. It is a sialoprotein that binds prominently to L-selectin in endothelial cells. Podocalixin-like proteins have been suggested to be associated with adhesion and lymphocyte rotation. Podocalixin is a component of the endothelial plasma membrane. Although the function of podocalyxin in endothelial cells is incomprehensible, it has recently been shown that podocalyxin can function as an L-selectin receptor in inflamed lymph nodes (Sassetti et al., J Exp Med 187: 1965-75, 1998). reference). Thus, this receptor may play several roles in cell-cell interactions or adhesion. TaqMan ™ analysis was performed as described in Example 19 using the primers and probes provided in Table 4. The results for podocalyxin-like proteins are shown in Fig5. Gene expression is stronger under conditions that do not promote tube formation (membrane) than cells grown under tube formation conditions (gel). Expression peaked at 8-16 hours, suggesting that laminin expression contributes to early stages of growth.

Cytoskeletal protein moesin, acc: M69066 [PA4] Moesin (membrane-organizing extension spike protein) is a heparin or heparin sulfate receptor candidate in the interaction of basement membrane heparan sulfate with cells. It has significant sequence homology to ezrin, protein 4.1, talin, radixin, and merlin. These proteins make up a family with structural, and possibly functional, relationships. All of these proteins are localized to the submembrane cytoskeleton. Furthermore, moesin is widely expressed in different tissues, but it is localized to filamentous pseudopodia and other membranous processes important for cell-cell recognition and signal transduction and cell motility (Amieva and Furthmayr Exp Cell Res 219: 180-96
, 1995). TaqMan ™ analysis was performed as described in Example 19 using the primers and probes provided in Table 4. The results for moesin are shown in Figure 6. Moesin expression is significantly higher under conditions that do not promote tube formation than under conditions that promote tube formation. Expression levels are high at all times tested.

Keratin K-7, accX03212 [PA5] Cytokeratin (also known as keratin) is an intermediate filamentous protein expressed predominantly in endothelial cells (see Alberts et al.). The gene for monolayer epithelial keratin K7 has been assigned to chromosome 12 using Southern blot analysis of somatic cell hybrids. In particular, the gene was located in region 12q12-q14 by in situ hybridization of metaphase chromosomes. Keratin is often used as a marker for various types of tumors (Hibino et al., J Invest Dermato 112: 85-90,
1999; Sundstrom and Stigbrand, Int J Biol Markers 9: 102-8, 1994). TaqMan ™ analysis was performed as described in Example 19 using the primers and probes provided in Table 4. The results for mesothelial keratin are shown in Figure 7. Mesothelial keratin expression was strongly suppressed in growing HUVECs, and was significantly suppressed under tube-forming conditions (gel) than in the membrane. These results suggest that stimulation of mesothelial keratin expression is useful in the desired clinical context of angiogenesis.

Myosin-1C, acc: U14391 [PA6] Class I myosin is a single-head actin-binding, mechanochemical “motor” protein with heavy chains in the molecular weight range of 110-130 kDa. These proteins do not make up the fiber. Each myosin I heavy chain is associated with 1-6 light chains,
It binds to a particular motif known as the IQ domain. In the vertebrate myosin I isomer, the light chain is calmodulin, which is believed to regulate locomotor activity (see Coluccio J Cell Sci 107: 2279-84, 1994). A protein similar to calmodulin binds the myosin I isomer from lower eukaryotes. Some myosin I isomers from lower eukaryotes are regulated by phosphorylation. However, the phosphorylation site is not present in the vertebrate myosin I isomer.

T-Plastin, acc: L05491 [PA7] Plastin is a family of actin-binding proteins that is transduced during eukaryotic development and expressed in most tissues of higher eukaryotes (Lin et al., J Biol. Chem
268: 2781-92, 1993; Arpin et al., J Cell Biol 127: 1995-2008, 1994). Two
It was found that there were two T-plastin isomers and their expression was restricted to solid tissue replicating cells. However, L-plastin is induced in many human solid tumor-derived cells. Both plastin isomers contain a potential calcium binding site near the N-terminus. T-plastin appears to be associated with cytoskeletal rearrangements. In view of the increased expression of T-plastin mRNA in cisplatin resistant tumor cells (see Hisano et al., FEBS Lett 397: 101-7, 1996), and its expression during endothelial cell tube formation reported here, this gene Appears to be a good target for combination therapy of antibody-based therapies with cisplatin or other chemotherapeutic alkylating or cross-linking agents. TaqMan ™ analysis was performed as described in Example 19 using the primers and probes provided in Table 4. Results for T-plastin are shown in Figure 8. T-plastin expression shows a narrow peak at 8-24 hours of growth. There were few significant differences between the gel-grown cells and the membrane-grown cells.

Actin-packing protein, acc: U09873 [PA8] The actin-bundling protein is involved in the kinetics of actin filaments. They are also known as fascins and are also found in membrane folds, microprojections, and tension fibers (Yamashito et al. Mol BIol Cell 9: 993-1006, 1998). Fascin is a homolog of the Drosophila "signature" gene product (SLN) and the human gene is HSN.
It is called. The heLa cell-derived 55 kD protein is thought to be involved in the assembly of actin fiber bundles present in microprojections, membrane folds and tension fibers. TaqMan ™ analysis was performed as described in Example 19 using the primers and probes provided in Table 4. Results for actin-packed proteins are F
ig9. Expression of the actin-packaging protein showed a modest increase at 8 hours after growth, with slightly higher expression under conditions that did not promote tube formation. This suggests that stimulation of actin-packaging protein expression tends to minimize angiogenesis, and that antagonist drugs promote angiogenesis.

The dynein light chain, acc: U32944 [PA9] Cytoplasmic dynein is a microtubule-based mechanochemical protein that plays an essential role in cell division, vesicle transport, and cytoplasmic membrane formation. As a molecular movement, dynein undergoes microtubule binding and release, and conformational changes
The TP hydrolysis mechanism is used to make a displacement toward the negative end of the microtubule as a whole (see Samso et al., J Mol Biol 276: 927-37, 1998).

C3VS homologue acc: Q2828 similar to C3VS from the genus Canine
2 [PA10] This gene encodes a novel human protein that is a homologue of C3VS from the genus Canine (Dog). A portion of this cloned sequence, referred to herein as ss_79, was previously identified and patented as acc: V33528. The patented sequence is partial (254 bp) and has only part of the reading frame, which is included in ss_79 disclosed herein, but not completely identical. Array ss_79
Is 1434 bp, encodes the 402aa reading frame and is homologous to the canine gene C3VS, and thus a novel human ortholog of the canine gene.
Is. Nucleotides in the sequences in bold and underlined are misread, resulting in a frameshift in the sequence leading to the premature stop codon. This determination was shown by comparison with the public sequence GenBankAcc: AF155135 published March 2000. In addition to the ankyrin domain, the protein contains a protein kinase phosphorylation site, and a Src-related SH3 domain. It is not clear that it is a secreted protein. The upregulation of C3VS in tube-forming endothelial cells described here suggests that it is directly involved in the process of endothelial differentiation and angiogenesis. The protein product is most likely involved in cytoskeletal interactions / recognition during the tube formation phase of angiogenesis. It contains an ankyrin repeat domain, a kinase phosphorylation site, and a Src-related SH3 domain. It is not clear that it is a secreted protein. Its upregulation in the tube-forming endothelial cells described here suggests that it is directly involved in the process of endothelial differentiation and angiogenesis. The presence of SH3 domain and ankyrin repeat sequences in this protein strongly suggests that it interacts with cytoskeletal components during tube formation and that up-regulation in tube-forming endothelial cells is essential for angiogenesis. There is.

The arrangement of ss_79 is shown below. GGCCGCGTTTTCCTGGGGAAGCGGCGGGCGGGGTGGAGCAGCCAGCTGGG TCCGGGGAGCGCCGCCGCCGC
CTCGATGGGGTGTTGAAAAGTCTCCTCTA GAGCTTTGGAAGGCTGAATGCACTAAACATGAAGAGCTTGAA
AGCGAAGT TCAGGAAGAGTGACACCAATGAGTGGAACAAGAATGATGACCGGCTACTG CAGGCCGTGGAG
AATGGAGATGCGGAGAAGGTGGCCTCACTGCTCGGCAA GAAGGGGACCAGTGCCACCAAACACGACAGTGA
GGGCAAGACCGCTTTCCATCTTGCTGCTGCAAAAGGACACGTGGAATGCCTCAGGGTCATGATTACACATGG
TGTGGATGTGACAGCCCAAGATACTACCGGACACAGCGCCTTACATCTCGCAGCCAAGAACAGCCACCATGA
ATGCATCAGGAAGCTGCTTCAGTCTAAATGCCCAGCCGAAAGTGTNGACAGCTCTGGGAAAACAGCTTTACA
TTATGCAGCGGCTCAGGGCTGCCTTCAAGCTGTGCAGATTCTCTGCGAACACAAGAGCCCCATAAACCTCAA
AGATTTGGATGGGAATATACCGCTGCTNCTTGCTGTACAAAATGGTCACAGTGAGATCTGTCACTTTCTCCT
GGATCATGGAGCAGATGTCAATTCCAGGAACAAAAGTGGAAGAACTGCTCTCATGCTGGCCTGTGAG ATTG
GCAGCTCTAACGCTGTGGAAGCCTTAATTAAAAAGGGTGCAGACCT AAACCTTGTAGATTCTCTTGGATAC
AATGCCTTACATTATTCCAAACTCT CAGAAAATGCAGGAATTCAAAGCCTTCTATTATCAAAAATCTCTCA
GGAT GCTGATTTAAAGACCCCAACAAAACCAAAGCAGCATGACCAAGTCTCTAA AATAAGCTCAGAAAGA
AGTGGAACTCCAAAAAAACGCAAAGCTCCACCACCTCCTATCAGTCCTACCCAGTTGAGTGATGTCTCTTCC
CCAAGATCAATAACTTCGACTCCACTATCGGGAAAGGAATCGGTATTTTTTGCTGAACCACCCTTCAAGGCT
GAGATCAGTTCTATACGAGAAAACAAAGACAGACTAAGTGACAGTACTACAGGTGCTGATAGCTTATTGGAT
ATAAGTTCTGAAGCTGACCAACAAGATCTTCTCTCTCTATTGCAAGCAAAAGTTGCTTCCCTTACCTTACAC
AATAAGGAGTTACAAGATAAATTACAGGCCAAATCACCCAAGGAGGCGGAAGCAGACCTAAGCTTTGACTCA
TACCATTCCACCCAAACTGACTTGGGCCCATCCCTGGGGAAAACCTGGTGAAACCTCTCCCCCAGACTCCAA
ATCATCTCCATCTGTCTTAATACATTCTTTAGGTAAATCCACTACTGGCAATGATGTCAGAATTCAGNCAAC
TGGC (SEQ ID NO: 1) TaqMan (trade name) analysis was performed as described in Example 19 using the primers and probes provided in Table 4. The result for brain ankyrin-2 is Fig1.
It shows in 0.

Genes Included in Proteolysis, Proteinases / Proteinase Inhibitors These genes are integrated into the biological pathway of matrix degradation during the first phase of angiogenesis. Cathepsin B, acc: L16510 [PA11] Cathepsin B is a lysosomal thiol endopeptidase involved in extracellular matrix degradation (see Keppler et al., Biochem Cell Biol 74: 799-810, 1996). It appears to be involved in the infiltration of endothelial cells into the peripheral matrix, which is involved in antigenic degradation and is overexpressed in lung, prostate, colon, breast and gastric tumors. Cathepsin B has been implicated in tumor progression through the observation that its activity, secretion or membrane association is increased. The most aggressive tumors, especially the cells at the infiltrating ends of these tumors, show the highest activity. Cathepsin B promotes tumor invasion directly by lysing an extracellular matrix barrier such as basement membrane or indirectly by activating other proteases that can digest the extracellular matrix (Be
rquin and Sloane Adv Exp Med Biol 389: 281-94, 1996). TaqMan ™ analysis was performed as described in Example 19 using the primers and probes provided in Table 4. Results for cathepsin B are shown in Figure 12. Expression was not significantly different in gel vs. membrane cells; expression levels showed a narrow peak at 8-24 hours.

ADAMTS-4 (aggrecanase), acc: NM_005099 [PA1
2] Aggrecanase is a proteolytic enzyme belonging to the disintegrin-type metalloprotease family. This enzyme is involved in extracellular matrix turnover in pathological conditions such as osteoarthritis,
Therefore, it decomposes aggrecan, which is a high-molecular-weight aggregate proteoglycan (Tortor
Ella et al., Science 284: 1664-6, 1999; Vasquez et al., J Biol Chem 274: 23349-57,
1999). TaqMan ™ analysis was performed as described in Example 19 using the primers and probes provided in Table 4. The result about ADAMTS-4 is Fig1.
4 shows. Expression of ADAMTS-4 was markedly promoted after 2 hours of growth. Three
Between 0 minutes and 8 hours, the gene was much more strongly expressed in non-tube forming conditions than in tube forming conditions. After 8 hours, expression under both conditions was comparable. These results indicate that endothelial cell growth requires early expression of this gene and, based on the early results, tube formation, a model of angiogenesis, is inhibited when its expression is promoted. Suggests.

Human BAC clone GS345D13 from 7q31-q32, complete sequence, a
cc: L27624 [PA13] It is also known as tissue factor pathway inhibitor 2, Kunitz-type serine protease inhibitor. Human BAC clone GS345D13 has 7q31-q
Obtained from 32. Its complete sequence is found under accession number AC002076.
PA13, a protease inhibitor also known as placental protein 5, is a serine protease inhibitor consisting of three tandemly arranged Kunitz-type protease inhibitor domains. TFPI-2 is a potential inhibitor of trypsin, plasmin, kallikrein, and factor Xia; thought to be involved in the regulation of extracellular matrix degradation during tube formation and adhesion of endothelial cells to the ECM ( Iino et al., Arteriosclerosis, Thrombosis, and Vascular Biology
, 18: 40-6, Rao et al., Biochem Biophys Res Comm 255: 94-8, 1999). Tissue factor pathway inhibitors are key regulators of the extrinsic pathway of blood coagulation through its ability to inhibit factor Xa and factor VIIa-tissue factor activity. Initially,
It was identified as a placental glycoprotein that inhibits plasmin, trypsin, and thrombin and was called placental protein-5. PA13 has been reported to exert mitogenic activity in smooth muscle cells (Shinoda et al., J Biol Chem 274:
5379-84, 1999). TaqMan ™ analysis was performed as described in Example 19 using the primers and probes provided in Table 4. Results for tissue factor pathway inhibitors are shown in Figure 11. Expression of this gene was significantly enhanced at 16-24 hours with slightly higher expression under tube-forming conditions than on the membrane. This suggests that stimulation of tissue factor pathway inhibitors promotes angiogenesis, and that antagonists of this gene or protein promote angiogenesis.

Urokinase Inhibitor (PAI-2) acc: M31551 [PA14] PA14 is a serpin family protein. It inhibits both tissue-type and urokinase-type plasminogen activators. Previous studies have shown expression of this gene by various cell types, including endothelial cells (Amma
n et al., Thrombosis Res 77: 431-40, 1995; Zoellner et al., Thrombosis and Haemost.
asis 69: 135-40, 1993). However, the modulation of this gene during endothelial tube formation has not yet been described. Down-regulation of PAI-2 in endothelial cells is believed to increase extracellular matrix degradation and promote endothelial cell infiltration into the surrounding matrix. PAI-2 has been suggested to play a role in TNF-α-induced apoptosis (Dickinson et al., Cel
l Death Differ 5: 163-71, 1998). TaqMan ™ analysis was performed as described in Example 19 using the primers and probes provided in Table 4. Results for plasminogen activator inhibitor-2 are shown in Figure 13. Expression of tissue plasminogen activator-2 mRNA peaks dramatically at 4 hours of growth and is significantly stronger in the membrane (no tube formation) than in cells grown in gel (promoting tube formation). These results suggest that endothelial cell growth requires early expression of this gene, and that enhanced expression inhibits tube formation, a model of angiogenesis.

Tyrosine Kinase Receptors In endothelial cells, they participate in signal transduction pathways that induce tube formation. Axl, acc: X57019 [PA15] The axl receptor has a unique structure among tyrosine kinases. It is initially overexpressed during the progression of chronic myelogenous leukemia (CML) to acute leukemia.
It has been identified as RNA; it drives cell proliferation when the receptor is stimulated. Axl is a receptor tyrosine kinase that contains both immunoglobulin and fibronectin III repeats in its extracellular domain, implying a cell adhesion molecule (see McCloskey et al., J. Biol Chem 272: 23285-91, 1997), (Avanzi et al., Blood 91: 2334-40, 1998). Growth arrest-specific gene-6 (GAS-6) was identified as an axl stimulator. Extrinsic Gas
6 protected HUVECs from apoptosis upon growth factor withdrawal and from TNFalpha-mediated cytotoxicity (see O'Donnell et al., Am J Pathol 154: 1171-80, 1999). Therefore, axl is considered to be involved in the survival mechanism of endothelial cells.
See also US Pat. No. 5,468,634. TaqMan ™ analysis was performed as described in Example 19 using the primers and probes provided in Table 4. Results for axl are shown in Figure 15.
The expression of axl was strongly suppressed after 8 hours of growth, with the degree of suppression being similar in tube-forming and non-tube forming. Since the gene was repressed under the condition of endothelial cell growth, axl
Expression of the gene can promote angiogenesis.

ECK-1 acc: M59371, NM_004431.1 [PA16] epithelial cell receptor, tyrosine kinase (EPH and EPH-related proteins)
Contains the largest subfamily of receptor protein tyrosine kinases. They are involved in developmental events, especially in the nervous system (Zhou, Pharmacol Th
er 77: 151-81, 1998). Receptors in the Eph subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and two fibronectin type III repeats. The ligand for the Eph receptor is named ephrin. Mice lacking the double mutation depletion balance in EphrinB2 and EphB2 and EphB3 receptor signaling die in utero before embryonic day 11.5 due to defects in remodeling of the embryonic vasculature ( See Adams et al., Genes Dev 13: 295-306, 1999). The modulation of this gene in the endothelial tube formation process has not yet been described, so the precise role of Eck-1 in angiogenesis is here determined to be associated with tube formation. TaqMan ™ analysis was performed as described in Example 19 using the primers and probes provided in Table 4. Results for ECK are shown in FIG.
Gene expression shows a narrow peak at 8-24 hours with little significant difference between gel-grown cells and membrane-grown cells.

The transmembrane receptor OX-40acc: S76792 [PA17] OX-40 has already been found to be expressed in activated T cells 1.
It is a type of transmembrane glycoprotein and is believed to play a role in the adhesion of T cells to HUVEC (see Imura et al., J Exp Med 183: 185-95, 1996). That is T
A member of the NF-alpha receptor family (Arch and Thompson Mol
Cell Bio 18: 558-65, 1998). The OX40 ligand is a type II membrane-bound cytokine identified as glycoprotein 34 (gp34), a member of the TNF family (see Godfrey et al., J Exp Med 180: 757-62, 1994). TaqMan ™ analysis was performed as described in Example 19 using the primers and probes provided in Table 4. Results for OX-40 are shown in Figure 17. Expression of this gene under tube-forming conditions was dramatically enhanced after 8 hours of growth, but under conditions that did not promote tube formation, its expression was minimally affected. These results strongly suggest, for example, that treatment with an agonist of OX-40 is beneficial under clinical conditions where angiogenesis is desired.

Interleukin 6 signal transducer, gp130acc: M572
30 [PA18] gp originally described as an interleukin-6 signal transducer
130 is a number of cytokines such as IL-6, IL-11, leukemia inhibitory factor,
It is a transducer chain shared by oncostatin M and ciliary neurotrophic factor. All of these cytokines act through a receptor complex that is divided into two or three parts, where signaling is homodimerization of gp130 (
Heterodimerization with IL-6) or LIF-Rb / gp190 protein (IL-1
1, LIF, OSM, and CNTF) (Taga and Kishim
oto Annual Rev Immunology 15: 797-819, 1997). The extracellular domain part of the signal transducer gp130 is composed of six fibronectin type III.
Like domain. It has recently been shown that three membrane-terminal domains bind the IL-6-IL-6R complex. The structural model of the IL-6-IL-6R-gp130 complex allowed us to abandon the amino acid residues in these domains of gp130 that interact with IL-6 bound to its receptor. TaqMan ™ analysis was performed as described in Example 19 using the primers and probes provided in Table 4. The results for gp130 are shown in Figure 18. Expression of gp130 under non-tube forming conditions was significantly enhanced after 4 hours of growth. It is no stronger than its expression in cells grown in gel. These results are
It is suggested that endothelial cell growth requires the expression of this gene, and that its enhanced expression inhibits tube formation, a model of angiogenesis.

Cd82 / BST-2acc: D28137 [PA19] CD82 (BST-2, C33) is a member of the transmembrane 4 superfamily and binds to MHC class II components (Hammond et al., J Immunology 161: 328).
2-91, 1998). It is the activated Ag of T cells. Recent research is CD82
Have been shown to bind CD4 or CD8 and deliver costimulatory signals for the TCR / CD3 pathway (see Nagira et al., Cell Immoral 157: 144-57, 1994). c
Expression of d82 is inversely associated with tumor progression and is a preferred prognostic factor in some tumors, the activation antigen of T cells. TaqMan ™ analysis was performed as described in Example 19 using the primers and probes provided in Table 4. Results for CD82 are shown in Figure 19.
Expression of this gene under tube-forming conditions was strongly enhanced during 8-24 hours of growth, but under conditions that did not promote tube formation, its expression was very low at these times. These results show that, for example, CD in clinical conditions where angiogenesis is desired.
Suggesting that the treatment at 82 is beneficial.

Zero-related protein acc: AF087020 [PA20] PA20 is a protein having a single transmembrane segment and a signal sequence. The extracellular portion of this protein contains a single immunoglobulin-like domain that exhibits 46% sequence identity to that of myelin P0, the major structural protein of peripheral myelin. The intracellular segment of this protein shows no significant sequence identity to any known protein except for two immunoreceptor tyrosine-based inhibitory motifs, and is designated PZR for protein zero association. , Has been suggested to be a putative substrate for the tyrosine phosphatase SHP2 and may have importance in cell signaling (Seue Zhao and Zhao, J. Biol. Chem.
273: 29367 (1998)). TaqMan ™ analysis was performed as described in Example 19 using the primers and probes provided in Table 4. Results for protein zero related proteins are shown in Figure 20. The expression of this gene is 16-
It was large during 24 hours, but was stronger on the membrane before 8 hours and after 16 hours than in the gel.

Integrin alpha-2 subunit, acc: X17033 [PA21] The integrin family includes cell surface receptors for extracellular matrix components as well as receptors involved in various aspects of leukocyte adhesion. Integrins generally consist of an alpha-beta heterodimeric transmembrane glycoprotein in which the alpha subunit is non-covalently linked to the beta subunit. First identified in T cell lymphocytes, they were subsequently shown to be present in a wide range of cell types including fibroblasts and platelets. Six forms VLA-1 to VLA-6 have been identified, each consisting of different alpha chains (numbered alpha-1 to alpha-6) linked to a common beta chain. The alpha-2 heterodimer functions as a cell surface receptor for collagen. TaqMan ™ analysis was performed as described in Example 19 using the primers and probes provided in Table 4. The result for alpha 2 integrin is F
ig21. Expression of the alpha2 integrin gene peaked at about 16 hours and was stronger in the gel than on the membrane at 16-38 hours. These results suggest that promoting alpha2 integrin expression is beneficial in situations where angiogenesis is desired.

Secreted proteins, such as growth factors, cytokines, peptide hormones PIGF, acc: X54936 [PA22] PIGF placental growth factor are related to VEGF and VPF, secretory growth factors with angiogenic regulatory properties. It has already been found to be associated with angiogenesis, which was repeated in this study. It supports in vivo tube formation as a model system for angiogenesis. PA22 also supports the statement that these DNA and related protein sequences are, in fact, expressed during angiogenesis, which states that this molecule is expressed during in vitro and in vivo angiogenesis. Because it is known. PIGF is a member of the vascular endothelial growth factor (VEGF) family of growth factors. PIGF shows 53% identity with the platelet-derived growth factor-like region of VEGF. Alternative splicing of RNA produced two PIGF isomers, PIGF131 (PIGF-1) and PIGF152 (PIGF-2). In contrast to PIGF131, PIGF152 is rich in basic amino acids21
Has an amino acid insertion. Like VEGF, the PIGF isomer is a homodimeric glycoprotein. PIGF131 is a non-heparin-binding protein, but PIG131
F152 binds strongly to heparin. The PIGF protein binds Flt-1 with high affinity, but not Flk-1 / KDR. Purified PIGF isomers have little or no mitogenic or permeability enhancing activity. However, they can significantly potentiate the effects of low concentrations of VEGF in vitro and in vivo (Khaliq et al., Lab Invest 78: 109-116, 1998; Kaliq et al., Growth Factors 13:
243-250, 1996; Park et al., J Biol Chem 269: 25646-25654, 1994; Sawano et al., Cel.
l Growth Differ 7: 213-221, 1996; Ziche et al., Lab Invest 76: 517-531, 1997.
reference). TaqMan ™ analysis was performed as described in Example 19 using the primers and probes provided in Table 4. Results for placental growth factor are shown in Figure 22. Expression of this gene under tube-forming conditions was dramatically enhanced after 4 hours of growth, whereas under conditions that did not promote tube formation, its increase was modest and slower. These results suggest that treatment with placental growth factor agonists or agents that promote increased expression in clinical situations where angiogenesis is desired is beneficial.

Stanniocalcin precursor, acc: U25997 [PA23] This is a secreted glycoprotein that has been suggested to be involved in calcium and phosphate regulation (Olsen et al., Proc Natl Acad Sci 93: 1792-1796, 1996). reference).
Previous studies have shown that it is expressed in kidney and thymic stromal cells (Wagner
Et al., Proc Natl Acad Sci 92: 1871-1875, 1995). It is upregulated in the differentiation of endothelial cells into tube-like structures. This suggests that stanniocalcin is involved in endothelial tube formation. Because it is a secretory hormone,
This suggests the presence of a receptor for stanniocalcin that can be used as a target to block tube formation. Neutralizing antibodies against stanniocalcin are useful as therapeutic molecules because they bind to stanniocalcin and remove it from the immediate cellular environment. TaqMan ™ analysis was performed as described in Example 19 using the primers and probes provided in Table 4. The results for the stanniocalcin precursor are F
ig23. Expression of this gene under tube-forming conditions was dramatically enhanced after 8 hours of growth, but under conditions that did not promote tube formation, its expression remained modest.
These results suggest that in clinical situations where angiogenesis is desired, treatment with an agonist or an agent that promotes increased expression of stanniocalcin precursors would be beneficial.

Fibroblast Growth Factor-16, acc: AB009391 [PA24] Fibroblast growth factor is a peptide regulator that acts through four different tyrosine kinase receptors, including implantation, morphogenesis and angiogenesis. , And possibly involved in various biological processes during embryonic development and adult survival, including tumorigenesis.
FGF-16 in the embryo seems to play a role in the development of brown adipose tissue. Of the FGF family members, FGF-16 is most similar to FGF-9 (73% amino acid identity). Human FGF-16 has a high degree of amino acid sequence identity (98.6%) with rat FGF16. Upregulation of FGF-16 is in endothelial cells in a tube forming environment, indicating that it is involved in the process of angiogenesis (Miyake et al., Biochem Biophys Res Comm 243:
148-152, 1998; Danilenko et al., Arch Biochem Biophys 361: 34-46, 1999).
. FGF-16 is the newest member of the FGF family to be cloned (Miyake, 1998). In the rat, FGF-16 is most highly expressed in the heart. The human homologue of FGF-16 has also recently been cloned from human cDNA (Miyake, 1998). The only known activity of FGF-16 is a relatively weak stimulation of NIH3T3 fibroblast proliferation and a reasonably strong stimulation of early rat oligodendrocyte proliferation (Danilenko, 1999).

TaqMan ™ analysis was performed as described in Example 19 using the primers and probes provided in Table 4. Results for FGF-16 are shown in Figure 24. Expression of this gene under tube-forming conditions showed a sharp peak at 8 hours of growth, but under conditions that did not promote tube formation, its expression remained modest. Expression levels then regressed to very low levels by 2 days. To date, there is no literature on the possible role of FGF-16 in angiogenesis or the expression of this growth factor at the site of neovascularization. Since no proliferation was observed in the HUVEC model system used here for expression analysis, the late down-regulation observed for FGF-16 is consistent with published reports. However, the transient and significant promotion of growth-free expression is substantially exclusively associated with, for example, tube morphogenesis, as shown in Figure 24. These results strongly suggest that treatment with an agonist of FGF-16 or an agent that promotes an increase in FGF-16 expression is beneficial, for example, in clinical situations where angiogenesis is desired.

The channel / transporter white protein homolog, acc: X91249 [PA25] A ~ 2200 bp contig containing the 25 component EST was produced. By BLAST-X it had 99% amino acid sequence homology with the human G02068 White homolog. The genomic clone is similar to the white protein homolog. It is associated with metabolism, metabolite storage / transport proteins, plasma membrane shuttling. Human white gene protein (HS WHITE) metabolism, metabolite accumulation /
Transport proteins, related to plasma membrane shuttling. It is a homolog of the Drosophila White gene. In Drosophila, "white" (W),
"Scarlet" (St), and "Brown" (Bw) proteins are members of the ATP-binding cassette (ABC) transporter superfamily of transmembrane permease and are involved in the transport of eye pigment precursors. Human white protein homologues are also known as ATP binding cassettes (ABC). Many members of the ABC family of proteins function as transporters or channels (see Dreesen et al., Mol Cell Biol. 8: 5206-15 (1988)). The human homolog gene (hW) has been mapped to chromosome 21q22.3. TaqMan ™ analysis was performed as described in Example 19 using the primers and probes provided in Table 4. Results for the white protein homolog are shown in Figure 25. Expression of this gene under tube-forming conditions was strongly promoted during growth 4-16 hours, but under conditions that did not promote tube formation, its expression had minimal effect at that time. These results suggest that treatment with an agonist of, for example, a white protein homologue may be beneficial in clinical situations where angiogenesis is desired.

Apoptosis-related mouse Alix (AJ005073) -like (sim) gene or ALG-2 interacting protein-1 (AF151793) [PA26] Gene Calling identified a cDNA, whose EST sequence is a BLASTN against the GenBank combined database. All DNA sequences that were used for the above and matched at least 95% to the input DNA over a stretch of 50 bases were used to assemble a 1458 bp contig consisting of 15 sequences. These are: est: gb_AA088472 +,
est: gb_AA196914 +, est: gb_AA301555 +, est: gb_AA332019 +, est: gb_AA337670 +,
est: gb_AA363712 +, est: gb_AA370299 +, est: gb_AA984515-, est: gb_AW076072-,
est: gb_N56435 +, est: gb_N73108 +, est: bg_T53906 +, est: gb_W38656 +, est: gb_W
It is 77963+, pg_hs_aj005073_gli0286.3. BLASTN hit the human ALG-2 interacting protein with exact matches over the entire 1458 bp sequence. BLAST-X hit the mouse protein Alix (AJ005073) or ALG-2 interacting protein-1 (AF151793) (p = 1.
8e- ⁹⁴ , matching frame-2, aa329-533, 91% identity, 9
5% positive, including conservative substitutions). ALG-2 is a T cell receptor-, Fa
Encodes Ca (2 +)-binding proteins required for s- and glucocorticoid-induced cell death. It interacts with the apoptosis-related gene ALG-2.
ALG-2 is a newly discovered Ca2 + binding protein that has been shown to be directly associated with apoptosis (Missotten et al., Cell Death Differ. 6: 1
24-29 (1999)). Sequence of 15: est: gb_AA088472 +, est: gb_AA196914 +, est: gb_AA301555 +, est:
gb_AA332019 +, est: gb_AA337670 +, est: gb_AA363712 +, est: gb_AA370299 +, est:
gb_AA984515-, est: gb_AW076072-, est: gb_N56435 +, est: gb_N73108 +, est: gb_T
The nucleic acid sequence of the consensus extension of aj005073_gli0286.3 using 53906+, est: gb_W38656 +, est: gb_W77963 +, pg_hs_aj005073_gli0286.3 is shown below.

Human gene similar to mouse Alix (ALG-2 interacting protein): TCTAGATCCTATTGGCAAAGCCACACTTGTGAAATCTACCCCGGTCAATG TACCCATCAGTCAGAAATTTA
NTGATCTGTTTGAGAAGATGGTTCCCGTG TCAGTACAGCAGTCTTTGGCTGCCTATAATCAGAGGAAAGCC
GATTTGGT TAACAGATCAATTGCTCAGATGAGAGAAGCCACCACTTTGGCAAATGGGG TGCTAGCTTCCC
TTAATCTTCCAGCAGCAATTGAAGATGTGTCTGGAGAC ACTGTACCTCAGTCTATATTGACTAAATCCAGA
TCTGTGATTGAACAGGGAGGCATCCAGACTGTTGATCAGTTGATTAAAGAACTGCCTGAATTACTGCAACGA
AATAGAGAAATCCTAGATGAGTCATTAAGGTTGTTGGATGAAGAAGAAGCAACCGATAATGATTTAAGAGCA
AAATTTAAGGAACGTTGGCAAAGGACACCATCCAATGAACTGTATAAGCCTTTAAGAGCAGAGGGAACCAAC
TTCAGAACAGTTTTAGATAAAGCTGTGCAGGCAGATGGACAAGTGAAAGAATGTTACCAGTCTCATCGTGAC
ACCATCGTGCTTTTGTGTAAGCCAGAGCCTGAGCTGAATGCTGCCATCCCTTCTGCTAATCCAGCAAAGACC
ATGCAGG GCAGTGAGGTTGTAAATGTCTTAAAATCCTTATTGTCAAATCTTGATGAA GTAAAGAAGGAAA
GAGAGGGTCTGGAGAATGACTTGAAATCTGTGAATTT TGACATGACAAGCAAGTTTTTGACAGCCCTGGCT
CAAGATGGTGTGATAA ATGAAGAAGCTCTTTCTGTTACTGAACTAGATCGAGTCTATGGAGGTCTT ACAA
CTAAAGTCCAAGAATCTCTAAAGAAACAGGAGGGACTTCTTAAAAATATTCAGGTCTCACATCAGGAATTTT
CGAAAATGAAACAATCTAATAATGAAGCTAACTTAAGAGAAGAAGTTTTGAAGAATTTAGCTACTGCATATG
ACAACTTTGTTGAACTTGTAGCTAATTTGAAGGAAGGCACAAAGTTTTACAATGAGTTGACTGAAATCCTGG
TCAGGTTCCAGAACAAATGCAGTGATATAGTTTTTGCACGGAAGACAGAAAGAGATGAACTCTTAAAGGACT
TGCAACAAAGCATTGCCAGAGAACCTAGTGCTCCTTCAATTCCTACACCTGCGTATCAGTCCTCACCAGCAG
GAGGACATGCACCAACTCCTCCAACTCCAGCGCCAAGAACCATGCCGCCTACTAAGCCCCAGCCCCCAGCCA
GGCCTCCACCACCTGTGCTTCCAGCAAATCGAGCTCCTTCTGCTACTGCTCCATCTCCAGTGGGGGCTGGGA
CTGCTGCGCCAGTTCCATCAAC AAACGCCTGGCTCAGCTCCTCCTCCACAGGCGCAGGGACCACCCTATCC
C ACCTATCCAGGATATCCTGGGTATTGCC (SEQ ID NO: 2)

Table 2 contains categories of PA genes and their major emerging uses. * The extracellular domains of these receptors can be used as soluble protein therapeutics as antagonists of angiogenesis.

I. Definitions The term "PA" as used herein refers to the pro-angiogenic sequences of the invention. The terms "PA polypeptide", "PA protein" and "PA" include native sequence polypeptides and polypeptide variants (as further defined herein). PA polypeptides can be isolated from a variety of sources such as human tissue types or other sources. Furthermore, they may be prepared by recombinant or synthetic methods. As used herein, "pro-angiogenesis (PA)" means angiogenesis and / or
Or, it relates to the genes and gene products of the invention in which differential expression is promoted compared to a reference state that does not promote angiogenesis. Thus, "pro-angiogenesis" as used herein refers to genes and gene products whose expression is promoted in an angiogenic environment and genes whose expression is suppressed in such an environment. And gene products. Among the genes and gene products that are promoted are tissue factor pathway inhibitor-2, aggrecanase (ADAMTS-4), protein KIAA0188,
Placenta growth factor (PIGF), fibroblast growth factor 16 (FGF-16), stanniocalcin precursor, tyrosine kinase receptor (epithelial cell ECK), interleukin 6 signal transducer (gp130), CD82, podocalyxin-like protein, OX40 cell surface antigen , Alpha-2 integrin, protein zero related protein, T-plastin, moesin, dynein light chain, myosin-IC,
Includes ankyrin-2, actin packaging protein, osteonidogen, white protein homologue, cathepsin B, and laminin gamma-2 chain. Among the genes and gene products that are suppressed in the angiogenic environment are tyrosine kinase receptors a.
xl, urokinase inhibitor (PAI-2), and mesothelial keratin K7 (type II). In addition, additional genes or gene products differentially expressed in angiogenesis that are considered pro-angiogenic for purposes of the present invention include ALG-2 interacting proteins and collagenases.

A “native sequence PA polypeptide” comprises a polypeptide having the same amino acid sequence as the corresponding PA from nature. Such native sequence PA can be isolated from nature or can be produced by recombinant and / or synthetic means. "
The term “native sequence PA” specifically refers to naturally occurring truncated or secreted forms of PA proteins (eg, extracellular domain sequences), naturally occurring mutant forms (eg, alternatively spliced forms), and naturally occurring The resulting allelic variants are included. In one embodiment of the invention, the native sequence PA is a mature or full length native sequence PA comprising an amino acid sequence having the N-terminus to the C-terminus of the known sequence. "Pro-angiogenesis" as used herein refers to the genes and gene products of the invention. Differential expression of these genes can be observed in comparison to a reference state that does not promote angiogenesis and / or angiogenesis. Thus, "pro-angiogenesis" as used herein refers to genes and gene products whose expression is promoted in an environment favorable for angiogenesis (ie, an environment that promotes angiogenesis), and It includes genes and gene products whose expression is suppressed in such an environment.

A “PA polypeptide variant” refers to an active P that has at least about 80% amino acid sequence identity with the amino acid sequence of the PA protein of Table 1 as defined herein.
A polypeptide. Such identity may be to a residue of the full-length polypeptide or to a specifically derived fragment of the amino acid sequence of the protein. Such PA variant polypeptides include, for example, N- of each amino acid sequence.
And / or C-terminal, as well as within one or more internal domains, PA polypeptides with one or more amino acid residues added or deleted. Generally, a PA variant polypeptide is present in at least about 80 amino acids with either the full-length polypeptide or a specifically derived fragment of the amino acid sequence of the PA protein shown in Table 1.
% Amino acid sequence identity, or at least about 81% amino acid sequence identity, or at least about 82% amino acid sequence identity, or at least about 83% amino acid sequence identity, or at least about 84% amino acid sequence identity. , Or at least about 85% amino acid sequence identity, or at least about 86% amino acid sequence identity,
Or at least about 87% amino acid sequence identity, or at least about 88% amino acid sequence identity, or at least about 89% amino acid sequence identity, or at least about 90% amino acid sequence identity, or at least about 91%. Amino acid sequence identity, or at least about 92% amino acid sequence identity, or at least about 93% amino acid sequence identity, or at least about 94% amino acid sequence identity, or at least about 95% amino acid sequence identity, or At least about 96% amino acid sequence identity, or at least about 97% amino acid sequence identity, or at least about 98
% Amino acid sequence identity, and / or at least about 99% amino acid sequence identity. PA variant polypeptides do not include native PA polypeptide sequences. Generally, a PA variant polypeptide is at least about 10 amino acids long, or at least about 20 amino acids long, or at least about 30 amino acids long, or at least about 40 amino acids long, or at least about 50 amino acids long, or at least about 60 amino acids long.
Amino acids long, or at least about 70 amino acids long, or at least about 80 amino acids long, or at least about 90 amino acids long, or at least about 100 amino acids long, or at least about 150 amino acids long, or at least about 200 amino acids long, or at least about 250 amino acids long. Long, or at least about 300 amino acids long, or longer.

“Percentage” when used on the PA polypeptide sequences described herein
"(%) Amino acid sequence identity" aligns the sequences, introduces cavities if necessary to obtain maximal percent sequence identity, and does not consider any conservative substitutions to be part of the sequence identity, It is defined as the percentage of amino acid residues in the candidate sequence that are identical to amino acid residues in a particular PA polypeptide sequence. Alignment for the purpose of determining percent amino acid sequence identity can be performed by a variety of methods within the skill of the art, including BLAST, BLAST-2, ALIGN, ALIGN-2 or Megalign (DNASTAR
) Can be achieved by using publicly available computer software such as software. One of ordinary skill in the art can determine the appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared. However, for the purposes herein,% amino acid sequence identity values are obtained as described below using the sequence comparison computer program ALIGN-2. The ALIGN-2 sequence comparison computer program was written by Genentech, Inc. and the source code is submitted to the US Copyright Office, Washington DC, 20559, which is a US copyright registration number TXU51008.
Registered under 7. The ALIGN-2 program is from Genentech, South San Fran
Publicly available from cisco, California. The ALIGN-2 program is compiled for use with a UNIX operating system, preferably Digital UNIX V4.0D. All sequence comparison parameters are set by the ALIGN-2 program and do not change.

For the purposes herein, the% amino acid sequence identity of a given amino acid sequence B to, or to, a given amino acid sequence B (or to a given amino acid sequence B, or to it). Can also be referred to as a given amino acid sequence A which has or contains some% amino acid sequence identity) is calculated as follows:
Fraction X / Y 100 times, where X is the number of amino acid residues with a score that was matched by the alignment of A and B of the sequence alignment program ALIGN-2, and Y is the total amino acid residue of B. It is a radix. When the length of amino acid sequence A differs from the length of amino acid sequence B, the% amino acid sequence identity of A to B is
It will be appreciated that it differs from the% amino acid sequence identity to. Unless otherwise noted, all% amino acid sequence identity values herein are as above.
Obtained using the ALIGN-2 sequence comparison computer program. However,%
Amino acid sequence identity is determined by the sequence comparison program NCBI-BLAST2 (Altschul et al., Nucleic
Acids Res. 25: 3389-3402 (1997)). The NCBI-BLAST2 sequence comparison program can be downloaded from http://www.ncbi.nlm.nih.gov.
NCBI-BLAST2 uses several search parameters, all of which are set to initial values, eg unmask = ok, chains = all, expected occurrences = 10,
Minimum low composite length = 15/5, multipath e-value = 0.01, multipath constant = 2
5, including final gap alignment drop-off = 25, and scoring matrix = BLOSUM62.

In the situation where NCBI-BLAST2 is used for amino acid sequence comparisons, the% amino acid sequence identity of a given amino acid sequence A with or to a given amino acid sequence B (or with a given amino acid sequence B , Or a given amino acid sequence A with or containing some% amino acid sequence identity thereto) is calculated as follows: 100 times the fraction X / Y, where , X is the number of amino acid residues in the score that were matched by the alignment of A and B in the sequence alignment program NCBI-BLAST2, and Y is the total number of amino acid residues in B. It will be appreciated that when the length of amino acid sequence A differs from the length of amino acid sequence B, the% amino acid sequence identity of A to B is different from the% amino acid sequence identity of B to A.

A “PA variant polynucleotide” or “PA variant nucleic acid sequence” is a nucleic acid molecule that encodes an active PA polypeptide, as defined herein, (a) a PA polynucleotide shown in Table 2. At least 80% of a nucleic acid sequence encoding a residue containing a chitin reading frame of a PA nucleic acid encoding a peptide, or (b) a nucleic acid sequence encoding a specifically derived fragment of the amino acid sequence shown in Table 1. A nucleic acid having nucleic acid sequence identity is meant. Usually, the PA variant polypeptide nucleotide is
(A) a nucleic acid sequence encoding all the residues of the PA polypeptide shown in Table 1, or (b) a nucleic acid sequence encoding another specifically derived fragment of the amino acid sequence shown in Table 1, and at least about 80% nucleic acid sequence identity, preferably at least about 81%
Nucleic acid sequence identity, more preferably at least about 82% nucleic acid sequence identity, more preferably at least about 83% nucleic acid sequence identity, more preferably at least about 84% nucleic acid sequence identity, more preferably at least about 85% nucleic acid sequence identity, more preferably at least about 86% nucleic acid sequence identity, more preferably at least about 87% nucleic acid sequence identity, more preferably at least about 88% nucleic acid sequence identity, more preferably At least about 89% nucleic acid sequence identity, more preferably at least about 90% nucleic acid sequence identity, more preferably at least about 91% nucleic acid sequence identity, more preferably at least about 92% nucleic acid sequence identity, Preferably at least about 93% nucleic acid sequence identity, more preferably at least about 94.
% Nucleic acid sequence identity, more preferably at least about 95% nucleic acid sequence identity, more preferably at least about 96% nucleic acid sequence identity, more preferably at least about 97% nucleic acid sequence identity, more preferably at least It has about 98% nucleic acid sequence identity, and more preferably at least about 99% nucleic acid sequence identity.

Generally, a PA variant polynucleotide is at least about 30 nucleotides in length,
More at least about 60 nucleotides, more at least about 90 nucleotides, more at least about 120 nucleotides, more at least about 150 nucleotides, more at least about 180 nucleotides,
More than at least about 210 nucleotides in length, more than at least about 240
Nucleotides, more at least about 270 nucleotides, more at least about 300 nucleotides, more at least about 450 nucleotides, more at least about 600 nucleotides, more at least about 9
00 nucleotides or more.

“Percent (%) nucleic acid sequence identity” to a PA-encoding nucleic acid sequence identified herein refers to aligning sequences and introducing gaps, if necessary, to obtain maximum percent sequence identity. Is defined as the percentage of nucleotides in the candidate sequence that are identical to the nucleotides of the invention polypeptide-encoding sequence of. Alignment for the purpose of determining percent nucleic acid sequence identity can be accomplished by a variety of methods within the purview of those of skill in the art, such as BLAST, BLAST-2, ALIGN, ALIGN-2 or Megalign (DNASTAR) software. This can be accomplished using available computer software. One of ordinary skill in the art can determine the appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared. However, for purposes herein,% nucleic acid sequence identity values are obtained as described below by using the sequence comparison program ALIGN-2. The ALIGN-2 sequence comparison computer program was written by Genentech, Inc. and the source code is submitted to the US Copyright Office, Washington DC, 20559 and registered under US Copyright Registration No. TXU510087. ALIGN-2 is suitably available from Genentech, Inc., South San Francisco, CA. The ALIGN-2 program is compiled for use on a UNIX® operating system, preferably Digital UNIX® V4.0D. All sequence comparison parameters are set by the ALIGN-2 program and do not change.

For the purposes herein, the% nucleic acid sequence identity of a given nucleic acid sequence D, or to it, of a given nucleic acid sequence C (or to a given nucleic acid sequence D, or to it). A given nucleic acid sequence C with or containing some degree of nucleic acid sequence identity
Is calculated as follows: 100 times the fraction W / Z, where W is the score that is consistent with the C and D alignments of the sequence alignment program ALIGN-2. Is the number of nucleotides and Z is the total number of nucleotides in D. It will be appreciated that when the length of nucleic acid sequence C differs from the length of nucleic acid sequence D, the% nucleic acid sequence identity of C to D is different from the% nucleic acid sequence identity of D to C. Unless otherwise noted, all% nucleic acid sequence identity values used herein are ALIGN-2.
Obtained as described above using a computer program. However,% nucleic acid sequence identity is also determined by the sequence comparison program NCBI-BLAST2 (Altschul et al., N.
Nucleic Acids Res. 25: 3389-3402 (1997)). This NCBI
-The BLAST2 sequence comparison program can be obtained by downloading from http://www.ncbi.nlm.nih.gov, or from the National Institutes of Health, Bethesta, MD. NCBI-BLAST2 uses several search parameters, all of which are set to initial values, eg unmask = ok, chains = all, expected occurrences = 10, minimum low compound length = 15/5 , Multipath e-value = 0.01, multipath constant = 25, final gap alignment dropoff = 25, and scoring matrix = BLOSUM62.

In the situation where NCBI-BLAST2 is used for nucleic acid sequence comparisons, the% nucleic acid sequence identity of a given nucleic acid sequence C to a given nucleic acid sequence D or to a given nucleic acid sequence C (or , A given nucleic acid sequence D, or a given nucleic acid sequence C having or having some degree of% nucleic acid sequence identity thereto) is calculated as follows: fraction W / 100 times Z, where W is the number of nucleic acid residues with a score consistent with the C and D alignments of the sequence alignment program NCBI-BLAST2, and Z is the total number of nucleic acid residues in D. is there. Nucleic acid sequence C
% Of nucleic acid sequence identity to D, the% nucleic acid sequence identity of C to D is
It will be appreciated that D differs from the% nucleic acid sequence identity to C.

In another embodiment, the PA variant polypeptide nucleotide encodes an active PA polypeptide, preferably under stringent hybridization and wash conditions, the nucleotide sequence encoding the full-length PA polypeptide shown in Table 1. A nucleic acid molecule capable of hybridizing to. The PA variant polypeptide can be one encoded by the PA variant polynucleotide.

The term “positive” refers to amino acid sequence identity comparisons carried out as described above, in which not only are the identical amino acid residues in the compared sequences, but those with similar properties. Included amino acid residues. An amino acid residue that scores a positive value for an amino acid residue of interest is the same as the amino acid residue of interest, or a preferred substitution of the amino acid residue of interest. Preferred substitutions are shown in Table 3.

For this purpose, the positive% value of the given amino acid sequence B with or against B given amino acid sequence B (separately given amino acid sequence A It can also be referred to as having or including a certain% positive for, with, or against B.
) Is calculated by the following formula: 100 times the fraction X / Y, where X is A and B
Is the number of amino acid residues scored positive by the sequence alignment program ALIGN-2 and Y is the total number of B amino acid residues in the program alignment of. The length of amino acid sequence A is not equal to the length of amino acid sequence B, and% of A to B is
It will be understood that positive is not equal to the% positive of B for A.

The term “isolated”, when used to describe the various polypeptides disclosed herein, has been identified, separated and / or recovered from components of its natural environment. Means Preferably, the isolated polypeptide is
Not combined with all ingredients that naturally combine. Contaminant components of its natural environment are materials that typically interfere with diagnostic or therapeutic uses for the polypeptide, and include enzymes, hormones, and other proteinaceous or nonproteinaceous solutes. In a preferred embodiment, the polypeptide is (1) sufficient to obtain an N-terminal or internal amino acid sequence of at least 15 residues by using a spinning cup sequenator, or (2) Coomassie blue or It is preferably purified to homogeneity by SDS-PAGE under non-reducing or reducing conditions using silver staining. Isolated polypeptide includes polypeptide in situ within recombinant cells, since at least one component of the PA polypeptide natural environment will not be present. Ordinarily, however, isolated polypeptide will be prepared by at least one purification step. An "isolated" nucleic acid molecule that encodes a PA polypeptide is a nucleic acid molecule that has been identified and separated from at least one contaminating nucleic acid molecule that is normally associated with the natural source of the PA-encoding nucleic acid. Preferably, the isolated nucleic acid molecule is free of all naturally bound contaminants. An isolated PA-encoding nucleic acid molecule is in a form or setting other than that found in nature. Isolated nucleic acid molecules therefore are distinguished from the PA-encoding nucleic acid molecule as it exists in natural cells. But,
An isolated nucleic acid molecule encoding a PA polypeptide can be, for example, a P contained in a cell that normally expresses PA in which the nucleic acid molecule is at a chromosomal location different from that of the native cell.
It comprises an A-encoding nucleic acid molecule.

The term “control sequence” refers to a DNA sequence necessary for the expression of an operably linked coding sequence in a particular host organism. For example, control sequences that are suitable for prokaryotes include a promoter, optionally an operator sequence, and a ribosome binding site. Furthermore, eukaryotic cells are known to utilize promoters, polyadenylation signals and enhancers. Nucleic acid is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence. For example, the DNA for a presequence or secretory leader is operably linked to the DNA for a polypeptide if it is expressed as a preprotein that participates in the secretion of the polypeptide; promoters or enhancers affect the transcription of the sequence. Is operably linked to the coding sequence; or the ribosome binding site is operably linked to the coding sequence if it is in a position that facilitates translation. Generally, "operably linked" refers to bound DNA.
The sequences are contiguous, which in the case of a secretory leader is contiguous and in the reading phase. However, enhancers do not necessarily have to be in close proximity. Binding is accomplished by ligation at convenient restriction sites. If such sites do not exist, then synthetic oligonucleotide adapters or linkers are used in accord with conventional practice.

The term “antibody” is used in the broadest sense, and in particular single anti-PA monoclonal antibodies (including agonists, antagonists and neutralizing antibodies), and anti-PA antibody compositions with multi-epitopic specificity. , Single-chain anti-PA antibody, and anti-PA
It includes fragments of antibodies. The term "monoclonal antibody" as used herein refers to an antibody that is obtained from a population of substantially homogeneous antibodies, that is, the individual antibodies that make up the population may occur in small amounts, which may occur naturally and suddenly. Identical except for mutations. The "stringency" of a hybridization reaction is readily determined by one of ordinary skill in the art and is generally an empirical calculation that depends on probe length, wash temperature, and salt concentration.
In general, longer probes have higher temperatures for proper annealing and shorter probes have lower temperatures. Hybridization generally depends on the ability of denatured DNA to reanneal when complementary strands are present in an environment below their melting point. The higher the degree of desired homology between the probe and hybridizable sequence, the higher the relative temperature that can be used. As a result, higher relative temperatures make the reaction conditions more stringent, while lower temperatures reduce stringency. Further details and explanations of the stringency of the hybridization reaction can be found in
Ausubel et al., Current Protocols in Molecular Biology, Wiley Interscience Pub
See lishers, (1995).

“Stringent conditions” or “high stringency conditions” as defined herein means (1) low ionic strength and high temperature for washing, eg 0.015 M sodium chloride / 0 at 50 ° C. Using 0015 M sodium citrate / 0.1% sodium dodecyl sulfate; (2) denaturing agents such as formamide during hybridization, eg 50% (v / v) formamide and 0.1% at 42 ° C. Bovine serum albumin / 0.1% ficoll / 0.1% polyvinylpyrrolidone / 50 mM sodium phosphate buffer pH 6.5, and 750 mM sodium chloride,
With 75 mM sodium citrate; (3) 50% formamide at 42 ° C., 5 × SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% Sodium pyrophosphate, 5x Denhardt's solution, sonicated salmon sperm DNA (50 μg / ml), 0
． 0.2% SS at 42 ° C with 1% SDS and 10% dextran sulfate
Identified by using a high stringency wash consisting of a wash in C (sodium chloride / sodium citrate) and 50% formamide at 55 ° C followed by 0.1xSSC with EDTA at 55 ° C. “Moderate stringency conditions” are described in Sambrook et al., Molecular Cloning: A Laboratory.
Manual New York: Cold Spring Harbor Laboratory Press, 1989, including use of less stringent wash solutions and hybridization conditions (eg, temperature, ionic strength and% SDS) identified as described in Cold Spring Harbor Laboratory Press. Moderate stringency conditions were: 20% formamide, 5xSSC (150 mM NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate pH 7.6, 5x denhard solution, 10% dextran sulfate, and 20 mg / mL. Denatured sheared salmon sperm D
Incubation overnight at 37 ° C. in a solution containing NA, then 3 in 1 × SSC.
The condition is that the filter is washed at 7-50 ° C. One of ordinary skill in the art will recognize how to adjust temperature, ionic strength, etc. as needed to accommodate factors such as probe length.

The term “epitope tag” as used herein refers to PA polypeptides fused to a “tag polypeptide” or chimeric polypeptides comprising their domain sequences. The tag polypeptide has a sufficient number of residues to provide an epitope against which the antibody can be produced, or an epitope identifiable by some other reagent, but whose length is the polypeptide of interest. Short enough not to interfere with the activity of. Also, the tag polypeptide is preferably fairly unique so that the antibody does not substantially cross-react with other epitopes. Suitable tag polypeptides generally have at least 6 amino acid residues, usually about 8 to about 50 amino acid residues (preferably about 10 to about 20 residues). The term “immunoadhesin” as used herein refers to antibody-like molecules that combine the binding specificity of a heterologous protein (“adhesin”) with the effector functions of immunoglobulin constant domains. Structurally, an immunoadhesin contains a fusion of an immunoglobulin constant domain sequence with an amino acid sequence that has the desired binding specificity and is other than the antigen recognition and binding site of an antibody (ie, "heterologous"). . The adhesin portion of the immunoadhesin molecule is typically a contiguous amino acid sequence containing at least the binding site for the receptor or ligand. The immunoglobulin constant domain sequence of the immunoadhesin has IgG-1, IgG-2, IgG-3 or IgG-4 subtype, I
It can be obtained from any immunoglobulin such as gA (including IgA-1 and IgA-2), IgE, IgD or IgM.

As used herein, “active” and “activity” refer to forms of the PA polypeptide that retain the biological and / or immunological activity of the native or naturally occurring PA polypeptide. "Biological" activity is the biological function (inhibitory or stimulatory) produced by a naturally occurring or naturally occurring PA, the ability to generate antibodies against the antigenic epitopes possessed by the naturally occurring or naturally occurring PA. By "immunological" activity is meant the ability to generate antibodies against the antigenic epitopes of natural or naturally occurring PA. Preferred biological activities include, for example, the extracellular matrix degrading properties of PA polypeptides, such as in the case of proteases found to have such effects described in the present invention. The term "antagonist" is used in its broadest sense and refers to any molecule that blocks, inhibits, or neutralizes the biological activity of a native PA polypeptide disclosed herein. Similarly, the term "agonist" is used in its broadest sense and refers to any molecule that mimics the biological activity of a native PA polypeptide disclosed herein. Suitable agonist or antagonist molecules include, among others, agonist or antagonist antibodies or antibody fragments, fragments or amino acid sequence variants of naturally occurring PA polypeptides, peptides, antisense molecules, and small organic molecules. A method of identifying an agonist or antagonist of a PA polypeptide comprises contacting a PA polypeptide, mRNA or gene with a candidate antagonist or agonist molecule to detect a detectable change in one or more biological activities normally associated with the PA polypeptide. Including measuring.

“Treatment” as used herein refers to both curative treatment and prophylactic or preventative therapy, in which a patient prevents or reduces (reduces) the targeted pathological condition or disease.
To be made. More specifically, "treatment" is treatment performed with the intention of inhibiting the progression of angiogenic disorders or modulating pathology. The concept of treatment is used in its broadest sense and includes in particular the prevention (prevention), alleviation, reduction and cure of angiogenic disorders of any stage. Thus, “treatment” refers to both curative treatment and prophylactic or preventative measures, the objective of which is to prevent or delay (reduce) angiogenic disorders. The disease is the result of any cause, including idiopathic, cardiotrophic, or myotrophic causes, or ischemia or ischemic attacks, such as myocardial infarction. Those in need of treatment include those already with the disorder as well as those prone to have the disorder or those in whom the disorder is to be prevented. By "chronic" administration is meant administration of the drug in a continuous manner, as opposed to an acute manner, to maintain the initial therapeutic effect (activity) over an extended period of time. An "intermittent" administration is a treatment that is cyclical in nature, rather than continuous without interruption.

Microarray refers to discrete polynucleotides arranged on a substrate such as paper, nylon or other type of membrane, filter, gel, polymer, chip, glass slide, or other suitable substrate including a solid support. Alternatively, it refers to an array of oligonucleotides. Polynucleotides or oligonucleotides (backbone chemistry are available in the art) can be synthesized on the substrate or prepared prior to application to the substrate. "Mammal" means any animal classified as a mammal, including humans and animals such as dogs, cats, cows, horses, sheep, pigs, goats, rabbits and the like. Preferably,
The mammal is a human. Administration "in combination with" one or more additional therapeutic agents includes simultaneous (concurrent) and sequential administration in any order.

As used herein, “carrier” includes a pharmaceutically acceptable carrier, excipient, or stabilizer, and is non-reactive to the cells or mammals exposed to them at the dosages and concentrations used. It is toxic. The physiologically acceptable carrier is often an aqueous pH buffered solution. Examples of physiologically acceptable carriers are phosphate, citrate, and other organic acid salt buffers; antioxidants including ascorbic acid; low molecular weight (about 1
<0 residues) polypeptide; protein such as serum albumin, gelatin, or immunoglobulin; hydrophobic polymer such as polyvinylpyrrolidone; amino acid,
E. Glycine, glutamine, asparagine, arginine or lysine; monosaccharides, disaccharides and other carbohydrates including glucose, mannose or dextran; E
Chelating agents such as DTA; sugar alcohols such as mannitol or sorbitol; salt forming counterions such as sodium; and / or nonionic surfactants such as TWEEN (trade name), polyethylene glycol (PEG), and PLURONICS (trade name). )including. An "antibody fragment" comprises a portion of an intact antibody, preferably the antigen binding or variable region of the intact antibody. Examples of antibody fragments are Fab, Fab ′, F (ab ′) ₂ and Fv fragments; diabodies; linear antibodies (Zapata et al., Protein Eng. 8 (10): 105).
7-1062 [1995]); single-chain antibody molecules; and multispecific antibodies formed from antibody fragments. Papain digestion of antibodies produces two identical antibody-binding fragments, called "Fab" fragments, each of which has a single antigen-binding site and the rest "Fc", reflecting its ability to crystallize readily. Named Fragment. Pepsin treatment yields an F (ab ′) ₂ fragment that has two antigen-combining sites and is still capable of cross-linking antigen.

“Fv” is the minimum antibody fragment that contains a complete antigen recognition and binding site. This region consists of a dimer of one heavy chain and one light chain variable region in close, non-covalent association. In this arrangement the three CDRs of each domain interact to determine the antigen binding site on the surface of the VH-VL dimer. To be precise, the six CDRs determine the antigen binding site specific for the antibody. However, even a single variable domain (or half of an Fv comprising only three CDRs specific for an antigen) has a lower affinity than the entire binding site, but has the ability to recognize and bind antigen . The Fab fragment also contains the constant domain of the light chain and the first constant domain (CH
Also includes 1). Fab fragments differ from Fab fragments by the addition of a few residues at the carboxy terminus of the heavy chain CH1 domain including one or more cysteines from the antibody hinge region. Here, Fab′-SH represents Fab ′ in which the cysteine residue of the constant domain has a free thiol group. F (ab ′) ₂ antibody fragments originally were produced as pairs of Fab ′ fragments which have hinge cysteines between them.
Other chemical couplings of antibody fragments are known to those of skill in the art. "Light chains" of antibodies (immunoglobulins) from any vertebrate species are classified into one of two distinct types called kappa and lambda, based on the amino acid sequences of their constant domains.

Depending on the amino acid sequence of the constant domain of their heavy chains, immunoglobulins can be classified into different classes. Five major immunoglobulin classes: IgA, Ig
D, IgE, IgG and IgM, some of which are further subclasses (isotypes), eg IgG1, IgG2, IgG3, IgG4, IgA and Ig.
It is classified into A2. "Single-chain Fv" or "sFv" antibody fragments include antibody fragments that contain the VH and VL domains of the antibody, these domains being present in a single polypeptide chain. Preferably, the Fv polypeptide further comprises a polypeptide linker between the VH and VL domains, which enables the sFV to form the desired structure for antigen binding.
For an overview of sFv, see The Pharmacology of Monoclonal Antibodies, vol.
113, Rosenburg and Moore, Springer-Verlag, New York, pp. 269-315 (1994).
See Pluckthun. The term "diabodies" refers to a small antibody fragment having two antigen binding sites, which fragment is a heavy chain linked to a light chain variable domain (VL) within the same polypeptide chain (VH-VL). It contains a variable domain (VH). By using a linker that is too short to pair between two domains on the same chain, the domains are forced to pair with the complementary domains on the other chain, creating two antigen binding sites. Diabodies are described, for example, in EP 404,097; WO 93/11161; and Hollinger et al., Proc. Natl.
Acad. Sci. USA, 90: 6444-6448 (1993).

An “isolated” antibody is one that has been identified and separated and / or recovered from a component of its natural environment. Contaminant components of its natural environment are materials that would interfere with its diagnostic or therapeutic use for the antibody, including enzymes, hormones, and other proteinaceous or nonproteinaceous solutes. In a preferred embodiment, the antibody is (1) Lori method.
More than 95% antibody, most preferably 99% by weight when measured by (Lowry method)
By using (2) Spinning cup sequenator until
Enough to obtain an N-terminal or internal amino acid sequence of at least 15 residues,
Alternatively, (3) purification to homogeneity by SDS-PAGE under non-reducing or reducing conditions using Coomassie blue or preferably silver staining. Isolated antibody includes the antibody in situ within recombinant cells since at least one component of the antibody's natural environment will not be present. Ordinarily, however, isolated antibody will be prepared by at least one purification step. The term "label" as used herein refers to a detectable compound or composition which is conjugated directly or indirectly to the antibody to produce a "labeled" antibody. The label may itself be detectable (eg a radioactive or fluorescent label) or, in the case of an enzymatic label, may catalyze the chemical conversion of a detectable substrate compound or composition.

By “solid phase” is meant a non-aqueous matrix to which the antibodies of the invention can adhere. Examples of solid phases contemplated herein include those formed partly or wholly from glass (eg, controlled pore glass), polysaccharides (eg, agarose), polyacrylamide, polystyrene, polyvinyl alcohol and silicone. In certain embodiments, depending on the context, the solid phase can comprise the wells of an assay plate; in others it can be a purification column (eg, an affinity chromatography column). The term also includes a discontinuous solid phase of discrete particles, such as those described in US Pat. No. 4,275,149. "Liposomes" are small vesicles composed of various types of lipids, phospholipids, and / or surfactants, useful for delivery of drugs (anti-PA polypeptides or antibodies described herein) to mammals. Is. The components of the liposome are commonly arranged in a bilayer formation, similar to the lipid arrangement of biological membranes. Here, "small molecule" refers to any molecule having a molecular weight of less than about 500 Daltons.

The terms “vascular or angiogenic disorders”, “vascular or angiogenic dysfunction” are used interchangeably and refer to systemic diseases affecting blood vessels such as diabetes mellitus, as well as arteries, capillaries, veins, And / or refers to some of the disease of the blood vessels themselves, such as the lymphatic vessels. These disorders include those that stimulate angiogenesis, cardiovascularization and / or angiogenesis, and those that inhibit angiogenesis, cardiovascularization and / or angiogenesis. Such diseases include, for example, arterial diseases such as atherosclerosis, hypertension, inflammatory vasculitis, Raynaud's disease and Raynaud's phenomenon, aneurysms, and arterial restenosis; venous and lymphatic vessel diseases such as thrombotic veins. Inflammation, lymphangiitis, and lymphedema; and other vascular diseases such as peripheral vascular disease, cancer, such as hemangiomas, such as hemangiomas (capillary and cavernous), glomus tumor, telangiectasia, bacterial hemangiomatosis, Hemangioendothelioma, angiosarcoma,
Hemangiopericytoma, Kaposi's sarcoma, lymphangioma, and lymphangiosarcoma, tumor angiogenesis,
Trauma such as wounds, burns and other injured tissue, graft fixation, scarring, ischemia reperfusion injury, rheumatoid arthritis, cerebrovascular disease, kidney disease such as acute renal failure,
And osteoporosis. Also included are angina (angina), myocardial infarction, such as acute myocardial infarction, and heart failure, such as congestive heart failure.

“Heart failure” refers to an abnormality of cardiac function in which the heart does not pump blood as fast as the demands of metabolizing tissues require. Heart failure can be due to many factors, including ischemia, congenital, rheumatic or idiopathic forms. A type of heart failure, "congestive heart failure" (CHF), provides sufficient cardiac output (ie, the amount of blood pumped by the heart over time) to deliver oxygenated blood to peripheral tissues. A progressive medical condition of the heart that cannot be supplied. As CHF progresses, structural and hemodynamic damage occurs. This damage manifests in various ways, one characteristic sign of which is ventricular hypertrophy. CHF is a common end result of many heart diseases.

“Myocardial infarction” is commonly accepted to be the result of atherosclerosis of the coronary arteries, often with multiple coronary artery thrombosis. It can be of two types: intramural infarction with myocardial necrosis over the entire thickness of the ventricular wall, and without the necrosis extending into all the pathways through the ventricular wall to the epicardium, the subendothelial layer, within the myocardial wall, or It can be divided into accessory endocardial (non-intramural) infarcts. Myocardial infarction is known to be due to both altered hemodynamic effects and altered structures in the damaged and healthy areas of the heart. Thus, for example, myocardial infarction reduces the maximum outflow of the heart and the heart beat volume. In addition, in association with myocardial infarction, interstitial DNA synthesis is stimulated, resulting in increased collagen formation in the unaffected heart region. The superior valve "aortic stenosis" is a hereditary vascular disease characterized by narrowing of the ascending aorta, but other arteries, including the pulmonary artery, may also be affected. Untreated aortic stenosis results in increased intracardiac pressure, resulting in cardiac hypertrophy, which in fact leads to heart failure and death. Although the etiology of this disease is not fully understood, hyperplasia and hypertrophy of intermediate smooth muscle are hallmarks of this disease. It was reported that a molecular mutant of the elastin gene is involved in the progression and pathogenesis of aortic stenosis. See U.S. Pat. No. 5,650,282.

“Heart valve regurgitation” occurs as a result of heart disease due to the result of heart valve disease. Various conditions, such as rheumatic fever, cause contraction or pulling of the valve orifice, while other conditions include endocarditis, inflammation of the endocardium or the membrane inside the atrial orifice, and cardiac surgery. by. Defects, such as valve stenosis or proximity of a valve defect, result in the accumulation of blood in the heart chamber or regurgitation of blood through the valve. Failure to heal the valve stenosis or insufficiency for a long period of time will result in cardiac hypertrophy and myocardial related damage, eventually requiring replacement of the valve. The treatment of these and endothelium-related cardiovascular and angiogenic disorders is included in the present invention.

The terms “cancer”, “cancerous”, and “malignant” as used herein refer to or describe the physiological condition in mammals that is typically characterized by unregulated cell growth. To do. Examples of cancer include, but are not limited to, adenocarcinoma, lymphoma,
Includes blastomas, melanomas, sarcomas, and leukemias. More specific examples of such cancers include squamous cell carcinoma, small cell lung cancer, non-small cell lung cancer, gastric cancer, Hodgkin and non-Hodgkin lymphoma, pancreatic cancer, glioblastoma, cervical cancer, ovarian cancer, Liver cancer, such as hepatic carcinoma and hepatoma, bladder cancer, breast cancer, colorectal cancer, colorectal cancer, endometrial cancer, salivary gland cancer, renal cell carcinoma and Wilms tumor, basal cell carcinoma , Melanoma, prostate cancer, ovarian cancer, thyroid cancer, testicular cancer, esophageal cancer, and various types of head and neck cancer. Cancers suitable for treatment according to the invention described herein include breast cancer, colon cancer, lung cancer, melanoma, ovarian cancer and the above-mentioned vascular tumors. The term "cytotoxic agent" as used herein refers to a substance that inhibits or prevents the function of cells and / or causes destruction of cells. The term refers to radioisotopes (eg, ^{1 31} I, ¹²⁵ I, ⁹⁰ Y and ¹⁸⁶ Re), chemotherapeutic agents, and toxins, such as enzymatically active toxins of bacterial, fungal, plant or animal origin, or fragments thereof. Intended to include.

A “chemotherapeutic agent” is a chemical compound useful in the treatment of cancer. Examples of chemotherapeutic agents are alkylating agents, folate antagonists, anti-metabolites of nucleic acid metabolism, antibiotics, pyrimidine analogs, 5-fluorouracil, cisplatin, purine nucleosides,
Included are amines, amino acids, triazole nucleosides, or corticosteroids. Specific examples include adriamycin, doxorubicin, 5-fluorouracil, cytosine arabinoside (“Ara-C”), cyclophosphamide, thiotepa, busulfan, cytoxin, taxol, toxotea, methotrexate, cisplatin, melphalan, vinblastine. , Bleomycin, etoposide, ifosfamide, mitomycin C, mitoxanthone, vincristine, vinorelbine, carboplatin, teniposide, daunomycin, carminomycin, aminopterin, dactinomycin, mitomycin, esperamycin (see U.S. Pat. No. 4,675,187), melphalan and Includes related nitrogen mustards. Also included in this definition are hormonal agents that function to regulate or inhibit hormonal action on tumors such as tamoxifen and onapristone. “Growth inhibitor” as used herein refers to a compound or composition that inhibits the growth of cells, eg, Wnt-overexpressing cancer cells, in vitro or in vivo. That is, the growth inhibitor significantly reduces the percentage of malignant cells in the S phase. Examples of growth inhibitory agents include agents that block cell cycle progression (at a position other than S phase), such as agents that induce G1 arrest and M phase arrest. Classical M-phase blockers include vincas (vincristine and vinblastine), taxol, and topo II inhibitors such as doxorubicin, daunorubicin, etoposide, and bleomycin. These drugs that arrest G1 also spread to S-phase arrest,
For example, DNA alkylating agents such as tamoxifen, prednisone, dacarbazine, mechlorethamine, cisplatin, methotrexate, 5-fluorouracil and Ara-C. For more information, see The Molecular Basis of Cancer, Me
Ndelsohn and Israel, Editor, Chapter 1, Murakami, et al. entitled "Cell cycle reg
ulation, oncogenes, and antineoplastic drugs '' (WB Saunders: Philadelphia
, 1995), especially on page 13. Further examples are antibodies capable of inhibiting or neutralizing the angiogenic activity of tumor necrosis factor (TNF), acidic or basic FGF or hepatocyte growth factor (HGF), capable of inhibiting or neutralizing the coagulation activity of tissue factor Antibody, protein C
Or Protein S (see WO91 / 01753 published on February 21, 1991), or HER2
Antibodies capable of binding to the receptor (WO89 / 06692) such as the 4D5 antibody (and their functional equivalents) (eg WO92 / 22653) are included.

The term “cardiovascular drug” is a small molecule drug or soluble protein, such as an antibody, that promotes cardiovascular formation or inhibits the destruction of existing defect structures, or myocardial blood vessels to thrombotic plaques or blood vessels. Prevents obstruction by other proteinaceous deposits that lead to plaque formation on the wall. "Angiogenic agents" and "endothelial agents" are active agents that promote angiogenesis and / or endothelial cell growth, or, where appropriate, angiogenesis. This includes factors that promote wound healing, such as growth hormone, insulin-like growth factor-I (IGF-I), VE.
GF, VIGF, PDGF, epidermal growth factor (EGF), CTGF and its family members, FGF, and TGF-α and TGF-β.

“Angiogenesis inhibitors” are active agents that inhibit angiogenesis or angiogenesis, or inhibit or prevent the growth of cancer cells. Examples include antibodies to the angiogenic agents described above or other antagonists such as antibodies to VEGF. In addition, cytotherapeutic agents such as cytotoxic agents, chemotherapeutic agents, growth inhibitors, apoptotic agents, and other agents that treat cancer, such as anti-HER-2, anti-CD20, and bioactive and organic chemical agents included. In the context of the present invention, in the context of the present invention, a “therapeutically effective amount” of an active agent such as a PA polypeptide or an agonist or antagonist thereof or an anti-PA antibody means cardiovascular, endothelial and vascular in mammals. It refers to an amount effective for the treatment of dysplasia, and the determination of a therapeutically effective amount that can be empirically determined can be accomplished by any method known to those of skill in the art. As used herein, an "effective amount" of an active agent such as a PA polypeptide or agonist or antagonist thereof or anti-PA antibody refers to an amount effective to carry out the stated purpose, and such The amount can be empirically determined for the desired effect.

General Screening and Diagnostic Methods Using PA Sequences Some of the methods described herein involve comparing expression levels of one or more PA nucleic acids in test and reference cell populations. The sequence information disclosed herein, in combination with nucleic acid detection methods known in the art, allows the detection and comparison of various PA transcripts. In some embodiments, the PA nucleic acid and polypeptide are each PA
Corresponds to nucleic acids or polypeptides comprising the various sequences disclosed for nucleic acid sequences (referenced by GenBank accession number and SEQ ID NO). In its various aspects and embodiments, the invention comprises at least one test cell population capable of expressing the sequence PA1-27, or one or more of any combination of the PA sequences. By "expressible" is meant that the gene can be present and expressed within the cell in its intact form. Then one, some, of the PA sequences, if any,
Or all are detected and preferably measured. Using the sequence information provided by database entries for known sequences, PA sequence expression (if expressed) can be detected and measured using techniques well known to those of skill in the art. For example, a sequence in a sequence database entry corresponding to a PA sequence may be probed for the detection of a PA RNA sequence, eg, in a Northern blot hybridization analysis or a method of specifically and preferably quantitatively amplifying a particular nucleic acid sequence. Can be used to build As in other examples, the sequences can be used to construct primers for specifically amplifying PA sequences in amplification-based detection methods, such as reverse transcription-based polymerase chain reaction. Where modulation in gene expression is accompanied by gene amplification or deletion, sequence comparisons in test and reference means are made by comparing the relative amounts of the tested DNA sequences in the test and reference cell populations.

For PA sequences whose polypeptide products are known, expression can also be measured by measuring protein levels, ie, the levels of polypeptides encoded by the gene products described herein. Such methods are known in the art and include, for example, antibody-based immunoassays against gene-encoded proteins. The expression level of the one or more PA sequences in the test cell population is then compared to the expression level of the sequences in the one or more cells from the reference cell population. Expression of sequences can be compared using any art-recognized method for comparing expression of nucleic acid sequences to test expression of cells in a test and control population of cells. For example, expression is described in US Pat. No. 5,871,697 and Shimkets et al., Nat. Biotechnol.
.17: 798-803, Gene Calling® can be used for comparison, both of which are incorporated herein by reference. In various embodiments 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11
, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23
, 24, 25 or all sequences represented by PA1-27 are measured. If desired, expression of these sequences can be measured along with other sequences whose expression is known to vary according to one of the parameters or conditions described herein.

The reference cell population comprises one or more cells capable of expressing the PA sequence to be measured and of which the parameter to be compared with, eg the angiogenic stage, is known. By "angiogenic stage" is meant that the reference cell is known to be from a patient suffering from an angiogenic disorder. For example, patients with a positive angiogenic stage have angiogenic disorders, while patients with a negative angiogenic stage do not. Whether the comparison of the gene expression profile in the test cell population to the reference cell population reveals the presence or extent of the measured parameter depends on the composition of the reference cell population. For example, if the reference cell population consists of cells from a patient with an angiogenic disorder (ie, a patient with a positive angiogenic stage), a similar gene expression level between the test cell population and the reference cell population is It is shown that the cell population also has a positive angiogenic stage. Similarly, different gene expression levels indicate that the test cell population has a negative angiogenic stage.

In various embodiments, a PA sequence in a test cell population has a level of expression that varies by a factor equal to or less than 2.0-fold that of PA transcription in a reference cell population, It appears to be comparable in expression level to the expression of PA sequences in the reference cell population. In various embodiments, the PA sequence in the test cell population is at an expression level when the expression level changes from the reference cell population by more than 2.0-fold than the expression level of the corresponding PA sequence in the reference cell population. It is considered to be changing. If desired, comparison of differentially expressed sequences between a test cell population and a reference cell population can be performed on a control nucleic acid whose expression is independent of the parameter or condition for which it is measured. The expression level of the control nucleic acid in the test and reference nucleic acids can be used to normalize the signal levels of the compared populations. Appropriate control nucleic acids can be readily determined by one of ordinary skill in the art.

In some embodiments, the test cell population is compared to multiple reference cell populations. Each of the plurality of reference populations may differ in known parameters. Therefore, the test cell population may be compared to a first cell population having a positive angiogenic stage as well as a second reference population having a negative angiogenic stage. The test cell population can be any number of cells, ie, one or more cells, and can be provided in vitro, in vivo, or ex vivo. In other embodiments, the test cell population can be divided into two or more subpopulations. Subpopulations can be created by dividing a first population of cells to produce the same subpopulation as possible. This would be suitable, for example, in in vitro or in vivo screening methods. In some embodiments, the different subpopulations are placed in a control reagent and / or a test reagent, a plurality of test reagents, or, for example, different amounts of one or more test reagents administered simultaneously, or different combinations. Can be exposed.

Preferably, the cells in the reference cell population are divided from a tissue type that is as similar as possible to the test cells. In some embodiments, control cells are divided from the same patient as the test cells, eg, from a region adjacent to the source of the test cells. In another embodiment, the reference population is a database of previously tested expression patterns for which one of the parameters or conditions described herein (eg, angiogenic stage, diagnostic, or therapeutic requirements) is known. be able to. The patient is preferably a mammal. The mammal can be, for example, a human or non-human primate, mouse, rat, dog, cat, horse, or cow.

Methods Including Diagnosing or Measuring Susceptibility to Angiogenic Disorders The present invention further provides methods of diagnosing or measuring susceptibility to angiogenic disorders.
Angiogenic disorders are diagnosed by examining the expression of two or more PA nucleic acids from cell populations from patients suspected of having the disease. Expression of one or more PA nucleic acid sequences in the test cell population, eg, PA: 1-27, is measured and compared to expression of the sequence in the reference cell population. The reference cell population comprises at least one cell from a patient not suffering from it. Where the reference cell population comprises diseased cells, the similarity in expression of PA sequences between the test population and the reference cell population indicates that the patient is obese. Differences in the expression of PA sequences between the test population and the reference cell population indicate that the patient is not obese.

The patient is preferably a mammal, which can be, for example, a human, non-human primate, mouse, rat, dog, cat, horse, or cow. In various embodiments 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11
, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23
, 24, 25 or all sequences represented by PA1-27 are measured. If desired, expression of these sequences can be measured along with other sequences whose expression is known to vary according to one of the parameters or conditions described herein.

Methods of Treating Angiogenic Disorders The present invention also comprises administering to a patient an agent that modulates the expression or activity of one or more nucleic acid sequences selected from the group consisting of PA: 1-27. Provided are methods of treating, i.e., preventing or delaying the onset of angiogenic disorders in a patient. “Modulate” is meant to include an increase or decrease in PA nucleic acid expression or activity. Preferably, modulation results in a change in PA gene or gene product expression or activity in a patient to a level similar or identical to a patient not suffering from an angiogenic disorder. The patient can be, for example, a human, a rodent such as a mouse or rat, or a dog or cat. In one aspect, the method of treatment comprises administering an agent that reduces the expression or activity of one or more nucleic acid sequences selected from the group consisting of PA: 5, 14 and 15. Alternatively, the method comprises administering an agent that increases the expression or activity of one or more nucleic acid sequences selected from the group consisting of PA: 1-4, 6-13 and 16-26.

Preferred agents include antibodies to polypeptides encoded by specific PA nucleic acid sequences, antisense nucleic acid molecules, peptides, PA polypeptide agonists, PA.
It may include a polypeptide antagonist, peptidomimetic, small molecule, or other drug. In various embodiments, the angiogenic disorder treated can be selected from the group consisting of cardiac hypertrophy, trauma, age-related macular degeneration, and cancer. Other angiogenic disorders can also be treated according to the methods of the invention. The PA nucleic acids, polypeptides, antibodies, agonists, and antagonists described herein, when used therapeutically, are referred to herein as "Therapeutics." Methods of administration of therapeutic agents include, but are not limited to, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, and oral routes. The therapeutic agents of the invention may be administered by any conventional route, such as infusion or bolus injection, epithelial or mucosal lining (eg, oral mucosa, rectal and intestinal mucosa), and other biological activities. It may be administered with the agent. Administration can be systemic or local. Furthermore, it may be advantageous to administer the therapeutic agent to the central nervous system by any route, including intraventricular and intrathecal injection.

Intraventricular injection is facilitated by an intraventricular catheter connected to a reservoir (eg, Ommaya reservoir). Pulmonary administration may be employed by the use of an inhaler or nebulizer and formulation with an aerosolizing agent. It is also desirable to administer the therapeutic agent locally to the area in need of treatment; this may include, but is not limited to, local injection during surgery, local application, injection by catheter, suppository, or implant. Achieved by In particular embodiments, administration is by direct injection at the site (or previous site) of the malignant tumor or tumorigenic or pro-tumorigenic tissue. Various delivery systems are known and can be used to administer the therapeutic agents of the present invention, such as: (1) encapsulation in liposomes, microparticles, microcapsules; (ii) expressing the therapeutic agent. Possible recombinant cells; (iii) receptor-mediated endocytosis (see, for example, Wu and Wu, 1987. J Biol Chem 262: 4429-4432); (iv) therapeutic agents as part of a retrovirus or other vector. Including the construction of nucleic acids. In one embodiment of the invention, the therapeutic agent is delivered in vesicles, especially liposomes. In liposomes, the protein of the invention is mixed with an amphipathic reagent, such as a lipid, in addition to other pharmaceutically acceptable carriers, which is a micelle in aqueous solution,
It exists in an aggregated form as an insoluble monolayer, liquid crystal, or lamella layer. Suitable lipids for liposome formation include, but are not limited to, monoglycerides, diglycerides,
Includes sulfatide, lysolecithin, phospholipids, saponins, bile acids, etc. The preparation of such liposomal formulations is within the skill of those in the art and is described, for example, in US Pat.
No. 4,837,028 and US Pat. No. 4,737,323, which are incorporated herein by reference in their entirety. In yet another embodiment, the therapeutic agent is, for example, a delivery pump (eg, Saudek et al., 1989. New Engl J Med 321: 574) and a semipermeable polymeric material (eg, Howard et al., 1989. J Neurosurg 71: Delivered in a sustained release system including 105). Moreover, the sustained release system can be placed in close proximity to the therapeutic target (eg, brain), so only a portion of the systemic dose is required. Goodson,
Medical Applications of Controlled Release 1984 (CRC Press, Bocca Raton
, FL).

In a particular embodiment of the invention, the therapeutic agent is a nucleic acid encoding a protein,
It is constructed as part of a suitable nucleic acid expression vector (using retroviral vectors, by direct injection, by using microparticle bombardment, coating with lipids or cell surface receptors or transfection reagents, or entering the nucleus. Administration in a linkage to a known homeobox-like peptide, etc. (for example, Joliot et al., 1991. Proc Natl Acad Sci USA 88: 1864-1868), so that it becomes intracellular. By doing so, the therapeutic nucleic acid is administered in vivo to promote expression of the encoded protein. Alternatively, the nucleic acid therapeutic is
It may be introduced intracellularly and introduced into host cell DNA for expression by homologous recombination. The term "therapeutically effective amount" as used herein means a significant patient benefit of each active ingredient of the pharmaceutical composition or method, i.e. treatment, cure, prevention or alleviation of the associated medical condition, or By total amount sufficient to indicate an increased rate of treatment, cure, prevention or alleviation of the condition. When applied to an individual active ingredient, administered alone, the term refers to that ingredient alone. When applied to a combination, the term refers to the total amount of active ingredients that produces a therapeutic effect, whether administered sequentially or simultaneously in combination.

The amount of therapeutic agent of the present invention effective in treating a particular disease or condition depends on the nature of the disease or condition and can be determined by one of ordinary skill in the art by standard clinical techniques. In addition, in vitro assays may optionally be employed to help identify optimal dosage ranges. The precise dosage employed in a formulation will also depend on the route of administration and the severity of the disease or disorder remnant, and should be determined according to the judgment of the practitioner and the individual patient. Ultimately, the attending physician will decide the amount of protein of the invention with which to treat each patient. First, the attending physician will administer a low dose of the protein of the invention and observe the patient's response. The dose of the protein of the invention is increased until the optimal effect is obtained for the patient, in which case the dose is not increased further. However, suitable doses for intravenous administration of the therapeutic agents of the invention are:
Generally, 20-500 micrograms (μg) per kilogram (kg) of body weight
) Is an active compound. Suitable doses for intranasal administration are generally about 0.01 p.
g / kg body weight to 1 mg / kg body weight. Effective doses may be extrapolated from dose-response curves derived from in vitro or animal model test systems. Suppositories are generally 0
． It contains 5% to 10% by weight of the active ingredient; oral formulations preferably contain 10% to 95% of the active ingredient. The duration of intravenous treatment with the pharmaceutical composition of the present invention will vary depending on the severity of the disease being treated and the condition and potential idiosyncrasy of the individual patient. The duration of each application of the protein of the invention will vary within the range of 12 to 24 hours of continuous intravenous administration. Ultimately, the appropriate institution for intravenous treatment with the pharmaceutical compositions of the present invention will be decided by the attending physician.

The polynucleotides of the invention can also be used in gene therapy. Gene therapy refers to treatment performed by administration of a particular nucleic acid to a patient. Delivery of therapeutic drug nucleic acids to a mammalian patient can be direct (ie, the patient is directly exposed to the nucleic acid or a nucleic acid-containing vector) or indirect (ie, the cells are first transformed with the nucleic acid in vitro and then the patient). Be transplanted to). These two methods are known as in vivo or ex vivo gene therapy, respectively. The polynucleotides of the invention may also be administered by other known methods for introducing nucleic acids into cells or organisms, including but not limited to viral vectors or naked DNA. Any methodology for gene transfer available in the art can be used in the practice of the invention. See, for example, Goldspiel et al., 1993. Clin Pharm 12: 488-505. The cells may be cultured ex vivo in the presence of the therapeutic agents or proteins of the invention to grow in those cells and produce the desired effect or activity. The treated cells can then be introduced in vivo for therapeutic purposes.

Assessing the Efficacy of Anti-Angiogenic Therapies in Patients The differentially expressed PA sequences identified here also allow the course of treatment of pathophysiology to be monitored. In this method, a test cell population is provided from a patient undergoing treatment for an angiogenic disorder. If desired, test cell populations can be removed from the patient at various times before, during, or after treatment. Expression of one or more of the PA sequences in the cell population, eg, PA: 1-27, is then measured and compared to a reference cell population of known angiogenic stage. Preferably, the reference cell population has not been exposed to treatment. If the reference cell population contains cells that have not been exposed to treatment and are not diseased,
Differences in expression between PA sequences in the test cell population and this reference cell population indicate that the treatment is ineffective. However, similar expression between PA sequences in the test and reference cell populations indicates that the treatment is effective.

“Effective” means that the treatment leads to a reduction in pathophysiology in the patient. When the treatment is prophylactic, "effective" means that the treatment delays or prevents pathophysiology. For example, if the anti-angiogenic disorder treatment is "effective," it will improve the angiogenic disorder in the patient. Efficacy can be determined in association with known methods for treatment of a particular pathophysiology. The patient is preferably a mammal. The mammal can be, for example, a human, non-human primate, mouse, rat, dog, cat, horse, or cow. In various embodiments 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11
, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23
, 24, 25 or all sequences represented by PA1-27 are measured. If desired, expression of these sequences can be measured along with other sequences whose expression is known to vary according to one of the parameters or conditions described herein. In various embodiments, the expression of the nucleic acid sequence may be increased or decreased in the test cell population as compared to the reference cell population. The test cell population can be any number of cells, ie, one or more cells can be provided in vitro, in vivo, or ex vivo.

Identification of Agents That Treat Angiogenic Disorders The present invention is also a method of identifying agents that treat angiogenic disorders. One method involves contacting one or more of the PA polypeptides with a test reagent and detecting a complex between the test reagent and the polypeptide. The presence of the complex indicates that the test reagent treats an angiogenic disorder. The absence of complex indicates that the test reagent does not treat the angiogenic disorder. By "treating an angiogenic disorder" is meant that the test reagent increases or decreases the expression of one or more PA nucleic acid sequences. The test reagent is, for example, an antibody against a polypeptide encoded by PA: 1-27, an antisense nucleic acid molecule, a peptide, a PA polypeptide agonist, P
It can be an A polypeptide antagonist, peptidomimetic, small molecule or other drug. The test reagent may be a known or unknown therapeutic agent.

Angiogenic disorders treated are vascular tumors, proliferative vitreoretinopathy, rheumatoid arthritis, Crohn's disease, atherosclerosis, ovarian hyperstimulation, psoriasis, endometriosis with neovascularization. , Restenosis following balloon angioplasty, scar tissue hyperplasia, peripheral vasculopathy, hypertension, inflammatory vasculitis, Reynolds disease and Reynolds phenomenon, aneurysm, arterial restenosis, thrombophlebitis, lymphatic vessel It may be selected from the group consisting of inflammation, lymphedema, wound healing and tissue regeneration, ischemic reperfusion injury, angina, myocardial infarction, chronic heart failure, heart failure such as congestive heart failure, age-related macular degeneration, and osteoporosis. Other angiogenic disorders can also be treated according to the methods of the invention. The patient is preferably a mammal. The mammal can be, for example, a human, non-human primate, mouse, rat, dog, cat, horse, or cow.

Methods of Modulating the Activity of PA Proteins The present invention provides modulators, ie, candidate or test compounds or reagents that bind to PA proteins or that have a stimulatory or inhibitory effect on PA expression or PA activity (
For example, an antibody against a polypeptide encoded by PA: 1-27, an antisense nucleic acid molecule, a peptide, a PA polypeptide agonist, a PA polypeptide antagonist, a peptidomimetic, a small molecule or other drug) is provided. . In one embodiment, the invention provides an assay method for screening candidate or test compounds that bind to or modulate the activity of a membrane-bound form of a PA protein or polypeptide or biologically active portion thereof. The test compound of the present invention is
Biological libraries; spatially addressable solid or solution phase libraries; synthetic library methods that require deconvolution; "one bead, one compound" library methods; and synthetic library methods that use affinity chromatography selection, It can be obtained using any of the numerous methods in the recombinant library method known in the art. Biological library methods are limited to peptide libraries, while the other four methods are applicable to small molecule libraries of peptides, non-peptide oligomers or compounds (Lam
(1997) Anticancer Drug Des 12: 145).

Examples of methods for synthesizing molecular libraries are found in this field, for example: DeWitt et al.
(1993) Proc Natl Acad Sci USA 90: 6909; Erb et al. (1994) Proc Natl Acad Sci.
ci USA 91: 11422; Zuckermann et al. (1994) J Med Chem 37: 2678; Cho et al. (199
3) Science 261: 1303; Carrell et al. (1994) Angew Chem Int Ed Engl 33: 2059;
Carrell et al. (1994) Angew Chem Int Ed Engl 33: 2061; and Gallop et al. (1994) J
Can be found in Med Chem 37: 1233. Compound libraries are available in solution (see, eg, Houghten (1992) Biotechniques 13
: 412-421) or on beads (Lam (1991) Nature 354: 82-84), on chips (Fod
or (1993) Nature 364: 555-556), bacteria (Ladner US Pat. No. 5,223,409),
Spores (Ladner USP'409), plasmids (Cull et al. (1992) Proc Natl Acad Sci USA
89: 1865-1869) or on phage (Scott and Smith (1990) Science 249: 386-3).
90; Devlin (1990) Science 249: 404-406; Cwirla et al. (1990) Proc Natl Acad S
ci USA 87: 6378-6382; Felici (1991) J Mol Biol 222: 301-310; Ladner
Above).

In one embodiment, the assay is a cell-based assay, in which cells expressing the membrane-bound form of the PA protein or a biologically active portion thereof on the cell surface are contacted with a test compound and the test compound is The ability to bind the PA protein is measured.
The cells can be, for example, of mammalian origin or yeast cells. Measurement of the ability of a test compound to bind to a PA protein can be performed, for example, by coupling the test compound with a radioisotope or an enzyme label, and binding the test compound to the PA protein or biologically active portion thereof in a complex. Can be measured by detecting the labeled compound of. For example, a test compound can be labeled directly or indirectly with 125 I, 35S, 14C, or 3H, and a radioisotope can be measured directly by counting radiation emission or by scintillation counting. To be done. Alternatively, the test compound can be enzymatically labeled with, for example, horseradish peroxidase, alkaline phosphatase, or luciferase, and the enzymatic label detected by measuring conversion of the appropriate substrate to product. In one embodiment, the assay comprises staining cells expressing a membrane-bound form of the PA protein, or a biologically active portion thereof, on the cell surface with a known compound that binds PA to form an assay mixture, the assay Contacting the mixture with a test compound and determining the ability of the test compound to interact with the PA protein,
Measuring the ability to interact with a protein includes measuring the ability of a test compound to preferentially bind to PA or a biologically active portion thereof as compared to a known compound.

In another embodiment, the assay involves contacting cells expressing a membrane-bound form of a PA protein or a biologically active portion thereof on the cell surface with a test compound, wherein the test compound is P
A cell-based assay comprising measuring the ability of A or a biologically active portion thereof to modulate (eg, stimulate or inhibit) the activity. Measuring the ability of a test compound to modulate the activity of PA or a biologically active portion thereof can be accomplished, for example, by measuring the ability of a PA protein to bind or interact with a PA target molecule. As used herein, a “target molecule” is a molecule with which a PA protein binds or interacts in nature, eg, a molecule on the cell surface that expresses a PA interacting protein, a molecule on the surface of a second cell. , A molecule in the extracellular environment, a molecule that binds to the inner surface of the cell membrane, or a cytoplasmic molecule. PA target molecules are non-
It can be a PA molecule or a PA protein or polypeptide of the invention. In one embodiment, the PA target molecule is a component of a signal transduction pathway that facilitates the transduction of extracellular signals across cell membranes and into cells (eg, signals generated by the binding of compounds to membrane-bound PA molecules). The target can be, for example, a second intracellular protein having catalytic activity or a protein that promotes binding of PA with a downstream signaling molecule.

Measuring the ability of a PA protein to bind or interact with a PA target molecule can be accomplished by one of the methods described above for direct binding. In one embodiment, measuring the ability of a PA protein to bind or interact with a PA target molecule can be accomplished by measuring the activity of the target molecule. For example, the activity of the target molecule is determined by the target cellular second messenger (ie intracellular Ca2 +, diacylglycerol, IP3, etc.).
Of the reporter gene (a detectable marker, eg, a PA-responsive regulatory component operably linked to a nucleic acid encoding luciferase, by detecting the catalytic / enzymatic activity of the target of the appropriate substrate by detecting the induction of Can be achieved by detecting the induction of (including) or by detecting a cellular response such as cell survival, cell differentiation, or cell proliferation. In yet another embodiment, the assay of the present invention comprises contacting a PA protein or biologically active portion thereof with a test compound and determining the ability of the test compound to bind to the PA protein or biologically active portion thereof. Cell-free (no)
Assay. Binding of the test compound to the PA protein or biologically active portion thereof can be measured directly or indirectly as described above. In one embodiment, the assay involves contacting a PA protein or biologically active portion thereof with a known compound that binds PA to form an assay mixture, and contacting the assay mixture with a test compound, wherein the test compound is PA. Measuring the ability of a test compound to interact with a PA protein comprises measuring the ability of the test compound to interact with a PA protein such that the test compound preferentially binds to PA or a biologically active portion thereof, as compared to a known compound. Includes measurement of ability to bind.

In another embodiment, the assay involves contacting a PA protein or biologically active portion thereof with a test compound, wherein the test compound modulates (eg, stimulates or inhibits) the activity of PA or a biologically active portion thereof. Cell-free assay comprising measuring the ability to Measuring the ability of a test compound to modulate the activity of PA or a biologically active portion thereof is accomplished, for example, by measuring the ability of a PA protein to bind a PA target molecule by one of the methods described above for direct binding. it can. In an alternative embodiment, measuring the ability of a test compound to modulate the activity of PA can be accomplished by measuring the ability of a PA protein to further modulate a PA target molecule. For example, the catalytic / enzymatic activity of the target molecule on the appropriate substrate can be measured as previously described. In yet another embodiment, the cell-free assay involves contacting a PA protein or biologically active portion thereof with a known compound that binds PA to form an assay mixture and contacting the assay mixture with a test compound. , Measuring the ability of a test compound to interact with a PA protein, wherein the ability of the test compound to interact with a PA protein is determined by the test compound being preferentially P
Includes measuring the ability to bind A or a biologically active portion thereof.

The cell-free assay of the invention is applicable to both soluble or membrane bound forms of PA. If the cell-free assay involves a membrane-bound form of PA,
It is desirable to use a solubilizing reagent so that the membrane bound form of PA is maintained in solution. Examples of such solubilizing reagents are non-ionic detergents such as n-octyl glucoside, n-dodecyl glucoside, n-dodecyl maltoside, octanoyl-N-.
Methyl glucamide, decanoyl-N-methyl glucamide, Triton (registered trademark) X-100
, Triton (registered trademark) X-114, Thesit (registered trademark), isotridecipoly (ethylene glycol ether) n, N-dodecyl-N, N-dimethyl-3-ammonio-1-propanesulfonate, 3- (3-colamide Propyl) dimethyl aminiol-1-propane sulfonate (CHAPS) or 3- (3-colamido propyl) dimethyl aminiol-
Includes 2-hydroxy-1-propane sulfonate (CHAPSO). In one or more embodiments of the above assay methods of the invention, either PA or its target molecule is immobilized, facilitating the separation of complex forms from uncomplexed forms of one or both proteins while simultaneously automating the assay. It is desirable to be adapted to. The binding of the test compound to PA with or without the candidate compound, or the interaction of PA with the target molecule, can be carried out in any vessel suitable for containing the reactants. Examples of such vessels include microtiter plates, test tubes, and microcentrifuge tubes. In one embodiment, a fusion protein can be provided, which adds a domain that allows one or both proteins to bind to the matrix. For example, the GST-PA fusion protein or GST-target fusion protein can be adsorbed to glutathione sepharose beads (Sigma Chemical, St. Louis, MO) or glutathione-induced microtiter plates, which are then non-conjugated with the test compound or test compound. Conditions under which adsorbed target protein or PA protein is mixed and the mixture leads to complex formation (eg physiological conditions for salt and pH)
Incubated under. Following incubation, the beads or wells of the microtiter plate are washed to remove unbound components and, in the case of beads, the immobilized matrix is measured directly or indirectly, for example as described above. Alternatively, the complex can be detached from the matrix and the level of PA binding or activity measured using standard techniques.

Other techniques of protein immobilization on matrices can also be used in the screening assays of the invention. For example, either PA or its target molecule
It can be immobilized using the conjugation of biotin and streptavidin. Biotinylated PA or target molecules can be biotin-NHS using techniques well known in the art (eg, biotinylation kit, Pierce Chemicals, Rockford, Ill.).
Can be prepared from (N-hydroxy-succinimide) and is coated with streptavidin 96
It can be immobilized in the wells of a well plate (Pierce Chemical). Or PA
Alternatively, an antibody that reacts with the target molecule but does not inhibit the binding of the PA protein to its target molecule can be derivatized to the wells of the plate and the unbound target or PA captured in the wells by antibody conjugation. Methods for detecting such complexes include, in addition to those described above for GST-immobilized complexes, immunodetection of the complex using an antibody reactive with PA or the target molecule, and for the PA or target molecule. Includes enzyme-linked assays that rely on detection of relevant enzyme activity.

In another embodiment, a modulator of PA expression is that the cell is contacted with a candidate compound,
It is identified by a method in which the expression of PA mRNA or protein in cells is measured. The expression level of PA mRNA or protein in the presence of the candidate compound is compared to the expression level of PA mRNA or protein in the absence of the candidate compound. The candidate compound is then identified as a modulator of PA expression based on this comparison. For example, in the presence of a candidate compound, when the expression of PA mRNA or protein is higher (statistically significantly higher) than in the absence thereof, the candidate compound is PA mRN.
A or as a stimulator of protein expression. Conversely, if the expression of PA mRNA or protein in the presence of the candidate compound is lower (statistically significantly lower) than in the absence, the candidate compound is identified as an inhibitor of PA mRNA or protein expression. The level of PA mRNA or protein expression in cells is
A mRNA or protein is determined by the methods described herein for detection. In yet another aspect of the invention, the PA protein is a two-hybrid or three-hybrid assay (eg, US Pat. No. 5,283,317; Zervos et al. (1993) Cell 72).
: 223-232; Madura et al. (1993) J. Biol. Chem. 268: 12046-12054; Bartel et al. (199)
3) Biotechniques 14: 920-924; Iwabuchi et al. (1993) Oncogene 8; 1693-1696;
Other proteins that bind or interact with A (“PA-binding proteins” or “PA-bp”) and that modulate PA activity can be identified. Such PA binding proteins can be labeled, for example, as P or P upstream or downstream of a component of the PA pathway.
It appears to be related to the growth of signaling by the A protein.

The two-hybrid system is based on the modular nature of most transcription factors, which consist of separable DNA-binding and activation domains. Briefly, this assay utilizes two different DNA constructs. In one construct, P
The gene encoding A is fused to the gene encoding the DNA binding domain of a known transcription factor (eg GAL-4). In the other construct, a DNA sequence encoding an unidentified protein ("prey" or "sample") from a DNA library is fused to a gene encoding the activation domain of a known transcription factor. The DNA binding and activation domains of transcription factors are in close proximity when the "bait" and "diet" proteins interact to form a PA-dependent complex in vivo. This proximity allows transcription of a reporter gene (eg, LacZ) operably linked to a transcriptional regulatory site responsive to the transcription factor. Expression of the reporter gene can be detected and cell colonies containing the functional transcription factor can be isolated and used to obtain a cloned gene encoding a protein that interacts with PA.

Methods for Detecting PA Proteins The present invention also provides methods for detecting the presence or absence of PA in a biological sample. This method involves obtaining a biological sample from a test patient and contacting the biological sample with a compound or reagent capable of detecting PA protein or nucleic acid encoding PA protein (eg, mRNA, genomic DNA). , PA in biological samples
Detecting the presence of. The reagent for detecting PA mRNA or genomic DNA is a labeled nucleic acid probe capable of hybridizing to PA mRNA or genomic DNA. The nucleic acid probe is, for example, a full-length P such as the nucleic acid of SEQ ID NO: 1.
A nucleic acid, or a part thereof, for example an oligonucleotide which is at least 15, 30, 50, 100, 250 or 500 nucleotides in length and is capable of specifically hybridizing to PA mRNA or genomic DNA under stringent conditions. Other probes suitable for use in the diagnostic assays of the invention are described herein. The reagent for detecting PA protein is an antibody capable of binding to PA protein,
Preferred is a detectably labeled antibody. The antibody can be polyclonal, more preferably monoclonal. An intact antibody, or a fragment thereof (eg Fab or F (ab ') 2) can be used. The term "labeled" with respect to a probe or antibody means that the detection of the probe or antibody results in the coupling of brain material (ie,
Physical labeling) of the probe or antibody, as well as indirect labeling of the probe or antibody by reactivity with other directly labeled reagents. Examples of indirect labeling include detection of the primary antibody with a fluorescently labeled secondary antibody, and end labeling of the DNA probe with fluorescently labeled streptavidin-detectable biotin. The term "biological sample" includes patients and tissues, cells and biological fluids isolated from tissues, cells and fluids within the patient. That is, the detection method of the present invention can be used to detect PA mRNA, protein, or genomic DNA in a biological sample in vitro as well as in vivo. For example, in vitro techniques for detection of PA mRNA include Northern hybridizations and in situ hybridizations. In vitro techniques for detection of PA proteins include enzyme-linked immunosorbent assay (ELISA), western blot, immunoprecipitation and immunofluorescence. In vitro techniques for detection of PA genomic DNA include Southern hybridizations. In addition, in vivo techniques for detection of PA proteins include
Including the introduction of labeled anti-PA antibody into the patient. For example, the antibody can be labeled with a radioactive marker whose presence and location can be detected by standard imaging techniques.

In one embodiment, the biological sample contains protein molecules from the test patient. Alternatively, the biological sample can include mRNA molecules from the test patient or genomic DNA from the test patient. In another embodiment, the method obtains a control biological sample from a control patient and uses the control sample as a PA protein, mRNA, or genomic DN.
A is contacted with a detectable compound or reagent to detect the presence of PA protein, mRNA or genomic DNA in a biological sample and to detect the presence of PA protein, mRNA or genomic DNA in a control sample It further comprises comparing to the presence of PA protein, mRNA, or genomic DNA in the.

PA Polypeptide Variants In addition to the full-length native sequence PA polypeptides described herein, PA variants could also be prepared. PA variants can be prepared by introducing appropriate nucleotide changes into PA DNA, or by synthesizing the desired PA polypeptide. One of ordinary skill in the art will appreciate that amino acid changes, such as changes in the number or position of glycosylation sites or changes in membrane anchoring properties, can alter post-translational processes of PA polypeptides. Mutations in the native full-length sequence PA or in various domains of the PA polypeptides described herein are made using any technique and guideline for conservative and non-conservative mutations described, for example, in US Pat. No. 5,364,934. be able to. The mutation may be a substitution, deletion or insertion of one or more codons encoding PA that result in a change in the amino acid sequence of PA relative to the native sequence PA. In some cases, the mutation is the replacement of at least one amino acid with any other amino acid in one or more domains of the PA polypeptide. A guideline for which amino acid residues are inserted, substituted or deleted without adversely affecting the desired activity is to compare the sequence of the PA polypeptide with that of a known homologous protein molecule, It is found by minimizing the number of amino acid sequence changes made in the high regions. Amino acid substitutions can be the result of the replacement of one amino acid with another amino acid that has similar structural and / or chemical properties, eg, replacement of leucine with serine. Insertions and deletions can optionally be in the range of about 1 to 5 amino acids. Permissible mutations are determined by systematically making amino acid insertions, deletions or substitutions in the sequence and testing the resulting variants for the activity exhibited by the full-length or mature native sequence.

PA fragments can be prepared by any of many conventional methods.
The desired peptide fragment may be chemically synthesized. Another approach is to treat the fragment by enzymatic digestion, for example by treating the protein with an enzyme known to cleave the protein at a site defined by a particular amino acid residue, or by digesting the DNA with an appropriate restriction enzyme. And producing a PA fragment by isolating the desired fragment. Yet another suitable technique involves isolating and amplifying a DNA fragment encoding the desired polypeptide fragment by polymerase chain reaction (PCR). Oligonucleotides that define the desired ends of the DNA fragments are used as 5'and 3'primers in PCR. Preferably, the PA polypeptide fragment shares at least one biological and / or immunological activity with the native PA polypeptide. In particular embodiments, conservative substitutions of interest are shown in Table 3 under the heading of preferred substitutions. If such a substitution results in a change in biological activity, it is named in Table 3 as an exemplary substitution, or as further described below with reference to the amino acid taxonomy,
Greater changes are introduced and the product screened for activity.

Substantial modification of the function and immunological identity of a polypeptide can be accomplished by (a) the structure of the polypeptide backbone of the substitution region, eg, a sheet or helical arrangement, (b) the charge or hydrophobicity of the target site, or (C) It is achieved by selecting substituents that differ significantly in their effect, while maintaining the bulk of the side chains. Naturally occurring residues are divided into groups based on common side chain properties: (1) Hydrophobicity: norleucine, met, ala,
val, leu, ile; (2) Neutral hydrophilicity: cys, ser, thr; (3) Acidity: asp, glu;
(4) Basicity: asn, gln, his, lys, arg; (5) Residues affecting chain orientation: gly,
pro; and (6) aromatic: trp, tyr, phe. Non-conservative substitutions will entail exchanging a member of one of these classes for another class. Residues so substituted can also be introduced at conservative substitution sites, more preferably at remaining (non-conserved) sites.

Mutations can be made using techniques known in the art such as oligonucleotide-mediated (site-directed) mutagenesis, alanine scanning, and PCR mutagenesis. Site-directed mutagenesis (Carter et al., Nucl. Acids Res.
, 13: 4331 (1986); Zoller et al., Nucl. Acids Res., 10: 6487 (1987)), cassette mutagenesis (Wells et al., Gene, 34: 315 (1985)), restriction selective mutagenesis. (See Wells et al., Philos. Trans. R. Soc. London SerA, 317: 415 (1986)) or other well known techniques can be performed on cloned DNA to produce PA mutant DNA. Also, scanning amino acid analysis can be used to identify one or more amino acids along a flanking sequence. The preferred scanning amino acids are relatively small, neutral amino acids. Such amino acids include alanine, glycine,
Contains serine and cysteine. Alanine is a typically preferred scanning amino acid in this group because it excludes side chains above the beta carbon and does not alter the backbone structure of the mutant (Cunningham and Wells, Science, 244: 1081-1085). (19
89)). Also, alanine is typically preferred because it is the most common amino acid. Moreover, it is often found in both buried and exposed locations (Creighton, The Proteins, (WH Freeman & Co., NY); Chothia, J. Mol.
Biol., 150: 1 (1976)). However, if alanine substitution does not yield sufficient amounts of variant, isoteric amino acids can be used.

Modifications of PA Polypeptides Covalent modifications of PA are included within the scope of this invention. One type of covalent modification involves modifying the targeted amino acid residue of a PA polypeptide with a selected side chain or N of PA.
-Or by reacting with an organic derivatizing reagent capable of reacting with the C-terminal residue. Derivatization with a bifunctional reagent allows, for example, the addition of PA to a water-insoluble support matrix or anti-
It is useful for cross-linking surfaces for use in purifying PA antibodies or vice versa. Commonly used cross-linking agents are, for example, 1,1-bis (diazoacetyl) -2-phenylethane, glutaraldehyde, N-hydroxysuccinimide ester such as 4-azidosalicylic acid, 3,3′-dithiobis (succinimidyl). (Propionate)
Homobifunctional imide esters including disuccinimidyl esters such as bis-N-
Includes bifunctional maleimides such as maleimide-1,8-octane, and reagents such as methyl-3-[(p-azidophenyl) -dithio] propioimidate. Other modifications include deamination of glutaminyl and asparaginyl residues to the corresponding glutamyl and aspartyl residues, hydroxylation of proline and lysine,
Phosphorylation of hydroxyl group of ceryl or threonyl residue, lysine, arginine,
And methylation of α-amino group of histidine side chain (TE Creighton, Proteins: Str
ucture and Molecular Properties, WH Freeman & Co., San Francisco, pp.7
9-86 (1983)), acetylation of N-terminal amines, and amidation of optional C-terminal carboxyl groups.

Another type of covalent modification of the PA polypeptide included within the scope of this invention comprises altering the native glycosylation pattern of the polypeptide. By "altering the native glycosylation pattern" is intended for this purpose the deletion of one or more carbohydrate moieties found in native sequence PA polypeptides (glycosides present by chemical and / or enzymatic means). (Either by removal of glycosylation sites or deletion of glycosylation) and / or addition of one or more glycosylation sites not present in the native sequence PA. In addition, this phrase encompasses qualitative changes in glycosylation of native proteins, including changes in the nature and properties of the various carbohydrates present. Addition of glycosylation sites to the PA polypeptide may be accompanied by changes in the amino acid sequence. This modification may be made, for example, by the addition or substitution of one or more serine or threonine residues to the native sequence PA (O-linked glycosylation site). The PA amino acid sequence is optionally modified through changes at the DNA level, particularly by mutating the DNA encoding the PA polypeptide at preselected bases to produce codons that are translated into the desired amino acids. Good.

Another means of increasing the number of carbohydrate moieties on the PA polypeptide is by chemical or enzymatic coupling of glycosides to the polypeptide. Such a method is disclosed in this technical field, for example, in WO 87/05330 published on September 11, 1987, and Aplin and Wriston, CRC Crit. Rev. Biochem., Pp. 259-306 (1981). Have been described. Removal of carbohydrate moieties present on the PA polypeptide may be accomplished chemically or enzymatically
Alternatively, it can be done by mutational substitution of the codons encoding the amino acid residues presented as targets for glycosylation. Chemical deglycosylation techniques are known in the art, for example Hakimuddin et al., Arch. Biochem. Biophys., 259: 52.
(1987) and by Edge et al., Anal. Biochem., 118: 131 (1981). Enzymatic cleavage of carbohydrate moieties on polypeptides is described by Thotakura et al., Meth. E.
This is accomplished by using various endo and exoglycosidases, as described in nzymol. 138: 350 (1987). Another type of covalent modification of PA is US Pat. No. 4,640,835 to PA polypeptides to one of a variety of non-proteinaceous polymers such as polyethylene glycol (PEG), polypropylene glycol, or polyoxyalkylenes; Fourth 4,496
, 689; No. 4,301,144; No. 4,670,417; No. 4,791,192 or No. 4,179,337.

The PA of the present invention may also be a P fused to another heterologous polypeptide or amino acid sequence.
It may be modified by a method of forming a chimeric molecule containing A. In one embodiment, such a chimeric molecule comprises a fusion of PA with a tag polypeptide that provides an epitope to which an anti-tag antibody can selectively bind. The epitope tag is generally located at the amino- or carboxyl-terminus of PA. Such P
The presence of the epitope-tagged form of A can be detected using an antibody against the tag polypeptide. Also, provision of the epitope tag allows the PA to be readily purified by affinity purification using an anti-tag antibody or another type of affinity matrix that binds to the epitope tag. Various tag polypeptides and their respective antibodies are well known in the art. An example is poly-hisidine
Or poly-histidine-glycine (poly-his-gly) tag; flu HA tag polypeptide and its antibody 12CA5 (Field et al., Mol. Cell. Biol., 8: 2159-2165 (1988)); c
-myc tag and its corresponding 8F9, 3C7, 6E10, G4, B7 and 9E10
Antibody (Evan et al., Molecular and Cellular Biology, 5: 3610-3616 (1985)); and herpes simplex virus glycoprotein D (gD) tag and its antibody (Paborsky et al., Prot.
ein Engineering, 3 (6): 547-553 (1990)). Other tag polypeptides include flag peptides (Hopp et al., BioTechnology, 6: 1204-1210 (1988)); KT3 epitope peptides (Martin et al., Science, 255: 192-194 (1992)); α-tubulin epitope peptides. (Skinner et al., J. Biol. Chem., 266: 15163-15166 (1991))
And T7 gene 10 protein peptide tag (Lutz-Freyermuth et al., Proc. Nat
l. Acad. Sci. USA, 87: 6393-6397 (1990)).

In another embodiment, the chimeric molecule may comprise a fusion of a PA polypeptide with an immunoglobulin or a particular region of an immunoglobulin. For the bivalent form of the chimeric molecule (also called the "immunoadhesin"), such a fusion may be the Fc region of an IgG molecule. The Ig fusion is preferably a soluble (transmembrane domain deleted or inactivated) PA polypeptide in place of at least one variable region within the Ig molecule.
Including morphology. In a particularly preferred embodiment, the immunoglobulin fusion comprises the hinge, CH2 and CH3, or hinge, CH1, CH2 and CH3 regions of an IgG1 molecule. See US Pat. No. 5,428,130 issued Jun. 27, 1995 for the preparation of immunoglobulin fusions. In another embodiment, the chimeric molecule comprises a fusion of PA and a signal peptide,
It enables or enhances the secretion of the PA peptide or alters its localization within the host cell. The signal sequence is generally located at the amino- or carboxy-terminus of PA, and more usually at the N-terminus when secretion or membrane localization is desired. Such fusions are typically intermediate products since the signal peptide is usually specifically cleaved by the host cell enzyme. The provision of the signal peptide allows PA to be readily purified following its secretion into the cell medium. Various signal peptides that enable intracellular secretion or compartmental targeting are well known in the art and are available for use in many host cells, including yeast and mammalian cells.

Detection of Gene Amplification / Expression Gene amplification and / or expression can be performed based on the sequences provided herein, using appropriately labeled probes, eg, conventional Southern blotting, quantifying mRNA transcription. Northern blotting method (Thomas, Proc. Natl. Acad. Sci. USA, 77:52)
01-5205 (1980)), the dot blot method (DNA analysis), or the in situ hybridization method, and can be directly measured in a sample. Alternatively,
DNA double strand, RNA double strand and DNA-RNA hybrid double strand or DNA-
An antibody capable of recognizing a specific double chain including a protein double chain can also be used. The antibody can then be labeled and the assay performed, wherein the duplex is surface bound, such that the antibody bound to the duplex at the time of surface duplex formation. Presence can be detected. Alternatively, gene expression can also be measured by immunological methods that directly quantitate the expression of the gene product, such as immunohistochemical staining of cells or tissue sections and cell culture or body fluid assays. Antibodies useful for immunohistochemical staining and / or assay of sample fluids may be monoclonal or polyclonal and can be prepared in any mammal. Conveniently, the antibody is fused to a native sequence PA polypeptide, or to a synthetic peptide based on the DNA sequences provided herein, or fused to DNA encoding PA to encode a specific antibody epitope. It can be prepared for exogenous sequences.

Purification of Polypeptides Forms of PA can be recovered from culture medium or lysates of host cells. If membrane-bound, it can be detached from the membrane using a suitable wash (eg Triton-X100) or enzymatic cleavage. The cells used to express the nucleic acid encoding the PA polypeptide can be disrupted by various chemical or physical means such as freeze-thaw cycling, sonication, mechanical disruption, or cytolytic agents. It may be desirable to purify PA polypeptide from recombinant cell proteins or polypeptides. Purified by the following procedure, which is an example of a suitable purification procedure:
Fractionation on an ion exchange column; ethanol precipitation; reverse phase HPLC; chromatography on silica or cation exchange resins such as DEAE; chromatofocusing; SDS-PAGE; ammonium sulfate precipitation; gel filtration using eg Sephadex G-75; A protein A sepharose column to remove such contaminants; and a metal chelation column that binds the epitope-tagged forms of PA polypeptides. Known in the art, eg Deutscher, Methods in Enzymology, 18
2 (1990) ； Scopes, Protein Purification: Principles and Practice, (Spring
Many protein purification methods described in er-Verlag, New York 1982) can be used. The purification process chosen will depend, for example, on the production method used and in particular the nature of the particular PA polypeptide produced.

Uses of PA Polypeptides When the coding sequence of a PA polypeptide encodes a protein that binds to another protein, the PA polypeptide is used to identify other proteins or molecules involved in a binding interaction. It can be used in an assay. By such a method, an inhibitor of binding interaction can be identified. Proteins involved in such binding interactions can also be used to screen for peptides or small molecule inhibitors or agonists of binding interactions. The receptor PA can also be used to isolate related ligands. Screening assays are designed for the discovery of lead compounds that mimic the biological activity of native PA or the receptor for PA. Such screening assays are also used in high throughput screening of chemical libraries, making them particularly suitable for identifying small molecule drug candidates. Small molecules considered include synthetic organic or inorganic compounds. The assays are performed in a variety of formats, including protein-protein binding assays, biological screening assays, immunoassays and cell-based assays that are well known and characterized in the art. Such high- and ultra-high-throughput assays can also be used to identify test antisense molecules.

Nucleic acids encoding PA polypeptides or modified forms thereof can also be used to produce transgenic or “knockout” animals, which are useful in the development and screening of therapeutically useful reagents. is there. Transgenic animals (
A mouse or rat) is an animal having cells containing the transgene introduced prenatally, eg at the embryonic stage, into the animal or its ancestors. A transgene is a DNA that has integrated into the genome of a cell in which a transgenic animal develops. In one embodiment, the cDNA encoding the PA of interest can be used to clone the genomic DNA encoding the PA by established techniques, wherein the genomic sequence expresses the DNA encoding the PA. It can be used to produce transgenic animals with cells. Methods for producing transgenic animals, especially certain animals such as mice or rats, are routine in the art and are described, for example, in US Pat. Nos. 4,736,866 and 4,870,009. Typically, particular cells are targeted for introduction of the PA transgene with tissue-specific enhancers. A transgenic animal containing a copy of a PA-encoding transgene introduced into the germ line of an animal at the embryonic stage is a DNA encoding a PA polypeptide.
Can be used to investigate the effects of increased expression of. Such animals can be used, for example, as tester animals for reagents that would provide protection against pathological conditions associated with their overexpression. In this aspect of the invention, treatment of an animal with a reagent and a lower incidence of the pathological condition as compared to untreated animals carrying the transgene indicates a potential therapeutic treatment for the pathological condition. .

Alternatively, the non-human homologue of the PA gene is a homologous association between a modified genomic DNA encoding a PA polypeptide introduced into an embryonic cell of an animal and an endogenous gene encoding a PA polypeptide. Alternatively, it can be used to create PA gene "knockout" animals that have defective or altered genes that encode PA polypeptides. For example, a cDNA encoding a PA polypeptide can be used to clone genomic DNA encoding PA according to established techniques. A portion of the genomic DNA encoding PA can be deleted or replaced with another gene, such as the gene encoding a selectable marker used to monitor integration.
Vectors typically contain unchanged flanking DNA (both at the 5'and 3'ends) for several kilobases (eg, Thomas and Capecc for homologous recombination vectors).
hi, Cell, 51: 503 (1987)). The vector is introduced into embryonic stem cells (eg, by electroporation), and cells in which the introduced DNA is homologously recombined with the endogenous DNA are selected (eg, Li et al., Cell, 69: 915 (1992). )reference)
. The selected cells are then injected into the blastocyst of an animal (eg, mouse or rat) to form an assembled chimera (eg, Bradley, Teratocarcinomas and Embryonic St
em Cells: A Practical Approach, EJ Robertson, ed. (IRL, Oxford, 1987)
, pp. 113-152). The chimeric embryos are then transplanted into a suitable pseudopregnant female nanny and at intervals, "knockout" animals are created. Offspring with DNA that has been homologously recombined into germ cells are identified by standard techniques and can be used to breed animals in which all cells of the animal contain homologously recombined DNA. .
Knockout animals are characterized by their ability to protect against certain pathological conditions and the progression of those pathological conditions, eg, due to the absence of PA polypeptides.

Assays for Angiogenic Activity Various assays can be used to test the angiogenic activity of the polypeptides described herein. Such assays include those provided in the Examples below. Assays for tissue-generating activity include, but are not limited to, those described in WO95 / 16035 (bone, cartilage, tendon); WO95 / 05846 (nerve, neuron) and WO91 / 07491 (skin, endothelium). Is included. Wound healing activity assays are described, for example, by Eaglelstein and Mertz, J. Invest. Der.
Matol., 71: 382-384 (1978), modified by Winter, Epidermal Wound.
Healing, Maibach, HI and Rovee, DT, edited (Year Book Medical Publishers. Inc.
., Chicago), pp71-112 are included.

Cell-Based Assays Cell-based assays and animal models for angiogenic disorders such as tumors include:
Here, the findings of the angiogenesis assay can be substantiated and further used to understand the relationship between the genes identified here and the progression and pathogenesis of unwanted angiogenic cell growth. The role of the gene products identified herein in the progression and pathogenesis of undesired angiogenic cells (eg endothelial cells, tumor cells) has been identified as stimulated or inhibited by PA polypeptides, or agonists or antagonists thereof. It can be tested using cells or cell lines. Such cells include, for example, those shown in the following examples. In a different approach, cells of cell types known to be involved in a particular angiogenic activity or disorder are transfected with the cDNAs thereof, which cDNAs induce excessive growth or induce growth. Analyze ability to inhibit. When the angiogenic disorder is cancer, suitable tumor cells include, for example, stable tumor cell lines such as B104-
Included are 1-1 cell lines (stable NIH-3T3 cell line transfected with neu proto-oncogene) and ras-transfected NIH-3T3 cells, which are capable of transfecting the desired gene and forming tumors. Growth can be monitored. Then, using such transfected cell lines, poly- or monoclonal antibodies or antibody compositions are
The ability to inhibit tumorigenic cell growth by exerting cytostatic or cytotoxic activity on the growth of transfected cells or by mediating antibody-dependent cellular cytotoxicity (ADCC) is tested. In addition, cells transfected with the coding sequences of the genes identified herein can be used to identify candidate drugs for the treatment of angiogenic disorders, such as cancer.

In another assay, human umbilical cord endothelial cells (HUVECS) undergoing tube formation in collagen gels in the presence of growth factors mimic the angiogenic environment of endothelium in vivo under normal and tumorigenic conditions. Provides a well tolerated system for angiogenesis and angiogenesis in both. H grown on the surface of gelatin gel or plastic
Since UVECS does not undergo tube formation, three-dimensional gels are a prerequisite for endothelial cell tube differentiation and fusion. HUVECS induces tube formation either on gelatin or collagen membranes (non-inducing) or in collagen gels (inducing) with or without the addition of growth factors that stimulate normal angiogenic or tumor-inducing factors. It can grow under a variety of conditions, including inducible or non-inducible. HUVEC cells are described in c
It can be transfected with DNA (or their antisense) and the ability of these nucleic acids to induce overgrowth or tube formation or to inhibit growth or tube formation is analyzed. HUVEC cells expressing the coding sequences of the genes identified herein can be further used to identify candidate agents. In addition, the primary medium (described above) obtained from tumors of transgenic animals is
Although stable cells lines can be used in the cell-based assays herein, stable cell lines are preferred. Techniques for deriving certain cell lines from transgenic animals are well known in the art. For example, Small et al., Mol. Cell. Biol., 5: 642-648 (1985
).

For cancer, further understanding of the role of the genes identified herein in the pathogenesis and progression of tumors, and of therapeutic candidates including antibodies and other antagonists of native PA polypeptides, such as small molecule antagonists. A variety of well known animal models can be used to test efficacy. The in vivo nature of such models makes human patients particularly prognostic in their response. Animal models of tumors and cancers (breast cancer, colon cancer, prostate cancer, lung cancer, etc.) include non-recombinant and recombinant (transgenic) animals. Non-recombinant animal models include, for example, rodent, eg mouse models. Such models are standard techniques such as subcutaneous injection, tail vein injection, spleen transplantation, peritoneal transplantation, subrenal capsule transplantation, or orthopin.
It can be prepared by using colon cancer cells transplanted, for example, colon cancer tissue, and transferring tumor cells to syngeneic mice. See, for example, PCT Publication No. WO97 / 33551 published September 18, 1997. Probably the most frequently used animal species for oncogene studies are immunodeficient mice, especially nude mice. The finding that nude mice with thymus stimulation / dysplasia successfully act as hosts for human tumor xenografts has led to their widespread use for this purpose. Autosomal recessive nu
The genes include, for example, ASW, A / He, AKR, BALB / c, B10. LP,
C17, C3H, C57BL, C57, CBA, DBA, DDD, I / st, N
It has been introduced into a large number of clearly homologous nude mice, including C, NFR, NFS, NFS / N, NZB, NZC, NZW, P, RIII and SJL. further,
In addition to nude mice, a wide range of other animals that have inherited immunological deficiencies are raised and used as recipients of tumor xenografts. For more details, see The Nude Mou, for example.
se in Oncology Research, E. Boven and B. Winograd. eds. (CRC Press, Inc.,
1991).

Cells introduced into such animals are well-known tumor / cancer cells, eg, any of the tumor cell lines listed above, eg, the B104-1-1 cell line (transfected with the neu proto-oncogene). Stable NIH-3T3 cell line); ras-transfected NIH-3T3 cells;
Caco-2 (ATCC HTB-37); or a moderately differentiated grade II human colon adenocarcinoma cell line, HT-29 (ATCC HTB-38), or from tumors and cancers can be induced. Tumor or cancer cell samples are used in standard conditions, including freezing and storage in liquid nitrogen, and can be obtained from patients by surgery. Ka
rmali et al., Br. J. Cancer. 48: 689-696 (1983). Tumor cells can be introduced into animals such as nude mice by various procedures.
The subcutaneous (sc) space of mice is very suitable for tumor implantation. Tumors can also be transplanted as solid blocks with needle biopsies, eg by use of trochars, or cell suspensions. Tumor tissue fragments of suitable size for solid block or trocar implantation are introduced into the subcutaneous space. Cell suspensions are prepared fresh from primary tumor or stable tumor cell lines and injected subcutaneously. Tumor cells can also be injected as a subcutaneous implant. In this position, the implant is applied between the bottom of the dermal connective tissue and the subcutaneous tissue.

Animal models of breast cancer are described by Drebin et al., Proc. Nat. Acad. Sci. USA, 83: 9129-913.
3 (1986), e.g., rat neuroblast cells (ne
u oncogene) or neu-transformed NIH-3T3 cells into nude mice. Similarly, an animal model of colon cancer can be prepared by allowing colon cancer cells to pass through an animal, for example, a nude mouse, to cause a tumor to appear in these animals.
Orthotopic transplant models of human colon cancer in nude mice are described, for example, in Wang et al., Cancer R
esearch, 54: 4726-4728 (1994) and Too et al., Cancer Research, 55: 681-684 (1995).
). This model is based on AntiCancer, Inc., (San Diego, Californi
It is based on the so-called "METAMOUSE (registered trademark)" sold by a).

Tumors generated in animals can be removed and cultured in vitro. The cells from the in vitro culture are then passed to the animal. Such tumors may be for further testing or drug screening. Alternatively, the tumors obtained by passage can be isolated and RNA of pre-passage cells and cells isolated after one or more passage steps analyzed for differential expression of the gene of interest. To be done. Such passaging techniques can be performed on any well known tumor or cancer cell line. For example, Meth A, CMS4, CMS5, CMS21 and WEHI-164.
Is a highly regulated model to chemically induce fibrosarcoma in BALB / c female mice (DeLeo et al., J. Exp. Med., 146: 720 (1977)) and study the antitumor activity of various drugs. Provide the system. Palladino et al., J. Immunol., 138: 4023-4032 (1987). Briefly, tumor cells are grown in vitro in cell culture. The cell lines are washed and suspended in buffer at a cell density of 10x10 6 to 10x10 7 cells / ml before injecting the animals. The animals are then injected subcutaneously with 10 to 100 μl of cell suspension, with tumors appearing in 1 to 3 weeks.

Furthermore, one of the most thoroughly studied trial tumors, the mouse Lewis lung
The (3LL) carcinoma can be used as a tumor model for research. The efficacy of this tumor model correlates with a favorable effect in treating human patients diagnosed with small cell carcinoma of the lung (SCCL). This tumor can be introduced into normal mice by injecting tumor fragments from diseased mice or cells in culture. Zupi et al., Br. J. Cancer, 41: suppl. 4. 30 (1980). Evidence showed that tumors started with single cell injections and that a fairly high proportion of infected tumor cells survived. For more information on this tumor model, see Zacharski, Haemostasis,
16: 300-320 (1986).

One method of assessing the efficacy of test compounds in animal models with transplanted tumors is to measure tumor size before or after treatment. Traditionally, the size of transplanted tumors is measured with two or three dimensional calipers. Measurements limited to two dimensions do not accurately reflect tumor size; thus, mathematical formulas are usually used and converted to the corresponding quantities.
However, tumor size measurements are very inaccurate. The therapeutic effect of a candidate drug can be described as better if the treatment-induced growth is delayed and the specific growth is delayed. Another important variable in the description of tumor growth is the time to double tumor burden. Also, computer programs for calculating and describing tumor growth, such as Ry.
gaard and Spang-Thomsen, Proc. 6th Int. Workshop on Immune-Deficient Anim
The program reported by als. Wu and Sheng. eds. (Basel. 1989), p. 301 is available. However, it should be noted that post-treatment necrosis and inflammatory response may actually result in increased tumor size, at least initially. Therefore,
These changes need to be carefully monitored by a combination of morphometry and flow cytometric analysis.

In addition, recombinant (transgenic) animal models use standard techniques for introducing the coding sites for the PA genes identified herein into the genome of an animal of interest to create transgenic animals. Can be operated using. Animals that can be provided as targets for transgenic manipulation include, but are not limited to, mice, rats, rabbits, guinea pigs, sheep, goats, pigs, and non-human primates,
Examples include baboons, chimpanzees and monkeys. Techniques well known in the art for introducing transgenes into such animals include pronuclear microinjection (US Pat. No. 4,873,191); retrovirus-mediated gene transfer into the embryo (eg, Van der P
Utten et al., Proc. Nat. Acad. Sci. USA, 82: 6148-615 (1985)); targeting genes in embryonic stem cells (Thompson et al., Cell, 56: 312-321 (1989)); embryo electroporation. (Lo, Mol. Cell. Biol., 3: 1803-1814 (1983)); and sperm-mediated gene transfer. Lavitrano et al., Cell, 57: 717-73 (1989). See, eg, US Pat. No. 4,736,866 for a review.

For the purposes of the present invention, transgenic animals include those carrying the transgene in only some of their cells (“mosaic animals”). The transgenes can be integrated as a single transgene or as a concatamer, eg, head-to-head or head-to-tail tandem. Also, selective introduction of the transgene into a particular cell line is described, for example, in Lasko et al., Proc.
Nat. Acad. Sci. USA, 89: 6232-636 (1992). Expression of the transgene in transgenic animals can be monitored by conventional techniques. For example, Southern blot analysis or PCR amplification can be used to verify transgene integration. The expression level of mRNA can then be analyzed using techniques such as in situ hybridization, Northern blot analysis, PCR or immunocytochemistry. Animals are further tested for signs of tumor or cancer progression.

Alternatively, PA identified herein by homologous recombination between the altered genomic DNA encoding the PA polypeptide introduced into the embryonic cell of an animal and the endogenous gene encoding the PA polypeptide. "Knockout" animals can be constructed that have defective or altered genes that encode the polypeptides. For example, a specific PA
The cDNA encoding the polypeptide can be used to clone genomic DNA encoding the polypeptide according to established techniques. A portion of the genomic DNA encoding a particular PA polypeptide can be deleted or replaced with another gene, such as the gene encoding a selectable marker used to monitor integration. Vectors typically contain constant flanking DNA (both at the 5'and 3'ends) for several kilobases. See, for example, Thomas and Capecchi, Cell, 51: 503 (1987) for homologous recombination vectors. The vector is introduced into embryonic stem cells (eg, by electroporation), and the introduced DNA is endogenous DNA.
Cells that have been homologously recombined with are selected. For example, Li et al., Cell, 69: 915 (1992).
reference. The selected cells are then injected into the blastocyst of an animal (eg mouse or rat) to form an assembled chimera. For example, Bradley, Teratocarcinomas and Embryoni
c Stem Cells: A Practical Approach, EJ Robertson, ed. (IRL, Oxford, 1
987), pp. 113-152. The chimeric embryos are then transplanted into a suitable pseudopregnant female nanny and at intervals, "knockout" animals are created. Offspring with DNA that has been homologously recombined into germ cells are identified by standard techniques and can be used to breed animals in which all cells of the animal contain homologously recombined DNA. . Knockout animals are characterized by the absence of PA polypeptides (knockouts) and their ability to protect against certain pathological conditions and the progression of those pathological conditions.

The effects of antibodies that specifically bind to the PA polypeptides identified herein, and other drug candidates, can be further tested in the treatment of spontaneous animal tumors. A suitable target for this study is feline oral squamous cell carcinoma (SCC). Feline oral SCC is highly invasive, and this malignant tumor is considered to be the most common oral malignant tumor in cats, and it has been measured that 60% or more of oral tumors are repeated in this species. Although it rarely metastasizes to distant sites, the low incidence of metastases is reflected in the short survival of cats bearing this tumor. These tumors
Due mainly to the anatomy of the cat's oral cavity, it cannot usually be treated by surgery. Currently, there is no effective treatment for this tumor. Prior to entry into the study, each cat is biopsied for a complete clinical trial and scanned by computed tomography (CT). Cats diagnosed with squamous cell tumors of the sublingual mouth are excluded from this study. The tongue is paralyzed as a result of such tumors, and the animals are unable to feed themselves when the tumor dies from treatment. Each cat is treated repeatedly over a long period of time. Tumors will be photographed daily and then rechecked during the treatment period. After treatment, each cat is subjected to another CT scan. CT scans and chest radiographs are evaluated every 8 weeks thereafter. The data were evaluated as different in viability, reactivity and toxicity from the control group. Positive reactions require evidence of tumor regression, preferably with improved quality of life and / or increased lifespan.

In addition, spontaneous animal tumors of dogs, cats and baboons, such as fibrosarcoma, adenocarcinoma, lymphoma, chondroma, or leiomyosarcoma can also be tested. Of course, canine and feline mammary adenocarcinomas are a preferred model, and their appearance and properties are very similar to those of humans. However, the use of this model is limited by the rare occurrence of this type of tumor in animals. Also other in vitro and in vivo angiogenesis tests well known in the art are suitable here. Accordingly, the PA polypeptides described herein can be used as therapeutic agents. The PA polypeptides of the present invention can be formulated according to known methods to prepare pharmaceutically useful compositions, in which case the PA products herein are combined with a pharmaceutically acceptable carrier medium. Mix with. Therapeutic compositions include any pharmaceutically acceptable carrier, excipient, or stabilizer of the desired PA polypeptide of suitable purity (Remington's Pharmaceutical Sciences, 16th edition, Osol, A. Ed., ( 1980)
) With a lyophilized formulation or in the form of an aqueous solution. Acceptable carriers, excipients, or stabilizers are preferably non-toxic to recipients at the dosages and concentrations employed and are buffers such as phosphates, citrates, and other organic acids; Antioxidants containing ascorbic acid; low molecular weight (less than about 10 residues) polypeptides; proteins such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; glycine, glutamine, asparagine, histidine, arginine, or Amino acids such as lysine; monosaccharides, disaccharides and other carbohydrates containing glucose, mannose or dextran; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose or sorbitol;
A salt forming counterion such as sodium; and / or a nonionic surfactant such as TWEEN (trade name), PLURONICS (trade name) or polyethylene glycol (PEG).

The formulations used for in vivo administration must be sterile. This is easily accomplished by filtration through a sterile filter membrane prior to subsequent lyophilization and reconstitution. Here, the therapeutic composition is generally placed in a container having a sterile access port, such as an intravenous bag or vial having a stopper pierceable by a hypodermic injection needle. The route of administration is according to known methods, for example, intravenous, intraperitoneal, intracerebral, intramuscular, intraocular, intraarticular or intralesional route, injection or infusion for local administration, or sustained release system. The dosage and desired drug concentration of the pharmaceutical compositions of the present invention will vary depending on the particular intended use. Determination of the proper dosage or route of administration is within the skill of the ordinary physician. Animal studies provide reliable guidance on the determination of effective doses for human therapy. Toxicokinetics and New Dru
g Development, Yacobi et al., ed., Pergamon Press, New York 1989, pp. 42-96, M.
ordenti, J. and Chappell, W. `` The use of interspecies scaling in toxi
It can be carried out according to the principle described in "cokinetics".

When in vivo administration of a PA polypeptide or agonist or antagonist thereof is used, a normal dosage is from about 10 ng / kg to 100 mg / kg of body weight per day of the mammal, depending on the route of administration. Is about 1 μg / kg / day to 10 mg / kg / day. Guidance on specific doses and delivery methods is given in the literature; eg, US Pat. Nos. 4,657,760, 5,206,344, or 5,225,212.
See issue. It is expected that different formulations will be effective for different therapeutic compounds and different diseases, for example, targeting administration to one organ or tissue may require delivery in a different manner than other organs or tissues. To be done. Micro-encapsulation of PA polypeptide is contemplated when sustained release of PA polypeptide is desired in a formulation with release properties suitable for the treatment of any disease or disorder that requires administration of PA polypeptide. Microencapsulation of recombinant proteins for sustained release includes human growth hormone (rhGH), interferon (rhI).
FN-), interleukin-2, and MNrgp120 have been successfully implemented. Johnson et al., Nat. Med., 2: 795-799 (1996); Yasuda, Biomed. Ther., 27:
1221-1223 (1993); Hora et al., Bio / Technology, 8: 755-758 (1990); Cleland, ``
Design and Production of Single Immunization Vaccines Using Polylactide
Polyglycolide Microsphere Systems '' Vaccine Design: The Subunit and Adjuv
ant Approach, Powell and Newman, (Plenum Press: New York, 1995), p. 4
39-462; WO 97/03692, WO 96/40072, WO 96/07399; and US Pat. No. 5,654,010.

Sustained release formulations of these proteins include poly-lactic-coglycolic acid (PLGA)
Developed with polymers, based on their biocompatibility and wide range of biodegradable properties. The degradation products of PLGA, lactic acid and glycolic acid, are immediately cleared within the human body. Furthermore, the degradability of this polymer can be adjusted from months to years depending on the molecular weight and composition. Lewis, `` Controlled release of bioactive agent
s from lactide / glycolide polymer '': M. Chasin and R. Langer (ed.), Biodeg
radable Polymers as Drug Delivery Systems (Marcel Dekker: New York, 1990
), pp. 1-41. The invention also includes methods of screening compounds to identify those that mimic PA polypeptides (agonists) or inhibit the effects of PA polypeptides (antagonists). Screening assays for antagonist drug candidates include compounds that bind or complex with the PA polypeptides encoded by the genes identified herein, or other compounds that inhibit the interaction of the encoded polypeptides with other cellular proteins. Designed to identify. Such a screening assay is
It includes assays applicable to high-throughput screening of chemical libraries, making it particularly suitable for identifying small molecule drug candidates.

This assay is performed in a variety of formats, including protein-protein binding assays, biochemical screening assays, immunoassays, and cell-based assays, which are well characterized in the art. In certain embodiments, all assays for antagonists include PA polypeptides encoded by the nucleic acid identified herein as a candidate drug and these 2
They are common in that they require contact under conditions and for a time sufficient for the two components to interact. In the binding assay, the interaction is binding and the complex formed is isolated or detected in the reaction mixture. In a particular embodiment, the PA polypeptide encoded by the gene identified herein or the drug candidate is covalently or non-covalently immobilized to a solid phase, eg, a microtiter plate. Non-covalent attachment generally is accomplished by coating the solid surface with a solution of PA polypeptide and drying. Alternatively, an immobilized antibody specific for the PA polypeptide to be immobilized, eg a monoclonal antibody, can be used to anchor it to a solid surface. The assay is performed by adding the non-immobilized component, which may be labeled with a detectable label, to the immobilized component, eg, the coated surface containing the anchored component. When the reaction is complete, unreacted components are removed, for example by washing, and the complex adhered to the solid surface is detected. When the first non-immobilized component carries a detectable label, detection of the label immobilized on the surface indicates that complex formation has occurred. If the first non-immobilized component has no label, complex formation can be detected, for example, by using a labeled antibody that specifically binds to the immobilized complex.

Specific PAs with which the candidate compound interacts but is encoded by the gene identified here
If it does not bind to the polypeptide, its interaction with the polypeptide is
It can be assayed by well known methods for detecting protein interactions. Such assays include traditional techniques such as cross-linking, co-immunoprecipitation, and co-purification through gradients or chromatographic columns. In addition, protein-protein interactions are described by Chevray and Nathans, Proc. Natl. Acad. Sci. USA 8
9, 5789-5793 (1991), as described in Fields and collaborators (Fi
elds and Song, Nature (London) 340, 245-246 (1989); Chien et al., Proc. Natl. A
It can be monitored by using the yeast-based gene system described in cad. Sci. USA 88, 9578-9582 (1991)). Many transcriptional activators, such as yeast GAL4, consist of two physically distinct modular domains, one acting as a DNA binding domain and the other functioning as a transcriptional activation domain. The yeast expression system described in the previous literature (generally referred to as the "2-hybrid system") takes advantage of this property and uses two hybrid proteins, while the target protein is the DNA binding domain of GAL4. On the other hand, the candidate activating protein is fused to the activation domain. Expression of the GAL1-lacZ reporter gene under the control of the GAL4-activating promoter depends on the reconstitution of GAL4 activity via protein-protein interactions. Colonies containing interacting polypeptides are detected with a chromogenic substance for β-galactosidase. A complete kit (MATCHMAKER®) for identifying protein-protein interactions between two specific proteins using 2-hybrid technology is Clon
commercially available from tech. This system can be extended to the mapping of protein domains involved in a particular protein interaction, as well as the identification of amino acid residues important for this interaction.

Compounds that inhibit the interaction of a gene encoding a PA polypeptide identified herein with an intracellular or extracellular component can be tested as follows: Usually, the reaction mixture is the gene product and the extracellular component. Alternatively, the intracellular component is prepared under conditions and for a time when the two products interact and bind. To test the ability of a candidate compound to inhibit binding, the reaction is performed in the absence and presence of the test compound. In addition, placebo may be added to the third reaction mixture to provide a positive control. Binding of test compounds present in the mixture to intracellular or extracellular components (
Complex formation) is monitored as described above. The formation of the complex in the control reaction but not in the reaction mixture containing the test compound indicates that the test compound inhibits the interaction of the test compound with its reaction partner. A particularly useful assay system is
Microarray assays, such as chips based on PA gene sequences, on which nucleic acid fragment sequence libraries have been synthesized. Oligonucleotides or longer fragments derived from any of the polynucleotides described herein can be used as targets in microarrays. Microarrays simultaneously monitor the expression levels of multiple genes (to create a transcriptional image), identify antisense molecules, mutants and polymorphisms, antisense molecules, regulatory proteins, ribosomes. Alternatively, it can be used to identify effective nucleic acid binding molecules such as polymerases. This information may be used to determine gene function, understand the genetic basis of the disease, and to develop therapeutics and monitor their activity.

In one embodiment, the microarray is WO95 / 11995 (Chee et al.), Lockhart, DJ.
(Nat. Biotech. 14: 1675-1680 (1996)), and Schena, M. et al. (Proc. Natl.
Acad. Sci. 93: 10614-10619 (1996)) or WO 99/24463 and can be prepared and used according to methods known in the art. Microarrays are preferably composed of a large number of unique, single-stranded nucleic acid sequences, usually synthetic antisense oligonucleotides or cDNAs immobilized on a solid support.
NA fragment. Oligonucleotides are preferably about 6-60 nucleotides in length, more preferably about 15-30 nucleotides in length, and most preferably about 20.
~ 25 nucleotides long. Only 7-10 for some types of microarrays
Preference is given to using oligonucleotides of nucleotide length. Microarrays cover unique 5 '(3') sequences or oligonucleotides that cover untranslated regions, full length sequences or unique oligonucleotides selected from specific regions along the length of sequences that include untranslated regions. It may include contiguous oligonucleotides.
The polynucleotides used in the microarray are specific for the gene or genes of interest, preferably the PA gene, at least a fragment of the sequence of which is known, or a specific cell or tissue type or normal, developmental or It can be an oligonucleotide that is specific for one or more of the unidentified cDNAs common to the disease stage. In some situations it may be appropriate to use pairs of oligonucleotides on the microarray. This pair is identical except that one nucleotide is preferably located in the center of the sequence. The second oligonucleotide in this pair (which does not match one) provides a control. The number of oligonucleotide pairs is 2-1
The range is 1,000,000. Microarrays can also include fragments in the form of DNA replicas that are particularly useful in identifying molecules that bind to PA genomic DNA.

To produce oligonucleotides to known sequences for microarrays, the gene of interest is tested using a computer algorithm starting at the 5 ′, more preferably 3 ′ end of the nucleotide sequence. It The algorithm identifies oligomers of determined length that are unique to the gene, have a GC component in the region suitable for hybridization, and have no predicted secondary structure that could interfere with hybridization. In one embodiment, the oligonucleotides are synthesized in defined areas on the surface of the substrate using light-controlled chemical coupling techniques and inkjet application equipment, eg, as described in WO95 / 251116 (Baldeschweiler et al.). . The base is paper,
It may be nylon or any other book-type membrane, filter, chip, glass slide, or any other suitable solid support. In another aspect, vacuum system, temperature, U
V, for spotting or grooving blots for sequencing and binding of cDNA fragments or oligonucleotides to substrate surfaces using mechanical or chemical ligation techniques.
A "lattice" array analogue (HYBRIDOT device, GIBCO / BRL) may be used. In yet another aspect, the array comprises handmade or available equipment, materials, and machinery (BRINKM
(Including ANN multi-channel pipettors or robotic devices). These arrays can be 8, 24, 96, 384, 1536, or 61.
Helps to effectively use 44 oligonucleotides or commercially available devices 2
~ 1,000,000 any other multiple may be included.

Sample analysis using microarrays can be performed by extraction of polynucleotides from biological samples. A biological sample is any body fluid (blood, urine,
Saliva, sputum, gastric juice, etc.), cultured cells, biopsies, or other tissue preparations. The polynucleotide extracted from the sample can be used as a probe for producing a nucleic acid sequence complementary to the nucleic acid on the microarray. Microarray is cDNA
An antisense RNA (aRNA) is a suitable probe if Thus, in one aspect, mRNA is used for the production of cDNA, which, conversely,
Used in the production of fragments or oligonucleotide aRNA probes in the presence of fluorescent nucleotides. These fluorescently labeled probes are incubated with the microarray such that the probe sequences hybridize to the microarray cDNA oligonucleotides. In another aspect, the nucleic acid sequences used as probes may include restriction enzymes well known in hybridization techniques, PCR techniques, and OL.
It may include polynucleotides, fragments, or complementary or antisense sequences produced using the IGOLABELING ™ or TRANSPROBE ™ kit (Pharmacia). In an alternative microarray embodiment, oligonucleotides (preferably antisense molecules) are used on a support and the target cDNA is the soluble binding component of the assay.

Incubation conditions are adjusted so that hybridization occurs with exact complementarity matches or varying degrees of loss of complementarity. After removing the unhybridized probe, a scanner is used to measure the level and pattern of fluorescence. The scanned images are examined to determine the degree of complementarity and the relative amount of each oligonucleotide sequence on the microarray. The detection system is used to simultaneously measure the absence, presence, and amount of hybridization of all different sequences. This data may be used for large-scale correlation experiments or functional analysis of sequences, mutants, variants, and polymorphisms in a sample (Heller, RA et al., Proc.
Natl. Acad. Sci. 94: 2150-55 (1997)). For gene mapping, a gene or cloned DNA fragment is hybridized to an ordered array of DNA fragments and the identity of the DNA components applied to the array is determined by the pixel or pixel pattern of the array detected. Established in. Immobilized cloned DNA in constructing a physical map of the genome
The array of fragments hybridizes to other cloned DNA fragments to determine if the cloned fragments in the probe mix overlap and thus flank the immobilized clones on the array. For example, Meier-Ewert et al. (J. Biotech. 35 (2-3): 191-203 (1994)) discloses such an application.

Arrays of immobilized DNA fragments may be used for genetic diagnosis. For example,
Arrays containing multiple forms of mutated genes or groups of genes are probed with a labeled mixture of patient DNA that preferentially interacts with only one of the immobilized gene variants. Detection of this interaction may provide a medical diagnosis. The array of immobilized DNA fragments can also be used in DNA probe diagnostics. DNA- or RNA-
For unambiguous genotyping or identification of the containing sample as human, the identity of the test sample can be confirmed by hybridization to an array containing DNA from different organisms, including human, one or more. The PA gene sequence is included in the array. Other molecules of genetic interest, such as cDNA and RNA, can be immobilized on the array or used as a mixture of labeled probes applied to the array. In one embodiment, a PA polypeptide may be added to cells together with a compound to be screened for a particular activity, in order to assay for an antagonist, P
The ability of the compound to inhibit the activity of interest in the presence of the A polypeptide indicates that the compound is an antagonist of the PA polypeptide. Alternatively, the antagonist may be detected by binding the PA polypeptide and potential antagonist to the PA polypeptide receptor or recombinant receptor under conditions suitable for competitive inhibition assays. PA polypeptides can be labeled, such as radioactively, and the number of PA polypeptide molecules bound to the receptor can be used to determine the efficacy of a potential antagonist. The gene encoding the receptor can be identified by many methods known to those skilled in the art, such as ligand panning and FACS sorting (Coligan et al., Current Protocols in Immun., 1 (2): Chapter 5 (199).
1)).

Expression cloning is preferably used where the polyadenylated RNA is P
CDNA prepared from cells reactive with A polypeptide and produced from this RNA
The A library is distributed into pools and used for transfection of COS cells or cells that are free of proteins that are not reactive with or bind to other PA polypeptides. Transfected cells grown on glass slides are exposed to labeled PA polypeptide. PA polypeptides can be labeled by a variety of means including iodinated or site-specific protein kinase recognition sites. After fixation and incubation,
Perform autoradiograph analysis on slides. Positive pools are identified and subpools are prepared and retransfected using an interactive subpooling and rescreening step, resulting in the generation of a single clone encoding the putative receptor. As an alternative method for receptor identification, the labeled PA polypeptide can be photoaffinity-linked with cell membranes or extract preparations that contain or express the receptor or binding protein. Cross-linked material is separated by PAGE and exposed to X-ray film. The labeled complex can be excised, peptide fragments can be separated and subjected to protein microsequencing. The amino acid sequence obtained from microsequencing is used to design a degenerate oligonucleotide probe that screens a cDNA library that identifies the gene encoding the putative receptor or binding protein. More particular examples of potential antagonists include polypeptides that bind to fusions of immunoglobulins with PA polypeptides, particularly but not limited to poly- and monoclonal antibodies and antibody fragments, single chain antibodies, anti-antibodies. It includes idiotype antibodies, and chimeric or humanized forms of these antibodies or fragments, as well as antibodies, including human antibodies and antibody fragments. Alternatively, the potential antagonist may be a closely related protein, eg, a mutated form of the PA polypeptide that recognizes the receptor but exerts no effect, thus competitively inhibiting the action of the PA polypeptide.

Other potential PA polypeptide antagonists are antisense constructs prepared using antisense technology, eg, antisense molecules are targeted to the target mR.
Protein translation (or mRNA) by hybridizing to NA (or genomic DNA)
It acts to directly block translation (or transcription) of mRNA by interfering with transcription. Antisense technology can be triple helix formation or antisense DN.
It can be used to control gene expression through A or RNA, both of which methods are based on the binding of polypeptide nucleotides to DNA or RNA. For example,
The 5'coding portion of the polynucleotide sequence encoding the mature PA polypeptide herein is used to design an antisense RNA oligonucleotide of about 10 to 40 base pairs in length. DNA oligonucleotides are designed to be complementary to regions of the gene involved in transcription (triple helix-Lee et al., Nucl, Acid Res., 6: 3073.
(1979); Cooney et al., Science, 241: 456 (1988); Dervan et al., Science, 251: 1360.
(1991)), thereby preventing transcription and production of PA polypeptides. The antisense RNA oligonucleotide hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule into a PA polypeptide (antisense-Okano, N.
eurochem., 56: 560 (1991); Oligodeoxynucleotides as Antisense Inhibitors
of Gene Expression (CRC Press: Boca Raton, FL, 1988)). The above oligonucleotides can also be delivered to cells where they express antisense RNA or DNA in vivo and inhibit PA polypeptide production. If antisense DNA is used, oligodeoxyribonucleotides derived from the translation initiation site, eg, between the -10 and +10 positions of the target gene nucleotide sequence, are preferred.

A potential antagonist binds to the active site, protein binding site, or other associated binding site (eg, cofactor binding site, substrate binding site) of a PA polypeptide, thereby normalizing the PA polypeptide. Includes small molecules that inhibit certain biological activities. Examples of small molecules include, but are not limited to, small peptides or peptide-like molecules,
Preferably it includes soluble peptides and synthetic non-peptide organic or inorganic compounds.

Ribozymes are enzymatic RNA molecules capable of catalyzing the specific cleavage of RNA. Ribozymes act by sequence-specific hybridization to complementary target RNA, followed by endonucleolytic cleavage. Specific ribozyme cleavage sites within potential RNA targets can be identified by known techniques. Further details can be found in, for example, Rossi, Cur
rent Biology 4: 469-471 (1994) and PCT publication, number WO 97/33551 (September 1997)
Issued on the 18th). Nucleic acid molecules in triple helix formation used to inhibit transcription are single-stranded and composed of deoxynucleotides. The basic composition of these oligonucleotides is designed to promote triple helix formation via the Hoogsteen base pairing rule, which generally requires resizable extension of purines or pyrimidines on one strand of the duplex. . For further details, see, for example, PCT publication, number WO 97/33551, supra. These small molecules can be identified by any one or more of the screening assays discussed above and / or by any other screening technique well known to those of skill in the art.

Anti-PA Antibodies The present invention further provides anti-PA antibodies. Examples of antibodies include polypeptide clonal, monoclonal, humanized, bispecific, and heteroconjugate antibodies. Polyclonal Antibodies Anti-PA polypeptide antibodies may include polypeptide clonal antibodies. Methods of preparing polyclonal antibodies are known to those of skill in the art. Polyclonal antibodies in mammals can be generated by one or more injections of, for example, an immunizing agent and, if desired, an adjuvant. Typically, the immunizing agent and / or adjuvant will be injected in the mammal by multiple subcutaneous or intraperitoneal injections. The immunizing agent may include the PA polypeptide or a fusion protein thereof. It is useful to conjugate the immunizing agent to a protein known to be immunogenic in the immunized mammal. Examples of such immunogenic proteins include, but are not limited to, keyhole limpet hemocyanin, serum albumin, bovine thyroglobulin and soybean trypsin inhibitor. Examples of adjuvants that may be used include Freund's complete adjuvant and MPL-TDM adjuvant (monophosphoryl lipid A, synthetic trehalose dicorynomycolate). The immunization protocol will be selected by one of ordinary skill in the art without undue experimentation.

Monoclonal Antibody Alternatively, the anti-PA antibody may be a monoclonal antibody. Monoclonal antibodies can be prepared using the hybridoma method as described by Kohler and Milstein, Nature, 256: 495 (1975). In the hybridoma method, mice, hamsters or other suitable host animals are typically immunized with an immunizing agent to produce lymphocytes that produce or are capable of producing antibodies that specifically bind to the immunizing agent. Induce. The lymphocytes can also be immunized in vitro. The immunizing agent will typically include the PA polypeptide or a fusion protein thereof. Generally, peripheral blood lymphocytes ("PBLs") are used when cells of human origin are desired, or spleen cells or lymph node cells are used when non-human mammalian sources are desired. The lymphocytes are then fused with an immortalized cell line using an appropriate fusion agent such as polyethylene glycol to form hybridoma cells (Goding, Mo.
noclonal Antibodies: Principles and Practice, Academic Press, (1986) pp.
59-103). Immortalized cell lines are usually transformed mammalian cells, particularly myeloma cells of rodent, bovine, and human origin. Usually, rat or mouse myeloma cell lines are used. The hybridoma cells are preferably cultured in a suitable medium that contains one or more substances that inhibit the survival or growth of the unfused, immortalized cells. For example, if the parental cell lacks the enzyme hypoxanthine guanine phosphoribosyl transferase (HGPRT or HPRT), the hybridoma medium typically comprises hypoxatin, aminoputilin and thymidine ("HAT medium"), This substance blocks the growth of HGPRT-deficient cells.

Preferred immortalized cell lines are those that fuse efficiently, support stable high level expression of antibody by the selected antibody-producing cells, and are sensitive to a medium such as HAT medium. A more preferred immortalized cell line is the mouse myeloma line, which is available, for example, from the Salk Institute Cell Distribution Center in San Diego, Calif. And the American Type Culture Collection in Manassas, Virginia. Human myeloma and mouse for producing human monoclonal antibodies-
Human xenomyeloma cell lines have also been disclosed (Kozbor, J. Immunol., 133: 3001 (1
984); Brodeur et al., Monoclonal Antibody PRoduction Techniques and Applicati
ons, Marcel Dekker, Inc., New York, (1987) pp. 51-63). The culture medium in which the hybridoma cells are cultured can then be assayed for the presence of monoclonal antibodies to PA. Preferably, the binding specificity of the monoclonal antibody produced by the hybridoma cells is measured by immunoprecipitation or an in vitro binding assay such as radioimmunoassay (RIA) or enzyme-linked immunoassay (ELISA). Such techniques and assays are known in the art. The binding affinity of a monoclonal antibody can be determined, for example, by Munson and Pollard, Anal.
It can be measured by the Scatchard analysis method by Biochem., 107: 220 (1980).

After the desired hybridoma cells have been identified, clones can be subcloned by a limiting dilution step and grown by standard methods (Goding, supra).
Suitable culture media for this purpose include, for example, Dulbecco's Modified Eagle's Medium and RPMI-1640 medium. Alternatively, the hybridoma cells can be grown in vivo as ascites in a mammal. The monoclonal antibody secreted by the subclone is, for example, protein A
-Isolated or purified from the culture medium or ascites fluid by a conventional immunoglobulin purification method such as sepharose method, hydroxylapatite chromatography method, gel electrophoresis method, dialysis method or affinity chromatography. Monoclonal antibodies are also prepared by recombinant DNA methods, such as US Pat. No. 4,816,567.
It can be prepared by the method described in No. The DNA encoding the monoclonal antibody of the present invention can be easily prepared using a conventional method (for example, using an oligonucleotide probe capable of specifically binding to the genes encoding the heavy and light chains of mouse antibody). Can be isolated and sequenced. The hybridoma cells of the invention are a preferred source of such DNA. Once isolated, DNA
Can be placed in an expression vector, which is transfected into a host cell, such as monkey COS cells, Chinese hamster ovary (CHO) cells, or myeloma cells that do not produce immunoglobulin proteins, Monoclonal antibody can be synthesized with. The DNA may also be non-immunized with immunoglobulin coding sequences, for example, by substituting the coding sequences for human heavy and light chain constant domains in place of homologous mouse sequences (US Pat. No. 4,816,567; Morrison et al., Supra). It can be modified by covalently linking part or all of the coding sequence for the globulin polypeptide. Such non-immunoglobulin polypeptides can be substituted for the constant domain of the antibodies of the invention or for the variable domain of one of the antigen binding sites of the antibodies of the invention to produce chimeric, bivalent antibodies.

The antibody can also be a monovalent antibody. Methods for preparing monovalent antibodies are well known in the art. For example, one method involves recombinant expression of immunoglobulin light chain and modified heavy chain. The heavy chain is truncated generally at any point in the Fc region so as to prevent heavy chain crosslinking. Alternatively, the relevant cysteine residue is replaced or deleted with another amino acid residue to prevent cross-linking. In vitro methods are also suitable for preparing monovalent antibodies. Generation of fragments thereof, particularly Fab fragments, by digestion of the antibody can be accomplished using conventional techniques known in the art.

Human and Humanized Antibodies The anti-PA antibodies of the present invention further include humanized antibodies or human antibodies. Humanized forms of non-human (eg, murine) antibodies are chimeric immunoglobulins, immunoglobulin chains or fragments thereof (eg, Fv, Fab, Fab ′, F (ab ′) ₂ or other antigen-binding subsequences of antibodies). It contains a minimal sequence derived from non-human immunoglobulin. Humanized antibodies are human immunoglobulins (recipe) in which the CDR residues have been replaced by the CDR residues of a non-human species (donor antibody) having the desired specificity, affinity and capacity, such as mouse, rat or rabbit. Ent antibody). In some examples, human immunoglobulin Fv framework residues are replaced by corresponding non-human residues. Humanized antibodies may also contain residues which are found neither in the recipient antibody nor in the imported CDR or framework sequences.
Generally, a humanized antibody has at least one, and typically no, at least one, where all or almost all CDR regions correspond to those of a non-human immunoglobulin and all or almost all FR regions are of human immunoglobulin consensus sequences. Contains substantially all of the two variable domains. Humanized antibodies optimally comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin (Jones et al., Nature, 321: 522-525 (1986); Riechmann et al. , Nature, 332: 323-329
(1988); and Presta, Curr. Op Struct. Biol., 2: 593-596 (1992)).

Methods for humanizing non-human antibodies are well known in the art. Generally, a humanized antibody has one or more amino acid residues introduced into it from a source that is non-human. These non-human amino acid residues are often referred to as "import" residues, which typically result from an "import" variable domain. Humanization is basically accomplished by substituting the relevant sequences of human antibodies with rodent CDRs or CDR sequences by Winter and coworkers (Jones et al., Nature, 321: 522-525 (1986); Riechmann. Et al, Nature, 332: 323-327.
(1988); Verhoeyen et al., Science, 239: 1534-1536 (1988)). Thus, such "humanized" antibodies are chimeric antibodies (US Pat. No. 4,816,567) in which substantially less than the intact human variable domain has been replaced with the corresponding sequence from a non-human species. In practice, humanized antibodies are typically human antibodies in which some CDR residues and optionally some FR residues have been replaced by residues from similar sites in rodent antibodies.

Human antibodies can also be made using various techniques known in the art, including phage display libraries (Hoogenboom and Winter, J. Mol. Biol.,
227: 381 (1991); Marks et al., J. Mol. Biol., 222: 581 (1991)). The methods of Cole et al. And Boerner et al. Can also be used for the preparation of human monoclonal antibodies (Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R. Liss. P. 77.
(1985) and Boerner et al., J. Immunol., 147 (1): 86-95 (1991)). Similarly, human antibodies can be produced by introducing human immunoglobulin loci into transgenic animals, such as mice in which the endogenous immunoglobulin genes have been partially or completely inactivated. Upon administration, production of human antibodies is observed that is very similar to that found in humans in all respects, including gene rearrangement, assembly, and antibody repertoire. This approach is described, for example, in US Pat. Nos. 5,545,807;
No. 5,545,806; No. 5,569,825; No. 5,625,126; No. 5,633,425; No. 5,661.
, 016, and the following scientific literature: Marks et al., Bio / Technology 10, 779-783 (1992); Lo.
nberg et al., Nature 368 856-859 (1994); Morrison, Nature 368, 812-813 (1994).
Fishwild et al., Nature Biotechnology 14, 845-851 (1996); Neuberger, Nature
Biotechnology 14, 826 (1996); Lonberg and Huszar, Intern. Rev. Immunol.
13 65-93 (1995).

Bispecific Antibodies Bispecific antibodies are monoclonal antibodies, preferably human or humanized antibodies, that have binding specificities for at least two different antigens. In the present case, one of the binding specificities is for PA and the other one is for any other antigen,
Preferred is for cell surface proteins or receptors or receptor subunits. Methods of making bispecific antibodies are well known in the art. Traditionally, recombinant production of bispecific antibodies is based on the co-expression of two immunoglobulin heavy chain / light chain pairs, where the two heavy chains have different specificities. Milstein and Cuello, Nature,
305: 537-539 (1983). To randomly arrange the heavy and light chains of immunoglobulins,
These hybridomas (quadromas) produce a potential mixture of 10 different antibody molecules, of which only one has the correct bispecific structure. Purification of the correct molecule is usually accomplished by affinity chromatography steps. A similar procedure is described in WO 93/08829 published May 13, 1993, and Traunecker et al., EMBO J., 10: 3655-36.
59 (1991).

Antibody variable domains with the desired binding specificities (antibody-antigen combining sites) can be fused to immunoglobulin constant domain sequences. The fusion is preferably with an immunoglobulin heavy chain constant domain, comprising at least the hinge region, and portions of the CH2 and CH3 regions. It is preferred to have the first heavy-chain constant region (CH1) containing the site necessary for light-chain binding present in at least one of the fusions. The DNA encoding the immunoglobulin heavy chain fusion, and, if desired, the immunoglobulin light chain, are inserted into separate expression vectors and cotransfected into a suitable host organism. For further details on making bispecific antibodies, see, eg, Suresh et al., Methods in Enzymology, 121: 210 (1986). According to another approach described in WO96 / 27011, the interface between a pair of antibody molecules can be engineered to maximize the percentage of heterodimers recovered from recombinant cell culture. The preferred interface comprises at least part of the CH3 domain of an antibody constant domain. In this method, one or more small amino acid side chains from the interface of the first antibody molecule are replaced with larger side chains (eg tyrosine or tryptophan). A complementary “cavity” of the same or smaller size as the large side chain is created at the interface of the second antibody molecule by replacing the large amino acid side chain with the smaller one (alanine or threonine). This provides a mechanism to increase the yield of heterodimers relative to unwanted other end products such as homodimers.

Bispecific antibodies can be prepared as full length antibodies or antibody fragments (eg F (ab ′) ₂ bispecific antibodies. Techniques for producing bispecific antibodies from antibody fragments are also described in the literature. Bispecific antibodies can be prepared, for example, using chemical conjugation.Brennan et al., Science, 229: 81 (1985) cleaves intact antibodies proteolytically to give F ( ab ') ₂ fragments are described which are reduced in the presence of the dithiol complexing agent sodium arsenite to stabilize vicinal dithiols and prevent intermolecular disulphide formation. The Fab ′ fragment was then converted to a thionitrobenzoate (TNB) derivative, one of the Fab′-TNB derivatives was then reconverted to Fab′-thiol by reduction with mercaptoethylamine and the other Fab′-TNB derivative. Invitation Mixed with equimolar amounts of conductors to form bispecific antibodies, which can be used as agents for selective immobilization of enzymes Fab 'fragments from E. coli. It can be directly recovered and chemically coupled to form bispecific antibodies Shalaby et al., J. Exp. Med., 175: 217-225 (1992) are fully humanized bispecific antibodies. The production of specific antibody F (ab ') ₂ molecules is described.
The b'fragments are separately secreted from E. coli and directed chemical coupled in vitro to form bispecific antibodies. The bispecific antibody thus formed is ErbB
It can bind to cells overexpressing the 2 receptor and normal human T cells and trigger the lytic activity of human cytotoxic lymphocytes against human breast tumor targets.

Various methods for making and isolating bispecific antibody fragments directly from recombinant cell culture have also been described. For example, bispecific antibodies were produced using leucine zippers. Kostelny et al., J. Immunol., 148 (5): 1547-1553 (1992). Leucine zipper peptides from the Fos and Jun proteins were linked to the Fab 'portions of two different antibodies by gene fusion. Antibody homodimers are reduced at the hinge region to form monomers and then reoxidized to form antibody heterodimers. This method can also be used for the production of antibody homodimers. Ho
The "diabody" technique described by Lllinger et al., Proc. Natl. Acad. Sci. USA, 90: 6444-6448 (1993) provided another mechanism for making bispecific antibody fragments. Fragments consist of a heavy chain variable domain ( _VH ) linked to a light chain variable domain ( _VL ) with a linker short enough to allow pairing between two domains on the same chain. Thus, the V _H and V _L domains of one fragment are forced to pair with the complementary V _L and V _H domains of the other fragment, forming two antigen binding sites. Other bispecific antibody fragment production strategies using single chain Fv (sFv) dimers have also been reported. See Gruber et al., J. Immunol., 152: 5368 (1994). Antibodies with more than two valencies are possible. For example, trispecific antibodies can be prepared. Tutt et al. J. Immunol. 147: 60 (1991).

Exemplary bispecific antibodies can bind to two different epitopes of the PA polypeptides provided herein. Alternatively, the arm of the anti-PA polypeptide triggers on leukocytes, such as T cell receptor molecules (eg CD2, CD3, CD28, or B7), to focus the cellular defense mechanism on specific PA polypeptide expressing cells. Molecule or FcγRI (CD64), FcγRII (CD32) and FcγR
It can bind to an arm that binds to the Fc receptor for IgG (FcγR) such as III (CD16). Bispecific antibodies can also be used to localize cytotoxic drugs on cells expressing a particular PA polypeptide. These antibodies include PA binding arms and cytotoxic agents or radioactive chelating agents such as EOTUBE, DPTA.
, DOTA, or TETA. Other bispecific antibodies of interest bind to PA polypeptides and also to tissue factor (TF).

Heteroconjugate Antibodies Heteroconjugate antibodies are also included within the scope of the invention. Heteroconjugate antibodies are composed of two covalently joined antibodies. Such antibodies are, for example, for targeting immune system cells to unwanted cells (US Pat. No. 4,676,980) and for treating HIV infection (WO 91/00360; WO 92/200373; European Patent No. No. 03089) Proposed. It is believed that this antibody can be prepared in vitro using known methods in synthetic protein chemistry, including those associated with cross-linking agents. For example, by using a disulfide exchange reaction or by forming a thioether bond,
Can make immunotoxins. Examples of suitable reagents for this purpose include iminothiolate and methyl-4-mercaptobutyrimidate and, for example, US Pat.
Those included in 4,676,980 are included.

Modifying Effector Function It may be desirable to modify the antibody of the invention with respect to effector function, so as to improve the effectiveness of the antibody in treating cancer, for example. For example, cysteine residue (s) may be introduced in the Fc region, thereby allowing interchain disulfide bond formation in this region. The homodimeric antibody thus produced has improved internalization capacity and / or
Or it may have increased complement-mediated cell killing and antibody-dependent cellular cytotoxicity (ADCC). Caron et al., J. Exp. Med. 176: 1191-1195 (1992) and Shopes, J. Immunol. 148.
: See 2918-2922 (1992). Allodimeric antibodies with improved antitumor activity have also been identified by Wo
It may also be prepared using a heterobifunctional crosslink as described in Lff et al., Cancer Research 53: 2560-2565 (1993). Alternatively, the antibody can be engineered to have two Fc regions, thereby improving complement lysis and ADCC capabilities.
See Stevenson et al., Anti-Cancer Drug Design 3: 219-230 (1989).

Immunoconjugates The present invention also includes cytotoxic agents, such as chemotherapeutic agents, toxins (eg, enzymatically active toxins of bacterial, fungal, plant or animal origin, or fragments thereof), or radioisotopes (ie,
Immunoconjugates comprising the antibody conjugated to a radioactive complex). Chemotherapeutic agents useful in generating such immunoconjugates have been described above. Enzymatically active toxins and fragments thereof that can be used include diphtheria A chain, non-binding active fragments of diphtheria toxin, exotoxin A chain (from Pseudomonas aeruginosa), ricin A chain, abrin A chain, modexin (m
odeccin) A chain, alpha-sarcin, Aleurites ford
ii) protein, dianthin protein, phythora americana (
Phytolaca americana) protein (PA polypeptide I, PA polypeptide II
, And PA polypeptide-S), momordica charantia
ia) inhibitor, curcin, crotin, crotin, sapaonaria officinalis inhibitor, gelonin, mitogellin
llin), restrictocin, phenomycin, enomycin and trichothecene. Various radionucleotides are available for the production of radioconjugated antibodies. As an example, ²¹² Bi, ¹³¹ I
, ¹³¹ In, ⁹⁰ Y and ¹⁸⁶ Re.

Conjugates of antibodies and cytotoxic agents can be conjugated to various bifunctional protein coupling agents,
For example, N-succinimidyl-3- (2-pyridyldithiol) propionate (S
PDP), iminothiolane (IT), bifunctional derivative of imide ester (dimethyl adipimidate HCL, etc.), active ester (disuccinimidyl suberate, etc.), aldehyde (glutaraldehyde, etc.), bis-azide compound (eg, Bis (p-azidobenzoyl) hexanediamine etc.), bis-diazonium derivative (bis- (p-diazoniumbenzoyl) -ethylenediamine etc.), diisocyanate (triene 2,6-diisocyanate etc.), and bis-active fluorine compound (1, 5-difluoro-2,4-dinitrobenzene etc.). For example, ricin immunotoxins such as Vitetta
, Science 238: 1098 (1987). Carbon-14-labeled 1-isothiocyanatobenzyl-3-methyldiethylenetriaminepentaacetic acid (MX-DTPA) is an example of a chelating agent for conjugation of radionucleotide to the antibody. See WO 94/11026. In other embodiments, the antibody may be conjugated to a "receptor" (such as streptavidin) for use in tumor pre-targeting, the antibody-receptor conjugate is administered to a patient, and then a clarifying agent is added. Unbound conjugate is used to remove from circulation and then a "ligand" (such as avidin) conjugated to a cytotoxic drug (such as a radionucleotide).
Is administered.

Immunoliposomes The antibodies disclosed herein may also be prepared as immunoliposomes. Liposomes containing antibodies are described by Epstein et al., Proc. Natl. Acad. Sci. USA, 82: 3688 (1985).
Hwang et al., Proc. Natl. Acad. Sci. USA, 77: 4030 (1980); and U.S. Pat.
Prepared by methods known in the art, such as those described in 485,045 and 4,544,545. Liposomes with improved circulation time are disclosed in US Pat. No. 5,013,556. Particularly useful liposomes are phosphatidylcholine, cholesterol and PEG.
-Produced by the reverse phase evaporation method with a lipid composition containing derivatized phosphatidylethanolamine (PEG-PE). Liposomes are extruded through filters of defined size pores to produce liposomes with the desired size. Fa of the antibody of the present invention
The b'fragment can be conjugated to liposomes via a disulfide exchange reaction as described by Martin et al., J. Biol. Chem. 257: 286-288 (1982). Chemotherapeutic drugs
(Doxorubicin, etc.) is optionally contained within the liposome. Gabizon etc.,
See J. National Cancer Inst. 81 (19) 1484 (1989).

Pharmaceutical Compositions of Antibodies Antibodies that specifically bind to the PA polypeptides identified herein, as well as other molecules identified in the screening assays disclosed above, may be used in pharmaceutical compositions for the treatment of various diseases. It can be administered in the form of a product. Internalized antibodies are preferred when the PA polypeptide is intracellular and whole antibodies are used as inhibitors. However, lipofections or liposomes can also be used to introduce the antibody, or antibody fragment, into cells. When antibody fragments are used, the smallest inhibitory fragment that specifically binds to the binding domain of the target protein is preferred. For example, peptide molecules can be designed that retain the ability to bind to target protein sequences based on the variable region sequences of the antibody. Such peptides can be chemically synthesized and / or produced by recombinant DNA technology. For example, Marasco et al., Proc. Natl. Aca
d. Sci. USA 90, 7889-7893 (1993). The formulations herein may also contain more than one active compound as necessary for the particular indication being treated, preferably those with complementary activities that do not adversely affect each other. Alternatively, or in addition, the composition may include agents that enhance its function, such as cytotoxic agents, cytokines, chemotherapeutic agents or growth inhibitors. These molecules are suitably present in combination in amounts that are effective for the purpose intended.

The active ingredient may also be in microcapsules prepared eg by coacervation techniques or by interfacial polymerization, eg hydroxymethylcellulose or gelatin-microcapsules and poly (methylmethacrylate) microcapsules, respectively.
It may be encapsulated in a colloidal drug delivery system (eg liposomes, albumin globules, microemulsions, nanoparticles and nanocapsules) or in microemulsions. These techniques are disclosed in Remington's Pharmaceutical Science, supra. The formulations used for in vivo administration must be sterile. This is easily accomplished by filtration through a sterile filtration membrane.

Sustained-release preparations may be prepared. Suitable examples of sustained release formulations include semipermeable matrices of solid hydrophobic polymers containing the antibody, which matrices are in the form of shaped articles, eg films, or microcapsules. Examples of sustained release matrices are polyesters, hydrogels (eg poly (2-hydroxyethyl-methacrylate) or poly (vinyl alcohol)), polylactides (US Pat. No. 3,773,919).
No.), copolymers of L-glutamic acid and γ-ethyl-L-glutamate, non-degradable ethylene-vinyl acetate, LUPRON DEPOT ^™ (injectable globules of lactic acid-glycolic acid copolymer and leuprolide acetate)- Glycolic acid copolymer,
Includes poly- (D) -3-hydroxybutyric acid. While polymers such as ethylene-vinyl acetate and lactic acid-glycolic acid enable release of molecules for over 100 days, certain hydrogels release proteins for shorter time periods. When the encapsulated antibodies remain in the body for a long time, they are denatured or aggregated by exposure to water at 37 ° C, resulting in reduced biological activity and possible altered immunogenicity. . Rational methods can be devised for stabilization depending on the mechanism involved. For example, the aggregation mechanism is intermolecular S--S through thio-disulfide exchange.
If found to be bond formation, stabilization is achieved by modification of sulfhydryl residues, lyophilization from acidic solutions, control of water content, addition of suitable additives, and development of specific polymer matrix compositions. Can be done.

Uses of Anti-PA Antibodies The anti-PA antibodies of the present invention have various utilities. For example, anti-PA antibody
It is used in diagnostic assays for PA, for example detecting its expression in specific cells, tissues, or serum. Competitive binding assays, direct or indirect sandwich assays and immunoprecipitation assays performed in heterogeneous or homogeneous phases [Zola, Monoclonal Antibodies: AM
various diagnostic assay techniques known in the art such as an anual of Techniques, CRC Press, Inc. (1987) pp. 147-158] are used. The antibody used in the diagnostic assay is labeled with a detectable moiety. The detectable moiety must directly or indirectly generate a detectable signal. For example, the detectable ^{moiety, 3 H, 1 4 C,} 32 P, 35 S or ¹²⁵ radioactive isotopes such I, fluorescein isothiocyanate, rhodamine, or fluorescent or chemiluminescent compound, such as luciferin, or alkaline phosphatase, beta - It may be an enzyme such as galactosidase or horseradish peroxidase. Any method known in the art for conjugating a detectable site to an antibody may be used, including Hunter et al., Nature, 144: 94.
5 (1962); David et al., Biochemistry, 13: 1014 (1974); Pain et al., J. Immunol. Me.
th., 40: 219 (1981); and Nygren, J. Histochem. and Cytochem., 30: 407 (198
The method described in 2) is included. Anti-PA antibodies are also useful for affinity purification of PA from recombinant cell culture or natural sources. In this method, antibodies to PA are immobilized on a suitable support such as Sephadex resin or filter paper using methods well known in the art. Next, after contacting the immobilized antibody with a sample containing PA to be purified, the support is treated with a suitable solvent that removes substantially all substances in the sample other than PA bound to the immobilized antibody. To wash. Finally, the support is washed with another suitable solvent that releases the PA from the antibody.

Nucleic Acid Diagnostic Assays The invention also relates to the use of genes encoding PA polypeptides as diagnostics. Because the mutation in the PA polypeptide is responsible for the tumor, the mutated form of P
Detection of the A polypeptide allows the diagnosis of angiogenic disorders such as infectivity to tumors. Individuals carrying variants in the gene encoding human PA polypeptide are detected at the DNA level by a variety of techniques. Diagnostic nucleic acids can be obtained from patient cells, such as blood, urine, saliva, tissue biopsies, and autopsy materials. Genomic DNA is
It is enzymatically amplified using PCR before analysis (Saiki et al., Nature, 324: 163-1.
66 (1986)) or can be used directly for detection. RNA or cDNA can be used for the same purpose. As an example, PCR primers complementary to the nucleic acid encoding the PA polypeptide can be used to identify and analyze PA polypeptide variants. For example, deletions and insertions can be detected by changes in the size of the amplification product compared to the normal genotype. Point mutation refers to amplified DNA against radiolabeled RNA encoding PA polypeptide or radiolabeled antisense DNA sequence encoding PA polypeptide.
Can be identified by hybridizing Preferred compatible sequences can be distinguished from non-compatible duplexes by RNase A digestion or different melting temperatures.

Genetic testing based on DNA sequence differences is based on DNA in gels with or without denaturing agents.
This is accomplished by detecting changes in the electrophoretic mobility of the fragment. Small sequence deletions and insertions can be visualized by high resolution gel electrophoresis. DNA fragments of different sequences are distinguished in denaturing formamidine gradient gels, and migration of different DNA fragments is inhibited at different positions of the gel by the particular melting or partial melting temperature. See, for example, Myers et al., Science, 230: 1242 (1985). Sequence changes at specific positions may also be accompanied by nuclease protection assays, such as RNase and SI protection, or chemical cleavage methods, such as Cotton et al., Proc. Nat. Acad. S.
ci. USA, 85: 4397-4401 (1985). Thus, deletion of a particular DNA sequence may result in hybridization, RNase protection, chemical cleavage, direct DNA sequencing, or use of restriction enzymes, such as restriction fragment length polymorphisms.
(RFLP), and Southern blot of genomic DNA.

Detection of Polypeptide Levels In addition to the more common gel electrophoresis and DNA sequencing, mutations can also be detected by in situ analysis. Expression of nucleic acids encoding PA polypeptides is associated with vascular disease or neovascularization associated with tumorigenesis. When the PA polypeptide has a signal sequence, mRNA is highly expressed in endothelial cells, whereas it is low in smooth muscle cells, indicating that PA polypeptide is present in serum. Is shown. Therefore, anti-PA polypeptide antibodies may be used in the diagnosis of such diseases, since changes in the levels of this PA polypeptide are indicative of vascular disease associated with tumorigenesis or neovascularization. can do. Competitive assays may also be used in which antibodies specific for the PA polypeptide are attached to a solid support and labeled PA polypeptide and a sample derived from the host are passed over the solid support. The amount of detected label attached can be correlated to the amount of PA polypeptide in the sample.

Screening Assays for Candidate Agents The present invention also provides for those that mimic PA polypeptides (agonists) or inhibit the effects of PA polypeptides (antagonists), ie, angiogenesis in vivo or endothelial cells in vitro. Also included are methods of screening compounds to identify those that respectively promote or inhibit tube formation in E. coli. Screening assays for antagonist drug candidates include compounds that bind or complex with the PA polypeptides encoded by the genes identified herein, or other compounds that inhibit the interaction of the encoded polypeptides with other cellular proteins. Designed to identify. Such a screening assay makes it particularly suitable for identifying small molecule drug candidates,
Includes assays applicable to high throughput screening of chemical libraries. The assay is performed in a variety of formats, including protein-protein binding assays, biochemical screening assays, immunoassays, and cell-based assays, including those known in the art.

All assays for antagonists involve contacting a candidate drug with a PA polypeptide encoded by the nucleic acid identified herein under conditions and for a time sufficient for these two components to interact. Common in needing things. In the binding assay, the interaction is binding and the complex formed is isolated or detected in the reaction mixture. In a particular embodiment, the PA polypeptide encoded by the gene identified herein or the drug candidate is covalently or non-covalently immobilized to a solid phase, eg, a microtiter plate. Non-covalent attachment generally is accomplished by coating the solid surface with a solution of PA polypeptide and drying. Alternatively, an immobilized antibody specific for the PA polypeptide to be immobilized, eg a monoclonal antibody, can be used to anchor it to a solid surface. The assay is performed by adding the non-immobilized component, which may be labeled with a detectable label, to the immobilized component, eg, the coated surface containing the anchored component. When the reaction is complete, unreacted components are removed, for example by washing, and the complex adhered to the solid surface is detected. When the first non-immobilized component carries a detectable label, detection of the label immobilized on the surface indicates that complex formation has occurred. If the first non-immobilized component has no label, complex formation can be detected, for example, by a labeled antibody that specifically binds to the immobilized complex.

Specific PAs with which the candidate compound interacts but is encoded by the gene identified here
If it does not bind to the polypeptide, the interaction with that polypeptide is
It can be assayed by well known methods for detecting protein interactions. Such assays include traditional techniques such as cross-linking, co-immunoprecipitation, and co-purification through gradients or chromatographic columns. In addition, protein-protein interactions are reported by Chevray and Nathans, Proc. Natl. Acad. Sci. USA.
89, 5789-5793 (1991), Fields and collaborators (
Fields and Song, Nature (London) 340, 245-246 (1989); Chien et al., Proc. Natl.
It can be monitored by using the yeast-based gene system described in Acad. Sci. USA 88, 9578-9582 (1991)). Many transcriptional activators, such as yeast GAL4, consist of two physically distinct modular domains, one acting as a DNA binding domain and the other functioning as a transcriptional activation domain. The yeast expression system described in the previous literature (generally called "2-hybrid system") is
Taking advantage of this property, two hybrid proteins are used, on the one hand the target protein is fused to the DNA binding domain of GAL4 and on the other hand the candidate activation protein is fused to the activation domain. Expression of the GAL1-lacZ reporter gene under the control of the GAL4-activating promoter depends on the reconstitution of GAL4 activity via protein-protein interactions. Colonies containing interacting polypeptides are detected with a chromogenic substance for β-galactosidase. A complete kit for identifying protein-protein interactions between two specific proteins using 2-hybrid technology (MATCHMAKER (trade name))
Is commercially available from Clontech. This system can be extended to the mapping of protein domains involved in a particular protein interaction, as well as the identification of amino acid residues important for this interaction.

Compounds that inhibit the interaction of the genes encoding the PA polypeptides identified herein with intracellular or extracellular components can be tested as follows: Usually, the reaction mixture is the gene product and extracellular components. Alternatively, the intracellular component is prepared under conditions and for a time when the two products interact and bind. To test the ability of a candidate compound to inhibit binding, the reaction is performed in the absence and presence of the test compound. In addition, placebo may be added to the third reaction mixture to provide a positive control. The binding (complex formation) of the test compound present in the mixture with intracellular or extracellular components is monitored as described above. The formation of the complex in the control reaction but not in the reaction mixture containing the test compound indicates that the test compound inhibits the interaction of the test compound with its binding partner. If the PA polypeptide has the ability to stimulate endothelial cell proliferation in the presence of the co-mitogen ConA, one example of a screening method will take advantage of this ability. In particular, in a proliferation assay, human umbilical vein endothelial cells were obtained and
Culturing in 6-well flat bottom culture dishes (Costar, Cambridge, MA), supplemented with the appropriate reaction mixture to facilitate cell growth, the mixture being Con-A (Calbiochem, La Jolla,
CA) is included. Con-A and compounds to be screened were added, 37
After incubation at ° C, the cultures are labeled with 3-H-thymidine and collected on glass fiber filters (phD; Cambridge Technology, Watertown, MA). The mean 3-H-thymidine incorporation (cpm) of 3 media is measured using a liquid scintillation counter (Beckman Instruments. Irvine. CA). Significant 3- (H) thymidine contamination was shown upon stimulation of endothelial cells.

To assay for antagonists, the assay described above is performed; in this assay PA polypeptide may be added with the compound to be screened and 3- (H) thymidine incorporation in the presence of PA polypeptide. The ability of the compound to inhibit E. coli indicates that the compound is an antagonist of PA polypeptide. Alternatively, the antagonist may be detected by binding a potential antagonist with a PA polypeptide and a membrane-bound PA polypeptide receptor or a recombinant receptor under conditions suitable for competitive inhibition assays. PA polypeptide is
It can be labeled, such as radioactively, and the number of PA polypeptide molecules bound to the receptor can be used to determine the efficacy of a potential antagonist. The gene encoding the receptor may be expressed in many ways known to those skilled in the art, such as ligand panning and FAC.
It can be identified by S-sort. Coligan et al., Current Protocols in Immun., 1 (2):
Chapter 5 (1991). Preferably, expression cloning is used, polyadenylated RNA is prepared from cells responsive to PA polypeptide, and the cDNA library generated from this RNA is distributed into pools, COS cells or other non-PA polypeptide responsive. Used for transfection of cells. Transfected cells grown on glass slides are exposed to labeled PA polypeptide. PA polypeptides can be labeled by a variety of means including iodination or the inclusion of recognition sites for site-specific protein kinases. After fixation and incubation, slides are subjected to autoradiographic analysis. Positive pools are identified and subpools are prepared and retransfected using an interactive subpooling and rescreening step, resulting in the generation of a single clone encoding the putative receptor.

As an alternative method for receptor identification, labeled PA polypeptides can be photoaffinity-linked with cell membrane or extract preparations that express the receptor molecule. The crosslinked material is dissolved in PAGE and exposed to X-ray film. The labeled complex containing the receptor can be excited, resolved into peptide fragments and subjected to protein microsequencing. The amino acid sequences obtained from the microsequences are used to design a set of degradable oligonucleotide probes that screen a cDNA library to identify genes encoding putative receptors. In another assay for antagonists, mammalian cells expressing the receptor or a membrane preparation are incubated with labeled PA polypeptide in the presence of the candidate compound. The ability of the compound to enhance or block this interaction is then measured.

Compositions useful in the treatment of angiogenic disorders include, but are not limited to, antibodies, small organic and inorganic molecules, peptides, which inhibit the activity and / or expression of target gene products.
Included are phosphopeptides, antisense and ribozyme molecules, triple helix molecules. More particular examples of potential antagonists are oligonucleotides that bind to fusions of immunoglobulins and PA polypeptides, particularly but not limited to poly- and monoclonal antibodies and antibody fragments, single chain antibodies, anti-idio. It includes type antibodies, and chimeric or humanized forms of these antibodies or fragments, as well as antibodies, including human antibodies and antibody fragments. Alternatively, the potential antagonist may be a closely related protein, eg, a mutated form of the PA polypeptide that recognizes the receptor but exerts no effect and thus competitively inhibits the action of the PA polypeptide.

Other potential PA polypeptide antagonists are antisense RNA or DNA constructs prepared using antisense technology, eg, antisense RNA or DNA is hybridized to a target mRNA to produce a protein. It acts to directly block the translation of mRNA by interfering with the translation. Antisense technology can be used to control gene expression through triple-helix formation or antisense DNA or RNA, both of which methods include polynucleotide D
Based on binding to NA or RNA. For example, the 5'coding portion of a polypeptide nucleotide sequence herein encoding a mature PA polypeptide has a sequence of about 10-40
Used in the design of base pair length antisense RNA oligonucleotides. DNA
Oligonucleotides are designed to be complementary to regions of the gene involved in transcription (Triple Helix-Lee et al., Nucl, Acid Res., 6: 3073 (1979); Cooney
Et al., Science, 241: 456 (1988); Dervan et al., Science, 251: 1360 (1991)).
, Thereby preventing transcription and production of PA polypeptide. Antisense RNA
The oligonucleotide hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule into a PA polypeptide (Antisense-Okano, Neurochem., 56 :.
560 (1991); Oligodeoxynucleotides as Antisense Inhibitors of Gene Expre
ssion (CRC Press: Boca Raton, FL, 1988)). The above oligonucleotide is
It is transported to cells and expressed antisense RNA or DNA in vivo to induce PA
It can also inhibit the production of the polypeptide. If antisense DNA is used, oligodeoxyribonucleotides derived from the translation initiation site, eg, between the -10 and +10 positions of the target gene nucleotide sequence, are preferred.

Antisense RNA or DNA molecules are generally at least about 5 bases long, about 1 base long.
0 base length, about 15 base length, about 20 base length, about 25 base length, about 30 base length, about 35 base length
Base length, about 40 base length, about 45 base length, about 50 base length, about 55 base length, about 60 base length, about 65 base length, about 70 base length, about 75 base length, about 80 base length, about 85 base length Base length, about 90 bases, about 95 bases, about 100 bases, or more. Potential antagonists include small molecules that bind to the active site, receptor binding site, or growth factor or other related binding site of the PA polypeptide, thereby blocking the normal biological activity of the PA polypeptide. Examples of small molecules include, but are not limited to, small peptides or peptide-like molecules, preferably soluble peptides, and synthetic non-peptide organic or inorganic compounds.

Ribozymes are enzymatic RNA molecules capable of catalyzing the specific cleavage of RNA. Ribozymes act by sequence-specific hybridization to complementary target RNA, followed by endonucleolytic cleavage. Specific ribozyme cleavage sites within potential RNA targets can be identified by known techniques. Further details can be found in, for example, Rossi, Cur
rent Biology 4: 469-471 (1994) and PCT publication, number WO 97/33551 (September 1997)
Issued on the 18th). Nucleic acid molecules in triple-helix formation used to inhibit transcription are single-stranded and composed of deoxynucleotides. The basic composition of these oligonucleotides is designed to promote triple helix formation via Hoogsteen base pairing rules,
It generally requires resizable extension of purines or pyrimidines on one strand of the duplex. For further details, see, for example, PCT publication, number WO 97/33551, supra. These small molecules can be identified by any one or more of the screening assays discussed above and / or by any other screening technique well known to those of skill in the art.

Drug Screening The present invention is particularly useful for screening compounds by using PA polypeptides or binding fragments thereof in various drug screening techniques. The PA polypeptide or fragment used in such a test, even when free in solution,
It may be immobilized on a solid support, carried on the cell surface, or located intracellularly. One method of drug screening utilizes eukaryotic or prokaryotic host cells that are stably transfected with recombinant nucleic acids expressing PA polypeptides or fragments. Agents are screened against such transfected cells in a competitive binding assay. Such cells, either in viable or immobilized form, can be used for standard binding assays. For example, the formation of complexes between the PA polypeptide or fragment and the reagent being tested may be measured. Alternatively, the reduction in complex formation between the PA polypeptide and its target cells caused by the agent being tested can be tested. Thus, the invention provides a method of screening for agents or any other reagents that can affect PA polypeptide-related diseases or disorders. These methods involve contacting the reagent with a PA polypeptide or fragment, (i) for the presence of a complex between the reagent and the PA polypeptide or fragment, or (ii) between the PA polypeptide or fragment and the cell. Including assaying for the presence of a complex between. In these competitive binding assays, the PA polypeptide or fragment is typically labeled. After appropriate incubation, free PA polypeptide or fragment is separated from its bound form and the amount of free or uncomplexed label is such that certain reagents bind to PA polypeptide or PA.
It measures the ability to inhibit the polypeptide / cell complex.

Other techniques for drug screening provide high throughput screening for compounds with suitable binding affinity for polypeptides, 1984 9
It is described in detail in WO84 / 03564 published on March 13. Briefly, a number of different small peptide test compounds are synthesized on a solid support such as plastic pins or some other surface. When applied to a PA polypeptide, the peptide test compound is reacted with the PA polypeptide and washed. Bound PA polypeptide is detected by methods well known in the art. Purified PA polypeptide can also be coated directly onto plates for use in the drug screening techniques described above. In addition, non-neutralizing antibodies can be used to capture the peptide and immobilize it on a solid support. The present invention also contemplates competitive drug screening assays in which neutralizing antibodies capable of binding PA polypeptides specifically compete with test compounds for PA polypeptides or fragments thereof. In this way, the antibody can be used to detect the presence of any peptide in the PA polypeptide that carries one or more antigenic determinants.

Rational Drug Design The purpose of rational drug design is to identify biologically active polypeptides of interest (eg, P
A polypeptides) or small molecules with which they interact, eg, structural analogs of agonists, antagonists, or inhibitors. Any of these examples can be used to determine the more active and stable form of PA polypeptide or PA in vivo.
It can be used to create drugs that promote or inhibit the function of polypeptides (Reference, Hodgso
n, Bio / Technology, 9: 19-21 (1991)). In one method, the three-dimensional structure of a PA polypeptide, or PA polypeptide-inhibitor complex, is determined by x-ray crystallography, computer modeling, and most typically by a combination of the two methods. Both the shape and charge of the PA polypeptide must be confirmed in order to elucidate the structure of the molecule and determine the active site. Although small in number, useful information regarding the structure of PA polypeptides may sometimes be obtained by modeling based on the structure of homologous proteins. In both cases, relevant structural information is used to design similar PA polypeptide-like molecules or to identify effective inhibitors. A useful example of rational drug design is Br
axton and Wells, Biochemistry, 31: 7796-7801 (1992), molecules with improved activity or stability, or Athauda et al., J. Biochem., 113: 742-746 (
1993) and molecules that act as inhibitors, agonists or antagonists of natural peptides.

Further, the target-specific antibody selected by the functional assay as described above can be isolated and its crystal structure can be elucidated. This method in principle produces a pharmacore upon which subsequent drug design can be based. Protein crystallography can be bypassed by generating anti-idiotypic antibodies (anti-ids) to functional, pharmacologically active antibodies. As a mirror image of a mirror image, the binding site of anti-ids can be expected to be an analog of the first receptor. Anti-
The ids can then be used to identify and isolate peptides from banks of chemically or biologically produced peptides. The isolated peptide will function as the pharmacore. In accordance with the present invention, sufficient amounts of PA polypeptides are available to carry out analytical experiments such as X-ray crystallography. Further, the knowledge of the PA polypeptide amino acid sequences provided herein provides the knowledge used in computer modeling techniques to replace or supplement X-ray crystallography.

Angiogenic Disorders Treated It has been found to have activity in the cardiovascular, angiogenic and endothelial assays described herein and / or their gene products located in the cardiovascular system. PA polypeptides or their agonists or antagonists are likely to have therapeutic use in a variety of angiogenic disorders, including systemic disorders affecting blood vessels, such as diabetes mellitus. Their therapeutic efficacy depends on arteries, capillaries, veins, and / or
Alternatively, it may involve lymphatic vessel disease. Therapeutic examples below include muscle wasting disease treatment, osteoporosis treatment, transplant fixation aids to stimulate cell growth around the transplant, thus facilitating binding to its intended site, IGF stability in tissue or serum. And, where appropriate, increased binding to the IGF receptor (as it has been shown in vitro that IGF enhances the growth of human bone marrow erythroid and granulocyte progenitor cells). The PA polypeptide or an agonist or antagonist thereof also stimulates erythropoiesis or granulopoiesis, stimulates wound healing and tissue regeneration, and affects tissues such as connective tissue, skin, bone, cartilage, muscle, lung or kidney. Related to re-growth related treatments,
It can be used to promote angiogenesis, stimulate or inhibit endothelial cell migration, and enhance vascular smooth muscle growth and endothelial cell production. Increased angiogenesis mediated by PA polypeptides or antagonists is beneficial in the ischemic tissue and the collateral coronary arteries of the heart following coronary stenosis. Antagonists inhibit the action of such polypeptides, and if PA polypeptides promote such production, to limit excessive connective tissue production, for example during wound healing or embryonic fibrosis. used. This includes acute myocardial infarction and heart failure.

Furthermore, the present invention relates to the treatment of cardiac hypertrophy by administering a therapeutically effective amount of a PA polypeptide, or an agonist or antagonist thereof, regardless of the underlying cause. When the purpose is treatment of human patients, the PA polypeptide is preferably a recombinant human PA polypeptide (rhPA or rhPA polypeptide).
Is. Treatment of cardiac hypertrophy can be performed at any of its various stages resulting in a wide variety of medical conditions, including myocardial infarction, hypertension, hypertrophic cardiomyopathy, and heart valve regurgitation. Treatment can be extended to all stages of the progression of cardiac hypertrophy, with or without structural damage to the myocardium, regardless of the underlying heart disease. Unlike antagonists of a molecule, the decision whether to use the molecule itself or its agonists for a particular indication is primarily due to the molecule promoting cardiovascularization, endothelial cell development, or angiogenesis, or It depends on whether these pathologies are inhibited. For example, if the molecule promotes angiogenesis, its antagonists would be useful in treating diseases where it is desired to limit or prevent angiogenesis. Examples of such diseases are associated with hemangiomas such as hemangiomas, tumor angiogenesis, retinal neovascularization, diabetic retinopathy or premature infantile retinopathy or macular degeneration and proliferative vitreoretinopathy. Choroid or cornea, rheumatoid arthritis, Crohn's disease, atherosclerosis, ovarian hyperstimulation, psoriasis, endometriosis associated with neovascularization, restenosis following balloon angioplasty, scar tissue overgrowth, eg surgery Such as later formed keloids, fibrosis after myocardial infarction, or fibrotic disorders associated with embryonic fibrosis.

However, if the molecule inhibits angiogenesis, it is expected to be used directly in the treatment of the above mentioned pathologies. On the other hand, if the molecule stimulates angiogenesis, itself (or an agonist thereof) may be, for example, peripheral vascular disease, hypertension, vasculitis, Raynaud's disease and Raynaud's phenomenon, aneurysm, and arterial restenosis, thrombophlebitis, lymph. Ductitis, lymphedema, wound healing and tissue repair,
It is used for indications where angiogenesis is desired, such as ischemia-reperfusion injury, angina, myocardial infarction, eg acute myocardial infarction, chronic heart disease, heart failure, eg congestive heart failure, and osteoporosis. However, if the molecule inhibits angiogenesis, its antagonists are used in the treatment of conditions in which angiogenesis is desired. Described below are certain types of diseases for which the PA polypeptides or antagonists herein will be useful as therapeutic targets for the prevention or treatment of diseases, or for targeted vascular agents. Atherosclerosis is a disease characterized by the accumulation of plaques in the thickened intima of the arteries due to fluid accumulation, smooth muscle cell proliferation, and the formation of fibrous tissue within the arterial wall. is there. The disease affects large, middle and small arteries in any organ. Changes in endothelial and vascular smooth muscle cell function
It is known to play an important role in regulating the accumulation and mitigation of these plaques.

Hypertension is characterized by elevated blood pressure in the systemic arteries, pulmonary arteries, or portal system. Elevated blood pressure results from or results in defective endothelial function and / or vascular disease. Vasculitis includes giant cell arteritis, Takayas arteritis, multiple nodular arteritis (including microangiopathy), Kawasaki disease, micropolyangiitis, Wegener's granulomatosis, and various infection-related blood vessels. Diseases (including Henoch-Schonlein purpura) are included. Altered endothelial cell function has been shown to be important in these diseases. Raynaud's disease and phenomenon are those characterized by intermittent abnormal defects in the circulation through limbs exposed to cold air. Altered endothelial cell function has been shown to be important in this disease.

Aneurysm is a saccular or fusiform dilatation of the arterial or venous dendritic tree associated with altered endothelial cells and / or vascular smooth muscle cells. Arterial restenosis (arterial wall restenosis) follows angiogenesis as a result of altered endothelial and vascular smooth muscle cell proliferation and function. Thrombophlebitis and lymphangitis are inflammatory diseases of the veins and lymphatic vessels that result and / or result in altered endothelial cell function, respectively. Similarly, lymphedema is a condition associated with defects in the lymphatic vessels from endothelial cell function. The family of benign and malignant vascular tumors is characterized by abnormal growth and growth of cellular elements of the vasculature. For example, lymphangioma is a congenital, often benign tumor of the lymphatic system of the bladder, a lymphoid malformation that usually occurs in newborns. Bladder tumors tend to grow in adjacent tissues. Bladder tumors usually occur in the cervix and axilla. They also occur in the soft tissues of the extremities. The main manifestation is swelling, sometimes lymph cysts surrounded by reticularly structured lymphoid and connective tissue.
Lymphangioma has been hypothesized to result from improper binding to fetal lymphatic vessels or their deletions. The result is local damage to lymph drainage. Griener
Et al, Lymphology, 4: 140-144 (1971).

Other uses of PA polypeptides or antagonists herein include growth and / or
Or in tumor angiogenesis involved in neovascularization of metastatic tumors. This process depends on the growth of new blood vessels. Examples of related pathologies involving neoplasia and tumor angiogenesis include breast cancer, lung carcinoma, gastric carcinoma, esophageal carcinoma, colorectal carcinoma, liver carcinoma, ovarian carcinoma, tecoma, male embryonal tumor, cervical carcinoma, uterus. Endometrial carcinoma, endometrial hyperplasia, endometriosis, fibrosarcoma, choriocarcinoma, head and neck cancer, nasopharyngeal carcinoma, laryngeal carcinoma, hepatoblastoma, Kaposi's sarcoma, melanoma, skin carcinoma, blood vessels Tumor, marine hemangioma, hemangioblastoma, pancreatic carcinoma, retinal carcinoma, astrocytoma, glioblastoma, schwannoma, oligodendroma, medulloblastoma,
Abnormal vascular growth, edema associated with neuroblastoma, rhabdomyosarcoma, osteogenic sarcoma, leiomyosarcoma, urosarcoma, thyroid carcinoma, Wilms tumor, renal cell carcinoma, prostate carcinoma, phakomatoses (Such as those associated with brain tumors) and Meigs syndrome. Age-related macular degeneration (AMD) is the cause of severe visual loss in the elderly population. The exudative form of AMD is characterized by choroidal neovascularization and retinal pigment endothelial cell detachment. Because choroidal neovascularization is associated with a dynamic decline in prognosis, PA
The polypeptides or their antagonists are expected to be useful in reducing severe AMD.

Also, wound healing, such as wound healing and tissue repair, is an application targeted by PA polypeptides or their antagonists herein. The formation and relaxation of new blood vessels is essentially tissue healing and repair. This category includes bones, cartilage, tendons,
Ligaments and / or nerve tissue growth or regeneration, as well as wound healing and tissue regeneration and replacement, and treatment of burns, amputations, and ulcers. PA polypeptides or antagonists thereof that induce cartilage and / or bone growth in environments where bone is not normally formed are indicated for the treatment of bone fractures and cartilage damage, or human and other animal defects. Such preparations using PA polypeptides or antagonists thereof are prophylactically used in reducing fractures and improving fixation of artificial joints. New bone formation induced by osteogenic agents contributes to the repair of congenital, trauma-induced, or oncological, resection-induced cranial defects and is also useful in cosmetic plastic surgery. Moreover, PA polypeptides or antagonists thereof better and faster occlude unhealed wounds including, but not limited to, pressure ulcers, ulcers associated with vascular insufficiency, surgical or traumatic wounds, etc. It is useful for promoting things.

Still further, PA polypeptides or antagonists thereof may be used in other tissues, such as organs (including, for example, pancreas, liver, intestine, kidney, skin or endothelium), muscle (smooth muscle, skeletal muscle or myocardium), and It may exhibit vascular (including vascular endothelium) tissue production or regeneration, or activity to promote cell growth involving such tissue. Part of the desired effect is to inhibit or regulate fibrotic scarring and regenerate normal tissue. The PA polypeptides or antagonists herein are also useful for pathology from systemic cytokine damage, and for reperfusion of wounds in various tissues, treatment of lung or liver fibrosis, and regeneration or protection. Also, the PA polypeptide or an antagonist thereof promotes or inhibits the differentiation of the above-mentioned tissues from precursor tissues or cells,
Alternatively, it is useful for inhibiting the growth of the above-mentioned tissues.

PA polypeptides or antagonists thereof can also be used in the treatment of periodontal disease and other tooth repair processes. Such drugs attract osteogenic cells,
It is provided in an environment that stimulates the growth of osteogenic cells or induces the differentiation of osteogenic cell progenitors. PA polypeptides or antagonists thereof herein stimulate the inflammation or inflammation of osteoporosis or osteoarthritis, eg bone and / or cartilage repair, as blood vessels play an important role in the regulation of bone rotation and growth. It is useful for treatment by blocking the process of process-mediated tissue destruction (collagenase activity, osteoclasts, etc.) or inflammation. Another category of tissue renewal activity, as claimed herein to be PA polypeptides or its antagonists, is tendon / ligament formation. Proteins that induce the formation of tendon / ligament-like tissue or other tissues in an environment where tissues are not normally formed are applied to the healing of tendon or ligament fissures, malformations, and tendon or ligament defects in humans and other animals. . Such preparations are prophylactically used in the prevention of damage to tendon or ligament tissue, as well as the improved fixation of tendon or ligament to bone or other tissue, and the repair of tendon or ligament tissue defects. New tendon / ligament-like tissue formation induced by a composition of PA polypeptides or antagonists herein contributes to the repair of tendon or ligament deficiencies of congenital, traumatic or other origin, It is also useful in cosmetic plastic surgery for the attachment or repair of tendons or ligaments. The composition herein attracts tendon- or ligament-forming cells, stimulates growth of tendon- or ligament-forming cells, induces differentiation of tendon- or ligament-forming cell progenitors, or recovers ex vivo, in vivo. Is provided in an environment that induces growth of tendon / ligament cells or progenitors in the tissue repair effect of. The compositions herein are also useful for tendinitis, carpal tunnel syndrome, and other tendon or ligament defects. In addition, the composition comprises the same suitable matrix and / or sequestrant as carriers well known in the art.

PA polypeptides or antagonists thereof are central and peripheral nervous system diseases and neuropathies involved in nerve cell proliferation and regeneration of nerve and brain tissue, ie degeneration of nerve cells or nerve tissue, death or trauma, and It is useful for treating mechanical or traumatic diseases. In particular, the PA polypeptide or an antagonist thereof has a peripheral nervous system condition such as peripheral nerve injury, peripheral neuropathy and focal neuropathy, and central nervous system condition such as Alzheimer's disease, Parkinson's disease, Huntington's disease, muscular atrophy. It is used to treat lateral sclerosis and Shy-Drager syndrome. Additional medical conditions treated with the present invention include mechanical or traumatic disorders such as spinal cord disorders, head trauma and cerebrovascular disorders such as stroke. Peripheral neuropathy resulting from chemotherapy or other medical therapies can also be treated with PA polypeptides or antagonists thereto. Ischemia-reperfusion injury is another sign. Endothelial cell dysfunction is important both in the initiation and regulation of sequelae of events that follow ischemia-reperfusion injury.

Rheumatoid arthritis is a further sign. The target of inflammatory cells that cross the blood vessel growth and vasculature is an important factor in the pathogenesis of the rheumatoid and serum negative forms of arthritis. In addition, the PA polypeptide or an antagonist thereof is prophylactically administered to patients with cardiac hypertrophy in order to prevent the progression of medical conditions and to avoid sudden death, including death of asymptomatic patients. Such prophylactic treatment is in the case of patients diagnosed with large left ventricular cardiac hypertrophy (maximum wall thickness of 35 mm or more in adults, or comparable in children), or of hemangiomas in the heart. This is especially justified in the case of particularly heavy loads. In addition, PA polypeptides or antagonists thereof are useful in the treatment of atrial fibrillation, which is expressed in a significant proportion of patients diagnosed with hypertrophic cardiomyopathy.

Further signs include angina, myocardial infarction, eg acute myocardial infarction, and heart failure,
For example, congestive heart failure is included. Further, non-neoplastic conditions include psoriasis, diabetes, and premature retinopathy, posterior lens fibroplasia, other proliferative retinopathy including neovascular glaucoma, thyroid hyperplasia (including Graves' disease), cornea and others. Tissue transplantation, chronic inflammation, pneumonia, nephrotic syndrome, preeclampsia, ascites, pericardial effusion (eg, associated with pericarditis), and pleural effusion. In view of the above, the PA polypeptides described herein, or agonists or antagonists thereof, which have been shown to alter or impact endothelial cell function, proliferation and / or morphology, may include many or all of the above. Plays an important role in the etiology and etiology of the diseases of, and could be provided as a vascular-related agent that targets these diseases, or as a therapeutic target to augment or inhibit these processes.

Administration Procotol, Schedule, Dose and Formulation The molecules described herein and their agonists and antagonists are pharmaceutically useful as prophylactic and therapeutic agents for the various diseases and conditions mentioned above. Therapeutic compositions of PA polypeptides or agonists or antagonists include any desired pharmaceutically acceptable carrier, excipient, or stabilizer (Remington's Pharmaceutical Sciences, 16th edition, Osol) of the desired molecule with suitable purity. , A., (1980)
) And a lyophilized formulation or an aqueous solution. Acceptable carriers, excipients, or stabilizers are non-toxic to recipients at the dosages and concentrations employed and include buffers such as phosphates, citrates, and other organic acids; ascorbic acid and Antioxidants containing methionine; preservatives (octadecyldimethylbenzylammonium chloride; hexamethonium chloride; benzalkonium chloride; benzethonium chloride; phenol, butyl or benzyl alcohol; alkylparabens such as methyl or propylparaben; catechol; resorcinol; cyclo Hexanol; 3-pentanol; and m-cresol); low molecular weight (less than about 10 residues) polypeptides; proteins such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; glycine, glutamine, asbestos Amino acids such as lagin, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates containing glucose, mannose, or dextran; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose, or sorbitol; sodium, etc. Salt-forming counterions; metal complexes (eg Zn-protein complexes); and / or TWEEN ™, PLURON
Includes nonionic surfactants such as ICS ™ or polyethylene glycol (PEG).

Further examples of such carriers are ion exchangers, alumina, aluminum stearate, lecithin, serum albumin such as human serum albumin, buffer substances such as phosphates, glycine, sorbic acid, potassium sorbate, Partial glyceride mixtures of saturated vegetable fatty acids, water, salts or electrolytes such as protamine sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, zinc salt, colloidal silica, magnesium trisilicate, polyvinylpyrrolidone, cellulose-based Substance, and propylene glycol. Topical carriers or gel-based forms of antagonists include polysaccharides such as sodium carboxymethylcellulose or methylcellulose, polyvinylpyrrolidone, polyacrylates, polyoxyethylene-polyoxypropylene block copolymers, polyethylene glycol, and mokul alcohol. For any administration, conventional depot forms are preferably used. Such forms include, for example, microcapsules, nano-capsules, liposomes, plasters, inhalation forms, nasal sprays, sublingual tablets, and sustained release formulations. The PA polypeptide or agonist or antagonist is typically formulated in such vehicles at a concentration of about 0.1 mg / ml to 100 mg / ml.

Other preparations are included with the PA polypeptide or antagonist thereof incorporated into the product formed. Such products can be used to regulate endothelial cell growth and angiogenesis. In addition, tumor invasion and metastasis may be regulated with these products. PA polypeptides or antagonists used for in vivo administration must be sterile. This is easily accomplished by filtration through sterile filter membranes before or after lyophilization and reconstitution. PA polypeptides are usually stored in lyophilized form or in solution when administered systemically. When in lyophilized form, the PA polypeptide or agonist thereof is typically formulated in combination with other ingredients, including a suitable diluent at the time of use. An example of a liquid formulation of a PA polypeptide or antagonist is a sterile, clear, colorless, fresh solution filled in single-dose vials for subcutaneous injection. Preservative pharmaceutical compositions suitable for repeated use depend mainly on, for example, the type and indication of the polypeptide: a) PA polypeptides or their agonists or antagonists; b) the stability of the polypeptides or other molecules in solution. A buffer capable of maintaining a pH within a range of maximization, preferably a pH of about 4-8; c) a detergent / surfactant that primarily stabilizes the polypeptide or molecule against agitation-induced assembly; d). An isotonicity agent; e) a preservative selected from the group of phenols, benzyl alcohol and benzethonium halides such as chlorides; and f) water.

If the cleaning agent used is nonionic, it is for example polysorbate.
(E.g., POLYSORBATETM (TWEENTM) 20, 80, etc.), poloxamer (e.g., POLOXAMER
TM188). By using a nonionic surfactant, the formulation can be exposed to shear of surface stress without causing protein denaturation.
Furthermore, such surfactant-containing preparations can be used for aerosol devices such as pulmonary administration,
And those used in needleless jet injection guns (see, eg, EP 257,956). An isotonicity agent is present to ensure isotonicity of liquid compositions of PA polypeptides or antagonists thereof, and is a polyhydric sugar alcohol, preferably a trihydric or higher sugar alcohol, such as glycerin, erythritol, arabitol, xylitol. , Sorbitol and mannitol. These sugar alcohols can be used alone or in combination. Alternatively, sodium chloride or other suitable inorganic salt may be used to make the solution isotonic. The buffer may be an acetate, citrate, succinate or phosphate buffer, depending on the pH desired. One type of p for liquid formulations of the present invention
H is buffered in the range of about 4 to 8, preferably at about physiological pH.

Preservatives, phenols, benzyl alcohol and benzethonium halides,
Chloride, for example, is a well known antimicrobial agent that can be used. Therapeutic PA polypeptide compositions are generally placed in a container having a sterile access port, such as an intravenous solution bag or a vial having a stopper pierceable by a hypodermic needle. The formulation is preferably repeated intravenously (iv), subcutaneously
(sc) or as an intramuscular (im) injection or as an aerosol formulation suitable for intranasal or intrapulmonary delivery (for intrapulmonary delivery see, for example, European Patent No.
257,956). The PA polypeptide can also be administered in the form of sustained release formulations. Suitable examples of sustained-release preparations include semipermeable matrices of solid hydrophobic polymers containing the protein, which matrices are in the form of shaped articles, eg films or microcapsules. Examples of sustained release matrices include polyesters, hydrogels (e.g. Lan
Ger et al., J. Biomed. Mater. Res., 15: 167-277 (1981) and Langer, Chem. Tech.
, 12: 98-105 (1982), poly (2-hydroxyethyl-methacrylate), or poly (vinyl alcohol)), polyactide (US Pat. No. 3,773,919,
EP 58,481), a copolymer of L-glutamic acid and gamma-ethyl-L-glutamate (Sidman et al., Biopolymers, 22: 547-556 (1983)), non-degradable ethylene-
Vinyl acetate (Langer et al., Supra), degradable lactic acid-glycolic acid copolymer, eg Lup
ron Depot ^™ (injectable microspheres consisting of lactic acid-glycolic acid copolymer and leuprolide acetate), and poly-D-(-)-3-hydroxybutyric acid (EP 133,988).
No.) is included.

While polymers such as ethylene-vinyl acetate and lactic acid-glycolic acid enable release of molecules for over 100 days, certain hydrogels release proteins for shorter time periods. If the encapsulated protein remains in the body for a long period of time, it may be denatured or aggregated by exposure to water at 37 ° C., resulting in loss of physiological activity or alteration of immunogenicity. Rational measures are conceivable to obtain protein stability by such a mechanism. For example, if it was found that the aggregation mechanism was intermolecular SS bond by thio-disulfide exchange, the sulfhydryl residue was changed, freeze-dried from an acidic solution, the water content was adjusted, and an appropriate additive was used. Stability can be achieved by developing specific polymer matrix compounds. The sustained release PA polypeptide composition also includes liposomally encapsulated PA polypeptide. Liposomes containing PA polypeptides are known per se, eg by DE 3,218,121, Epstein et al., Proc. Natl. Acad. Sci. USA, 8
2: 3688-3692 (1985), Hwang et al., Proc. Natl. Acad. Sci. USA, 77: 4030-4034 (1
980); European Patent 52,322; 36,676; 88,046; 143,949; 142,
641; Japanese Patent Application No. 83-118008; US Patent Nos. 4,485,045 and 4,544,545.
And European Patent No. 102,324. Usually, liposomes are microlamellar (about 200-800 angstroms) unilamellar with a lipid content of about 30 mol% or more and cholesterol adjusted to the optimal therapeutic method.

A therapeutically effective amount of a PA polypeptide or antagonist thereof will, of course, be the pathological condition to be treated (including prophylaxis), the mode of administration, the type of compound used in the treatment, and any included. It will depend on factors such as concurrent treatment, patient age, weight, general medical condition, medical history, etc., which are well determined within the skill of the attending physician. Therefore, the therapist needs to titrate the dosage and modify the route of administration to obtain the maximum therapeutic effect. If the PA polypeptide has a narrow host range, it is preferred for treatment of human patients to be a preparation containing human PA polypeptide, more preferably native sequence human PA polypeptide. The clinician will administer the PA polypeptide until the dosage achieves the desired effect in treating the condition. For example, if the goal is treatment of CHF, it is an amount that inhibits the progressive cardiac hypertrophy associated with this condition. The progress of this treatment is easily monitored by echocardiography. Similarly, patients with hypertrophic cardiomyopathy can be empirically administered PA polypeptides. In the above guidelines, an effective dose is generally about 0.001 to about 1.0 mg / k.
g, preferably about 0.01-1.0 mg / kg, most preferably about 0.01-0.
． It is within the range of 1 mg / kg.

For parenteral use in the treatment of adult hypertension, about 0.01 to 50 mg, preferably about 0.05 to 20 mg, most preferably 1 to 20 mg of PA polypeptide per kg body weight is administered in the form of an injection. It is advantageous to administer 1 to 3 times a day by intravenous injection. For oral administration, the PA polypeptide-based molecule is preferably about 5 mg to 1 g / kg body weight, preferably about 10-100.
mg, 1 to 3 times daily. Endotoxin contaminants should be kept at a minimum safe level, eg less than 0.5 ng / mg protein. Moreover, for human administration, the preparations are preferably sterile, pyrogenic, generally safe, and FDA Office a
Purified as required by nd Biologics standards. Dosage regimens for pharmaceutical compositions containing PA polypeptides used for tissue regeneration include:
Various factors that alter the action of the polypeptide, such as the tissue desired to be formed, the damaged site, the condition of the damaged tissue, the size of the wound, the type of damaged tissue (e.g. bone), the patient's It will be determined by the attending physician taking into account age, sex, diet, severity of infection, time of administration, and other clinical factors. The dose may vary depending on the type of matrix used for reconstitution, other protein content of the pharmaceutical composition. For example, the addition of other well known growth factors such as IGF-I to the final composition further affects the dose. Progress can be monitored by periodic assessment of tissue / bone growth and / or repair, for example by X-rays, histomorphometric determinations and tetracycline labeling.

The route of administration of the PA polypeptide or antagonist or agonist is according to well-known methods, for example, intravenous, intramuscular, intracerebral, intraperitoneal, cerebrospinal, subcutaneous, intraocular, intraarticular, intrasynovial, encapsulating. By injection or infusion by the oral, oral, topical or inhalation routes, or by the sustained release system described below. Further, PA polypeptides or their antagonists are preferably administered by intratumoral, peritumoral, intralesional, or perilesional routes, and exert local and systemic therapeutic effects. The intraperitoneal route is expected to be particularly useful in the treatment of ovarian tumors, for example. When the peptide or small molecule is used as an antagonist or agonist,
Preferably, it is administered to a mammal orally or parenterally in liquid or solid form. Examples of pharmaceutically acceptable salts of molecules that form salts and are useful below include alkali metal salts (e.g. sodium salt, potassium salt), alkaline earth metal salts (e.g. calcium salt, magnesium salt), ammonium. Included are salts, organic base salts (eg pyridine salts, triethylamine salts), inorganic acid salts (eg hydrochloric acid, sulfates, nitrates) and organic acid salts (eg acetates, oxalates, p-toluenesulfonates).

Methods of treatment in compositions described herein and useful for bone, cartilage, tendon, or ligament regeneration include topically, systemically or locally as an implant or device.
y) administration of the composition is included. When administered, the therapeutic composition used is in a pyrogen-free, physiologically acceptable form. Further, it is desirable that the composition be injected or encapsulated in a viscous form that is delivered to the site of damage to bone, cartilage or tissue. Topical administration is suitable for wound healing and tissue repair. Preferably, for the formation of bone and / or cartilage, the composition delivers the protein-containing composition to the site of bone and / or cartilage damage, preferably developing resorbable bone and cartilage into the body. It includes a matrix that can provide a structure. Such matrices are made of materials used in other implantable medical applications. The choice of matrix material is based on biocompatibility, biodegradability, mechanical properties, cosmetic appearance, and surface activity. The particular use of the composition will be defined by the appropriate formulation. The latent matrix of the composition is biodegradable and may be chemically defined calcium sulfate, tricalcium phosphate, hydroxyapatite, polylactic acid, polyglycolic acid, and polyanhydride. Other potential matrices are biodegradable and biologically well defined, eg bone or dermal collagen. The further matrix consists of pure proteins or extracellular matrix components. Other potential matrices are non-biodegradable and chemically defined, such as sintered hydroxyapatite, bioglass, aluminates, or other ceramics. The matrix may be of any type of material described above, for example a combination of polylactic acid and hydroxyapatite or collagen and tricalcium phosphate. The bioceramic may be altered in composition, for example, calcium-aluminate-phosphate, and may be processed to alter pore size, particle size, particle shape and biodegradability.

In one particular embodiment, the lactic acid and glycolic acid are 50:50 (molar weight) copolymer and are in the form of porous particles having a diameter in the range of 150 to 800 microns. In some applications, sequestering agents such as carboxymethyl cellulose, or autologous clots are utilized to help protect the composition from separation from the matrix. One suitable family of sequestrants is cellulosic materials such as alkylcelluloses (including hydroxyalkylcelluloses), including methylcellulose, ethylcellulose, hydroxyethylcellulose, hydroxypropylcellulose, hydroxypropylmethylcellulose and carboxymethylcellulose, preferably carboxymethylcellulose. It is a cationic salt of methyl cellulose (CMC). Other preferred sequestrants include hyaluronic acid, sodium alginate, poly (ethylene glycol), polyoxyethylene oxide, carboxyvinyl polymers, and poly (vinyl alcohol). The amount of sequestrant useful herein is 0.5-20% by weight, preferably 1-10% by weight, based on the total weight of the preparation, to desorb the polypeptide (or its antagonist) from the polymer matrix. And imparting appropriate operability to the composition and further preventing the penetration of progenitor cells into the matrix, thus providing the polypeptide (or its antagonist) with the opportunity to promote progenitor osteogenic activity. Is the amount needed to

Combination Therapy The efficacy of PA polypeptides, or agonists or antagonists thereof, in the prevention or treatment of disease in question is combined with other agents effective for these purposes, either in the same composition or in separate compositions. Or improved by continuous administration of the active agent. For example, for the treatment of cardiac hypertrophy, PA polypeptide treatment is well known for inhibitors of myocardial myocyte hypertrophic factors, such as inhibitors of α-adrenergic agonists such as phenylephrine; endothelin-I inhibitors such as BOSENTANTM and MOXONODINTM. ; C
Inhibitors for T-1 (US Pat. No. 5,679,545); Inhibitors for LIF; ACE
Inhibitors; Des-asparatate-angiotensin I inhibitors (US Pat. No. 5,773,415)
No.) and angiotensin II inhibitor can be combined.

For the treatment of cardiac hypertrophy associated with hypertension, the PA polypeptide is administered with a β-adrenergic receptor blocking agent such as propranolol, timolol, tartarolol, carteolol, nadolol, betaxolol, penbutolol,
Acetobutolol, Atenolol, Metoprolol, or Carvedilol; A
CE inhibitors such as quinapril, captopril, enalapril, ramipril,
Benazepril, fosinopril or lisinopril; diuretics such as chlorothiazide, hydrochlorothiazide, hydroflumetazide, methylclothiazide, benzthiazide, dichlorophenamide, acetazolamide, or indapamide; and / or calcium channel blockers, such as diltiazem,
It can be administered in combination with nifedipine, verapamil or nicardipine.
Pharmaceutical compositions containing the therapeutic agents identified herein by generic name are commercially available and are administered according to the manufacturer's instructions for dosing, mode of administration, side effects, contraindications, etc. For example, Physicians'Desk Reference (Medical Economics Data Production Co .: M
ontvale, NJ, 1997), 51th Edition. Preferred candidates for combination therapy in the treatment of hypertrophic cardiomyopathy are beta-adrenergic receptor blocking agents (e.g., propranolol, timolol, tartarolol, carteolol, nadolol, betaxolol, penbutolol, acetobutolol, atenolol, metoprolol, or carvedilol. ), Verapamil, difedipine, or diltiazem. To treat hypertrophy with high blood pressure,
Calcium channel blockers such as diltiazem, nifedipine, verapamil or nicardipine; β-adrenergic receptor blocking agents; diuretics such as chlorothiazide, hydrochlorothiazide, hydroflumetazide, methylclothiazide, benzthiazide, dichlorophenamide, acetazolamide, or indapamide. And / or the use of anti-hypertensive agents using ACE inhibitors such as quinapril, captopril, enalapril, ramipril, benazepril, fosinopril or lisinopril.

For other indications, PA polypeptides or their antagonists may be combined with other agents useful in the treatment of bone and / or cartilage defects, wounds or tissues in the problem. Such agents include various growth factors such as EGF, PDGF, T
GF-α or TGF-β, IGF, FGF, and CTGF are included. In addition, PA polypeptides or their antagonists used in the treatment of cancer are combined with cytotoxic, chemotherapeutic or growth inhibitory agents as specified above. Also, for the treatment of cancer, the PA polypeptide or an antagonist thereof is suitably administered sequentially or in combination with radiological treatment, with or without irradiation or administration of radioactive material. The effective amount of the therapeutic agent administered in combination with the PA polypeptide or its antagonist is at the discretion of the physician or veterinarian. Dosage and adjustments are made to achieve maximal therapeutic effect on the condition being treated. For example, in the treatment of hypertension, these amounts ideally take into account the use of diuretics or digitalis, and hypertension or hypotension, renal damage, etc. The dose depends on such factors as the particular patient being treated and the type of therapeutic agent used. Typically, the amount used is the same dose as when the therapeutic agent is not administered with the PA polypeptide.

Articles of Manufacture An article of manufacture, such as a kit, containing a PA polypeptide or agonist or antagonist thereof useful for the diagnosis or treatment of the disorders described above comprises at least one container and label. Suitable containers include, for example, bottles, vials, syringes and test tubes. The container can be formed from various materials such as glass or plastic. The container holds a composition useful for diagnosing or treating a condition and may have a sterile access port (for example, the container may be an intravenous fluid bag or vial with a stopper pierceable by a hypodermic injection needle). ). The active agent in the composition is the PA polypeptide or an agonist or antagonist thereof. The label on, or associated with, the container indicates that the composition is used for diagnosing or treating the condition of choice. The article of manufacture may further comprise a second container containing a pharmaceutically acceptable buffer such as phosphate buffered saline, Ringer's solution, and dextrose solution. In addition, other materials desirable from a commercial and user standpoint may be provided, including other buffers, diluents, filters, needles, syringes, and packaging inserts with instructions for use. The article of manufacture may also include a second or third container containing the other activator described above.

The present invention is further described in the following examples, which do not limit the scope of the claimed invention. The following examples are provided for illustrative purposes only and are not intended to limit the scope of the invention in any way. All commercially available reagents referred to in the examples were used according to manufacturer's instructions unless otherwise indicated. Sources of cells identified by the ATCC Registry Number in the examples below and throughout the specification are Virginia,
Manassas, American type culture collection.

Example 1: Quantitative Expression Analysis QEA is a method for rapid detection and quantification of gene expression in tissues or cells. This process uses a proprietary process called GeneCalling, which allows a quantitative method to identify all of the different mRNA transcripts differentially expressed in RNA samples from cells or tissues. . The QEA GeneCalling ™ method involves preparation of total RNA followed by mRNA purification and double-stranded cDNA synthesis. This produces a cDNA fragment attached to the linker following digestion of the cDNA with a restriction enzyme pair. The primer pair with the specific sequence of the linker used is then used to amplify the products of the PCR reaction. HUVECs grown on collagen gel were dissolved in Trizol reagent and total RNA was prepared according to the Trizol recommended method. Biotinylated oligo-dt _(
25) / Poly-A ⁺ RNA was prepared by fractionating total RNA using the / streptavidin magnetic bead method (MPG, Lincoln Park, NJ). cDNA for oligo-dt
Prepared by reverse transcription of primed mRNA followed by second strand synthesis.

Double-stranded DNA was then digested with a pair of restriction enzymes with 6 base pair recognition sites. Four
Eight or more enzyme pairs were used and these were chosen to achieve the typical range of the majority of possible sequences in a given cDNA sample. If possible, the GeneCalling (trade name) results were confirmed using the TaqMan (trade name) method. TaqMan ™ is a PCR-based method for measuring gene expression. An oligonucleotide probe labeled with a gene-specific PCR oligonucleotide primer pair and a reporter fluorescent dye at the 5'end and a quencher fluorescent dye at the 3'end was used in Oligo 4.0 software (National Bioscience, Plymouth).
MN). Total RNA (50 ng) from the resulting cells was added to a 50 ml RT-PCR reaction mixture at various time points ranging from 30 minutes to 2 days by the manufacturer (Roche Mol).
ecular Systems Inc. Branchburg, NJ). Temperature cycle conditions are 48 ° C for 1/30 cycle, 95 ° C for 1/10 cycle,
40 cycles of 15 seconds at 95 ° C, 1 minute annealing at 60 ° C, and 2 at 25 ° C
Included a final hold of minutes. A standard curve for expression of each gene was generated by serial dilution of a standard preparation of total RNA isolated from quiescent HUVEC grown in monolayer medium. Data were expressed as fold induction normalized to the same gene from resting HUVEC RNA. Data obtained with RNA extracted from HUVEC grown on collagen membranes were included for comparison. HUVECs grown on collagen membranes did not undergo tube-like structure differentiation.

Example 2: Isolation of cDNA clones encoding human PA Three-dimensional collagen gel formation: Endothelial tube formation is an important process in vascular development during angiogenesis and angiogenesis. Human umbilical cord endothelial cells (HUVEC) undergo tube formation in collagen gels in the presence of growth factors that mimic the angiogenic environment of endothelial cells in vivo, resulting in angiogenesis and angiogenesis in both normal and tumorigenic conditions. Provide a well-accepted system for Three-dimensional gels are a prerequisite for endothelial cell differentiation and fusion. HUVEC grown on gelatin gel or plastic do not undergo tube formation. (See Figure 1, Panels A-J, and Figure 2). Briefly, HUVECs induce tube formation with either collagen membranes (non-inducible) or collagen gels (inducible) with or without the addition of growth factors that stimulate normal angiogenic or ductal inducers. It grows in a variety of conditions, whether sexual or non-inducible. Differential cDNA screening was used to identify genes important in this process. A particular method used to quantify endothelial cell expression is described by quantitative expression analysis (QEA, US Pat.
No. 1,697). HUVEC total RNA was prepared, followed by mRNA purification and double-stranded cDNA synthesis. The cDNA was digested with a restriction enzyme pair to generate a linker-ligated cDNA fragment. The primer pair with the specific sequence of the linker used was then used to amplify the products of the PCR reaction. Quantification and identification of amplified products revealed modulated genes, and genes so identified were important for angiogenesis.

Tube formation Collagen gels were prepared with ice-cold gelatin solution (10XM199, water, 0.53M NaHCO3.
, 200mML-glutamine, type I collagen, 0.1M NaOH; by volume 100: 27.7: 50: 10
: 750: 62.5) and cells were formed by mixing in 1 × basal medium at a concentration of 3 × 10 ⁶ cells / ml in a ratio of 4 volumes gelatin solution: 1 volume cells. Gels were formed by incubation for 30 minutes to 1 hour at 37 ° C in a CO2 free incubator. The gel is then 1% FBS, 1XITS, 2 mM L-glutamine, 50 mg / ml ascorbic acid, 26.5 mM NaHCO3, 100 U / ml penicillin and 100 U /.
Coated with 1 × basal medium containing M199 supplemented with ml streptomycin. In tube formation experiments, 80 nM PMA, 40 ng / ml bFGF and 40 ng / ml VEGF were added to the culture medium. In a parallel set of experiments, 1% FBS, 1XITS, 2 mM L-glutamine, 50 mg / ml
80 nM PMA, 40 ng / ml bF in 1X basal medium containing M199 supplemented with ascorbic acid, 26.5 mM NaHCO3, 100 U / ml penicillin and 100 U / ml streptomycin
Endothelial cells in the presence or absence of GF and 40 ng / ml VEGF were cultured on the surface of type I collagen or pig skin gelatin (Difco). In the GeneCalling experiment, mRNA was isolated from cells incubated for 4, 24 and 48 hours under the above conditions.

MRNA Isolation and cDNA Synthesis Medium was aspirated from the surface of collagen gel and 3 volumes of Tri-reagent-LS (Molecular Re
Gels were minced into 50 ml polypropylene tubes containing search center, Cincinnati, OH). Tube-grown cells at 10 ° C at 23 ° C with moderate and gentle shaking.
Incubated for minutes. The tubes were stored at -80 ° C until all experimental samples were collected. The tubes were then thawed at room temperature and mRNA was extracted according to the manufacturer's instructions. The RNA pellet was resuspended in DEPC treated water and RNA content was quantified spectrophotometrically at 260 nm. RNA samples were stored at -20 ° C. Samples used for GeneCalling ™ analysis were shipped to Curagen (New Haven, CT) on dry ice. Samples from 4, 24 and 48 hours were used for GeneCalling analysis, and in another experiment, in collagen gel and 80 nM PMA, 40 ng / ml bFGF and 40 ng / ml VEGF.
Cell samples grown on the surface of type I collagen in supplemented 1X basal medium, 30 min, 2
, 4, 8, 16, 24, 38 and 46.5 hours prepared for Taqman confirmation.

For quantitative expression analysis, DNAseI of isolated RNA (Promega, Madison
, WI) to remove contaminated DNA. MRNA using the biotinylated oligo-dT-streptavidin magnetic beads method (MPG, Lincoln Park, NJ)
Poly-A ⁺ RNA was prepared by fractionation of total RNA using a purification kit, followed by cDNA synthesis by reverse transcription and second strand synthesis of oligo-dt primed mRNA (Superscript II, Life Technologies). Removal of terminal phosphoric acid is done by Artic Shrimp
CDNA was purified by treatment with alkaline phosphatase (American Life Sciences, Piscataway, NJ), followed by phenol-chloroform extraction. The yield of cDNA was quantified by a fluorometric method using Picogreen dye (Molecular Probes, Eugene OR). Double-stranded DNA was digested using a pair of restriction enzymes with 6 base pair regulatory sites. Forty-eight or more enzyme pairs were used and they were selected so that the most representative range of possible sequences of a given DNA sample was achieved.
PCR amplification with a specific linker was performed as previously described. Final D
The NA product was denatured by heating to 96 ° C. and electrophoresed on an ultrathin polyacrylamide gel under denaturing conditions of 6M urea. The PCR product is FA on the product
Due to the presence of M label, multicolor laser excited Niagara (Curagen, New Haven CT)
Visualization was performed using an image system.

Data Interpretation Gene Calling uses a well-integrated, web-based, intercommunicating bioinformatics data aggregation and analysis suite called "GeneScape." The data from Niagara Gel was GeneCalled against public and proprietary databases using current statistical and mathematical standards.
And the gene list is generated from the cDNA fragment data, which is a list of genes to which the DNA fragment is likely to belong based on the size of the fragment and one of the restriction enzyme pairs that purifies it in the known sequence. If no candidate gene is obtained, the cDNA fragment is digested to belong to the putative novel gene.

Gene Call Confirmation Gene call is defined as the likelihood that a cDNA belongs to a known gene. Gene Cole, as previously described for known sequences of genes of interest (
Shimkets et al., Nature Biotechnology) Poisoning used in the design of poisoning primers (
Confirmed in the poisoning) reaction. The disappearance of the cDNA of interest confirms that the cDNA fragment belonged to the gene for which the primer was designed. Novel cDNA Fragments If no Gene call was obtained for the cDNA fragment, the cDNA fragment was eluted and transformed into E. coli with the standard TA-cloning vector (Invitrogen, Palo Al.
to, CA). The cDNA fragment is then sequenced and the resulting sequence is used to design an addictive primer for confirmation as described above.

Differentially Expressed Gene Selection (Gating) The experimental design was 1 × supplemented with 80 nM PMA, 40 ng / ml bFGF and 40 ng / ml VEGF.
It is based on the observation that endothelial cells grown on the surface of type I collagen in basal medium do not tube form and remain as a monolayer. This is also true when cells grow in the form of gelatin, denatured collagen. However, cells were suspended in a three-dimensional collagen gel, and 80 nM PMA, 40 ng / ml bFGF and 40 ng / ml VEG
When grown in 1X basal medium supplemented with F, cells undergo synchronized differentiation to become interconnected tube-like networks. Tubular structures include lumen-like structures. At 4 hours, large intracellular vacuoles are formed, but the cells are still spherical. At 24 hours, the cells begin to grow and many cells come into contact with other cells. By 48 hours,
The cells bind to each other and share a common lumen. In order to select the gene that plays a role in this differentiation, the 2D (type I collagen or gelatin surface) environment changes more than twice in 24 and 4, 48 and 4 or 48 and 4 hours in 3D gel environment. Then, different GeneCalling arrays were assembled so that cDNA fragments that did not change or that changed less than 2-fold in the same time comparison were preferentially selected and identified. In addition, cDNA fragments were identified that showed large (8-fold or more) changes in gene expression.

Example 3: Use of PA DNA as a Hybridization Probe The following method describes the use of a nucleic acid sequence encoding PA DNA as a hybridization probe. The DNA containing the coding sequence for the full-length or mature PA polypeptide is human tissue cDNA.
It is used as a probe for screening homologous DNAs (such as those encoding naturally occurring variants of PA) in NA libraries or human tissue genomic libraries. Hybridization and washing of filters containing either library DNA was performed under the following high stringency conditions. Hybridization of the radiolabeled PA-derivatized probe to the filter was performed with 50% formamide, 5xSSC, 0.
1% SDS, 0.1% sodium pyrophosphate, 50 mM sodium phosphate, pH
6.8, 2x Denhard's solution, and 10% dextran sulphate in solution at 42 ° C for 20 hours. Wash the filter with 0.1x SSC and 0.1% SD
It was carried out in an aqueous solution of S at 42 ° C. DNAs having the desired sequence identity with the full length native sequence PA DNA can then be identified using standard methods known in the art. Also, a fragment of PA DNA can be used as a probe in a method similar to the above, or an RNA transcript produced from DNA encoding PA polypeptide (or a DNA fragment encoding a part of PA polypeptide) is , Can be used as a probe as well. The preparation of such DNA fragments and RNA transcripts comprises
It is well known in the art and can be implemented by any person skilled in the art.

Example 4: Expression of the PA gene in E. coli This example illustrates preparation of a non-glycosylated form of PA polypeptide by recombinant expression in E. coli. The DNA sequence encoding the PA polypeptide was first amplified using selected PCR primers. The primer must have a restriction enzyme site corresponding to the restriction enzyme site of the selected expression vector. Various expression vectors are used. An example of a suitable vector is pBR322 (derived from E. coli; Boli
var et al., Gene, 2:95 (1977)) and includes genes for ampicillin and tetracycline resistance. The vector is digested with restriction enzymes and dephosphorylated. The PCR amplified sequence is then ligated into the vector. The vector preferably contains an antibiotic resistance gene, a trp promoter, a polyhis leader (including the first 6 STII codons, polyhis sequences, and an enterokinase cleavage site), a PA coding region, a lambda transcription terminator, and an argU gene. .

The ligation mixture is then used to transform selected E. coli using the method described in Sambrook et al., Supra. Transformants are identified by their ability to grow on LB plates and then antibiotic resistant clones are selected.
Plasmid DNA is isolated and confirmed by restriction analysis and DNA sequence analysis. Selected clones can be grown overnight in liquid media such as LB broth supplemented with antibiotics. The overnight medium is subsequently used to seed large-scale medium.
The cells are then grown at optimal density during which the expression promoter operates. After culturing for a few more hours, the cells can be harvested and centrifuged. The cell pellet obtained by centrifugation was solubilized using various reagents known in the art, and solubilized P
Protein A was purified using metal chelation columns under conditions that allow for tight binding of the polypeptide.

[0237]   PA polypeptides are poly-His tagged in E. coli using the following procedure.
Can be expressed in various forms. DNA encoding PA using selected PCR primers
First amplified. The primers should be compatible with the restriction enzyme sites of the selected expression vector.
Compatible restriction enzyme sites, and efficient and reliable translation initiation, metal chelate columns
Others that provide rapid purification with, and proteolytic removal with enterokinase
Contains useful sequences. Expression of the poly-His tag sequence, which was then PCR amplified
To the strain 52 (W3110 fuhA (tonA) lon galE rpoHts (htpRts) c
It was used to transform E. coli hosts based on lpP (lacIq)). Transformants first
3-5 O in LB containing 50 mg / ml carbenicillin with shaking at 30 ° C.
． D. Grow to 600. The medium was then changed to CRAP medium (3.57 g _Four )_TwoSO_Four, 0.71g sodium citrate 2H_TwoO, 1.07 g KCl, 5.36 g
Difco yeast extract, 5.36 g Sheffield hycase SF in 500 mL water, and 110 mM M
POS, pH 7.3, 0.55% (w / v) glucose and 7 mM MgSO 4._FourA mixture of
(Prepared in 1.) and grown for about 20-30 hours with shaking at 30 ° C.
. Remove the sample, confirm the expression by SDS-PAGE, and centrifuge the bulk medium.
Separated to give a pellet of cells. Freeze the cell pellet until purification and refolding.
Let

E. coli paste from 0.5 to 1 L of fermentation (6-10 g pellets) was resuspended at 10 volumes (w / v) in 7M guanidine, 20 mM Tris, pH 8 buffer. Solid sodium sulfate and sodium tetrathionate were added to give final concentrations of 0.1M and
0.02M and the solution was stirred at 4 ° C overnight. This step resulted in a denatured protein with cysteine residues blocked by sulfite. Beckman solution
Concentrate in Ultracentifuge at 40,000 rpm for 30 minutes. Dilute the supernatant with 3-5 volumes of metal chelate column buffer (6 M guanidine, 20 mM Tris, pH 7.4) to give 0.22
Clarified by filtration through a micron filter. The clarified extract was loaded onto a 5 ml Qiagen Ni-NTA metal chelate column equilibrated with the metal chelate column buffer. The column was washed with additional buffer containing 50 mM imidazole (Calbiochem, Utrol grade), pH 7.4. The protein was eluted with a buffer containing 250 mM imidazole. Fractions containing the desired protein were pooled and stored at 4 ° C. The protein concentration was estimated by its absorption at 280 nm using the extinction coefficient calculated on the basis of its amino acid sequence.

Protein was added to 20 mM Tris, pH 8.6, 0.3 M NaCl, 2.5 M urea, 5 mM
Proteins were refolded by gradual dilution into a freshly prepared refolding buffer consisting of cysteine, 20 mM glycine and 1 mM EDTA. The refolding volume was chosen to give a final protein concentration of 50-100 micrograms / ml. Refolding solution 12-3 at 4 ° C
Stir slowly for 6 hours. In the refolding reaction, TFA was collected at a concentration of 0.4% (about
It was stopped by addition at pH 3). Before further purifying the protein, the solution was filtered through a 0.22 micron filter and acetonitrile was added to a final concentration of 2-.
Added at 10%. The refolded protein was loaded onto a Poros R1 / H reverse-phase column with 0
Chromatograph using elution with a migration buffer of .1% TFA and a gradient of 10-80% acetonitrile. Aliquots of fractions with A280 absorption were analyzed on SDS polyacrylamide gels and fractions containing homologous refolded proteins were pooled. In general, the correctly refolded species of most proteins elute at the lowest concentration of acetonitrile because these species are the most compact and their hydrophobic inner surface is shielded from interaction with reverse phase resin. To be done. Aggregated species are usually eluted at higher acetonitrile concentrations. In addition to removing the misfolded form of the protein from the desired form, the reverse phase step also removes endotoxin from the sample. Fractions containing the desired folded PA polypeptide were pooled and the acetonitrile removed using a gentle stream of nitrogen directed at the solution. Proteins were prepared in 20 mM HEPES, pH 6.8 with 0.14 M sodium chloride and 4% mannitol by dialysis or gel filtration with G25 Superfine (Pharmacia) resin equilibrated with preparation buffer and sterile filtration.

Example 5: Expression of PAP in mammalian cells This example illustrates preparation of potential glycosylated forms of PA polypeptides by recombinant expression in mammalian cells. PRK5 (see EP 307,247 published on Mar. 15, 1989) was used as an expression vector. Optionally, the PA-encoding DNA is ligated to pRK5 with selected restriction enzymes and the PA polypeptide DNA is inserted using the ligation method as described in Sambrook et al., Supra. The resulting vector is called pRK5-PA. In one embodiment, the host cell selected is a HUVE as defined above using the vectors and transfection methods described herein for other mammalian cells.
It can be a C cell. Transfected HUVEC cells overexpressing the PA gene or expressing PA antisense are tested, for example, in a tube formation assay. In one embodiment, the host cell selected can be 293 cells. Human 293 cells (ATCC CCL 1573) were grown to confluence in tissue culture plates in media such as DMEM supplemented with fetal bovine serum and optionally nutrients and / or antibiotics. About 10 μg of pRK5-PA polypeptide DN
A of about 1 μg of VA RNA gene-encoding DNA (Thimmappaya et al., Cell, 31:
543 (1982)) and mixed with 500 μl of 1 mM Tris-HCl, 0.1 mM EDT.
A, 0.227M CaCl ₂ was dissolved. To this mixture, dropwise, 500 μl
50 mM HEPES (pH 7.35), 280 mM NaCl, 1.5 mM
NaPO ₄ was added and a precipitate was formed at 25 ° C. for 10 minutes. The precipitate was suspended, added to 293 cells, and fixed at 37 ° C. for about 4 hours. Aspirate the culture medium, 2 ml
20% glycerol in PBS was added for 30 seconds. The 293 cells were then washed with serum free medium, fresh medium was added and the cells were incubated for about 5 days.

Approximately 24 hours after transfection, the culture medium is removed and replaced with culture medium (only) or 200 μl.
The medium was replaced with a culture medium containing Ci / ml ³⁵ S-cysteine and 200 μCi / ml ³⁵ S-methionine. After 12 hours incubation, collect the conditioned medium,
It was concentrated on a spin filter and loaded on a 15% SDS gel. The treated gel was dried and exposed to film for a selected time that revealed the presence of PA polypeptide. The medium containing the transformed cells was subjected to further incubation (in serum-free medium) and the medium was tested in the selected bioassay. In an alternative technique, the PA polypeptide is modified by Somparyrac et al., Proc. Natl.
293 using the dextran sulfate method described in Acad. Sci., 12: 7575 (1981).
Transiently introduced into cells. 293 cells are grown to maximal density in spinner flasks and 700 μg of pRK5-PA polypeptide DNA is added. The cells were first concentrated from the spinner flask by centrifugation and washed with PBS. DN
The A-dextran precipitate was incubated on the cell pellet for 4 hours. Cells are treated with 20% glycerol for 90 seconds, washed with tissue culture medium,
The spinner flask containing 5 μg / ml bovine insulin and 0.1 μg / ml bovine transferrin was reintroduced. After about 4 days, the conditioned medium was centrifuged and filtered to remove cells and cell debris. The sample containing the expressed PA polypeptide was then concentrated and purified by a selected method such as dialysis and / or column chromatography.

In another embodiment, PA DNA can be expressed in CHO cells. p
RK5-PA polypeptides can be transfected into CHO cells using known reagents such as CaPO ₄ or DEAE-dextran. As described above, the cell culture medium can be incubated and the medium replaced with culture medium (only) or medium containing a radiolabel such as ³⁵ S-methionine. After identifying the presence of PA polypeptide, the culture medium may be replaced with serum-free medium. Preferably, the medium is incubated for about 6 days and then the conditioned medium is collected. The medium containing the expressed PA polypeptide can then be concentrated and purified for the method of choice. The epitope-tagged PA polypeptide may also be expressed in host CHO cells. PA polypeptide was subcloned from the pRK5 vector. The subclone insert can then be subjected to PCR to fuse in frame with a selected epitope tag such as a poly-his tag in a baculovirus expression vector. Poly-
The his-tagged PA polypeptide insert can then be subcloned into an SV40 driven vector containing a selectable marker such as DHFR for selection of stable clones. Finally, CHO cells were transfected with the SV40 inducible vector (as above). Labeling may be performed as described above to confirm expression. The culture medium containing the expressed poly-his tagged PA polypeptide is then concentrated and Ni ²⁺ −.
It can be purified by a selected method such as chelate affinity chromatography.

PA is expressed in CHO and / or COS cells by a transient expression procedure or C
It can be expressed in other stable expression techniques in HO cells. Stable expression in CHO cells was performed using the following method. A protein is a hinge of IgG1 where the coding sequence (eg, extracellular domain) of the soluble and / or poly-His tagged form of the corresponding protein is IgG1, CH2 and CH.
It was expressed as an IgG construct (immunoadhesin) fused to a constant region sequence containing 2 domains. Following PCR amplification, the corresponding DNA was added to Ausubel et al., Current protocols of
Subcloned into CHO expression vector using standard techniques as described in Molecular Biology, Unit 3.16, John Wiley and Sons (1997). The CHO expression vector has restriction sites compatible with the 5'and 3'of the DNA of interest, and has a cD
It is created so that NA can be conveniently shuttled. Vectors are Lucas et al., Nuc
cDNAs of interest and dihydrofolate reductase (DHFR) using expression in CHO cells as described in L. Acids Res. 24: 9, 1774-1779 (1996).
The SV40 early promoter / enhancer is used to control the expression of (1). DHFR
Expression allows selection for stable maintenance of the plasmid following transfection. Twelve micrograms of the desired plasmid DNA is added to the commercially available transfection reagent Superf
ect (registered trademark) (Quiagen), Dosper (registered trademark) and Fugene (registered trademark) (Boehringer
Mannheim) was introduced into about 10 million CHO cells. Cells were grown as described in Lucas et al., Supra. About 3x10 ^-7 cells were frozen in ampoules for further growth and production as described below.

Ampoules containing plasmid DNA were placed in a water bath, thawed and mixed by vortexing. The contents were pipetted into a centrifuge tube containing 10 mL of medium and centrifuged at 1000 rpm for 5 minutes. The supernatant is aspirated and the cells are mixed with 10 mL of selective medium (0.2 μm filtered PS20, 5%
0.2 μm diafiltered fetal bovine serum) was added). The cells were then split into a 100 ml spinner containing 90 ml of selective medium for 1-2 days, then the cells were transferred to a 250 ml spinner filled with 150 ml of selective medium and incubated at 37 ° C. 2-3 more days later, 2
50 mL, 500 mL and 2000 mL spinners were seeded at 3 × 10 ⁵ cells / mL. The cell medium was replaced with fresh medium by centrifugation and resuspended in production medium. Any suitable CH
Although O medium may be used, in practice the production medium described in US Pat. No. 5,122,469 of June 16, 1992 was used. A 3 L production spinner was seeded at 1.2 × 10 ⁶ cells / mL. On day 0, cell number and pH were measured. On day 1, spinners were sampled and sparged with filtered air. On the second day, sample the spinner and set the temperature to 33
The temperature was changed to 50 ° C., and glucose was added at 500 g / L and 0.6 mL was added to 30 mL of 10% antifoaming agent (eg, 35% polydimethylsiloxane emulsion, Dow Corning 365 Medical Grade Emulsion). The pH was adjusted and maintained at around 7.2 throughout the production. After 10 days or until viability falls below 70%, the cell culture medium was collected by centrifugation and filtered through a 0.22 μm filter. The filtrate was either stored at 4 ° C or immediately loaded on the purification column.

For poly-His tagged constructs, proteins were purified using a Ni-NTA column (Qiagen). Prior to purification, imidazole was added to the conditioned medium to a concentration of 5 mM. Conditioned medium containing 20 mM Hepes, p containing 0.3 M NaCl and 5 mM imidazole.
A 6 ml Ni-NTA column equilibrated with H7.4 buffer was pumped at 4 ° C. at a flow rate of 4-5 ml / min. After loading, the column was further washed with equilibration buffer and the protein was eluted with equilibration buffer containing 0.25M imidazole. The highly purified protein was subsequently desalted with 25 ml G25 Superfine (Pharmacia) in a storage buffer containing 10 mM Hepes, 0.14 M NaCl and 4% mannitol,
Stored at -80 ° C. The immunoadhesin (Fc containing) construct was purified from conditioned medium as follows. Conditioned medium was loaded onto a 5 ml protein A column (Pharmacia) equilibrated with 20 mM sodium phosphate buffer, pH 6.8. After loading, the column was washed extensively with equilibration buffer and then eluted with 100 mM citric acid, pH 3.5. The eluted protein was immediately neutralized by collecting 1 ml fractions in a tube containing 275 μl of 1 M Tris buffer, pH 9. The highly purified protein was subsequently desalted in storage buffer as described above for poly-His tagged proteins. Homogeneity was tested on SDS polyacrylamide gels and N-terminal amino acid sequenced by Edman degradation.

Example 6: Expression of PA gene in yeast Recombinant expression of PA polypeptide in yeast can also be performed. First, create a yeast expression vector for intracellular production or secretion of PA polypeptide from the ADH2 / GAPDH promoter. DNA encoding PA
And a promoter is inserted into the appropriate restriction enzyme sites of the selected plasmid to direct direct intracellular expression of PA. The DNA encoding the ADH2 / GAPDH promoter, the natural P
A signal peptide or other mammalian signal peptide, or, for example, yeast alpha factor or invertase secretion signal / leader sequence, and (if necessary) P
It can be cloned with a linker sequence for expression of the A polypeptide.

Yeast cells, such as yeast strain AB110, can then be transformed with the expression plasmids described above and cultured in a selected fermentation medium. The transformed yeast supernatant can be analyzed by precipitation with 10% trichloroacetic acid and separation by SDS-PAGE, followed by staining of the gel with Coomassie blue stain. Recombinant PA polypeptide can subsequently be isolated and purified by removing yeast cells from the fermentation medium by centrifugation and then concentrating the medium using selected cartridge filters. The concentrate containing the PA polypeptide may be further purified using a selected column chromatography resin.

Example 7: Expression of PA Polypeptides in Baculovirus-Infected Insect Cells The following method describes recombinant expression of PA polypeptides in Baculovirus-infected insect cells. The DNA sequence encoding the PA polypeptide was fused upstream of an epitope tag contained in a baculovirus expression vector. Such epitope tags include poly-his tags and immunoglobulin tags (such as the Fc region of IgG). pV
Various plasmids can be used, including plasmids derived from commercially available plasmids such as L1393 (Navogen). Briefly, a PA polypeptide or a portion of a PA polypeptide (such as a sequence encoding the extracellular domain of a transmembrane protein) is amplified by PCR with primers complementary to the 5'and 3'regions. The 5'primer may include flanking (selected) restriction enzyme sites. The product is then digested with the selected restriction enzymes and subcloned into the expression vector. Recombinant baculovirus is the above plasmid and BaculoGold ^™ virus D
NA (Pharmingen) with Spodoptera frugiperda (“Sf9”) cells (ATCC CRL
1711) with lipofectin (commercially available from GIBCO-BRL). After 4 to 5 days of incubation at 28 ° C, released virus was collected and used for further amplification. Viral infection and protein expression are O '
Reilley et al., Baculovirus expression vectors: A Laboratory Manual, Oxford:
Performed as described in Oxford University Press (1994).

[0249]   Next, the expressed poly-his tagged PA polypeptide is, for example, Ni²⁺-Kire
It is purified by affinity chromatography as follows. Extracted by Ru
pert et al., Nature, 362: 175-179 (1993).
Prepared from recombinant Sf9 cells. Briefly, Sf9 cells are washed and sonicated.
Processing buffer (25 mL Hepes, pH 7.9; 12.5 mM MgCl 2 _Two 0.1 mM EDTA; 10% glycerol; 0.1% NP-40;
Resuspended in 4M KCl) and sonicated twice on ice for 20 seconds. Sonication
The product was clarified by centrifugation, and the supernatant was added to the loading buffer (50 mM phosphate, 300 m
50 times diluted with M NaCl, 10% glycerol, pH 7.8), 0.45μ
m filter. Ni²⁺-NTA agarose column (commercially available from Qiagen
) Was prepared in a total volume of 5 mL, washed with 25 mL of water and washed with 25 mL of loading buffer.
Equilibrate with The filtered cell extract was loaded onto the column at 0.5 mL / min.
The column is at the point where fraction collection begins₂₈₀Load buffer up to baseline
-Washed. The column is then subjected to a secondary wash that elutes the bound protein nonspecifically.
Buffer (50 mM phosphate; 300 mM NaCl, 10% glycerol,
It was washed with pH 6.0). A₂₈₀After reaching the baseline of
A 0 to 500 mM imidazole gradient was developed in the secondary wash buffer. 1 mL
Was collected by SDS-PAGE and silver staining or alkaline phosphatase (Qi
Ni combined with agen)²⁺-Analyzed by Western blot on NTA. Elute
His₁₀-Pool fractions containing tagged PA polypeptide into loading buffer
It was dialyzed.   Alternatively, purification of the IgG-tagged (or Fc-tagged) PA polypeptide can be performed, for example, by
Known chromatographies including protein A or protein G column chromatography
It can be carried out using a graphic technique.

Example 8: Preparation of Antibodies that Bind PA Polypeptides This example illustrates preparation of monoclonal antibodies that can specifically bind PA. Techniques for the production of monoclonal antibodies are known in the art and are described, for example, in Goding, supra. Immunogens that can be used include purified PA, fusion proteins containing PA, cells expressing recombinant PA on the cell surface. The choice of immunogen can be made by one of ordinary skill in the art without undue experimentation. Mice such as Balb / c are immunized with PA polypeptide immunogen emulsified in complete Freund's adjuvant and injected subcutaneously or intraperitoneally at 1-100 micrograms. Alternatively, the immunogen is treated with MPL-TDM adjuvant (Ribi Immunochemical
Researh, Hamilton, MT) and may be injected into the hind footpads of animals. The immunized mice are then boosted 10 to 12 days later with additional immunogen emulsified in the selected adjuvant. The mice are then boosted with additional immunization injections for several weeks. Serum samples from retroorbital bleeds may be taken periodically from mice for testing in an ELISA assay for detection of anti-PA polypeptide antibodies.

After a suitable antibody titer has been detected, animals “positive” for the antibody are given a PA
The final infusion of the polypeptide intravenous injection can be given. After 3 to 4 days, the mice were sacrificed and the spleens were removed. The spleen cells were then (using 35% polyethylene glycol) P3X63Ag available from the ATCC under number CRL1597.
U. Fused to selected mouse myeloma cell lines such as 1. Hybridoma cells were generated by the fusion and then plated on 96-well tissue culture plates containing HAT (hypoxanthine, aminopterin, and thymidine) medium to inhibit the growth of unfused cells, myeloma hybrids, and spleen cell hybrids. Hybridoma cells are ELIS for reactivity with PA polypeptides.
Screened at A. The determination of "positive" hybridoma cells that secrete monoclonal antibodies to PA polypeptides is within the skill of the art. Positive hybridoma cells are injected intraperitoneally into syngeneic Balb / c mice to generate ascites fluid containing anti-PA polypeptide monoclonal antibody. Alternatively, hybridoma cells can be grown in tissue culture flasks or roller bottles. Purification of the monoclonal antibody produced in the ascites can be performed using ammonium sulfate precipitation followed by gel exclusion chromatography. Alternatively, affinity chromatography based on the affinity of the antibody for protein A or protein G can be used.

Example 9: Purification of PA Polypeptides Using Specific Antibodies Native or recombinant PA polypeptides can be purified by a variety of standard protein purification methods in the art. For example, the pro-PA polypeptide, mature PA polypeptide, or pre-PA polypeptide is purified by immunoaffinity chromatography using an antibody specific for the PA polypeptide of interest. In general, immunoaffinity columns are made by covalently attaching anti-PA polypeptide antibodies to activated chromatography resins. Polyclonal immunoglobulins are prepared from immune sera by either precipitation with ammonium sulfate or purification with immobilized Protein A (Pharmacia LKB Biotechnology, Piscataway, NJ). Similarly, monoclonal antibodies are prepared from mouse ascites fluid by ammonium sulfate precipitation or chromatography on immobilized Protein A. The partially purified immunoglobulin is covalently bound to a chromatography resin such as CnBr-activated Sepharose ^™ (Pharmacia LKB Biotechnology). The antibody is bound to the resin, the resin is blocked, and the derivative resin is washed according to the manufacturer's instructions.

Such immunoaffinity columns are utilized in the purification of PA polypeptides by preparing fractions from cells containing the soluble form of PA polypeptide. This preparation is derived by the addition of detergents or the solubilization of whole cells or subcellular fractions obtained via differential centrifugation by methods known in the art. Alternatively,
Solubilized PA polypeptide containing a signal sequence is secreted in an oily amount into the medium in which the cells are grown. The solubilized PA polypeptide-containing preparation is passed through an immunoaffinity column, and the column is washed under conditions that allow for favorable absorption of PA polypeptide (eg, high ionic strength buffer in the presence of detergent). The column is then eluted under conditions that cleave the antibody / PA polypeptide bond (eg, a low pH, such as about 2-3, a high concentration of chaotrope such as urea or thiocyanate ion) and the PA polypeptide is recovered. .

Example 10: Stimulation of Endothelial Tube Formation This assay is based on Davis and Camarillo, Experimental Cell Research, 224: 39.
-51 (1996) or a modification thereof as follows: Protocol: Human venous umbilical vein endothelial cells (HUVEC, Cell Systems) (passage from initiation to less than 8) in type I rats Mixed with tail collagen, final concentration 2.6 mg
/ Ml, density 6x10 ⁵ cells / ml, 5 per well in 96-well plates
It was plated with 0 μl. Gels were allowed to solidify for 1 hour at 37 ° C and supplemented with 1% FBS and PA polypeptide samples (dilutions of 1%, 0.1%, and 0.01%, respectively), 50 μl of M199 medium per well. Was added with 1 μM 6-FAM-FITC dye that stains vacuoles during formation. Cells were incubated at 37 ° C / 5% CO2 for 48 hours, fixed with 3.7% formalin for 10 minutes at room temperature, washed 5 times with PBS, then stained with Rh-Phalloidin at 4 ° C overnight, 4 μM. Nuclear staining was performed with DAPI.

1. Ab Apoptosis Assay This assay identifies factors that promote cell survival in a three-dimensional matrix in the presence of exogenous growth factors (VEGF, bFGF without PMA). Positive results are equal to or less than 1. 0 = no apoptosis 1 =
Less than 20% of the cells are apoptotic, 2 = less than 50% of the cells are apoptotic, and 3 = more than 50% of the cells are apoptotic. Stimulators of apoptosis in this system are expected to be apoptotic factors, and inhibitors are expected to prevent or reduce apoptosis. 2. Ab vacuolar assay This assay identifies factors that stimulate endothelial vacuolization and lumen formation in the presence of bFGF and VEGF (40 ng / ml). Positive results are equal to or greater than 2. 1 = less than 20% cells have vacuoles, 2 = 20-50% cells have vacuoles, 3 = more than 50% cells have vacuoles. This assay was designed to identify factors involved in stimulating pinocytosis, ion pumping, permeability, junction formation. 3. Ab Tube Formation Assay This assay identifies factors that stimulate endothelial tube formation in a three-dimensional matrix. This assay stimulates endothelial cells to stimulate exogenous growth factors (VEGF, b
FGF) to identify factors that differentiate into tube-like structures in a three-dimensional matrix. Positive results are equal to or greater than 2. 1 = cells are all round, 2 = cells are long, 3 = cells form a tube with some connections, 4 = cells form a complex tubular network. This assay identifies factors associated with stimulating transport, chemotaxis, or endothelial shape changes. Results are buffer control (10 mM HEPES / 0.14M at 1% dilution).
Clearly shows that more complex tube formation occurs in the PA-poly-His sample at a dilution of 1%, compared to NaCI / 4% mannitol, pH 6.8).

Example 11: Stimulation of Endothelial Cell Proliferation This assay is designed to determine whether PA exhibits the ability to stimulate adrenal cortical capillary endothelial cell (ACE) growth. Bovine adrenal cortex capillary endothelial (ACE) cells (from primary culture, up to 12-1
4 passages) were plated at 500 cells / well per 100 microliter in 96-well plates. The assay medium contains low glucose DMEM, 10% fetal bovine serum, 2 mM glutamine, and 1x penicillin / streptomycin / fungizone. Control wells include: (1) no ACE cells added; (2)
ACE cells only; (3) ACE cells + VEGF (5 ng / ml); and (4) ACE cells + FGF (5 ng / ml). Then control and test samples (100 microliter volume)
Were added to the wells (1%, 0.1% and 0.01% dilutions, respectively). Cell culture medium at 37 ℃ / 5
Incubated with% CO2 for 6-7 days. After incubation, the medium in the wells was aspirated and the cells were washed 1x with PBS. Then acid phosphatase reaction mixture (100 microliters, 0.1 M sodium acetate, pH 5.5, 0.1% Triton
X-100, 10 mM p-nitrophenyl phosphate) was added to each well. After incubation for 2 hours at 37 ° C., the reaction was stopped by the addition of 10 microliters of 1N NaOH. Optical density (OD) was measured at 405 nm in a microplate reader.

The activity of PA was (1) against the background of cells only and (2) VE.
Against maximal stimulation by GF (acid phosphatase activity, measured at OD 405 nm)
Calculated as fold increase in proliferation. VEGF (as an activity reference for maximal stimulation
3-10 ng / ml) and FGF (1-5 ng / ml) were used. The result of the assay is "if the observed stimulation is equal to or greater than 50% over background.
Positive. " PA was assayed as "positive" as follows: 1% dilution = double stimulation 0.1% dilution = double stimulation 0.01% dilution = double stimulation VEGF (5ng / ml) compared to control: 1% Dilution = double stimulation FGB (5ng / ml) control: 1% Dilution = double stimulation

Example 12: Inhibition of Vascular Endothelial Growth Factor (VEGF) -stimulated Endothelial Cell Growth Proliferation The ability of various angiogenesis-inhibiting polypeptides (AIP) to inhibit VEGF-stimulated proliferation of endothelial cells was tested. . In particular, Bovine Adrenal Cortex Capillary Endothelial (ACE) cells (from primary culture, up to 12-14 passages) were plated in 96-well plates at 500 cells / well per 100 microliters. The assay medium contains low glucose DMEM, 10% calf serum (not fetal calf), 2 mM glutamine, and 1x penicillin / streptomycin / fungizone. Control wells included: (1) no ACE cells added; (2) ACE cells only; (3) ACE cells + 5 ng / ml.
FGF; (4) ACE cells +3 ng / ml VEGF; (5) ACE cells +3 ng / ml VEG
F + 1 ng / ml TGT-beta; and (6) ACE cells + 3 ng / ml VEGF + 5 ng / ml L
IF. The test sample, poly-His tagged PA polypeptide (100 microliter volume) was then added to the wells (1%, 0.1% and 0.01% dilutions, respectively). Cell culture medium 37
Incubated at 5 ° C./5% CO2 for 6-7 days. After incubation, the medium in the wells was aspirated and the cells were washed 1x with PBS. Then acid phosphatase reaction mixture (100 microliters, 0.1 M sodium acetate, pH 5.5, 0.1% Triton X-100
, 10 mM p-nitrophenyl phosphate) was added to each well. After incubation for 2 hours at 37 ° C., the reaction was stopped by the addition of 10 microliters of 1N NaOH. Optical density (OD) was measured at 405 nm in a microplate reader.

The activity of AIP was calculated as the percent inhibition of VEGF (3 ng / ml) stimulated proliferation (as measured by acid phosphatase activity at OD405 nm) relative to unstimulated cells. Since TGF-beta blocks 70-90% of VEGF-stimulated ACE cell proliferation, TGF-beta was used as an activity control at 1 ng / ml. Result is,
It shows the utility of AIP in the treatment of cancer, especially in inhibiting tumor angiogenesis. Numbers (relative inhibition) were calculated by calculating the percent inhibition of VEGF stimulated proliferation by AIP relative to unstimulated cells, followed by 1 ng / ml TGF-, which is known to inhibit 70-90% of VEGF stimulated cell proliferation. It is determined by dividing that percentage by the percent inhibition obtained by β. The results were considered positive if AIP showed 30% or more inhibition of VEGF stimulation of endothelial cell growth (30% or more relative inhibition).

Example 13: Induction of c-fos in Endothelial Cells This assay is for determining whether a PA polypeptide or AIP shows the ability to induce c-fos in endothelial cells. Growth medium (50% Ham's F12 w / o GHT: low glucose, and 50% DMEM without glycine: NaHCO3, 1% glutamine, 10 mM HEPES, 1
Human venous umbilical vein endothelial cells (HUVE) in 0% FBS, 10 ng / ml bFGF)
C, Cell Systems) were plated in 96-well macrotiter plates at a cell density of 1 × 10 ⁴ cells / well. The day after plating, the growth medium was removed and the cells were incubated with 100 μl / well of test sample and control (positive control: growth medium; negative control: 10 mM HEPES, 140 mM).
Cells were starved by treatment with NaCl, 4% (w / v) mannitol, pH 6.8). Cells were incubated for 30 minutes at 37 ° C in 5% CO2. Remove the sample and bDNA kit protocol (Chiron Diagnostics, Catalog #
# 6005-037) was followed, but the reagents / buffers utilized below were available from the kit.

Briefly, the amount of TM lysis buffer and probe required for the test was calculated based on the information provided by the manufacturer. An appropriate amount of frozen probe was added to TM lysis buffer. The supplemental hybridization buffer was warmed to room temperature. The bDNA strips were placed in a metal strip holder and 100 μl of complementary hybridization buffer was added to the required b-DNA wells followed by incubation for at least 30 minutes. The test plate with cells was removed from the incubator and the medium was gradually removed using a vacuum manifold. 100 μl of lysis buffer containing probe was quickly pipetted into each well of the microtiter plate. The plates were then incubated at 55 ° C for 15 minutes. Upon removal from the incubator, the plate was placed on a vortex mixer equipped with a microtiter adapter head and vortexed at # 2 setting for 1 minute. 80 μl of lysate was removed and added to bDNA wells containing capture hybridization buffer and pipetted up and down to mix. The plates were incubated at 53 ° C for 16 hours.

The next day, the second part of the bDNA kit protocol was followed. Specifically, the plates were removed from the incubator and placed on a cooling bench for 10 minutes. The amount of addition required was calculated based on the information provided to the manufacturer. Amplification working solution is A
Prepared by diluting the amplification concentrate (20 fm / μl) 1: 100 in L hybridization buffer. The hybridization mixture was removed from the plate and washed twice with Wash A. Add 50 μl amplification working solution to each well,
Incubated for 0 minutes. Then remove the plate from the incubator 1
Cooled for 0 minutes. The labeled probe working solution was prepared by diluting the labeling concentrate (40 pmoles / μl) 1: 100 in AL hybridization buffer. After a 10 minute cooling period, the amplification hybridization mixture was removed and the plate was washed with Wash A.
Washed twice. Add 50 μl of labeled probe working solution to each well and add 53 wells to each well.
Incubated at 15 ° C for 15 minutes. After cooling for 10 minutes, the substrate was warmed to room temperature. When 3 μl of substrate enhancer is added for every 1 ml of substrate required for the assay, the plate is cooled for 10 minutes, the labeled hybridization mixture is removed and the plate is Wa
Washed twice with sh A and 3 times with Wash D. 50 μl of substrate solution and enhancer was added to each well. The plates were incubated for 30 minutes at 37 ° C and the RLU read on an appropriate luminometer. The replicates were averaged to determine the coefficient of variation. Negative control (HEP described above
Measurement of fold-increase activity versus ES buffer) value was indicated by chemiluminescence units (RLU). Results were considered positive if the PA polypeptide showed at least twice the value over the negative control. Negative control = 1.00 RLU at 1.00% dilution. Positive control = 1.00
8.39 RLU at% dilution.

Example 14: Human Vein Endothelial Cell Ca Flux Assay This assay uses PA polypeptide or AIP in human umbilical vein endothelial cells (HUVE).
C, Cell Systems) to determine whether it exhibits the ability to stimulate calcium flux. Ca influx is a well documented response of certain ligands to their receptors. It can be said that a test compound that produces a positive reaction in this Ca influx assay binds to a specific receptor and activates a biological signal transduction pathway in human endothelial cells. It can ultimately induce, for example, cell division, inhibition of cell proliferation, endothelial tube formation, cytophoresis, apoptosis, etc.

Growth medium (50:50 no glycine, 1% glutamine, 10 mM Hepes, 10% FBS, 10 ng / m
Human Umbilical Vein Endothelial Cells (HUVEC, Cell Systems) in bFGF) of 96-well microtiter View Plate-96 (Packard Instrument Company Part # 6005182).
Microtiter plates were plated at a cell density of 2x10 ⁴ cells / well. The day after plating, cells were washed 3 times with buffer (HBSS + 10 mM Hepes), leaving 100 μl / well. Then 100 μl / well of 8 μM Fluo-3 (2
x) was added. Cells were incubated for 1.5 hours at 37 ° C / 5% CO2. After incubation, cells were washed 3x with buffer (above), leaving 100 μl / well. Test samples of PA polypeptide were prepared on different 96-well plates at 5x concentration in buffer. The positive control corresponds to 50 μM ionomycin (5x); the negative control corresponds to protein 32. Cell plates and sample plates were run on a FLIPR (Molecular Devices) machine. The FLIPR machine added 25 μl of test sample to the cells and read every 2 seconds for 1 minute and then every 3 seconds for 3 minutes. The change in fluorescence (Δ change) from the baseline of the curve to the maximum was calculated and replicates were averaged. The rate of fluorescence increase was monitored and only samples with Δ changes greater than 1000 and rises within 60 seconds were considered positive.

Example 15: Induction of Endothelial Cell Apoptosis The ability of PA polypeptides or AIP to induce apoptosis in endothelial cells was evaluated using a 96-well format in 0% serum medium supplemented with 100 ng / ml VEGF. Tested in umbilical vein endothelial cells of human vein (HUVEC, Cell Systems). (
All pipetting in the wells should be as gentle as possible, as HUVEC cells are easily released from the plate surface. ) Medium was aspirated and cells were washed once with PBS. 5m to cells in T-175 flask
l of 1x trypsin was added and cells were allowed to elute until they were released from the plate (approximately 5-1
It left for 0 minutes. Trypsinization was stopped by adding 5 ml of growth medium. The cells were spun at 1000 rpm for 5 minutes at 4 ° C. Aspirate medium, 10 ml 10%
Cells were resuspended in serum-supplemented medium (Cell Systems), 1x penicillin / streptomycin.

Cells were transferred to 96-well microtiter plates (Amersham Life Science, cytos
2x1 per well in 10% serum (CSG-vehicle, Cell Systems) with tar-T scintillating microplate, RPNQ160, sterile, tissue culture medium treated, individually wrapped)
0 ⁴ at a density of cells were plated in a total volume 100 [mu] l. 1% PA polypeptide
, 0.33% and 0.11% dilutions were added in 3 steps. Wells without cells were used as a blank and wells with cells were used as a negative control. As a positive control, 50 μl of a 1: 3 serial dilution of 3 × stock of staurosporine was used. The ability of PA polypeptides or AIP to induce apoptosis is due to the presence of Annexin V, a member of the calcium and phospholipid binding proteins, to detect apoptosis.
Was used to determine. 0.2 ml of annexin V-biotin stock solution (100 μg / ml) was added to 4.6 ml of 2x.
Diluted in Ca2 + binding buffer and 2.5% BSA (1:25 dilution). Add 50 μl of diluted Annexin V-Biotin solution to each well (excluding control) to a final concentration of 1.0 μg / ml.
Was added to. Samples were incubated with Annexin-Biotin for 10-15 minutes prior to direct addition of 35S-streptavidin. 35 S-streptavidin is 2 x Ca
2+ binding buffer was diluted in 2.5% BSA, final concentration was added to all wells until the 3 x 10 ⁴ cpm / well. The plates were then sealed, centrifuged at 1000 rpm for 15 minutes and placed on an orbital shaker for 2 hours. Analysis is 1450 Microbet
a Trilux (Wallac).

Example 16: Increased Neonatal Cardiac Hypertrophy This assay is designed to measure the ability of PA polypeptides to stimulate neonatal cardiac hypertrophy. Cardiomyocytes were obtained from 1-day-old Harlan Sprague Dawley rats. Cells (7.5x104 / ml
180 μl, serum <0.1%, freshly isolated) on day 1 beforehand in DMEM / F12 + 4
% FCS coated 96 well plates. Test samples containing test PA polypeptide or growth factor alone (negative control) (20 μl / well) were added directly to the wells on day one. PGF (20 μl / well) was then added on day 2 at a final concentration of 10 −6 M. The cells were then stained on day 4 and scored visually on day 5, with cells that did not increase in size compared to the negative control given a score of 0.0, with smaller size compared to the negative control. Cells with a moderate increase were scored as 1.0 and cells with a large increase in size compared to the negative control were scored as 2.0.

Example 17: Induction of c-fos in Endothelial Cells This assay was designed to determine if PA polypeptides show induction of c-fos in endothelial cells. Growth medium (50% Ham's F12w / oGHT: low glucose, and 50% DMEM without glycine: NaHCO3, 1% glutamine, 10 mM HEPES,
Human venous umbilical vein endothelial cells (HU) in 10% FBS, 10 ng / ml bFGF).
VEC, Cell Systems) were plated in 96-well macrotiter plates at a cell density of 1 × 10 ⁴ cells / well. The day after plating, growth medium was removed and cells were incubated with 100 μl / well of test sample and control (positive control:
Growth medium; negative control: 10 mM HEPES, 140 mM Na
Cells were starved by treatment with Cl, 4% (w / v) mannitol, pH 6.8. Cells were incubated for 30 minutes at 37 ° C in 5% CO2. Remove the sample and use the DNA kit protocol (Chiron Diagnostics, cat. # 6005-037)
The first part of the above was followed, but the reagents / buffers utilized below were available from the kit. Briefly, the amount of TM Lysis Buffer and probe required for the test was calculated based on the information provided by the manufacturer. Appropriate amount of thaw probe was added to TM lysis buffer. Capture hybridization buffer (C
apture Hybridization Buffer) was warmed to room temperature. The bDNA strip was set up in a metal strip holder and 100 μl of capture hybridization buffer was added to each required b-DNA well and incubated for at least 30 minutes. The intracellular test plate was removed from the incubator and the medium was gently removed using a vacuum manifold. 100μ in each well of microtiter plate
Lysis hybridization buffer with 1 probe was quickly pipetted into each b-DNA well. The plates were then incubated for 15 minutes at 55 ° C. Removed from the incubator, placed the plate in a vortex mixer equipped with a microtiter adapter head and vortexed at # 2 setting for 1 minute. 80 μl of lysate was removed and added to bDNA wells containing capture hybridization buffer and pipetted up and down to mix. The plates were incubated at 53 ° C for at least 16 hours.

The next day, the second part of the bDNA kit protocol was followed. Specifically, the plates were removed from the incubator, placed on the bench and cooled for 10 minutes. The volume of addition required was calculated based on the information applied by the manufacturer. Amplification concentrate at a dilution of 1: 100 in AL hybridization buffer (20 fm / μl
) Was prepared to prepare an amplifier working solution. The hybridization mixture was removed from the plate and washed twice with wash solution A. 50 μl of amplifier working solution was added to each well and the wells were incubated at 53 ° C. for 30 minutes. The plate was then removed from the incubator and cooled for 10 minutes. Add labeled probe working solution to AL hybridization buffer to 1
: Prepared by making a labeled concentrate (40 pmoles / μl) at a dilution of 100. After a 10 minute cooling period, the amplifier hybridization mixture was removed and the plate washed twice with detergent A. 50 μl of labeled probe working solution was added to each well and the wells were incubated at 53 ° C. for 15 minutes. 10
After cooling for a minute, the substrate was warmed to room temperature. 3 μl for each mole of substrate required for the assay
Substrate enhancer was added, the plate was cooled for 10 minutes, the labeled hybridization mixture was removed, and the plate was washed twice with detergent A and three times with detergent D. 50 μl of substrate solution with enhancer was added to each well. Plate 3
After incubating for 30 minutes at 7 ° C., RLU was read with an appropriate luminometer.

The duplicates were averaged and the coefficient of variation was determined. Negative control (HEP described above
Measurement of fold-increase activity versus ES buffer) value was indicated by chemiluminescence units (RLU). Samples showing at least twice the negative control values were considered positive. The PA polypeptide was assayed as "positive" twice: (1) Negative control = RLU positive control = RLU 0.01% PA = RLU (2) Negative control = RLU positive control = RLU 0.01% PA = RLU

Example 18: Guinea Pig Vascular Leakage This assay was designed to determine if PA polypeptides show the ability to induce vascular permeability. Ketamine (75-80mg / kg) in hairless guinea pigs of 350g or more
And 5 mg / kg of xylazine were intramuscularly administered for anesthesia. Test samples containing PA polypeptide or test buffer without physiological buffer were injected intradermally into the dorsal skin of test animals at 100 μl per injection site. There were approximately 16-24 injection sites per animal. Then 1 ml of Evans Blue dye (
(1% in PBS) was injected intracardially. The cutaneous vascular permeability response to the compound (ie, spots at the injection site) was visually scored by measuring the diameter (mm) of blue leakage from the injection site 1 and 6 hours after administration of the test animals. The blue diameter mm diameter of the injection site was observed and recorded along with the severity of vascular leakage. Spots with a diameter of at least 5 mm are considered positive in the assay when testing purified protein, indicating the ability to induce vascular leakage or permeability. 7 mm
Reactions with diameters greater than are considered positive for conditioned medium samples. 0.1 μg
/ 100 μl human VEGF was used as a positive control,
A response of 23 mm diameter was induced.

Example 19: Time-dependent TAQMAN® P expression of angiogenesis-related genes
CR analysis Validation and confirmation of gene expression by quantitative RT-PCR (Taqman (trade name)). G
To confirm the data from eneCalling ™ by an independent technique, HUVECs were grown in collagen gels as a model system to promote angiogenesis. Digestion of an oligonucleotide probe labeled with a gene-specific PCR oligonucleotide primer pair and a reporter fluorescent dye at the 5'end and a quencher fluorescent dye at the 3'end using Oligo 4.0 software (National Bioscience, Plymouth MN). did. Total RNA (50 ng) obtained from the resulting cells was added to the manufacturer (Roche Molecular Syste) in 50 ml RT-PCR reaction mixture at various time points ranging from 30 minutes to 2 days.
ms Inc. Branchburg, NJ). The temperature cycle conditions are 48 ° C for 1/30 cycle, 95 ° C for 1/10 cycle, and 95 ° C for 15 cycles.
Included 40 cycles of seconds, 1 minute anneal at 60 ° C., and 2 minutes final hold at 25 ° C. A standard curve for expression of each gene was generated by serial dilution of a standard preparation of total RNA isolated from quiescent HUVEC grown in monolayer medium. Data were expressed as fold induction normalized to the same gene from resting HUVEC RNA. For comparison, the data obtained with RNA extracted from HUVEC grown on collagen membrane in which differentiation into tube-like structures did not occur was inserted as a control. Table 4 shows the set of TaqMan (trade name) primers and probes used.

[0273]

Example 20: In situ Hybridization of Three PA Genes Fluorescent in situ hybridization (FISH) in angiogenesis associated with tumor and inflammatory disease for the three PAP genes identified from the differential expression analysis described herein. ) Was performed by the method described in Rosen, B. et al., Trends Genet. 9: 162-167 (1993). Samples were saved and prepared for microscopic examination. The same fragment was then treated with the fluorescence of hematoxylin-eosin and the hybridization probe, or adjacent fragments were treated with one or the other preparation, respectively. The results are shown in Figures 26-29. The results of podocalyxin [PA3] mRNA expression are shown in FIG. Podocalixin-like proteins showed moderate to strong expression in the blood vessels surrounding squamous cell carcinoma of the lung (arrow). Furthermore, it was expressed in almost all small arterioles in fetal tissues, and in a subset of adrenal cortex and skeletal muscle venules and capillaries. In adult tissues, expression was restricted to podocytes, adventitia around macrovessels, endothelial cells in the inner segment of the outer nuclear layer and photoreceptor layer of the retina. In tumor tissue, the expression is small vessels with chondrosarcoma, squamous cell carcinoma of the oral mucosa, squamous cell carcinoma of the lung, ductal adenocarcinoma, and renal cell carcinoma (usually arterioles rather than venules or capillaries). ) Was moderate to weak in the endothelium. Expression was observed in arterial endothelium in inflamed adipose tissue from appendicitis samples. These data, as well as the real-time quantitative expression analysis of podocalyxin-like proteins in the in vitro angiogenic assay, support the new uses set forth in Table 2 and the claimed methods of the invention.

Figure 27 shows the results for the Protein Zero (PZR) [PA21] probe. PZR is expressed in malignant epithelium from lung adenocarcinoma at elevated levels compared to normal epithelium. Similar results were observed in renal cell carcinoma and ductal adenocarcinoma. Generally, high levels of PZR are found in actively replicated cell populations (many fetal tissues, basal epithelial layer, and tumor cells). Although in situ hybridization did not reflect a vascular cell type-specific bias, the real-time quantitative PCR results clearly demonstrate the modulation of PZr in this epithelial cell tube formation system. This discrepancy can be easily explained by the fact that tube formation is a transient intermediate during vascular morphogenesis (Yang et al., Am J Pathol 1999 Sep; 15).
5 (3): 887-95). Figures 28 and 29 show hematoxylin-eosin staining and in situ hybridization for expression of stanniocalcin precursor [PA23] mRNA in ductal adenocarcinoma and squamous cell carcinoma, respectively. The stanniocalcin probe shows strong but variable expression around the cancer tissue. It was also found less in chondrosarcoma and renal cell carcinoma vasculature. Some expression was also observed in the small blood vessels of placental villi during the first trimester. The lack of significant expression of stanniocalcin anywhere in the vasculature is important to the specificity of this molecule as an indicator of vasculature morphogenesis. A more important observation is the lack of significant expression in normal blood vessels.

Example 21: Novel gene differentially expressed in endothelial tube formation The QEA method employed here provides a gene fragment designated r0v0-176.7 [PA27]. This is 100% consistent with human sequences not present in all public databases available to the inventor. This assembly is r0v0-1
It is 99% similar to AF173937, a secreted protein of unknown function, which is named 76.7A and seems to be a partial sequence only. Furthermore, r0v0-
176.7A is 4 out of 95 residues identical to the 100 residue putative Arabidopsis steroid-binding protein (TREMBLNEW-ACC: AAD23019).
7 and 68 of 95 positive residues; rat membrane-bound progesterone receptor protein of 194 residues (SWISSNEW-ACC: P70580)
It has 52 of the same 140 residues and 73 of the positive 140 residues. The amino acid sequence of PA27 is included in Fig30. TaqMan ™ analysis, performed as described in Example 19, shows that expression peaks at 4 hours with a gel / membrane ratio of 0.5 initially, 1.0, 8 at 4 hours. It was found to be 1.5 at time and then decreased to 0.25 at 46.5 hours.

Testosterone and dexamethasone are strong inhibitors, and all-trans retinoic acid (at-RA) and 9-cis retinoic acid (9-cisRA) are stimulators of the formation of potential capillary-like tubule structures ( UI: 98345318). Prostaglandins are also inhibitors. Thus, endothelial cells are able to release the r0v0-176.7A protein to bind and trap steroid-like hormones in the tube formation process. Signal P and signal peptide analysis found a signal peptide with a cleavage site at either residue 27 or residue 32. PSORT predicts that the protein will be localized extracellularly. Sbase has a homology between residues 45-90 to the cytochrome B5 and oxidoreductase Heme binding domain, a homology to the transmembrane region between residues 96-145 and a kinase between residues 3-46. We found homology to the region.

The hydropathy plot for r0v0-176.7A is shown in Figure 31. Mouse and rat autologs for r0v0-176.7A were generated. Results are shown in Figure 32 with ClustalW alignment. The rat autolog is highly similar to the human sequence and the two are highly coextensive. The mouse sequence has a mismatch in the NH region, resulting in a frameshift. All three autologous species arise from multiple ESTs, indicating that they are highly expressed.
Most of the ESTs are of fetal origin or tumor (ovarian cancer). This is further evidence of a possible role in angiogenesis. The r0v0-176.7A genes and the polypeptides they encode are considered to be alone or some essential components in the biological pathway of endothelial cell angiogenesis or angiogenesis.

Other Embodiments The present invention has been described in connection with its detailed description, but the above description is intended to be exemplary,
It should be understood that it does not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

[Brief description of drawings]

[FIG. 1] Photomicrographs of hHUVECs grown in a collagen gel matrix (panels A-I) and when plated on a collagen membrane (panel J).

FIG. 2 is a schematic diagram showing various stages involved in the differentiation of endothelial cells into tube-like structures.

[Fig3] Fig. 3 is a graph showing TaqMan PCR analysis of the time course of expression of osteonidogen in collagen gel (light bar) and collagen membrane (dark bar).

FIG. 4 is a graph showing TaqMan PCR analysis of laminin gamma-2 chain (nicein) expression in collagen gel (light bar) and collagen membrane (dark bar) over time.

[FIG. 5] A graph showing TaqMan PCR analysis of podocalyxin expression in collagen gel (light bar) and collagen membrane (dark bar) over time.

FIG. 6 is a graph showing TaqMan PCR analysis of the time course of moesin expression in collagen gel (light bar) and collagen membrane (dark bar).

FIG. 7 is a graph showing TaqMan PCR analysis of the time course of mesoendothelial keratin expression in collagen gel (light bar) and collagen membrane (dark bar).

[Fig8] Fig. 8 is a graph showing TaqMan PCR analysis of T-plastin expression over time in collagen gel (light bar) and collagen membrane (dark bar).

FIG. 9 is a graph showing TaqMan PCR analysis of the time course of actin-packing protein expression in collagen gel (light bar) and collagen membrane (dark bar).

FIG. 10 is a graph showing TaqMan PCR analysis of the time course of brain ankyrin expression in collagen gel (light bar) and collagen membrane (dark bar).

[FIG. 11] A graph showing TaqMan PCR analysis of the time course of expression of tissue factor pathway inhibitor-2 in collagen gel (light bar) and collagen membrane (dark bar).

FIG. 12 is a graph showing TaqMan PCR analysis of cathepsin B expression over time in collagen gel (light bar) and collagen membrane (dark bar).

FIG. 13 is a graph showing TaqMan PCR analysis of plasminogen activator inhibitor expression over time in collagen gel (light bar) and collagen membrane (dark bar).

FIG. 14 is a graph showing TaqMan PCR analysis of ADAMTS-4 expression over time in collagen gel (light bar) and collagen membrane (dark bar).

FIG. 15 is a graph showing TaqMan PCR analysis of axl expression over time in collagen gel (light bar) and collagen membrane (dark bar).

FIG. 16 is a graph showing TaqMan PCR analysis of ECK expression time course in collagen gel (light bar) and collagen membrane (dark bar).

FIG. 17 is a graph showing TaqMan PCR analysis of OX-40 expression in collagen gel (light bar) and collagen membrane (dark bar) over time.

FIG. 18 is a graph showing TaqMan PCR analysis of gp130 expression over time in collagen gel (light bar) and collagen membrane (dark bar).

[FIG. 19] A graph showing TaqMan PCR analysis of time course of CD82 expression in collagen gel (light bar) and collagen membrane (dark bar).

FIG. 20 is a graph showing TaqMan PCR analysis of PRZ expression over time in collagen gel (light bar) and collagen membrane (dark bar).

FIG. 21 is a graph showing TaqMan PCR analysis of the time course of alpha2 integrin expression in collagen gel (light bar) and collagen membrane (dark bar).

FIG. 22 is a graph showing TaqMan PCR analysis of PIGF expression over time in collagen gel (light bar) and collagen membrane (dark bar).

FIG. 23 is a graph showing TaqMan PCR analysis of the time course of stanniocalcin precursor expression in collagen gel (light bar) and collagen membrane (dark bar).

[FIG. 24] A graph showing TaqMan PCR analysis of FGF16 expression in collagen gel (light bar) and collagen membrane (dark bar) over time.

FIG. 25 is a graph showing TaqMan PCR analysis of the time course of white protein homologue expression in collagen gel (light bar) and collagen membrane (dark bar).

FIG. 26 shows the results of hematoxylin-eosin staining (upper panel) and in situ hybridization (lower panel) of podocalyxin expression in blood vessels surrounding lung squamous cell carcinoma.

FIG. 27 shows the results of hematoxylin-eosin staining of protein zero expression in tissues associated with lung adenocarcinoma (upper panel) and in situ hybridization (lower panel).

FIG. 28 shows the results of hematoxylin-eosin staining (upper panel) and in situ hybridization (lower panel) of stanniocalcin precursor mRNA expression in mammalian ductal carcinoma.

FIG. 29 shows the results of hematoxylin-eosin staining (upper panel) and in situ hybridization (lower panel) of stanniocalcin body mRNA expression in squamous cell carcinoma.

[Fig30] This is the amino acid sequence of r0v0-176.7A [PA27].

FIG. 31 is a graph showing a hydrophobic-hydrophilicity index plot of r0v0-176.7A [PA27].

FIG. 32 is a graph showing Clustal W of mouse, rat, and human ortholog of r0v0-176.7A [PA27]. The "Detailed Description of the Invention" in the translation submitted on May 17, 2001 based on Article 184-4 (1) of the Patent Act was incorrect from the translation of another application. Therefore, the relevant part was corrected to the original correct translation.

─────────────────────────────────────────────────── ─── Continuation of front page (51) Int.Cl. ⁷ Identification code FI theme code (reference) A61K 39/395 A61P 1/04 4C085 45/00 9/00 4C086 48/00 9/08 4H045 A61P 1/04 9/10 9/00 101 9/08 9/12 9/10 15/00 101 17/02 9/12 17/06 15/00 19/02 17/02 19/10 17/06 27/02 19/02 29/00 101 19/10 35/00 27/02 43/00 121 29/00 101 C07K 14/705 35/00 16/28 43/00 121 C12M 1/00 A C07K 14/705 C12N 1/15 16 / 28 1/19 C12M 1/00 1/21 C12N 1/15 C12Q 1/02 1/19 1/68 A 1/21 G01N 33/53 D 5/10 M C12Q 1/02 33/566 1/68 C12N 15 / 00 ZNAA G01N 33/53 5/00 A 15/00 F 33/566 A61K 37/04 (31) Priority claim number 09 / 703,350 (32) Priority date October 2000 31st (October 31, 2000) (33) Priority claiming countries United States (US) (81) Designated countries EP (AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE , IT, LU, MC, NL, PT, SE, TR), OA (BF, BJ, CF, CG, CI, CM, GA, GN, GW, ML, MR, NE, SN, TD, TG), AP (GH, GM, KE, LS, MW, MZ, SD, SL, SZ, TZ, UG, ZW), EA (AM, AZ, BY, KG, KZ, MD, RU, TJ, TM), AE , AG, AL, AM, AT, AU, AZ, BA, BB, BG, BR, BY, BZ, CA, CH, CN, CR, CU, CZ, DE, DK, DM, DZ, EE, ES, FI, GB, GD, GE, GH, GM, HR, HU, ID, IL, IN, IS, JP, KE, KG, KP, KR, K , LC, LK, LR, LS, LT, LU, LV, MA, MD, MG, MK, MN, MW, MX, MZ, NO, NZ, PL, PT, RO, RU, SD, SE, SG, SI, SK, SL, TJ, TM, TR, TT, TZ, UA, UG, US, UZ, VN, YU, ZA, ZW (72) Inventor Melavan, Faud United States Connecticut 06511, New Haven, Long Wharf Drive 555,11 THI Floor (72) Inventor Geritzen, Marie United States California 94402, San Mateo, Parrot Drive 541 (72) Inventor Lastelli, Luca United States Connecticut 06437, Guilford, Pepper Bush Lane 52 F Term (reference) 4B024 AA01 AA11 BA63 CA04 CA09 DA02 DA03 DA06 EA04 GA11 HA12 HA17 4B029 AA07 AA23 BB20 CC03 FA15 4B063 QA01 QA05 QA13 QA18 QA 19 QQ08 QQ20 QQ42 QR32 QR55 QR62 QS25 QS34 4B065 AA26X AA80X AA88X AA90X AA91X AA93X AB01 AC14 BA02 CA24 CA44 CA46 4C084 AA02 AA06 AA07 A15 ZA97 ZA52B97BA15 BA14 DB70 BA22 BA70 MA22 BA22 ZC03 ZC41 4C085 AA13 AA14 BB07 BB11 CC07 CC08 CC21 CC31 DD23 DD62 DD63 EE01 EE03 4C086 AA01 AA02 AA03 EA16 MA01 MA02 MA04 NA14 ZA33 ZA36 ZA42 ZA45 FA40 A40 A40 A40 A40 A40 A40 A40 A40 A40 A40 AA25 AA01 AA02 AA03 AA03 AA03 AA03 AA03 AA03 AA03 AA03 AA03 AA03 AA03 AA03 AA03 AA03 AA03 AA03 AA03 AA03 AA03 AA02 AA03 AA03 AA03 AA03 AA02 AA03 AA03 AA02 AA03 AA03 AA03 AA03 AA03 AA02 AA03 AA03 AA03 AA03 AA03 AA3

Claims (68)

[Claims] 1. A method of assessing the efficacy of treatment of an angiogenic disorder in a patient, comprising: a) a cell capable of expressing one or more nucleic acid sequences selected from the group consisting of PA: 1-27. Supplying a test cell population from a patient, b) detecting the expression of one or more nucleic acid sequences in said test cell population, and c) expressing the expression of the nucleic acid sequence in the test cell population in cells of known angiogenic stage. Compared to the expression of the nucleic acid sequence in a reference cell population comprising at least one, d) PA: 1-2 in the test cell population and the reference cell population, if present.
Identifying the differences in the expression levels of the 7 sequences and thereby assessing the efficacy of treating angiogenic disorders in the patient. 2. The method of claim 1, wherein the patient is a mammal. 3. The method according to claim 2, wherein the patient is a human. 4. The method of claim 1, wherein the expression of the nucleic acid sequence in the test cell population is increased compared to the reference cell population. 5. The method of claim 1, wherein the expression of the nucleic acid sequence in the test cell population is reduced compared to the reference cell population. 6. The method of claim 1, wherein the test cell population is provided in vitro. 7. The method of claim 1, wherein the test cell population is provided ex vivo from a mammalian patient. 8. The method of claim 1, wherein the test cell is provided in vivo in a mammalian patient. 9. A method of diagnosing angiogenic disorders in a patient, comprising: a) a test cell population comprising cells capable of expressing one or more nucleic acid sequences selected from the group consisting of PA: 1-27. Patient-supplied, b) detecting expression of one or more nucleic acid sequences in the test cell population, and c) expressing nucleic acid sequence in the test cell population, comprising at least one cell of known angiogenic stage. Compared to the expression of the nucleic acid sequence in the reference cell population, d) PA: 1-2 in the test cell population and the reference cell population, if present.
Identifying the differences in the expression levels of the 7 sequences and thereby diagnosing angiogenic disorders in the patient. 10. The method of claim 9, wherein the patient is a mammal. 11. The method of claim 10, wherein the patient is a human. 12. The method of claim 9, wherein the expression of the nucleic acid sequence in the test cell population is increased compared to the reference cell population. 13. The method of claim 9, wherein the expression of the nucleic acid sequence in the test cell population is reduced compared to the reference cell population. 14. The method of claim 9, wherein the test cell population is provided in vitro. 15. The method of claim 9, wherein the test cell population is provided ex vivo from a mammalian patient. 16. The method of claim 9, wherein the test cell is provided in vivo in a mammalian patient. 17. A method of identifying a test therapeutic agent for the treatment of angiogenic disorders in a patient, which comprises: a) expressing one or more nucleic acid sequences selected from the group consisting of PA: 1-27. Providing a test cell population comprising cells from a patient; b) contacting the test cell population with a test therapeutic agent; c) detecting expression of one or more nucleic acid sequences in the test cell population; d) test cell population Comparing the expression of the nucleic acid sequence in a reference cell population comprising at least one cell of known angiogenic stage; and e) the test cell population and the reference cell population, if present. In PA: 1-2
Identifying the difference in the expression level of the 7 sequence, thereby identifying a test therapeutic agent for treating an angiogenic disorder in a patient. 18. The method of claim 17, wherein the patient is a mammal. 19. The method of claim 18, wherein the patient is a human. 20. The test therapeutic agent is a known anti-angiogenic disorder agent.
The method described in. 21. The method of claim 17, wherein the test therapeutic agent is an agonist of the natural PA polypeptide. 22. The method of claim 17, wherein the test therapeutic agent is an antagonist of the native PA polypeptide. 23. The method of claim 21, wherein the agonist is an anti-PA antibody. 24. The method of claim 22, wherein the antagonist is an anti-PA antibody. 25. The test therapeutic agent is an unknown anti-angiogenic disorder agent.
The method described in. 26. Angiogenic disorders include vascular tumors, proliferative vitreoretinopathy, rheumatoid arthritis, Crohn's disease, atherosclerosis, ovarian hyperstimulation, psoriasis, endometriosis with neovascularization, Balloon angioplasty followed by restenosis, scar tissue hyperplasia, peripheral vasculopathy, hypertension, inflammatory vasculitis, Reynolds disease and Reynolds phenomenon, aneurysm,
Arterial restenosis, thrombophlebitis, lymphangitis, lymphedema, wound healing and tissue regeneration, ischemic reperfusion injury, angina, myocardial infarction, chronic heart failure, heart failure such as congestive heart failure, age-related macular degeneration, 18. The method of claim 17, selected from the group consisting of: and osteoporosis. 27. A method of diagnosing or measuring susceptibility to angiogenic disorders in a patient, comprising: a) a cell capable of expressing one or more nucleic acid sequences selected from the group consisting of PA: 1-27. Providing a test cell population from a patient, b) measuring the expression of one or more nucleic acid sequences in the test cell population, and c) expressing the nucleic acid sequence in the test cell population from a patient of known angiogenic stage. Comparing the expression of the nucleic acid sequence in a reference cell population comprising at least one cell, and d) identifying the difference in the expression level of the nucleic acid sequence in the test cell population and the reference cell population, if present, and thereby in the patient. A method comprising diagnosing or measuring susceptibility to angiogenic disorders. 28. The method of claim 27, wherein the patient is a mammal. 29. The method of claim 28, wherein the patient is a human. 30. A method of treating an angiogenic disorder, wherein the patient suffering from or at risk of developing an angiogenic disorder is selected from the group consisting of PA: 1-27.
Or a method comprising administering an agent that modulates the expression or activity of multiple nucleic acid sequences. 31. In a patient suffering from or at risk of developing an angiogenic disorder,
31. The method of claim 30, comprising administering an agent that reduces the expression or activity of one or more nucleic acid sequences selected from the group consisting of PA: 5, 14 and 15. 32. A patient suffering from or at risk of developing an angiogenic disorder,
31. The method of claim 30, comprising administering an agent that increases the expression or activity of one or more nucleic acid sequences selected from the group consisting of PA: 1-4, 6-13 and 16-26. 33. The agent is an antibody to a polypeptide encoded by a PA nucleic acid sequence, an antisense nucleic acid molecule, a peptide, a PA polypeptide agonist, a PA polypeptide antagonist, a peptide analog, a small molecule, or another drug. 31. The method of claim 30. 34. The method of claim 30, wherein the angiogenic disorder is selected from the group consisting of cardiac hypertrophy, trauma, age-related macular degeneration, and cancer. 35. A kit comprising one or more reagents for detecting two or more nucleic acid sequences selected from the group consisting of PA: 1-27. 36. An array of probe nucleic acids, wherein the probe nucleic acids are PA.
An array for detecting two or more nucleic acid sequences selected from the group consisting of: 1-27. 37. An isolated polypeptide used for treating an angiogenic disorder in a patient, comprising: a) a polypeptide comprising the amino acid sequence of PA: 1-27; b) PA: 1-. A fragment of a polypeptide comprising 27 amino acid sequences, comprising:
A fragment comprising at least 6 contiguous amino acids of 1-27; c) a derivative of a polypeptide comprising the amino acid sequence of PA: 1-27; d) an analogue of a polypeptide comprising the amino acid sequence of PA: 1-27; And e) a polypeptide at least 80% identical to a polypeptide selected from the group consisting of homologues of a polypeptide comprising the amino acid sequence of PA: 1-27. 38. The polypeptide of claim 37, wherein expression of the polypeptide is downregulated in an angiogenic environment and the polypeptide is selected from the group consisting of PA: 5, 14 and 15. 39. The poly of claim 37, wherein expression of the polypeptide is upregulated in an angiogenic environment and the polypeptide is selected from the group consisting of PA: 1-4, 6-13 and 16-26. peptide. 40. The polypeptide of claim 37, wherein the patient is a mammal. 41. The polypeptide of claim 40, wherein the patient is human. 42. An isolated nucleic acid molecule used to treat an angiogenic disorder in a patient, wherein the nucleic acid sequence is PA: 1-27 or at least 75% of one of its complements. Identical nucleic acid molecule. 43. The expression state of a nucleic acid sequence is downregulated in an angiogenic environment and the nucleic acid is selected from the group consisting of PA: 5, 14 and 15.
2. The nucleic acid molecule according to 2. 44. The nucleic acid of claim 42, wherein the expression status of the nucleic acid sequence is upregulated in the angiogenic environment and the nucleic acid is selected from the group consisting of PA: 1-4, 6-13 and 16-26. molecule. 45. The nucleic acid molecule according to claim 42, wherein the patient is a mammal. 46. The nucleic acid molecule according to claim 45, wherein the patient is a human. 47. A therapeutic composition comprising the polypeptide of claim 37 and a pharmaceutically acceptable carrier. 48. The therapeutic composition of claim 47, further comprising an additional active ingredient selected from the group consisting of cardiovascular agents, endothelial agents, angiogenic agents, and vasodilators. 49. A therapeutic composition comprising the nucleic acid molecule of claim 42 and a pharmaceutically acceptable carrier. 50. The therapeutic composition of claim 49, further comprising an additional active ingredient selected from the group consisting of cardiovascular agents, endothelial agents, angiogenic agents, and vasodilators. 51. An agonist or antagonist of PA polypeptide,
A therapeutic composition comprising a pharmaceutically acceptable carrier. 52. The therapeutic composition of claim 51, further comprising an additional active ingredient selected from the group consisting of cardiovascular agents, endothelial agents, angiogenic agents, and vasodilators. 53. A therapeutic composition used in the treatment of angiogenic disorders,
A kit comprising a pharmaceutically acceptable carrier, wherein the therapeutic composition comprises:
A kit selected from the group consisting of PA polypeptides, agonists of PA polypeptides, and antagonists of PA polypeptides. 54. A method of treating an angiogenic disorder, comprising administering the therapeutic composition of claim 47. 55. A method of treating an angiogenic disorder, comprising administering the therapeutic composition of claim 49. 56. A method of inhibiting angiogenesis in a mammal, comprising administering to the mammal a therapeutically effective amount of a therapeutic composition that inhibits angiogenesis. 57. The method of claim 56, wherein the therapeutic composition is selected from the group consisting of PA polypeptides, agonists of PA polypeptides, antagonists of PA polypeptides, and anti-PA antibodies. 58. A method of stimulating angiogenesis in a mammal, comprising administering to the mammal a therapeutically effective amount of a therapeutic composition that stimulates angiogenesis. 59. The method of claim 58, wherein the therapeutic composition is selected from the group consisting of PA polypeptides, agonists of PA polypeptides, antagonists of PA polypeptides, and anti-PA antibodies. 60. An isolated nucleic acid molecule comprising a nucleic acid sequence that encodes the polypeptide of SEQ ID NO: 72, or a nucleic acid sequence that is at least 75% identical to the complement of that nucleic acid sequence. 61. A nucleic acid vector comprising the nucleic acid sequence of claim 60. 62. A host cell comprising the isolated nucleic acid molecule of claim 60. 63) a) a polypeptide comprising the amino acid sequence of SEQ ID NO: 72; b) a fragment of a polypeptide comprising the amino acid sequence of SEQ ID NO: 72, the fragment comprising at least 6 contiguous amino acids; c) A derivative of a polypeptide comprising the amino acid sequence of SEQ ID NO: 72; d) an analogue of a polypeptide comprising the amino acid sequence of SEQ ID NO: 72; and e) consisting of a homologue of the polypeptide comprising the amino acid sequence of SEQ ID NO: 72 An isolated polypeptide that is at least 80% identical to a polypeptide selected from the group. 64. An antibody that selectively binds to the polypeptide of claim 63 and fragments, homologues, analogs and derivatives of the antibody. 65. A pharmaceutical composition comprising the nucleic acid of claim 60. 66. A pharmaceutical composition comprising the polypeptide of claim 63. 67. A method of detecting the presence of the nucleic acid of claim 60 in a sample, the sample being contacted with a compound that selectively binds to the nucleic acid of claim 60,
61. A method comprising detecting detecting whether a compound bound to the nucleic acid of claim 60 is present in a sample. 68. A method for detecting the presence of the polypeptide of claim 63 in a sample, wherein the sample is contacted with a compound that selectively binds to the polypeptide of claim 63. Detecting the presence or absence of a compound bound to the polypeptide according to claim 1 in a sample.