WO2007144781A2 - Diagnostic methods and kits utilizing antibodies for metalloproteases - Google Patents

Abstract

Disclosed are monoclonal antibodies and detection methods using these antibodies, diagnostic kits and detection kits comprising the antibodies, related fusion proteins, and immunogenic compositions comprising the fusion proteins. In particular, monoclonal antibodies directed to matrix metalloprotease-2 and/or matrix metalloprotease-9 (MMP-2 and MMP-9) are disclosed with regard to their use in the detection of cancers and other disorders, such as endometrial cancer or renal cancer.

Description

DIAGNOSTIC METHODS AND KITS UTILIZING ANTIBODIES FOR

METALLOPROTEASES

This invention relates to new monoclonal antibodies and to detection methods using these antibodies, as well as to diagnostic kits and detection kits comprising the antibodies. In particular the invention relates to monoclonal antibodies directed to matrix metalloprotease-2 and/or matrix metalloρrotease-9 (MMP-2 and MMP-9) , and their use in the detection of cancers and other disorders. In particular embodiments the cancer is endometrial cancer or renal cancer.

BACKGROUND

All references, including any patents or patent application, cited in this specification are hereby incorporated by reference to enable full understanding of the invention. Nevertheless, such references are not to be read as constituting an admission that any of these documents forms part of the common general knowledge in the art in any country. The discussion of the references states what their authors assert, and the applicants reserve the right to challenge the accuracy and pertinency of the cited documents.

For several forms of solid tumours, the processes of tumour detection, disease staging, grading of tumour aggressiveness and monitoring of treatment and recurrence have been greatly improved by the development of assays which detect and measure tumour-specific markers in specimens of patient tissues or body fluids, for example the use of prostate-specific antigen screening for prostate cancer and CA-125 antigen monitoring for ovarian cancer. Such assays could revolutionize the clinical approach to detection , staging and monitoring the effect of therapeutic intervention in human malignancies. Many of these tumour marker assays are based on immunological detection of the tumour marker protein. A number of solid tissue cancers are difficult to detect in the early stages of the disease. Cancer of the uterus (endometrial cancer) is one of these, and is most commonly detected only when the patient presents with post- or peri-menopausal uterine bleeding; this is generally after the cancer has already reached an advanced stage. In general the stage of endometrial cancer, the degree of invasion into the myometrium, the histological grade and type of tumour, and the degree of invasion of the lymph-vascular space have some predictive value as to the aggressiveness of the disease. However, none of these factors is an accurate predictor, and they all depend on subjective assessment. For example the type and grade of tumour are determined by histological examination, and it has been reported that assessment of these may result in a disagreement figure of up to 85% between individual different pathologists. Baak, J. P.A., "Manual of Quantitative Pathology in Cancer Diagnosis and Prognosis," 1991. Thus currently there is no means of predicting the prognosis for an individual patient.

It is becoming clear that the accurate prediction of the course of endometrial cancer, and the probability of survival following various types of treatment, also depend on the intrinsic properties of the malignant cells and their interaction with the host. See Baak, 1991. A major objective of research in this field, therefore, is to discover the biological properties that determine the tumour's invasive and metastatic potential.

Similarly renal cell carcinoma is usually asymptomatic until a relatively advanced state is reached. Consequently a large proportion of new patients already have metastatic disease when they are initially diagnosed. In recent years the incidental discovery of asymptomatic renal cell carcinoma has significantly increased, because of the more widespread use of imaging techniques. A much higher percentage of incidentally-discovered renal cell carcinomas are localized and of low grade compared to symptomatic tumours. Provided that the tumour has not yet metastasized, renal cell carcinoma is usually completely curable by radical or partial nephrectomy. Primarily because of the increase in incidental discovery of these tumours, the 5-year survival rate has increased to above 50%, compared to much poorer survival rates in the 1970s and 1980s.

It is now generally accepted that tumour development is a multi-stage process, in which successive accumulation of genetic changes exacerbates the disease. It is also generally accepted that the probability of metastatic disease increases with time. Metastatic disease is usually incurable. For these and other reasons, the earlier the diagnosis and treatment, the greater the probability of a favourable outcome.

Diagnosis and staging of solid tumours such as cancer of the uterus, ovarian cancer or cervical cancer on the basis of histological assessment of biopsy or cytological material is prone to sampling error, because the relevant malignant tissue may be missed, or may be unrepresentative of the cancer as a whole. Moreover such assessment is subjective, and is very labour-intensive and hence costly. Consequently there is a real need for improved methods of diagnosis, and for ways to detect cancer at earlier stages.

It is also widely accepted that in many malignancies there is a high correlation between tumour aggressiveness and expression of proteases in the tumour tissue. In the last seven years, for example, convincing evidence has accumulated which directly implicates members of the matrix metalloproteinase (MMP) family and tissue inhibitors of metalloproteinases (TIMPs) in control of tumour invasion and metastasis, such as, for example in the review of Stetler-Stevenson, W. G. et al., published as Ann. Rev. Cell Biol., 1993 9 541-573, 1993. It has been suggested, for example by U.S. patent No. 5,324,634 to Zucker, that detection of MMPs in biological fluids, especially as complexes with TIMPs, can be used to detect metastatic cancer. These enzymes are also synthesised and secreted by normal cells during physiological tissue remodelling (menstruation) and invasion (embryo implantation). See Salamonsen, L.A. et al., J. Reprod. Fertil. Suppl., 1995 49 29-37, 1995; and see Salamonsen, L. A. et al., Human Reprod., 1996 11 Suppl. 2 124-133, 1996. MMPs may be present in tissues either in the fully active form, or in a latent form which requires activation before enzymic activity can be demonstrated.

Previous work by the Applicants has shown that detection of endometrial cancer by assessment of the levels of matrix metalloprotease-2 and metalloprotease-9 (MMP-2 and MMP-9, also known as gelatinases A and B, or type IV and V collagenases, or 72 kD and 92 kD collagenases respectively) in uterine washings has much greater sensitivity and specificity than histology of biopsy material. See, for example, international patent application No. PCT/AU98/381454, the entire contents of which are incorporated herein by this reference.

Current methods for detection of MMP-2 and MMP-9 generally rely on zymography, in which the sample is analysed by SDS-polyacrylamide gel electrophoresis in polyacrylamide which has been impregnated with gelatin, and the enzyme activity is revealed by a zone of clearing of the gelatin at the appropriate molecular weight. See Kleiner, et al., "Quantitative zymography: detection of picogram quantities of gelatinases," Anal. Biochem., 1994 218, 325-329, 1994; and see Snoek-van Beurden, P. A., et al., "Zymographic techniques for the analysis of matrix metalloproteinases and their inhibitors," Biotechniques, 2005 38, 73-83, 2005. Although this method is very sensitive and accurate, it is slow and cumbersome, and not well-suited to routine or large-scale use in diagnostic pathology laboratories. Nor is it suitable for the screening of at-risk populations. If the detection of MMP-2 and MMP-9 could be adapted to a simple colour reaction or immunoassay, such as an enzyme-linked immunosorbent assay ("ELISA"), the use of these enzymes for detection of uterine and other cancers cancer could be greatly simplified and reduced in cost and time, so that a routine test would be possible.

It would be desirable for such a test to use monoclonal antibodies to MMP-2 and MMP-9 respectively, because such reagents are pure, chemically defined and highly reproducible. Although some monoclonal antibodies to human MMP-2 and MMP-9 and ELISA kits for assay of these enzymes are commercially available, they are very expensive and of somewhat variable quality. For example, Calbiochem markets a number of different polyclonal and monoclonal antibodies against MMP-2 and MMP-9; anti-MMP-2 mouse monoclonal antibody (Ab-6) , Catalogue no. IM53, is raised against a synthetic peptide from the N-terminal of proMMP-2, and recognises the 72 kDa proenzyme. Similarly anti-MMP-2 mouse monoclonal antibody (Ab-3) , Catalogue no. IM33L, is raised against a synthetic peptide corresponding to amino acids 468-483 of MMP-2, and also recognises the 72 kDa proenzyme.

There is therefore a strong need for new monoclonal antibodies directed against the active and proenzyme forms of MMP-2 and MMP-9 for use in immunoassays and detection kits.

SUMMARY

In a first aspect the invention provides an antibody specific for a fibronectin Type II domain of MMP- 2, of MMP-9, or both. In one embodiment the antibody is raised against a fusion protein between the MMP fibronectin Type II domain and either MBP or GST. Preferably the fusion protein comprises the three fibronectin Type II domains of the MMP.

The antibody may be polyclonal or monoclonal. In one embodiment the antibody is a monoclonal antibody. Antibody fragments such as Fv, Fab, F(ab)₂, and ScFv are also within the scope of the invention. A preferred embodiment of the invention comprises a monoclonal antibody that is specific for fibronectin Type II domain of both MMP-2 and MMP-9.

In a second aspect the invention provides a hybridoma cell line which produces a monoclonal antibody specific for a fibronectin Type II domain of MMP-2 or MMP- 9. In a third aspect the invention provides a recombinant fusion protein in which a MMP fibronectin Type II domain is linked to a second protein such as glutathione S-transferase from Schistosoma japonicum or maltose-binding protein from Escherichia coli. Expression of the fibronectin repeats fused to maltose-binding protein is particularly favorable because this system has been shown to have a high probability of generating correctly folded and water-soluble recombinant proteins as confirmed by the experiments of the Applicants. Use of alternative fusion systems such as those based on hexa- histidine tags has often been shown to require denaturing agents such as guanidine for solubilisation of inclusion bodies followed by refolding and further purification steps, increasing the complexity and possibly introducing artefacts such as contamination with unfolded or incorrectly folded or partly folded species. The Applicants have found that expression of the fibronectin repeats in two different fusion protein systems allowed immunization with one fusion system and screening on the other fusion system, which enabled rapid and unambiguous screening and a clear answer to the question of whether the resulting monoclonal antibodies were directed to the fusion partner (glutathione S-transferase or maltose- binding protein) or to the fibronectin repeats. In one embodiment the fusion protein comprises the three fibronectin Type II domains of the MMP. The preferred embodiment uses fusion to maltose-binding protein because the yield and solubility characteristics of this system are considerably better than with the glutathione S-transferase system.

In a fourth aspect the invention provides an immunogenic composition comprising the fusion protein according to the invention, and optionally also comprising an adjuvant. Suitable adjuvants, such as alum, Quil A and complete Freund' s adjuvant, are well known in the art.

In a fifth aspect the invention provides a composition comprising an antibody specific for a fibronectin Type II domain of MMP-2 or MMP-9, or both, and a carrier.

In a sixth aspect the invention provides a method of assay of MMP-2 and/or MMP-9, comprising the step of exposing a biological sample suspected to contain MMP-2 and/or MMP-9 to an antibody specific for a fibronectin Type II domain of MMP-2, of MMP-9, or both, under conditions suitable for formation of a complex between the MMP and an antibody specific for the MMP, and detecting the bound MMP.

In one embodiment the method further comprises the steps of

(a) applying an antibody-binding partner which binds to the complex, if present, in which the antibody-binding partner comprises a detectable marker; and

(b) determining if a signal is present, wherein the presence or absence of the signal is indicative of the presence of the MMP. The biological sample is preferably a biological fluid, such as plasma, serum, lymph, urine, uterine fluid, breast duct fluid, sputum or saliva.

In one embodiment, the invention provides a two- site capture/sandwich immunoassay for MMP-2 and MMP-9 using combinations of monoclonal antibodies which recognise both active and inactive forms of these enzymes, and also is expected to recognise MMPs whether or not they are bound to tissue inhibitors of metalloproteinases (TIPMs) . Optionally, this embodiment of the invention provides such an immunoassay that includes one or more monoclonal antibodies that each are specific for fibronectin Type II domain of both MMP-2 and MMP-9. Such assays are simple, reliable, rapid and inexpensive.

In a seventh aspect the invention provides a method of detection, prognosis, or monitoring of a condition associated with elevated levels of MMP-2 and/or MMP-9 using the assay method according to the invention. Such conditions include, but are not limited to, cancer including endometrial cancer, renal cancer, or breast cancer; conditions associated with tissue remodelling or destruction, including renal damage or airway damage; arthritic, osteolytic or dermatological conditions; cardiovascular or fibrotic conditions; stroke; transient ischaemic attack; and obstetric or gynaecological conditions, including fibroids, infertility, or early pregnancy risk. In particular embodiments, this aspect of the invention provides a) a method of detecting the presence of endometrial cancer in a subject at risk of, or suspected to be suffering from, endometrial cancer, comprising the steps of obtaining a sample of uterine fluid from the uterine cavity of the subject, and measuring the level of matrix metalloproteinase-2 (MMP-2) and/or matrix metalloρroteinase-9 (MMP-9) in the uterine fluid using an immunoassay according to the invention, wherein an elevated level of MMP-2 and/or MMP-9 in the fluid from the subject as compared to a control subject without cancer indicates that endometrial cancer may be present in the subject, thereby detecting the presence of endometrial cancer; b) a method of detection of recurrence of endometrial cancer in a patient who has undergone conservative treatment for primary endometrial cancer, comprising the steps of obtaining a sample of uterine fluid from the uterine cavity of the patient/ and measuring the level of MMP-2 and/or MMP-9 in the fluid, wherein an elevated level of MMP-2 and/or MMP-9 in the fluid from the patient as compared to a control indicates that endometrial cancer has recurred in the patient, thereby detecting the recurrence of endometrial cancer; c) a method of monitoring the efficacy of a putative treatment for endometrial cancer in a patient, comprising the steps of obtaining a sample of uterine fluid from the uterine cavity of the patient before and after the patient has received the putative treatment, measuring the levels or activity of MMP-2 and/or MMP-9 in the uterine fluid, wherein a lowered level of MMP-2 and/or MMP-9 in the sample taken after treatment relative to the sample taken before treatment indicates that the putative treatment is succeeding, thereby monitoring the efficacy of the putative treatment for endometrial cancer; and d) a method for assessing the prognosis of endometrial cancer, comprising the steps of measuring the level of MMP-2 and /or MMP-9 in uterine washings obtained prior to surgery in a patient undergoing surgery for endometrial cancer, obtaining a sample of endometrial cells from said patient, obtaining a sample of tumour and adjacent normal endometrium for histological examination, and correlating level of MMP-2 and /or MMP-9 and grade and type of tumour as an indicator of the prognosis.

If surgery to remove the uterus is not possible or is not desired for any reason, primary treatment of endometrial cancer may be conservative, using radiotherapy, chemotherapy, progesterone treatment, endometrial ablation (for example, using photodynamic therapy, or curettage, rather than hysterectomy) ; in some cases curettage is used in conjunction with other methods. For example, a young woman who is diagnosed with endometrial cancer may not wish to have a hysterectomy until she has a chance to have a child. Such women may be treated with high levels of progesterone. In patients undergoing such conservative treatment, follow-up and detection of any recurrence of the cancer is particularly important . Thus in another embodiment, this aspect of the invention provides a method of monitoring the efficacy of treatment of endometrial cancer, comprising the steps of obtaining a sample of uterine washings from a patient undergoing such treatment, and measuring the levels of MMP-2 and/or MMP-9 in the washings. This method is also applicable to monitoring efficacy of putative treatments.

In an eight aspect, the invention provides a method of detecting recurrence of endometrial cancer in a patient who has undergone conservative treatment for primary endometrial cancer, comprising the steps of obtaining a sample of uterine washings from the patient, and measuring the levels of MMPs in the washings.

The risk of endometrial cancer is significantly elevated in some populations of women, and the method of the invention is useful in monitoring these women in order to detect any appearance of cancer of this type at an early stage. In particular, hormone replacement therapy with oestrogen unopposed by progesterone and treatment with the oestrogen antagonist tamoxifen are regarded as having a strong association with endometrial cancer. The risk with tamoxifen is particularly high in postmenopausal women. A number of additional risk factors have been identified, and most appear to be related to estrogenic effects. Among these factors are obesity, high-fat diet, Type II diabetes, and reproductive factors such as nulliparity, polycystic ovary syndrome and other anovulatory conditions, early menarche, and late menopause. Furthermore, hereditary nonpolyposis colorectal cancer syndrome is associated with a markedly increased risk of endometrial cancer compared with women in the general population.

In other particular embodiments, the invention provides a) a method of 'detection, prognosis_/ or monitoring or treatment of cancer , comprising the steps of a) detecting a presence of an active metalloproteinase in a urine sample from the subject; and correlating the presence of the active metalloproteinase to the presence of cancer in the subject; and b) a method of detection, prognosis, or monitoring of treatment of a urological cancer in a subject, comprising the step of determining the level of active metalloproteinase in a urine sample from the subject, and comparing this to the mean amount of the metalloproteinase in urine of a normal population, an increase in the amount of active metalloproteinases in the subject's urine being an indication of increased probability of a urological cancer.

Other conditions in which the MMP detection system of the invention may be used include monitoring of early pregnancy in women at risk of recurrent abortion, or who have suffered repeated failure of embryo transfer in assisted reproduction programs. One of the inventors has found that levels of MMP-2 and MMP-9 are significantly 'elevated in women who have had repeated failure of embryo transfer Inagaki et al., "Analysis of intra-uterine cytokine concentration and matrix-metalloproteinase activity in women with recurrent failed embryo transfer," Human Reproduction, 2003 18 608-615, 2003.

Uterine fibroids are usually diagnosed by ultrasound examination in premenopausal women wishing to conceive, who present after failure to become pregnant despite attempting to do so. Assessment of levels of MMP- 2 and MMP-9 is useful in the initial evaluation of these patients. If fibroids are detected, they may be removed in order to treat the infertility.

Where uterine washings are used as the test sample, they may be obtained by using any suitable solution which is delivered to the uterine cavity and then recovered and collected for testing. Suitable solutions will be readily apparent to those skilled in the art and include any sterile non-toxic solution which will not interfere with measurement of MMPs. An example of a suitable solution is sterile saline. Any number of means for delivery and recovery of the washing solution may be utilised, by way of example a syringe and tube are conveniently used. The washing may be collected in the recovery means or transferred to another container.

Delivery, recovery and collection means will routinely be chosen to provide comfort and convenience to both the patient and clinician. Preferably the washings are collected as described in detail in co-owned earlier international patent application No. PCT/AU98/381454. A device which is advantageous for performing the washing procedure has been described in application No. PCT/AUOO/00962.

Detection of MMP-2 and MMP-9 has also been suggested to be useful in the detection or monitoring of . other cancers. For example, methods for the detection or monitoring of a urological cancer such as renal cell carcinoma, bladder cancer and prostate cancer by detection of MMP-2 and MMP-9 have been described. See U.S. Patent Application publication No. 2004/0029200 to Weimbs, and see Sherief et al., "Matrix metalloproteinase activity in urine of patients with renal cell carcinoma leads to degradation of extracellular matrix proteins: possible use as a screening assay," J. Urol., 2003 169 1530-4, 2003, in which MMP-2 and MMP-9 were detected by zymography, by analysis of breakdown of fibronectin, or by fluorescence assay of breakdown of Type IV collagen. U.S. Patent Application publication No. 2004/0029200 also suggests the use of immunoassays. U.S. Patent No. 6,642,010 describes detection of metalloproteases in breast duct fluid for diagnosis of breast cancer.

Levels of MMP-2 and MMP-9 are also implicated in other conditions especially those associated with tissue remodelling or destruction. For example, levels of these enzymes are significantly elevated in uterine washings from women in assisted reproduction programs who suffer from repeated failure of embryo implantation, compared to levels in control women; these increased enzyme levels are correlated with increased levels of interleukin-β. See Inagaki et al., 2003. Measurement of MMP-2 or MMP-9 has been used in the diagnosis of kidney damage, for example in diabetic patents as described in PCT application

WO 01/88544. Further, PCT application WO 03/01983 by Mount Sinai School of Medicine of New York University describes detection of MMP-2 in the diagnosis of a variety of arthritis, osteolytic and dermatological conditions. Also, PCT application WO 02/46462 by Isis Innovation

Limited describes detection of MMP-2 in the diagnosis of cardiovascular and fibrotic conditions. The PCT application WO 03/16910 by Biosite, Inc. discloses the detection of MMP-9 in diagnosis of stroke or transient ischaemic attack, while PCT application WO 03/20286 by

Arakis Ltd. describes the use of assays for MMP-9 in the diagnosis of airway diseases involving tissue destruction or remodelling such as asthma, chronic obstructive pulmonary disease, and cystic fibrosis. Although ELISA, including ELISA assays which utilize a capture antibody, are one preferred type of assay for the purposes of this invention, it will be clearly understood that the antibodies of the invention may be used in any other type of assay for MMP-2 and/or MMP-9 in which monoclonal antibodies may be employed, including but not limited to radioimmunoassays, chemiluminescence assays, scintillation proximity assays, iramunohistochemistry, immunoblotting, for example Western blotting, and immunofluorescence. It will also be clearly understood that the invention is applicable to immunoassay test strips containing antibody-coated beads, where a thin line develops as readout, and to other forms of solid- phase immunoassay. See, for example, U.S. Patents No. 4,889,816, No. 5,610,077 and No. 6,352,862 by Unilever Patent Holdings BV, and U.S. Patent No. 4837145 by Liotta. Other solid-phase assay methods are described in PCT application WO 99/23245 by Fuji Photo Film Co Ltd. A solid-phase capture assay using fluorescence resonance energy transfer for high sensitivity detection is described in Lauer-Fields, J. L. et al . , "Development of a Solid-Phase Assay for Analysis of Matrix Metalloproteinase Activity," J. of Biomolecular Techniques, 2004 15:305-316, 2004.

The assay of the invention is expected to detect both active and inactive forms of the enzyme, because it does not depend on the presence of absence of the propeptide.

The mammal may be a human, or may be a domestic, companion or zoo animal. While it is particularly contemplated that the antibodies and methods of the invention are suitable for use in diagnosis of conditions in humans, they are also applicable .to veterinary diagnosis, including diagnosis of conditions in companion animals such as dogs and cats, and domestic animals such as horses, cattle and sheep, or zoo animals such as non- human primates, felids, canids, bovids, and ungulates.

BRIEF DESCRIPTION OF THE FIGURES

Figure 1 is a schematic illustration of the modular structure of MMP-2 and MMP-9. Figure 2 is an illustration of the three- dimensional structure of MMP-2, showing the different domains of the enzyme.

Figure 3 shows the alignment of the fibronectin domains in the sequences of MMP-2 and MMP-9. Figure 4 is a photograph showing how native type

I collagen can be used to capture MMP-2 fibronectin repeats, which can then be detected by monoclonal antibodies .

DETAILED DESCRIPTION

MMPs are complex zinc-containing glycoproteins, and are secreted by a number of different cell types. They digest extracellular matrix proteins such as collagen and elastin, and have many important biological roles, including involvement in embryo implantation, tissue remodelling, menstruation and tumour cell invasion. See review by Nagase, H. et al._t "Matrix metalloproteinases, " J. Biol. Chem., 1999 274, 21491-21494, 1994; and see Woessner, J. F^". et al., "Matrix metalloproteinases and TIMPS," Oxford, Oxford University Press, 2000. There are currently 28 known members of the MMP family, all of which have closely related sequences, although individual family members have distinctive properties. See Sang, Q.A. et al., "Computational sequence analysis of matrix metalloproteinases," J. Protein Chem., 1996 15, 137-160, 1996. MMP-2 and MMP-9 are important in the degradation of basement membrane and denatured collagen (gelatin) . These enzymes have a modular structure, as illustrated in Figure 1. Also see Overall, CM., "Matrix metalloproteinase substrate binding domains, modules and exosites. In Matrix metalloproteinase protocols," I.M. Clarke, ed. (Totowa, New Jersey, Humana Press), pp. 79-120, 2001.

In view of their potent biological activities, the enzymic activity of the MMPs is tightly controlled at many different levels. In particular, the presence of a propeptide near the N-terminus inhibits catalytic activity and this must be removed by proteolysis, for example using collagenase or matrilysin, for the enzyme to be active. See Sang, Q. A. et al., "Activation of human progelatinase A by collagenase and matrilysin: activation of procollagenase by matrilysin," J. Protein Chem., 1996 15, 243-253, 1996; and see Morgunova, E. efc al., "Structure of human pro-matrix metalloproteinase-2 : activation mechanism revealed," Science, 1999 284, 1667-1670, 1999. The propeptide is also functionally inactivated by sodium dodecyl sulphate without proteolysis, allowing in-gel. zymograms to detect all forms of the enzyme, regardless of whether they were initially active or not. In addition, members of a family of Tissue Inhibitors of Metallo Proteinases (TIMPS) bind tightly to the active site of MMPs, also preventing activity (Nagase and Woessner, 1999; Woessner and Nagase, 2000) . While it is possible to produce monoclonal antibodies without using purified antigen, the availability of purified or greatly enriched antigen facilitates immunisation and screening. See Goding, J.W., Monoclonal Antibodies: Principles and Practice, 3 edn (London, Academic Press) 1996.

MMPS are expressed and secreted at very low levels by mammalian cells. Purification of MMP-2 and MMP- 9 from sources such as uterine washings is not feasible, because of their very low concentrations. Purification from cell lines which produce these enzymes is technically possible, but the yield of protein is generally very low and the purification procedures are slow and cumbersome. Therefore it is preferable to express the MMPs, or fragments thereof, in a host such as Escherichia coli, using recombinant technology. Methods for doing so are known in the art, and MMP-2 has been produced in this way. See Steffensen, B. efc al. , "Extracellular matrix binding properties of recombinant fibronectin type II-like modules of human 72-kDa gelatinase/type IV collagenase. High affinity binding to native type I collagen but not native type IV collagen," J. Biol. Chem. 1995; 270: 11555, 1995. MMP-2 has also been successfully expressed in an insect cell system using a baculovirus vector, in the form of a catalytically inactive mutant; this prevents autolytic digestion (Morgunova et al., 1999). Successful expression of MMP2 in an insect cell line (albeit a catalytically inactive mutant form of MMP2) suggests that it is likely to be possible to express MMP2 in a mammalian host cell line.

The three-dimensional structure of MMP-2 (Morgunova et al., 1999) is shown in Figure 2. This indicates the locations of the propeptide, the catalytic domain, the hemopexin/vitronectin domain which is responsible for binding to TIMPs, and the three fibronectin ("FN") type II domains. The FN type II domains, which are also known as FN type II repeats, are located within the catalytic domain, at amino acids 220-

393 for MMP-2 and amino acids 217-391 for MMP-9. These FN type II repeats are unique to MMP-2 and MMP-9, and are not present in any of the other members of the MMP family (Overall, 2001) . They are not glycosylated, and can be expressed as stable and correctly-folded proteins in E. coli (Steffensen et al., 1995) . These regions were selected to use as antigens for various aspects of the present invention, as hereafter described.

The FN repeats of MMP-2 and MMP-9 bind gelatin (denatured type I collagen) , and importantly, they retain this property when expressed in E. coli as an isolated cassette containing all three repeats, demonstrating that the native three-dimensional structure is preserved in this system (Steffensen et al., 1995). The fibronectin repeats are a particularly attractive part of the MMP molecule because:

1. They are not glycosylated,

2. They form a discrete, stable module,

3. Their ability to bind gelatin can be used to assess correct folding, and may also be used in an ELISA system,

4. They have already been expressed in E. coli as a recombinant protein, and

5. The fibronectin repeats are on the opposite side of the molecule to the active site and the propeptide, as shown in Figure 2, so there is a reasonable expectation that they would be accessible to antibodies regardless of whether the propeptide is present or absent, and also regardless of whether the enzyme is complexed to TIMPs or not.

6. The crystal structure of MMP-2 (See Morgunova et al., 1999) shows that the fibronectin repeats have the shape of a three-pronged fish hook (Figure 2), with each barb, i.e. each individual fibronectin repeat, being oriented about 90 degrees from the adjacent hook (repeat). Since the amino acid sequence of the three hooks are similar but not identical, the potential is presented to make monoclonal antibodies that are specific for each hook, and because of their orientation with respect to each other, these antibodies may be able to bind simultaneously. The experimental evidence provided in Table 2 shows that this is indeed the case.

These crystallographic data have also shown that the tissue inhibitors of matrix metalloproteases (TIMPs) bind to blades 3 and 4 of the hemopexin domain in a region well away from the fibronectin repeats. It is therefore likely that assays for MMPs based on monoclonal antibodies to the fibronectin repeats will detect MMPs even if the MMP is bound to TIMP.

Detection of the MMPs can be facilitated by coupling (i.e. physically linking) the antibody to a detectable substance. Examples of detectable substances include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, and radioactive materials. Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, β-galactosidase, or acetylcholinesterase; examples of suitable prosthetic group complexes include streptavidin/biotin and avidin/biotin; examples of suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin; an example of a luminescent material includes luminol; examples of bioluminescent materials include luciferase, luciferin, and aequorin, and examples of suitable radioactive material include ¹²⁵I, ³⁵S or ³H. Suitable coupling methods are very well known in the art.

Methods of preparation of antibody fragments,

5 such as Fab, F(ab)2, Fv and the like, are very well known in the art. Antibody genes or fragments thereof can be cloned and expressed in hosts such as E. coli in a biologically functional form. Antibodies and antibody fragments can also be produced by recombinant DNA

10 technology, using either bacterial or mammalian cells. Methods of manufacture of two-chain Fv fragments substantially free of constant region are disclosed in U.S. Pat. No. 4,642,334. Methods of manufacture of covalently-linked Fv fragments are disclosed in U.S. Pat.

15 No. 4,946,778 and U.S. Pat. No. 5,132,405. Further heterogeneity can be achieved by the production of bifunctional and multifunctional agents, such as described in U.S. Patents No. 5,091,513, No. 4,816,397, No. 5,869,620, No. 5,837,242 and No. 5,844,094. Also, PCT

20. application WO 92/01047 describes the display of scFv fragments on the surface of soluble recombinant genetic display packages, such as bacteriophage.

Affinity maturation is a process whereby the binding specificity, affinity or avidity of an antibody

25 can be modified. A number of laboratory techniques have been devised whereby amino acid sequence diversity is created by the application of various mutation strategies, either on the entire antibody fragment or on selected regions such as the CDRs. Mutation to change enzyme

30 specific activity has also been reported. The person skilled in the art will be aware of a variety of methods for achieving random or site-directed mutagenesis, and for selecting molecules with a desired modification. Mechanisms to increase diversity and to select specific

35 antibodies by the so called "chain shuffling" technique, i.e., the reassortment of a library of one chain type, such as heavy chain, with a fixed complementary chain, such as light chain, have also been described. See Kang et al., Proc. Natl. Acad. Sci. USA, 1991 88 4363-466, 1991; and see Hoogenboom et al., Nucl . Acid Res., 1991 19 4133-4137, 1991; and see Marks et al., Bio/Technology, 1992 10 779-783, 1992.

In the description of the invention and in the claims which follow, except where the context requires otherwise due to express language or necessary implication, the word "comprise" or variations such as "comprises" or "comprising" is used in an inclusive sense, i.e. to specify the presence of the stated features but not to preclude the presence or addition of further features in various embodiments of the invention.

As used herein, the singular forms "a", "an", and "the" include the corresponding plural reference unless the context clearly dictates otherwise. Thus, for example, a reference to "an enzyme" includes a plurality of such enzymes, and a reference to "an amino acid" is a reference to one or more amino acids. Where a range of values is expressed, it will be clearly understood that this range encompasses the upper and lower limits of the range, and all values in between these limits.

The term "metalloprotease" is to be understood to be synonymous with "metalloproteinase" .

MMP-2 is also known as gelatinase A, 72 kD gelatinase, type IV collagenase, or TBE-I. The active form of this enzyme has a molecular mass of 66 kD.

MMP-9 is also known as gelatinase B, type V collagenase or 92 kD collagenase.

The term "antibody" includes all classes and subclasses of intact immunoglobulins, and also encompasses antibody fragments. The term "antibody" specifically encompasses monoclonal antibodies, including antibody fragment clones.

"Antibody fragments" comprise a portion of an intact antibody which contains the antigen binding or variable region of the intact antibody. Examples of antibody fragments include Fab, Fab', F(ab')2, and Fv fragments; diabodies; single-chain antibody molecules, including single-chain Fv (scFv) molecules; and multispecific antibodies formed from antibody fragments.

The term "monoclonal antibody" as used herein refers to an antibody, or antibody fragment, obtained from a population of substantially homogeneous antibodies, ie the individual antibodies comprising the population are identical except for possible naturally-occurring mutations which may be present in minor amounts. Monoclonal antibodies are highly specific, being directed against a single antigenic site. Furthermore, in contrast to conventional polyclonal antibody preparations, which typically include different antibodies directed against different determinants (epitopes) , each monoclonal antibody is directed against a single determinant on the antigen. In addition to their specificity, monoclonal antibodies are advantageous in that they are synthesized by the hybridoma culture, and are not contaminated by other immunoglobulins. The modifier "monoclonal" indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies, and is not to be construed as reguiring production of the antibody by any particular method. For example, the monoclonal antibodies to be used in accordance with the present invention may be made by the hybridoma method first described by Kohler et al., Nature, 256: 495 (1975), or may be made by recombinant DNA methods (eg see U.S. Patent No. 4,816,567). The "monoclonal antibodies" also include clones of antibody fragments containing antigen- recognition and antigen-binding sites (Fv clones) isolated from phage antibody libraries, for example using the techniques described in Clackson et al., Nature, 352: 624- 628, 1991, and Marks et al., J. MoI. Biol., 222: 581-597, 1991.

"Single-chain Fv" or "scFv" antibody fragments comprise the V_H and V_L domains of antibody, in which these domains are present in a single polypeptide chain. Generally the scFv polypeptide further comprises a polypeptide linker between the V_H and V_L domains, which enables the scFv to form the desired structure for antigen binding. Reviews of scFv are provided by Pluckthun, "The Pharmacology of Monoclonal Antibodies," vol. 113, Rosenburg and Moore eds . , Springer-Verlag, New York, pp. 269-315, 1994, Dall'Acqua et al., Curr. Opin. Struct. Biol. 8: 443-450, 1998, and Hudson, Curr. Opin. Immunol. 11: 548-557, 1999.

The term "diabody" refers to small antibody fragments with two antigen-binding sites, in which the fragments comprise a heavy-chain variable domain (V_H) connected to a light- chain variable domain (V_L) in the same polypeptide chain (V₁₁-V₁,) . By using a linker which is too short to allow pairing between the two domains on the same chain, the domains are forced to pair with the complementary domains of another chain and create two antigen-binding sites. Diabodies are described more fully in European application EP 404,097, PCT applications WO 93/11161, WO 94/07921, and Holliger et al., Proc. Natl. Acad. Sci. USA, 90: 6444-6448, 1993.

An "isolated" antibody is one which has been identified and separated and/or recovered from a component of its natural environment. Contaminant components of its natural environment are materials which would interfere with diagnostic or therapeutic uses for the antibody, and may include enzymes, hormones, and other proteinaceous or non-proteinaceous solutes. In preferred embodiments, the antibody will be purified

(1) to greater than 95% by weight of antibody as determined by the Lowry method, and most preferably more than 99% by weight, (2) to a degree sufficient to obtain at least

15 residues of N-terminal or internal amino acid sequence by use of a spinning cup sequenator, or

(3) to homogeneity by SDS-PAGE under reducing or nonreducing conditions, as identified using Coomassie blue or, preferably, silver stain. Isolated antibody includes the antibody in situ within recombinant cells, since at least one component of the antibody's natural environment will not be present. Ordinarily, however, isolated antibody will be prepared by at least one purification step. The term "neutralizing antibody" means an antibody molecule which is able to eliminate or significantly reduce an effector function of a target antigen to which it binds.

Accordingly, a "neutralizing" MMP antibody is capable of eliminating or significantly reducing the gelatinase activity of MMP-2 or MMP-9.

"Significant" reduction means at least about 60%, or at least about 70%, preferably at least about 75%, more preferably at least about 80%, even more preferably at least about 85%, still more preferably at least about 90%, still more preferably at least about 95%, most preferably at least about 99% reduction of the gelatinase activity of MMP-2 or MMP-9. Preferably, the "neutralizing" antibodies as defined herein will be capable of neutralizing at least about 60%, or at least about 70%, preferably at least about 75%, more preferably at least about 80%, even more preferably at least about 85%, still more preferably at least about 90%, still more preferably at least about 95%, most preferably at least about 99% of the gelatinase activity of MMP-2 or MMP-9. In a particularly preferred embodiment, the neutralizing anti-IFN-α antibodies will be able to neutralize all, or substantially all, of the gelatinase activity of both MMP-2 and MMP-9.

Antibodies which bind to a particular epitope can be identified by "epitope mapping". There are many methods known in the art for mapping and characterizing the location of epitopes on proteins, including solving the crystal structure of an antibody-antigen complex, competition assays, gene fragment expression assays, and synthetic peptide-based assays, for example as described in Chapter 11 of Harlow and Lane, "Using Antibodies, a Laboratory Manual," Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1999. Competition assays are discussed above and below. In gene fragment expression assays, the open reading frame encoding the protein is fragmented either randomly or by specific genetic constructions, and the reactivity of the expressed fragments of the protein with the antibody to be tested is determined. For example, the gene fragments may be produced by PCR, and then transcribed and translated into protein in vitro, in the presence of radioactive amino acids . The binding of the antibody to the radioactively- labelled protein fragments is then determined by immunoprecipitation and gel electrophoresis. Certain epitopes can also be identified by using large libraries of random peptide sequences displayed on the surface of phage particles; these are known as phage, libraries.

Alternatively, a defined library of overlapping peptide fragments can be tested for binding to the test antibody in simple binding assays. The latter approach is suitable to define linear epitopes of about 5 to 15 amino acids.

An antibody binds "essentially the same epitope" as a reference antibody when the two antibodies recognize identical or sterically-overlapping epitopes. The most widely used and rapid methods for determining whether two epitopes bind to identical or sterically-overlapping epitopes are competition assays, which can be configured in a number of different formats, using either labelled antigen or labelled antibody. Usually the antigen is immobilized on a 96-well plate, and the ability of unlabelled antibodies to block the binding of labelled antibodies is measured using radioactive or enzyme labels. The term "disease state" refers to a physiological state of a cell or of a whole mammal in which an interruption, cessation, or disorder of a cellular or body function, system, or organ has occurred. The expression "detection of cancer" is used in its broadest sense, and includes the determination of the likely presence or absence of cancer, or cells in a precancerous state or the early phases of development of cancer. Thus, for example, the invention encompasses not only the detection of active endometrial cancer, but also the risk of developing such active cancer.

It is to be clearly understood that this invention is not limited to the particular materials and methods described herein, as these may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and it is not intended to limit the scope of the present invention, which will be limited only by the appended claims .

Unless otherwise indicated, the present invention employs conventional chemistry, protein chemistry, molecular biological and enzymological techniques within the capacity of those skilled in the art. Such techniques are well known to the skilled worker, and are explained fully in the literature. See Coligan et al., "Current protocols in Protein Science," 1999, Volumes I and II (John Wiley & Sons Inc.); Sambrook et al., "Molecular Cloning: A Laboratory Manual," 2001; Shuler, M. L., "Bioprocess Engineering: Basic Concepts" (2nd Edition, Prentice-Hall International, 1991); Glazer, A.N. et al., "Chemical Modification of Proteins" (North Holland

Publishing Company, Amsterdam, 1975); Graves, D.J. et al . , "Co- and post-translational modification of proteins: chemical principles and biological effects" (Oxford University Press, 1994); Lundblad, R. L-, "Techniques in protein modification," CRC Press, Inc. Boca Raton, Fl. USA, 1995; Clark, I.M-, "Matrix Metalloproteinase Protocols; Humana Press, Totowa, New Jersey, 2001; Crowther J. R., ELISA: Theory and Practice (Humana Press, 1995); and Goding, J.W. : Monoclonal Antibodies: principles and practice (Academic Press, New York: 3^rd ed. 1996) .

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any materials and methods similar or equivalent to those described herein can be used to practice or test the present invention, the preferred materials and methods are described.

Abbreviations used herein are as follows:

ELISA enzyme-linked immunoadsorbent assay FN fibronectin GST glutathione S-transferase from

Schistosoma japonicum HRPO horeseradish peroxidase MBP E. coli maltose-binding protein MMP metalloprotease MoAb monoclonal antibody

PCR polymerase chain reaction

RT-PCR reverse transcriptase polymerase chain reaction

TIMPs Tissue Inhibitors of Metallo Proteinases

The invention will now be described in detail by way of reference only to the following non-limiting examples and drawings.

According to aspects of the invention, applicants have isolated intact high-quality RNA from two different uterine carcinomas, and have made cDNA using reverse transcriptase, and amplified the region which encompasses the three fibronectin repeats using polymerase chain reaction (PCR). The primers for PCR were designed to amplify three repeats, and restriction enzyme sites were added at the 5' and 3' ends (BamH I and EcoR I respectively) in order to faciliate cloning and in-frame expression in a variety of bacterial expression vectors. The amplified cDNA was .cloned into Bluescript, sequenced and subcloned into the plasmid pMAL-c2. BEST which is a modified form of pMAL-c2 (New England Biolabs, Mass, USA) . We further modified the vector by inserting a pentaglycine "kinker" following the gene encoding maltose- binding protein to facilitate thrombin cleavage and inserting a thrombin cleavage site and inserting a more extensive set of restriction sites. None of these changes is material to the current application, and we believe that the original pMAL-c2 vector would be equally suitable. The plasmids pMAL-c2 and pMAL-c2. BEST encode the fusion partner E. coli maltose-binding protein (MBP) . pMAL-c2 and its modified form ρMAL-c2. BEST have the advantage that the fusion partner has been shown to promote the correct folding of fusion proteins, and gives an unusually high percentage of correctly-folded and soluble fusion proteins compared to other bacterial expression vectors. See Kapust et al., Protein Science, 1999 8: 1668-74, 1999. The fusion protein can also be purified easily by binding to an amylose column, followed by elution with maltose. However, a minor disadvantage of this system is that the relevant protein is rather small (20 kDa) compared to the size of the fusion partner (MBP; 42 kDa) .

The inserts were then subcloned into the plasmid pGEX-KT, which encodes the fusion partner glutathione S- transferase (GST) from Schistosoma japonicum to enable screening for the GST fusion protein, and to avoid isolation of clones which produce antibodies against MPB. See Hakes, D.J. et al., Analytical Biochemistry, 1992 202: 293-298, 1992.

Both MMP-2 and MMP-9 clones were confirmed to have the correct sequence, and the MBP fusion proteins were water-soluble and easily purified on amylose beads. Example 1 Cloning of Human MMP9 fibronectin repeats

RNA was isolated from two different fresh surgically-removed human uterine tumours by the method of Chomczynski et al . , Analytical Biochemistry, 1987 162 156- 159, 1987. The isolates were named sample 1 and sample 2.

Single stranded complementary DNA (cDNA) was synthesised from this RNA using the reverse transcriptase enzyme Thermoscript RT (available from Life Technologies) , using a 3' primer of the following sequence:

GCGGAATTCTCATTGGTC (AC) GGGCAGAAGCC

This sequence, designated Oligo 16771, was based on that of the 3' end of the third fibronectin II repeat, and included a stop codon and an EcoR I site. Its sequence was designed so that it would be expected to prime both MMP2 and MMP9.

This cDNA was amplified by the polymerase chain reaction (PCR) using the proofreading thermostable DNA ^■ polymerase Pfx (available from Life Technologies) . The 3' primer was oligo 16771 as described above, and the 5' primer, designated oligo 16763, was based on the 5' end of the fibronectin II first repeat of MMP9:

GCGGGATCCGTGGTTCCAACTCGGTT

DMSO (10%) was necessary for PCR. The reason why DMSO is sometimes required for successful PCR is not well understood, but it may help the DNA polymerase to copy regions of high G/C content.

Each fibronectin II repeat is 60 amino acids in length, so the PCR product for 3 repeats would be expected to be about 3 x 180 = 540 bp in length. Initial attempts at PCR, using Pfx polymerase, gave products designated DNA#1392A from sample 1 and

DNA#1391B from sample 2 respectively, but the size of the DNA product was smaller than the expected 540 bp. This failure may have reflected poor quality RNA. Consequently further samples of RNA were isolated directly from new samples of freshly-removed human uterine tumour tissue (#23, 24) and amplified by RT-PCR, using Thermoscript RT and Pfx polymerase and the same primers as previously.

The 540 bp cDNA product was digested with BamH I and EcoR I, purified by agarose gel electrophoresis and cloned into Bluescript II SK+ (Stratagene) . A Bio-Rad miniprep (DNA#1394) was sequenced, and the sequence was found to agree with the published sequence.

The insert was excised with BamH I and EcoR I, and subcloned into plasmid pMAL-c2. BEST and pGEX-KT as described above, and standard minipreps made. These were designated DNA#1395a-d (pMAL-c2. BEST) and DNA#1613 (pGEX- KT) .

Example 2 Cloning of Human MMP-2 fibronectin repeats

Initial attempts to isolate MMP-2 using the methods described in Example 1 were unsuccessful, possibly due to poor quality RNA, and a second set of fresh surgical tissue samples had to be obtained from new patients with uterine tumours. RNA was isolated as previously described, and allocated numbers RNA#23 and 24. PCR was carried out using the 3' primer oligo 16771, and the following 5' primer, whose sequence was based on that of the 5' end of the fibronectin II first repeat of MMP-2:

GCGGGATCCGTGGTCCGTGTGAAGTATGGC

This was designated oligo 17036. Again DMSO (10%) was necessary for PCR. A 5' primer 4 bp shorter than oligo 17036 was found to be unsatisfactory. The 540 bp cDNA product was digested with BamH I and EcoR I, purified by agarose gel electrophoresis and cloned into Bluescript II SK+ (Stratagene) , giving DNA#1402. A Bio-Rad rainiprep was sequenced, and the sequence was found to agree with the published sequence. The insert from DNA#1402 was excised with BamH I and EcoR I, and subcloned into pMAL-c2. BEST, to give DNA#1403a-d, and into pGEX-KT to give DNA#1614.

Example 3 Purification of Fusion Proteins

The plasmids encoding MMP-2 and MMP-9 prepared in Examples 1 and 2 were transfected into XL-I blue cells, plated out on L-agar plates containing 50 micrograms/ml Ampicillin, and single colonies inoculated into 500 ml cultures of Luria Broth containing 50 micrograms/ml Ampicillin. In each case induction with IPTG for 4 hours at 37⁰C gave a protein of the expected size, which was about 30% soluble, as assessed by sonication, centrifugation and analysis of the proteins contained in the pellet and supernatant by SDS-polyacrylamide gel electrophoresis and staining with Coomassie Blue. The MMP fusion protein was easily purified by affinity chromatography on amylose beads (from New England Biolabs) using the method recommended by the manufacturer.

It is thought that a higher percentage solubility may be achieved by induction at room temperature. Fusion proteins from pGEX-KT were induced, solubilised and purified in a similar manner, except that purification was by affinity chromatography on reduced glutathione-agarose beads, with competitive elution with free glutathione such as described in Smith, D. B., Methods in Enzymology, 2000 326: 254-270, 2000. The yield of protein from the pGEX-KT vector was much less than that from the pMAL-c2 vector, and it was essential to induce synthesis using IPTG at room temperature rather than 37° C, because the GST fusion proteins were insoluble when induced at 37° C. Example 4 Production of Polyclonal Antibodies to MMPs

Polyclonal antibodies may be raised in a variety of animals, such as mice, rabbits, sheep, goats, horses or cattle. If large volumes of antibody are required, sheep or goats are generally the most convenient sources, and antibodies from these sources are widely used for commercial immunoassays.

Animals are immunised with the purified MMP from Example 3, together with an adjuvant such as Complete

Freund' s adjuvant. MMP fibronectin repeats produced as a fusion protein with either E. coli maltose-binding protein (MBP) or glutathione S-transferase from Schistosoma japonicum may be used as the antigen. After 1-3 months the animals are given several booster immunizations consisting of the purified MMP in saline without adjuvant, until their serum animals contains sufficient amounts of antibody as detected by an ELISA or other assay. Typical doses of antigen are in the range of 10-1000 micrograms per injection, preferably 50 micrograms per injection. The dose is quite flexible, and can readily be optimised.

Polyclonal antibodies are purified by affinity chromatography on the immobilised antigen, and may be used to set up a two-site ELISA assay such as the one described below.

Example 5 Production of Monoclonal Antibodies to MMPs

Methods for the production of monoclonal antibodies to MMPS such as MMP-2 and MMP-9 are straightforward, and use technology which is now standard in the art. See Goding, 1996. The antigen may be MMP fibronectin repeats produced as a fusion protein with either E. coli maltose-binding protein or glutathione S- transferase from Schistosoma japonicum.

Mice are immunised with a mixture of MBP or GST fusion proteins containing fibronectin domains from MMP-2 and MMP-9, given a booster immunization after an appropriate interval, and then their spleen cells are fused with a mouse myeloma cell line such as X63Ag8.653, which does not produce light or heavy chains of its own, or NS-I cells, which produce their own K light chains. Typical immunisation protocols use 10 micrograms of antigen emulsified in 100 microlitres of Complete Freund' s Adjuvant, given subcutaneously, followed by a series of booster injections of a similar amount of antigen given subcutaneously in normal saline at typical intervals of A- 8 weeks between injections. Boosting is usually continued until high titre serum antibodies are produced, as tested by ELISA assay, although the antibody titre is not a strong predictor of success in making monoclonal antibodies. Spleen cell suspensions are made about 3-4 days after the last boost, and fused with mouse myeloma cells using 50% polyethylene glycol according to standard methods (see Goding, 1996) . Hybrids are selected by growth in HAT medium in Dulbecco' s modified Eagle's medium with 10% fetal bovine serum (Goding, 1996) .

After plating out the hybrids in 96 well micro- plates and allowing growth of hybrids for 1-2 weeks in HAT medium, the supernatants are collected and tested for the presence of antibodies to MMP-2 and MMP-9, using a simple ELISA system using horseradish peroxidase-conjugated anti- mouse immunoglobulin as the detection reagent.

Clones which are thus identified as antibody- producing are then expanded, re-tested, characterised according to antibody isotype (subclass), and cloned by limiting dilution according to conventional methods.

Large-scale cultures are then produced, and the antibodies are purified by affinity chromatography on protein A- or protein G-agarose beads, according to standard techniques (Goding, 1996) . It is advantageous to use clones which produce

IgG2 or IgG3 antibodies, because these bind to protein A, and can thus be readily purified from culture supernatants by affinity chromatography on protein A columns such as protein A-Sepharose using standard methods, without the contamination with bovine IgG which can arise if affinity chromatography is carried out on anti-immunoglobulin columns, although in the present case the majority of clones obtained were IgGl producers, and required purification on protein G columns.

We have so far cloned nine hybridoma cell lines which produce monoclonal antibodies against the fusion protein between MBP and the MMP fibronectin repeats prepared in Example 3. A mixture of the fusion proteins MBP-MMP-2 and MBP-MMP-9 was used for immunization.

Of these monoclonal antibodies, five are specific for MMP-2 and four for MMP-9. Screening and specificity testing were carried out as described in Examples 6 and 7 below. Further antibody-secreting hybridomas have been prepared, and are being cloned and tested.

Example 6 Screening for antibodies to MMPs

Screening for polyclonal or monoclonal antibodies to the two MMPs may be carried out by coating polystyrene or polyvinyl microtitre plates with the respective recombinant antigens. MMP fibronectin repeats produced as a fusion protein with either E. coli maltose-binding protein or glutathione S-transferase from Schistosoma japon±cum may be used.

If the immunising antigen is a GST fusion protein, screening is carried out using an MBP fusion protein to avoid detecting clones producing antibodies -to GST. Conversely, if the immunising antigen is an MBP fusion protein, screening is carried out using a GST fusion protein to avoid detecting clones secreting antibodies to MBP.

The wells of the plates are coated with the antigen and washed in order to remove unbound antigen, then any remaining non-specific protein-binding sites are saturated by an excess of an irrelevant protein, such as bovine serum albumin or non-fat powdered milk (BLOTTO; Carnation Ltd) • The wells are then incubated with the antibody- containing solution (either culture supernatants or diluted serum from animals) at approximately neutral pH (6.5-8.5 would suffice). Unbound antibody is removed by washing 3-5 times with phosphate-buffered saline or other neutral buffer containing an irrelevant protein such as bovine serum albumin to saturate any non-specific protein- binding sites) .

The plate is then incubated with an appropriate dilution of an antibody to mouse immunoglobulin, conjugated with an enzyme such as horseradish peroxidase or alkaline phosphatase, and then unbound antibody is removed by further washing as described above.

Finally, the plates are incubated with an enzyme substrate which gives a coloured product if acted upon by the relevant enzyme. A suitable substrate for. horseradish peroxidase is o-phenylenediamine (OPD) /H₂O₂, which gives a yellow product. This system is one of the most sensitive available. A suitable substrate for a alkaline phosphatase is p-nitrophenyl phosphate. An alternative substrate for peroxidase is ABTS and hydrogen peroxide, which gives a green colour but is less sensitive than OPD.

Colour development is detected by visual inspection and may be quantified using a microtitre plate reader. Negative controls include wells which have not been coated with antigen or which have not been incubated with antibody. Positive controls use a known active antibody source, such as serum from an animal which has been repeatedly immunised and boosted with the relevant antigen . Suitable antibodies, enzymes, enzyme substrates and microtitre plate readers are widely commercially available. Example 7 Determination of specificity of antibodies

The fibronectin repeats in MMP-2 AND MMP-9 are similar, but not identical, as illustrated by the alignment shown in Figure 3. Consequently applicants predicted that some clones would react with both MMP-2 AND MMP-9, while many other clones would only react with one of these enzymes. It is first necessary to ensure that the antibodies to the fusion partner protein are eliminated from consideration. The preferred method is to prepare a second set of fusion proteins using a fusion partner which is different from that used for immunisation. For example, if the immunisation is performed with MMP-MBP, the screening may be done using MMP-GST. Any reactivity in such assays must be therefore due to antibodies to MMPs. We have used this and other approaches. For example, if the fusion partner is MBP, this can be done by screening each sample in duplicate pn wells coated with

MMP-2-MBP or MMP-9-MBP. Samples which react with only one- of these are clearly not directed to MBP, because MBP is common to both wells .

Alternatively, the MBP moiety can be cleaved from the MMP moiety by proteolytic enzymes such as thrombin, and the MBP removed prior to setting up the assay.

The results of testing of the 9 monoclonal antibodies prepared and screened as described in Examples 5 and 6 are summarised in Table 1. Each antibody was first tested against a mixture of GST-MMP-2 and GST-MMP-9, and then separately tested against MBP-MMP-2 and MBP-MMP-9 respectively. Table 1 ANTI-MMP MONOCLONJU. ANTIBODIES

Example 8 Identification of Antibody Pairs Suitable for Two-site Capture ELISA Systems

Individual monoclonal antibodies are purified by affinity chromatography on immobilised protein A or protein G, and half the antibody is labelled with biotin using biotin succinimide ester as described by Goding (1996) . The other half of each sample is not labelled. ELISA plates as described above are coated with each of the non-biotinylated candidate antibodies, washed with protein-containing buffers to saturate any nonspecific protein-binding sites, then incubated with recombinant MMP for about 1 hour. After washing to remove unbound MMP, the plates are incubated with the biotinylated antibodies for about 1 hour, then washed and incubated with labelled streptavidin labelled with an enzyme such as horseradish peroxidase or alkaline phosphatase. The plates are washed once more to remove unbound streptavidin, and incubated with an enzyme substrate which gives a coloured product if acted upon by the relevant enzyme, as described in Example 5. Wells in which strong colour development is observed contain pairs of antibodies which are suitable for capture and detection of MMP.

These pairs are tested with authentic native human MMPs to confirm that they will detect the native MMP as desired.

In this manner, pairs can be identified that are strong candidates for a capture assay for MMP-2, and/or MMP-9 may be identified by this method.

In this particular example, four monoclonal antibodies against MMP-2 were purified and biotinylated, and these were tested in a model two-site capture ELISA using the recombinant fibronectin repeats as a surrogate for the full length MMP2. These antibodies were designated 1.2, 4.3, 7.4 and 8.8. The antibodies were tested in all possible combinations for capture and detection. Even though we only tested four antibodies, we did find some combinations that worked in a two-site capture assay. The assay was successful with antibodies 4.3 and 7.4 as capture antibody (i.e. bound to the plate) and antibody 1.2 for detection. The combination of 4.3 as capture antibody and 1.2 for detection gave the best results (underlined in Table 2).

These results suggest that it may not be necessary to prepare large numbers of purified antibodies against each of MMP-2 and MMP-9 in order to find suitable pairs for capture ELISA.

The results are shown in Table 2, and are expressed as optical density after scanning the plate.

TABLE 2

Example 9 ELISA for Detection of MMP-2 AND MMP-9

The simplest method for ELISA is a two-site sandwich "capture" ELISA. This involves coating the plate with one monoclonal antibody, and then washing the plate and saturating all remaining non-specific protein binding sites using an irrelevant protein such as non-fat powdered milk (BLOTTO) .

The plate is then incubated with the test sample to allow capture of the MMP. The plate is washed, and a second monoclonal antibody which has been directly conjugated with an enzyme such as horseradish peroxidase is added. After a further incubation and washing, the bound antibody is revealed by adding a substrate such as o-phenylenediamine/H2θ₂, which gives a yellow product. This system is chosen because it is one of the most sensitive available, although several other systems are known, such as alkaline phosphatase and p-nitrophenyl phosphate.

Two-site capture ELISA has the advantages that it is simple to set up, highly sensitive, and gives a linear dose-response readout. Disadvantages and problems with this system include: (a) the need to choose appropriate capture and detection antibodies which are capable of simultaneous binding to the antigen;

(b) choosing a capture antibody which is not denatured by binding to the plate; (c) choosing antibodies of very high affinity, to provide the adequate degree of sensitivity; and (d) avoiding destruction of the antibodies by the proteolytic activity of the MMPs. However, proteolytic degradation of MMPs may be prevented by including the chelating agent EDTA in all assay buffers; this chelates zinc, and thereby inactivates the catalytic site of the MMP.

Example 10 Collagen or Gelatin Capture System

As an alternative to capture of MMPs in the assay sample by antibody, the enzymes may be captured by coating the plates with native type I collagen or gelatin (denatured collagen) , which binds to the fibronectin repeats (see Steffensen, 1995) . MMP-2 and MMP-9 do not cleave native type I collagen, but they do cleave gelatin. This binding is probably independent of the need for divalent cations, and the enzyme may be inactivated by EDTA to prevent destruction of the plate or the antibodies .

This capture system has the potential advantage of greater simplicity, in that only a single monoclonal antibody would be required for detection of MMP-2 and a single monoclonal antibody for MMP-9, in contrast to a two-site antibody-capture ELISA, in which carefully chosen matched pairs of antibodies that bind to different epitopes and do not hinder each other's binding must be used.

We have tested four of the monoclonal antibodies described in Examples 5 and 6, and have found that these are effective in the gelatin capture system. The collagen capture assay was performed as follows. Native type I collagen from sheep was dissolved in 10 mM acetic acid and diluted into phosphate-buffered saline (PBS) to a final concentration of 50 micrograms per ml, and used to coat polyvinyl 96 well trays at 37°C overnight. Unbound collagen was removed by washing, and any remaining nonspecific protein-binding sites on the trays blocked with bovine serum albumin (BSA) in PBS. Control wells were blocked with BSA but were not coated with collagen. Plates were then incubated with a recombinant fusion protein consisting of fibronectin repeats from MMP2 fused with maltose-binding protein, prepared as described in Examples 2 and 3. Plates were then washed again, and incubated with biotinylated monoclonal antibodies to human MMP2 (l=clone 1.2; 4=clone 4.3, 7=clone 7.4; 8=clone 8.8; -ve = negative control in which collagen coating was omitted) .

After further washing to remove unbound recombinant protein, plates were incubated with horseradish peroxidase-conjugated streptavidin, washed again, and incubated with substrate consisting of hydrogen peroxide and o-phenylenediamine . Plates were scanned when colour developed. Colour development was assessed by eye and also by optical scanning.

The results are shown in Figure 4. It is apparent that all four monoclonal antibodies to MMP-2 gave a strong signal, indicating detection of bound recombinant protein consisting of the fibronectin repeats from MMP2. This experiment demonstrates the feasibility of capture of MMP-2 (and by inference, MMP-9, which also contains fibronectin repeats) using collagen-coated plates. It is apparent that the fibronectin repeats are capable of simultaneously binding to collagen on the plate and to the four monoclonal antibodies which were tested. The negative control, in which coating of the plates by collagen was omitted (well marked -ve) , shows that the assay was specific, because no colour developed when collagen coating was omitted.

These results show that it may not always be necessary to generate pairs of monoclonal antibodies for capture and detection of MMPs, because efficient capture can be achieved using collagen, which is known to bind to the fibronectin repeats contained in MMP-2. A similar approach could be used to capture MMP-9.

Example 11 Antibodies to both MMP-2 and MMP-9

As described above, certain preferred embodiments of the invention utilize monoclonal antibodies to both MMP-2 and MMP-9. Mice were immunised against MBP-MMP (maltose-binding protein-matrix metalloprotease) fusion proteins and their 3pleen cells fused with mouse myeloma cell line (NS-I) . After plating out the hybrids in 96 well micrσtitration plates, the supernatants were collected and tested for antibodies to MMP-2 and MMP-9 by simple ELISA.

Initially, hybridoma culture supernatants were screened against GST-fusion (GST= glutathione S- transferase) proteins (GST-MMP2 and GST-MMP9) to avoid detecting anti-MBP antibodies. Before cloning, the hybrids that were positive for production of antibodies to MMP-2 and MMP-9 were expanded and further tested against MBP alone and MBP-MMP fusion proteins to demonstrate that the reactivity observed was against MMPs and not MBP. After the cloning of the hybrids, each clone was screened against both the MBP fusion proteins (MMP-2 and MMP-9) to confirm that they were still active and also to identify any clones that reacted with both MMP-2 and MMP- 9. The ELISA used included:

1) Recombinant GST-fusion proteins were adsorbed to the microtitration plate by adding lOOul recombinant solution tb the wells. Recombinant MMPs were diluted between 0.1- 5ug/well with 0. IM sodium hydrogen carbonate.

The plate was covered with plastic wrap and stored overnight at 4C.

2) Unbound recombinant MMPs were removed by flicking off the solution, and then flooding wells with PBS before flicking again.

3) Non-specific binding was blocked with the addition of 200ul/well of 1%BSA/PBS solution, and allowed to stand at room temperature for 1 hr before flicking off. 4) lOOul of hybridoma culture supernatant was added to two wells containing recombinant MMP2 or MMP9, and kept at room temperature for 1 hr. (This was to test for positive hybridomas and also to check for positives that recognised both the recombinant MMPs.)

5) Emptied wells by flicking off solution and washed the plate 4X with PBS.

6) lOOul of Goat anti mouse IgG horseradish peroxidase conjugate (Sigma, cat! A2554) was added to wells at 1:40 000 dilution in

1%BSA/PBS. The plate was covered with plastic wrap and incubated for 1 hr at room temperature.

7) Unreacted conjugate solution was washed by flick-waahing the plate 4X with PBS.

8) lOOul of peroxidase (OPD) substrate solution was added to each well. Positive and negative controls were included to ensure the validity of the assay (immune mouse serum was used as a positive control at 1:1000 dilution) . Identification of positive hits were assessed after 5 to 10 minutes at room temperature by colour reaction.

9) Colour development was stopped by adding equal volumes of 0.4M Sulphuric acid.

Results were documented using the model 384 SPECTRAmax PLUS microplate reader at 490 nm. A total of 50 monoclonal antibodies were generated, and the results of the above ELISA demonstrated that 20 monoclonal antibodies were specific to MMP-2, 24 monoclonal antibodies were specific to MMP-9, and 6 were cross-reactive (recognising both) .

It will be apparent to the person skilled in the art that while the invention has been described in some detail for the purposes of clarity and understanding, various modifications and alterations to the embodiments and methods described herein may be made without departing from the scope of the inventive concept disclosed in this specification.

References cited herein are listed on the following pages, and are incorporated herein by this reference .

Claims

CLAIMS :

1. A recombinant fusion protein in which a MMP fibronectin Type II domain is linked to a second protein.

2. The recombinant fusion protein according to claim 1, wherein said second protein is maltose-binding protein from Escherichia coli.

3. The recombinant fusion protein according to claim 1, wherein said second protein is glutathione S- transferase from Schistosoma japonicum.

4. The recombinant fusion protein according to any one of claims 1 through 3, wherein said fusion protein comprises three fibronectin Type II domains of MMP.

5. An immunogenic composition comprising a recombinant fusion protein in which a MMP fibronectin Type II domain is linked to a second protein,_, and optionally also comprising an adjuvant.

6. The immunogenic composition according to claim 5, wherein said second protein is maltose-binding protein from Escherichia coli.

7. The immunogenic composition according to claim 5, wherein said second protein is glutathione S-transferase from Schistosoma japonicum.

8. The immunogenic composition according to any one of claims 5 through 7, wherein said fusion protein comprises three fibronectin Type II domains of MMP.

9. The immunogenic composition according to any one of claims 5 through 8, wherein said adjuvant comprises alum, Quil A, and complete Freund' s adjuvant.

10. An immunogenic composition comprising a plurality of fusion proteins, wherein at least one of the fusion proteins comprises the three fibronectin Type II domains of the MMP.

11. The immunogenic composition according to claim 10, further comprising an adjuvant.

12. A method of assay of MMP-2 and/or MMP-9, comprising the step of exposing a biological sample suspected to contain MMP-2 and/or MMP-9 to an antibody specific for a fibronectin Type II domain of MMP-2 and/or MMP-9, under conditions suitable for formation of a complex between the MMP and an antibody specific for the MMP, and detecting bound MMP.

13. The method according to claim 12, wherein the antibody is specific to both MMP-2 and MMP-9.

14. The method according to claim 12 or 13, wherein said biological sample is a biological fluid.

15. The method according to claim 14, wherein said biological fluid comprises uterine fluid.

16. The method according to any one of claims 12 through 15, wherein said assay comprises a two-site capture/sandwich immunoassay for MMP-2 and MMP-9, and wherein said immunoassay utilizes a plurality of monoclonal antibodies that recognize both active and inactive forms of MMP-2 and MMP-9.

17. A method of detection, diagnosis, prognosis, or monitoring of a condition associated with elevated levels of MMP-2 and/or MMP-9 using the assay method according to any one of claims 12 through 16.

18. The method of detection, diagnosis, prognosis, or monitoring of a condition according to claim 17, wherein said condition is selected from the group consisting of endometrial cancer, renal cancer, breast cancer, renal damage conditions, airway damage conditions, arthritic conditions, osteolytic conditions, dermatological conditions, cardiovascular conditions, fibrotic conditions, stroke, transient ischaemic attack, fibroids, infertility, and early pregnancy.

19. A method of detection, diagnosis, prognosis, or monitoring of endometrial cancer in a subject at risk thereof or suspected to be suffering therefrom, said method comprising using the assay method according to any one of claims 12 through 16.

20. The method of detection, diagnosis, prognosis, or monitoring of endometrial cancer according to claim 19, wherein said biological fluid comprises uterine fluid obtained from the subject.

21. The method of detection, diagnosis, prognosis, or monitoring of endometrial cancer according to claim 20, wherein said biological fluid comprises uterine washings obtained from the subject.