WO2008002573A2 - Bile acid derivatives as fxr ligands for the prevention or treatment of fxr-mediated deseases or conditions - Google Patents

Bile acid derivatives as fxr ligands for the prevention or treatment of fxr-mediated deseases or conditions Download PDF

Info

Publication number
WO2008002573A2
WO2008002573A2 PCT/US2007/014829 US2007014829W WO2008002573A2 WO 2008002573 A2 WO2008002573 A2 WO 2008002573A2 US 2007014829 W US2007014829 W US 2007014829W WO 2008002573 A2 WO2008002573 A2 WO 2008002573A2
Authority
WO
WIPO (PCT)
Prior art keywords
disease
compound
formula
liver
fxr
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2007/014829
Other languages
French (fr)
Other versions
WO2008002573A3 (en
Inventor
Roberto Pellicciari
Stefano Fiorucci
Mark Pruzanski
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Intercept Pharmaceuticals Inc
Original Assignee
Intercept Pharmaceuticals Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=38846269&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=WO2008002573(A2) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Priority to SI200731515T priority Critical patent/SI2040713T1/en
Priority to JP2009518230A priority patent/JP5222846B2/en
Priority to EP07809913.2A priority patent/EP2040713B1/en
Priority to HK09109151.7A priority patent/HK1130187B/en
Priority to CN2007800321119A priority patent/CN101522703B/en
Priority to CA2656320A priority patent/CA2656320C/en
Priority to DK07809913.2T priority patent/DK2040713T3/en
Application filed by Intercept Pharmaceuticals Inc filed Critical Intercept Pharmaceuticals Inc
Priority to AU2007265457A priority patent/AU2007265457C1/en
Priority to ES07809913.2T priority patent/ES2523591T3/en
Priority to PL07809913T priority patent/PL2040713T3/en
Publication of WO2008002573A2 publication Critical patent/WO2008002573A2/en
Publication of WO2008002573A3 publication Critical patent/WO2008002573A3/en
Priority to IL196169A priority patent/IL196169A/en
Anticipated expiration legal-status Critical
Priority to IL221764A priority patent/IL221764A/en
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/56Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids
    • A61K31/575Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids substituted in position 17 beta by a chain of three or more carbon atoms, e.g. cholane, cholestane, ergosterol, sitosterol
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/04Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/12Antidiarrhoeals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/14Prodigestives, e.g. acids, enzymes, appetite stimulants, antidyspeptics, tonics, antiflatulents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00Drugs for disorders of the urinary system
    • A61P13/12Drugs for disorders of the urinary system of the kidneys
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/04Anorexiants; Antiobesity agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/06Antihyperlipidemics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/08Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04Antibacterial agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • A61P37/06Immunosuppressants, e.g. drugs for graft rejection
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/10Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/12Antihypertensives
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07JSTEROIDS
    • C07J31/00Normal steroids containing one or more sulfur atoms not belonging to a hetero ring
    • C07J31/006Normal steroids containing one or more sulfur atoms not belonging to a hetero ring not covered by C07J31/003
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07JSTEROIDS
    • C07J9/00Normal steroids containing carbon, hydrogen, halogen or oxygen substituted in position 17 beta by a chain of more than two carbon atoms, e.g. cholane, cholestane, coprostane

Definitions

  • the present invention relates to Farnesoid X receptor (FXR) modulators which can be used for the treatment of cholestatic disorders, in particular to bile acid derivatives wherein the Ce contains an ethyl and the C24 carboxy group is transformed into a sulphate group.
  • FXR Farnesoid X receptor
  • Farnesoid X Receptor is an orphan nuclear receptor initially identified from a rat liver cDNA library (BM. Forman, et al., Cell 81:687-693 (1995)) that is most closely related to the insect ecdysone receptor.
  • FXR is a member of the nuclear receptor family of ligand-activated transcription factors that includes receptors for the steroid, retinoid, and thyroid hormones (DJ. Mangelsdorf, et al., Cell 83:841-850 (1995)).
  • Northern and in situ analysis show that FXR is most abundantly expressed in the liver, intestine, kidney, and adrenal (BM.
  • FXR binds to DNA as a heterodimer with the 9-cis retinoic acid receptor (RXR).
  • RXR 9-cis retinoic acid receptor
  • the FXR/RXR heterodimer preferentially binds to response elements composed of two nuclear receptor half sites of the consensus AG(G/T)TCA organized as an inverted repeat and separated by a single nucleotide (IR-I motif) (BM. Forman, et al., Cell 81:687- 693 (1995)).
  • the bile acids that serve as FXR ligands include chenodeoxycholic acid (CDCA), deoxycholic acid (DCA), lithocholic acid (LCA), and the taurine and glycine conjugates of these bile acids.
  • Bile acids are cholesterol metabolites that are formed in the liver and secreted into the duodenum of the intestine, where they have important roles in the solubilization and absorption of dietary lipids and vitamins. Most bile acids ( ⁇ 95%) are subsequently reabsorbed in the ileum and returned to the liver via the enterohepatic circulatory system.
  • bile acids down-regulate the transcription of cytochrome P450 7a (CYP7a), which encodes the enzyme that catalyzes the rate limiting step in bile acid biosynthesis.
  • CYP7a cytochrome P450 7a
  • FXR farnesoid receptor
  • IBABP intestinal bile acid binding protein
  • EP 1392714 discloses 3 ⁇ ,7 ⁇ -dihydroxy-6 ⁇ -ethyl-5 ⁇ -cholan-24-oic acid (hereinafter also referred to as 6-ethyl-chenodeoxycholic acid, 6-EDCA), solvates and amino acids conjugates thereof as FXR agonists, which can be used in the preparation of medicaments for the prevention or treatment of FXR-mediated diseases or conditions.
  • EP 1568796 discloses 6-ethyl-ursodeoxycholic acid (6-EUDCA) derivatives as FXR agonists and their use in the prevention or treatment of FXR-mediated diseases or conditions.
  • the present invention provides compounds of formula (I):
  • R is hydrogen or alpha-hydroxy, the hydroxyl group in position 7 is in the alpha or beta position; and pharmaceutically acceptable salts, solvates or amino acid conjugates thereof.
  • the compound of formula (I) is in the form of a chenodeoxycholic acid derivative. In another embodiment, the compound of formula (I) is in the form of a ursodeoxycholic acid derivative. In still another embodiment, the compound of formula (I) is in the form of a cholic acid derivative.
  • the compound of formula (I) is in the form of a trie thy 1 ammonium salt:
  • the compound of formula (I) is in the form of a sodium salt:
  • the present invention provides a method for the prevention or treatment of an FXR mediated disease or condition.
  • the method comprises administering a therapeutically effective amount of a compound of formula (I).
  • the present invention also provides the use of a compound of formula (I) for the preparation of a medicament for the prevention or treatment of an FXR mediated disease or condition.
  • the gastrointestinal disease is inflammatory bowel disease (IBD) (including Crohn's disease and ulcerative colitis), irritable bowel syndrome (IBS), bacterial overgrowth, malabsorption, post-radiation colitis, or microscopic colitis.
  • the renal disease is diabetic nephropathy, focal segmental glomerulosclerosis (FSGS), hypertensive nephrosclerosis, chronic glomerulonephritis, chronic transplant glomerulopathy, chronic interstitial nephritis, or polycystic kidney disease.
  • the cardiovascular disease is atherosclerosis, arteriosclerosis, dyslipidemia, hypercholesterolemia, or hypertriglyceridemia.
  • the metabolic disease is insulin resistance, Type I and Type II diabetes, or obesity.
  • Figure 6 shows the effect of UPF-987 on stool consistency.
  • Figure 7 shows the effect of UPF-987 on mucosal damage score.
  • Figure 8 shows the effect of UPF-987 on mouse colon genes expression. The result is the mean of two quantitative Real-Time PCR experiments.
  • Figure 19 shows the effect of INT-1 103 on plasmatic ALT in ANIT-induced cholestasic rats.
  • Figure 22 shows the effect of INT-1103 on body weight in ANIT-induced cholestasic rats.
  • Figure 23 shows the resulting liver ratio (liver weight/body weight xlOO).
  • Figure 24 shows the effect of INT-1 103 on plasmatic bilirubin in BDL- induced cholestasic rats.
  • Figure 30 shows the resulting liver ratio (liver weight/body weight x 100).
  • Figure 31 shows the effect of INT-1103 and INT-747 on bile flow in naive rats.
  • Figure 32 shows the effect of INT-1103 and INT-747 on bile flow in estrogen colestatic rats.
  • Figure 33 shows the effect of INT-1103 and INT-747 on liver ratio in estrogen colestatic rats.
  • Figure 37 shows the surface tension (dyne/cm) plotted against the logarithm of the bile salt concentration (mM) in NaCl 0.15 M.
  • Figure 38 shows the secretion rate of taurine conjugated INT-747. Data are reported as concentration in bile and should be corrected by the bile volume.
  • Figure 39 shows the secretion rate of glycine conjugated INT-747. Data are reported as concentration in bile and should be corrected by the bile volume.
  • Figure 40 shows the secretion rate of INT-747. Data are reported as concentration in bile and should be corrected by the bile volume.
  • Figure 41 shows the secretion rate of INT-747 epimers. Data are reported as concentration in bile and should be corrected by the bile volume.
  • Figure 44 shows the secretion rate of INT-1103 and its main metabolite 3- Glucuronides. The relative amount are expressed as analytical signal. Data are reported as concentration in bile and should be corrected by the bile volume.
  • Figure 46 shows the secretion rate of INT-1103 main metabolites identified in bile using mass spectrometry zoom display. Data are reported as concentration in bile and should be corrected by the bile volume.
  • Figure 48 shows the metabolic stability of INT-1103 in simulated pancreatic fluid.
  • Olive oil was used as a reference as reported in the USP protocol.
  • the compound is very stable and the ester bond (sulphate) is not hydro lyzed by pancreatic esterases, suggesting a high stability in human duodenal and upper intestine content.
  • R is hydrogen or alpha-hydroxy, the hydroxyl group in position 7 is in the alpha or beta position; and pharmaceutically acceptable salts, solvates or amino acid conjugates thereof.
  • Suitable pharmaceutically acceptable salts will be readily determined by one skilled in the art and will include, for example, basic salts such as alkali or alkaline-earth metallic salts made from aluminium, calcium, lithium, magnesium, potassium, sodium, and zinc or organic salts made from N.N'-dibenzylethylenediamine, chlorprocaine, choline, diethanolamine, ethyle ⁇ diamine, meglumine (N-methylglucamine), and procaine. Salts with pharmaceutically acceptable amines such as lysine, arginine, tromethamine, triethylamine and the like can also be used. Such salts of the compounds of formula (I) may be prepared using conventional techniques, from the compound of Formula (I) by reacting, for example, the appropriate base with the compound of Formula (I).
  • basic salts such as alkali or alkaline-earth metallic salts made from aluminium, calcium, lithium, magnesium, potassium, sodium, and zinc or organic salts made from N.N'-di
  • salts of a compound of formula (I) should be pharmaceutically acceptable, but pharmaceutically unacceptable salts may conveniently be used to prepare the corresponding free base or pharmaceutically acceptable salts thereof.
  • solvate is a crystal form containing the compound of formula (I) or a pharmaceutically acceptable salt thereof and either a stoichiometric or a non-stoichiometric amount of a solvent.
  • Solvents include water, methanol, ethanol, or acetic acid.
  • reference to a compound of formula (I) is to any physical form of that compound, unless a particular form, salt or solvate thereof is specified.
  • amino acid conjugates refers to conjugates of the compounds of formula (I) with any suitable amino acid.
  • suitable amino acid conjugates of the compounds of formula (I) will have the added advantage of enhanced integrity in bile or intestinal fluids.
  • suitable amino acids include but are not limited to glycine and taurine.
  • the present invention encompasses the glycine and taurine conjugates of any of the compounds of formula
  • the compound of formula I is a chenodeoxycholic acid derivative, wherein the hydroxyl group in 7 is in the alpha position and R is hydrogen. In another embodiment, the compound of formula I is a ursodeoxycholic acid derivative, wherein the hydroxyl group in 7 is in the beta position and R is hydrogen.
  • the compound of formula I is a cholic acid derivative, wherein the hydroxyl group in 7 is in the alpha position and R is alpha- hydroxy.
  • the compounds of formula I may be prepared starting from the 6-ethyl-7- keto-cholic acids, prepared as disclosed in EP 1392714 and EP 1568796, suitably protected at the 3-hydroxy moiety, by a reaction sequence comprising the transformation of the C24 carboxy group into a iodine atom, the conversion of the latter into an hydroxyl group, reduction of the 7-keto group to give the corresponding 3 -alpha or 3-beta hydroxyl group, the selective sulfonylation of the C24 hydroxy group and the deprotection of the 3-hydroxy group.
  • reaction scheme and the reagents used in each step are reported in the following scheme showing the preparation of 3 ⁇ ,7 ⁇ ,23-trihydroxy-6 ⁇ -ethyl-24-nor- 5/?-cholan-23 -sulphate in the form of triethylammonium salt (UPF-987 or compound (9) below).
  • UPF-987 or compound (9) triethylammonium salt
  • the same scheme may be adapted, by suitably substituting the reagents and/or starting materials and optionally by also changing reaction sequences and protective groups, for the preparation of other compounds of formula I.
  • reaction scheme and the reagents used in each step are reported in the following scheme below showing the preparation of 3 ⁇ ,7 ⁇ ,23-trihydroxy-6 ⁇ -ethyl- 24-nor-5/?-cholan-23-sulphate in the form of sodium salt (INT-1 103 or compound (10) below).
  • the same scheme may be adapted, by suitably substituting the reagents and/or starting materials and optionally by also changing reaction sequences and protective groups, for the preparation of other pharmaceutically acceptable salt forms of formula I.
  • Chronic liver diseases which may be prevented or treated using compounds of formula (I) include but are not limited to primary biliary cirrhosis (PBC), primary sclerosing cholangitis (PSC), cerebrotendinous xanthomatosis (CTX), drug induced cholestasis, intrahepatic cholestasis of pregnancy, parenteral nutrition associated cholestasis (PNAC), bacterial overgrowth or sepsis associated cholestasis, autoimmune hepatitis, chronic viral hepatitis, alcoholic liver disease, nonalcoholic fatty liver disease (NAFLD), nonalcoholic steatohepatitis (NASH), liver transplant associated graft versus host disease, living donor transplant liver regeneration, congenital hepatic fibrosis, choledocholithiasis, granulomatous liver disease, intra- or extrahepatic malignancy, Sjogren's syndrome, Sarcoidosis,
  • PBC primary biliary cirrhosis
  • Gastrointestinal diseases which may be prevented or treated using compounds of formula (I) include but are not limited to inflammatory bowel disease (IBD) (including Crohn's disease and ulcerative colitis), irritable bowel syndrome (IBS), bacterial overgrowth , malabsorption, post-radiation colitis, and microscopic colitis.
  • IBD inflammatory bowel disease
  • IBS irritable bowel syndrome
  • bacterial overgrowth malabsorption, post-radiation colitis, and microscopic colitis.
  • Renal diseases which may be prevented or treated using compounds of formula (I) include but are not limited to diabetic nephropathy, focal segmental glomerulosclerosis (FSGS), hypertensive nephrosclerosis, chronic glomerulonephritis, chronic transplant glomerulopathy, chronic interstitial nephritis, and polycystic kidney disease.
  • Cardiovascular diseases which may be prevented or treated using compounds of formula (I) include but are not limited to atherosclerosis, arteriosclerosis, dyslipidemia, hypercholesterolemia, and hypertriglyceridemia.
  • Metabolic diseases which may be prevented or treated using compounds of formula (I) include but are not limited to insulin resistance, Type I and Type II diabetes, and obesity.
  • the present invention provides pharmaceutical compositions comprising, as active ingredient, a compound of formula (I) together, and/or in admixture, with at least one pharmaceutical carrier or diluent.
  • These pharmaceutical compositions may be used in the prophylaxis and treatment of the foregoing diseases or conditions.
  • Formulations suitable for topical or intranasal application include ointments, creams, lotions, pastes, gels, sprays, aerosols and oils.
  • Suitable carriers for such formulations include petroleum jelly, lanolin, polyethyleneglycols, alcohols, and combinations thereof.
  • Nebulisers are commercially available devices that transform solutions or suspensions of the active ingredient into a therapeutic aerosol mist either by means of acceleration of a compressed gas typically air or oxygen, through a narrow venturi orifice, or by means of ultrasonic agitation.
  • Suitable formulations for use in nebulisers consist of the active ingredient in a liquid carrier and comprise up to 40% w/w of the formulation, preferably less than 20% w/w.
  • the carrier is typically water or a dilute aqueous alcoholic solution, preferably made isotonic with body fluids by the addition of, for example, sodium chloride.
  • Optional additives include preservatives if the formulation is not prepared sterile, for example, methyl hydroxy- benzoate, anti-oxidants, flavouring agents, volatile oils, buffering agents and surfactants.
  • the compound 3 (2.2 g, 3.8 mmol) was stirred in a solution of HCl 37% in THF (50 ml) overnight at room temperature. The reaction mixture was washed with a saturated solution OfNaHCO 3 (20 ml), H 2 O (20 ml), brine (20 ml) dried over
  • FXR modulators will be used for the treatment of the inflammatory, cholestatic, fibrotic liver disorders, and metabolic disorders including hypertriglyceridemic and hypercholesterolemic states and, by extension, atherosclerosis and its complications.
  • mice were administered intra- peritoneally, UPF-987 (0.3-1-
  • Cholestasis results in intrahepatic accumulation of cytotoxic bile acids which cause liver injury ultimately leading to biliary fibrosis and cirrhosis. Cholestatic liver damage is counteracted by a variety of intrinsic hepatoprotective mechanisms. Such defense mechanisms include repression of hepatic bile acid uptake and de novo bile acid synthesis. Furthermore, phase I and II bile acid detoxification is induced rendering bile acids more hydrophilic. In addition to "orthograde" export via canalicular export systems, these compounds are also excreted via basolateral "alternative" export systems into the systemic circulation followed by renal elimination.
  • mice 100mg/kg via gavage plus UPF-987 5 and 3 mg/kg intraperitoneally daily.
  • rats were sacrificed under anaesthesia with sodium pentobarbital (50 mg/kg i.p.) and terminally bled via cardiac puncture; the liver was removed and weighted for examination and blood samples were taken.
  • Rat genes expression was evaluated by quantitative real-time polymerase chain reaction (RT-PCR) as previously described herein.
  • RT-PCR quantitative real-time polymerase chain reaction
  • the following PCR primers were designed using PRIMER3 -OUTPUT software using published sequence data from the NCBI database: rGAPDH: atgactctacccacggcaag and atgactctacccacggcaag rSHP cctggagcagccctcgtctcag and aacactgtatgcaaaccgagga rBSEP: aaggcaagaactcgagataccag and tttcactttcaatgtccaccaac rCYP7Al: ctgcagcgagctttatccac and cctgggttgctaagggactc rCYP8Bl : cccctatctctcagtacacatgg and gacc
  • INT-1103 is sulphide derivative of 6-ethyl-chenodeoxycholic acid (6E-CDCA or
  • PCR primers were designed using PRIMER3 -OUTPUT software using published sequence data from the NCBI database: rGAPDH: atgactctacccacggcaag and atgactctacccacggcaag rSHP cctggagcagccctcgtctcag and aacactgtatgcaaaccgagga rBSEP: aaggcaagaactcgagataccag and tttcactttcaatgtccaccaac rCYP7A 1 : ctgcagcgagctttatccac and cctgggttgctaagggactc rCYP8Bl : cccctatctctcagtacacatgg and gaccataaggaggacaaggtct rNTCP: gcatgatgccactcctcttatac and tacatagtgtggcct
  • mice were maintained on standard chow and water ad libitum and housed in a temperature (21-23 0 C)- and humidity (45-50%)-controlled room under a 12-h light/dark cycle. All studies were approved by the Animal Study Committee of the University of Perugia. For bile flow measurement, animals were anesthetized with a single dose of sodium pentobarbital (50 mg/kg body wt intraperitoneally) and maintained under this condition throughout the experiment.
  • bile collection surgical procedures were made on the sixth day ( 1 day after the administration of the last dose of E217 ).
  • animals were anesthetized with a single dose of sodium pentobarbital (50 mg/kg body wt intraperitoneally) and maintained under this condition throughout the experiment. A middle abdominal incision was made, and the common bile duct was also cannulated (PE-10, Intramedic; Clay Adams).. Body temperature was maintained at 37.0 to 38.5°C with a warming lamp to prevent hypothermic alterations of bile flow..
  • Bile collection started between 9:00 and 11:00 AM to minimize influence of circadian variations. Bile was collected at 15-min intervals for 120 min, and bile flow was determined gravimetrically. At the end of the experiments the body and liver rats was weighted.
  • Example 10 In vitro study of insulin gene regulation by INT-747 vs INT-1103 Material and Methods For RT-PCR assay, pancreatic Beta-TC6 cells were cultured in D-MEM supplemented with 1% penicillin/streptomycin, 1% L-glutamine and 10% fetal bovine serum (high glucose) (CELBIO). Cells were grown at 37°C in 5% CO2 and treated with INT-1103 and INT-747, at the final concentration l ⁇ M, for 18 hours. At the and of the experiments the cells were collected for RNA extraction.
  • Real Time PCR Real Time PCR
  • Superscript III Invitrogen, Carsbad, CA
  • the mean value of the replicates for each sample was calculated and expressed as the cycle threshold (CT; cycle number at which each PCR reaction reaches a predetermined fluorescent threshold, set within the linear range of all reactions).
  • CT cycle threshold
  • the amount of gene expression was then calculated as the difference ( ⁇ CT) between the CT value of the sample for the target gene and the mean CT value of that sample for the endogenous control (GAPDH).
  • ⁇ CT difference between ⁇ CT values of the test control sample for each target gene.
  • the relative mRNA expression was shown as 2 ' ⁇ CT .
  • the Primers used in Real-Time PCR were: mGAPDH: gaaggtgaaggtcggagt and catgggtggaatcatattggaa; mSHP: gctgtctggagtccttctgg and ccaatgatagggcgaaagaagag; mSREBPlc: gcaaggccatcgactacatt and ggtcagtgtgtcctcacct.
  • the two bile acid analogues INT-747 and INT-1103, were admitted to a complete physico-chemical properties characterization following protocols previously developed and optimized in our laboratory and previously applied for a complete screening of a large series of Bile acid analogues (UDCA analogues) developed in the R. Pellicciari lab.
  • the physico-chemical properties were selected to accurately define the behaviour in aqueous solutions and in biological fluids and to establish their potential toxicity to biological membranes, their pharmacokinetics and pharmacodynamics and biodistribution in the different biological fluids and organs. Comparative data with natural analogues will be also performed and discussed.
  • BA were suspended in 5 ml of 0.1 M HCl.
  • the saturated solutions after incubation for 1 week, were filtered on a Millipore filter (0.22 ⁇ m) and the concentration of BA was measured by HPLC-ESI-MS/MS using C18 column (150mm x 2mm i.d., 4 ⁇ m) and mobile phases of water containing ISmM acetic acid pH 5 and acetonitrile.
  • the flow rate was 150 ⁇ l/min.
  • the mass spectrometry acquisition was performed in the multiple reaction monitoring mode using the ESI source in negative ionization. Water solubility was expressed as ⁇ mol/liter
  • water solubility refers to BA as protonated species and therefore not evaluated for INT-1103
  • the water solubility was measured for the insoluble protonated species of carboxylated bile acids at a pH 1.
  • the sulphate compound, UPF 1103 is ionized even at low pH and in physiological conditions is always soluble in all biological fluids.
  • the water solubility of INT-747 is 9 ⁇ M , lower than CDCA, and comparable with that of UDCA. Since the CMC of INT-747 is relatively low (see next paragraph), the low water solubility of INT-747 do not compromise the behaviour of the compound in a micellar phase; in the case of UDCA, the low water solubility associated with an high CMC compromises the pH at which the protonated acid goes in solution to form micelles.
  • the CMpH is, in fact, for UDCA 8.4, which is too high if is not present a postprandial alkalinization in duodenal content.
  • Critical Micellar Concentration (CMC) Critical Micellar Concentration
  • This value was determined by surface tension measurements using a maximum bubble-pressure method.
  • the tensiometer was a Sensadyne 6000 (Chem-Dyne Research Corp., Milwaukee, WI) equipped with two glass probes of 0.5 and 4.0 mm diameters connected to a source of nitrogen.
  • the surface tension of BA sodium salts solutions both in water and in NaCl 0.15 M was measured at various concentrations range, 0.2-75 mM and 0.3-100 mM respectively.
  • the CMC, as evaluated by surface tension measurements in non equilibrium conditions i.e. in conditions that impurities do not affect the results, of INT-747 and INT-1103 are relatively low, similar to CDCA natural analogue.
  • INT-1103 presents the lower CMC both in water and in presence of counter ion Na+ 150 mM.
  • the low CMC value of INT-747 is related to the topographic distribution of the ethyl and hydroxyl groups: the ethyl group in the 6 position is oriented in the ⁇ face, the back of the steroid, contributing to increase the lipophilic extent and area of the surface of this moiety and therefore the tendency to form micelles.
  • INT-1103 presents the lower CMC as result of ethyl group in 6 position and the 23 sulphate in the side chain.
  • the peculiar properties of the sulphate group gave to INT-1103 anionic surfactant like properties (like sodium dodecyl sulphate) as a result of a negative charged head and lipophilic tail with a surface lipophilic moiety.
  • the values of the surface tension activity both at CMC and in micellar phase (50 mM) agree with the present CMC data, both compounds are surface active and able to lower the surface tension to a great extent in respect to UDCA and TUDCA. This data further supports the concept that this compounds are detergent like the CDCA analogue and even more.
  • 1-Octanol/water partition coefficient (log P) was evaluated using a conventional shake-flask procedure. The experiments were carried out on 0.1 mM bile salt solution buffered at pH 8 with 0.1 M phosphate buffer to ensure complete ionization of the BA; the log P values refer to the BA in the ionized form, not to the protonated species, and the initial concentration of each BA was below its own CMC value.
  • the aqueous buffer was previously pre-saturated with 1-octanol, 5 ml of 1-octanol pre- saturated with water was then added and the samples were left to equilibrate for 2 weeks under continuous stirring at room temperature After centrifugation the two phases were carefully separated.
  • BA concentration in the water phase was measured with HPLC-ESI-MS/MS using C18 column (150mm x 2mm i.d., 4 ⁇ m) and mobile phases: A: water containing 15 mM acetic acid pH 5 , B: acetonitrile. The flow rate was 150 ⁇ l/min and the column was maintained at 45°C. The mass spectrometry acquisition was performed in the multiple reaction monitoring mode using the ESI source in negative ionization. Table 5: 1-octanol-water partition coefficient of the studied bile acids as ionized species
  • the 1-octanol/water partition coefficient was calculated for the ionized species to facilitate the comparison between the carboxyl and sulphate bile acids since the latter do not protonated even at very low pH.
  • INT-747 presents a slightly higher lipophilicity in respect to other dihydroxy bile acids such as UDCA and CDCA.
  • the increased lipophilicity is the result of the introduction of an ethyl group in position 6.
  • the tendency to distribute in a lipid domain is therefore af ⁇ her.
  • the UPF 1103 shows a logP of 2.0, value slightly lower than INT-747 and natural CDCA and UDCA analogues and this account for the contribution of the sulphate group and side chain length.
  • INT- 1103 is still similar to an unconjugated BA and higher than taurine conjugated like TCDCA that present a logP of 0.9. Contrarily to Taurine conjugate which preferentially stay in a water domain , INT-1103 has a tendency to accumulate in a lipid domain like INT-747.
  • Albumin binding Albumin binding was evaluated by equilibrium dialysis at a fixed BA-albumin ratio. BA was dissolved at a concentration of 100 ⁇ M in 5% bovine serum albumin-saline solution and left to stand for 24 h at 25°C. Two ml of this solution was dialyzed in cellulose sacs having a molecular weight cut-off of 12-14,000 against 25 ml of saline solution. The system was equilibrated by mechanical shaking for 72 h at 25°C. BA concentrations of the dialyzed solution and of the starting solution were determined with HPLC-ESI-MS/MS in the same conditions of the previous analysis.
  • BA starts to precipitate from a micellar solution. It can be calculated from the CMC
  • CMpH pKa + log CMCAVS.
  • the CMpH of the studied compounds in comparison with the natural analogs are reported in Table I.
  • CMpH value of INT747 is similar to that of CDCA and lower to UDCA. According to this value INT747 do not present problems of intestinal solubility and requires a pH of 7.6 which is physiological to go in solution.
  • UDCA with a CMpH of 8.4 requires an higher alkalinization of the duodenal content and only in post-prandial phase is solubilized in a micellar phase.
  • UP 1103 having a sulphate group do not present these problems since is always soluble in the physiological pH from 2 to 9 since the pKa is very low and the compound do not protonated to form insoluble molecule. Its behaviour is similar to taurine conjugated bile acids.
  • Bile acids and their metabolites were determined by a liquid chromatography- tandem mass spectrometry (HPLC-MS/MS) method using electrospray (ESI) source in negative ionization mode.
  • Liquid chromatography was performed using a Waters Alliance 2695 separation module coupled with autosampler.
  • MassLynx software version 4.0 was used for data acquisition and processing.
  • INT-747 is secreted into bile mainly as taurine conjugate and its recovery is almost complete: at the administered dose more than 99 % of the infused molecule is secreted into bile as shown in fig 3. At the last point of bile collection a relatively high amount of the taurine conj. compound is still secreted in bile. The maximum secretion rate is achieved after 120 minutes just at the end of the infusion. A steady state concentration is maintained for additional 30 minutes. The taurine conjugation process begin very early and appears efficient at the administered dose. Trace amount of the compound is also conjugate with glycine, less than 0.2% and similar amount is secreted as such in bile.
  • INT-747 The behaviour of INT-747 is similar to that of natural dihydroxy analogs such as CDCA or UDCA which are secreted into bile only as taurine and glycine conjugates.
  • dihydroxy analogs such as CDCA or UDCA which are secreted into bile only as taurine and glycine conjugates.
  • trihydroxy BA such as CA
  • the extent of a BA that can be secreted unmodified is related to its lipophilicity and is dose and species dependent.
  • INT-1103 is secreted in bile partially unmodified as reported in fig 41.
  • the amount of INT-1103 secreted in bile is approx. 30-40% of the administered dose and its secretion rate is relatively low and at the end of the collection period a relatively high amount of the molecule is still secreted into bile.
  • the main hepatic metabolite of INT-1103 in rat at the administered dose is the 3-glucoronide as reported in fig 42. The amount of this compound has not be quantified since the pure reference standard is not available.
  • Other metabolites are secreted into bile as reported in fig 43 and in more details in fig 43 and fig 44.
  • the main identified metabolites is the 3- sulphate conjugate, an hydroxy analog (one more hydroxyl ) , keto derivatives and epimers of INT-1103. The exact amount of these compound were not quantified since the standards are not yet available.
  • INTl 103 facilitate the secretion process even if the molecule is still quite lipophilic and the behaviour is between an unconjugated and taurine conjugated bile acid.
  • the liver strong metabolize this compound forming more hydrophilic compound such as 3-glucuronides, 3 -sulphates and hydroxylated analogs.
  • the extensive metabolism do to retained compound is related to the animal species and to the administered dose and according to these data we can speculate that this compound present a metabolism more similar to an "acids steroids" slightly different from a common bile acid, but maybe sharing same properties.
  • the compound was administered iv and addition data are required to evaluate the extent of its intestinal absorption ie passive or active like a taurine conjugate.
  • Example 13 In vitro metabolic stability in human stools culture
  • TLC Thin-layer chromatography
  • the solvent system used for the separation of conjugated BA was composed of propionic acid/isoamyl acetate/water/N-propanol (3:4: 1 :2, v/v/v/v; solvent I), and that of the unconjugated BA was acetic acid/carbon tetrachloride/isopropyl ether/isoamyl acetate/water/N- propanol/benzene (1 :4:6:8:2:2, v/v/v/v/v/v; solvent II).

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Diabetes (AREA)
  • Hematology (AREA)
  • Obesity (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Cardiology (AREA)
  • Immunology (AREA)
  • Epidemiology (AREA)
  • Urology & Nephrology (AREA)
  • Oncology (AREA)
  • Communicable Diseases (AREA)
  • Virology (AREA)
  • Child & Adolescent Psychology (AREA)
  • Transplantation (AREA)
  • Endocrinology (AREA)
  • Emergency Medicine (AREA)
  • Pain & Pain Management (AREA)
  • Rheumatology (AREA)
  • Nutrition Science (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Vascular Medicine (AREA)
  • Steroid Compounds (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The present invention relates to compounds of formula (I) wherein R is hydrogen or alpha-hydroxy, the hydroxyl group in position 7 is in the alpha or beta position; and pharmaceutically acceptable salts, solvates or amino acid conjugates thereof.

Description

BILE ACID DERIVATIVES AS FXR LIGANDS FOR THE PREVENTION OR TREATMENT OF FXR-MEDIATED DISEASES OR CONDITIONS
Field of the invention
The present invention relates to Farnesoid X receptor (FXR) modulators which can be used for the treatment of cholestatic disorders, in particular to bile acid derivatives wherein the Ce contains an ethyl and the C24 carboxy group is transformed into a sulphate group.
Background of the invention
Farnesoid X Receptor (FXR) is an orphan nuclear receptor initially identified from a rat liver cDNA library (BM. Forman, et al., Cell 81:687-693 (1995)) that is most closely related to the insect ecdysone receptor. FXR is a member of the nuclear receptor family of ligand-activated transcription factors that includes receptors for the steroid, retinoid, and thyroid hormones (DJ. Mangelsdorf, et al., Cell 83:841-850 (1995)). Northern and in situ analysis show that FXR is most abundantly expressed in the liver, intestine, kidney, and adrenal (BM. Forman, et al., Cell 81:687-693 (1995) and W. Seol, et al., MoI. Endocrinnol. 9:72-85 (1995)). FXR binds to DNA as a heterodimer with the 9-cis retinoic acid receptor (RXR). The FXR/RXR heterodimer preferentially binds to response elements composed of two nuclear receptor half sites of the consensus AG(G/T)TCA organized as an inverted repeat and separated by a single nucleotide (IR-I motif) (BM. Forman, et al., Cell 81:687- 693 (1995)). An early report showed that rat FXR is activated by micromolar concentrations of farnesoids such as farnesol and juvenile hormone (BM. Forman, et al., Cell 81:687-693 (1995)). However, these compounds failed to activate the mouse and human FXR, leaving the nature of the endogenous FXR ligand in doubt. Several naturally-occurring bile acids bind to and activate FXR at physiological concentrations (PCT WO 00/37077, published 29 June 2000)). As discussed therein, the bile acids that serve as FXR ligands include chenodeoxycholic acid (CDCA), deoxycholic acid (DCA), lithocholic acid (LCA), and the taurine and glycine conjugates of these bile acids. Bile acids are cholesterol metabolites that are formed in the liver and secreted into the duodenum of the intestine, where they have important roles in the solubilization and absorption of dietary lipids and vitamins. Most bile acids (~95%) are subsequently reabsorbed in the ileum and returned to the liver via the enterohepatic circulatory system. The conversion of cholesterol to bile acids in the liver is under feedback regulation: bile acids down-regulate the transcription of cytochrome P450 7a (CYP7a), which encodes the enzyme that catalyzes the rate limiting step in bile acid biosynthesis. There is data to suggest that FXR is involved in the repression of CYP7a expression by bile acids, although the precise mechanism remains unclear (DW. Russell, Cell 97:539-542 (1999)). In the ileum, bile acids induce the expression of the intestinal bile acid binding protein (IBABP), a cytoplasmic protein which binds bile acids with high affinity and may be involved in their cellular uptake and trafficking. Two groups have now demonstrated that bile acids mediate their effects on IBABP expression through activation of FXR, which binds to an IR-I type response element that is conserved in the human, rat, and mouse IBABP gene promoters. Thus FXR is involved in both the stimulation (IBABP) and the repression (CYP7a) of target genes involved in bile acid and cholesterol homeostasis.
EP 1392714 discloses 3α,7α-dihydroxy-6α-ethyl-5β-cholan-24-oic acid (hereinafter also referred to as 6-ethyl-chenodeoxycholic acid, 6-EDCA), solvates and amino acids conjugates thereof as FXR agonists, which can be used in the preparation of medicaments for the prevention or treatment of FXR-mediated diseases or conditions. EP 1568796 discloses 6-ethyl-ursodeoxycholic acid (6-EUDCA) derivatives as FXR agonists and their use in the prevention or treatment of FXR-mediated diseases or conditions.
Brief summary of the invention
According to a first aspect, the present invention provides compounds of formula (I):
Figure imgf000004_0001
wherein R is hydrogen or alpha-hydroxy, the hydroxyl group in position 7 is in the alpha or beta position; and pharmaceutically acceptable salts, solvates or amino acid conjugates thereof.
In one embodiment, the compound of formula (I) is in the form of a chenodeoxycholic acid derivative. In another embodiment, the compound of formula (I) is in the form of a ursodeoxycholic acid derivative. In still another embodiment, the compound of formula (I) is in the form of a cholic acid derivative.
In another embodiment, the compound of formula (I) is in the form of a trie thy 1 ammonium salt:
Figure imgf000004_0002
6. In another embodiment, the compound of formula (I) is in the form of a sodium salt:
Figure imgf000005_0001
In another aspect, the present invention provides a method for the prevention or treatment of an FXR mediated disease or condition. The method comprises administering a therapeutically effective amount of a compound of formula (I). The present invention also provides the use of a compound of formula (I) for the preparation of a medicament for the prevention or treatment of an FXR mediated disease or condition.
In certain embodiments, the FXR-mediated disease or condition is cardiovascular disease, atherosclerosis, arteriosclerosis, hypercholesteremia, or hyperlipidemiachronic liver disease, gastrointestinal disease, renal disease, cardiovascular disease, metabolic disease, cancer (i.e., colorectal cancer), or neurological indications such as stroke. In certain embodiments, the chronic liver disease is primary biliary cirrhosis (PBC), cerebrotendinous xanthomatosis (CTX), primary sclerosing cholangitis (PSC), drug induced cholestasis, intrahepatic cholestasis of pregnancy, parenteral nutrition associated cholestasis (PNAC), bacterial overgrowth or sepsis associated cholestasis, autoimmune hepatitis, chronic viral hepatitis, alcoholic liver disease, nonalcoholic fatty liver disease (NAFLD), nonalcoholic steatohepatitis (NASH), liver transplant associated graft versus host disease, living donor transplant liver regeneration, congenital hepatic fibrosis, choledocholithiasis, granulomatous liver disease, intra- or extrahepatic malignancy, Sjogren's syndrome, Sarcoidosis, Wilson's disease, Gaucher' s disease, hemochromatosis, or alpha 1 -antitrypsin deficiency. In certain embodiments, the gastrointestinal disease is inflammatory bowel disease (IBD) (including Crohn's disease and ulcerative colitis), irritable bowel syndrome (IBS), bacterial overgrowth, malabsorption, post-radiation colitis, or microscopic colitis. In certain embodiments, the renal disease is diabetic nephropathy, focal segmental glomerulosclerosis (FSGS), hypertensive nephrosclerosis, chronic glomerulonephritis, chronic transplant glomerulopathy, chronic interstitial nephritis, or polycystic kidney disease. In certain embodiments, the cardiovascular disease is atherosclerosis, arteriosclerosis, dyslipidemia, hypercholesterolemia, or hypertriglyceridemia. In certain embodiments, the metabolic disease is insulin resistance, Type I and Type II diabetes, or obesity.
In another aspect, the present invention provides a pharmaceutical composition comprising a compound of formula (I) and a pharmaceutically acceptable carrier or diluent.
In another aspect, the present invention provides a process for preparing a compound of formula (I) and pharmaceutically acceptable salts, solvates or amino acid conjugates thereof.
Brief description of the figures Figure 1 shows the transactivation assay result in a graph format. Each data point is the average of triplicate assays. CTRL: control; INT-747: 6-ECDCA; UPF- 987.
Figure 2 shows the dose response of INT-747 and UPF-987 in the transactivation assay. Figure 3 shows FXR target gene expression in vitro. The result is the mean of two quantitative Real-Time PCR experiments.
Figure 4 shows representative FXR target gene expression in cells derived from mouse liver in vivo. The data is the mean of two quantitative Real-Time PCR experiments.
Figure 5 shows the effect of UPF-987 on weight loss induced by TNBS.
Figure 6 shows the effect of UPF-987 on stool consistency. Figure 7 shows the effect of UPF-987 on mucosal damage score.
Figure 8 shows the effect of UPF-987 on mouse colon genes expression. The result is the mean of two quantitative Real-Time PCR experiments.
Figure 9 shows the effect of UPF-987 on plasmatic bilirubin in ANIT-induced cholestasis. Figure 10 shows the effect of UPF-987 on plasmatic AST in ANIT-induced cholestasis.
Figure 11 shows the effect of UPF-987 on plasmatic ALP in ANIT-induced cholestasis.
Figure 12 shows the effect of UPF-987 on plasmatic gammaGT in ANIT- induced cholestasis.
Figure 13 shows the effect of UPF-987 on plasmatic cholesterol in ANIT- induced cholestasis.
Figure 14 shows the effect of UPF-987 on body weight in ANIT-induced cholestasis. Figure 15 shows the effect of UPF-987 on liver weight in ANIT-induced cholestasis.
Figure 16 shows the effect of UPF-987 on FXR target genes expression in the liver of ANIT-induced cholestatic rat. The result is the mean of two quantitative Real-Time PCR experiments. Figure 17 shows the effect of INT-1103 on plasmatic bilirubin in ANIT- induced cholestasic rats.
Figure 18 shows the effect of INT-1103 on plasmatic AST in ANIT-induced cholestasic rats.
Figure 19 shows the effect of INT-1 103 on plasmatic ALT in ANIT-induced cholestasic rats.
Figure 20 shows the effect of INT-1 103 on plasmatic ALP in ANIT-induced cholestasic rats.
Figure 21 shows the effect of INT- 1103 on plasmatic gammaGT in ANIT- induced cholestasic rats.
Figure 22 shows the effect of INT-1103 on body weight in ANIT-induced cholestasic rats. Figure 23 shows the resulting liver ratio (liver weight/body weight xlOO).
Figure 24 shows the effect of INT-1 103 on plasmatic bilirubin in BDL- induced cholestasic rats.
Figure 25 shows the effect of INT-1 103 on plasmatic AST in BDL-induced cholestasic rats. Figure 26 shows the effect of INT-1103 on plasmatic ALT in BDL-induced cholestasic rats.
Figure 27 shows the effect of INT-1 103 on plasmatic ALP in BDL-induced cholestasic rats.
Figure 28 shows the effect of INT-1 103 on plasmatic gammaGT in BDL- induced cholestasic rats.
Figure 29 shows the effect of INT-1 103 on body weight in BDL-induced cholestasic rats.
Figure 30 shows the resulting liver ratio (liver weight/body weight x 100).
Figure 31 shows the effect of INT-1103 and INT-747 on bile flow in naive rats.
Figure 32 shows the effect of INT-1103 and INT-747 on bile flow in estrogen colestatic rats. Figure 33 shows the effect of INT-1103 and INT-747 on liver ratio in estrogen colestatic rats.
Figure 34 shows the effect of INT-1103 and INT-747 on body weight in estrogen colestatic rats. Figure 35 shows the resulting insulin gene expression by Quantitative Real-
Time PCR.
Figure 36 shows the surface tension (dyne/cm) plotted against the logarithm of the bile salt concentration (mM) in water.
Figure 37 shows the surface tension (dyne/cm) plotted against the logarithm of the bile salt concentration (mM) in NaCl 0.15 M.
Figure 38 shows the secretion rate of taurine conjugated INT-747. Data are reported as concentration in bile and should be corrected by the bile volume.
Figure 39 shows the secretion rate of glycine conjugated INT-747. Data are reported as concentration in bile and should be corrected by the bile volume. Figure 40 shows the secretion rate of INT-747. Data are reported as concentration in bile and should be corrected by the bile volume.
Figure 41 shows the secretion rate of INT-747 epimers. Data are reported as concentration in bile and should be corrected by the bile volume.
Figure 42 shows the secretion rate of taurine conjugated epimers of INT-747. Data are reported as concentration in bile and should be corrected by the bile volume.
Figure 43 shows the secretion rate of INT-1103. Data are reported as concentration in bile and should be corrected by the bile volume.
Figure 44 shows the secretion rate of INT-1103 and its main metabolite 3- Glucuronides. The relative amount are expressed as analytical signal. Data are reported as concentration in bile and should be corrected by the bile volume.
Figure 45 shows the secretion rate of INT-1103 main metabolites identified in bile using mass spectrometry. Data are reported as concentration in bile and should be corrected by the bile volume.
Figure 46 shows the secretion rate of INT-1103 main metabolites identified in bile using mass spectrometry zoom display. Data are reported as concentration in bile and should be corrected by the bile volume.
Figure 47 shows the metabolic stability of INT-747 and INT- 1103 in human stools cultures. Chenodeoxycholic was used as a reference natural analogue.
Figure 48 shows the metabolic stability of INT-1103 in simulated pancreatic fluid. Olive oil was used as a reference as reported in the USP protocol. The compound is very stable and the ester bond (sulphate) is not hydro lyzed by pancreatic esterases, suggesting a high stability in human duodenal and upper intestine content.
Detailed description of the invention The present invention relates to compounds of general formula (I):
Figure imgf000010_0001
wherein R is hydrogen or alpha-hydroxy, the hydroxyl group in position 7 is in the alpha or beta position; and pharmaceutically acceptable salts, solvates or amino acid conjugates thereof.
Suitable pharmaceutically acceptable salts according to the present invention will be readily determined by one skilled in the art and will include, for example, basic salts such as alkali or alkaline-earth metallic salts made from aluminium, calcium, lithium, magnesium, potassium, sodium, and zinc or organic salts made from N.N'-dibenzylethylenediamine, chlorprocaine, choline, diethanolamine, ethyleπdiamine, meglumine (N-methylglucamine), and procaine. Salts with pharmaceutically acceptable amines such as lysine, arginine, tromethamine, triethylamine and the like can also be used. Such salts of the compounds of formula (I) may be prepared using conventional techniques, from the compound of Formula (I) by reacting, for example, the appropriate base with the compound of Formula (I).
When used in medicine, the salts of a compound of formula (I) should be pharmaceutically acceptable, but pharmaceutically unacceptable salts may conveniently be used to prepare the corresponding free base or pharmaceutically acceptable salts thereof.
As used herein, the term "solvate" is a crystal form containing the compound of formula (I) or a pharmaceutically acceptable salt thereof and either a stoichiometric or a non-stoichiometric amount of a solvent. Solvents, by way of example, include water, methanol, ethanol, or acetic acid. Hereinafter, reference to a compound of formula (I) is to any physical form of that compound, unless a particular form, salt or solvate thereof is specified.
As used herein, the term "amino acid conjugates" refers to conjugates of the compounds of formula (I) with any suitable amino acid. Preferably, such suitable amino acid conjugates of the compounds of formula (I) will have the added advantage of enhanced integrity in bile or intestinal fluids. Suitable amino acids include but are not limited to glycine and taurine. Thus, the present invention encompasses the glycine and taurine conjugates of any of the compounds of formula
(I)- In one embodiment, the compound of formula I is a chenodeoxycholic acid derivative, wherein the hydroxyl group in 7 is in the alpha position and R is hydrogen. In another embodiment, the compound of formula I is a ursodeoxycholic acid derivative, wherein the hydroxyl group in 7 is in the beta position and R is hydrogen.
In another embodiment, the compound of formula I is a cholic acid derivative, wherein the hydroxyl group in 7 is in the alpha position and R is alpha- hydroxy.
Hereinafter all references to "compounds of formula (I)" refer to compounds of formula (I) as described above together with their and pharmaceutically acceptable salts, solvates or amino acid conjugates thereof. The compounds of formula I may be prepared starting from the 6-ethyl-7- keto-cholic acids, prepared as disclosed in EP 1392714 and EP 1568796, suitably protected at the 3-hydroxy moiety, by a reaction sequence comprising the transformation of the C24 carboxy group into a iodine atom, the conversion of the latter into an hydroxyl group, reduction of the 7-keto group to give the corresponding 3 -alpha or 3-beta hydroxyl group, the selective sulfonylation of the C24 hydroxy group and the deprotection of the 3-hydroxy group.
The reaction scheme and the reagents used in each step are reported in the following scheme showing the preparation of 3α,7α,23-trihydroxy-6α-ethyl-24-nor- 5/?-cholan-23 -sulphate in the form of triethylammonium salt (UPF-987 or compound (9) below). The same scheme may be adapted, by suitably substituting the reagents and/or starting materials and optionally by also changing reaction sequences and protective groups, for the preparation of other compounds of formula I.
Figure imgf000013_0001
a) 3,4-dihydro-2H-plrane, p-TsOH, dioxane, r.t.; b) I2, Pb(AcO)4, hv, CCI4; c) HCI00nC., THF; d) TBDMSiCI, imidazole, CH2CI2, r.t.; e) Ag2CO3, acetone, H2O, reflux; f) NaBH4, THF1 H2O, r.t.; g) CISO3H, (Et)3N, THF; h) CH3COCH3, PdCI2(CH3CN)2
The reaction scheme and the reagents used in each step are reported in the following scheme below showing the preparation of 3α,7α,23-trihydroxy-6α-ethyl- 24-nor-5/?-cholan-23-sulphate in the form of sodium salt (INT-1 103 or compound (10) below). The same scheme may be adapted, by suitably substituting the reagents and/or starting materials and optionally by also changing reaction sequences and protective groups, for the preparation of other pharmaceutically acceptable salt forms of formula I.
Figure imgf000014_0001
10 a) 3,4 dihydro-2H-pyraπe. p-TsOH. dioxane, t.a.: b) I2. Pb(AcO)4, hv. CCI4; c) HCIgas, DME; d) TBDMSCI. imidazole, CH2CI2, t.a.; e) Ag2CO3, acetone, H2O, reflux; f) NaBH4, THF, H2O, r.t; g) CISO3H, (Et)3N, THF; h) H2O, acetone: PdCI2(CHSCN)2 i) NaOH, MeOH
As explained in greater detail in the experimental section, compound 9 was tested in a cell-free assay and transactivation assay in a human hepatocyte cell line and in vivo in intact mice and rats rendered cholestatic by administration of alfa- nafthylsiotiocyanate (ANIT). In the FRET assay, the compound was found to be approximately 1000 fold more potent than chenodeoxycholic acid (CDCA) in activating FXR. In the tranactivation assay Compound 9 caused 2 fold induction of bile acid transporter, BSEP (bile salt export pump) and the small heterodimeric partner (SHP, an atypical nuclear receptor that lacks a DNA-binding domain). Further it potently suppressed Cyp7Al, SREPB-Ic and the fatty acid synthase (FAS), thus indicating that FXR activation by the compound of the invention allows selective modulation of genes involved in bile acid synthesis as well as in lipid, cholesterol and glucose metabolism. Therefore, compounds of formula (I) act as selective modulators of the bile acid transporters and increase the flux of biliary acids in the liver; furthermore, they potently regulate genes involved in lipid and cholesterol metabolism and for this reason they can be used for the prevention or treatment of FXR-mediated diseases or conditions, which include chronic liver disease (involving one or more of cholestasis, steatosis, inflammation, fibrosis, and cirrhosis), gastrointestinal disease, renal disease, cardiovascular disease, and metabolic disease. Chronic liver diseases which may be prevented or treated using compounds of formula (I) include but are not limited to primary biliary cirrhosis (PBC), primary sclerosing cholangitis (PSC), cerebrotendinous xanthomatosis (CTX), drug induced cholestasis, intrahepatic cholestasis of pregnancy, parenteral nutrition associated cholestasis (PNAC), bacterial overgrowth or sepsis associated cholestasis, autoimmune hepatitis, chronic viral hepatitis, alcoholic liver disease, nonalcoholic fatty liver disease (NAFLD), nonalcoholic steatohepatitis (NASH), liver transplant associated graft versus host disease, living donor transplant liver regeneration, congenital hepatic fibrosis, choledocholithiasis, granulomatous liver disease, intra- or extrahepatic malignancy, Sjogren's syndrome, Sarcoidosis,
Wilson's disease, Gaucher's disease, hemochromatosis, and alpha 1 -antitrypsin deficiency. Gastrointestinal diseases which may be prevented or treated using compounds of formula (I) include but are not limited to inflammatory bowel disease (IBD) (including Crohn's disease and ulcerative colitis), irritable bowel syndrome (IBS), bacterial overgrowth , malabsorption, post-radiation colitis, and microscopic colitis. Renal diseases which may be prevented or treated using compounds of formula (I) include but are not limited to diabetic nephropathy, focal segmental glomerulosclerosis (FSGS), hypertensive nephrosclerosis, chronic glomerulonephritis, chronic transplant glomerulopathy, chronic interstitial nephritis, and polycystic kidney disease. Cardiovascular diseases which may be prevented or treated using compounds of formula (I) include but are not limited to atherosclerosis, arteriosclerosis, dyslipidemia, hypercholesterolemia, and hypertriglyceridemia. Metabolic diseases which may be prevented or treated using compounds of formula (I) include but are not limited to insulin resistance, Type I and Type II diabetes, and obesity.
The methods of the present invention comprise the step of administering a therapeutically effective amount of a compound of formula (I). As used herein, the term "therapeutically effective amount" refers to an amount of a compound of formula (I) which is sufficient to achieve the stated effect. Accordingly, a therapeutically effective amount of a compound of formula (I) used in a method for the prevention or treatment of FXR mediated diseases or conditions will be an amount sufficient to prevent or treat the FXR mediated disease or condition.
Similarly, a therapeutically effective amount of a compound of formula (I) for use in a method for the prophylaxis or treatment of cholestatic liver diseases or increasing bile flow will be an amount sufficient to increase bile flow to the intestine.
The amount of the compound of formula (I) which is required to achieve the desired biological effect will depend on a number of factors such as the use for which it is intended, the means of administration, and the recipient, and will be ultimately at the discretion of the attendant physician or veterinarian. In general, a typical daily dose for the treatment of FXR mediated diseases and conditions, for instance, may be expected to lie in the range of from about 0.01 mg/kg to about 100 mg/kg. This dose may be administered as a single unit dose or as several separate unit doses or as a continuous infusion. Similar dosages would be applicable for the treatment of other diseases, conditions and therapies including the prophylaxis and treatment of cholestatic liver diseases.
Thus, in a further aspect, the present invention provides pharmaceutical compositions comprising, as active ingredient, a compound of formula (I) together, and/or in admixture, with at least one pharmaceutical carrier or diluent. These pharmaceutical compositions may be used in the prophylaxis and treatment of the foregoing diseases or conditions.
The carrier must be pharmaceutically acceptable and must be compatible with, i.e. not have a deleterious effect upon, the other ingredients in the composition. The carrier may be a solid or liquid and is preferably formulated as a unit dose formulation, for example, a tablet which may contain from 0.05 to 95% by weight of the active ingredient. If desired, other physiologically active ingredients may also be incorporated in the pharmaceutical compositions of the invention.
Possible formulations include those suitable for oral, sublingual, buccal, parenteral (for example subcutaneous, intramuscular, or intravenous), rectal, topical including transdermal, intranasal and inhalation administration. Most suitable means of administration for a particular patient will depend on the nature and severity of the disease or condition being treated or the nature of the therapy being used and on the nature of the active compound, but where possible, oral administration is preferred for the prevention and treatment of FXR mediated diseases and conditions. Formulations suitable for oral administration may be provided as discrete units, such as tablets, capsules, cachets, lozenges, each containing a predetermined amount of the active compound; as powders or granules; as solutions or suspensions in aqueous or non-aqueous liquids; or as oil-in-water or water-in-oil emulsions.
Formulations suitable for sublingual or buccal administration include lozenges comprising the active compound and, typically a flavoured base, such as sugar and acacia or tragacanth and pastilles comprising the active compound in an inert base, such as gelatine and glycerine or sucrose acacia. Formulations suitable for parenteral administration typically comprise sterile aqueous solutions containing a predetermined concentration of the active compound; the solution is preferably isotonic with the blood of the intended recipient. Additional formulations suitable for parenteral administration include formulations containing physiologically suitable co-solvents and/or complexing agents such as surfactants and cyclodextrins. Oil-in-water emulsions are also suitable formulations for parenteral formulations. Although such solutions are preferably administered intravenously, they may also be administered by subcutaneous or intramuscular injection. Formulations suitable for rectal administration are preferably provided as unit-dose suppositories comprising the active ingredient in one or more solid carriers forming the suppository base, for example, cocoa butter.
Formulations suitable for topical or intranasal application include ointments, creams, lotions, pastes, gels, sprays, aerosols and oils. Suitable carriers for such formulations include petroleum jelly, lanolin, polyethyleneglycols, alcohols, and combinations thereof.
Formulations of the invention may be prepared by any suitable method, typically by uniformly and intimately admixing the active compound with liquids or finely divided solid carriers or both, in the required proportions and then, if necessary, shaping the resulting mixture into the desired shape.
For example a tablet may be prepared by compressing an intimate mixture comprising a powder or granules of the active ingredient and one or more optional ingredients, such as a binder, lubricant, inert diluent, or surface active dispersing agent, or by moulding an intimate mixture of powdered active ingredient and inert liquid diluent.
Suitable formulations for administration by inhalation include fine particle dusts or mists which may be generated by means of various types of metered dose pressurised aerosols, nebulisers, or insufflators.
For pulmonary administration via the mouth, the particle size of the powder or droplets is typically in the range 0.5-10 μm, preferably 1-5 μm, to ensure delivery into the bronchial tree. For nasal administration, a particle size in the range 10-500 μm is preferred to ensure retention in the nasal cavity.
Metered dose inhalers are pressurised aerosol dispensers, typically containing a suspension or solution formulation of the active ingredient in a liquefied propellant. During use, these devices discharge the formulation through a valve adapted to deliver a metered volume, typically from 10 to 150 μl, to produce a fine particle spray containing the active ingredient. Suitable propellants include certain chlorofluorocarbon compounds, for example, dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane and mixtures thereof. The formulation may additionally contain one or more co-solvents, for example, ethanol surfactants, such as oleic acid or sorbitan trioleate, anti-oxidants and suitable flavouring agents.
Nebulisers are commercially available devices that transform solutions or suspensions of the active ingredient into a therapeutic aerosol mist either by means of acceleration of a compressed gas typically air or oxygen, through a narrow venturi orifice, or by means of ultrasonic agitation. Suitable formulations for use in nebulisers consist of the active ingredient in a liquid carrier and comprise up to 40% w/w of the formulation, preferably less than 20% w/w. The carrier is typically water or a dilute aqueous alcoholic solution, preferably made isotonic with body fluids by the addition of, for example, sodium chloride. Optional additives include preservatives if the formulation is not prepared sterile, for example, methyl hydroxy- benzoate, anti-oxidants, flavouring agents, volatile oils, buffering agents and surfactants.
Suitable formulations for administration by insufflation include finely comminuted powders which may be delivered by means of an insufflator or taken into the nasal cavity in the manner of a snuff. In the insufflator, the powder is contained in capsules or cartridges, typically made of gelatin or plastic, which are either pierced or opened in situ and the powder delivered by air drawn through the device upon inhalation or by means of a manually-operated pump. The powder employed in the insufflator consists either solely of the active ingredient or of a powder blend comprising the active ingredient, a suitable powder diluent, such as lactose, and an optional surfactant. The active ingredient typically comprises from 0.1 to 100 w/w of the formulation. In addition to the ingredients specifically mentioned above, the formulations of the present invention may include other agents known to those skilled in the art of pharmacy, having regard for the type of formulation in issue. For example, formulations suitable for oral administration may include flavouring agents and formulations suitable for intranasal administration may include perfumes. Therefore, according to a further aspect of the present invention, there is provided the use of the compounds of formula (I) in the preparation of medicaments for the prevention or treatment of FXR mediated diseases or conditions.
The invention will be hereinafter illustrated in more detail in the following Examples. EXAMPLE 1
Chemistry. Melting points were determined with a Buchi 535 electrothermal apparatus and are uncorrected. NMR spectra were obtained with a Bruker AC 200 MHz spectromer, and the chemical shifts are reported in parts per million (ppm). The abbreviations used are as follows: s, singlet; bs, broad singlet; d, doublet; dd, double doublet; m, multiplet; q, quartet, t, triplet. Flash column chromatography was performed using Merck silica gel 60 (0.040-0.063 mm). TLC was carried out on precoated TLC plates with silica gel 60 F-254 (Merck). Spots were visualized with phosphomolybdate reagent (5% solution in EtOH). The reactions were carried out under a nitrogen atmosphere.
3o-Tetrahydropyranyloxy-7-keto-5/?-cholan-24-oic Acid (2) 3,4-dihydro-2H-pyrane (1.74 ml, 19 mmol) in dioxane (12 ml) was dropped slowly to a solution of/»-Toluenesulfonic acid (1 15 mg, 0.6 ml) and 6α-ethyl-7- ketolithocholic acid (5.0 g, 12 mmol) in dioxane (55 ml). The reaction mixture was stirred at room temperature for 2 hours. Water (40 ml) was then added, and the mixture was partially concentrated under vacuum and extracted with EtOAc (4 x 25 ml). The combined organic fractions were washed with brine (1 x 50 ml), dried over anhydrous Na2SO4 and evaporated under vacuum to afford 6 g of compound 2. The crude derivative was used for the next step without further purification.
1H NMR: (200 MHz, CDCl3) δ: 0,68 (3H, s, C-18 Me); 0,8 (3H, t, J= 4 Hz, C-26); 0,98 (3H, d, J=6,5, C-21 Me); 1,17 (3H, s, C-19 Me); 3.4-3,7 (4H, m, C-23 CH2, C-6 ); 3,8-3,9 (IH, m, C-3); 2,6-2,8 (IH, m, C-6). '3C NMR (50,3 MHz, CDCl3) δ: 212,41, 179,42, 54,75, 52,10, 21,79, 18,30,
12,04.
3o-Tetrahydropyranyloxy-7-keto-24-nor-5^-cholan-23-I (3) Under irradiation with a 300 w tungsten lamp, iodine (5 g, 20 mmol) in CCU (75 ml) was added dropwise to a solution of 2 (5.5 g, 11 mmol) and lead tetra- acetate (4.9 g, 11 mmol) in CCI4 (200 ml). The reaction mixture was stirred until the colour was permanent (18 h). The mixture was cooled and filtered on celite. The organic phase was washed with a 5% Na2S2O3 solution, 5% NaOH, brine (15 ml), dried over anhydrous Na2SO4 and evaporated under vacuum. The residue was purified by silica gel flash chromatography using a mixture of light petroleum/EtOAc 95/5 as mobile phase to give 4.6 g of compound 3 (40% yield). 1H NMR: (200 MHz, CDCl3) δ: 0,54 (3H, s, C-18 Me); 0.68 (3H, t, 7=7,36 MHz, C-25); 0,79 (3H, d, /=5,2 MHz, C-21); 1,09 (3H, s, C-19); 2,55 (IH, m, C- 26); 2,96 (IH, m, C-23); 3,16 (IH, m, C-23); 3,20 (IH, m, C-6'); 3,76 (IH, m, C- 6'); 4,59 (IH, m, C-2').
13C NMR (50,3 MHz, CDCl3) δ: 212.50, 96.56, 95.99, 74.90, 74.60, 62.63, 54.63, 52.08, 50.78, 50.58, 49.84, 48.91, 43.38, 42.70, 40.1 1, 38.90, 36.92, 35.81 , 34.34, 34.10, 31.07, 30.06, 29.61, 28.26, 27.85, 25.97, 25.42, 24.54, 23.49, 21.75, 19.76, 19.59, 18.88, 17.84, 12.05, 1 1.98, 5.26.
3α-hydroxy-6α-ethyl-7-keto-24-nor-5/?-cholan-23-I (4)
The compound 3 (2.2 g, 3.8 mmol) was stirred in a solution of HCl 37% in THF (50 ml) overnight at room temperature. The reaction mixture was washed with a saturated solution OfNaHCO3 (20 ml), H2O (20 ml), brine (20 ml) dried over
Na2SO4 and evaporated under vacuum to afford 1.4 g of compound 4 (80% yield). The crude derivative was used for the next step without further purification.
1H NMR: (200 MHz, CDCl3) δ: 0,68 (3H, s, C-18 Me); 0.82 (3H, t, ./=7,36 MHz, C-21); 0,93 (3H, t, 7=5,2 Hz, C-21 Me); 1,26 (3H, s, C-19 Me); 3.08 (IH, m, C-23); 3,37 (IH, m, C-23); 3.61 (IH, m, C-3).
13C NMR (50,3 MHz, CDCl3) δ: 212.81 , 71.09, 54.63, 51.93, 50.60, 49.84, 48.93, 43.64, 42.70, 40.1 1, 38.92, 36.92, 35.63, 34.19, 31.71, 31.06, 29.78, 28.25, 27.89, 25.96, 25.42, 24.51, 23.48, 21.79, 19.56, 18.77, 18.22, 17.85, 12.02, 11.95, 5.22. 3α-ter^ButhyldimethylsiIyloxy-6α-ethyl-7-keto-24-nor-5/?-cholan-23-I (5)
To a solution of 4 (1.4 g, 2.8 mmol) in CH2Cl2 (30 ml), tert-butyldimethylsilylchloride (496 mg, 3.22 mmol) and imidazole (230 mg, 3.36 mmol) were added and the mixture was stirred overnight at room temperature. The reaction mixture was washed with a saturated solution Of NaHCO3 (30 ml), brine (30 ml), and dried over anhydrous Na2SO.). The organic phase was evaporated under vacuum to afford 1.5 g of compound 5 (87% yield). The crude derivative was used for the next step without further purification. 1H NMR: (200 MHz, CDCl3) δ: 0.02 (6H, s, (CH3)2Si); 0,65 (3H, s, C-18 Me); 0.85 (9H, s, (CHj)3CSi); 1,19 (3H, s, C-19); 3,16 (IH, m, C-23); 3.30 (IH, m, C-23); 3.48 (IH m, C-3).
13C NMR (50,3 MHz, CDCl3) δ: 212.56, 71.93, 54.63, 51.89, 50.62, 49.81, 48.90, 43.34, 42.72, 40.11, 38.89, 36.92, 35.62, 34.37, 31.97, 30.34, 28.26, 25.83, 25.61, 24.57, 23.48, 21.77, 18.81, 17.84, 12.02, 11.92, 5.27, -4.70.
3a-terf-Buthyldimethylsilyloxy-6a-ethyI-7-keto-24-nor-5//-cholan-23-ole
(6)
To a solution of S (1.2 g, 1.96 mmol) in acetone (12 ml), Ag2CO3 (1.1 g, 3.9 mmol) was added. The reaction mixture was refluxed overnight and then cooled to r.t., filtered on celite washed with acetone and the combined organic phases were concentrated to yield 1 g of compound 6. The crude derivative was used for the next step without further purification.
1H NMR: (200 MHz, CDCl3) δ: 0.02 (6H, s, (CH3)2Si); 0,65 (3H, s, C-18 Me); 0.88 (9H, s, (CH3)3CSi); 3,16 (IH, m, C-23); 3.37 (IH m, C-3); 3.69 (2H, m, C-23).
13C NMR (50,3 MHz, CDCl3) δ: 212.64, 71.96, 60.84, 55.27, 50.66, 49.87,
48.94, 43.37, 42.69, 38.94, 35.64, 34.39, 32.70, 32.00, 30.36, 29.68, 28.53, 25.85,
24.64, 23.50, 21.80, 18.84,12.01, 11.94, -4.68. 3α-terϊ'-Buthy.dimethylsilyloxy-7α-hydroxy-6α-ethyl-24-nor-5/?-cholaii-
23-ole (7)
To a solution of 6 (1 g, 1.96 mmol) in a mixture of THF (50 ml) and H2O
(12.5ml), NaBH4 (740 mg, 19.6 mmol) was added and the mixture was stirred at room temperature for 1 hours and 30 minutes. The reaction solution was partially concentrated under vacuum and extracted with CHCl3 (3 x 20 ml). The combined organic layers were washed with brine (1 x 50 ml), dried over anhydrous Na2SOi), and evaporated under vacuum. The crude residue was purified by silica gel flash chromatography using a mixture Of CH2C^MeOH 99: 1 as mobile phase to give 0.8 g of 7 (81% yield).
1H NMR: (200 MHz, CDCl3) δ: 0.04 (6H, s, (CH3)2Si); 0,66 (3H, s, C-18 Me); 0.88 (9H, s, (CHj)3CSi); 3,16 (IH, m, C-23); 3.37 (IH m, C-3); 3.69 (IH, m, C-7, 2H, m, C-23).
13C NMR (50,3 MHz, CDCl3) δ: 73.30, 70.85, 60.82, 56.31 , 50.55, 45.28, 42.77, 41.17, 40.03, 39.62, 38.95, 35.74, 35.52, 34.10, 33.14, 32.93, 31.01, 28.40, 25.98, 23.70, 23.18, 22.22, 20.72, 18.79,1 1.62, -4.60.
3α-tert-Buthyldimethylsilyloxy-7α-hydroxy-6α-ethyl-24-nor-5/7-cholan- 23-sulphate triethyl ammonium salt (8)
To a solution of 7 (0.5 g, 0.99 mmol) in THF (7 ml) cooled at -3°C, Et3N (0.3 ml, 2.1 mmol) was added and the resulting mixture was stirred for 10 min. ClSO3H (0.1 ml, 1.5 mmol) was added and the mixture was stirred overnight at room temperature. Water (10 ml) was then added and the mixture was extracted with CH2Ch (3 x 15 ml), dried over anhydride Na2SO4 and evaporated under vacuum.
The crude sulphate derivative was used for the next step without further purification.
3α,7α,23-trihydroxy-6α-ethyl-24-nor-S/?-cholan-23-sulphate triethyl ammonium salt (9)
To a solution of 8 (0.5 g, 0.77 mmol) in acetone (8 ml), PdCl2(CH3CN)2 (10 mg, 0.05 eq) was added and the mixture was stirred at room temperature for 3 hours. The reaction mixture was filtered, concentrated under vacuum and purified by medium pressure Lichroprep RP-8 using a MeOH/H2O 8/2 mixture as mobile phase to afford 0.115 g of 9, m p 1 18-121°C
1H NMR (200 MHz, CD3OD) «5: 0.70 (3H, s, C-18 Me); 0.91 (3 H, m, C-21 Me, 3 H, C-25); 0.98 (3 H, d, J= 6.4 Hz, C-19 Me); 1.32 (9 H, t, J= 7.3 Hz, (CH3- CH2)3N); 3.20 (6 H, q, J= 7.31 Hz, (CH3-CH2-)3N; 3.31 (1 H, m, C-3); 3.65 (1 H, bs, C-7); 4.03 (2H, m, CH2-23). 13C NMR (CD3OD) δ: 9.23, 12.05, 12.19, 19.14, 21.97, 23.52, 23.76, 24.57, 34.23, 34.51, 36.56, 36.65, 36.79, 41.06, 41.55, 43.13, 47.73, 50.28, 51.68, 57.80, 67.19, 71.16, 73.23.
3α,7α,23-trihydroxy-6α-ethyI-24-nor-5^-cholan-23-sulphate sodium salt (10)
To a solution of 8 (0.4 g, 0.72 mmol) in a mixture of acetone (4 ml) and H2O (0.08 ml), PdCl2(CHsCN)2 (10 mg, 0.05 eq) was added and the resulting mixture was stirred at room temperature for 3 hours. The reaction mixture was filtered over celite and concentrated under vacuum. The resulting residue was treated with a methanolic solution of 10% NaOH for 2h. The resulting mixture was concentrated under vacuum and submitted to liquid medium pressure purification using a mixture of CH3OH/H2O (7:3) as mobile phase to afford 0.09 g of 10 (25% yield).
EXAMPLE 2 Biological activities
Tests were first carried out in order to verify whether UPF-987 modulates FXR-regulated genes, in comparison with chenodeoxycholic acid (CDCA). CDCA is a primary bile acid that functions as an endogenous ligand of the farnesoid-x- receptor (FXR; NR1H4). The biological activity of UPF-987 on FXR activity was first tested in an in vitro assay using the fluorescence resonance energy transfer (FRET) cell free assay, described in Pellicciari R., et al. J Med Chem. 2002 15;45:3569-72.
Briefly, reactions contained europium-labeled anti-GST antibody and streptavidin-conjugated allophycocyanin, FXR GST-LBD fusion proteins and biotinylated SRCl sensor peptide. Reactions were incubated at room temperature for 1 h in FRET buffer (10 mM Hepes, pH 7.9, 150 mM NaCl, 2 mM MgC12, 1 mM EDTA, 0.1 mg/ml BSA). FRET was measured on a Victor 1420 multilabel counter. In the FRET cell-free assay, the recruitment of Scr-1, a co-activating factor for FXR, occurs at a concentration of compound that is almost 300-fold lower than that required for the natural FXR-ligand CDCA (Table 1).
Table 1. Activity of UPF-987 on Human FXR on FRET
Figure imgf000026_0001
1 Relative recruitment of the SRCl peptide to FXR where CDCA = 100%.
All data are mean ± SE, n = 4.
It was also evaluated if UPF-987 modulated FXR-regulated genes in a cellular assay using a human hepatocyte cell line (HepG2). In a cell transfection assay using the HepG2 cell line, UPF-987 proved a potent FXR ligand. Exposure of HepG2 cells to UPF-987 transactivates FXR. In other experiments using liver cells transfected with viral constructs carrying the FXR gene or other nuclear receptors cloned upstream to the luciferase gene, it was found that UPF-987 functions as a selective FXR ligand in mouse, rat, and human hepatocytes. A detailed description of these methods can be found in the following reference: Fiorucci S., et al. Gastroenterology 2004.
Briefly, for luciferase assay, HepG2 cells were cultured in E-MEM supplemented with 1% penicillin/streptomycin, 1% L-glutamine and 10% fetal bovine serum (high glucose) (CELBIO). Cells were grown at 37°C in 5% CO2. All the transfections were making using a calcium phosphate coprecipitation method in the presence of 25 μM chloroquine as inhibitor for DNA degradation. Transient transfections were performed using 500 ng of reporter vector phsp27-TKLUC, 200 ng pCMV-βgal, as internal control for transfection efficiency, and 50 ng of each receptor expression plasmid pSG5-FXR, pSG5-RXR. The pGEM vector was added to normalize the amounts of DNA transfected in each assay (2.5 μg). The transfection efficiency was evaluated by β-gal expression, obtained by co- transfecting the cells with pCMV-βgal plasmid. Forty-Eight hours post-transfection, HepG2 cells were stimulated with 1 μM UPF-987 for 18 h. Control cultures received vehicle (0.1% DMSO) alone. Cells were lysed in 100 μl diluted reporter lysis buffer (Promega), and 0.2 μl cellular Iisate was assayed for luciferase activity using Luciferase Assay System (Promega). Luminescence was measured using an automated luminometer. Luciferase activities were normalized for transfection efficiencies by dividing the relative light units by β-galactosidase activity. Regulation of FXR Target Gene Expression by UPF-987 in HepG2 Cells
To establish if UPF-987 is a FXR modulator and exerts differential activities, human HepG2 cells were exposed to UPF-987, CDCA (natural FXR ligand) and to its 6-ethyl-derivative, 6-ECDCA, which is a potent FXR ligand. The effects of these ligands on FXR responsive genes was then investigated by quantitative reverse transcription PCR (qRT-PCR).
Briefly, all PCR primers were designed using PRIMER3 -OUTPUT software using published sequence data from the NCBI database. Total RNA was isolated (TRIzol reagen, Invitrogen srl, Milan, Italy) from specimens taken from livers. One microgram of purified RNA was treated with DNAse I for 10 minutes at room temperature, followed by incubation at 95°C for 3 minutes in the presence of 2.5 mmol/L EDTA. The RNA was reverse transcribed with Superscript III (Invitrogen, Carsbad, CA) in 20μL reaction volume using reandom primers. For quantitative RT- PCR, 100 ng template was dissolved in a 25 μL containing 0.3 μmol/L of each primer and 12.5 μL of 2X SYBR Green PCR Master mix (Fynnzime S-DyN Amo SYBRR Green qPCR mix). All reactions were performed in triplicate, and the thermal cycling conditions were as follows: 2 minutes at 95°C, followed by 50 cycles of 95°C for 20 seconds, 55°C for 20 seconds and 72°C for 30 seconds on iCycler iQ instrument (Bio-Rad, Hercules, CA). The mean value of the replicates for each sample was calculated and expressed as the cycle threshold (CT; cycle number at which each PCR reaction reaches a predetermined fluorescent threshold, set within the linear range of all reactions). The amount of gene expression was then calculated as the difference (ΔCT) between the CT value of the sample for the target gene and the mean CT value of that sample for the endogenous control (GAPDH). Relative expression was calculated as the difference (ΔΔCT) between ΔCT values of the test control sample for each target gene. The relative mRNA expression was shown as 2-ΔΔCT (Figure 3). The Primers used in Real-Time PCR were: hGAPDH: gaaggtgaaggtcggagt and catgggtggaatcatattggaa; hCYP7Al : caccttgaggacggttccta and cgatccaaagggcatgtagt; hSHP: gctgtctggagtccttctgg and ccaatgatagggcgaaagaagag; hBSEP: gggccattgtacgagatcctaa and tgcaccgtcttttcactttctg; hSREBPlc: gcaaggccatcgactacatt and ggtcagtgtgtcctccacct. In contrast to Figure 3, a different in vitro experiment using quantitative reverse transcription PCR, demonstrated that while no direct cell toxicity was observed upon exposure to any of these ligands, exposure of HepG2 cells to CDCA and its 6-ECDCA derivative, resulted in a 2-3 fold induction of SHP, an FXR regulated gene. By contrast, despite the fact that UPF-987 is a FXR ligand (see above), it stimulates SHP expression. All the FXR ligands tested, namely CDCA, 6- ECDCA and UPF-987 exerted the same effect on CYP7αl (all agents caused a 60- 70% reduction of the expression of CYP7αl mRNA). In addition, exposure to UPF- 987 induced BSEP and SHP mRNA expression (approximately 2-3 fold induction). This effect was significantly more pronounced with UPF-987 than with the other FXR ligands. Furthermore, similarly to the other ligands, exposure to UPF-987 resulted in a potent inhibition of SREPB-Ic and FAS mRNA expression. Taken together, these data suggest that UPF-987 is an FXR modulator that functions as a potent FXR ligand, and unexpectedly alters FXR regulated genes, causing significant induction of bile acid transporters (for example BSEP) and potent suppression of lipid-related genes. In addition, UPF-987 represses the expression of Cyp7αl, a gene that is critically involved in bile acid synthesis from cholesterol. The regulation of these FXR target genes suggests that UPF-987 is a gene-selective FXR ligand that may inhibit bile acid biosynthesis through the classical pathway while increasing bile acid secretion from hepatocytes, without interfering with SHP expression. This effect is desirable, since it narrows the pharmacological activities of these FXR ligands, and might prevent metabolic activation typically associated with SHP induction.
Results of In vitro pharmacology studies on UPF-987 are shown in Table 2 below.
Table 2. In Vitro Pharmacology Studies on UPF-987
Figure imgf000029_0001
Figure imgf000030_0001
Example 3
Regulation of FXR target genes by UPF-987 in vivo Background Compound 9 is also referred to as UPF-987. FXR plays a key role in the transcriptional regulation of genes involved in bile acid metabolism and lipid/cholesterol and glucose homeostasis. The regulation of these interactions is highly complex and contains multiple feedback loops to self-regulate the transcriptional circuits. The overlapping range of agonistic and antagonistic ligands, as well as of target genes shared by FXR with other metabolic nuclear receptors including PPARs and LXR, may serve as a redundant safety mechanism to elicit a protective response so that even when one pathway is compromised, a salvage pathway takes over. Crucial to the complexity of putative convergent and divergent functions of the metabolic nuclear receptors are their transcriptional coactivators and corepressors, that will be recruited in various manner from FXR modulators.
FXR modulators will be used for the treatment of the inflammatory, cholestatic, fibrotic liver disorders, and metabolic disorders including hypertriglyceridemic and hypercholesterolemic states and, by extension, atherosclerosis and its complications.
In conclusion, FXR is emerging as a particularly intriguing therapeutic target, not only for the promising application associated with its modulation but also for its peculiar mechanism of ligand recognition and gene activation. Materials and Methods Animals
Six- to eight-week old female Balb/c mice were obtained from Charles River (Charles River Laboratories, Inc., Wilmington, MA). Animals were fed a standard chow pellet diet, had free access to water, and were maintained on a 12-h light/dark cycle. All procedures in this study were approved by the Animal Study Committees of the University of Perugia (Italy) according to governmental guidelines for animal care. Animals were treated for 5 days by intraperitoneal injection of 6-ECDCA 5mg/Kg/day, while control animals were treated with vehicle alone (methyl- cellulose). At the end of the experiment mice were sacrificed and liver was removed to perform Real Time PCR analysis of FXR target genes. Quantitative Real-Time PCR
Quantitative Real-Time PCR was performed as above (see 1.1 Materials and Methods). The primers used were: mGAPDH: ctgagtatgtcgtggagtctac and gttggtggtgcaggatgcattg mBSEP: aaatcggatggtttgactgc and tgacagcgagaatcaccaag mSHP: tctcttcttccgccctatca and aagggcttgctggacagtta mCYP7Al: aagccatgatgcaaaacctc and gccggaaatacttggtcaaa mSREBPlc: gatcaaagaggagccagtgc and tagatggtggctgctgagtg Results
In vivo administration of the UPF-987 to intact mice for 4 days at the dose of 5 mg/kg resulted in a potent induction of BSEP and SHP in the liver. Despite encouraging yet inconsistent target gene expression data with preliminary in vitro assays discussed above, the observed in vivo data suggest potent downregulation (60-70% reduction) of Cyp7al. UPF-987 which also caused 90% inhibition of SREBP-Ic and reduced FAS mRNA expression in the liver (Fig. 5). Example 4 Evaluation of UPF-987 anti-inflammatory activity in TNBS mouse model of colitis
Materials and Methods Colitis models The intracolonic application of the hapten TNBS causes acute and chronic colitis in rodents. Mucosal inflammation in TNBS-colitis has a prominent neutrophilic infiltrate, but also comprises influx of CCRl + and CCR5+ macrophages and monocytes as well as a prominent IL- 12 and IFN- dependent T lymphocyte (ThI) activation. Histopatho logical features resemble human Crohn's disease, transmural inflammation, granulomas, fissuring ulcers and "skip lesions" (regions of ulceration separated by regions of normal mucosa". TNBS-colitis serves as a useful preclinical model for testing established and innovative treatments for Crohn's disease. Animals
Animals were monitored daily for appearance of diarrhea, loss of body weight, and survival. At the end of the experiment, surviving mice were sacrificed, blood samples collected by cardiac puncture, and a 7 cm segment of colon was excised, weighed, and macroscopic damage was evaluated. Induction of Colitis and Study Design Colitis was induced in BALB/c mice (8 weeks old) by intra-rectal administration of
TNBS (0.5 mg/mouse) Beginning three hours later and continuing at 24-h intervals for five days, the mice were administered intra- peritoneally, UPF-987 (0.3-1-
3mg/kg) or vehicle (methyl cellulose 1%). Each group consisted of 5 or 7 mice. The mice were sacrificed 18h after the final administration of the test drug or vehicle. The severity of colitis was scored by assessing the macroscopic appearance. The latter is an index of granulocyte infiltration in the tissue. The macroscopic scoring of colitis has been described in detail by Fiorucci et al, and involved blind scoring on a 0 (normal) to 4 (severe damage) scale. Body weight and stool consistency was recorded at the start and end of the study. Tissue samples were collected from the distal colon of each mouse and processed, as described previously.
Macroscopic Grading of Colitis
Colons were examined under a dissecting microscope (x 5) and graded for macroscopic lesions on a scale from 0 to 10 based on criteria reflecting inflammation, such as hyperemia, thickening of the bowel, and the extent of ulceration.
Quantitative Real-Time PCR
Mouse colon genes expression was evaluated by quantitative real-time polymerase chain reaction (RT-PCR) like previously described. Total RNA was isolated from speciments taken from distal colon. Followed primers were designed using
PRIMER3 -OUTPUT software, using published sequence data from the NCBI database: mGAPDH: ctgagtatgtcgtggagtctac and gttggtggtgcaggatgcattg mTNFα: acggcatggatctcaaagac and gtgggtgagcacgtagt mILlβ: tcacagcagcacatcaacaa and tgtcctcatcctcgaaggtc mIL6: ccggagaggagacttcacag and tccacgatttcccagagaac mINFγ: gctttgcagctcttcctcat and gtcaccatccttttgccagt miNOS: acgagacggataggcagaga and cacatgcaaggaagggaact mTGFβl: ttgcttcagctccacagaga and tggttgtagagggcaaggac mFXR: tgtgagggctgcaaaggttt and acatccccatctctctgcac Example 5
Evaluation of efficacy of UPF-987 in rat cholestatic model (ANIT) Background
Cholestasis results in intrahepatic accumulation of cytotoxic bile acids which cause liver injury ultimately leading to biliary fibrosis and cirrhosis. Cholestatic liver damage is counteracted by a variety of intrinsic hepatoprotective mechanisms. Such defense mechanisms include repression of hepatic bile acid uptake and de novo bile acid synthesis. Furthermore, phase I and II bile acid detoxification is induced rendering bile acids more hydrophilic. In addition to "orthograde" export via canalicular export systems, these compounds are also excreted via basolateral "alternative" export systems into the systemic circulation followed by renal elimination. Passive glomerular filtration of hydrophilic bile acids, active renal tubular secretion, and repression of tubular bile acid reabsorption facilitate renal bile acid elimination during cholestasis. The underlying molecular mechanisms are mediated mainly at a transcriptional level via a complex network involving nuclear receptors and other transcription factors. So far, the famesoid X receptor FXR, pregnane X receptor PXR, and vitamin D receptor VDR have been identified as nuclear receptors for bile acids. However, the intrinsic adaptive response to bile acids cannot fully prevent liver injury in cholestasis. Therefore, additional therapeutic strategies such as targeted activation of nuclear receptors are needed to enhance the hepatic defense against toxic bile acids. Materials and Methods Animals Wistar Rats studies were approved by the Animal Study Committee of the
University of Perugia. Male Wistar rats (200-250 g) were obtained from Charles
River Breeding Laboratories (Portage, MI) and maintained on standard laboratory rat chow on a 12-h light/dark cycle. Colestatic models: Methodialpha-naphthyl-isothiocyanate (ANIT)
The first rats group (N=6) was treated, daily, by ANIT 100mg/kg via gavage
(colestatic inducer), the second and third groups (N=6) were treated by ANIT
100mg/kg via gavage plus UPF-987 5 and 3 mg/kg intraperitoneally daily. Control rats (N=4) were administered vehicle (physiologic solution I. P.). At the end of the study, rats were sacrificed under anaesthesia with sodium pentobarbital (50 mg/kg i.p.) and terminally bled via cardiac puncture; the liver was removed and weighted for examination and blood samples were taken.
Quantitative Real-Time PCR
Rat genes expression was evaluated by quantitative real-time polymerase chain reaction (RT-PCR) as previously described herein. The following PCR primers were designed using PRIMER3 -OUTPUT software using published sequence data from the NCBI database: rGAPDH: atgactctacccacggcaag and atgactctacccacggcaag rSHP cctggagcagccctcgtctcag and aacactgtatgcaaaccgagga rBSEP: aaggcaagaactcgagataccag and tttcactttcaatgtccaccaac rCYP7Al: ctgcagcgagctttatccac and cctgggttgctaagggactc rCYP8Bl : cccctatctctcagtacacatgg and gaccataaggaggacaaaggtct rNTCP: gcatgatgccactcctcttatac and tacatagtgtggccttttggact rMdrl: cgttgcctacatccaggttt and gccattgcctgaaagaacat rMdr2: gttctcgctggtcttcttgg and cgtctgtggcgagtcttgta rMMP2: gatggatacccgtttgatgg and tgaacaggaaggggaacttg
Results UPF-987 was tested in vivo for its ability to protect against cholestasis induced in rat by α-naphthylisothiocyanate (ANIT). ANIT administration leads to a severe cholestasis, previous studies by Fiorucci et al. (unpublished) have shown that 6-ECDCA is not effective in reducing liver injury in this model. Administration of UPF-987 attenuates liver injury in ANIT treated rats, as measured by assessing plasma levels of AST, γGT and alkaline phosphatase, three markers of cholestasis and plasma cholesterol. In addition UPF-987, modulates NTCP, CYP7A1 and BSEP expression.
Example 6
Evaluation of efficacy of INT-1103 in rat cholestatic model (ANIT)
Background
INT-1103 is sulphide derivative of 6-ethyl-chenodeoxycholic acid (6E-CDCA or
INT-747), which is disclosed and in U.S. Patent No. 7,138,390 and incorporated by reference herein.
Material and Methods
Colestatic models: alpha-naphthyl-isothiocyanate (ANIT) Wistar Rats
Studies were approved by the Animal Study Committee of the University of Perugia.
Male Wistar rats (200-250 g) were obtained from Charles River Breeding Laboratories (Portage, MI) and maintained on standard laboratory rat chow on a 12- h light/dark cycle. The first group (N=8) were treated, daily, by ANIT 100mg/kg via gavage (colestatic inducer), the second and third groups (N=8) were treated by ANIT 100mg/kg via gavage plus INT-1103 5mg/kg intraperitoneally daily. Control rats (N=8) were administered vehicle (physiologic solution I.P.). At the end of the study, rats were sacrificed under anaesthesia with sodium pentobarbital (50 mg/kg i.p.) and terminally bled via cardiac puncture; the liver was weighted and removed for examination and blood samples were taken. Quantitative Real-Time PCR
The expression of rat FXR target genes was evaluated by quantitative real-time polymerase chain reaction (RT-PCR) as previously described herein. The following
PCR primers were designed using PRIMER3 -OUTPUT software using published sequence data from the NCBI database: rGAPDH: atgactctacccacggcaag and atgactctacccacggcaag rSHP cctggagcagccctcgtctcag and aacactgtatgcaaaccgagga rBSEP: aaggcaagaactcgagataccag and tttcactttcaatgtccaccaac rCYP7A 1 : ctgcagcgagctttatccac and cctgggttgctaagggactc rCYP8Bl : cccctatctctcagtacacatgg and gaccataaggaggacaaaggtct rNTCP: gcatgatgccactcctcttatac and tacatagtgtggccttttggact rMdrl : cgttgcctacatccaggttt and gccattgcctgaaagaacat rMdr2: gttctcgctggtcttcttgg and cgtctgtggcgagtcttgta rMMP2: gatggatacccgtttgatgg and tgaacaggaaggggaacttg
Example 7
Evalutation of efficacy of INT-1103 in rat cholestatic model (BTL)
Material and Methods
The (BTL) hepatic cholestatic model was induced by bile duct ligation (BDL) of 225-25Og old male Wistar rats. Sham-operated rats (N = 8) received the same laparoscopic procedure, except that the bile duct was manipulated, but not ligated and sectioned. In total, 24 animals were operated. Three days after surgery, surviving rats were randomized to receive placebo, intraperitoneally, (fisiologic solution) (N=6) or INT-1103 5 mg/kg (N=8). Animals were then treated for 7 days. At the end of the study, rats were sacrificed under anaesthesia with sodium pentobarbital (50 mg/kg i.p.) and terminally bled via cardiac puncture; the liver was weighted and removed for examination and blood samples were taken. Example 8
Evalutation of efficacy of INT-1103 and INT-747 in bile flow on naive rat
Material and Methods Adult male Wistar rats weighing 200 to 250 g were used throughout the study.
Before the experiments, the animals were maintained on standard chow and water ad libitum and housed in a temperature (21-230C)- and humidity (45-50%)-controlled room under a 12-h light/dark cycle. All studies were approved by the Animal Study Committee of the University of Perugia. For bile flow measurement, animals were anesthetized with a single dose of sodium pentobarbital (50 mg/kg body wt intraperitoneally) and maintained under this condition throughout the experiment. After catheterization of the jugular vein using a PE-50 polyethylene tubing (Intramedic; Clay Adams, Parsippany, NJ), a middle abdominal incision was made, and the common bile duct was also cannula ted (PE-10, Intramedic; Clay Adams).. Body temperature was maintained at 37.0 to 38.50C with a warming lamp to prevent hypothermic alterations of bile flow.. The bile samples were collected by the external biliary fistula every 15 min for 195 min and then weighed in order to determine the bile flow. Bile flow was determined by gravimetry, assuming a density of the bile of 1.0 g/ml. Bile collection started between 9:00 and 11:00 AM to minimize influence of circadian variations. Drugs admininistration was done by jugular cannula at the doses of 3μmoli/kg/min, control group received vehicle alone
(BSA 2% on fisilogic solution).
Example 9
Ealutation of efficacy of INT-1103 and INT-747 in bile flow on estrogen colestatic rat
Material and Methods
Adult male Wistar rats weighing 300 to 350 g were used throughout the study. Before the experiments, the animals were maintained on standard chow and water ad libitum and housed in a temperature (21-230C)- and humidity (45-50%)-controlled room under a 12-h light/dark cycle. All studies were approved by the Animal Study Committee of the University of Perugia. Animals were randomly divided into 4 experimental groups :
1. Naϊve,(N=5).
2. 17 -ethynylestradiol 5mg/kg for 5 days intra-peritoneal, (N=8).
3. 17 -ethynylestradiol 5mg/kg + INT-747 5mg/kg intra-peritoneal, for 5 days (N=7); 4. 17 -ethynylestradiol 5mg/kg + INT-1103 5mg/kg intra-peritoneal, for 5 days
(N=7).
For bile collection, surgical procedures were made on the sixth day ( 1 day after the administration of the last dose of E217 ). For bile flow measurement, animals were anesthetized with a single dose of sodium pentobarbital (50 mg/kg body wt intraperitoneally) and maintained under this condition throughout the experiment. A middle abdominal incision was made, and the common bile duct was also cannulated (PE-10, Intramedic; Clay Adams).. Body temperature was maintained at 37.0 to 38.5°C with a warming lamp to prevent hypothermic alterations of bile flow.. Bile collection started between 9:00 and 11:00 AM to minimize influence of circadian variations. Bile was collected at 15-min intervals for 120 min, and bile flow was determined gravimetrically. At the end of the experiments the body and liver rats was weighted.
Example 10 In vitro study of insulin gene regulation by INT-747 vs INT-1103 Material and Methods For RT-PCR assay, pancreatic Beta-TC6 cells were cultured in D-MEM supplemented with 1% penicillin/streptomycin, 1% L-glutamine and 10% fetal bovine serum (high glucose) (CELBIO). Cells were grown at 37°C in 5% CO2 and treated with INT-1103 and INT-747, at the final concentration lμM, for 18 hours. At the and of the experiments the cells were collected for RNA extraction. Real Time PCR
Quantification of the expression of mouse genes was performed by quantitative real-time polymerase chain reaction (RT-PCR). All PCR primers were designed using PRIMER3 -OUTPUT software using published sequence data from the NCBI database. Total RNA was isolated (TRIzol reagen, Invitrogen srl, Milan, Italy) from speciments taken from livers. One microgram of purified RNA was treated with DNAse I for 10 minutes at room temperature, followed by incubation at 95°C for 3 minutes in the presence of 2.5 mmol/L EDTA. The RNA was reverse transcribed with Superscript III (Invitrogen, Carsbad, CA) in 20μL reaction volume using reandom primers. For quantitative RT-PCR, 100 ng template was dissolved in a 25 μL containing 0.3 μmol/L of each primer and 12.5 μL of 2X SYBR Green PCR Master mix (Fynnzimes-DyNAmo SYBRR Green qPCR mix). All reactions were performed in triplicate, and the thermal cycling conditions were as follows: 2 minutes at 95°C, followed by 50 cycles of 95°C for 20 seconds, 55°C for 20 seconds and 72°C for 30 seconds on iCycler iQ instrument (Bio-Rad, Hercules, CA). The mean value of the replicates for each sample was calculated and expressed as the cycle threshold (CT; cycle number at which each PCR reaction reaches a predetermined fluorescent threshold, set within the linear range of all reactions). The amount of gene expression was then calculated as the difference (ΔCT) between the CT value of the sample for the target gene and the mean CT value of that sample for the endogenous control (GAPDH). Relative expression was calculated as the difference (ΔΔCT) between ΔCT values of the test control sample for each target gene. The relative mRNA expression was shown as 2'ΛΛCT . The Primers used in Real-Time PCR were: mGAPDH: gaaggtgaaggtcggagt and catgggtggaatcatattggaa; mSHP: gctgtctggagtccttctgg and ccaatgatagggcgaaagaagag; mSREBPlc: gcaaggccatcgactacatt and ggtcagtgtgtcctccacct. mINS: tgttggtgcacttcctaccc and ttgttccacttgtgggtcct mSHP: aagggcttgctggacagtta and tctcttcttcctccctatca mGLUT2: ccctgggtactcttcaccaa and gccaagtaggatgtgccaat
Example 11 Physico-chemical properties of INT-747 and INT-1103
Background
The two bile acid analogues, INT-747 and INT-1103, were admitted to a complete physico-chemical properties characterization following protocols previously developed and optimized in our laboratory and previously applied for a complete screening of a large series of Bile acid analogues (UDCA analogues) developed in the R. Pellicciari lab. The physico-chemical properties were selected to accurately define the behaviour in aqueous solutions and in biological fluids and to establish their potential toxicity to biological membranes, their pharmacokinetics and pharmacodynamics and biodistribution in the different biological fluids and organs. Comparative data with natural analogues will be also performed and discussed.
Water Solubility
Only side chain carboxylated BA INT-747, CDCA and UDCA were studied. Solid
BA were suspended in 5 ml of 0.1 M HCl. The saturated solutions, after incubation for 1 week, were filtered on a Millipore filter (0.22 μm) and the concentration of BA was measured by HPLC-ESI-MS/MS using C18 column (150mm x 2mm i.d., 4μm) and mobile phases of water containing ISmM acetic acid pH 5 and acetonitrile. The flow rate was 150 μl/min. The mass spectrometry acquisition was performed in the multiple reaction monitoring mode using the ESI source in negative ionization. Water solubility was expressed as μmol/liter
Table 3: water solubilit of the studied bile acids
Figure imgf000042_0001
* water solubility refers to BA as protonated species and therefore not evaluated for INT-1103
The water solubility was measured for the insoluble protonated species of carboxylated bile acids at a pH 1. The sulphate compound, UPF 1103 is ionized even at low pH and in physiological conditions is always soluble in all biological fluids. The water solubility of INT-747 is 9 μM , lower than CDCA, and comparable with that of UDCA. Since the CMC of INT-747 is relatively low (see next paragraph), the low water solubility of INT-747 do not compromise the behaviour of the compound in a micellar phase; in the case of UDCA, the low water solubility associated with an high CMC compromises the pH at which the protonated acid goes in solution to form micelles. The CMpH is, in fact, for UDCA 8.4, which is too high if is not present a postprandial alkalinization in duodenal content. Critical Micellar Concentration (CMC)
This value was determined by surface tension measurements using a maximum bubble-pressure method. The tensiometer was a Sensadyne 6000 (Chem-Dyne Research Corp., Milwaukee, WI) equipped with two glass probes of 0.5 and 4.0 mm diameters connected to a source of nitrogen. The bubble frequency was 1 bubble/second in distilled water at 26°C (P=2.7 atm) and the calibration was made with double-distilled water and methanol. The surface tension of BA sodium salts solutions both in water and in NaCl 0.15 M was measured at various concentrations range, 0.2-75 mM and 0.3-100 mM respectively. The surface tension values were plotted against the logarithm of the bile salt concentration; the regression lines corresponding to the two parts of the curve (monomeric and micellar phases) were calculated using the method of least squares, and the intersection of the lines was taken as the CMC value. Table 4: Critical Micellar Concentration of the studied bile acids
Figure imgf000043_0001
STcMO Surface Tension at CMC in water, ST50: Surface Tension of 5OmM aqueous solution; : values from literature
The CMC, as evaluated by surface tension measurements in non equilibrium conditions i.e. in conditions that impurities do not affect the results, of INT-747 and INT-1103 are relatively low, similar to CDCA natural analogue. INT-1103 presents the lower CMC both in water and in presence of counter ion Na+ 150 mM. The low CMC value of INT-747 is related to the topographic distribution of the ethyl and hydroxyl groups: the ethyl group in the 6 position is oriented in the β face, the back of the steroid, contributing to increase the lipophilic extent and area of the surface of this moiety and therefore the tendency to form micelles. INT-1103 presents the lower CMC as result of ethyl group in 6 position and the 23 sulphate in the side chain. The peculiar properties of the sulphate group gave to INT-1103 anionic surfactant like properties (like sodium dodecyl sulphate) as a result of a negative charged head and lipophilic tail with a surface lipophilic moiety. The values of the surface tension activity both at CMC and in micellar phase (50 mM) agree with the present CMC data, both compounds are surface active and able to lower the surface tension to a great extent in respect to UDCA and TUDCA. This data further supports the concept that this compounds are detergent like the CDCA analogue and even more. INT-747 at a relatively high concentration >60 mM and in the presence of Na+ 0.15 M form a gel phase and this account for the relatively inaccurate ST data found in that conditions (Fig.l) These results are not surprising since other detergent natural BA like deoxycholic acid behave similarly forming this gel (usually viscoelastic) particularly for the effect of counter ions like Na+ and Ca++ This phase evolves to micellar phase with a relatively low kinetics. Moreover this phenomenon occurs at a very high not physiological concentration. Octanol/water partition coefficient
1-Octanol/water partition coefficient (log P) was evaluated using a conventional shake-flask procedure. The experiments were carried out on 0.1 mM bile salt solution buffered at pH 8 with 0.1 M phosphate buffer to ensure complete ionization of the BA; the log P values refer to the BA in the ionized form, not to the protonated species, and the initial concentration of each BA was below its own CMC value. The aqueous buffer was previously pre-saturated with 1-octanol, 5 ml of 1-octanol pre- saturated with water was then added and the samples were left to equilibrate for 2 weeks under continuous stirring at room temperature After centrifugation the two phases were carefully separated. BA concentration in the water phase was measured with HPLC-ESI-MS/MS using C18 column (150mm x 2mm i.d., 4μm) and mobile phases: A: water containing 15 mM acetic acid pH 5 , B: acetonitrile. The flow rate was 150 μl/min and the column was maintained at 45°C. The mass spectrometry acquisition was performed in the multiple reaction monitoring mode using the ESI source in negative ionization. Table 5: 1-octanol-water partition coefficient of the studied bile acids as ionized species
Figure imgf000045_0001
*: value from literature
The 1-octanol/water partition coefficient was calculated for the ionized species to facilitate the comparison between the carboxyl and sulphate bile acids since the latter do not protonated even at very low pH. INT-747 presents a slightly higher lipophilicity in respect to other dihydroxy bile acids such as UDCA and CDCA. The increased lipophilicity is the result of the introduction of an ethyl group in position 6. The tendency to distribute in a lipid domain is therefore af^her. The UPF 1103 shows a logP of 2.0, value slightly lower than INT-747 and natural CDCA and UDCA analogues and this account for the contribution of the sulphate group and side chain length. Moreover the lipophlicity of INT- 1103 is still similar to an unconjugated BA and higher than taurine conjugated like TCDCA that present a logP of 0.9. Contrarily to Taurine conjugate which preferentially stay in a water domain , INT-1103 has a tendency to accumulate in a lipid domain like INT-747. Albumin binding Albumin binding was evaluated by equilibrium dialysis at a fixed BA-albumin ratio. BA was dissolved at a concentration of 100 μM in 5% bovine serum albumin-saline solution and left to stand for 24 h at 25°C. Two ml of this solution was dialyzed in cellulose sacs having a molecular weight cut-off of 12-14,000 against 25 ml of saline solution. The system was equilibrated by mechanical shaking for 72 h at 25°C. BA concentrations of the dialyzed solution and of the starting solution were determined with HPLC-ESI-MS/MS in the same conditions of the previous analysis.
Table 6: Albumin bindin of the studied bile acids * : values from literature
Figure imgf000046_0001
Both INT-747 and UPF 1103 present a strong interaction with albumin quite similar to natural dihydroxy bile acid like CDCA and UDCA suggesting a similar kinetic in the hepatic uptake. Trihydroxy bile acids like cholic acid or taurine conjugated bile acids show a lower interaction with albumin and this account to the lower serum concentration at a similar intestinal uptake as a result of a higher first pass clearance. The unbound fraction (like for many drugs) modulates the liver uptake: as the fraction increase the higher is the uptake. INT-747 and INT-1103 present a low unbound fraction and therefore their serum concentration are higher as a result of a relatively low first pass clearance, and their behaviour is similar to natural analogs. Critical micellar pH This value can be experimentally determined by evaluating the pH at which a given
BA starts to precipitate from a micellar solution. It can be calculated from the CMC
Water solubility of the protonated species and pKa using the formula:
CMpH= pKa + log CMCAVS. The CMpH of the studied compounds in comparison with the natural analogs are reported in Table I.
Table 7: Critical Micellar H the studied bile acids
Figure imgf000047_0001
The CMpH value of INT747 is similar to that of CDCA and lower to UDCA. According to this value INT747 do not present problems of intestinal solubility and requires a pH of 7.6 which is physiological to go in solution. For example UDCA with a CMpH of 8.4 requires an higher alkalinization of the duodenal content and only in post-prandial phase is solubilized in a micellar phase. UP 1103 having a sulphate group do not present these problems since is always soluble in the physiological pH from 2 to 9 since the pKa is very low and the compound do not protonated to form insoluble molecule. Its behaviour is similar to taurine conjugated bile acids.
Example 12
Hepatic metabolism and secretion of INT-747 and INT-1103 in rat after one hour iv infusion at a dose of 3umol/Kg/min Background The BA were administered by infusion to bile fistula rat and bile collected at 15 min intervals for 7 hours. The bile flow was measured and bile analyzed using HPLC- ES-MS-MS for the identification of the rate of biliary secretion and to evaluate the major hepatic metabolites. HPLC-ES-MS/MS Method
Bile acids and their metabolites were determined by a liquid chromatography- tandem mass spectrometry (HPLC-MS/MS) method using electrospray (ESI) source in negative ionization mode. Rat bile samples were brought to room temperature and diluted 1: 100 v/v - 1: 1000 v/v with 15 mM ammonium acetate buffer (pH=5). Then, 10 μL were injected into the chromatographic column. Liquid chromatography was performed using a Waters Alliance 2695 separation module coupled with autosampler. Bile acids were analyzed using a Synergi Hydro-RP Cl 8 column (150x2.0mm i.d., 4 μm particle size), protected by a SecurityGuard ODS 4x2.0mm i.d. precolumn, both supplied from Phenomenex. Bile acids were separated in elution gradient using 15 mM ammonium acetate buffer (pH = 5.00) as mobile phase A and acetonitrile as mobile phase B. Mobile phase B was increased from 30% to 64% in 12 min, then to 70% in 8 min, and finally brought to 100% in 10 min and held constant for 1 min. Flow rate was 150 μL/min and the column was maintained at 45°C. The column effluent was analysed by ESI-MS/MS using a Quattro-LC (Micromass) triple quadruple mass spectrometer operating in Multiple Reaction
Monitoring (MRM) acquisition mode. MassLynx software version 4.0 was used for data acquisition and processing.
Results
INT-747 is secreted into bile mainly as taurine conjugate and its recovery is almost complete: at the administered dose more than 99 % of the infused molecule is secreted into bile as shown in fig 3. At the last point of bile collection a relatively high amount of the taurine conj. compound is still secreted in bile. The maximum secretion rate is achieved after 120 minutes just at the end of the infusion. A steady state concentration is maintained for additional 30 minutes. The taurine conjugation process begin very early and appears efficient at the administered dose. Trace amount of the compound is also conjugate with glycine, less than 0.2% and similar amount is secreted as such in bile. The behaviour of INT-747 is similar to that of natural dihydroxy analogs such as CDCA or UDCA which are secreted into bile only as taurine and glycine conjugates. Differently, trihydroxy BA such as CA, can be also partially secreted in unconjugated form. The extent of a BA that can be secreted unmodified is related to its lipophilicity and is dose and species dependent.
The behaviour in term of hepatic uptake and secretion of this molecule is quite similar to natural analogue like CDCA and the rate of hepatic secretion is related to that of taurine conjugation mediated by a CoA activation and taurine liver availability. The preferential conjugation with taurine is peculiar to rat and other species (dog, mice,..) and in man this compound is amidated mainly with glycine. According to these date seems that INT-747 is efficiently take up and secreted by the liver. The hepatic metabolism of INT-747 produces mainly the taurine conjugate form. Trace amount of glycine conjugate are secreted in bile and also very low amount is secreted as such, (fig 37 and 38). Minor epimers of both unconjugated and taurine conjugated are present in bile (fig 39 and 40).
INT-1103 is secreted in bile partially unmodified as reported in fig 41. The amount of INT-1103 secreted in bile is approx. 30-40% of the administered dose and its secretion rate is relatively low and at the end of the collection period a relatively high amount of the molecule is still secreted into bile. The main hepatic metabolite of INT-1103 in rat at the administered dose is the 3-glucoronide as reported in fig 42. The amount of this compound has not be quantified since the pure reference standard is not available. Other metabolites are secreted into bile as reported in fig 43 and in more details in fig 43 and fig 44. The main identified metabolites is the 3- sulphate conjugate, an hydroxy analog (one more hydroxyl ) , keto derivatives and epimers of INT-1103. The exact amount of these compound were not quantified since the standards are not yet available.
These data suggest that INT-1103 can be secreted in bile as such and its behaviour is different from natural dihydroxy analogs such as CDCA and INT- 747 that require a conjugation with taurine and glycine to be secreted into bile. This is a main requisite for molecules with this lipophilicity. On the contrary trihydrohy BA such as CA or UCA can be secreted in bile also partially as such. The sulphate group present in
INTl 103 facilitate the secretion process even if the molecule is still quite lipophilic and the behaviour is between an unconjugated and taurine conjugated bile acid. Moreover the liver strong metabolize this compound forming more hydrophilic compound such as 3-glucuronides, 3 -sulphates and hydroxylated analogs. The extensive metabolism do to retained compound is related to the animal species and to the administered dose and according to these data we can speculate that this compound present a metabolism more similar to an "acids steroids" slightly different from a common bile acid, but maybe sharing same properties. We do not know the metabolism in human but if its behaviour is more like a steroid is may be underwent to 3-glucuronidation even in humans. The compound was administered iv and addition data are required to evaluate the extent of its intestinal absorption ie passive or active like a taurine conjugate.
Example 13 In vitro metabolic stability in human stools culture
Stability to Intestinal Bacteria; 7α-dehydroxylation
Homogenized fresh human stools (500 mg) were transferred into sterile vials to which 5 mL of sterilized chopped meat-glucose medium (Scott Lab., Fiskville, RI) was added. BA were then added at a final concentration of 0.05 tnM. Vials were incubated at 37 C; then, at 0, 4, 8, 16, 20, 24, and 72 h after the addition of the BA, the reaction was stopped with 150 L of 30% KOH. The samples were centrifuged at 3500 rpm for 10 min; from the supernatant the BA were isolated by C-18 solid- phase extraction and analyzed by TLC and HPLC-ES-MS/MS. Thin-layer chromatography (TLC), utilizing silica gel 0.25 m thickness plates (Merck, Darmstat, Germany), was employed as the first screening test. The solvent system used for the separation of conjugated BA was composed of propionic acid/isoamyl acetate/water/N-propanol (3:4: 1 :2, v/v/v/v; solvent I), and that of the unconjugated BA was acetic acid/carbon tetrachloride/isopropyl ether/isoamyl acetate/water/N- propanol/benzene (1 :4:6:8:2:2, v/v/v/v/v/v; solvent II). Separated BA were revealed with 5% phosphomolybdic acid ethanol solution. Both INT-747 and INT-1 103 are very stable when incubated in human stool cultures and even after 24 hour more than 85 % of the compounds can be recovered unmodified as reported in Fig 45 . On the contrary the reference natural analogue CDCA present an half-life time of almost one hour and after 8 hours of incubation is almost completely metabolized (7- dehydroxylated) to form lithocholic acid. Results These data, shown in Figure 46, suggest that the presence of the ethyl group in the 6 position protect the 7 hydroxyl group toward oxidation or removal by steric hindrance. In addition both analogues are very stable and particularly INT-1103. The side chain ester bond is quite stable in the human stool culture. No minor metabolites have been found by HPLC-ES-MS/MS
Example 14
In vitro metabolic stability in simulated duodenal/pancreatic fluid (USP specification)
Material and Methods
This study has been performed only for INTl 103 since it contain an ester bond in the side chain and the aim was to verify the stability in presence of esterase enzymes like present in duodenal and pancreatic juice. Simulated pancreatic fluid was prepared by dissolving 10 g/L Pancreatin (Sigma P8096: pancreatin from porcine pancreas, activity Ix USP specifications) in 0.05M phosphate buffer, pH = 7.2 ± 0.1. Then, 4-mL aliquots of the simulated pancreatic fluid were added of 50 μM INT- 1103 and incubated for different times (0, 30, 60, 90, 120, 180 and 240 min) at 37°C. After incubation, a 2-mL aliquot of each solution was added with 2 mL of
0.1M NaOH and subjected to bile acids extraction by SPE and analysis by thin-layer chromatography and mass spectrometry as described above.

Claims

1. A compound of formula (I):
Figure imgf000053_0001
wherein R is hydrogen or alpha-hydroxy the hydroxyl group in position 7 is in the alpha or beta position and pharmaceutically acceptable salts, solvates or amino acid conjugates thereof.
2. A compound of formula (I) wherein the hydroxy group in 7 is in the alpha position and R is hydrogen.
3. A compound of formula (I) wherein the hydroxy group in 7 is in the beta position and R is hydrogen.
4. A compound of formula (I) wherein the hydroxy group in 7 is in the alpha position and R is alpha-hydroxy.
5. A compound of formula (I) wherein the pharmaceutically acceptable salt is:
Figure imgf000053_0002
6. A compound of formula (I) wherein the pharmaceutically acceptable salt is:
Figure imgf000054_0001
7. A method for the prevention or treatment of an FXR-mediated disease or condition in a mammal comprising administering to the mammal suffering from an FXR-mediated disease or condition a therapeutically effective amount of a compound of formula (I) according to any one of claims 1-4.
8. A method according to claim 5 wherein the FXR-mediated disease or condition is selected from the group consisting of chronic liver disease, gastrointestinal disease, renal disease, cardiovascular disease, and metabolic disease.
9. A method according to claim 6 wherein the chronic liver disease is selected from the group consisting of primary biliary cirrhosis (PBC), cerebrotendinous xanthomatosis (CTX), primary sclerosing cholangitis (PSC), drug induced cholestasis, intrahepatic cholestasis of pregnancy, parenteral nutrition associated cholestasis (PNAC), bacterial overgrowth or sepsis associated cholestasis, autoimmune hepatitis, chronic viral hepatitis, alcoholic liver disease, nonalcoholic fatty liver disease (NAFLD), nonalcoholic steatohepatitis (NASH), liver transplant associated graft versus host disease, living donor transplant liver regeneration, congenital hepatic fibrosis, choledocholithiasis, granulomatous liver disease, intra- or extrahepatic malignancy, Sjogren's syndrome, Sarcoidosis, Wilson's disease, Gaucher' s disease, hemochromatosis, and alpha 1 -antitrypsin deficiency.
10. A method according to claim 6 wherein the gastrointestinal disease is selected from the group consisting of inflammatory bowel disease (IBD), Crohn's disease, ulcerative colitis, irritable bowel syndrome (IBS), bacterial overgrowth , malabsorption, post- radiation colitis, and microscopic colitis.
11. A method according to claim 6 wherein the renal disease is selected from the group consisting of diabetic nephropathy, focal segmental glomerulosclerosis (FSGS), hypertensive nephrosclerosis, chronic glomerulonephritis, chronic transplant glomerulopathy, chronic interstitial nephritis, and polycystic kidney disease.
12. A method according to claim 6 wherein the cardiovascular disease is selected from the group consisting of atherosclerosis, arteriosclerosis, dyslipidemia, hypercholesterolemia, and hypertriglyceridemia.
13. A method according to claim 6 wherein the metabolic disease is selected from the group consisting of insulin resistance, Type I and Type II diabetes, and obesity.
14. A pharmaceutical composition comprising a compound of formula (I) according to any one of claims 1-4 and a pharmaceutically acceptable carrier or diluent.
15. Use of a compound of formula (I) as defined in claims 1-4 for the preparation of pharmaceutical compositions for the prevention or treatment of FXR-mediated diseases or conditions.
16. Use of a compound of formula (I) as defined in claims 1 -4 for the preparation of pharmaceutical compositions for the prevention or treatment of a FXR-mediated disease or condition selected from the group consisting of chronic liver disease, gastrointestinal disease, renal disease, cardiovascular disease, and metabolic disease, cardiovascular disease, atherosclerosis, arteriosclerosis, hypercholesteremia, and hyperlipidemia .
17. Use of a compound of formula (I) as defined in claims 1-4 for the preparation of pharmaceutical compositions for the prevention or treatment of cholestatic liver diseasesa chronic liver disease selected from the group consisting of primary biliary cirrhosis (PBC), cerebrotendinous xanthomatosis (CTX), primary sclerosing cholangitis (PSC), drug induced cholestasis, intrahepatic cholestasis of pregnancy, parenteral nutrition associated cholestasis (PNAC), bacterial overgrowth or sepsis associated cholestasis, autoimmune hepatitis, chronic viral hepatitis, alcoholic liver disease, nonalcoholic fatty liver disease (NAFLD), nonalcoholic steatohepatitis
(NASH), liver transplant associated graft versus host disease, living donor transplant liver regeneration, congenital hepatic fibrosis, choledocholithiasis, granulomatous liver disease, intra- or extrahepatic malignancy, Sjogren's syndrome, Sarcoidosis, Wilson's disease, Gaucher's disease, hemochromatosis, and alpha 1-antitrypsin deficiency.
18. Use of a compound of formula (I) as defined in claims 1-4 for the preparation of pharmaceutical compositions for the prevention or treatment of a gastrointestinal disease selected from the group consisting of inflammatory bowel disease (IBD), Crohn's disease, ulcerative colitis, irritable bowel syndrome (IBS), bacterial overgrowth , malabsorption, post-radiation colitis, and microscopic colitis.
19. Use of a compound of formula (I) as defined in claims 1-4 for the preparation of pharmaceutical compositions for the prevention or treatment of a renal disease selected from the group consisting of diabetic nephropathy, focal segmental glomerulosclerosis (FSGS), hypertensive nephrosclerosis, chronic glomerulonephritis, chronic transplant glomerulopathy, chronic interstitial nephritis, and polycystic kidney disease.
20. Use of a compound of formula (I) as defined in claims 1-4 for the preparation of pharmaceutical compositions for the prevention or treatment of a cardiovascular disease selected from the group consisting of atherosclerosis, arteriosclerosis, dyslipidemia, hypercholesterolemia, and hypertriglyceridemia.atherosclerosis, arteriosclerosis, hypercholestremia, and hyperlipidemia.
21. Use of a compound of formula (I) as defined in claims 1-4 for the preparation of pharmaceutical compositions for the prevention or treatment of a metabolic disease selected from the group consisting of insulin resistance, Type I and Type II diabetes, and obesity.
22. Pharmaceutical compositions containing a compound of formula (I) as defined in claims 1 -4 in admixture with pharmaceutically acceptable carriers and/or diluents. Figure 1
HepG2
Figure imgf000058_0001
1/48 Figure 2
HepG2
Figure imgf000059_0001
2/48
Figure 3
Figure imgf000060_0001
Figure 4
Figure imgf000061_0001
Figure 5
weight loss
Figure imgf000062_0001
days
5/48 Figure 6
Figure imgf000063_0001
Figure 7
mucosal damage
Figure imgf000064_0001
7/48
Figure 8
Figure imgf000065_0001
Figure 9
Bilirubin
Figure imgf000066_0001
9/48 Figure 10
Figure imgf000067_0001
Figure 11
ALP
Figure imgf000068_0001
11/48 Figure 12
γGT
Figure imgf000069_0001
12/48 Figure 13
Figure imgf000070_0001
Figure 14
body weight
Figure imgf000071_0001
14/48 Figure 15
Figure imgf000072_0001
Figure 16
Figure imgf000073_0001
Figure 17
Bilirubin
Figure imgf000074_0001
17/48 Figure 18
Figure imgf000075_0001
Figure 19
Figure imgf000076_0001
Figure 20
Figure imgf000077_0001
Figure 21
Figure imgf000078_0001
Figure 22
Figure imgf000079_0001
Figure 23
liver ratio
Figure imgf000080_0001
23/48 Figure 24
Bilirubin
Figure imgf000081_0001
24/48 Figure 25
AST
Figure imgf000082_0001
25/48 Figure 26
Figure imgf000083_0001
Figure 27
Figure imgf000084_0001
Figure 28
Figure imgf000085_0001
Figure 29
Figure imgf000086_0001
Figure 30
liver ratio%
Figure imgf000087_0001
30/48 Figure 31
Figure imgf000088_0001
Figure 32
Figure imgf000089_0001
Figure 33
Figure imgf000090_0001
Figure 34
Figure imgf000091_0001
Figure 35
Mouse β-cells
Figure imgf000092_0001
35/48 Figure 36
Figure imgf000093_0001
0,1 10 100
36/48 Figure 37
Figure imgf000094_0001
,1 10 100
37/48 Figure 38
Figure imgf000095_0001
Figure 39
Figure imgf000096_0001
Figure 40
Figure imgf000097_0001
40/48 Figure 41
L1, L2 and L3 epimers
Figure imgf000098_0001
0 50 100 150 200 time (min)
41/48 Figure 42
Figure imgf000099_0001
Figure 43
Figure imgf000100_0001
43/48 Figure 44
Figure imgf000101_0001
44/48 Figure 45
INT1103 METABOLITES
-3-sulphatelNT1103 • 3-glucuronιde INT1103 -Hydroxy INT1103
- Mono Keto metabolite 1
- Mono Keto metabolite 2 -INT1103epιmer
Figure imgf000102_0001
Time (min)
45/48 Figure 46
INT 1103 METABOLITES (zoom)
- 3-sulphate lNT1103
■ Hydroxy INT1103
■ Mono Keto metabolite 1
■ Mono Keto metabolite 2
■ INT1103 epimer
Figure imgf000103_0001
50 100 150 200 Time (min)
46/48 Figure 47
Stability in human stools cultures
Figure imgf000104_0001
10 12 14 16 18 20 22 24 Time (h)
47/48 Figure 48
Figure imgf000105_0001
0 2 4 6 time (hour)
48/48
PCT/US2007/014829 2006-06-27 2007-06-27 Bile acid derivatives as fxr ligands for the prevention or treatment of fxr-mediated deseases or conditions Ceased WO2008002573A2 (en)

Priority Applications (12)

Application Number Priority Date Filing Date Title
ES07809913.2T ES2523591T3 (en) 2006-06-27 2007-06-27 Bile acid derivatives as FXR ligands for the prevention or treatment of diseases or conditions mediated by FXR
AU2007265457A AU2007265457C1 (en) 2006-06-27 2007-06-27 Bile acid derivatives as FXR ligands for the prevention or treatment of FXR-mediated diseases or conditions
EP07809913.2A EP2040713B1 (en) 2006-06-27 2007-06-27 Bile acid derivatives as fxr ligands for the prevention or treatment of fxr-mediated deseases or conditions
HK09109151.7A HK1130187B (en) 2006-06-27 2007-06-27 Bile acid derivatives as fxr ligands for the prevention or treatment of fxr-mediated deseases or conditions
CN2007800321119A CN101522703B (en) 2006-06-27 2007-06-27 Bile acid derivatives and its uses in the prevention or treatment of fxr-mediated diseases or conditions
CA2656320A CA2656320C (en) 2006-06-27 2007-06-27 Bile acid derivatives as fxr ligands for the prevention or treatment of fxr-mediated diseases or conditions
DK07809913.2T DK2040713T3 (en) 2006-06-27 2007-06-27 BILIC ACID DERIVATIVES AS FXR LIGANDS FOR THE PREVENTION OR TREATMENT OF FXR-MEDIATED DISEASES OR CONDITIONS
SI200731515T SI2040713T1 (en) 2006-06-27 2007-06-27 Bile acid derivatives as fxr ligands for the prevention or treatment of fxr-mediated deseases or conditions
PL07809913T PL2040713T3 (en) 2006-06-27 2007-06-27 Bile acid derivatives as fxr ligands for the prevention or treatment of fxr-mediated deseases or conditions
JP2009518230A JP5222846B2 (en) 2006-06-27 2007-06-27 Bile acid derivatives as FXR ligands for the prevention or treatment of FXR-mediated diseases or conditions
IL196169A IL196169A (en) 2006-06-27 2008-12-25 Bile acid derivatives and pharmaceutical compositions containing the same
IL221764A IL221764A (en) 2006-06-27 2012-09-03 Use of sulfate of bile acids for the preparation of pharmaceutical compositions for treating fxr-mediated diseases

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US81663506P 2006-06-27 2006-06-27
US60/816,635 2006-06-27

Publications (2)

Publication Number Publication Date
WO2008002573A2 true WO2008002573A2 (en) 2008-01-03
WO2008002573A3 WO2008002573A3 (en) 2008-02-28

Family

ID=38846269

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2007/014829 Ceased WO2008002573A2 (en) 2006-06-27 2007-06-27 Bile acid derivatives as fxr ligands for the prevention or treatment of fxr-mediated deseases or conditions

Country Status (14)

Country Link
US (4) US7932244B2 (en)
EP (1) EP2040713B1 (en)
JP (1) JP5222846B2 (en)
CN (1) CN101522703B (en)
AU (1) AU2007265457C1 (en)
CA (1) CA2656320C (en)
CY (1) CY1115533T1 (en)
DK (1) DK2040713T3 (en)
ES (1) ES2523591T3 (en)
IL (2) IL196169A (en)
PL (1) PL2040713T3 (en)
PT (1) PT2040713E (en)
SI (1) SI2040713T1 (en)
WO (1) WO2008002573A2 (en)

Cited By (48)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009021740A2 (en) 2007-08-15 2009-02-19 Sanofis-Aventis Substituted tetrahydronaphthalenes, process for the preparation thereof and the use thereof as medicaments
WO2010014836A3 (en) * 2008-07-30 2010-04-01 Intercept Pharmaceuticals, Inc. Tgr5 modulators and methods of use thereof
WO2010069604A1 (en) 2008-12-19 2010-06-24 Royal College Of Surgeons In Ireland Treatment of diarrhoea
US7994352B2 (en) 2005-05-19 2011-08-09 Intercept Pharmaceuticals, Inc. Process for preparing 3a(β)-7a(β)-dihydroxy-6a(β)-alkyl-5β-cholanic acid
WO2011107494A1 (en) 2010-03-03 2011-09-09 Sanofi Novel aromatic glycoside derivatives, medicaments containing said compounds, and the use thereof
US8058267B2 (en) 2001-03-12 2011-11-15 Intercept Pharmaceuticals, Inc. Steroids as agonists for FXR
ITRM20100329A1 (en) * 2010-06-15 2011-12-16 Franco Baldelli MODULATION OF THE NUCLEAR RECEPTOR FOR PHARNESOIDS (FXR) WITH MOLECULES AGONIST FOR THE PREVENTION AND TREATMENT OF ATTEROSCLEROTIC PHENOMENA INDUCED BY ADMINISTRATION OF PROTEASIS INHIBITORS
WO2011157827A1 (en) 2010-06-18 2011-12-22 Sanofi Azolopyridin-3-one derivatives as inhibitors of lipases and phospholipases
US8114862B2 (en) 2008-11-19 2012-02-14 Intercept Pharmaceuticals, Inc. TGR5 modulators and methods of use thereof
GB2465677B (en) * 2008-11-26 2012-09-26 Satiogen Pharmaceuticals Inc Non-systemic delivery of satiogens for use in the treatment of obesity and/or diabetes
US8410083B2 (en) 2007-01-19 2013-04-02 Intercept Pharmaceuticals, Inc. 23-substituted bile acids as TGR5 modulators and methods of use thereof
WO2014085474A1 (en) * 2012-11-28 2014-06-05 Intercept Pharmaceuticals, Inc. Treatment of pulmonary disease
WO2014200349A1 (en) 2013-06-13 2014-12-18 Fast Forward Pharmaceutical B.V. Cd40 signalling inhibitor and a further compound, wherein the further compound is a bile acid, a bile acid derivative, an tgr5-receptor agonist, an fxr agonist or a combination thereof, for the treatment of chronic inflammation, and the prevention of gastrointestinal cancer or fibrosis.
WO2015036442A1 (en) * 2013-09-11 2015-03-19 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and pharmaceutical compositions for the treatment of hepatitis b virus infection
US9238673B2 (en) 2012-06-19 2016-01-19 Intercept Pharmaceuticals, Inc. Preparation and uses of obeticholic acid
EP2912013A4 (en) * 2012-10-26 2016-06-01 Intercept Pharmaceuticals Inc PROCESS FOR THE PREPARATION OF BILARY ACID DERIVATIVES
WO2016173493A1 (en) * 2015-04-28 2016-11-03 Shanghai De Novo Pharmatech Co. Ltd. Sulfonylaminocarbonyl derivative, pharmaceutical composition and uses thereof
US9498484B2 (en) 2004-03-12 2016-11-22 Intercept Pharmaceuticals, Inc. Treatment of fibrosis using FXR ligands
EP3124080A1 (en) 2015-07-28 2017-02-01 Merz Pharma GmbH & Co. KGaA Semisynthetic bile acids for injection lipolysis
WO2017053428A1 (en) 2015-09-21 2017-03-30 Intercept Pharmaceuticals, Inc. Methods of promoting hepatic regeneration
WO2017199033A1 (en) 2016-05-18 2017-11-23 NZP UK Limited Intermediates for the synthesis of bile acid derivatives, in particular of obeticholic acid
US9982008B2 (en) 2012-06-19 2018-05-29 Intercept Pharmaceuticals, Inc. Preparation and uses of obeticholic acid
WO2018178260A1 (en) 2017-03-30 2018-10-04 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and pharmaceutical compositions for reducing persistence and expression of episomal viruses
US10131688B2 (en) 2014-11-19 2018-11-20 NZP UK Limited 5.beta.-6-alkyl-7-hydroxy-3-one steroids as intermediates for the production of steroidal FXR modulators
US10188646B2 (en) 2010-05-26 2019-01-29 Satiogen Pharmaceuticals, Inc. Bile acid recycling inhibitors and satiogens for treatment of diabetes, obesity, and inflammatory gastrointestinal conditions
US10220027B2 (en) 2011-07-13 2019-03-05 Gilead Sciences, Inc. FXR (NR1H4) binding and activity modulating compounds
US10301350B2 (en) 2014-11-19 2019-05-28 NZP UK Limited 6-alkyl-7-hydroxy-4-en-3-one steroids as intermediates for the production of steroidal FXR modulators
US10329286B2 (en) 2016-06-13 2019-06-25 Gilead Sciences, Inc. FXR (NR1H4) modulating compounds
US10421730B2 (en) 2016-06-13 2019-09-24 Gilead Sciences, Inc. FXR (NR1H4) modulating compounds
US10512657B2 (en) 2011-10-28 2019-12-24 Lumena Pharmaceutials Llc Bile acid recycling inhibitors for treatment of pediatric cholestatic liver diseases
US10538550B2 (en) 2014-11-19 2020-01-21 NZP UK Limited 6.alpha.-alkyl-3,7-dione steroids as intermediates for the production of steroidal FXR modulators
WO2020025942A1 (en) 2018-07-30 2020-02-06 NZP UK Limited Fluorinated bile acid derivatives
US10555950B2 (en) 2008-11-26 2020-02-11 Satiogen Pharmaceuticals, Inc. Bile acid recycling inhibitors for treatment of obesity and diabetes
US10597423B2 (en) 2014-11-19 2020-03-24 NZP UK Limited 6.alpha.-alkyl-6,7-dione steroids as intermediates for the production of steroidal FXR modulators
EP3626725A1 (en) 2014-05-29 2020-03-25 Bar Pharmaceuticals S.r.l. Cholane derivatives for use in the treatment and/or prevention of fxr and tgr5/gpbar1 mediated diseases
EP3518937A4 (en) * 2016-09-30 2020-04-29 Intercept Pharmaceuticals, Inc. Crystalline forms of a bile acid derivative
US10766921B2 (en) 2016-05-18 2020-09-08 NZP UK Limited Process and intermediates for the 6,7-alpha-epoxidation of steroid 4,6-dienes
WO2021009332A1 (en) 2019-07-18 2021-01-21 Enyo Pharma Method for decreasing adverse-effects of interferon
US10987362B2 (en) 2004-03-12 2021-04-27 Intercept Pharmaceuticals, Inc. Treatment of fibrosis using FXR ligands
WO2021144330A1 (en) 2020-01-15 2021-07-22 INSERM (Institut National de la Santé et de la Recherche Médicale) Use of fxr agonists for treating an infection by hepatitis d virus
US11072631B2 (en) 2015-09-24 2021-07-27 Intercept Pharmaceuticals, Inc. Methods and intermediates for the preparation bile acid derivatives
US11225473B2 (en) 2019-01-15 2022-01-18 Gilead Sciences, Inc. FXR (NR1H4) modulating compounds
WO2022152770A1 (en) 2021-01-14 2022-07-21 Enyo Pharma Synergistic effect of a fxr agonist and ifn for the treatment of hbv infection
US11419878B2 (en) 2016-03-28 2022-08-23 Intercept Pharmaceuticals, Inc. Medicine obtained by combining FXR agonist and ARB
WO2022229302A1 (en) 2021-04-28 2022-11-03 Enyo Pharma Strong potentiation of tlr3 agonists effects using fxr agonists as a combined treatment
US11524005B2 (en) 2019-02-19 2022-12-13 Gilead Sciences, Inc. Solid forms of FXR agonists
US11833150B2 (en) 2017-03-28 2023-12-05 Gilead Sciences, Inc. Methods of treating liver disease
US12145959B2 (en) 2011-10-28 2024-11-19 Shire Human Genetic Therapies, Inc. Bile acid recycling inhibitors for treatment of hypercholemia and cholestatic liver disease

Families Citing this family (51)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DK2040713T3 (en) 2006-06-27 2014-09-29 Intercept Pharmaceuticals Inc BILIC ACID DERIVATIVES AS FXR LIGANDS FOR THE PREVENTION OR TREATMENT OF FXR-MEDIATED DISEASES OR CONDITIONS
US9719068B2 (en) 2010-05-06 2017-08-01 Children's Hospital Medical Center Methods and systems for converting precursor cells into intestinal tissues through directed differentiation
EP2525223A1 (en) * 2011-05-19 2012-11-21 Universiteit Maastricht In vitro method for predicting in vivo genotoxicity of chemical compounds.
US11154559B2 (en) 2011-09-29 2021-10-26 Ethicon Endo-Surgery, Inc. Methods and compositions of bile acids
DK2997035T3 (en) * 2013-05-14 2018-07-02 Intercept Pharmaceuticals Inc 11-HYDROXY-6-SUBSTITUTED BALIC ACID DERIVATIVES AND AMINO ACID CONJUGATES THEREOF AS FARNESOID X RECEPTOR MODULATORS
WO2015017813A2 (en) * 2013-08-01 2015-02-05 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Inhibitors of the farnesoid x receptor and uses in medicine
MX356006B (en) * 2013-10-18 2018-04-24 Centro De Investig Y Asistencia En Tecnologia Y Diseno Del Estado De Jalisco A C Process for obtaining a molecule serving as an antimicrobial peptide elicitor.
KR102507624B1 (en) 2013-11-22 2023-03-09 미나 테라퓨틱스 리미티드 C/ebp alpha short activating rna compositions and methods of use
SG10201801654RA (en) 2014-05-28 2018-04-27 Childrens Hospital Med Ct Methods and systems for converting precursor cells into gastric tissues through directed differentiation
MX2017003933A (en) 2014-09-24 2017-06-30 Gilead Sciences Inc Methods of treating liver disease.
WO2016045480A1 (en) * 2014-09-28 2016-03-31 上海源力生物技术有限公司 Method for preparing obeticholic acid
AU2015331848B2 (en) 2014-10-17 2022-03-03 Children's Hospital Medical Center, D/B/A Cincinnati Children's Hospital Medical Center In vivo model of human small intestine using pluripotent stem cells and methods of making and using same
BR112017009657A2 (en) 2014-11-06 2018-01-23 Enanta Pharmaceuticals, Inc bile acid analogues as fxr / tgr5 agonists and methods of using them
US10208081B2 (en) 2014-11-26 2019-02-19 Enanta Pharmaceuticals, Inc. Bile acid derivatives as FXR/TGR5 agonists and methods of use thereof
CA2968404A1 (en) 2014-11-26 2016-06-02 Enanta Pharmaceuticals, Inc. Bile acid analogs as fxr/tgr5 agonists and methods of use thereof
WO2016086115A1 (en) * 2014-11-26 2016-06-02 Enanta Pharmaceuticals, Inc. Tetrazole derivatives of bile acids as fxr/tgr5 agonists and methods of use thereof
AR103624A1 (en) 2015-02-06 2017-05-24 Intercept Pharmaceuticals Inc PHARMACEUTICAL COMPOSITIONS FOR COMBINATION THERAPY
RU2017130466A (en) 2015-02-11 2019-03-12 Энанта Фармасьютикалс, Инк. BILIC ACID ANALOGUES AS FXR / TGR5 AGONISTS AND WAYS OF THEIR APPLICATION
SI3277286T1 (en) 2015-03-31 2021-09-30 Enanta Pharmaceuticals, Inc. Bile acid derivatives as fxr/tgr5 agonists and methods of use thereof
CA2981507A1 (en) 2015-04-07 2016-10-13 Intercept Pharmaceuticals, Inc. Pharmaceutical compositions for combination therapy
CN108348530B (en) * 2015-10-07 2023-09-29 英特塞普特医药品公司 Farnesoid X receptor modulator
IL243707A0 (en) 2016-01-20 2016-05-01 Galmed Res And Dev Ltd Treatment for modulating gut microbiota
US20200262865A1 (en) * 2016-02-15 2020-08-20 Alexander Khoruts Compositions and methods for treating clostridium associated diseases
US20170233431A1 (en) * 2016-02-17 2017-08-17 City Of Hope Bile acid derivatives and methods for synthesis and use
US10364267B2 (en) 2016-02-23 2019-07-30 Enanta Pharmaceuticals, Inc. Deuterated bile acid derivatives as FXR/TGR5 agonists and methods of use thereof
WO2017147137A1 (en) 2016-02-23 2017-08-31 Enanta Pharmaceuticals, Inc. Benzoic acid derivatives of bile acid as fxr/tgr5 agonists and methods of use thereof
US10323061B2 (en) 2016-02-23 2019-06-18 Enanta Pharmaceuticals, Inc. Heteroaryl containing bile acid analogs as FXR/TGR5 agonists and methods of use thereof
CN109071452A (en) * 2016-04-13 2018-12-21 英特塞普特医药品公司 The method for the treatment of cancer
CN109415685B (en) 2016-05-05 2023-07-04 儿童医院医疗中心 Method for producing gastric fundus tissue in vitro and compositions related thereto
EP3534976A4 (en) 2016-11-04 2020-09-16 Children's Hospital Medical Center LIVER ORGANOID DISEASE MODELS AND METHODS OF MANUFACTURING AND USING THEREOF
US11197870B2 (en) 2016-11-10 2021-12-14 Galmed Research And Development Ltd Treatment for hepatic fibrosis
US10584145B2 (en) 2016-11-29 2020-03-10 Enanta Pharmaceuticals, Inc. Process for preparation of sulfonylurea bile acid derivatives
CA3045145A1 (en) 2016-12-05 2018-06-14 Children's Hospital Medical Center Colonic organoids and methods of making and using same
WO2018152171A1 (en) 2017-02-14 2018-08-23 Enanta Pharmaceuticals, Inc. Bile acid derivatives as fxr agonists and methods of use thereof
US20180256600A1 (en) * 2017-03-07 2018-09-13 Intercept Pharmaceuticals, Inc. Methods of treating cancer
TW201832768A (en) * 2017-03-07 2018-09-16 英特賽普醫藥品公司 Methods Of Treating Cancer
ES2971092T3 (en) 2017-04-07 2024-06-03 Enanta Pharm Inc Procedure for the preparation of sulfonyl carbamate bile acid derivatives
WO2018191673A1 (en) 2017-04-14 2018-10-18 Children's Hospital Medical Center Multi donor stem cell compositions and methods of making same
CA3070837A1 (en) 2017-07-24 2019-01-31 Intercept Pharmaceuticals, Inc. Isotopically labeled bile acid derivatives
EP4183882A1 (en) 2017-09-08 2023-05-24 MiNA Therapeutics Limited Stabilized hnf4a sarna compositions and methods of use
JP2020536529A (en) 2017-10-10 2020-12-17 チルドレンズ ホスピタル メディカル センター Esophageal tissue and / or organ composition and how to make it
WO2019126626A1 (en) 2017-12-21 2019-06-27 Children's Hospital Medical Center Digitalized human organoids and methods of using same
EP3826652B1 (en) 2018-07-26 2026-02-25 Children's Hospital Medical Center Hepato-biliary-pancreatic tissues and methods of making same
US11208571B2 (en) 2018-08-08 2021-12-28 University Of Maryland, College Park Methods for nondestructive dispersing of carbon nanomaterials in water
EP3849568A4 (en) 2018-09-12 2022-06-15 Children's Hospital Medical Center ORGANOID COMPOSITIONS FOR THE PRODUCTION OF HEMATOPOIETIC STEM CELLS AND DERIVATIVES THEREOF
WO2020163201A1 (en) * 2019-02-04 2020-08-13 Intercept Pharmaceuticals, Inc. Treatment and prevention of intestinal inflammatory diseases with a bile acid derivative
EA202193334A1 (en) 2019-05-30 2022-03-14 Интерсепт Фармасьютикалз, Инк. PHARMACEUTICAL COMPOSITIONS CONTAINING FXR AGONIST AND FIBRATE FOR USE IN THE TREATMENT OF CHOLESTATIC LIVER DISEASE
AU2020283048A1 (en) 2019-05-31 2021-12-23 Children's Hospital Medical Center Shaped organoid compositions and methods of making same
EP3976066A4 (en) 2019-05-31 2023-06-28 Children's Hospital Medical Center Methods of generating and expanding hematopoietic stem cells
CN112142814B (en) * 2019-06-26 2021-09-28 江苏吉贝尔药业股份有限公司 Tauroursodeoxycholic acid derivative, and pharmaceutical composition and preparation comprising same
CN119950519B (en) * 2025-01-07 2025-11-21 山东省海洋科学研究院(青岛国家海洋科学研究中心) Application of obeticholic acid in the prevention and treatment of acute hepatopancreatic necrosis in shrimp

Family Cites Families (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5014206A (en) * 1988-08-22 1991-05-07 Facilitech International Incorporated Tracking system
DE9011787U1 (en) * 1990-08-14 1990-10-25 Fritz Schäfer GmbH, 5908 Neunkirchen Identification unit for waste containers
US5121853A (en) * 1991-07-30 1992-06-16 Waste Management Of North America Garbage container
DE9204254U1 (en) * 1992-03-28 1992-06-17 Fritz Schäfer GmbH, 5908 Neunkirchen Garbage containers, especially large-capacity garbage containers, with an identification unit
ZA947912B (en) 1993-10-12 1995-05-24 Broadbent J W Nominees Pty Ltd Treatment of medical disorders associated with free radical formation
US5541348A (en) 1994-03-10 1996-07-30 National Research Council Of Canada Bile acids for biological and chemical applications and processes for the production thereof
US5565846A (en) * 1994-04-25 1996-10-15 Indala Corporation Reader system for waste bin pickup vehicles
FR2784364B1 (en) * 1998-10-13 2000-12-15 Plastic Omnium Cie BIN FOR THE COLLECTION OF WASTE, EQUIPPED WITH A TRANSPONDER
JP2002532729A (en) 1998-12-23 2002-10-02 グラクソ グループ リミテッド Assay for nuclear receptor ligands
WO2003030120A1 (en) * 1999-12-16 2003-04-10 Cardinal Automation, Inc. System for auditing refuse collection
DE10030905C2 (en) * 2000-06-24 2003-08-07 Der Gruene Punkt Duales Syst Use of transponders in the documentation and handling of waste
EP1392714B1 (en) * 2001-03-12 2005-08-31 Intercept Pharmaceuticals, Inc. Steroids as agonists for fxr
US7078396B2 (en) * 2001-05-03 2006-07-18 Arch Development Corporation Method of treating disorder related to high cholesterol concentration
JP5384777B2 (en) 2001-12-18 2014-01-08 有限会社大長企画 Strong muscle agent, anti-inflammatory agent
US6975229B2 (en) 2002-08-09 2005-12-13 Battelle Memorial Institute K1-53 System and method for acquisition management of subject position information
US20040229453A1 (en) * 2003-05-15 2004-11-18 Jsr Micro, Inc. Methods of pore sealing and metal encapsulation in porous low k interconnect
EP1568706A1 (en) 2004-02-26 2005-08-31 Intercept Pharmaceuticals, Inc. Novel steroid agonist for FXR
DK2040713T3 (en) 2006-06-27 2014-09-29 Intercept Pharmaceuticals Inc BILIC ACID DERIVATIVES AS FXR LIGANDS FOR THE PREVENTION OR TREATMENT OF FXR-MEDIATED DISEASES OR CONDITIONS

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of EP2040713A4 *

Cited By (96)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8058267B2 (en) 2001-03-12 2011-11-15 Intercept Pharmaceuticals, Inc. Steroids as agonists for FXR
US8969330B2 (en) 2001-03-12 2015-03-03 Intercept Pharmaceuticals, Inc. Steroids as agonists for FXR
USRE48286E1 (en) 2001-03-12 2020-10-27 Intercept Pharmaceuticals, Inc. Steroids as agonists for FXR
US8377916B2 (en) 2001-03-12 2013-02-19 Intercept Pharmaceuticals, Inc. Steroids as agonists for FXR
US9732117B2 (en) 2001-03-12 2017-08-15 Intercept Pharmaceuticals, Inc. Steroids as agonists for FXR
US10421772B2 (en) 2001-03-12 2019-09-24 Intercept Pharmaceuticals, Inc. Steroids as agonists for FXR
US9498484B2 (en) 2004-03-12 2016-11-22 Intercept Pharmaceuticals, Inc. Treatment of fibrosis using FXR ligands
US10987362B2 (en) 2004-03-12 2021-04-27 Intercept Pharmaceuticals, Inc. Treatment of fibrosis using FXR ligands
US10258633B2 (en) 2004-03-12 2019-04-16 Intercept Pharmaceuticals, Inc. Treatment of fibrosis using FXR ligands
US7994352B2 (en) 2005-05-19 2011-08-09 Intercept Pharmaceuticals, Inc. Process for preparing 3a(β)-7a(β)-dihydroxy-6a(β)-alkyl-5β-cholanic acid
US9243027B2 (en) 2007-01-19 2016-01-26 Intercept Pharmaceuticals, Inc. TGR5 modulators and methods of use thereof
US8410083B2 (en) 2007-01-19 2013-04-02 Intercept Pharmaceuticals, Inc. 23-substituted bile acids as TGR5 modulators and methods of use thereof
WO2009021740A2 (en) 2007-08-15 2009-02-19 Sanofis-Aventis Substituted tetrahydronaphthalenes, process for the preparation thereof and the use thereof as medicaments
US9540414B2 (en) 2008-07-30 2017-01-10 Intercept Pharmaceuticals, Inc. TGR5 modulators and methods of use thereof
CN102164940B (en) * 2008-07-30 2015-08-19 英特塞普特医药品公司 TGR5 modulators and methods of use thereof
US8796249B2 (en) 2008-07-30 2014-08-05 Intercept Pharmaceuticals, Inc. TGR5 modulators and methods of use thereof
EA020310B1 (en) * 2008-07-30 2014-10-30 Интерсепт Фармасьютикалз, Инк. Tgr5 modulators and use thereof
CN102164940A (en) * 2008-07-30 2011-08-24 英特塞普特医药品公司 TGR5 modulators and methods of use thereof
WO2010014836A3 (en) * 2008-07-30 2010-04-01 Intercept Pharmaceuticals, Inc. Tgr5 modulators and methods of use thereof
US8445472B2 (en) 2008-11-19 2013-05-21 Intercept Pharmaceuticals, Inc. TGR5 modulators and methods of use thereof
US8114862B2 (en) 2008-11-19 2012-02-14 Intercept Pharmaceuticals, Inc. TGR5 modulators and methods of use thereof
US9650409B2 (en) 2008-11-19 2017-05-16 Intercept Pharmaceuticals, Inc. TGR5 modulators and methods of use thereof
GB2465677B (en) * 2008-11-26 2012-09-26 Satiogen Pharmaceuticals Inc Non-systemic delivery of satiogens for use in the treatment of obesity and/or diabetes
US9345715B2 (en) 2008-11-26 2016-05-24 Satiogen Pharmaceuticals, Inc. Methods of treating diabetes or obesity using bile acids, bile salts, and mimics thereof
US10028952B2 (en) 2008-11-26 2018-07-24 Satiogen Pharmaceuticals, Inc Methods of treating diabetes or obesity using bile acids, bile salts, and mimics thereof
US10555950B2 (en) 2008-11-26 2020-02-11 Satiogen Pharmaceuticals, Inc. Bile acid recycling inhibitors for treatment of obesity and diabetes
US8318663B2 (en) 2008-11-26 2012-11-27 Satiogen Pharmaceuticals, Inc. Methods of treating diabetes and/or obesity using an enteroendocrine peptide secretion enhancing agent
WO2010069604A1 (en) 2008-12-19 2010-06-24 Royal College Of Surgeons In Ireland Treatment of diarrhoea
WO2011107494A1 (en) 2010-03-03 2011-09-09 Sanofi Novel aromatic glycoside derivatives, medicaments containing said compounds, and the use thereof
US11260053B2 (en) 2010-05-26 2022-03-01 Satiogen Pharmaceuticals, Inc. Bile acid recycling inhibitors and satiogens for treatment of diabetes, obesity, and inflammatory gastrointestinal conditions
US10188646B2 (en) 2010-05-26 2019-01-29 Satiogen Pharmaceuticals, Inc. Bile acid recycling inhibitors and satiogens for treatment of diabetes, obesity, and inflammatory gastrointestinal conditions
US10251880B2 (en) 2010-05-26 2019-04-09 Satiogen Pharmaceuticals, Inc. Bile acid recycling inhibitors and satiogens for treatment of diabetes, obesity, and inflammatory gastrointestinal conditions
ITRM20100329A1 (en) * 2010-06-15 2011-12-16 Franco Baldelli MODULATION OF THE NUCLEAR RECEPTOR FOR PHARNESOIDS (FXR) WITH MOLECULES AGONIST FOR THE PREVENTION AND TREATMENT OF ATTEROSCLEROTIC PHENOMENA INDUCED BY ADMINISTRATION OF PROTEASIS INHIBITORS
WO2011157827A1 (en) 2010-06-18 2011-12-22 Sanofi Azolopyridin-3-one derivatives as inhibitors of lipases and phospholipases
US10220027B2 (en) 2011-07-13 2019-03-05 Gilead Sciences, Inc. FXR (NR1H4) binding and activity modulating compounds
US10485795B2 (en) 2011-07-13 2019-11-26 Gilead Sciences, Inc. FXR (NR1H4) binding and activity modulating compounds
US12145959B2 (en) 2011-10-28 2024-11-19 Shire Human Genetic Therapies, Inc. Bile acid recycling inhibitors for treatment of hypercholemia and cholestatic liver disease
US10512657B2 (en) 2011-10-28 2019-12-24 Lumena Pharmaceutials Llc Bile acid recycling inhibitors for treatment of pediatric cholestatic liver diseases
US12350267B2 (en) 2011-10-28 2025-07-08 Shire Human Genetic Therapies, Inc. Bile acid recycling inhibitors for treatment of pediatric cholestatic liver diseases
US11229661B2 (en) 2011-10-28 2022-01-25 Shire Human Genetic Therapies, Inc. Bile acid recycling inhibitors for treatment of pediatric cholestatic liver diseases
US11376251B2 (en) 2011-10-28 2022-07-05 Shire Human Genetic Therapies, Inc. Bile acid recycling inhibitors for treatment of pediatric cholestatic liver diseases
US10155787B2 (en) 2012-06-19 2018-12-18 Intercept Pharmaceuticals, Inc. Preparation and uses of obeticholic acid
US10174073B2 (en) 2012-06-19 2019-01-08 Intercept Pharmaceuticals, Inc. Preparation and uses of obeticholic acid
US9238673B2 (en) 2012-06-19 2016-01-19 Intercept Pharmaceuticals, Inc. Preparation and uses of obeticholic acid
US9732116B2 (en) 2012-06-19 2017-08-15 Intercept Pharmaceuticals, Inc. Preparation and uses of obeticholic acid
US9982008B2 (en) 2012-06-19 2018-05-29 Intercept Pharmaceuticals, Inc. Preparation and uses of obeticholic acid
US10047117B2 (en) 2012-06-19 2018-08-14 Intercept Pharmaceuticals, Inc. Preparation and uses of obeticholic acid
EP2912013A4 (en) * 2012-10-26 2016-06-01 Intercept Pharmaceuticals Inc PROCESS FOR THE PREPARATION OF BILARY ACID DERIVATIVES
RU2693382C2 (en) * 2012-11-28 2019-07-02 Интерсепт Фармасьютикалз, Инк. Respiratory system diseases treatment
WO2014085474A1 (en) * 2012-11-28 2014-06-05 Intercept Pharmaceuticals, Inc. Treatment of pulmonary disease
CN104853758A (en) * 2012-11-28 2015-08-19 英特赛普特医药品公司 Treatment of pulmonary disease
AU2013352288B2 (en) * 2012-11-28 2017-11-23 Intercept Pharmaceuticals, Inc. Treatment of pulmonary disease
TWI636786B (en) * 2012-11-28 2018-10-01 美商英特塞普製藥公司 Treatment of pulmonary disease
WO2014200349A1 (en) 2013-06-13 2014-12-18 Fast Forward Pharmaceutical B.V. Cd40 signalling inhibitor and a further compound, wherein the further compound is a bile acid, a bile acid derivative, an tgr5-receptor agonist, an fxr agonist or a combination thereof, for the treatment of chronic inflammation, and the prevention of gastrointestinal cancer or fibrosis.
CN105764569B (en) * 2013-09-11 2019-09-13 国家医疗保健研究所 Methods and pharmaceutical compositions for treating hepatitis B virus infection
EP3711762A1 (en) 2013-09-11 2020-09-23 INSERM (Institut National de la Santé et de la Recherche Médicale) A farnesoid x receptor agonsits foruse and pharmaceutical compositions for the treatment of chronic hepatitis b virus infection
EA031003B1 (en) * 2013-09-11 2018-10-31 Инсерм (Энститю Насьональ Де Ля Сантэ Э Де Ля Решерш Медикаль) Methods and pharmaceutical compositions for the treatment of hepatitis b virus infections
WO2015036442A1 (en) * 2013-09-11 2015-03-19 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and pharmaceutical compositions for the treatment of hepatitis b virus infection
US10071108B2 (en) 2013-09-11 2018-09-11 Inserm (Institut National De La Sante Et De La Recherche Medicale) Methods and pharmaceutical compositions for the treatment of hepatitis b virus infection
CN105764569A (en) * 2013-09-11 2016-07-13 国家医疗保健研究所 Method and pharmaceutical composition for treating hepatitis B virus infection
US9895380B2 (en) 2013-09-11 2018-02-20 Inserm (Institut National De La Sante Et De La Recherche Medicale) Methods and pharmaceutical compositions for the treatment of hepatitis B virus infection
EP3626725A1 (en) 2014-05-29 2020-03-25 Bar Pharmaceuticals S.r.l. Cholane derivatives for use in the treatment and/or prevention of fxr and tgr5/gpbar1 mediated diseases
US10301350B2 (en) 2014-11-19 2019-05-28 NZP UK Limited 6-alkyl-7-hydroxy-4-en-3-one steroids as intermediates for the production of steroidal FXR modulators
US10131688B2 (en) 2014-11-19 2018-11-20 NZP UK Limited 5.beta.-6-alkyl-7-hydroxy-3-one steroids as intermediates for the production of steroidal FXR modulators
US10538550B2 (en) 2014-11-19 2020-01-21 NZP UK Limited 6.alpha.-alkyl-3,7-dione steroids as intermediates for the production of steroidal FXR modulators
US10597423B2 (en) 2014-11-19 2020-03-24 NZP UK Limited 6.alpha.-alkyl-6,7-dione steroids as intermediates for the production of steroidal FXR modulators
WO2016173493A1 (en) * 2015-04-28 2016-11-03 Shanghai De Novo Pharmatech Co. Ltd. Sulfonylaminocarbonyl derivative, pharmaceutical composition and uses thereof
EP3124080A1 (en) 2015-07-28 2017-02-01 Merz Pharma GmbH & Co. KGaA Semisynthetic bile acids for injection lipolysis
US10548906B2 (en) 2015-09-21 2020-02-04 Intercept Pharmaceuticals, Inc. Methods of promoting hepatic regeneration
WO2017053428A1 (en) 2015-09-21 2017-03-30 Intercept Pharmaceuticals, Inc. Methods of promoting hepatic regeneration
EP3352768A4 (en) * 2015-09-21 2019-04-24 Intercept Pharmaceuticals, Inc. METHODS FOR PROMOTING HEPATIC REGENERATION
US11072631B2 (en) 2015-09-24 2021-07-27 Intercept Pharmaceuticals, Inc. Methods and intermediates for the preparation bile acid derivatives
US11419878B2 (en) 2016-03-28 2022-08-23 Intercept Pharmaceuticals, Inc. Medicine obtained by combining FXR agonist and ARB
US10766921B2 (en) 2016-05-18 2020-09-08 NZP UK Limited Process and intermediates for the 6,7-alpha-epoxidation of steroid 4,6-dienes
US10968250B2 (en) 2016-05-18 2021-04-06 NZP UK Limited Intermediates for the synthesis of bile acid derivatives, in particular of obeticholic acid
WO2017199033A1 (en) 2016-05-18 2017-11-23 NZP UK Limited Intermediates for the synthesis of bile acid derivatives, in particular of obeticholic acid
US11479577B2 (en) 2016-05-18 2022-10-25 NZP UK Limited Intermediates for the synthesis of bile acid derivatives, in particular of obeticholic acid
EP3848382A1 (en) 2016-05-18 2021-07-14 NZP UK Limited Intermediates for the synthesis of bile acid derivatives, in particular of obeticholic acid
US10421730B2 (en) 2016-06-13 2019-09-24 Gilead Sciences, Inc. FXR (NR1H4) modulating compounds
US11739065B2 (en) 2016-06-13 2023-08-29 Gilead Sciences, Inc. FXR (NR1H4) modulating compounds
US12358903B2 (en) 2016-06-13 2025-07-15 Gilead Sciences, Inc. FXR (NR1H4) modulating compounds
US11247986B2 (en) 2016-06-13 2022-02-15 Gilead Sciences, Inc. FXR (NR1H4) modulating compounds
US10774054B2 (en) 2016-06-13 2020-09-15 Gilead Sciences, Inc. FXR (NR1H4) modulating compounds
US10981881B2 (en) 2016-06-13 2021-04-20 Gilead Sciences, Inc. FXR (NR1H4) modulating compounds
US10329286B2 (en) 2016-06-13 2019-06-25 Gilead Sciences, Inc. FXR (NR1H4) modulating compounds
EP3518937A4 (en) * 2016-09-30 2020-04-29 Intercept Pharmaceuticals, Inc. Crystalline forms of a bile acid derivative
US11833150B2 (en) 2017-03-28 2023-12-05 Gilead Sciences, Inc. Methods of treating liver disease
WO2018178260A1 (en) 2017-03-30 2018-10-04 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and pharmaceutical compositions for reducing persistence and expression of episomal viruses
WO2020025942A1 (en) 2018-07-30 2020-02-06 NZP UK Limited Fluorinated bile acid derivatives
US11225473B2 (en) 2019-01-15 2022-01-18 Gilead Sciences, Inc. FXR (NR1H4) modulating compounds
US11524005B2 (en) 2019-02-19 2022-12-13 Gilead Sciences, Inc. Solid forms of FXR agonists
US12102625B2 (en) 2019-02-19 2024-10-01 Gilead Sciences, Inc. Solid forms of FXR agonists
WO2021009332A1 (en) 2019-07-18 2021-01-21 Enyo Pharma Method for decreasing adverse-effects of interferon
WO2021144330A1 (en) 2020-01-15 2021-07-22 INSERM (Institut National de la Santé et de la Recherche Médicale) Use of fxr agonists for treating an infection by hepatitis d virus
WO2022152770A1 (en) 2021-01-14 2022-07-21 Enyo Pharma Synergistic effect of a fxr agonist and ifn for the treatment of hbv infection
WO2022229302A1 (en) 2021-04-28 2022-11-03 Enyo Pharma Strong potentiation of tlr3 agonists effects using fxr agonists as a combined treatment

Also Published As

Publication number Publication date
AU2007265457B2 (en) 2012-06-14
EP2040713A2 (en) 2009-04-01
IL196169A (en) 2012-10-31
US20080182832A1 (en) 2008-07-31
IL221764A (en) 2016-09-29
US9763964B2 (en) 2017-09-19
US20140057886A1 (en) 2014-02-27
IL196169A0 (en) 2009-09-22
CA2656320C (en) 2015-04-28
CN101522703A (en) 2009-09-02
IL221764A0 (en) 2012-10-31
US7932244B2 (en) 2011-04-26
US9090652B2 (en) 2015-07-28
US20120283234A1 (en) 2012-11-08
DK2040713T3 (en) 2014-09-29
JP2010500285A (en) 2010-01-07
PT2040713E (en) 2014-10-13
AU2007265457A1 (en) 2008-01-03
JP5222846B2 (en) 2013-06-26
SI2040713T1 (en) 2014-11-28
HK1130187A1 (en) 2009-12-24
EP2040713A4 (en) 2012-08-29
ES2523591T3 (en) 2014-11-27
CA2656320A1 (en) 2008-01-03
US8546365B2 (en) 2013-10-01
CY1115533T1 (en) 2017-01-04
AU2007265457C1 (en) 2012-11-29
WO2008002573A3 (en) 2008-02-28
PL2040713T3 (en) 2014-11-28
US20150359805A1 (en) 2015-12-17
CN101522703B (en) 2013-04-17
EP2040713B1 (en) 2014-06-18

Similar Documents

Publication Publication Date Title
US9763964B2 (en) Bile acid derivatives as FXR ligands for the prevention or treatment of FXR-mediated diseases or conditions
US7858608B2 (en) Bile acid derivatives as FXR ligands for the prevention or treatment of FXR-mediated diseases or conditions
US7138390B2 (en) Steroids as agonists for FXR
EP3360882B1 (en) 11-hydroxyl-6-substituted-derivatives of bile acids and amino acid conjugates thereof as farnesoid x receptor modulators
JP7021080B2 (en) Farnesoid X Receptor Modulator
JP5535233B2 (en) TGR5 modulator and method of using the same
EP2373673B1 (en) Tgr5 modulators and methods of use thereof
PT1776377E (en) Novel steroid agonist for fxr
HK1130187B (en) Bile acid derivatives as fxr ligands for the prevention or treatment of fxr-mediated deseases or conditions

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 200780032111.9

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 07809913

Country of ref document: EP

Kind code of ref document: A2

ENP Entry into the national phase

Ref document number: 2656320

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 196169

Country of ref document: IL

WWE Wipo information: entry into national phase

Ref document number: 2009518230

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: 5290/KOLNP/2008

Country of ref document: IN

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2007265457

Country of ref document: AU

NENP Non-entry into the national phase

Ref country code: RU

WWE Wipo information: entry into national phase

Ref document number: 2007809913

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2007265457

Country of ref document: AU

Date of ref document: 20070627

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 221764

Country of ref document: IL