WO2007138155A1 - Improved expression of tuberculosis vaccine proteins in plants - Google Patents

Improved expression of tuberculosis vaccine proteins in plants Download PDF

Info

Publication number
WO2007138155A1
WO2007138155A1 PCT/FI2007/000147 FI2007000147W WO2007138155A1 WO 2007138155 A1 WO2007138155 A1 WO 2007138155A1 FI 2007000147 W FI2007000147 W FI 2007000147W WO 2007138155 A1 WO2007138155 A1 WO 2007138155A1
Authority
WO
WIPO (PCT)
Prior art keywords
plant
protein
vaccine
ag85b
vector
Prior art date
Application number
PCT/FI2007/000147
Other languages
French (fr)
Inventor
Yuri Leonidovich Dorokhov
Timo Korpela
Joseph Grigorievich Atabekov
Original Assignee
Yuri Leonidovich Dorokhov
Timo Korpela
Joseph Grigorievich Atabekov
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Yuri Leonidovich Dorokhov, Timo Korpela, Joseph Grigorievich Atabekov filed Critical Yuri Leonidovich Dorokhov
Publication of WO2007138155A1 publication Critical patent/WO2007138155A1/en

Links

Classifications

    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H5/00—Angiosperms, i.e. flowering plants, characterised by their plant parts; Angiosperms characterised otherwise than by their botanic taxonomy
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8257—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits for the production of primary gene products, e.g. pharmaceutical products, interferon
    • C12N15/8258—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits for the production of primary gene products, e.g. pharmaceutical products, interferon for the production of oral vaccines (antigens) or immunoglobulins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/02—Bacterial antigens
    • A61K39/04—Mycobacterium, e.g. Mycobacterium tuberculosis
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)

Definitions

  • the present invention relates to a method for producing the tuberculosis, vaccine proteins in plant cells.
  • the method comprises producing of cDNA in monocistronic and bicistronic constructs or in constructs containing the virus vectors expressing the gene encoding the protein, introduction of said cDNA copies into the plant cells, their transient expression by Agrobacterium-based leaf infiltration or injection or by stable transformation of the plant cells, and recovering the tuberculosis vaccine proteins from plants.
  • plants super-express proteins capable of generating antibody production and can be used as edible vaccines that can be administered through mucosal surfaces;
  • low cost of production since plants require only soil, water and light instead of expensive media;
  • no need of sterile conditions for plant cultivation iii) no need of the procedure of protein folding in vitro, since folding occurs in plant cells naturally in the course of processing and targeting;
  • the technology is entirely safe, since only selected target proteins serve as vaccinogens and the procedure of the virus-vector delivery proceeds in laboratory conditions.
  • RNA viruses are the best as the expression vectors, because they offer a higher expression level compared to DNA viruses.
  • viral vectors suitable for systemic expression of transgenic material in plants US5316931; US5589367; US5866785; WO2005071090.
  • these vectors can express a foreign gene as a translational fusion with a viral protein (US5491076; US5977438), from an additional subgenomic promoter (US5466788; US5670353; US5866785), or from polycistronic viral RNA using IRES elements for independent protein translation (WO0229068).
  • Plant viruses were proposed for vaccine production as well (US6042832, US6448070).
  • Tuberculosis caused primarily by the facultative intracellular bacterium Mycobacterium tuberculosis, is the leading cause of death among single infectious agents despite of the availability of effective short-course chemotherapy.
  • the TB epidemy is global public health tragedy that is being fueled by the spread of HIV/AIDS and the increasing incidence of multiple drug resistance.
  • the World Health Organization (WHO) has estimated that in the next two decades more than a billion people will be newly infected and about 36 million people will die from TB if control of this disease is not substantially strengthened (WHO, 2004, Tuberculosis — Fact Sheet No.104, http://www.who.int/mediacentre/factsheets).
  • BCG Bacille Calmette-Guerin
  • TB is common in developing countries deficient in sanitary facilities and vaccines.
  • the TB vaccine proteins can be produced by stable transgenic plant (especially, edible plant) and used for producing TB vaccines, it is very economical in view of low production cost with no need for purification and efficiency in transport and storage.
  • minimum of 2 years is required for construction of stably transformed transgenic plants including the plant testing and cultivation.
  • the major obstacle in production of TB proteins in stably transformed transgenic plants is the low yield of recombinant proteins produced by "stable transgenics" (less than 0.1% of the total soluble proteins). Because in oral vaccination huge amount of vaccine is lost as proteolytic waste, it is expressly important to have very high production level.
  • ESAT6 fused with enterotoxigenic E.coli heat-labile toxin B subunit was expressed in stably transgenic Arabidopsis thaliana using non-amplification expression vector (Rigano et al., 2004, Plant Cell Rep. 22:502-508), but the level of production was too low. Therefore, transgenic production of oral vaccines is not possible in practice.
  • Plant viral vectors might be considered as a promising alternative for production of TB vaccines.
  • Plant virus expression system devoid of stable genetic transformation of a plant is exploited. This relies on transient amplification of viral vectors delivered to multiple areas of a plant organism (systemic delivery) by Agrobacteri ⁇ m. In essence, then the whole mature plant infiltrates a dilute suspension of agrobacteria carrying T- DNAs encoding RNA replicons.
  • Plant virus-based vector provides cell-to-cell spread, amplification and high- level of expression. Only few plants are sufficient for fast production of milligram or even gram quantities of the protein.
  • ESAT6 antigen was expressed in Nicotiana tabacum cells agroinfected with recombinant vector of potato virus X (PVX) genome (Zelada et al., 2006, Tuberculosis (Edinb). VoI 86, No 3-4, p. 263-267).
  • the authors used the strategy which allows the production of free CP and ESAT-6 as well as fused ESAT-2A-CP to obtain recombinant chimerical virions expressing ESAT-6 at the virion surface.
  • ESAT6 yield in tobacco leaves was also too low.
  • ESAT6 is a specific protein inducing necrosis in plant leaf tissues and results in too low protein yield to be an effective vaccine.
  • the present invention overcomes the drawback of the low-yield vaccine production and provides an environmentally safe, economic, and non-transgenic method for production of TB vaccines in plants based on the agrobacterial infiltration or injection of the constructs containing a recombinant plant vector effecting super-expression of the TB vaccine proteins in a plant.
  • TB vaccine proteins can be produced in plant cells transiently transformed with constructs containing a full-length copy of plant expression vectors or with non-replicating construct encoding TB vaccine proteins in the presence of transgene inducing gene silencing (TIGS).
  • TIGS transgene inducing gene silencing
  • the main advantage is that TB vaccine proteins can be expressed by TMV-based vectors.
  • the high level of protein production is not the only consequence.
  • the super-production of the TB vaccine proteins is also possible due to the fact that the producing cells are jointly co- agroinfiltrated with the TB-producing virus vector together with the construct producing the protein that efficiently suppress the antiviral cellular reaction termed as virus- induced gene silencing (VIGS).
  • VIGS virus- induced gene silencing
  • our invention allows getting significant TB vaccine production without silencing suppressor co-delivery using only our upgraded TMV-based vectors described, for example, by Dorokhov et al., 2004. (Doklady Biochemistry and Biophysics, Vol. 394, pp. 30-32).
  • Fig. 1 is schematic presentation of a structure of an expression module of binary vector pA10193 including "35S promoter” which is 35S promoter from CaMV, "S1 leader” is sequence of CaMV 35S RNA, "35S term” is CaMV 3 1 UTR (polyA signal).
  • Fig. 2 is schematic presentation of a structure of expression module of binary vector pA10194.
  • Fig. 3 is schematic presentation of a structure of PVX-based expression module of binary vector pA10422 where "POL PVX” is gene of RNA-dependent RNA polymerase (viral replicase) of PVX, "25K SgPr” is subgenomic promoter of PVX 25K gene.
  • Fig. 4 is schematic presentation of a structure of crTMV-based expression module of binary vector pA10283 where LB and RB is left and right border T-DNA repeat, respectively; Arab. Act2 is Arabidopsis thaliana Act2 transcriptional promoter,
  • TVCV RdRp is RNA-dependent RNA polymerase of turnip vein clearing virus (TVCV); MP, movement protein gene; ⁇ , the 68-nt TMV Ul 5'NTR used as translational enhancer; NTR, TMV 3' nontranslated region; NOS is nopaline synthase promoter.
  • Fig. 5 is schematic presentation of a structure of TMV Ul-based expression module of binary vector pA103514.
  • Fig. 6 is schematic presentation of a structure of TMV Ul-based expression module of binary vector pA10346.
  • Fig. 7 is schematic presentation of a structure of crTMV-based expression module of binary vector pA10413.
  • Fig. 8 shows Western analysis of total proteins of N.benthamiana leaves transiently expressing ESAT6-Ag85B fusion protein.
  • N.benthamiana leaves were agroinjected with pA10193 (Bin19-based vector expressing ESAT6-Ag85B fused protein; lanes 1 and 2). Bin19 empty vector was used as a negative control (lane 3).
  • Three days after agroinjection proteins were isolated from sites of agroinjection tested with ESAT6-Ag85B specific antibodies. The arrow shows position of bacterially expressed 40 kDa fused protein.
  • Fig. 9 (lane 1) shows western analysis of total proteins of N.benthamiana leaves transiently expressing ESAT6-Ag85B-His fused protein.
  • N.benthamiana leaves were agroinjected with pA10194 (Bin19-based vector expressing ESAT6-Ag85B-
  • Lane 2 shows proteins of intact leaves. Arrow shows position of bacterially expressed 40 kDa fused protein.
  • Fig.10 shows Western analysis of proteins of pA10194-mediated N.benthamiana leaves transiently expressing ESAT6-Ag85B-His fused protein after subcellular fractioning. Fractions are: S30 (lane 1), P30 (lane 2), P1 (lane 3), cell wall (CW; lane 4). The arrow shows position of bacterially expressed 40 kDa fusion protein.
  • Fig.11 shows Western analysis of total proteins of N.benthamiana leaves transiently expressing PVX-based pA10422 (expressing ESAT6-Ag85B; lane 2 and 3) and crTMV-based vector pA10283 (lane 1 ).
  • Fig.12 shows Western analysis of total proteins of N.benthamiana leaves transiently expressing Ul-based pA103514 (expressing ESAT6; lanes 2 and 3) and empty vector (lane 1). The arrow shows position of 10 kDa ESAT6 protein. The non-specific bands are marked by asterisks.
  • Fig.13 shows Western analysis of total proteins of N.benthamiana leaves transiently expressing Ul-based pA10346 (expressing Ag85B; lanes 1-3). The arrow shows position of 35 kDa Ag85B.
  • Fig.14 shows Western analysis of total proteins of N.benthamiana leaves transiently expressing crTMV-based pA10413 (expressing Ag85B; lanes 1-4). The arrow shows position of 35 kDa Ag85B.
  • the method of producing TB vaccine protein in plants includes the following steps: (i) construction of a recombinant plant expression plasmid by insertion of a cDNA sequence of either a genome of a virus vector expressing the TB protein, or an individual protein gene; (ii) introduction of the recombinant expression plasmid into plant cells; (iii) accumulation of proteins abolishing the gene silencing, (iv) recovery and isolation the TB vaccine from the plants.
  • the present invention provides constructs and methods for accumulation of TB vaccine protein(s) in any plant species or in any tissue or organ of a plant.
  • the proteins are obtained by transformation of plants (a) with virus- based vectors encoding and transiently producing the proteins operationally linked with cellular compartment-specific regulatory sequences, or (b) with individual non- replicating TB protein gene.
  • the transformation or transfection by a recombinant vector virus is carried out preferably via Agrobacterium-me ⁇ iaied co-delivery with VIGS suppressors described, for example, by Savenkov et al., 2002. (J.Gen.Virology, VoI 83, pp. 2325-2335).
  • our invention allow getting significant TB vaccine production without silencing suppressor co-delivery using only our upgraded TMV-based vectors described, for example, by Dorokhov et al., 2004. (Doklady Biochemistry and biophysics, Vol. 394, pp. 30-32).
  • Such a plant tissue is useful as anti tuberculosis vaccine.
  • the basic embodiment of the invention is that the suppression of the natural protein destroying pathway by plant can be acquired by directing the produced vaccine proteins to be localized into separate organelles and membranes in plants and not into soluble form in the cytosol. Very high amounts of protein could be produced (up to 40% of total plant cell protein compared to less than 1% in the prior art publications) in the absence of gene silencing, high amounts of the protein could be loaded into cells, and the protein was stored in stable form. In addition, molecular capsulation (hiding) of vaccine proteins into membraneous and other plant structures is beneficial for non-invasive vaccines.
  • the present invention teaches that especially oral vaccines can be located in plant structural organelles.
  • the beneficial strategy of the present invention was demonstrated with production of TB vaccines in plants, almost any other vaccine can be also produced in the same way and this example was chosen only because of the burden need of such cheap oral TB-vaccines.
  • all proteins may not be always be expressed in high amounts but are dependent on protein, vectors, and plant host.
  • Non-injection vaccine means here any vaccine which is obtained into human or animal body through natural routes (through mucosal penetrations) without subcutaneous or non-intramuscular injections.
  • the goal of location of the vaccines inside suitable plant structures can be achieved by proper construction of the virus vectors triggering the vaccine production by proper signal molecules as exemplified in the present invention.
  • the spectrum of such signal sequences is large and several of them are still to be discovered.
  • Typical characteristic of the present invention is the existence of organelle-directing address labels in the protein-encoding gene construct. These signals direct the protein to specific plant organelles or parts like cell membranes, flowers, seeds, roots, and/or tubers.
  • the consequences of the use of the present invention is that the plant produces vaccine protein more than 5 % of the total cell protein and that the vaccine protein is isolated from other than the soluble cell cytosol fractions.
  • a specific feature of the present invention is that high amounts of the protein is achieved by transient expression systems.
  • Transient (short-term) expression of protein of interest allow obtaining milligram or even gram quantities of TB vaccine proteins or any protein of interest in a comparison to stably transformed plant (long-term expression) where the level of protein production is 100 times worse.
  • High level vaccine accumulation is very important because (i) protective vaccine effect is dose dependent in certain range of vaccine protein concentration, and (ii) plant material with high vaccine contents allows to ensure constant consistency of vaccine dose and adequate quality control.
  • the TB vaccine gene of interest can be obtained by amplifying it with the polymerase chain reaction (PCR).
  • PCR polymerase chain reaction
  • ESAT6 and Ag85B genes can be obtained by amplifying the chromosomal genomic DNA of M. tuberculosis H37Rv with PCR.
  • the construction of vector pGEM3 expressing TB vaccines is described in Example 1.
  • cDNA comprises a coding region encoding TB vaccine fusion protein(s).
  • Construction of vector pGEM3 expressing ESAT6:Ag85B fusion protein is described in Example 1.
  • Said TB vaccine may be produced in an unfolded, miss-folded, or in a natural, functional folding state. The latter possibility is preferred.
  • the TB vaccine fusion protein further comprises a signal peptide functional for targeting the fusion protein to the apoplast, plastids and other organelles and cell compartments. This may be achieved with a signal peptide that targets the fusion protein into the endoplasmatic reticulum and through the secretory pathway. All signal peptides of proteins known to be secreted or targeted to the apoplast, plastids and other organelles and cell compartments may be used for the purposes of the present invention.
  • cDNA encoding the TB vaccine protein(s) might be operably linked to specific cellular compartment regulatory sequences and affinity purification tag sequences.
  • Vector pA10194 expressing ESAT6:Ag85B fusion with His tag is described in Example 2.
  • the recombinant plasmid expressing cDNA encoding protein of the interest can be constructed from known common plant expression vectors.
  • the binary vector, co- integration vector, or a general vector which is designed not to include T-DNA region but to be capable of expressing in plant can be also used.
  • the examples of the desired binary vector include final binary vectors, for example, pA10193 and pA10194.
  • cDNA fragment encoding ESAT6:Ag85 fusion are prepared by inserting cDNA fragment encoding ESAT6:Ag85 fusion into binary vectors comprising left border of T-DNA involved in the infection of a foreign gene and right border of T-DNA for transformation of a plant cell, 35S CaMV promoter between the left border and the right border, nopalin synthase promoter, transcription termination region of 35S CaMV, and selection marker for transformants.
  • the vectors of this invention might be also non-replicable but such that allow the high TB vaccine production after suppression of the gene silencing.
  • the DNA vector is based on a virus.
  • the DNA vector is based on an RNA virus, i.e. the DNA vectors contains cDNA of the RNA viral sequences, in addition to said nucleotide sequence. Examples on the plant DNA or RNA virus sequences which may be used as the viral vectors according to the present invention are described in WO0229068 and US2004055037.
  • Such DNA vectors further contain a transcriptional promoter for producing the RNA viral transcript. Transformation or transfection is preferably carried out by viral transfection or via Agrobacterium-mediated transformation.
  • PVX vector means here a DNA or RNA vector that comprises of a PVX replicon. It is a nucleic acid sequence that may be replicated by the action of TRV replicase (an RNA polymerase) and comprises of a sense or complementary sequence derived from PVX RNA. Generally, when introduced into a host plant cell, PVX vector provides a replicase that mediates replication of the PVX replicon and expression of TB vaccine genes.
  • a TB vaccine-expressing PVX replicon comprises of a replication start site, a coding sequence for an RNA polymerase, a TB vaccine sequence and a transcriptional terminator, such as CaMV 35S terminator.
  • the PVX replicon for example, pA10422, might be operationally linked to plant-active promoters, such as CaMV 35S promoters (see Example 4). If the replicon is delivered to a plant cell as part of a DNA vector, the plant-active promoter will generally drive synthesis of the RNA strand that is then replicated and spread through the plant by the action of the PVX proteins.
  • the vector is a DNA vector designed for use with Agrobacterium-mediated transformation and contains T DNA sequences flanking the PVX replicon.
  • the flanking T DNA sequences mediate insertion of the replicon into the genome of a host plant cell.
  • Vectors for use with Agrobacterium are referred to as binary transformation vectors, and many are known in the prior art.
  • TMV vector is a DNA or RNA vector that comprises a TMV replicon.
  • a TMV replicon for example, pA103514 and pA10346, is a nucleic acid sequence that may be replicated by the action of a TMV replicase (an RNA polymerase) and comprises a sense or complementary sequence derived from a TMV RNA (see Example 6).
  • a TMV vector when introduced into a host plant cell, a TMV vector provides a replicase that mediates replication of the TMV replicon and expression of TB vaccine genes.
  • a TB vaccine-expressing TMV replicon comprises of a replication start site, a coding sequence for an RNA polymerase, a TB vaccine sequence and a transcriptional terminator, such as a CaMV 35S terminator.
  • the TMV replicon might be operably linked to plant active promoters, such as Arabidopsis Actin 2 promoter. If the replicon is delivered to a plant cell as part of a DNA vector, the plant active promoter will generally drive synthesis of an RNA strand that is then replicated and spread through the plant by the action of the TMV proteins.
  • the vector is a DNA vector designed for use with Agrobacterium-mediated transformation and contains T DNA sequences flanking the TMV replicon.
  • the flanking T DNA sequences mediate insertion of the replicon into the genome of a host plant cell.
  • Vectors for use with Agrobacterium are referred to as binary transformation vectors and many are known in the prior art.
  • the invention provides novel TB vaccine-expressing crucifer- infecting TMV (crTMV) nucleic acids and novel TB vaccine-expressing vectors based on TMV nucleic acids.
  • TMV vector is a DNA or RNA vector that comprises of a TMV replicon.
  • TMV replicon is a nucleic acid sequence that may be replicated by the action of a TMV replicase (an RNA polymerase) and comprises of a sense or complementary sequence derived from TMV RNA.
  • a TMV replicase an RNA polymerase
  • the TMV vector provides replicase that mediates replication of the TMV replicon and expression of TB vaccine genes.
  • a TB vaccine-expressing crTMV replicon for example, pA10283 and pA10413 (see Examples 5, 7), comprises of a replication start site, a coding sequence for an RNA polymerase, a TB vaccine sequence and a transcriptional terminator, such as NOS terminator.
  • the crTMV replicon might be operationally linked to plant active promoters such as Arabidopsis Actin 2 promoter. If the replicon is delivered to a plant cell as part of a DNA vector, the plant active promoter will generally drive synthesis of an RNA strand that is then replicated and spread through the plant by the action of the crTMV proteins.
  • the vector is a DNA vector designed for use with Agrobacterium-mediated transformation and contains T DNA sequences flanking the crTMV replicon.
  • the flanking T DNA sequences mediate insertion of the replicon into the genome of a host plant cell.
  • Vectors for use with Agrobacterium are referred to as binary transformation vectors of which many are known in the prior art.
  • the invention provides methods for making a TB vaccine- expressing transgenic plant, and the invention provides the resulting transgenic plants, descendants thereof, and TB vaccine protein(s) derived from such transgenic plants.
  • transgenic plant is used to refer to a plant comprising, in one or more of its cells, an exogenous nucleic acid. Accordingly, the term “transgenic plant” is intended to include both transiently and stably transformed plants, as well as plants carrying integrated or non-integrated exogenous nucleic acids. Transient transfection of grownup plants is preferred.
  • the method for introducing the vectors into the host plant can be selected depending on the type of vector.
  • transformation or transfection methods for plants or plant cells include Agrobacterium-mediated transformation, particle bombardment, PEG-aided protoplast transformation, viral infection etc.
  • transient expression of transfection for transient expression viral infection or Agrobacterium-mediated transformation are employed.
  • the plant will be contacted with an Agrobacterium culture comprising a plant viral-based vector. Co-delivery of silencing suppressors may increase PVX-mediated TB vaccine yield but TMV-based vectors (Dorokhov et al., 2004. Doklady Biochemistry and Biophysics, Vol.
  • Agrobacteria may be introduced into a plant by a variety of ways including agroinjection or vacuum infiltration (see Example 8). As disclosed herein, agroinjection of mixed Agrobacterium cultures is particularly effective for obtaining high infection levels in Nicotiana benthamiana.
  • TB-vaccine expressing vectors of the invention may be applied to both monocots and dicots. These include, for example, plants of the genus Nicotiana (e.g. tabacum or benthamiana), plants of the genus Lycopersicon (e.g. esculentum) and plants of the genus Arabidopsis (e.g. thaliana).
  • Beta vulgaris Brassica campestris, Brassica campestris ssp. napus, Brassica campest ⁇ s ssp.
  • Pekinensis Brassica juncea, Chenopodium amaranticolor, Chenopodium quinoa, Solarium tuberosum, and Spinacia oleracea.
  • TB vaccine proteins produced by the transformed plant tissue can be isolated and purified from the plant by using the known purification methods. Whether the vaccine is produced in an edible plants, it is often advantageous to use the plant itself directly as the vaccine without any purification process. Significant savings in production cost and process management can be gained. Moreover, according to the present invention when the vaccine is introduced into specific cellular compartments, like membranes, the vaccine will be more resistant to chemical and physical conditions during the administration of the vaccines.
  • the administration of the vaccine is preferably done orally with high concentration with normal food.
  • the vaccine can be also administered through mucosal parts of body, exemplified by mouth or lungs in the form of chewing gum or inhalator spray, in addition to traditional subcutaneous and parental injections that demand fulfillment of stringent regulatory issues.
  • the present invention will be furthermore illustrated below by non-limiting Examples involving different expression systems in the agroinjected N.benthamiana leaves. As described above, many other edible and non-edible plants can be used as the hosts of vaccine production. Furthermore, modifications based on well-known principles in genetic engineering can be done.
  • SEQ ID No.1 shows the nucleotide sequence of ESAT6 gene according to the present invention.
  • SEQ ID No.2 shows the nucleotide sequence of Ag85B gene according to the present invention.
  • SEQ ID No.3 shows the nucleotide sequence of ESAT6:Ag85B gene according to the present invention.
  • EXAMPLE 1 Cloning ofESAT ⁇ , Ag85B and ESAT6:Ag85B into pGEM3 vector.
  • ESAT6 and Ag85B were amplified from M. tuberculosis genome H37Rv (type strain; ATCC 27294) DNA by PCR.
  • the 2 pairs of primers were: ESAT6-BamH1p(1): CGGGATCCATGACAGAGCAGCAGTGG; ESAT6-EcoRlm(1 ):
  • ESAT6, Ag85B and ESAT6:Ag85B genes were sequenced and designated as respectively, SEQ ID No.1, SEQ ID No.2 and SEQ ID No.3.
  • EXAMPLE 2 Creation of E.coli producer of ESAT6:Ag85B-(His) 6 .
  • E.coli SG transformed with pQE30:: ESAT6:Ag85B was plated on LB solid medium containing ampicillin (100 ⁇ g/ml), and grown overnight at 37 0 C. An overnight culture of the resulting strain was used to inoculate LB with ampicillin medium and grown at 37 0 C. When the A 6 oo reached 0.7, isopropyl- ⁇ -D-thiogalactoside (IPTG) was added to a final concentration of 1 mM, the cells were incubated for another 4 h.
  • IPTG isopropyl- ⁇ -D-thiogalactoside
  • Ni-NTA column was used to purify ESAT6:Ag85B-(His) 6 .
  • the supernatant of solubilized inclusion body from 6M guanidine-HCI or 8 M urea was applied, respectively, to Ni 2+ -charged HiTrap columns pre-equilibrated with 6M guanidine-HCI in 20 mM sodium phosphate buffer or 8 M urea in 20 mM sodium phosphate buffer, pH 7.4. After sample loading, the column was washed with 6M guanidine-HCI or 8 M urea, pH 7.4.
  • ESAT6:Ag85B-(His)6 was eluted using a linear gradient with imidazole (10-500 mM) in 6 M guanidine-HCI or 8 M urea, pH 7.4, separately.
  • protein analysis showed very low ESAT6:Ag85B-(His) 6 production.
  • Our analysis showed that the Ag85B contains transmembrane domain (TM) (L 15 -T 37 ) which is likely to block the protein production.
  • TM- transmembrane domain
  • After removing TM and obtaining vector pQE30::ESAT6:Ag85B (TM-) the level of protein production drastically increased and allowed to purify ESAT6:Ag85B- (His) ⁇ -(TM-).
  • Purified ESAT6:Ag85B-(His) 6 -(TM-) protein was used for immunization of mice and generation of antibodies.
  • EXAMPLE 3 Construction of 35S-based ESAT6:Ag85B-expressing binary vector pA10193 andpA10193.
  • Ncol-Sall fragments encoding ESAT6 and Ag85B or Ag85B-(His) ⁇ were cloned into pCAMBIA1300 after linearizing with Ncol-Sall to get, respectively, pA10193 (Fig. 1) and pA10194 (Fig. 2).
  • EXAMPLE 4 Construction of PVX-based ESAT6:Ag85B-expressing binary vector PA10422.
  • EXAMPLE 5 Construction of crTMV-based ESAT6:Ag85B-expressing binary vector pA10283.
  • crTMV:GFP was recloned into pCambia 1300 after restriction with EcoRI and Apal to get pCambia- crTMV:GFP vector.
  • EXAMPLE 6 Construction of TMV Ul-based ESAT6 and Ag85B-expressing binary vectors, respectively, pA103514 and pA10346.
  • TMV Ul-based ESAT6 and Ag85B-expressing binary vectors we used the Arabidopsis thaliana Actin2 promoter-based TMV U1-GFP vector (pA2335) where GFP was fused with N-terminal part of their CP gene.
  • pA2335 the most part of the CP gene was substituted with GFP with using additional BamHI/Apal and Xbal sites introduced into the coat protein sequence and in front of the 3'-NTR, respectively.
  • the whole cassette was inserted into the binary vector pBin19 between Kpnl and Sail sites.
  • EXAMPLE 7 Construction of crTMV-based Ag85B-expressing binary vector pA10413.
  • crTMV-based Ag85B-expressing binary vectors we used the Arabidopsis thaliana Actin2 promoter-based crTMV-GFP vector (pA2211) where GFP was fused with N-terminal part of their CP gene.
  • pA2222 the most part of the CP gene was substituted with GFP with using additional BamHI/Apal and Xbal sites introduced into the coat protein sequence and in front of the 3'-NTR, respectively.
  • the whole cassette was inserted into the binary vector pBin19 between Kpnl and Hindlll sites.
  • EXAMPLE 8 Delivery of vector constructs by infiltration of Agrobacterium tumefaciens suspension into plant leaves of N. benthamiana.
  • a straightforward delivery method is the injection of Agrobacteria suspensions into intact leaves. This agroinjection was initially developed to analyze foreign gene expression and gene silencing in plants (Kaplia et al., 1997, Plant Science, .122: 101 -108; Dorokhov et al.,2004, Doklady Biochemistry and Biophysics 394:30-32).
  • Agrobacterium tumefaciens strain GV3101 was transformed with individual constructs (pA10193, pA10193, pA10422, pA10283, pA103514, pA10346, pA10413), grown in LB-medium supplemented with rifampicin 50 mg/l, carbencilin 50 mg/l and 100 ⁇ M acetosyringone at 28 0 C.
  • Agrobacterium cells from an overnight culture (5 ml) were collected by centrifugation (10 min, 4500xg) and resuspended in 10 mM MES (pH 5.5) buffer supplemented with 10 mM MgSO 4 andlOO ⁇ M acetosyringone.
  • the bacterial suspension was adjusted to a final OD 6 oo of 0.8.
  • Agrobacteria-containing vectors expressing TB vaccine was mixed with TIGS and/or VIGS suppressors in equal volumes before infiltration.
  • Agroinjection was conducted on near fully expanded leaves that were still attached to the intact plant.
  • a bacterial suspension was injected using a 5 ml syringe.
  • a vacuum of 0.5-1 bar was applied for 1-2 min and gently released. After injection, plants were further grown under greenhouse conditions at 22 0 C and 16 h light.
  • EXAMPLE 9 Expression of ESAT6-Ag85B fused protein in N.benthamiana leaves agroinjected with pA10193.
  • N.benthamiana leaves were agroinjected with pA10193 (Bin19-based vector expressing ESAT6-Ag85B fused protein).
  • pA10193 Bosset-based vector expressing ESAT6-Ag85B fused protein.
  • Three days after agroinjection proteins from sites of agroinjection were isolated and tested with ESAT6-Ag85B -specific antibodies.
  • Total proteins isolated from leaves were subjected to SDS-polyacrylamide gel electrophoresis and blotted onto polyvinylidene difluoride membranes (Amersham, Arlington Heights, III). The membranes were probed with affinity-purified rabbit antibodies that were raised against ESAT6-Ag85B.
  • FIG. 8 shows Western analysis of total proteins of N.benthamiana leaves agroinjected with pA10193 (lane 1 and 2). Bin19 empty vector was used as a negative control (lane 3). The arrow shows position of the bacterially expressed 40 kDa ESAT6-Ag85B fusion protein.
  • the estimate of the TB vaccine proteins allows to conclude that the expression of pA10193 was not less than 100 ⁇ g of TB -protein per 1g of fresh leaf tissue. Similar amount of ESAT6-Ag85B-His 6 fused protein was produced after agroinjection of N.benthamiana leaves with pA10194 (see Fig. 9). Thus, a very high expression of the TB-protein was achieved.
  • EXAMPLE 10 The ESAT6-Ag85B-His ⁇ protein accumulates in N.benthamiana leaves primarily in membrane-enriched fractions.
  • N.benthamiana leaves were agroinjected with pA10194 (Bin19-based vector expressing ESAT6-Ag85B-His 6 protein). Three days later proteins from the sites of agroinjection were isolated using differential centrifugation described (Dorokhov et al. 1999, FEBS Letters 46;223-228). The leaves (0.5 g) were homogenized in 2 ml of PBS (7.9 mM Na 2 HPO 4 , 1.5 mM KH 2 PO 4 , 150 mM NaCI; pH 7.5) plus 1 mM PMSF.
  • the homogenate was filtered through Miracloth (Calbiochem) to obtain the P1 , P30, S30 and CW fractions which were washed by PBS plus 1 mM PMSF three times to remove cytoplasmic contaminants.
  • Fractions P1, P30, S30 were mixed with sample buffer (SB), whereas CW fraction was homogenized in 10 volumes of PBS buffer plus 1 mM PMSF and 0.1% Triton X-100 and centrifuged again. This procedure was repeated five times followed by five washes (1000xg for 5 min at 4 0 C) in PBS buffer plus 1 mM PMSF. The resulting pellet was resuspended in SB.
  • Immunodetection of TB vaccine proteins was done with the mouse antiserum raised against the ESAT6:Ag85B-(His) 6 .
  • Immobilon-P filters after electrotransfer of TB vaccine proteins were incubated for 4 h at room temperature with renaturation solution containing 3% BSA in TL buffer (25 mM Tris-HCI, pH 8.0, 50 mM LiCI) with gentle mixing. Filters were washed with TL buffer three times and incubated in 20 ml of sterile TL buffer, containing 1% BSA, for 2 h at room temperature.
  • EXAMPLE 11 Expression of ESAT6-Ag85B fused protein in N.benthamiana leaves agroinjected with PVX-based pA10422 and crTMV-based vector pA10283.
  • N.benthamiana leaves were agroinjected with pA10422 or pA10283.
  • Three days later proteins from sites of agroinjection were isolated and tested with ESAT6-Ag85B - specific antibodies as described in Example 9.
  • Western analysis (Fig.11) showed the results of transient expression of ESAT6-Ag85B.
  • the level production of TB vaccine proteins allows concluding that pA10422 and pA10283 provided accumulation not less than 100 ⁇ g of TB vaccine protein from 1g of fresh leaf tissue, which significantly higher that in the prior art.
  • EXAMPLE 12 Expression of ESAT6 protein in N.benthamiana leaves agroinjected with Ul-based pA103514.
  • N.benthamiana leaves were agroinjected with pA103514. Three days later proteins from sites of agroinjection were isolated and tested with ESAT6-Ag85B -specific antibodies as described in Example 9. The ESAT6 expression resulted in the leaf necrosis after 2-3 days after agroinjection. Western analysis (Fig.12) showed transiently expressing ESAT6. The level production of ESAT6 allows concluding that pA103514 provided accumulation not more than 2 ⁇ g of TB vaccine protein per 1g of fresh leaf tissue. Such low level of accumulation was a result of the toxic effect of ESAT6 on plant cell viability. EXAMPLE 13. Expression of Ag85B protein in N.benthamiana leaves agroinjected with Ul-based pA10346 or crTMV-based pA10413 .
  • N.benthamiana leaves were agroinjected with pA10346 or pA10413.
  • Three days later proteins from sites of agroinjection were isolated and tested with ESAT6-Ag85B - specific antibodies as described in Example 9.
  • Western analysis (Figs.13 and 14) showed transiently expressing Ag85B.
  • Production level of Ag85B with pA10346 or pA10413 was more than 800 ⁇ g of TB vaccine protein from 1g of fresh leaf tissue that is extremely high and significantly higher than in prior art.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Cell Biology (AREA)
  • Biochemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Immunology (AREA)
  • Mycology (AREA)
  • Pulmonology (AREA)
  • Communicable Diseases (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Physiology (AREA)
  • Botany (AREA)
  • Developmental Biology & Embryology (AREA)
  • Environmental Sciences (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The present invention provides constructs and methods for expression and accumulation of tuberculosis vaccine proteins in tissue or organ of a plant. The proteins are obtained by transient expression in and/or stable transformation of plants with non-replicating genes or virus-based vector cDNAs encoding the proteins. The genes include cellular compartment-specific, regulatory and/or affinity purification tag sequences. The plant tissue fractions containing the tuberculosis vaccine proteins themselves or after purification are useful as a tuberculosis vaccine.

Description

IMPROVED EXPRESSION OF TUBERCULOSIS VACCINE PROTEINS IN PLANTS
FIELD OF THE INVENTION
The present invention relates to a method for producing the tuberculosis, vaccine proteins in plant cells. The method comprises producing of cDNA in monocistronic and bicistronic constructs or in constructs containing the virus vectors expressing the gene encoding the protein, introduction of said cDNA copies into the plant cells, their transient expression by Agrobacterium-based leaf infiltration or injection or by stable transformation of the plant cells, and recovering the tuberculosis vaccine proteins from plants.
BACKGROUND OF THE INVENTION
Recent development of genetic engineering allows to employ genetically modified plants for a large-scale production of target proteins as a source of vaccines as shown by several prior art publications US6194560, US5654184, US5679880, US5686079, US6042832, US6448070, US5484719, US5612487, US6034298, US6551820, US6261561, US6406885, US6528063, WO0155169, WO0194392, WO0020612, WO9918225A1 , WO9743428, WO0195934, WO0168682, WO9937784A1 , CA2221843, CA2319141 , CN1286120, US2002058312, US20030159182. The main advantages provided by plants as the factories for vaccine proteins production are: (i) plants super-express proteins capable of generating antibody production and can be used as edible vaccines that can be administered through mucosal surfaces; (ii) low cost of production, since plants require only soil, water and light instead of expensive media; (iii) no need of sterile conditions for plant cultivation; (iv), no need of the procedure of protein folding in vitro, since folding occurs in plant cells naturally in the course of processing and targeting; (v) high stability of vaccinogenes produced in plants and, in particular, those accumulated in plant cell walls; (vi) transient production of proteins in plants using cDNA constructs containing the virus expression vectors expressing the proteins, that is particularly advantageous because the maximum accumulation of the proteins require only about 4 days; (vii) the technology is entirely safe, since only selected target proteins serve as vaccinogens and the procedure of the virus-vector delivery proceeds in laboratory conditions.,
Expression systems based on the virus genome can be used for efficient protein production in plants (for a review see: Porta & Lomonossoff, 1996, MoI. Biotechnol., 5:209-221 ; Yusibov et al., 1999, Curr. Top.Microbiol. Immunol., 240:81-94). There are numerous publications and patents in this field describing systems based on DNA and RNA viral vectors (Kumagai et al., 1994, Proc. Natl. Acad. Sci. USA, 90,427-430, Mallory et al., 2002, Nature Biotechnol. 20, 622-625; Mor et al., 2003, Biotechnol. Bioeng.,81 :430-437; US5316931 ; US5589367; US5866785; US5491076; US5977438; US5981236; W002088369; W002097080; W09854342; WO2005071090).
RNA viruses are the best as the expression vectors, because they offer a higher expression level compared to DNA viruses. There are several patent publications which describe viral vectors suitable for systemic expression of transgenic material in plants (US5316931; US5589367; US5866785; WO2005071090). In general, these vectors can express a foreign gene as a translational fusion with a viral protein (US5491076; US5977438), from an additional subgenomic promoter (US5466788; US5670353; US5866785), or from polycistronic viral RNA using IRES elements for independent protein translation (WO0229068). Plant viruses were proposed for vaccine production as well (US6042832, US6448070).
Tuberculosis (TB), caused primarily by the facultative intracellular bacterium Mycobacterium tuberculosis, is the leading cause of death among single infectious agents despite of the availability of effective short-course chemotherapy. The TB epidemy is global public health tragedy that is being fueled by the spread of HIV/AIDS and the increasing incidence of multiple drug resistance. The World Health Organization (WHO) has estimated that in the next two decades more than a billion people will be newly infected and about 36 million people will die from TB if control of this disease is not substantially strengthened (WHO, 2004, Tuberculosis — Fact Sheet No.104, http://www.who.int/mediacentre/factsheets). Currently, the only available tuberculosis vaccine is the Bacille Calmette-Guerin (BCG), an alive attenuated vaccine derived from Mycobacterium bovis. Although BCG has been widely used for decades, its efficacy has been shown to be highly variable (Colditz, et al., 1994, JAMA 271 :698-702). While BCG is routinely given at birth to infants and generally protective against miliary and meningial TB in children, BCG is unable to protect against lung infections including adult pulmonary TB (Colditz et al., 1994, JAMA 271:698-702). The failure of BCG to protect older age groups likely results from of waning anti-TB immune responses about one decade after the initial immunization (Sterne et al., 1998, Int. J. Tuberc. Lung Dis. 2:200-207). Revaccination with BCG in early adulthood does not prevent the adult pulmonary disease. Moreover, the BCG vaccination seems to increase susceptibility to TB and enhance the overall risk of disease. The reasons of the failures can origin: (i) attenuation of the vaccine over time, (ii) blocking of the vaccine in adults, and/or (iii) masking of BCG vaccine efficacy in TB endemic areas. Clearly, the development of new, more effective vaccines and immunization strategies designed to protect against primary infection and to boost waning BCG-induced protective responses are needed for worldwide control of TB.
To improve TB vaccine, several antigen discovery programmes have been initiated in an attempt to find new immunogens that could constitute subunit or recombinant vaccines to replace the live vaccine Mycobacterium bovis BCG (US5591632, US5736524, US5830475, US5955077, US6673353, US20020032162, US20020177569). Among such candidate antigens, there are ESAT6 family (see review by Brodin et al., 2004, Trends in Microbiol. 12:500-508), 30/32-kDa mycolyl transferase complex, including Ag85 A, B and C (Belisle et al., 1997, Science 276:1420-1422), heat shock proteins (see review by Silva, 1999, Microbes and Infection 1j429-435) and Mtb32 and Mtb39 antigens (Brandt et al., 2004, Infection and Immunity 72:6622-6632). Many researchers have studied the TB vaccine production in E. coli expression system (Berthet et al., 1998, Microbiology 144: 3195-3203; Wang et al., 2005, Protein Expression and Purification 39:184-188), BCG (Palendira et al., 2005, Vaccine 23;1680-1685), or mammalian expression system (Derrick et al., 2004, Vaccine 23:780-788). There are several new vaccines entering clinical trials (see review by Orme, 2005, Drugs 65:2437-2444; Doherty, 2006, Lancet 367:947-49) based on recombinant BCG or animal virus genome expressing Ag85 or Ag85-ESAT fuse.
TB is common in developing countries deficient in sanitary facilities and vaccines. Evidently, if the TB vaccine proteins can be produced by stable transgenic plant (especially, edible plant) and used for producing TB vaccines, it is very economical in view of low production cost with no need for purification and efficiency in transport and storage. However, minimum of 2 years is required for construction of stably transformed transgenic plants including the plant testing and cultivation. The major obstacle in production of TB proteins in stably transformed transgenic plants is the low yield of recombinant proteins produced by "stable transgenics" (less than 0.1% of the total soluble proteins). Because in oral vaccination huge amount of vaccine is lost as proteolytic waste, it is expressly important to have very high production level. ESAT6 fused with enterotoxigenic E.coli heat-labile toxin B subunit was expressed in stably transgenic Arabidopsis thaliana using non-amplification expression vector (Rigano et al., 2004, Plant Cell Rep. 22:502-508), but the level of production was too low. Therefore, transgenic production of oral vaccines is not possible in practice.
Plant viral vectors might be considered as a promising alternative for production of TB vaccines. Plant virus expression system devoid of stable genetic transformation of a plant is exploited. This relies on transient amplification of viral vectors delivered to multiple areas of a plant organism (systemic delivery) by Agrobacteriυm. In essence, then the whole mature plant infiltrates a dilute suspension of agrobacteria carrying T- DNAs encoding RNA replicons. Plant virus-based vector provides cell-to-cell spread, amplification and high- level of expression. Only few plants are sufficient for fast production of milligram or even gram quantities of the protein. Recently, ESAT6 antigen was expressed in Nicotiana tabacum cells agroinfected with recombinant vector of potato virus X (PVX) genome (Zelada et al., 2006, Tuberculosis (Edinb). VoI 86, No 3-4, p. 263-267). The authors used the strategy which allows the production of free CP and ESAT-6 as well as fused ESAT-2A-CP to obtain recombinant chimerical virions expressing ESAT-6 at the virion surface. However, ESAT6 yield in tobacco leaves was also too low. We show in the present invention (Example 12) that that surprisingly ESAT6 is a specific protein inducing necrosis in plant leaf tissues and results in too low protein yield to be an effective vaccine.
The present invention overcomes the drawback of the low-yield vaccine production and provides an environmentally safe, economic, and non-transgenic method for production of TB vaccines in plants based on the agrobacterial infiltration or injection of the constructs containing a recombinant plant vector effecting super-expression of the TB vaccine proteins in a plant.
We found that TB vaccine proteins can be produced in plant cells transiently transformed with constructs containing a full-length copy of plant expression vectors or with non-replicating construct encoding TB vaccine proteins in the presence of transgene inducing gene silencing (TIGS). The main advantage is that TB vaccine proteins can be expressed by TMV-based vectors. Moreover, the high level of protein production is not the only consequence. The super-production of the TB vaccine proteins is also possible due to the fact that the producing cells are jointly co- agroinfiltrated with the TB-producing virus vector together with the construct producing the protein that efficiently suppress the antiviral cellular reaction termed as virus- induced gene silencing (VIGS). Whereas, our invention allows getting significant TB vaccine production without silencing suppressor co-delivery using only our upgraded TMV-based vectors described, for example, by Dorokhov et al., 2004. (Doklady Biochemistry and Biophysics, Vol. 394, pp. 30-32).
BRIEF DESCRIPTION OF THE DRAWINGS
Fig. 1 is schematic presentation of a structure of an expression module of binary vector pA10193 including "35S promoter" which is 35S promoter from CaMV, "S1 leader" is sequence of CaMV 35S RNA, "35S term" is CaMV 31UTR (polyA signal). Fig. 2 is schematic presentation of a structure of expression module of binary vector pA10194.
Fig. 3 is schematic presentation of a structure of PVX-based expression module of binary vector pA10422 where "POL PVX" is gene of RNA-dependent RNA polymerase (viral replicase) of PVX, "25K SgPr" is subgenomic promoter of PVX 25K gene. Fig. 4 is schematic presentation of a structure of crTMV-based expression module of binary vector pA10283 where LB and RB is left and right border T-DNA repeat, respectively; Arab. Act2 is Arabidopsis thaliana Act2 transcriptional promoter,
TVCV RdRp is RNA-dependent RNA polymerase of turnip vein clearing virus (TVCV); MP, movement protein gene; Ω, the 68-nt TMV Ul 5'NTR used as translational enhancer; NTR, TMV 3' nontranslated region; NOS is nopaline synthase promoter. Fig. 5 is schematic presentation of a structure of TMV Ul-based expression module of binary vector pA103514. Fig. 6 is schematic presentation of a structure of TMV Ul-based expression module of binary vector pA10346.
Fig. 7 is schematic presentation of a structure of crTMV-based expression module of binary vector pA10413.
Fig. 8 shows Western analysis of total proteins of N.benthamiana leaves transiently expressing ESAT6-Ag85B fusion protein. N.benthamiana leaves were agroinjected with pA10193 (Bin19-based vector expressing ESAT6-Ag85B fused protein; lanes 1 and 2). Bin19 empty vector was used as a negative control (lane 3). Three days after agroinjection proteins were isolated from sites of agroinjection tested with ESAT6-Ag85B specific antibodies. The arrow shows position of bacterially expressed 40 kDa fused protein. Fig. 9 (lane 1) shows western analysis of total proteins of N.benthamiana leaves transiently expressing ESAT6-Ag85B-His fused protein. N.benthamiana leaves were agroinjected with pA10194 (Bin19-based vector expressing ESAT6-Ag85B-
His fused protein). Lane 2 shows proteins of intact leaves. Arrow shows position of bacterially expressed 40 kDa fused protein. Fig.10 shows Western analysis of proteins of pA10194-mediated N.benthamiana leaves transiently expressing ESAT6-Ag85B-His fused protein after subcellular fractioning. Fractions are: S30 (lane 1), P30 (lane 2), P1 (lane 3), cell wall (CW; lane 4). The arrow shows position of bacterially expressed 40 kDa fusion protein. Fig.11 shows Western analysis of total proteins of N.benthamiana leaves transiently expressing PVX-based pA10422 (expressing ESAT6-Ag85B; lane 2 and 3) and crTMV-based vector pA10283 (lane 1 ).
Fig.12 shows Western analysis of total proteins of N.benthamiana leaves transiently expressing Ul-based pA103514 (expressing ESAT6; lanes 2 and 3) and empty vector (lane 1). The arrow shows position of 10 kDa ESAT6 protein. The non-specific bands are marked by asterisks. Fig.13 shows Western analysis of total proteins of N.benthamiana leaves transiently expressing Ul-based pA10346 (expressing Ag85B; lanes 1-3). The arrow shows position of 35 kDa Ag85B. Fig.14 shows Western analysis of total proteins of N.benthamiana leaves transiently expressing crTMV-based pA10413 (expressing Ag85B; lanes 1-4). The arrow shows position of 35 kDa Ag85B.
DETAILED DESCRIPTION OF THE INVENTION
The method of producing TB vaccine protein in plants includes the following steps: (i) construction of a recombinant plant expression plasmid by insertion of a cDNA sequence of either a genome of a virus vector expressing the TB protein, or an individual protein gene; (ii) introduction of the recombinant expression plasmid into plant cells; (iii) accumulation of proteins abolishing the gene silencing, (iv) recovery and isolation the TB vaccine from the plants. The present invention provides constructs and methods for accumulation of TB vaccine protein(s) in any plant species or in any tissue or organ of a plant. The proteins are obtained by transformation of plants (a) with virus- based vectors encoding and transiently producing the proteins operationally linked with cellular compartment-specific regulatory sequences, or (b) with individual non- replicating TB protein gene. The transformation or transfection by a recombinant vector virus is carried out preferably via Agrobacterium-meάiaied co-delivery with VIGS suppressors described, for example, by Savenkov et al., 2002. (J.Gen.Virology, VoI 83, pp. 2325-2335). Whereas, our invention allow getting significant TB vaccine production without silencing suppressor co-delivery using only our upgraded TMV-based vectors described, for example, by Dorokhov et al., 2004. (Doklady Biochemistry and biophysics, Vol. 394, pp. 30-32). Such a plant tissue is useful as anti tuberculosis vaccine.
Scientific publications teach (see for a review, Holmgren and Czerkinsky, 2005. Nature Medicine 1J.:S45-S53) that high concentration of a vaccine protein is needed for non- injection (enteral) vaccination because in oral and mucosal vaccination have high losses due to enzymatic decomposition and poor penetration through mucosal membranes. Therefore it is especially important to acquire high amounts of vaccines. On the other hand, the physico-chemical form of the vaccine protein is important for oral administration in the respect of protection against natural decomposition of the vaccine proteins in intestine and/or mucosal surfaces. The present invention was surprisingly able to combine these two important objectives with a new approach involving plant as the production machinery and plant viral vectors for. The basic embodiment of the invention is that the suppression of the natural protein destroying pathway by plant can be acquired by directing the produced vaccine proteins to be localized into separate organelles and membranes in plants and not into soluble form in the cytosol. Very high amounts of protein could be produced (up to 40% of total plant cell protein compared to less than 1% in the prior art publications) in the absence of gene silencing, high amounts of the protein could be loaded into cells, and the protein was stored in stable form. In addition, molecular capsulation (hiding) of vaccine proteins into membraneous and other plant structures is beneficial for non-invasive vaccines. Whereas the usual way of art of vaccine production demands that the vaccine must exist in soluble form, typical in cell cytosol, the present invention teaches that especially oral vaccines can be located in plant structural organelles. Although the beneficial strategy of the present invention was demonstrated with production of TB vaccines in plants, almost any other vaccine can be also produced in the same way and this example was chosen only because of the burden need of such cheap oral TB-vaccines. In spite of this general principle is working in practice and ways may be found for production of any protein, it is to be noted that all proteins may not be always be expressed in high amounts but are dependent on protein, vectors, and plant host.
Non-injection vaccine means here any vaccine which is obtained into human or animal body through natural routes (through mucosal penetrations) without subcutaneous or non-intramuscular injections.
Technically, the goal of location of the vaccines inside suitable plant structures can be achieved by proper construction of the virus vectors triggering the vaccine production by proper signal molecules as exemplified in the present invention. The spectrum of such signal sequences is large and several of them are still to be discovered. Typical characteristic of the present invention is the existence of organelle-directing address labels in the protein-encoding gene construct. These signals direct the protein to specific plant organelles or parts like cell membranes, flowers, seeds, roots, and/or tubers. The consequences of the use of the present invention is that the plant produces vaccine protein more than 5 % of the total cell protein and that the vaccine protein is isolated from other than the soluble cell cytosol fractions.
A specific feature of the present invention is that high amounts of the protein is achieved by transient expression systems. Transient (short-term) expression of protein of interest allow obtaining milligram or even gram quantities of TB vaccine proteins or any protein of interest in a comparison to stably transformed plant (long-term expression) where the level of protein production is 100 times worse. High level vaccine accumulation is very important because (i) protective vaccine effect is dose dependent in certain range of vaccine protein concentration, and (ii) plant material with high vaccine contents allows to ensure constant consistency of vaccine dose and adequate quality control.
A wide range of gene sources, e. g. human M. tuberculosis and animal M.bovis bacteria, are available for expressing TB vaccine protein(s). The TB vaccine gene of interest can be obtained by amplifying it with the polymerase chain reaction (PCR). Specifically, ESAT6 and Ag85B genes can be obtained by amplifying the chromosomal genomic DNA of M. tuberculosis H37Rv with PCR. The construction of vector pGEM3 expressing TB vaccines (ESAT6 and Ag85B) is described in Example 1.
In certain cases, cDNA comprises a coding region encoding TB vaccine fusion protein(s). Construction of vector pGEM3 expressing ESAT6:Ag85B fusion protein is described in Example 1. Said TB vaccine may be produced in an unfolded, miss-folded, or in a natural, functional folding state. The latter possibility is preferred. The TB vaccine fusion protein further comprises a signal peptide functional for targeting the fusion protein to the apoplast, plastids and other organelles and cell compartments. This may be achieved with a signal peptide that targets the fusion protein into the endoplasmatic reticulum and through the secretory pathway. All signal peptides of proteins known to be secreted or targeted to the apoplast, plastids and other organelles and cell compartments may be used for the purposes of the present invention.
In certain embodiments, cDNA encoding the TB vaccine protein(s) might be operably linked to specific cellular compartment regulatory sequences and affinity purification tag sequences. Vector pA10194 expressing ESAT6:Ag85B fusion with His tag is described in Example 2.
The recombinant plasmid expressing cDNA encoding protein of the interest can be constructed from known common plant expression vectors. The binary vector, co- integration vector, or a general vector which is designed not to include T-DNA region but to be capable of expressing in plant can be also used. In the present invention, the examples of the desired binary vector include final binary vectors, for example, pA10193 and pA10194. They are prepared by inserting cDNA fragment encoding ESAT6:Ag85 fusion into binary vectors comprising left border of T-DNA involved in the infection of a foreign gene and right border of T-DNA for transformation of a plant cell, 35S CaMV promoter between the left border and the right border, nopalin synthase promoter, transcription termination region of 35S CaMV, and selection marker for transformants. The vectors of this invention might be also non-replicable but such that allow the high TB vaccine production after suppression of the gene silencing.
One very convenient way of realizing the present invention is to use a DNA vector that is based on a virus. Preferably, the DNA vector is based on an RNA virus, i.e. the DNA vectors contains cDNA of the RNA viral sequences, in addition to said nucleotide sequence. Examples on the plant DNA or RNA virus sequences which may be used as the viral vectors according to the present invention are described in WO0229068 and US2004055037. Such DNA vectors further contain a transcriptional promoter for producing the RNA viral transcript. Transformation or transfection is preferably carried out by viral transfection or via Agrobacterium-mediated transformation.
An embodiment of the invention provides novel TB vaccine-expressing potato virus X (PVX) nucleic acids, and novel TB vaccine-expressing vectors based on PVX nucleic acids. PVX vector means here a DNA or RNA vector that comprises of a PVX replicon. It is a nucleic acid sequence that may be replicated by the action of TRV replicase (an RNA polymerase) and comprises of a sense or complementary sequence derived from PVX RNA. Generally, when introduced into a host plant cell, PVX vector provides a replicase that mediates replication of the PVX replicon and expression of TB vaccine genes.
In an exemplary embodiment, a TB vaccine-expressing PVX replicon comprises of a replication start site, a coding sequence for an RNA polymerase, a TB vaccine sequence and a transcriptional terminator, such as CaMV 35S terminator. The PVX replicon, for example, pA10422, might be operationally linked to plant-active promoters, such as CaMV 35S promoters (see Example 4). If the replicon is delivered to a plant cell as part of a DNA vector, the plant-active promoter will generally drive synthesis of the RNA strand that is then replicated and spread through the plant by the action of the PVX proteins.
In certain embodiments, the vector is a DNA vector designed for use with Agrobacterium-mediated transformation and contains T DNA sequences flanking the PVX replicon. The flanking T DNA sequences mediate insertion of the replicon into the genome of a host plant cell. Vectors for use with Agrobacterium are referred to as binary transformation vectors, and many are known in the prior art.
In contrast to Zeleda et al., 2006 (Tuberculosis VoI 86, No 3-4, p. 263-267) who used potato virus vectors, our invention provides novel TB vaccine-expressing tobacco mosaic virus (TMV) nucleic acids, and novel TB vaccine-expressing vectors based on TMV nucleic acids. A TMV vector, as the term is used herein, is a DNA or RNA vector that comprises a TMV replicon. A TMV replicon, for example, pA103514 and pA10346, is a nucleic acid sequence that may be replicated by the action of a TMV replicase (an RNA polymerase) and comprises a sense or complementary sequence derived from a TMV RNA (see Example 6). Generally, when introduced into a host plant cell, a TMV vector provides a replicase that mediates replication of the TMV replicon and expression of TB vaccine genes.
In an exemplary embodiment, a TB vaccine-expressing TMV replicon comprises of a replication start site, a coding sequence for an RNA polymerase, a TB vaccine sequence and a transcriptional terminator, such as a CaMV 35S terminator. The TMV replicon might be operably linked to plant active promoters, such as Arabidopsis Actin 2 promoter. If the replicon is delivered to a plant cell as part of a DNA vector, the plant active promoter will generally drive synthesis of an RNA strand that is then replicated and spread through the plant by the action of the TMV proteins.
In certain embodiments, the vector is a DNA vector designed for use with Agrobacterium-mediated transformation and contains T DNA sequences flanking the TMV replicon. The flanking T DNA sequences mediate insertion of the replicon into the genome of a host plant cell. Vectors for use with Agrobacterium are referred to as binary transformation vectors and many are known in the prior art.
In certain embodiments, the invention provides novel TB vaccine-expressing crucifer- infecting TMV (crTMV) nucleic acids and novel TB vaccine-expressing vectors based on TMV nucleic acids. TMV vector is a DNA or RNA vector that comprises of a TMV replicon. TMV replicon is a nucleic acid sequence that may be replicated by the action of a TMV replicase (an RNA polymerase) and comprises of a sense or complementary sequence derived from TMV RNA. Generally, when introduced into a host plant cell, the TMV vector provides replicase that mediates replication of the TMV replicon and expression of TB vaccine genes.
In an exemplary embodiments, a TB vaccine-expressing crTMV replicon, for example, pA10283 and pA10413 (see Examples 5, 7), comprises of a replication start site, a coding sequence for an RNA polymerase, a TB vaccine sequence and a transcriptional terminator, such as NOS terminator. The crTMV replicon might be operationally linked to plant active promoters such as Arabidopsis Actin 2 promoter. If the replicon is delivered to a plant cell as part of a DNA vector, the plant active promoter will generally drive synthesis of an RNA strand that is then replicated and spread through the plant by the action of the crTMV proteins.
In certain embodiments, the vector is a DNA vector designed for use with Agrobacterium-mediated transformation and contains T DNA sequences flanking the crTMV replicon. The flanking T DNA sequences mediate insertion of the replicon into the genome of a host plant cell. Vectors for use with Agrobacterium are referred to as binary transformation vectors of which many are known in the prior art.
In many embodiments, the invention provides methods for making a TB vaccine- expressing transgenic plant, and the invention provides the resulting transgenic plants, descendants thereof, and TB vaccine protein(s) derived from such transgenic plants. The term "transgenic plant" is used to refer to a plant comprising, in one or more of its cells, an exogenous nucleic acid. Accordingly, the term "transgenic plant" is intended to include both transiently and stably transformed plants, as well as plants carrying integrated or non-integrated exogenous nucleic acids. Transient transfection of grownup plants is preferred.
The method for introducing the vectors into the host plant can be selected depending on the type of vector. Several transformation or transfection methods for plants or plant cells are known in the art and include Agrobacterium-mediated transformation, particle bombardment, PEG-aided protoplast transformation, viral infection etc. For the preferred embodiment of transient expression of transfection for transient expression, viral infection or Agrobacterium-mediated transformation are employed. In the case of vectors for Agrobacterium-mediated delivery, the plant will be contacted with an Agrobacterium culture comprising a plant viral-based vector. Co-delivery of silencing suppressors may increase PVX-mediated TB vaccine yield but TMV-based vectors (Dorokhov et al., 2004. Doklady Biochemistry and Biophysics, Vol. 394, 2004, pp. 30- 32) allow to obtain significant amount of TB vaccine protein without suppressors adding. Agrobacteria may be introduced into a plant by a variety of ways including agroinjection or vacuum infiltration (see Example 8). As disclosed herein, agroinjection of mixed Agrobacterium cultures is particularly effective for obtaining high infection levels in Nicotiana benthamiana. TB-vaccine expressing vectors of the invention may be applied to both monocots and dicots. These include, for example, plants of the genus Nicotiana (e.g. tabacum or benthamiana), plants of the genus Lycopersicon (e.g. esculentum) and plants of the genus Arabidopsis (e.g. thaliana). Others include, but are not limited to, Beta vulgaris, Brassica campestris, Brassica campestris ssp. napus, Brassica campestήs ssp. Pekinensis, Brassica juncea, Chenopodium amaranticolor, Chenopodium quinoa, Solarium tuberosum, and Spinacia oleracea.
To prepare for the vaccine formulation, TB vaccine proteins produced by the transformed plant tissue can be isolated and purified from the plant by using the known purification methods. Whether the vaccine is produced in an edible plants, it is often advantageous to use the plant itself directly as the vaccine without any purification process. Significant savings in production cost and process management can be gained. Moreover, according to the present invention when the vaccine is introduced into specific cellular compartments, like membranes, the vaccine will be more resistant to chemical and physical conditions during the administration of the vaccines.
The administration of the vaccine is preferably done orally with high concentration with normal food. The vaccine can be also administered through mucosal parts of body, exemplified by mouth or lungs in the form of chewing gum or inhalator spray, in addition to traditional subcutaneous and parental injections that demand fulfillment of stringent regulatory issues.
The present invention will be furthermore illustrated below by non-limiting Examples involving different expression systems in the agroinjected N.benthamiana leaves. As described above, many other edible and non-edible plants can be used as the hosts of vaccine production. Furthermore, modifications based on well-known principles in genetic engineering can be done.
SEQ ID No.1 shows the nucleotide sequence of ESAT6 gene according to the present invention. SEQ ID No.2 shows the nucleotide sequence of Ag85B gene according to the present invention.
SEQ ID No.3 shows the nucleotide sequence of ESAT6:Ag85B gene according to the present invention. EXAMPLES
EXAMPLE 1. Cloning ofESATβ, Ag85B and ESAT6:Ag85B into pGEM3 vector.
The gene ESAT6 and Ag85B were amplified from M. tuberculosis genome H37Rv (type strain; ATCC 27294) DNA by PCR. The 2 pairs of primers were: ESAT6-BamH1p(1): CGGGATCCATGACAGAGCAGCAGTGG; ESAT6-EcoRlm(1 ):
GAGAATTCCTATGCGAACATCCCAGTG and Ag85-EcoR1p(1): ACGAATTCATGATCGGCACGGCAGCGGCT, Ag85-Sallm(1):
ACGCGTCGACCTAGCCGGCGCCTAACGAACT for amplification ESAT6 and Ag85B genes, respectively. PCR amplifications were done with 35 cycles at 94 0C for 1min, 66 0C for 1 min, and 72 0C for 1 min, followed by a final extension step at 72 0C for 2 min, using a DNA Thermal Cycler. The reaction was performed in 100 μl of buffer containing 50 mM MgSO4, 250 mM KCI, 50 mM (NH4)2SO4, 200 μM dNTPs, 100 mM Tris-HCI (pH 8.85), and 2.5 U Taq-polymerase. The PCR products were inserted into the pGEM3 vector and transferred into E. coli strain XL-1.
To create translationally fused chimeric gene ESAT6:Ag85B, two DNA fragments after PCR with pairs of primers [ESAT6-BamH1p(1) and ESAT6-EcoRlm(2):
GAGAATTCTGCGAACATCCCAGTGACGl and [Ag85-EcoRlp(2):
ACGAATTCGCTGCTACAGACGTGAGCCGAAAGATTC and Ag85-Sallm(1):
ACGCGICGACCTAGCCGGCGCCTAACGAACT] were digested with EcoRI and cloned into pGEM3 vector. ESAT6, Ag85B and ESAT6:Ag85B genes were sequenced and designated as respectively, SEQ ID No.1, SEQ ID No.2 and SEQ ID No.3.
EXAMPLE 2. Creation of E.coli producer of ESAT6:Ag85B-(His)6.
ESAT6:Ag85B chimera fused gene after PCR with primers [ESAT6-BamHlp(2): CGGGATCCCTGACAGAGCAGCAGTGG and Ag85-Sallm (2):
ACGCGTCGACCTAGCCGGCGCCTAACGAACTCTGG] was cloned into pQE30 vector and transferred into E. coli XL1. E.coli SG transformed with pQE30:: ESAT6:Ag85B was plated on LB solid medium containing ampicillin (100 μg/ml), and grown overnight at 37 0C. An overnight culture of the resulting strain was used to inoculate LB with ampicillin medium and grown at 37 0C. When the A6oo reached 0.7, isopropyl-β-D-thiogalactoside (IPTG) was added to a final concentration of 1 mM, the cells were incubated for another 4 h. After the fermentation, cells were harvested by centrifugation at 6,000xg for 15 min at 4°C. Ni-NTA column was used to purify ESAT6:Ag85B-(His)6. The supernatant of solubilized inclusion body from 6M guanidine-HCI or 8 M urea was applied, respectively, to Ni2+-charged HiTrap columns pre-equilibrated with 6M guanidine-HCI in 20 mM sodium phosphate buffer or 8 M urea in 20 mM sodium phosphate buffer, pH 7.4. After sample loading, the column was washed with 6M guanidine-HCI or 8 M urea, pH 7.4. ESAT6:Ag85B-(His)6 was eluted using a linear gradient with imidazole (10-500 mM) in 6 M guanidine-HCI or 8 M urea, pH 7.4, separately. However, protein analysis showed very low ESAT6:Ag85B-(His)6 production. Our analysis showed that the Ag85B contains transmembrane domain (TM) (L15-T37) which is likely to block the protein production. After removing TM and obtaining vector pQE30::ESAT6:Ag85B (TM-) the level of protein production drastically increased and allowed to purify ESAT6:Ag85B- (His)β-(TM-). Purified ESAT6:Ag85B-(His)6-(TM-) protein was used for immunization of mice and generation of antibodies.
EXAMPLE 3. Construction of 35S-based ESAT6:Ag85B-expressing binary vector pA10193 andpA10193.
Ncol-Sall fragments encoding ESAT6 and Ag85B or Ag85B-(His)β were cloned into pCAMBIA1300 after linearizing with Ncol-Sall to get, respectively, pA10193 (Fig. 1) and pA10194 (Fig. 2).
EXAMPLE 4. Construction of PVX-based ESAT6:Ag85B-expressing binary vector PA10422.
First, triple gene block and coat protein gene were removed from pPVX201 plasmid (Baulcombe et al., 1995, Plant J. 7:1045-1053) to obtain pPVXdt plasmid. Second, DNA fragments encoding C-terminal fragment PVX RdRp and gene from pA10193 was inserted into Hindlll-Ncol sites of pGEM3Z to get pA10422. Eventually, Avrll-Sall fragment of pA10422 was inserted into pPVXdt plasmid after restriction with Avrll and Xhol to get pA10422 (Fig. 3).
EXAMPLE 5. Construction of crTMV-based ESAT6:Ag85B-expressing binary vector pA10283. Binary Actin2-based crTMV:GFP vector described by Dorokhov et al. (2004, Doklady Biochemistry and Biophysics 394:30-32) was used as the basic construct for obtaining pA10283. First, crTMV:GFP was recloned into pCambia 1300 after restriction with EcoRI and Apal to get pCambia- crTMV:GFP vector. Then two fragments: (i) Ncol-Sall ESAT6:Ag85B from pA10193 and (ii) Xhol-Apal fragment corresponding 3'NTR of crTMV genome, were inserted into pCambia- crTMV:GFP vector linearized by EcoRI- Apal to get vector pA10283 (Fig. 4).
EXAMPLE 6. Construction of TMV Ul-based ESAT6 and Ag85B-expressing binary vectors, respectively, pA103514 and pA10346.
For construction of TMV Ul-based ESAT6 and Ag85B-expressing binary vectors we used the Arabidopsis thaliana Actin2 promoter-based TMV U1-GFP vector (pA2335) where GFP was fused with N-terminal part of their CP gene. To construct pA2335, the most part of the CP gene was substituted with GFP with using additional BamHI/Apal and Xbal sites introduced into the coat protein sequence and in front of the 3'-NTR, respectively. The whole cassette was inserted into the binary vector pBin19 between Kpnl and Sail sites. Next, three DNA fragments: (i) Hindlll-BamHI cDNA containing C-terminal part of TMV Ul MP and N-terminal part of CP; (ii) BamHI-Xbal cDNA containing ESAT6 or Ag85B, and (iii) Xbal-Notl cDNA containing TMV Ul 3'NTR, were ligated with pA2335 linearized with Hindlll-Notl to get pA103514 (Fig. 5) and pA10346 (Fig. 6), respectively .
EXAMPLE 7. Construction of crTMV-based Ag85B-expressing binary vector pA10413.
For construction of crTMV-based Ag85B-expressing binary vectors we used the Arabidopsis thaliana Actin2 promoter-based crTMV-GFP vector (pA2211) where GFP was fused with N-terminal part of their CP gene. To construct pA2222 the most part of the CP gene was substituted with GFP with using additional BamHI/Apal and Xbal sites introduced into the coat protein sequence and in front of the 3'-NTR, respectively. The whole cassette was inserted into the binary vector pBin19 between Kpnl and Hindlll sites. Then, we made intermediate construct pGEM3-based pA2211 as final of cloning two fragments: (i) cDNA encoding Ag85B, (ii) Xbal-Notl fragment containing crTMV 3'NTR, into pGEM3 linearized with Apal/Notl. Next, EcoRI/Hindlll fragment of pA2211 containing C-terminal part of crTMV MP, N-terminal (26 aa) part of CP, Ag85B and 31NTR inserted into PA2222 to get final pA10413 (Fig. 7).
EXAMPLE 8. Delivery of vector constructs by infiltration of Agrobacterium tumefaciens suspension into plant leaves of N. benthamiana.
A straightforward delivery method is the injection of Agrobacteria suspensions into intact leaves. This agroinjection was initially developed to analyze foreign gene expression and gene silencing in plants (Kaplia et al., 1997, Plant Science, .122: 101 -108; Dorokhov et al.,2004, Doklady Biochemistry and Biophysics 394:30-32). Agrobacterium tumefaciens strain GV3101 was transformed with individual constructs (pA10193, pA10193, pA10422, pA10283, pA103514, pA10346, pA10413), grown in LB-medium supplemented with rifampicin 50 mg/l, carbencilin 50 mg/l and 100 μM acetosyringone at 280C. Agrobacterium cells from an overnight culture (5 ml) were collected by centrifugation (10 min, 4500xg) and resuspended in 10 mM MES (pH 5.5) buffer supplemented with 10 mM MgSO4 andlOO μM acetosyringone. The bacterial suspension was adjusted to a final OD6oo of 0.8. Agrobacteria-containing vectors expressing TB vaccine was mixed with TIGS and/or VIGS suppressors in equal volumes before infiltration. Agroinjection was conducted on near fully expanded leaves that were still attached to the intact plant. A bacterial suspension was injected using a 5 ml syringe. Alternatively, for large-scale infiltration, all aerial parts of an entire plant were submerged into the Agrobacterium solution, and a vacuum of 0.5-1 bar was applied for 1-2 min and gently released. After injection, plants were further grown under greenhouse conditions at 220C and 16 h light.
EXAMPLE 9. Expression of ESAT6-Ag85B fused protein in N.benthamiana leaves agroinjected with pA10193.
N.benthamiana leaves were agroinjected with pA10193 (Bin19-based vector expressing ESAT6-Ag85B fused protein). Three days after agroinjection proteins from sites of agroinjection were isolated and tested with ESAT6-Ag85B -specific antibodies. Total proteins isolated from leaves were subjected to SDS-polyacrylamide gel electrophoresis and blotted onto polyvinylidene difluoride membranes (Amersham, Arlington Heights, III). The membranes were probed with affinity-purified rabbit antibodies that were raised against ESAT6-Ag85B. Goat anti-rabbit IgG conjugated with horseradish peroxidase (Sigma) were used as the secondary antibody and the reaction was visualized by chemiluminescence (ECL system, Amersham Pharmacia). Figure 8 shows Western analysis of total proteins of N.benthamiana leaves agroinjected with pA10193 (lane 1 and 2). Bin19 empty vector was used as a negative control (lane 3). The arrow shows position of the bacterially expressed 40 kDa ESAT6-Ag85B fusion protein. The estimate of the TB vaccine proteins allows to conclude that the expression of pA10193 was not less than 100 μg of TB -protein per 1g of fresh leaf tissue. Similar amount of ESAT6-Ag85B-His6 fused protein was produced after agroinjection of N.benthamiana leaves with pA10194 (see Fig. 9). Thus, a very high expression of the TB-protein was achieved.
EXAMPLE 10. The ESAT6-Ag85B-Hisβ protein accumulates in N.benthamiana leaves primarily in membrane-enriched fractions.
N.benthamiana leaves were agroinjected with pA10194 (Bin19-based vector expressing ESAT6-Ag85B-His6 protein). Three days later proteins from the sites of agroinjection were isolated using differential centrifugation described (Dorokhov et al. 1999, FEBS Letters 46;223-228). The leaves (0.5 g) were homogenized in 2 ml of PBS (7.9 mM Na2HPO4, 1.5 mM KH2PO4, 150 mM NaCI; pH 7.5) plus 1 mM PMSF. The homogenate was filtered through Miracloth (Calbiochem) to obtain the P1 , P30, S30 and CW fractions which were washed by PBS plus 1 mM PMSF three times to remove cytoplasmic contaminants. Fractions P1, P30, S30 were mixed with sample buffer (SB), whereas CW fraction was homogenized in 10 volumes of PBS buffer plus 1 mM PMSF and 0.1% Triton X-100 and centrifuged again. This procedure was repeated five times followed by five washes (1000xg for 5 min at 40C) in PBS buffer plus 1 mM PMSF. The resulting pellet was resuspended in SB. Samples were boiled in SB for 5 min and insoluble material removed by centrifugation at 5000xg in a microfuge. Polypeptides were separated by SDS-PAGE. The gels were either stained with Coomassie brilliant blue (CBB) R250 or electrotransferred to Immobilon-P (Millipore, pore size 0.45 μm).
Immunodetection of TB vaccine proteins was done with the mouse antiserum raised against the ESAT6:Ag85B-(His)6. Immobilon-P filters after electrotransfer of TB vaccine proteins were incubated for 4 h at room temperature with renaturation solution containing 3% BSA in TL buffer (25 mM Tris-HCI, pH 8.0, 50 mM LiCI) with gentle mixing. Filters were washed with TL buffer three times and incubated in 20 ml of sterile TL buffer, containing 1% BSA, for 2 h at room temperature. Filter washing with TLT buffer (25 mM Tris-HCI, pH 8.0, 50 mM LiCI, 0.1% Tween 20) was done three times for 20 min each. Then antiserum (diluted to 1/4000) in PBS containing 0.1% Tween 20 (PBST) was added for 45 min. After washing (2x20 min) with PBST blots were incubated for 45 min with affinity-purified mouse antibodies that were raised against TB vaccine proteins. Goat anti-rabbit IgG conjugated with horseradish peroxidase (Sigma) was used as the secondary antibody and the reaction was visualized by chemiluminescence (ECL, Amersham Pharmacia). Fig.10 shows that ESAT6-Ag85B- His6 protein could be isolated mainly from total proteins of membrane enriched fractions, P30 (lane 2), P1 (lane 3) and CW (lane 4).
EXAMPLE 11. Expression of ESAT6-Ag85B fused protein in N.benthamiana leaves agroinjected with PVX-based pA10422 and crTMV-based vector pA10283.
N.benthamiana leaves were agroinjected with pA10422 or pA10283. Three days later proteins from sites of agroinjection were isolated and tested with ESAT6-Ag85B - specific antibodies as described in Example 9. Western analysis (Fig.11) showed the results of transient expression of ESAT6-Ag85B. The level production of TB vaccine proteins allows concluding that pA10422 and pA10283 provided accumulation not less than 100 μg of TB vaccine protein from 1g of fresh leaf tissue, which significantly higher that in the prior art.
EXAMPLE 12. Expression of ESAT6 protein in N.benthamiana leaves agroinjected with Ul-based pA103514.
N.benthamiana leaves were agroinjected with pA103514. Three days later proteins from sites of agroinjection were isolated and tested with ESAT6-Ag85B -specific antibodies as described in Example 9. The ESAT6 expression resulted in the leaf necrosis after 2-3 days after agroinjection. Western analysis (Fig.12) showed transiently expressing ESAT6. The level production of ESAT6 allows concluding that pA103514 provided accumulation not more than 2 μg of TB vaccine protein per 1g of fresh leaf tissue. Such low level of accumulation was a result of the toxic effect of ESAT6 on plant cell viability. EXAMPLE 13. Expression of Ag85B protein in N.benthamiana leaves agroinjected with Ul-based pA10346 or crTMV-based pA10413 .
N.benthamiana leaves were agroinjected with pA10346 or pA10413. Three days later proteins from sites of agroinjection were isolated and tested with ESAT6-Ag85B - specific antibodies as described in Example 9. Western analysis (Figs.13 and 14) showed transiently expressing Ag85B. Production level of Ag85B with pA10346 or pA10413 was more than 800 μg of TB vaccine protein from 1g of fresh leaf tissue that is extremely high and significantly higher than in prior art.

Claims

1. A method for producing tuberculosis vaccine protein in plant comprising the steps of:
(a) preparing the recombinant expression plasmid by inserting cDNA fragment encoding tuberculosis vaccine protein into a Tobacco mosaic virus-based expression plasmid;
(b) introducing the plasmid of step (a) into plant cells;
(c) accumulation and recovering the tuberculosis vaccine protein in the plants of step (b).
2. The method of claim 1, wherein the tuberculosis vaccine protein is Ag85B protein or Ag85B-ESAT6 fusion protein.
3. The method according to claim 1 or 2, wherein the recombinant expression plasmid of step (a) encodes said tuberculosis vaccine protein fused with a specific sequence providing delivery of said protein into plastids or other organelles or plant cell compartments.
4. The method according to claim 1 , wherein the recombinant expression plasmid of step (a) is a non-replicating vector.
5. The method according to claim 1 , wherein the recombinant expression plasmid of step (a) is replication-competent plant virus-based vector.
6. The method according to claim 1 , wherein the recombinant expression plasmid of step (a) provides transient transformation of the plant cell.
7. The method according to claim 1 , wherein introducing the recombinant expression plasmid into the plant cells in step (b) is performed by culturing the plant cells with agrobacteria transformed with a recombinant binary vector.
8. The method according to claim 7, wherein the agrobacteria are of the species Agrobacterium tumefaciens or Agrobacterium rhizogenes.
9. The method according to claim 1 , wherein the tuberculosis vaccine protein of step (c) is a part of vaccine formulation in the crude form of plant cell itself, transgenic plant redifferentiated from plant cell, or the extract of plant cells.
10. The method according to claim 1 , wherein the cDNA sequence of step (a) is SEQ ID NO: 2 or SEQ ID NO: 3.
11. Genetically transformed plant cells derived from edible or non-edible plants containing tuberculosis vaccine protein of claim 1.
PCT/FI2007/000147 2006-06-01 2007-05-30 Improved expression of tuberculosis vaccine proteins in plants WO2007138155A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
FI20060533A FI20060533L (en) 2006-06-01 2006-06-01 Enhanced expression of tuberculosis vaccine proteins in plants
FI20060533 2006-06-01

Publications (1)

Publication Number Publication Date
WO2007138155A1 true WO2007138155A1 (en) 2007-12-06

Family

ID=36651361

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/FI2007/000147 WO2007138155A1 (en) 2006-06-01 2007-05-30 Improved expression of tuberculosis vaccine proteins in plants

Country Status (2)

Country Link
FI (1) FI20060533L (en)
WO (1) WO2007138155A1 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ITRM20080517A1 (en) * 2008-09-30 2010-04-01 Fond Parco Tecnologico Padano PRODUCTION OF NGF IN PLANT.
CN101845456A (en) * 2010-03-31 2010-09-29 暨南大学 Corn expression vector of tubercle Ag85B gene and application thereof
WO2013063059A1 (en) * 2011-10-24 2013-05-02 University Of Central Florida Research Foundation, Inc. Plastid-expressed mycobacterium tuberculosis vaccine antigens esat-6 and mtb72f fused to cholera toxin b subunit

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003020938A2 (en) * 2001-09-04 2003-03-13 Icon Genetics Ag Method of protein production in plants
WO2004101797A1 (en) * 2003-05-15 2004-11-25 Icon Genetics Ag Process of producing a plastid-targeted protein in plant cells

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003020938A2 (en) * 2001-09-04 2003-03-13 Icon Genetics Ag Method of protein production in plants
WO2004101797A1 (en) * 2003-05-15 2004-11-25 Icon Genetics Ag Process of producing a plastid-targeted protein in plant cells

Non-Patent Citations (10)

* Cited by examiner, † Cited by third party
Title
ACTA BOTANICA YUNNANICA, vol. 25, no. 2, April 2003 (2003-04-01), pages 223 - 229 *
ANDERSEN P. ET AL.: "TB subunit vaccines -putting the pieces together", MICROBES AND INFECTION, vol. 7, no. 5-6, 2005, pages 911 - 921, XP004936674 *
DATABASE BIOSIS [online] ZHANG G.-L. ET AL.: "An initial study of transgenic Carica papaya used as a kind of vaccine for anti-tuberculosis", XP008092670, Database accession no. (PREV200300311805) *
DATABASE EMBL [online] LEE C.F. ET AL., XP008092846, Database accession no. (AY207396) *
DATABASE EMBL [online] SINGH G. ET AL., XP008092845, Database accession no. (AF420491) *
DOROKHOV Y.L. ET AL.: "Reciprocal dependence between pectinmethylesterase gene expression and tobamovirus reproduction effectiveness in Nicotiana benthamiana", DOKLADY BIOCHEMISTRY AND BIOPHYSICS, vol. 394, 2004, pages 30 - 32, XP008090564 *
DOROKHOV Y.L. ET AL.: "Superexpression of tuberculosis antigens in plant leaves", TUBERCULOSIS, vol. 87, May 2007 (2007-05-01), pages 218 - 224 *
RIGANO M.M. ET AL.: "Oral immunogenity of a plant-made, subunit, tuberculosis vaccine", VACCINE, vol. 24, no. 5, 30 January 2006 (2006-01-30), pages 691 - 695, XP008092004 *
WANG L.-J. ET AL.: "The expression of Mycobacterium tuberculosis MPT64 protein in transgenic carrots", ACTA BOTANICA SINICA, vol. 43, no. 2, February 2001 (2001-02-01), pages 132 - 137, XP008090631 *
ZELADA A.M. ET AL.: "Expression of tuberculosis antigen ESAT-6 in Nicotiana tabacum using a potato virus X-based vector", TUBERCULOSIS, vol. 86, no. 3-4, May 2006 (2006-05-01) - July 2006 (2006-07-01), pages 263 - 267, XP005416887 *

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ITRM20080517A1 (en) * 2008-09-30 2010-04-01 Fond Parco Tecnologico Padano PRODUCTION OF NGF IN PLANT.
WO2010038158A1 (en) * 2008-09-30 2010-04-08 Fondazione Parco Tecnologico Padano Production of ngf in plant
CN101845456A (en) * 2010-03-31 2010-09-29 暨南大学 Corn expression vector of tubercle Ag85B gene and application thereof
CN101845456B (en) * 2010-03-31 2012-11-21 暨南大学 Corn expression vector of tubercle Ag85B gene and application thereof
WO2013063059A1 (en) * 2011-10-24 2013-05-02 University Of Central Florida Research Foundation, Inc. Plastid-expressed mycobacterium tuberculosis vaccine antigens esat-6 and mtb72f fused to cholera toxin b subunit
EP2771469A1 (en) * 2011-10-24 2014-09-03 University of Central Florida Research Foundation, Inc. Plastid-expressed mycobacterium tuberculosis vaccine antigens esat-6 and mtb72f fused to cholera toxin b subunit
EP2771469A4 (en) * 2011-10-24 2015-04-08 Univ Central Florida Res Found Plastid-expressed mycobacterium tuberculosis vaccine antigens esat-6 and mtb72f fused to cholera toxin b subunit
US20150196627A1 (en) * 2011-10-24 2015-07-16 University Of Central Florida Research Foundation, Inc. Plastid-expressed mycobacterium tuberculosis vaccine antigens esat-6 and mtb72f fused to cholera toxin b subunit

Also Published As

Publication number Publication date
FI20060533L (en) 2007-12-02
FI20060533A0 (en) 2006-06-01

Similar Documents

Publication Publication Date Title
Peyret et al. When plant virology met Agrobacterium: the rise of the deconstructed clones
Dorokhov et al. Superexpression of tuberculosis antigens in plant leaves
CA2651907C (en) Bipartite system, method and composition for the constitutive and inducible expression of high levels of foreign proteins in plants
US8535930B2 (en) Expression of proteins in plants
Choi et al. A plant virus vector for systemic expression of foreign genes in cereals
ES2350187T3 (en) SYSTEM OF EXPRESSION OF PLANTS DERIVED FROM ARN VIRUSES OF TWO COMPONENTS.
Kopertekh et al. Transient production of recombinant pharmaceutical proteins in plants: evolution and perspectives
Yusibov et al. Plant viral vectors based on tobamoviruses
KR101963792B1 (en) Rabies virus like particle production in plants
Yusibov et al. Hybrid viral vectors for vaccine and antibody production in plants
Skarjinskaia et al. Hairy roots as a vaccine production and delivery system
TW201233804A (en) Virus-like particle production in plants
Roy et al. A novel two-component Tobacco mosaic virus-based vector system for high-level expression of multiple therapeutic proteins including a human monoclonal antibody in plants
TR201802091T4 (en) Rotavirus - like particle production in plants.
Muthamilselvan et al. A transgenic plant cell‐suspension system for expression of epitopes on chimeric B amboo mosaic virus particles
Mikschofsky et al. Pea‐derived vaccines demonstrate high immunogenicity and protection in rabbits against rabbit haemorrhagic disease virus
Bolaños-Martínez et al. Expression of immunogenic poliovirus Sabin type 1 VP proteins in transgenic tobacco
WO2007138155A1 (en) Improved expression of tuberculosis vaccine proteins in plants
US6867353B2 (en) Production method of recombinant rotavirus structural proteins and vaccine composition
Wang et al. Facilitating viral vector movement enhances heterologous protein production in an established plant system
Hefferon Biopharmaceuticals in plants: toward the next century of medicine
EP2625276B1 (en) Closterovirus-based nucleic acid molecules and uses thereof
Ghiasi et al. Molecular farming, an effective system for the production of immunogenic Crimean-Congo Hemorrhagic fever virus glycoprotein
Appaiahgari et al. Plant-based edible vaccines: issues and advantages
Hajibehzad et al. High-level transient expression of the N-terminal domain of IpaD from Shigella dysenteriae in four plant species transformed with different construct configurations

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 07730616

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

NENP Non-entry into the national phase

Ref country code: RU

122 Ep: pct application non-entry in european phase

Ref document number: 07730616

Country of ref document: EP

Kind code of ref document: A1