WO2007130031A1 - Procedes de traitement de la dystrophie musculaire associee a une deficience en dysferline - Google Patents
Procedes de traitement de la dystrophie musculaire associee a une deficience en dysferline Download PDFInfo
- Publication number
- WO2007130031A1 WO2007130031A1 PCT/US2006/016980 US2006016980W WO2007130031A1 WO 2007130031 A1 WO2007130031 A1 WO 2007130031A1 US 2006016980 W US2006016980 W US 2006016980W WO 2007130031 A1 WO2007130031 A1 WO 2007130031A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- antibody
- mammal
- dysferlin
- complement
- antibodies
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2896—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against molecules with a "CD"-designation, not provided for elsewhere
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- A61K38/177—Receptors; Cell surface antigens; Cell surface determinants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P21/00—Drugs for disorders of the muscular or neuromuscular system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
Definitions
- the present invention relates to methods for the treatment of muscular dystrophy associated with dysferlin-deficiency.
- the invention relates to the use of antibodies capable of inhibiting complement as therapeutic agents to treat muscular dystrophy associated with dysferlin-deficiency.
- Muscular dystrophy represents a family of inherited diseases of the muscles. To date, there is no known treatment, medicine, or surgery that will cure muscular dystrophy, or stop the muscles from weakening. There has thus been a long felt need for new approaches and better methods to treat muscular dystrophy, including muscular dystrophy associated with dysferlin-deficiency.
- the disclosure provides methods and compositions useful for treating muscular dystrophy, particularly muscular dystrophy associated with dysferlin-deficiency.
- the disclosure provides a method of treating muscular dystrophy associated with dysferlin-deficiency in a mammal comprising administering to said mammal a therapeutically effective amount of an agent (e.g., an antibody or fragment thereof) that inhibits complement, such as for example by inhibiting the formation of the membrane attack complex (MAC).
- an agent e.g., an antibody or fragment thereof
- the agent is an antibody that comprises anti-C5 antibody, such as for example an antibody that binds C5 and prevents the cleavage of C5 to form C5a and C5b.
- the mammal is a human.
- the antibody is a whole antibody or an antibody fragment, hi certain embodiments, the whole antibody or antibody fragment is the group consisting of a polyclonal antibody, a monoclonal antibody or antibody fragment, a diabody, a chimerized or chimeric antibody or antibody fragment, a humanized antibody or antibody fragment, a deimmunized human antibody or antibody fragment, a folly human antibody or antibody fragment, a single chain antibody, an Fv, an Fab, an Fab', and an F(ab')2-
- the antibody is pexelizumab.
- the antibody is eculizumab.
- the agent is administered chronically to said mammal.
- said mammal receives a one-time administration or multiple administrations of the agent during a limited time period such as a week, a month, a year or longer.
- the agent is administered systemically to said mammal. In certain embodiments, the agent is administered locally to said mammal.
- the agent is administered in combination with another therapeutic agent to said mammal.
- the disclosure provides a method of treating muscular dystrophy associated with dysferlin-deficiency in a mammal comprising administering to said mammal a therapeutically effective amount of a CD55 agonist.
- the mammal is a human.
- the CD55 agonist increases the expression level and/or activity of CD55.
- the CD55 agonist is selected from: a polypeptide, a polypeptide analog, a nucleic acid, a nucleic acid analog, and a small molecule.
- the CD55 agonist comprises an agonistic ligand of CD97.
- the said CD55 agonist comprises an agent that is capable of preventing the association C4b and C3b to form the C3 or C5 convertase.
- the polypeptide comprises an amino acid sequence of greater than 90% sequence identity to the amino acid sequence of a soluble portion of a naturally occurring CD55 protein
- the nucleic acid comprises a polynucleotide sequence of greater than 90% sequence identity to the nucleotide sequence of a naturally occurring CD 55 mRNA.
- the polypeptide CD55 agonist is an antibody.
- the antibody is a whole antibody or an antibody fragment.
- the whole antibody or antibody fragment is the group consisting of a polyclonal antibody, a monoclonal antibody or antibody fragment, a diabody, a chimerized or chimeric antibody or antibody fragment, a humanized antibody or antibody fragment, a deimmunized human antibody or antibody fragment, a fully human antibody or antibody fragment, a single chain antibody, an Fv, an Fab, an Fab', and an F(ab') 2 .
- the antibody is an agonistic antibody that specifically binds CD 55 and increases CD 55 activity.
- the CD55 agonist is administered chronically to said mammal.
- said mammal receives a one-time administration or multiple administrations of the antibody during a limited time period such as a week, a month, a year or longer.
- the CD55 agonist is administered systemically to said mammal.
- the antibody is administered locally to said mammal.
- the CD55 agonist is administered in combination with another therapeutic agent to said mammal.
- the disclosure provides the use of an anti-C5 antibody in the manufacture of a medicament or medicament package for the treatment of muscular dystrophy associated with dysferlin-deficiency in a mammal.
- the disclosure provides the use of a CD55 agonist in the manufacture of a medicament or medicament package for the treatment of muscular dystrophy associated with dysferlin-deficiency in a mammal.
- FIGURE 1 TaqMan RT-PCR amplification plots of DAF/CD55.
- a and C DAFl (A) and DAF2 (Q expression in skeletal muscle (M. quadriceps) of a 30-wk-old SJL/J mouse compared with a C57BL/6 control mouse of the same age (Ctrl).
- E DAF/CD55 expression in skeletal muscle of a patient with LGMD2B (patient 4, Table III) compared with a healthy control.
- Housekeeping genes porphobilinogen deaminase (B and D) and / ⁇ -microglobulin (F) were used as internal standards.
- FIGURE 2. DAP/CD55 protein expression in dysferlin deficiency.
- A-D Murine skeletal muscle.
- A-D have the same scale as indicated in B.
- E and F Murine cardiac muscle.
- E and F have the same scale as indicated in F.
- G and H Human skeletal muscle.
- G and H have the same scale as indicated in H.
- FIGURE 3 Complement lysis assay and binding of C5b9-MAC to nonnecrotic muscle cells.
- A Quantification of PI uptake of myotubes after exposure to complement (ratio of Pi-positive cells after exposure to complement to Veronal buffer control), n, number of wells counted.
- F and G Serial sections of quadriceps muscle in LGMD2B (patient 1), demonstrating dystrophic changes with increase in connective tissue and pathological variation in fiber size (Gomori-TriChrome stain). There was sarcolemmal expression of C5b9-MAC on nonnecrotic muscle fibers. Staining was performed with anti-C5b9 mAb and Cy3-labeled donkey anti-mouse Ab.
- FIGURE 4 Expression of regulatory factors in skeletal muscle of dysferlin- deficient patients and SJL/J mice (aged 20-30 wk).
- A Unpooled TaqMan analysis of myostatin, SMAD3, SMALM, CARP, and EGRl (only human). The , y-axis demonstrates the fold change compared with healthy individuals and C57BL/6 mice, respectively.
- B and C Double-immunofluorescent staining of SMAD2 protein (FITC) and nuclear membrane with anti-lamin AJC mAb (Cy3) on dysferlin- deficient (patient 4, Table III; B) and normal (Q human skeletal muscle.
- FITC SMAD2 protein
- Cy3 nuclear membrane with anti-lamin AJC mAb
- the present invention relates, in part, to the discovery that CD55 is down- regulated in the skeletal muscle of dysferlin-deficient mice or human patients suffering from LGMD2B. Accordingly, methods and compositions are provided for treating muscular dystrophy, particularly muscular dystrophy associated with dysferlin deficiency.
- the term “treating” includes prophylactic and/or therapeutic treatments.
- the term “prophylactic or therapeutic” treatment is art-recognized and includes administration to the host of one or more of the subject therapeutic agents or pharmaceutical compositions.
- the methods and compositions of the disclosure employ a therapeutic agent that can inhibit complement activity, such as for example, by preventing the formation of MAC; in specific embodiments, such a therapeutic agent may comprise an antibody that binds to C5 and inhibits C5 activity (for example, by preventing the cleavage of C5 into C5a and C5b).
- the methods and compositions of the disclosure employ a therapeutic agent that is a CD55 agonist and capable of directly or indirectly increasing or potentiating an activity and/or expression of CD55.
- a therapeutic agent that is a CD55 agonist and capable of directly or indirectly increasing or potentiating an activity and/or expression of CD55.
- activation of the complement cascade has been identified on the surface of nonnecrotic muscle fibers in some patients with LGMD (1) and, in particular, in dysferlinopathies (2).
- Deposition of MAC on nonnecrotic muscle fibers in muscular dystrophies was surprising, in particular because this mechanism does not play a role in inflammatory muscle diseases (1).
- the complement system consists of >30 plasma and cell surface proteins. It is activated by three different pathways, named classical, alternative, and lectin pathway, respectively (3,4).
- the complement system acts in conjunction with other immunological systems of the body to defend against intrusion of cellular and viral pathogens.
- complement proteins There are at least 25 complement proteins, which are found as a complex collection of plasma proteins and membrane cofactors.
- the plasma proteins (which are also found in most other body fluids, such as lymph, bone marrow, synovial fluid, and cerebrospinal fluid) make up about 10% of the globulins in vertebrate serum.
- Complement components achieve their immune defensive functions by interacting in a series of intricate but precise enzymatic cleavage and membrane binding events. The resulting complement cascade leads to the production of products with opsonic, immunoregulatory, and lytic functions.
- the complement cascade progresses via the classical pathway or the alternative pathway. These pathways share many components, and, while they differ in their early steps, both converge and share the same terminal complement components responsible for the destruction of target cells and viruses.
- the classical complement pathway is typically initiated by antibody recognition of and binding to an antigenic site on a target cell. This surface bound antibody subsequently reacts with the first component of complement, Cl.
- the Cl thus bound undergoes a set of autocatalytic reactions that result in, inter alia, the induction of Cl proteolytic activity acting on complement components C2 and C4. This activated Cl cleaves C2 and C4 into C2a, C2b, C4a, and C4b. The function of C2b is poorly understood.
- C2a and C4b combine to form the C4b,2a complex, which is an active protease known as classical C3 convertase.
- C4b,2a acts to cleave C3 into C3a and C3b.
- C3a and C4a are both relatively weak anaphylatoxins that may induce degranulation of mast cells, resulting in the release of histamine and other mediators of inflammation.
- C3b has multiple functions. As opsonin, it binds to bacteria, viruses and other cells and particles and tags them for removal from the circulation. C3b can also form a complex with C4b,C2a to produce C4b,2a,3b, or classical C5 convertase, which cleaves C5 into C5a (another anaphylatoxin) and C5b. Alternative C5 convertase is C3b, Bb, C3b and performs the same function. C5b combines with C6 yielding C5b,6, and this complex combines with C7 to form the ternary complex C5b,6,7. The C5b,6,7 complex binds C8 at the surface of a cell membrane. Upon binding of C9, the complete membrane attack complex (MAC) is formed (C5b-9) which mediates the lysis of foreign cells, microorganisms, and viruses.
- MAC complete membrane attack complex
- Decay accelerating factor (DAF) (CD55) (NM_000574) can bind C4b and C3b dissociating the C3 and C5 convertases in both the classical and alternative pathways (Markrides, Pharmacol Rev. 1998 Mar;50(l):59-87).
- CD55 is also a known agonist of CD97 (Visser et al., Pharmacol Rev. 1998 Mar;50(l):59-87; and Hamann et al., J Exp Med. 1996 Sep 1;184(3): 1185-9).
- Soluble versions of DAF (sDAF) have been shown to inhibit complement activation (Christiansen et al., Eur J Immunol. 1996 Mar;26(3):578-85; and Moran et al., J Immunol. 1992 Sep l;149(5):1736-43).
- Duchenne dystrophy Some forms affect children (e.g., Duchenne dystrophy) and are lethal within two to three decades. Other forms present in adult life and are more slowly progressive.
- the genes for several dystrophies have been identified, including Duchenne dystrophy (caused by mutations in the dystrophin gene) and the teenage and adult onset Miyoshi dystrophy or its variant, limb girdle dystrophy 2B or LGMD-2B (caused by mutations in the dysferlin gene). These are "loss of function" mutations that prevent expression of the relevant protein in muscle and thereby cause muscle dysfunction.
- Dysferlin is a 230-kDa membrane-spanning protein consisting of a single C- terminal transmembrane domain and six C2 domains (7). In normal muscle, sarcolemma injuries lead to accumulation of dysferlin-enriched membrane patches and resealing of the membrane in the presence of Ca . Dysferlin deficiency results in defective membrane repair mechanisms (8, 9). An impaired interaction between dysferlin and annexins Al and A2 has been discussed as a possible mechanism (9).
- dysferlin is expressed in human skeletal and cardiac muscles (7)
- mutations in the encoding gene lead only to skeletal muscle phenotypes without myocardial involvement, namely limb girdle muscular dystrophy 2B (LGMD2B) and Miyoshi myopathy (10).
- SJL/J mice harbors a splice site mutation that results in a deletion corresponding to human exon 45 (12).
- SJL/J mice have long served as a model for autoimmune diseases, such as experimental allergic encephalomyelitis and myositis. The development of lymphomas is typically observed in older age. Therefore, it has been discussed whether other genetic disorders, apart from dysferlin deficiency, might play a role in SJL/J, and more defined models were engineered (13, 14).
- a mouse with a 12-kb deletion at the 3' end leading to complete loss of dysferlin was designed.
- corticosteroids include corticosteroids, calcium ionophores and/or blockers of the sarcoplasmic reticulum calcium reuptake pump, mast-cell stabilizers such as cromoglycate, clenbutarol (a non-steroid b2 adrenoreceptor agonist), creatine or creatine monohydrate, and gentamicin.
- mast-cell stabilizers such as cromoglycate, clenbutarol (a non-steroid b2 adrenoreceptor agonist), creatine or creatine monohydrate, and gentamicin.
- the present invention relates to a method for treating muscular dystrophy associated with dysferlin-deficiency by the administration of an agent capable of inhibiting complement (for example, by inhibiting the formation of MAC) to a patient in need of such treatment, hi particular embodiments, the agent inhibits the formation of the MAC by inhibiting the cleavage of C5 into C5a and C5b or the formation of C3 and/or C5 convertases.
- a complement inhibitor may be a small molecule (up to 6,000 Da in molecular weight), a nucleic acid or nucleic acid analog, a peptidomimetic, or a macromolecule that is not a nucleic acid or a protein.
- complement inhibitor may be an antibody capable of inhibiting complement, such as an antibody that can block the formation of MAC.
- an antibody complement inhibitor may include an anti-C5 antibody.
- anti-C5 antibodies may directly interact with C5, C5a, and/or C5b, so as to inhibit the formation of and/or physiologic function of C5a and/or C5b.
- the concentration and/or physiologic activity of C5a and C5b in a body fluid can be measured by methods well known in the art.
- C5a such methods include chemotaxis assays, RIAs, or ELISAs (see, for example, Ward and Zvaifler, J Clin Invest. 1971 Mar;50(3):606-16.; Wurzner, et al., Complement Inflamm. 8:328-340, 1991).
- C5b hemolytic assays or assays for soluble C5b-9 as discussed herein can be used. Other assays known in the art can also be used.
- candidate antibodies capable of inhibiting complement such as anti-C5 antibodies, now known or subsequently identified, can be screened in order to 1) identify compounds that are useful in the practice of the invention and 2) determine the appropriate dosage levels of such compounds.
- An antibody capable of inhibiting complement such as an anti-C5 antibody affecting C5a is preferably used at concentrations providing substantial reduction (i.e., reduction by at least about 25%) in the C5a levels present in at least one blood- derived fluid of the patient, e.g., blood, plasma, or serum, following activation of complement within the fluid.
- an antibody capable of inhibiting complement such as an anti-C5 antibody affecting C5b is preferably used at concentrations providing substantial reduction (i.e., reduction by at least about 25% as compared to that in the absence of the anti-C5 antibody) in the C5b levels present in at least one blood-derived fluid of the patient following activation of complement within the fluid.
- concentrations can be conveniently determined by measuring the cell-lysing ability (e.g., hemolytic activity) of complement present in the fluid or the levels of soluble C5b-9 present in the fluid.
- a specific concentration for an antibody that affects C5b is one that results in a substantial reduction (i.e., a reduction by at least about 25%) in the cell-lysing ability of the complement present in at least one of the patient's blood-derived fluids.
- Reductions of the cell-lysing ability of complement present in the patient's body fluids can be measured by methods well known in the art such as, for example, by a conventional hemolytic assay such as the hemolysis assay described by Kabat and Mayer (eds), "Experimental Immunochemistry, 2d Edition", 135-240, Springfield, IL, CC Thomas (1961), pages 135-139, or a conventional variation of that assay such as the chicken erythrocyte hemolysis method described below.
- Specific antibodies capable of inhibiting complement such as an anti-C5 antibody are relatively specific, and do not block the functions of early complement components.
- specific agents will not substantially impair the opsonization functions associated with complement component C3b, which functions provide a means for clearance of foreign particles and substances from the body.
- C3b is generated by the cleavage of C3, which is carried out by classical and/or alternative C3 convertases, and results in the generation of both C3a and C3b. Therefore, in order not to impair the opsonization functions associated with C3b, specific antibodies capable of inhibiting complement such as an anti-C5 antibody do not substantially interfere with the cleavage of complement component C3 in a body fluid of the patient (e.g., serum) into C3a and C3b. Such interference with the cleavage of C3 can be detected by measuring body fluid levels of C3a and/or C3b, which are produced in equimolar ratios by the actions of the C3 convertases.
- a body fluid of the patient e.g., serum
- Such measurements are informative because C3a and C3b levels will be reduced (compared to a matched sample without the antibody capable of inhibiting complement such as an anti-C5 antibody) if cleavage is interfered with by an antibody capable of inhibiting complement such as an anti-C5 antibody.
- C3a levels in a body fluid can be measured by methods well known in the art such as, for example, by using a commercially available C3a EIA kit, e.g., that sold by Quidel Corporation, San Diego, Calif., according to the manufacturer's specifications.
- C3a EIA kit e.g., that sold by Quidel Corporation, San Diego, Calif.
- Particularly specific antibodies capable of inhibiting complement such as an anti-C5 antibody produce essentially no reduction in body fluid C3a levels following complement activation when tested in such assays. Certain antibodies of the disclosure will prevent the cleavage of C5 to form
- C5a and C5b thus preventing the generation of the anaphylatoxic activity associated with C5a and preventing the assembly of the membrane attack complex associated with C5b.
- these anti-C5 antibodies will not impair the opsonization function associated with the action of C3b.
- a specific method of inhibiting complement activity is to use a monoclonal antibody which binds to complement C5 and prevents C5 from being cleaved. This prevents the formation of both C5a and C5b-9 while at the same time allowing the formation of C3a and C3b which are beneficial to the recipient.
- Such antibodies that are specific to human complement are known (U.S. Patent 6,355,245). These antibodies disclosed in U.S.
- Patent 6,355,245 include both a whole or full-length antibody (now named eculizumab) and a single-chain antibody (now named pexelizumab).
- a similar antibody against mouse C5 is called BB5.1 (Frei Y, et al. (1987). MoI. Cell Probes 1:141-149).
- BB5.1 was utilized in the experiments set forth below.
- Antibodies to inhibit complement activity need not be monoclonal antibodies. They can be, e.g., polyclonal antibodies. They may additionally be antibody fragments.
- An antibody fragment includes, but is not limited to, an Fab, F(ab'), F(ab') 2 , a single-chain antibody, a domain antibody, and an Fv.
- antibodies can be humanized (Jones PT, et al. (1986). Nature 321:522-525), chimerized, or deimmunized.
- An antibody may also comprise a mutated Fc portion, such that the mutant Fc does not activate complement.
- the antibodies to be used in the present invention may be any of these.
- Antibody analogs or mimics can also be used in the present invention, such as those described in U.S. Patent Application Publication No. 20050255548.
- the disclosure provides a method of treating muscular dystrophy associated with dysferlin-def ⁇ ciency in a mammal comprising administering to said mammal a therapeutically effective amount of a CD55 agonist.
- the mammal is a human.
- the CD55 agonist increases the expression and/or activity of CD55.
- the CD55 agonist comprises an agonistic ligand of CD97.
- the CD55 agonist comprises an agent that inhibits the association of C4b and C3b.
- the CD55 agonist blocks the formation of C3 or C5 convertases.
- CD55 activity can be measured by conventional methods, such as for example by measuring decay dissociation of the C4b2a enzyme, as described in Medof et al., J Exp Med. 160(5):1558-78 (1984).
- a therapeutic agent of the disclosure can be administered to a patient in need thereof as a single therapy.
- a therapeutic agent of the disclosure can be administered to a patient in need thereof in the form of combination therapy or adjuvant therapy.
- Such combination or adjuvant therapy further includes one or more other agents, such as other therapeutic agents (e.g., drugs or biologies) or nutritional agents (e.g., nutraceuticals or dietary supplements).
- other therapeutic agents e.g., drugs or biologies
- nutritional agents e.g., nutraceuticals or dietary supplements.
- combination therapy may include either simultaneous or sequential dosing or administration of the various agents as desired.
- a therapeutic agent comprises an antibody or antibody fragment to C5 (or an anti-C5 antibody or fragment thereof).
- an anti-C5 antibody or fragment thereof binds C5 and inhibits C5 activity.
- an anti-C5 antibody or its fragment of the disclosure binds C5 and blocks the cleavage of C5 to form C5a and C5b.
- an anti-C5 antibody or fragment thereof binds C5 and results in a more rapid clearance of C5 from the plasma than will occur in the absence of the anti-C5 antibody or fragment thereof.
- the CD55 agonist includes a polypeptide, a polypeptide analog, a nucleic acid, a nucleic acid analog, or a small molecule, or any combination thereof.
- the polypeptide comprises an amino acid sequence of greater than 90% sequence identity to the amino acid sequence of a soluble portion of a naturally occurring CD55 protein.
- the nucleic acid comprises a polynucleotide sequence of greater than 90% sequence identity to the nucleotide sequence of a naturally occurring CD55 mRNA.
- Percent (%) nucleic acid or amino acid sequence identity is defined as the percentage of nucleotides or amino acids in a candidate sequence that are identical with the nucleotides or amino acids in a reference sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity. Alignment for purposes of determining percent nucleic acid sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, BLAST-2, ALIGN, ALIGN-2 or Megalign (DNASTAR) software. Appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full-length of the sequences being compared can be determined by known methods.
- Rational drug design may also be employed.
- the interaction interface of CD55 may be targeted when designing a compound.
- Rational drug design can also be achieved based on known compounds, e.g., a known agonist of CD55.
- Peptidomimetics can be compounds in which at least a portion of a subject polypeptide of the disclosure (such as for example, a polypeptide comprising an amino acid sequence of greater than 90% sequence identity to the amino acid sequence of a soluble portion of a naturally occurring CD55 protein) is modified, and the three dimensional structure of the peptidomimetic remains substantially the same as that of the subject polypeptide.
- Peptidomimetics may be analogues of a subject polypeptide of the disclosure that are, themselves, polypeptides containing one or more substitutions or other modifications within the subject polypeptide sequence.
- at least a portion of the subject polypeptide sequence may be replaced with a nonpeptide structure, such that the three-dimensional structure of the subject polypeptide is substantially retained.
- one, two or three amino acid residues within the subject polypeptide sequence may be replaced by a non-peptide structure, hi addition, other peptide portions of the subject polypeptide may, but need not, be replaced with a non-peptide structure.
- Peptidomimetics may have improved properties (e.g., decreased proteolysis, increased retention or increased bioavailability). Peptidomimetics generally have improved oral availability, which makes them especially suited to treatment of disorders in a human or animal. It should be noted that peptidomimetics may or may not have similar two-dimensional chemical structures, but share common three-dimensional structural features and geometry. Each peptidomimetic may further have one or more unique additional binding elements.
- Antibodies are found in multiple forms, e.g., IgA, IgG, IgM, etc. Additionally, antibodies can be engineered in numerous ways. They can be made as single-chain antibodies (including small modular immunopharaiaceuticals or SMIPsTM), Fab and F(ab') 2 fragments, etc. Antibodies can be humanized, chimerized, deimmunized, or fully human. Numerous publications set forth the many types of antibodies and the methods of engineering such antibodies. For example, see U.S. Patent Nos. 6,355,245; 6,180,370; 5,693,762; 6,407,213; 6,548,640; 5,565,332; 5,225,539; 6,103,889; and 5,260,203.
- This invention provides fragments of anti-C5 antibodies or CD55 agonist antibodies, which may comprise a portion of an intact antibody, preferably the antigen-binding or variable region of the intact antibody.
- antibody fragments include Fab, Fab', F(ab') 2 , and Fv fragments; diabodies; linear antibodies (Zapata et al., Protein Eng.1995; 8(10): 1057-1062); single-chain antibody molecules; and multispecific antibodies formed from antibody fragments.
- Papain digestion of antibodies produces two identical antigen-binding fragments, called "Fab” fragments, each with a single antigen-binding site, and a residual "Fc" fragment, whose name reflects its ability to crystallize readily.
- Fv usually refers to the minimum antibody fragment that contains a complete antigen-recognition and -binding site. This region consists of a dimer of one heavy- and one light-chain variable domain in tight, non-covalent association. It is in this configuration that the three CDRs of each variable domain interact to define an antigen-binding site on the surface of the V H -V L dimer.
- the six CDRs confer antigen-binding specificity to the antibody.
- a single variable domain or half of an Fv comprising only three CDRs specific for an antigen
- the Fab fragment also contains the constant domain of the light chain and the first constant domain (CHl) of the heavy chain.
- Fab' fragments differ from Fab fragments by the addition of a few residues at the carboxy terminus of the heavy chain CHl domain including one or more cysteines from the antibody hinge region.
- Fab '-SH is the designation herein for Fab' in which the cysteine residue(s) of the constant domains bear a free thiol group.
- F(ab') 2 antibody fragments originally were produced as pairs of Fab' fragments that have hinge cysteines between them. Other chemical couplings of antibody fragments are also known.
- a monoclonal antibody can be obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical except for possible naturally-occurring mutations that may be present in minor amounts. Monoclonal antibodies are highly specific, being directed against a single antigenic site. Furthermore, in contrast to conventional (polyclonal) antibody preparations that typically include different antibodies directed against different determinants (epitopes), each monoclonal antibody is directed against a single determinant on the antigen. In addition to their specificity, the monoclonal antibodies are advantageous in that they are often synthesized by the hybridoma culture, uncontaminated by other immunoglobulins.
- Monoclonal antibodies may also be produced in transfected cells, such as CHO cells and NSO cells.
- the modifier "monoclonal” indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies and does not require production of the antibody by any particular method.
- the monoclonal antibodies to be used in accordance with the present disclosure may be made by the hybridoma method first described by Kohler et al., Nature 1975; 256:495, or may be made by recombinant DNA methods ⁇ see, e.g., U.S. Patent Nos. 4,816,567 and 6,331,415).
- the "monoclonal antibodies” may also be isolated from phage antibody libraries using the techniques described in Clackson et al., Nature 1991; 352:624-628 and Marks et al., J MoI. Biol.1991; 222:581-597, for example.
- oligoclonal antibodies refers to a predetermined mixture of distinct monoclonal antibodies. See, e.g., PCT publication WO 95/20401; U.S. Patent Nos. 5,789,208 and 6,335,163. hi one embodiment, oligoclonal antibodies consisting of a predetermined mixture of antibodies against one or more epitopes are generated in a single cell. In other embodiments, oligoclonal antibodies comprise a plurality of heavy chains capable of pairing with a common light chain to generate antibodies with multiple specificities ⁇ e.g., PCT publication WO 04/009618).
- Oligoclonal antibodies are particularly useful when it is desired to target multiple epitopes on a single target molecule ⁇ e.g., C5 or CD55).
- those skilled in the art can generate or select antibodies or mixture of antibodies that are applicable for an intended purpose and desired need.
- one or more of the CDRs are derived from an anti-human C5 antibody or CD55 agonist antibody.
- all of the CDRs are derived from an anti-human C5 antibody or CD55 agonistic antibody.
- the CDRs from more than one anti-human C5 antibody or CD55 agonist antibody are mixed and matched in a chimeric antibody.
- a chimeric antibody may comprise a CDRl from the light chain of a first anti-human C5 antibody or CD55 agonist antibody combined with CDR2 and CDR3 from the light chain of a second anti-human C5 antibody or CD55 agonist antibody, and the CDRs from the heavy chain may be derived from a third anti-human C5 antibody or CD55 agonist antibody.
- the framework regions may be derived from one of the same anti-human C5 antibodies or CD55 agonist antibodies, from one or more different antibodies, such as a human antibody, or from a humanized antibody.
- Single-chain Fv or “scFv” antibody fragments comprise the V H and V L domains of an antibody, wherein these domains are present in a single polypeptide chain.
- the Fv polypeptide further comprises a polypeptide linker between the V H and V L domains that enables the scFv to form the desired structure for antigen binding.
- diabodies refers to small antibody fragments with two antigen- binding sites, which fragments comprise a heavy-chain variable domain (V H ) connected to a light-chain variable domain (VL) in the same polypeptide chain (V H - V L ).
- V H heavy-chain variable domain
- VL light-chain variable domain
- the domains are forced to pair with the complementary domains of another chain and create two antigen-binding sites.
- Diabodies are described more fully in, for example, EP 404,097; WO 93/11161; and Hollinger et al., Proc. Natl. Acad. Sci. USA, 90: 6444-6448 (1993).
- an “isolated” antibody is one that has been identified and separated and/or recovered from a component of its natural environment. Contaminant components of its natural environment are materials that would interfere with diagnostic or therapeutic uses for the antibody, and may include enzymes, hormones, and other proteinaceous or nonproteinaceous solutes.
- the antibody will be purified to greater than 95% by weight of antibody as determined by the Lowry method, or greater than 99% by weight, to a degree that complies with applicable regulatory requirements for administration to human patients (e.g., substantially pyrogen-free), to a degree sufficient to obtain at least 15 residues of N- terminal or internal amino acid sequence by use of a spinning cup sequenator, or to homogeneity by SDS-PAGE under reducing or nonreducing conditions using
- Isolated antibody includes the antibody in situ within recombinant cells, since at least one component of the antibody's natural environment will not be present. Ordinarily, however, isolated antibody will be prepared by at least one purification step, for example, an affinity chromatography step, an ion (anion or cation) exchange chromatography step, or a hydrophobic interaction chromatography step.
- the Fc portions of antibodies are recognized by specialized receptors expressed by immune effector cells.
- the Fc portions of IgGl and IgG3 antibodies are recognized by Fc receptors present on the surface of phagocytic cells such as macrophages and neutrophils, which can thereby bind and engulf the molecules or pathogens coated with antibodies of these isotypes (C. A. Janeway et al., Immunobiology 5th edition, page 147, Garland Publishing (New York, 2001)).
- single chain antibodies and chimeric, humanized or primatized (CDR-grafted) antibodies, as well as chimeric or CDR-grafted single chain antibodies, comprising portions derived from different species, are also encompassed by the present disclosure as antigen-binding fragments of an antibody.
- the various portions of these antibodies can be joined together chemically by conventional techniques, or can be prepared as a contiguous protein using genetic engineering techniques.
- nucleic acids encoding a chimeric or humanized chain can be expressed to produce a contiguous protein. See, e.g., U.S.
- functional fragments of antibodies including fragments of chimeric, humanized, primatized or single chain antibodies, can also be produced.
- Functional fragments of the subject antibodies retain at least one binding function and/or modulation function of the full-length antibody from which they are derived.
- Preferred functional fragments retain an antigen-binding function of a corresponding full-length antibody (such as for example, ability of anti-C5 antibody to bind C5 or an anti-CD55 antibody to bind CD55).
- the anti-C5 antibodies or CD55 agonist antibodies can be administered in a variety of unit dosage forms.
- the dose will vary according to the particular antibody. For example, different antibodies may have different masses and/or affinities, and thus require different dosage levels.
- Antibodies prepared as Fab fragments will also require differing dosages than the equivalent intact immunoglobulins, as they are of considerably smaller mass than intact immunoglobulins, and thus require lower dosages to reach the same molar levels in the patient's blood.
- the dose will also vary depending on the manner of administration, the particular symptoms of the patient being treated, the overall health, condition, size, and age of the patient, and the judgment of the prescribing physician.
- Dosage levels of the antibodies for human subjects are generally between about 1 mg per kg and about 100 mg per kg per patient per treatment, and preferably between about 5 mg per kg and about 50 mg per kg per patient per treatment.
- the antibody concentrations are preferably in the range from about 25 ⁇ g/mL to about 500 ⁇ g/mL. However, greater amounts may be required for extreme cases and smaller amounts may be sufficient for milder cases.
- Administration of the anti-C5 antibodies will generally be performed by an intravascular route, e.g., via intravenous infusion by injection. Other routes of administration may be used if desired but an intravenous route will be the most preferable. Formulations suitable for injection are found in Remington's
- Such formulations must be sterile and non-pyrogenic, and generally will include a pharmaceutically effective carrier, such as saline, buffered (e.g., phosphate buffered) saline, Hank's solution, Ringer's solution, dextrose/saline, glucose solutions, and the like.
- a pharmaceutically effective carrier such as saline, buffered (e.g., phosphate buffered) saline, Hank's solution, Ringer's solution, dextrose/saline, glucose solutions, and the like.
- the formulations may contain pharmaceutically acceptable auxiliary substances as required, such as, tonicity adjusting agents, wetting agents, bactericidal agents, preservatives, stabilizers, and the like.
- Administration of the antibodies capable of inhibiting complement such as an anti-C5 antibody will generally be performed by a parenteral route, typically via injection such as intra- articular or intravascular injection (e.g., intravenous infusion) or intramuscular injection. Other routes of administration, e.g., oral (p.o.), may be used if desired and practicable for the particular antibody capable of inhibiting complement to be administered.
- Antibodies capable of inhibiting complement such as an anti-C5 antibody can also be administered in a variety of unit dosage forms and their dosages will also vary with the size, potency, and in vivo half-life of the particular antibody capable of inhibiting complement being administered. Doses of antibodies capable of inhibiting complement such as an anti-C5 antibody will also vary depending on the manner of administration, the particular symptoms of the patient being treated, the overall health, condition, size, and age of the patient, and the judgment of the prescribing physician.
- a typical therapeutic treatment includes a series of doses, which will usually be administered concurrently with the monitoring of clinical endpoints such as deposition of membrane attack complex (MAC) on nonnecrotic muscle fibers, age at reaching Hammersmith score of 30/40, age at becoming wheelchair bound, muscle pain or spasms, etc., with the dosage levels adjusted as needed to achieve the desired clinical outcome, hi certain embodiments, treatment is administered in multiple dosages over at least a week. In certain embodiments, treatment is administered in multiple dosages over at least a month. In certain embodiments, treatment is administered in multiple dosages over at least a year. In certain embodiments, treatment is administered in multiple dosages over the remainder of the patient's life. The frequency of administration may also be adjusted according to various parameters.
- MAC membrane attack complex
- levels of the therapeutic of the disclosure in the body fluid may be monitored during the course of treatment.
- levels of the cell-lysing ability of complement present in one or more of the patient's body fluids are monitored to determine if additional doses or higher or lower dosage levels are needed.
- Such doses are administered as required to maintain at least about a 25% reduction, and preferably about a 50% or greater reduction of the cell-lysing ability of complement present in blood, plasma, or serum.
- the cell-lysing ability can be measured as percent hemolysis in hemolytic assays of the types described herein.
- a 10% or 25% or 50% reduction in the cell-lysing ability of complement present in a body fluid after treatment with the antibody capable of inhibiting complement used in the practice of the invention means that the percent hemolysis after treatment is 90, 75, or 50 percent, respectively, of the percent hemolysis before treatment.
- dosage parameters are adjusted as needed to achieve a substantial reduction of C5a levels in blood, plasma, or serum.
- C5a levels can be measured using the techniques described in Wurzner, et al., Complement mflamm 8:328-340, 1991. Other protocols of administration can, of course, be used if desired as determined by the physician.
- a large initial dose is specific, i.e., a single initial dose sufficient to yield a substantial reduction, and more preferably an at least about 50% reduction, in the hemolytic activity of the patient's serum.
- a large initial dose is preferably followed by regularly repeated administration of tapered doses as needed to maintain substantial reductions of serum hemolytic titer.
- the initial dose is given by both local and systemic routes, followed by repeated systemic administration of tapered doses as described above.
- the liquid formulations of the invention are substantially free of surfactant and/or inorganic salts.
- the liquid formulations have a pH ranging from about 5.0 to about 7.0.
- the liquid formulations comprise histidine at a concentration ranging from about 1 mM to about 100 niM.
- the liquid formulations comprise histidine at a concentration ranging from 1 mM to 100 mM.
- liquid formulations may further comprise one or more excipients such as a saccharide, an amino acid (e.g., arginine, lysine, and methionine) and a polyol.
- excipients such as a saccharide, an amino acid (e.g., arginine, lysine, and methionine) and a polyol.
- formulations of the subject antibodies are pyrogen- free formulations which are substantially free of endotoxins and/or related pyrogenic substances.
- Endotoxins include toxins that are confined inside microorganisms and are released when the microorganisms are broken down or die.
- Pyrogenic substances also include fever-inducing, thermostable substances (glycoproteins) from the outer membrane of bacteria and other microorganisms.
- FDA Food & Drug Administration
- EU endotoxin units
- Formulations of the subject antibodies include those suitable for oral, dietary, topical, parenteral (e.g., intravenous, intraarterial, intramuscular, subcutaneous injection), ophthalmologic (e.g., topical or intraocular), inhalation (e.g., intrabronchial, intranasal or oral inhalation, intranasal drops), rectal, and/or intravaginal administration.
- parenteral e.g., intravenous, intraarterial, intramuscular, subcutaneous injection
- ophthalmologic e.g., topical or intraocular
- inhalation e.g., intrabronchial, intranasal or oral inhalation, intranasal drops
- rectal e.g., rectal, and/or intravaginal administration.
- Other suitable methods of administration can also include rechargeable or biodegradable devices and controlled release polymeric devices.
- Stents in particular, may be coated with a controlled release polymer mixed with an agent
- the amount of the formulation which will be therapeutically effective can be determined by standard clinical techniques, hi addition, in vitro assays may optionally be employed to help identify optimal dosage ranges.
- the precise dose to be employed in the formulation will also depend on the route of administration, and the seriousness of the disease or disorder, and should be decided according to the judgment of the practitioner and each patient's circumstances. Effective doses may be extrapolated from dose-response curves derived from in vitro or animal model test systems.
- the dosage of the compositions to be administered can be determined by the skilled artisan without undue experimentation in conjunction with standard dose-response studies.
- the condition or conditions to be treated includes the condition or conditions to be treated, the choice of composition to be administered, the age, weight, and response of the individual patient, and the severity of the patient's symptoms.
- the actual patient body weight maybe used to calculate the dose of the formulations in milliliters (mL) to be administered. There may be no downward adjustment to "ideal" weight. In such a situation, an appropriate dose may be calculated by the following formula:
- Dose (mL) [patient weight (kg) x dose level (mg/kg)/ drug concentration (mg/niL)]
- anti-C5 antibodies can be administered in a variety of unit dosage forms.
- the dose will vary according to the particular antibody. For example, different antibodies may have different masses and/or affinities, and thus require different dosage levels.
- Antibodies prepared as Fab' fragments or single chain antibodies will also require differing dosages than the equivalent native immunoglobulins, as they are of considerably smaller mass than native immunoglobulins, and thus require lower dosages to reach the same molar levels in the patient's blood.
- therapeutics of the disclosure can also be administered in a variety of unit dosage forms and their dosages will also vary with the size, potency, and in vivo half-life of the particular therapeutic being administered.
- Doses of therapeutics of the disclosure will also vary depending on the manner of administration, the particular symptoms of the patient being treated, the overall health, condition, size, and age of the patient, and the judgment of the prescribing physician.
- a typical therapeutic treatment includes a series of doses, which will usually be administered concurrently with the monitoring of clinical endpoints such as deposition of membrane attack complex (MAC) on nonnecrotic muscle fibers, age at reaching Hammersmith score of 30/40, age at becoming wheelchair bound, muscle pain or spasms, etc., with the dosage levels adjusted as needed to achieve the desired clinical outcome.
- MAC membrane attack complex
- the frequency of administration may also be adjusted according to various parameters. These include the clinical response, the plasma half-life of the antibody capable of inhibiting complement, and the levels of the antibody in a body fluid, such as, blood, plasma, serum, or synovial fluid. To guide adjustment of the frequency of administration, levels of the antibody capable of inhibiting complement in the body fluid may be monitored during the course of treatment.
- levels of the cell-lysing ability of complement present in one or more of the patient's body fluids are monitored to determine if additional doses or higher or lower dosage levels are needed.
- Such doses are administered as required to maintain at least about a 25% reduction, and preferably about a 50% or greater reduction of the cell-lysing ability of complement present in blood, plasma, or serum.
- the cell-lysing ability can be measured as percent hemolysis in hemolytic assays of the types described herein.
- a 10% or 25% or 50% reduction in the cell-lysing ability of complement present in a body fluid after treatment with the antibody capable of inhibiting complement used in the practice of the invention means that the percent hemolysis after treatment is 90, 75, or 50 percent, respectively, of the percent hemolysis before treatment.
- dosage parameters are adjusted as needed to achieve a substantial reduction of C5a levels in blood, plasma, or serum.
- C5a levels can be measured using the techniques described in Wurzner, et al, Complement Inflamm 8:328-340, 1991.
- Other protocols of administration can, of course, be used if desired as determined by the physician.
- Administration of the therapeutics of the disclosure will generally be performed by a parenteral route, typically via injection such as intra- articular or intravascular injection (e.g., intravenous infusion) or intramuscular injection.
- Other routes of administration e.g., oral (p.o.), may be used if desired and practicable for the particular antibody capable of inhibiting complement to be administered.
- a large initial dose is specific, i.e., a single initial dose sufficient to yield a substantial reduction, and more preferably an at least about 50% reduction, in the hemolytic activity of the patient's serum.
- a large initial dose is preferably followed by regularly repeated administration of tapered doses as needed to maintain substantial reductions of serum hemolytic titer.
- the initial dose is given by both local and systemic routes, followed by repeated systemic administration of tapered doses as described above.
- Formulations suitable for injection, p.o., and other routes of administration are well known in the art and may be found, for example, in Remington's Pharmaceutical Sciences, Mack Publishing Company, Philadelphia, Pa., 17th ed. (1985).
- Parenteral formulations must be sterile and non-pyrogenic, and generally will include a pharmaceutically effective carrier, such as saline, buffered (e.g., phosphate buffered) saline, Hank's solution, Ringer's solution, dextrose/saline, glucose solutions, and the like.
- saline such as saline, buffered (e.g., phosphate buffered) saline, Hank's solution, Ringer's solution, dextrose/saline, glucose solutions, and the like.
- These formulations may contain pharmaceutically acceptable auxiliary substances as required, such as, tonicity adjusting agents, wetting agents, bactericidal agents, preservatives, stabilizers, and the like.
- the GeneChip Murine Genome U74Av2 array was used to compare the gene expression profiles of skeletal and cardiac muscles of SJL/J mice with dysferlin deficiency to those of C57BL/6 control mice. Analysis of gene expression in the nonpooled skeletal muscle of SJL/J vs control mice revealed 291 differentially expressed genes at a threshold ofp ⁇ 0.001.
- CD59 another well-described inhibitor of complement activation, was not differentially expressed (Table IIhttp://www.iimmunol.org/cgi/content/full/l 75/9/6219 - TII#TID. There was no significant difference in the expression of complement receptor 1, complement component factor H, or factor H-like 1 in skeletal muscles of dysferlin-deficient and control mice (Table Hhttp://www.jimmunol.orR/cgi/content/full/175/9/6219 -
- the DAF/CD55 protein was absent by immunohistochemical staining of SJL/J quadriceps muscle, but was readily detectable on the sarcolemma of C57BL/6 control muscle ( Figure 2http://www.iimmunol.org/cgi/content/full/l 75/9/6219 - F2#F2, A and D).
- a decrease in DAF/CD55 was found in SJL/J mice of all age groups (12, 16, 20, 28, and 32, wk; at least two mice per age group were tested), indicating that CD55 down-regulation is not merely a consequence of age and progressive dystrophic changes in muscle.
- LGMD2B dysferlin-deficient muscular dystrophy
- DAF/CD55 The expression of DAF/CD55 in human skeletal muscle was also analyzed at the RNA level by TaqMan analysis. Compared with four control specimens from healthy individuals, DAF/CD55 mRNAin LGMD2B was 2.1-fold reduced ( Figure lhttp://www.iimmunol.org/cgi/content/full/175/9/6219 - F1#F1, E and F).
- DAF/CD55 down-regulation in dysferlin deficiency only plays a role in skeletal muscle, but not in heart, there should be genes that 1) are differentially expressed in dysferlin-deficient skeletal muscle and cardiac tissue and 2) regulate DAF/CD55.
- myostatin SMAD2, SMAD3, SMAD4, cardiac ankyrin repeat protein (CARP), and early growth response 1 (EGRl).
- DAF/CD55 promoter sequence (16) was analyzed for transcription factor binding sites using the MATInspector program (Genomatix) (17). This analysis revealed a binding site for the SMAD complex, GTCTgggct (SEQ ID NO: 49) (18, 19, 20), indicating that SMAD might influence DAF/CD55 expression.
- GTCTgggct SEQ ID NO: 49
- mice were treated with an anti-murine C5 antibody.
- the myopathological changes in SJL/J skeletal muscle was reduced by selective blockade of terminal complement with the anti-C5 antibody.
- mice Female SJL/J mice and C57BL/6 mice were purchased from Charles River
- mice 32-34 wk of age were tested for SJL/J mice.
- SJL/J mice showed marked histological signs of muscular dystrophy. Lymphomas were not detected.
- Muscle sections for immunohistochemistry were obtained from SJL/J mice at 12, 16, 20, 28, and 32 wk of age. For each age group, three mice were examined. Muscle sections from A/J and Dysf 1" mice were obtained at 16 wkof age. All experiments were approved by local committees.
- Total RNA preparation were performed in mice 32-34 wk of age. At this age, SJL/J mice showed marked histological signs of muscular dystrophy. Lymphomas were not detected. Muscle sections for immunohistochemistry were obtained from SJL/J mice at 12, 16, 20, 28, and 32 wk of age. For each age group, three mice were examined. Muscle sections from A/J and Dysf 1" mice were obtained at 16 wkof age. All experiments were approved by local committees. Total RNA preparation
- Nonpooled microarray experiments were performed with cRNA prepared from quadriceps muscles and left ventricles of five SJL/J and five C57BL/6 mice using GeneChip Murine Genome U74Av2 (Affymetrix). Eight micrograms of RNA was transcribed in double-stranded cDNA using a cDNA Synthesis System (Roche). cRNA was produced by MEGAscript High Yield Transcription Kit (Ambion) and was labeled with biotin-11-CTP and biotin-16-UTP nucleotides (PerkinElmer).
- Arrays were hybridized with 16 ⁇ g of fragmentized biotinylated cRNA at 45°C and 60 rpm for 16 h in a GeneChip Hybridization Oven 640 (Affymetrix), washed and stained on GeneChip Fluidics Station 400, and scanned in GeneArray scanner 2500 (Affymetrix).
- the resulting signals were processed using Affymetrix Micro Array Suite 5.0 software (MAS5.0) with a target intensity of 200. After standard data quality checks, the MAS5.0 expression signal values of each dataset were used for statistical analysis. Probe sets showing an absent call throughout all comparison groups were removed. A Nalimov test with a threshold of p ⁇ 0.001 was used to exclude outliers. Student's t test (unpaired, two-tailed assumed unequal variance) was used to check the differences between two selected experimental groups.
- MAS5.0 Affymetrix Micro Array Suite 5.0 software
- cDNA was synthesized from 5 ⁇ g of total RNA using PowerScript reverse transcriptase (BD Clontech) and an oligo(dT)i 8 primer.
- Real-time PCR experiments were performed using TaqMan chemistry on ABI PRISM 7700 Sequence Detection System (Applied Biosystems). Each reaction was performed in a singleplex format and contained TaqMan Universal PCR Master Mix (Applied Biosystems), 900 nM forward and reverse primers, and 200 nM TaqMan probe (BioTez). An annealing/extension temperature of 58°C and 40 cycles were used.
- Primer/probe sets were designed using Primer Express 1.5 software (Applied Biosystems; Table
- Murine DAF was detected with polyclonal rat anti-mouse Ab (MDI) (22); human CD55 was detected with SMl 141PS (Acris Antibodies).
- Anti-human C5b9 mAb (DakoCytomation) was applied for MAC detection.
- Anti-phospho-MADR2 mAb against phosphorylated SMAD2 was obtained from EMD Biosciences. Double- imrnunofluorescent staining for SMAD protein (FITC) and nuclear membrane protein lamin A/C (Novocastra; Cy3) were examined using a two-photon microscope (Leica).
- Myoblast/myotube cultures and complement attack assays were performed according to published protocols (23, 24).
- Myoblasts were grown in SMG-Medium (Promo Cell) supplemented with Promo Cell Supplement Mix, gentamicin (40 ⁇ g/ml; Invitro gen Life Technologies), 2 mM glutamine, and 10% FCS.
- Myoblasts were transferred on 96-well plates and grown to near confluence. Differentiation into myotubes was induced with DMEM containing 2% heat-inactivated horse serum.
- wells were incubated in sexplicate for 30 min with normal human serum diluted 1/5 and 1/20 in Veronal buffer (Hollborn & Sohne) containing 1% BSA.
- DAFl SEQ ID NO.2JGTACAGGAACCCCCTCAACG (SEQ ID NO.10JTGAGGAGTTGGTTGGTCTCC (SEQ NO- IS) FAM -CAGAAACCCACAACAGAAAGTGTTCCAAAT-TAMRA NM_ 010016
- DAF2 (SEQ ID NO.31ACAGGAATCCCCTCAACGC (SEQ ID NO.11)CTGAGGAGTTGGTTGGTCTCC (SEQ HO.19) FAM NM_ 007827
- CARP (SEQ ID NO.SJGGACTGGTCATTACGAGTGCG (SEQ ID NO.13JCCTTGGCATTGAGATCAGCC (SEQ NO.21) FAM NM_ 013468
- SMAD2 (SEQ ID KO.6)CCCATTCCTGTTCTGGTTCA (SEQ ID NO.lilAGCCAGCAGTGCAACITTTT (SEQ N0.22J FAM NM_ 010754
- SMAD3 (SEQ ID NO.7)GGGCCTACTGTCCAATGTCA (SEQ ID N0.1SJCCCAATGTGTCGCCTTGTA (SEQ NO.23) FAM KM_ 016769
- SMAD4 (SEQ ID NO.8) CTGGACAGAGAAGCTGGCC (SEQ ID N0.16JACGCGCTTGGGTAGATCTT (SEQ NO.24) FAM NM_ 008540
- DAF/CD 5 5 (SEQ ID NO.26)AAGTAATCTTTGGCTGTAAGGCA (SBQ ID NO.34) TTCACCAGCATGTTTTACCTTTAA (SEQ NO.42) FAM NM_ _000574
- CARP (SEQ ID NO.29)AAGTTGCTCAGCACAGCGCT (SEQ ID NO.37) TGCTCCGCGCACTCATAGT (SEQ NO.4S) FAM NM_ _014391
- SMAD2 (SEQ ID NO.30) TGTTTTAGTGCCCTGCTGC (SEQ ID NO.38)GCTCACAAGATGGGTAGTGGA (SEQ N0.46J FAM ⁇ CTTCCAGACTTTGTGCTGTCCAGTAATTATGTC-TAMRA KM_ _005901
- SMAD3 (SEQ ID NO-3DGGGCACAGCCAGTTCTGAA (SEQ ID NO.39)TTGGTGTTTCTGGATGCTGA (SEQ N0.47J FAM •TTGGTGGAGGGTGTAGTGGCTTTTTGG-TAMRA NM_ 005902
- SMAD4 (SEQ ID NO.321CAGCCGTGGCAGGAAAC (SEQ ID NO.40JGCTGACAGACTGATAGCTGGAGC (SEQ NO.48) FAM ⁇ TCCCTGGCCCAGGATCAGTAGGTGOA-TAMRA NM 005359
- Dysferlin is a plasma membrane protein and is expressed early in human development. Hum. MoI. Genet. 8:855-861.
- Genomelnspector a new approach to detect correlation patterns of elements on genomic sequences. Comput. Appl. Biosci. 12:405-413.
- Tumor suppressor Smad4 is a transforming growth factor P- inducible DNA binding protein. MoI. Cell. Biol. 17:7019-7028.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Medicinal Chemistry (AREA)
- Organic Chemistry (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Physical Education & Sports Medicine (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Neurology (AREA)
- Orthopedic Medicine & Surgery (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Cell Biology (AREA)
- Zoology (AREA)
- Gastroenterology & Hepatology (AREA)
- Epidemiology (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Peptides Or Proteins (AREA)
Abstract
Priority Applications (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU2006343402A AU2006343402A1 (en) | 2006-05-01 | 2006-05-01 | Methods for the treatment of muscular dystrophy associated with dysferlin-deficiency |
PCT/US2006/016980 WO2007130031A1 (fr) | 2006-05-01 | 2006-05-01 | Procedes de traitement de la dystrophie musculaire associee a une deficience en dysferline |
EP06769980A EP2013235A1 (fr) | 2006-05-01 | 2006-05-01 | Procedes de traitement de la dystrophie musculaire associee a une deficience en dysferline |
CA002650718A CA2650718A1 (fr) | 2006-05-01 | 2006-05-01 | Procedes de traitement de la dystrophie musculaire associee a une deficience en dysferline |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
PCT/US2006/016980 WO2007130031A1 (fr) | 2006-05-01 | 2006-05-01 | Procedes de traitement de la dystrophie musculaire associee a une deficience en dysferline |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2007130031A1 true WO2007130031A1 (fr) | 2007-11-15 |
Family
ID=37866247
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US2006/016980 WO2007130031A1 (fr) | 2006-05-01 | 2006-05-01 | Procedes de traitement de la dystrophie musculaire associee a une deficience en dysferline |
Country Status (4)
Country | Link |
---|---|
EP (1) | EP2013235A1 (fr) |
AU (1) | AU2006343402A1 (fr) |
CA (1) | CA2650718A1 (fr) |
WO (1) | WO2007130031A1 (fr) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2008048689A2 (fr) * | 2006-10-20 | 2008-04-24 | Alexion Pharmaceuticals, Inc. | Méthodes de traitement d'une dystrophie musculaire associée à une carence en dysferline |
CN109045296A (zh) * | 2008-11-10 | 2018-12-21 | 阿雷克森制药公司 | 用于治疗补体相关障碍的方法和组合物 |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP3124029A1 (fr) | 2006-03-15 | 2017-02-01 | Alexion Pharmaceuticals, Inc. | Traitement de patients souffrant d'hémoglobinurie paroxystique nocturne par un inhibiteur de complément |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6355245B1 (en) * | 1994-05-02 | 2002-03-12 | Alexion Pharmaceuticals, Inc. | C5-specific antibodies for the treatment of inflammatory diseases |
-
2006
- 2006-05-01 AU AU2006343402A patent/AU2006343402A1/en not_active Abandoned
- 2006-05-01 WO PCT/US2006/016980 patent/WO2007130031A1/fr active Application Filing
- 2006-05-01 CA CA002650718A patent/CA2650718A1/fr not_active Abandoned
- 2006-05-01 EP EP06769980A patent/EP2013235A1/fr not_active Withdrawn
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6355245B1 (en) * | 1994-05-02 | 2002-03-12 | Alexion Pharmaceuticals, Inc. | C5-specific antibodies for the treatment of inflammatory diseases |
Non-Patent Citations (4)
Title |
---|
CONFALONIERI PAOLO ET AL: "Muscle inflammation and MHC class I up-regulation in muscular dystrophy with lack of dysferlin: An immunopathological study.", JOURNAL OF NEUROIMMUNOLOGY, vol. 142, no. 1-2, September 2003 (2003-09-01), pages 130 - 136, XP002426427, ISSN: 0165-5728 * |
WENZEL KATRIN ET AL: "Increased susceptibility to complement attack due to down-regulation of decay-accelerating factor/CD55 in dysferlin-deficient muscular dystrophy", JOURNAL OF IMMUNOLOGY, vol. 175, no. 9, November 2005 (2005-11-01), pages 6219 - 6225, XP002426426, ISSN: 0022-1767 * |
WHISS P A: "PEXELIZUMAB", CURRENT OPINION IN INVESTIGATIONAL DRUGS, PHARMAPRESS, US, vol. 3, no. 6, June 2002 (2002-06-01), pages 870 - 877, XP009045357, ISSN: 1472-4472 * |
YAZDANBAKHSH KARINA: "DEVELOPMENT OF COMPLEMENT THERAPEUTICS FOR INHIBITION OF IMMUNE-MEDIATED RED CELL DESTRUCTION", TRANSFUSION, AMERICAN ASSOCIATION OF BLOOD BANKS, BETHESDA, MD, US, vol. 45, no. 2 SUPPL S, August 2005 (2005-08-01), pages 122S - 129S, XP008073567, ISSN: 0041-1132 * |
Cited By (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2008048689A2 (fr) * | 2006-10-20 | 2008-04-24 | Alexion Pharmaceuticals, Inc. | Méthodes de traitement d'une dystrophie musculaire associée à une carence en dysferline |
WO2008048689A3 (fr) * | 2006-10-20 | 2008-11-20 | Alexion Pharma Inc | Méthodes de traitement d'une dystrophie musculaire associée à une carence en dysferline |
CN109045296A (zh) * | 2008-11-10 | 2018-12-21 | 阿雷克森制药公司 | 用于治疗补体相关障碍的方法和组合物 |
Also Published As
Publication number | Publication date |
---|---|
CA2650718A1 (fr) | 2007-11-15 |
EP2013235A1 (fr) | 2009-01-14 |
AU2006343402A1 (en) | 2007-11-15 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US10703809B1 (en) | Treatment of paroxysmal nocturnal hemoglobinuria patients by an inhibitor of complement | |
KR102596852B1 (ko) | 항-프로/잠재성-미오스타틴 항체 및 그의 용도 | |
AU2017202957B2 (en) | Human antibodies and diagnostic and therapeutic uses thereof for the treatment of neurological disease | |
IL259079B2 (en) | Anti-complement factor c1q fab fragments and their uses | |
BRPI0619357B1 (pt) | Anticorpos monoclonais, composição farmacêutica, vacina, uso dos mesmos para tratamento ou prevenção de doença de alzheimer, métodos in vitro para diagnosticar e para identificar compostos apropriados para imunização de doença de alzheimer e kits | |
US20090041764A1 (en) | Methods for the treatment of muscular dystrophy associated with dysferlin-deficiency | |
WO2007130031A1 (fr) | Procedes de traitement de la dystrophie musculaire associee a une deficience en dysferline | |
BR112016027671B1 (pt) | Uso de um anticorpo |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 06769980 Country of ref document: EP Kind code of ref document: A1 |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2006343402 Country of ref document: AU |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2650718 Country of ref document: CA |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2009509509 Country of ref document: JP |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
ENP | Entry into the national phase |
Ref document number: 2006343402 Country of ref document: AU Date of ref document: 20060501 Kind code of ref document: A |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2006769980 Country of ref document: EP |