WO2007121512A1 - Récepteurs olfactifs d'insectes - Google Patents

Récepteurs olfactifs d'insectes Download PDF

Info

Publication number
WO2007121512A1
WO2007121512A1 PCT/AU2007/000510 AU2007000510W WO2007121512A1 WO 2007121512 A1 WO2007121512 A1 WO 2007121512A1 AU 2007000510 W AU2007000510 W AU 2007000510W WO 2007121512 A1 WO2007121512 A1 WO 2007121512A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
seq
polynucleotide
cell
sequence
Prior art date
Application number
PCT/AU2007/000510
Other languages
English (en)
Inventor
Richard David Newcomb
Melissa Danielle Jordan
Alisha Rebecca Anderson
Original Assignee
Commonwealth Scientific And Industrial Research Organisation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Commonwealth Scientific And Industrial Research Organisation filed Critical Commonwealth Scientific And Industrial Research Organisation
Publication of WO2007121512A1 publication Critical patent/WO2007121512A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
    • C07K14/43563—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from insects

Definitions

  • the present invention relates to insect olfactory receptors, as well as functional variants and mutants thereof.
  • the invention relates to a highly conserved family of olfactory receptors which are at least found in lepidopteran species.
  • the invention also relates to polynucleotides encoding these olfactory receptors, as well as vectors comprising said polynucleotides.
  • the present invention relates to methods of identifying odorant ligands.
  • Chemosensory systems are important for feeding, detecting prey and mate selection in many organisms. Such organisms can detect and discriminate thousands of different chemicals and understanding how this neural information is received and processed is the focus of many research questions.
  • the cellular and molecular basis of odour recognition is being intensively studied using several model organisms and recent work into odorant receptors (ORs) is providing the framework for understanding how an organism detects and discriminates odours.
  • Insects are a good model system for studying odour perception because the overall architecture of their olfactory system resembles that of mammals but they have far fewer ORs compared with mammalian systems (Hildebrand and Shepherd, 1997). It is also much easier and cost-effective to perform behavioural and electrophysiological assays and manipulate the genetic makeup of insects than is the case in mammals.
  • GPCRs transmembrane G-protein coupled receptors
  • Insect ORs have some of the features of G protein-coupled receptors but it has recently been demonstrated that their membrane topology is reversed with respect to all other GPCRs and that they occur naturally as heterodimers (Neuhaus et al., 2005; Benton et al., 2006).
  • Drosophila 60 OR genes encode 62 ORs (two are alternatively spliced). As is also true in mammals, there is very little amino acid conservation within this large family (Warr et al., 2000; Robertson et al., 2003).
  • d ⁇ r83b is unusual in that it is highly conserved across four insect orders (Krieger et al., 2003) and is expressed in a large proportion of the organism's olfactory sensory neurons in D. melanogaster, A. gambiae, H. virescens and B. mori (Krieger et al., 2003; Sakuri et al., 2004). In D. melanogaster a null mutation of this gene results in the loss of electroantennogram responses and disrupts olfactory driven behaviour (Larsson et al., 2004).
  • d ⁇ r83b forms heterodimers with other ORs (Neuhaus et al., 2005) and it is believed it may function to localise other ORs to the dendrites. It may also assist in some way to increase odour binding and signal transduction (Larsson et al., 2004). More recently, Benton et al. (2006) have shown d ⁇ r83b directly associates with other ORs through conserved cytoplasmic loops to form heterometric complexes within olfactory sensory neurons that are essential for functionality of the ORs. Since the discovery of invertebrate ORs many groups have begun to identify their in vivo ligands.
  • ORs from the silk moth B. mori that specifically respond to the sex pheromone (Pheromone Receptors; PRs) have been characterised by expressing the PRs in both Xenopus oocytes (Sakuri et al. 2004; Nakagawa et al. 2005) and mammalian cells (Krieger et al., 2005).
  • PRs sex pheromone
  • One PR was found to be specific for the major component of the pheromone bombykol (BmORl).
  • ORs are typically subject to rapid evolution and display low conservation in amino acid sequence both within and between organisms. ORs that display high conservation are likely to have a broader and more important role, as seen for d ⁇ r83b. This role may be to facilitate the functional expression of other ORs, to enhance odorant-driven signal transduction or to support the detection of particularly important odorants.
  • the present inventors have identified a family of olfactory receptors which are highly conserved.
  • the present invention provides a substantially purified polypeptide comprising a sequence selected from: i) an amino acid sequence as provided in SEQ ID NO:20, and ii) an amino acid sequence which is at least 30% identical to i), wherein the polypeptide is an olfactory receptor.
  • the polypeptide comprises the sequence: Ala VaI Thr GIu Lys Trp Tyr Xaai Xaa 2 Xaa 3 Xaa 4 Xaa 5 His Lys Xaa 6 Xaa 7 VaI Xaa 8 He Phe Xaa 9 Xaaio Ala Leu Xaa ⁇ GIn Arg Met Pro He Tyr He Phe GIy Xaa ] 2 He Xaa ⁇ Leu Ser Xaa ⁇ Pro Thr Phe Thr Tip ' Phe Xaais Xaai 6 Xaai 7 GIy Met Xaai 8 Phe Phe Thr Leu VaI Met (SEQ ID NO:20).
  • Xaai is He, Phe or Met, more preferably He or Met.
  • Xaa 2 is His, Asn, GIn, Phe, Leu, VaI, Ala, Trp or Tyr, more preferably His, Phe or Tyr.
  • Xaa 3 is Asp, GIu, GIn, Asn or His, more preferably Asp or Asn.
  • Xaa 4 is Arg or Lys.
  • Xaa 5 is any amino acid, more preferably Arg, Thr, Ala, Lys or Ser.
  • Xaa 6 is any amino acid, more preferably Thr, VaI, GIn, Lys.
  • Xaa 7 is Asn, GIn, His, Asp or GIu, more preferably Asn or Asp.
  • Xaag is Arg, Lys, Leu, He, VaI, Met, Ala or Phe, more preferably Arg or Leu.
  • Xaa 9 is Lys, Arg, Asn, GIn, His, Ser or Thr, more preferably Lys, Asn or Ser.
  • Xaaio is Met, Leu, Phe, Ser or Thr, more preferably Met or Thr.
  • Xaan is Ser, Thr, GIy, Pro, or Ala more preferably Ser or GIy.
  • Xaai 2 is Ser or Thr.
  • Xaa )3 is Thr, Ser, Pro or GIy, more preferably Thr or Pro.
  • Xaai 4 is Leu, He, VaI, Met, Ala, Phe or GIy, more preferably Leu or Ala.
  • Xaai 5 is Leu, He, VaI, Met, Ala, or Phe, more preferably Leu or lie.
  • Xaai 6 is Arg or Lys.
  • Xaa )7 is Thr, Ser, Ala, Leu, He or GIy, more preferably Thr or Ala.
  • Xaais is Thr, Ser, Cys, Tyr or Tip, more preferably Ser, Cys or Trp.
  • the present invention provides a substantially purified polypeptide comprising a sequence selected from: i) an amino acid sequence as provided in SEQ ID N0:3, ii) an amino acid sequence as provided in SEQ ID N0:5, iii) an amino acid sequence as provided in SEQ ID N0:7, iv) an amino acid sequence as provided in SEQ ID NO:9, v) an amino acid sequence as provided in SEQ ID NO:34 and vi) an amino acid sequence which is at least 30% identical to any one of i) to
  • V or a polypeptide which is a biological active fragment thereof, wherein the polypeptide is an olfactory receptor.
  • the present invention provides a substantially purified polypeptide comprising a sequence selected from: i) an amino acid sequence as provided in SEQ ID NO: 11, ii) an amino acid sequence as provided in SEQ ID NO: 13, iii) an amino acid sequence as provided in SEQ ID NO: 15, iv) an amino acid sequence as provided in SEQ ID NO: 17, v) an amino acid sequence as provided in SEQ ID NO: 19, and vi) an amino acid sequence which is at least 30% identical to any one of i) to v), wherein the polypeptide is an olfactory receptor.
  • the polypeptide can be purified from a Lepidopteran.
  • the polypeptide is fused to at least one other polypeptide.
  • the at least one other polypeptide may be, for example, a polypeptide that enhances the stability of a polypeptide of the present invention, or a polypeptide that assists in the purification of the fusion protein.
  • the present invention provides an isolated polynucleotide, the polynucleotide comprising a sequence selected from: i) a sequence of nucleotides as provided in SEQ ID NO:1, ii) a sequence of nucleotides as provided in SEQ ID NO:2, iii) a sequence of nucleotides as provided in SEQ ID NO:4, iv) a sequence of nucleotides as provided in SEQ ID NO:6, v) a sequence of nucleotides as provided in SEQ ID NO:8, vi) a sequence of nucleotides as provided in SEQ ID NO: 10, vii) a sequence of nucleotides as provided in SEQ ID NO: 12, viii) a sequence of nucleotides as provided in SEQ ID NO: 14, ix) a sequence of nucleotides as provided in SEQ ID NO: 16, x) a sequence of nucleotides as provided in SEQ ID NO: 18, xi) a sequence selected from:
  • the polynucleotide encodes an olfactory receptor.
  • an oligonucleotide which comprises at least 19 contiguous nucleotides of a polynucleotide of the invention.
  • the present invention provides a polynucleotide which, when present in a cell of an insect, interferes with chemosensory perception of the insect when compared to a cell of an insect that lacks said polynucleotide.
  • the polynucleotide is selected from, but not limited to, an antisense polynucleotide, a sense polynucleotide (used for cosuppression), a catalytic polynucleotide, and a double stranded RNA.
  • the polynucleotide is recombinant or non-naturally occurring.
  • the polynucleotide is operably linked to a promoter capable of directing expression of the polynucleotide in a cell.
  • the cell in an insect cell, more preferably a lepidopteran cell.
  • the polynucleotide down-regulates production of at least one olfactory receptor protein of the invention.
  • the catalytic polynucleotide is capable of cleaving a polynucleotide of the invention.
  • the catalytic polynucleotide is capable of cleaving a polynucleotide comprising a sequence selected from SEQ ID NO:2, SEQ
  • catalytic polynucleotides examples include, but are not limited to, ribozymes and DNAzymes.
  • the polynucleotide according to the invention which can be cleaved by the catalytic polynucleotide is RNA.
  • the polynucleotide is a double stranded RNA (dsRNA) molecule comprising an oligonucleotide of the invention, wherein the portion of the molecule that is double stranded is at least 19 basepairs in length and comprises said oligonucleotide.
  • dsRNA double stranded RNA
  • the dsRNA is expressed from a single promoter, wherein the strands of the double stranded portion are linked by a single stranded portion.
  • the present invention provides a vector comprising or encoding a polynucleotide of the invention.
  • the polynucleotide, or sequence encoding the polynucleotide is operably linked to a promoter.
  • the present invention provides a host cell comprising a vector of the invention, and/or a polynucleotide of the invention.
  • the present invention provides an antibody which specifically binds a polypeptide of the invention.
  • the present invention provides a composition comprising a polypeptide of the invention, a polynucleotide of the invention, a vector of the invention, a host of the invention and/or an antibody of the invention, and one or more acceptable earners.
  • the present invention provides a kit comprising a polypeptide of the invention, a polynucleotide of the invention, a vector of the invention, a host of the invention, an antibody of the invention, and/or a composition of the invention.
  • the present invention provides a method of identifying a molecule that binds to a polypeptide of the invention, the method comprising: i) contacting a polypeptide of the invention with a candidate compound, ii) determining whether the compound binds the polypeptide.
  • the present invention provides a method of identifying a molecule that binds to a polypeptide of the invention, the method comprising: a) exposing a polypeptide of the invention to a binding partner which binds the polypeptide, and a candidate agent, and b) assessing the ability of the candidate agent to compete with the binding partner for binding to the polypeptide.
  • binding partners include, but are not limited to, Limonene, Geraniol, Nerol, Citral, Geranial, Trans-2-hexenal and Geranyl acetate.
  • the binding partner is detectably labelled.
  • the present invention provides a method of identifying a molecule that binds to a polypeptide of the invention, the method comprising: i) contacting a protein complex comprising a polypeptide of the invention with a candidate compound, ii) determining whether the compound binds the complex.
  • the polypeptide is expressed in a cell.
  • the cell may be in vitro or in vivo.
  • the polypeptide spans the cell membrane.
  • the cell is an insect cell. More preferably, the insect cell is a Lepidopteran cell.
  • the insect cell is an olfactory receptor neuron.
  • the present invention provides a method of identifying a molecule that modulates the activity of a polypeptide of the invention, the method comprising: i) contacting a cell comprising a polypeptide of the invention with a candidate compound, ii) determining whether the compound modulates a physiologic activity of the cell.
  • the present invention provides a method of identifying a molecule that modulates the activity of a polypeptide of the invention, the method comprising: i) contacting a first cell comprising a polypeptide of the invention with a candidate compound, ii) contacting a second cell lacking the polypeptide with the candidate compound, and iii) determining whether the compound modulates a physiologic activity in the first or second cell, wherein the first and second cell are the same cell type, and wherein a compound that modulates a physiologic activity in the first cell but not the second cell is a modulator of the polypeptide.
  • the cell is a cell of an organism.
  • the organism is a Lepidopteran.
  • the first cell and second cell are cells of the same cell type from two different individuals of an organism of the same species.
  • the physiologic activity is determined by analysing a behavioural activity of the organism.
  • the physiologic activity is G-protein activity.
  • G-protein activity is determined by measuring calcium ion and/or cyclic AMP concentration in the cell.
  • the physiologic activity is determined using an electroolfactogram.
  • the present invention provides a method of screening for a compound that modulates the activity of a polypeptide of the invention, the method comprising using the structural coordinates of a crystal of the polypeptide to computationally evaluate a candidate compound for its ability to bind to the polypeptide.
  • the compound is an odorant.
  • the compound is an antagonist of the physiologic activity. In another embodiment, the compound is an agonist of the physiologic activity.
  • the present invention provides a method for controlling an insect pest, the method comprising exposing the insect pest to an antagonist identified using a method of the invention.
  • the antagonist repels the insect.
  • the antagonist blocks a signal to the insect.
  • the antagonist attracts the insect.
  • the method further comprises exposing the insect to an insecticidal compound and/or a biological control agent such as a viral or bacterial pathogen of the insect.
  • the present invention provides a method for controlling an insect pest, the method comprising exposing the insect pest to ' an agonist identified using a method of the invention.
  • the agonist repels the insect.
  • the agonist blocks a signal to the insect.
  • the agonist attracts the insect.
  • the method further comprises exposing the insect to an insecticidal compound and/or a biological control agent such as a viral or bacterial pathogen of the insect.
  • the present invention provides a biosensor comprising a polypeptide of the invention.
  • a biosensor comprising a polypeptide of the invention.
  • compounds that can be detected using such a biosensor include, but are not limited to, Limonene, Geraniol, Nerol, Citral, Geranial, Trans-2-hexenal and Geranyl acetate.
  • the present invention provides a transgenic non-human animal comprising an exogenous polynucleotide, the pol y nucleotide encoding at least one polypeptide of the invention.
  • the present invention provides a transgenic non-human animal comprising an exogenous polynucleotide of the invention, and/or a polynucleotide encoding therefor.
  • the present invention provides a transgenic plant comprising an exogenous polynucleotide, the polynucleotide encoding at least one polypeptide of the invention.
  • the present invention provides a transgenic plant comprising an exogenous polynucleotide of the invention, and/or a polynucleotide encoding therefor.
  • the present invention provides a method for controlling an insect pest, the method comprising delivering to the insect a polynucleotide of the invention, and/or a polynucleotide encoding therefor.
  • the polynucleotide is delivered by exposing the insect to a transgenic plant of the invention, wherein the insect eats the plant.
  • FIG. 1 Figure 1 - cDNA sequence of Epiphyas postvittana olfactory receptor designated herein EposOR3 (SEQ ID NO: 1).
  • Figure 2 Olfactory receptor amino acid sequence (SEQ ID NO:3) encoded by cDNA sequence provided in Figure 1. Predicted transmembrane spanning regions are highlighted.
  • Figure 3 Neighbour joining tree of lepidopteran olfactory receptors.
  • FIG. 4 Quantitative real time PCR results for EposOR3.
  • Ant adult antennae
  • Body adult body minus legs and antennae
  • Leg adult legs
  • pm samples collected at night compared with all other samples collected during daytime. Error bars represent standard error of the mean based on three technical replicates.
  • Figure 5 Alignment ofEposOR3 and homologues from other Lepidoptera.
  • Figure 6 Alignment of C-terminus amino acid sequence for EposOR3 and homologues.
  • Figure 7 A phylogeny of lepidoptera ditrysia families, with families where 3' sequence is disclosed being highlighted with an asterix.
  • Figure 8 - EC50 curves for EposOR3 ligands Dark squares represent the mean ⁇ F value at given concentration (n>3 responding cells). Error bars represent standard error of the mean.
  • SEQ ID NO:2 Open reading frame encoding Epiphyas postvittana olfactory receptor designated herein EposOR3.
  • SEQ ID NO:3 Epiphyas postvittana olfactory receptor encoded by SEQ ID NO:2.
  • SEQ ID NO:5 Bombyx mori olfactory receptor encoded by SEQ ID NO:4.
  • SEQ ID NO:6 Open reading frame encoding the Ctenopseustis obliquana homologue of the EposOR3 olfactory receptor.
  • SEQ ID NO: 8 Open reading frame encoding the Planotortix excessana homologue ofthe i ⁇ pc ⁇ sOR3 olfactory receptor.
  • SEQ ID NO:9 Planotortix excessana olfactory receptor encoded by SEQ ID NO:8.
  • SEQ ID NO: 11 Partial amino acid sequence of the Ephestia cautella olfactory receptor encoded by SEQ ID NO: 10.
  • SEQ ID NO: 12 Partial coding sequence of the Leuci ⁇ s fimbriarius homologue of the EposOR3 olfactory receptor.
  • SEQ ID NO: 13 Partial amino acid sequence of the Leuci ⁇ s fimbriarius olfactory receptor encoded by SEQ ID NO: 12.
  • SEQ ID NO: 14 Partial coding sequence of the Helicoverpa armigera homologue of the EposOR3 olfactory receptor.
  • SEQ ID NO: 15 Partial amino acid sequence of the Helicoverpa armigera olfactory receptor encoded by SEQ ID NO: 14.
  • SEQ ID NO: 16 Partial coding sequence of the Plodia interpunctella homologue of the EposOR3 olfactory receptor.
  • SEQ ID NO: 17 Partial amino acid sequence of the Plodia interpunctella olfactory receptor encoded by SEQ ID NO: 16.
  • SEQ ID NO: 18 Partial coding sequence of the Plutella xylostella homologue of the
  • SEQ ID NO: 19 Partial amino acid sequence of the Plutella xylostella olfactory receptor encoded by SEQ ID NO: 18.
  • SEQ ID NO:20 Consensus sequence of the C-terminus of olfactory receptors of the invention.
  • SEQ ID NO:34 Bombyx mori olfactory receptor encoded by SEQ ID NO:33.
  • olfactory receptor As used herein, the term "olfactory receptor”, "insect olfactory receptor”,
  • odorant receptor or “insect odorant receptor” or variations thereof when used in relation to the polypeptides of the invention refers to a polypeptide which, when present in a cell of an insect, is involved in chemosensory perception of the insect.
  • the insect is a Lepidopteran.
  • the cell is a neuron, more preferably a neuron cell in the antenna of the insect.
  • olfactory receptor or “insect olfactory receptor” when used in relation to the polypeptides of the invention refers to a polypeptide which binds an odorant ligand resulting in a physiologic response.
  • ligands which bind odorant receptors of the invention include, but are not limited to, Limonene, Geraniol, Nerol, Citral, Geranial, Trans-2-hexenal and Geranyl acetate.
  • olfactory receptor insect olfactory receptor
  • odorant receptor or insect odorant receptor
  • at least one other protein is a different olfactory receptor sub- unit when compared to the polypeptides of the invention.
  • plant includes whole plants, vegetative structures (for example, leaves, stems), roots, floral organs/structures, seed (including embryo, endosperm, and seed coat), plant tissue (for example, vascular tissue, ground tissue, and the like), cells and progeny of the same.
  • a “transgenic plant” refers to a plant that contains a gene construct ("transgene") not found in a wild-type plant of the same species, variety or cultivar.
  • a “transgene” as referred to herein has the normal meaning in the art of biotechnology and includes a genetic sequence which has been produced or altered by recombinant DNA or RNA technology and which has been introduced into the plant cell.
  • the transgene may include genetic sequences derived from a plant cell.
  • the transgene has been introduced into the plant by human manipulation such as, for example, by transformation but any method can be used as one of skill in the art recognizes.
  • transgenic non-human animal refers to an animal, other than a human, that contains a gene construct ("transgene") not found in a wild-type animal of the same species or breed.
  • a "transgene” as referred to herein has the normal meaning in the art of biotechnology and includes a genetic sequence which has been produced or altered by recombinant DNA or RNA technology and which has been introduced into an animal cell.
  • the transgene may include genetic sequences derived from an animal cell.
  • the transgene has been introduced into the animal by human manipulation such as, for example, by transformation but any method can be used as one of skill in the art recognizes.
  • Polynucleotide refers to a oligonucleotide, nucleic acid molecule or any fragment thereof. It may be DNA or RNA of genomic or synthetic origin, double- stranded or single-stranded, and combined with carbohydrate, lipids, protein, or other materials to perform a particular activity defined herein.
  • operably linked refers to a functional relationship between two or more nucleic acid (e.g., DNA) segments. Typically, it refers to the functional relationship of transcriptional regulatory element to a transcribed sequence.
  • a promoter is operably linked to a coding sequence, such as a polynucleotide defined herein, if it stimulates or modulates the transcription of the coding sequence in an appropriate host cell and/or in a cell-free expression system.
  • promoter transcriptional regulatory elements that are operably linked to a transcribed sequence are physically contiguous to the transcribed sequence, i.e., they are exacting.
  • some transcriptional regulatory elements, such as enhancers need not be physically contiguous or located in close proximity to the coding sequences whose transcription they enhance.
  • compositions of the present invention may include an "acceptable carrier".
  • acceptable carriers include water, saline, Ringer's solution, dextrose solution, Hank's solution, and other aqueous physiologically balanced salt solutions.
  • Nonaqueous vehicles such as fixed oils, sesame oil, ethyl oleate, or triglycerides may also be used.
  • the exact nature of the "acceptable carrier” will depend on the use of the composition. Considering the uses described herein, and the nature of the component of the invention in the composition, the skilled person can readily determine suitable a "acceptable carrier(s)" for a particular use.
  • biosensor means a sensor which converts an interaction between biomolecules into a signal such as an electric signal, so as to measure or detect a target substance.
  • a conventional biosensor is comprised of a receptor site for recognizing a chemical substance as a detection target and a transducer site for converting a physical change or chemical change generated at the site into an electric signal. Examples of biosensors incorporating receptor molecules are well known in the art and include those described in WO 00/70343.
  • a biosensor of the invention will comprise a polypeptide of the invention co-expressed with one or more accessory proteins such as a G protein, a sensory transduction mechanism, analogue to digital conversion, digital signal processing, pattern recognition, decision support and output.
  • substantially purified polypeptide or “purified” we mean a polypeptide that has generally been separated from the lipids, nucleic acids, other polypeptides, and other contaminating molecules with which it is associated in its native state. It is preferred that the substantially purified polypeptide is at least 60% free, more preferably at least 75% free, and more preferably at least 90% free from other components with which it is naturally associated. As the skilled addressee will appreciate, the purified polypeptide can be a recombinantly produced polypeptide.
  • polypeptide and “protein” are generally used interchangeably.
  • proteins and “polypeptides” as used herein also include variants, mutants, modifications, analogous and/or derivatives of the polypeptides of the invention as described herein.
  • the query sequence is at least 25 amino acids in length, and the GAP analysis aligns the two sequences over a region of at least 25 amino acids. More preferably, the query sequence is at least 50 amino acids in length, and the GAP analysis aligns the two sequences over a region of at least 50 amino acids. More preferably, the query sequence is at least 100 amino acids in length and the GAP analysis aligns the two sequences over a region of at least 100 amino acids. Even more preferably, the query sequence is at least 250 amino acids in length and the GAP analysis aligns the two sequences over a region of at least 250 amino acids. Most preferably, the two sequences are aligned over their entire length.
  • biologically active fragment is a portion of a polypeptide of the invention which maintains a defined activity of the full-length polypeptide, namely be able to act as an olfactory receptor.
  • Biologically active fragments can be any size as long as they maintain the defined activity.
  • biologically active fragments are at least 100, more preferably at least 200, and even more preferably at least 350 amino acids in length.
  • % identity figures higher than those provided above will encompass preferred embodiments.
  • the polypeptide comprises an amino acid sequence which is at least 40%, more preferably at least 45%, more preferably at least 50%, more preferably at least 55%, more preferably at least 60%, more preferably at least 65%, more preferably at least 70%, more preferably at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 91%, more preferably at least 92%, more preferably at least 93%, more preferably at least 94%, more preferably at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98%, more preferably at least 99%, more preferably at least 99.1%, more preferably at least 99.2%, more preferably at least 99.3%, more preferably at least 99.4%, more preferably at least 99.5%, more preferably at least 99.6%, more preferably at least 99.7%, more preferably at least 99.8%, and
  • Amino acid sequence mutants of the polypeptides of the present invention can be prepared by introducing appropriate nucleotide changes into a nucleic acid of the present invention, or by in vitro synthesis of the desired polypeptide.
  • Such mutants include, for example, deletions, insertions or substitutions of residues within the amino acid sequence.
  • a combination of deletion, insertion and substitution can be made to arrive at the final construct, provided that the final polypeptide product possesses the desired characteristics.
  • Mutant (altered) polypeptides can be prepared using any technique known in the art. For example, a polynucleotide of the invention can be subjected to in vitro mutagenesis.
  • Such in vitro mutagenesis techniques include sub-cloning the polynucleotide into a suitable vector, transforming the vector into a "mutator" strain such as the E. coli XL-I red (Stratagene) and propagating the transformed bacteria for a suitable number of generations.
  • a "mutator" strain such as the E. coli XL-I red (Stratagene)
  • the polynucleotides of the invention including genes encoding therefor,- are subjected to DNA shuffling techniques as broadly described by Harayama (1998).
  • DNA shuffling techniques may include genes related to those of the present invention, such as homologous genes encoding olfactory receptors from many different Lepidopterans. Products derived from mutated/altered DNA can readily be screened using techniques described herein to determine if they have olfactory receptor activity.
  • the location of the mutation site and the nature of the mutation will depend on characteristic(s) to be modified.
  • the sites for mutation can be modified individually or in series, e.g., by (1) substituting first with conservative amino acid choices and then with more radical selections depending upon the results achieved, (2) deleting the target residue, or (3) inserting other residues adjacent to the located site.
  • Amino acid sequence deletions generally range from about 1 to 15 residues, more preferably about 1 to 10 residues and typically about 1 to 5 contiguous residues.
  • Substitution mutants have at least one amino acid residue in the polypeptide molecule removed and a different residue inserted in its place.
  • the sites of greatest interest for substitutional mutagenesis include sites identified as important for function. Other sites of interest are those in which particular residues obtained from various strains or species are identical (see, for example, the protein alignments provided herein). These positions may be important for biological activity. These sites, especially those falling within a sequence of at least three other identically conserved sites, are preferably substituted in a relatively conservative manner. Such conservative substitutions are shown in Table 1 under the heading of "exemplary substitutions".
  • unnatural amino acids or chemical amino acid analogues can be introduced as a substitution or addition into the polypeptides of the present invention.
  • amino acids include, but are not limited to, the D-isomers of the common amino acids, 2,4-diaminobutyric acid, ⁇ -amino isobutyric acid, 4- aminobutyric acid, 2-aminobutyric acid, 6-amino hexanoic acid, 2-amino isobutyric acid, 3-amino propionic acid, ornithine, norleucine, norvaline, hydroxyproline, sarcosine, citrulline, homocitrulline, cysteic acid, t-butylglycine, t-butylalanine, phenylglycine, cyclohexylalanine, ⁇ -alanine, fluoro-amino acids, designer amino acids such as ⁇ -methyl amino acids, C ⁇ -methyl amino acids, N ⁇ -methyl amino acids
  • polypeptides of the present invention which are differentially modified during or after synthesis, e.g., by biotinylation, benzylation, glycosylation, acetylation, phosphorylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, linkage to an antibody molecule or other cellular ligand, etc. These modifications may serve to increase the stability and/or bioactivity of the polypeptide of the invention.
  • Polypeptides of the present invention can be produced in a variety of ways, including production and recovery of natural polypeptides, production and recovery of recombinant polypeptides, and chemical synthesis of the polypeptides.
  • an isolated polypeptide of the present invention is produced by culturing a cell capable of expressing the polypeptide under conditions effective to produce the polypeptide, and recovering the polypeptide.
  • a preferred cell to culture is a recombinant cell of the present invention.
  • Effective culture conditions include, but are not limited to, effective media, bioreactor, temperature, pH and oxygen conditions that permit polypeptide production.
  • An effective medium refers to any medium in which a cell is cultured to produce a polypeptide of the present invention. ' Such medium typically comprises an aqueous medium having assimilable carbon, nitrogen and phosphate sources, and appropriate salts, minerals, metals and other nutrients, such as vitamins.
  • Cells of the present invention can be cultured in conventional
  • Culturing can be carried out at a temperature, pH and oxygen content appropriate for a recombinant cell. Such culturing conditions are within the expertise of one of ordinary skill in the art.
  • an “isolated polynucleotide”, including DNA, RNA, or a combination of these, single or double stranded, in the sense or antisense orientation or a combination of both, dsRNA or otherwise we mean a polynucleotide which is at least partially separated from the polynucleotide sequences with which it is associated or linked in its native state.
  • the isolated polynucleotide is at least 60% free, preferably at least 75% free, and most preferably at least 90% free from other components with which they are naturally associated.
  • an isolated polynucleotide can be an exogenous polynucleotide present in, for example, a transgenic organism which does not naturally comprise the polynucleotide.
  • polynucleotide is used interchangeably herein with the term "nucleic acid”.
  • the query sequence is at least 45 nucleotides in length, and the GAP analysis aligns the two sequences over a region of at least 45 nucleotides.
  • the query sequence is at least 150 nucleotides in length, and the GAP analysis aligns the two sequences over a region of at least 150 nucleotides. More preferably, the query sequence is at least 300 nucleotides in length and the GAP analysis aligns the two sequences over a region of at least 300 nucleotides. Most preferably, the two sequences are aligned over their entire length.
  • a polynucleotide of the invention comprises a sequence which is at least 40%, more preferably at least 45%, more preferably at least 50%, more preferably at least 55%, more preferably at least 60%, more preferably at least 65%, more preferably at least 70%, more preferably at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 91%, more preferably at least 92%, more preferably at least 93%, more preferably at least 94%, more preferably at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98%, more preferably at least 99%, more preferably at least 99.1%, more preferably at least 99.2%, more preferably at least 99.3%, more preferably at least 99.4%, more preferably at least 99.5%, more preferably at least 99.6%, more preferably at least 99.7%, more preferably
  • the polynucleotide of the invention is not the isolated gene encoding the B. mori homologue of EposOR3.
  • Polynucleotides of the present invention may possess, when compared to naturally occurring molecules, one or more mutations which are deletions, insertions, or substitutions of nucleotide residues. Mutants can be either naturally occurring (that is to say, isolated from a natural source) or synthetic (for example, by perfo ⁇ ning site- directed mutagenesis on the nucleic acid).
  • stringent hybridization conditions refers to parameters with which the art is familiar, including the variation of the hybridization temperature with length of an polynucleotide or oligonucleotide. Nucleic acid hybridization parameters may be found in references which compile such methods, Sambrook, et al. (supra), and Ausubel, et al. (supra).
  • stringent hybridization conditions can refer to hybridization at 65 0 C in hybridization buffer (3.5xSSC, 0.02% Ficoll, 0.02% polyvinyl pyrrolidone, 0.02% Bovine Serum Albumin, 2.5 mM NaH 2 PO 4 ( ⁇ H7), 0.5% SDS, 2 mM EDTA) and washing twice in 0.2xSSC, 0.1% SDS at 65 0 C, with each wash step being about 30 min.
  • hybridization buffer 3.5xSSC, 0.02% Ficoll, 0.02% polyvinyl pyrrolidone, 0.02% Bovine Serum Albumin, 2.5 mM NaH 2 PO 4 ( ⁇ H7), 0.5% SDS, 2 mM EDTA
  • nucleic acid and/or oligonucleotides hybridize to the region of the an insect genome of interest, such as the genome of a Lepidopteran, under conditions used in nucleic acid amplification techniques such as PCR.
  • Oligonucleotides of the present invention can be RNA, DNA, or derivatives of either. Although the terms polynucleotide and oligonucleotide have overlapping meaning, oligonucleotide are typically relatively short single stranded molecules. The minimum size of such oligonucleotides is the size required for the formation of a stable hybrid between an oligonucleotide and a complementary sequence on a target nucleic acid molecule. Preferably, the oligonucleotides are at least 15 nucleotides, more preferably at least 18 nucleotides, more preferably at least 19 nucleotides, more preferably at least 20 nucleotides, even more preferably at least 25 nucleotides in length.
  • monomers of a polynucleotide or oligonucleotide are linked by phosphodiester bonds or analogs thereof to form oligonucleotides ranging in size from a relatively short monomeric units, e.g., 12-18, to several hundreds of monomeric units.
  • Analogs of phosphodiester linkages include: phosphorothioate, phosphorodithioate, phosphoroselenoate, phosphorodiselenoate, phosphoroanilothioate, phosphoranilidate, phosphoramidate.
  • the present invention includes oligonucleotides that can be used as, for example, probes to identify nucleic acid molecules, or primers to produce nucleic acid molecules.
  • Oligonucleotide of the present invention used as a probe are typically conjugated with a detectable label such as a radioisotope, an enzyme, biotin, a fluorescent molecule or a chemiluminescent molecule.
  • Probes and/or primers can be used to clone further homologues of the olfactory receptor cDNAs described herein from other Lepidopteran species. Further hybridization techniques known in the art can also be used to screen genomic or cDNA libraries for such homologues. As an example, the primers GCNGTSACNGTRAARTGGTA (SEQ ID NO:21) and
  • CATSACSAGNGTRAARAANSWC SEQ ID NO:22
  • CATSACSAGNGTRAARAANSWC SEQ ID NO:22
  • These fragments in turn can be labeled, for example radio-labeled, and used to screen a suitable cDNA library for the full-length sequence and/or 5 r and 3' RACE used to obtain the full-length sequence.
  • the skilled person would find such techniques routine.
  • antisense polynucleotide shall be taken to mean a DNA or RNA, or combination thereof, molecule that is complementary to at least a portion of a specific mRNA molecule encoding a polypeptide of the invention and capable of interfering with a post-transcriptional event such as mRNA translation.
  • the use of antisense methods is well known in the art (see for example, G. Hartmann and S. Endres, Manual of Antisense Methodology, Kluwer (1999).
  • An antisense polynucleotide of the invention hybridises under physiological conditions to a target polynucleotide (which is fully or partially single stranded), and thus are at least capable of forming a double stranded polynucleotide with mRNA encoding a protein, such as those proteins provided in SEQ ID NO:3, SEQ ID NO:5,
  • SEQ ID NO:7 SEQ ID NO:9 or SEQ ID NO:34, under normal conditions in a cell.
  • Antisense molecules may include sequences that correspond to the structural genes or for sequences that effect control over the gene expression or splicing event.
  • the antisense sequence may correspond to the targeted coding region of the genes of the invention, or the 5 '-untranslated region (UTR) or the 3'-UTR or combination of these. It may be complementary in part to intron sequences, which may be spliced out during or after transcription, preferably only to exon sequences of the target gene. In view of the generally greater divergence of the UTRs, targeting these regions provides greater specificity of gene inhibition.
  • the length of the antisense sequence should be at least 19 contiguous nucleotides, preferably at least 50 nucleotides, and more preferably at least 100, 200, or 500 nucleotides.
  • the full-length sequence complementary to the entire gene transcript may be used. The length is most preferably 100-2000 nucleotides.
  • the degree of identity of the antisense sequence to the targeted transcript should be at least 90% and more preferably 95-100%.
  • the antisense RNA molecule may of course comprise unrelated sequences which may function to stabilize the molecule.
  • catalytic polynucleotide/nucleic acid refers to a DNA molecule or DNA-containing molecule (also known in the art as a "deoxyribozyme”) or an RNA or RNA-containing molecule (also known as a "ribozyme”) which specifically recognizes a distinct substrate and catalyzes the chemical modification of this substrate.
  • the nucleic acid bases in the catalytic nucleic acid can be bases A, C, G, T (and U for RNA).
  • the catalytic nucleic acid contains an antisense sequence for specific recognition of a target nucleic acid, and a nucleic acid cleaving enzymatic activity (also referred to herein as the "catalytic domain").
  • ribozymes that are particularly useful in this invention are the hammerhead ribozyme (Haseloff and Gerlach, 1988, Perriman et al., 1992) and the hairpin ribozyme (Shippy et al., 1999).
  • the ribozymes of this invention and DNA encoding the ribozymes can be chemically synthesized using methods well known in the art.
  • the ribozymes can also be prepared from a DNA molecule (that upon transcription, yields an RNA molecule) operably linked to an RNA polymerase promoter, e.g., the promoter for T7 RNA polymerase or SP6 RNA polymerase.
  • an RNA polymerase promoter e.g., the promoter for T7 RNA polymerase or SP6 RNA polymerase.
  • a nucleic acid molecule i.e., DNA or cDNA, coding for a catalytic polynucleotide of the invention.
  • the ribozyme can be produced in vitro upon incubation with RNA polymerase and nucleotides.
  • the DNA can be inserted into an expression cassette or transcription cassette. After synthesis, the RNA molecule can be modified by ligation to a DNA molecule having the ability to stabilize the ribozyme and make it resistant to RNase.
  • catalytic polynucleotides of the invention should also be capable of hybridizing a target nucleic acid molecule (for example an mRNA encoding a polypeptide provided as SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9 or SEQ ID NO:34) under "physiological conditions", namely those conditions within a cell (especially conditions in an insect cell such as a cell of a lepidpoteran).
  • a target nucleic acid molecule for example an mRNA encoding a polypeptide provided as SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9 or SEQ ID NO:34
  • RNA interference is particularly useful for specifically inhibiting the production of a particular protein.
  • RNAi RNA interference
  • Waterhouse et al. 1998 have provided a model for the mechanism by which dsRNA can be used to reduce protein production.
  • This technology relies on the presence of dsRNA molecules that contain a sequence that is essentially identical to the mRNA of the gene of interest or part thereof, in this case an mRNA encoding a polypeptide according to the invention.
  • the dsRNA can be produced from a single promoter in a recombinant vector or host cell, where the sense and anti-sense sequences are flanked by an unrelated sequence which enables the sense and anti- sense sequences to hybridize to fo ⁇ n the dsRNA molecule with the unrelated sequence forming a loop structure.
  • the design and production of suitable dsRNA molecules for the present invention is well within the capacity of a person skilled in the art, particularly considering Waterhouse et al. (1998), Smith et al. (2000), WO 99/32619, WO 99/53050, WO 99/49029, and WO 01/34815.
  • a DNA is introduced that directs the synthesis of an at least partly double stranded RNA product(s) with homology to the target gene to be inactivated.
  • the DNA therefore comprises both sense and antisense sequences that, when transcribed into RNA, can hybridize to form the double-stranded RNA region.
  • the sense and antisense sequences are separated by a spacer region that comprises an intron which, when transcribed into RNA, is spliced out. This arrangement has been shown to result in a higher efficiency of gene silencing.
  • the double-stranded region may comprise one or two RNA molecules, transcribed from either one DNA region or two.
  • the presence of the double stranded molecule is thought to trigger a response from an endogenous plant system that destroys both the double stranded RNA and also the homologous RNA transcript from the target plant gene, efficiently reducing or eliminating the activity of the target gene.
  • the length of the sense and antisense sequences that hybridise should each be at least 19 contiguous nucleotides, preferably at least 30 or 50 nucleotides, and more preferably at least 100, 200, or 500 or 1000 nucleotides.
  • the full-length sequence corresponding to the entire gene transcript may be used. The lengths are most preferably 100-2000 nucleotides.
  • the degree of identity of the sense and antisense sequences to the targeted transcript should be at least 85%, preferably at least 90% and more preferably 95-100%.
  • the RNA molecule may of course comprise unrelated sequences which may function to stabilize the molecule.
  • the RNA molecule may be expressed under the control of a RNA polymerase II or RNA polymerase III promoter. Examples of the latter include tRNA or snRNA promoters.
  • Preferred small interfering RNA ('siRNA”) molecules comprise a nucleotide sequence that is identical to about 19-23 contiguous nucleotides of the target mRNA.
  • the target mRNA sequence commences with the dinucleotide AA, comprises a GC-content of about ' 30-70% (preferably, 30-60%, more preferably 40- 60% and more preferably about 45%-55%), and does not have a high percentage identity to any nucleotide sequence other than the target in the genome of the insect (preferably lepidopteran) in which it is to be introduced, e.g., as determined by standard BLAST search.
  • One embodiment of the present invention includes a recombinant vector, which comprises at least one isolated polynucleotide molecule of the present invention, inserted into any vector capable of delivering the polynucleotide molecule into a host cell.
  • Such vectors contains heterologous polynucleotide sequences, that is polynucleotide sequences that are not naturally found adjacent to polynucleotide molecules of the present invention and that preferably are derived from a species other than the species from which the polynucleotide molecule(s) are derived.
  • the vector can be either RNA or DNA, either prokaryotic or eukaryotic, and typically is a transposon (such as described in US 5,792,294), a virus or a plasmid.
  • One type of recombinant vector comprises a polynucleotide molecule of the present invention operatively linked to an expression vector.
  • the phrase operatively linked refers to insertion of a polynucleotide molecule into an expression vector in a manner such that the molecule is able to be expressed when transformed into a host cell.
  • an expression vector includes a DNA or RNA vector that is capable of transforming a host cell and of effecting expression of a specified polynucleotide molecule.
  • the expression vector is also capable of replicating within the host cell.
  • Expression vectors can be either prokaryotic or eukaryotic, and are typically viruses or plasmids.
  • Expression vectors of the present invention include any vectors that function (i.e., direct gene expression) in recombinant cells of the present invention, including in bacterial, fungal, endoparasite, arthropod, animal, and plant cells. Vectors of the invention can also be used to produce the polypeptide in a cell-free expression system, such systems are well known in the art.
  • expression vectors of the present invention contain regulatory sequences such as transcription control sequences, translation control sequences, origins of replication, and other regulatory sequences that are compatible with the recombinant cell and that control the expression of polynucleotide molecules of the present invention.
  • recombinant molecules of the present invention include transcription control sequences. Transcription control sequences are sequences which control the initiation, elongation, and termination of transcription. Particularly important transcription control sequences are those which control transcription initiation, such as promoter, enhancer, operator and repressor sequences. Suitable transcription . control sequences include any transcription control sequence that can function in at least one of the recombinant cells of the present invention. A.
  • transcription control sequences include those which function in bacterial, yeast, arthropod, nematode, plant or mammalian cells, such as, but not limited to, tac, lac, trp, trc, oxy-pro, omp/lpp, rrnB, bacteriophage lambda, bacteriophage T7, T71ac, bacteriophage T3, bacteriophage SP6, bacteriophage SPOl, metallothionein, alpha- mating factor, Pichia alcohol oxidase, alphavirus subgenomic promoters (such as Sindbis virus subgenomic promoters), antibiotic resistance gene, baculovirus, Heliothis zea insect virus, vaccinia virus, herpesvirus, raccoon poxvirus, other poxvirus, adenovirus, cytomegalovirus (such as intermediate early promoters), simian virus 40, retro
  • Host Cells Another embodiment of the present invention includes a recombinant cell comprising a host cell transformed with one or more recombinant molecules of the present invention, or progeny cells thereof. Transformation of a polynucleotide molecule into a cell can be accomplished by any method by which a polynucleotide molecule can be inserted into the cell. Transformation techniques include, but are not limited to, transfection, electroporation, microinjection, lipofection, adsorption, and protoplast fusion. A recombinant cell may remain unicellular or may grow into a tissue, organ or a multicellular organism.
  • Transformed polynucleotide molecules of the present invention can remain extrachromosomal or can integrate into one or more sites within a chromosome of the transformed (i.e., recombinant) cell in ⁇ such a manner that their ability to be expressed is retained.
  • Suitable host cells to transform include any cell that can be transformed with a polynucleotide of the present invention.
  • Host cells of the present invention either can be endogenously (i.e., naturally) capable of producing polypeptides of the present invention or can be capable of producing such polypeptides after being transformed with at least one polynucleotide molecule of the present invention.
  • Host cells of the present invention can be any cell capable of producing at least one protein of the present invention, and include bacterial, fungal (including yeast), parasite, nematode, arthropod, animal and plant cells.
  • host cells examples include Salmonella, Escherichia, Bacillus, Listeria, Saccharomyces, Spodoptera, Mycobacteria, Trichoplusia, BHK (baby hamster kidney) cells, MDCK cells, CRPK cells, CV-I cells, COS (e.g., COS-7) cells, and Vero cells.
  • E. coli including E.
  • coli K- 12 derivatives Salmonella typhi; Salmonella typhimurium, including attenuated strains; Spodoptera frugiperda; Trichoplusia ni; BHK cells; MDCK cells; CRFK cells; CV-I cells; COS cells; Vero cells; and non-tumorigenic mouse myoblast G8 cells (e.g., ATCC CRL 1246).
  • Additional appropriate mammalian cell hosts include other kidney cell lines, other fibroblast cell lines (e.g., human, murine or chicken embryo fibroblast cell lines), myeloma cell lines, Chinese hamster ovary cells, mouse NIH/3T3 cells, LMTK cells and/or HeLa cells.
  • Particularly preferred host cells are insect cells, especially lepidopteran cells, as well as nematode cells such as C. elegans cells.
  • Recombinant DNA technologies can be used to improve expression of a transformed polynucleotide molecule by manipulating, for example, the number of copies of the polynucleotide molecule within a, host cell, the efficiency with which those polynucleotide molecules are transcribed, the efficiency with which the resultant transcripts are translated, and the efficiency of post-translational modifications.
  • Recombinant techniques useful for increasing the expression of polynucleotide molecules of the present invention include, but are not limited to, operatively linking polynucleotide molecules to high-copy number plasmids, integration of the polynucleotide molecule into one or more host cell chromosomes, addition of vector stability sequences to plasmids, substitutions or modifications of transcription control signals (e.g., promoters, operators, enhancers), substitutions or modifications of translational control signals (e.g., ribosome binding sites, Shine-Dalgarno sequences), modification of polynucleotide molecules of the present invention to correspond to the codon usage of the host cell, and the deletion of sequences that destabilize transcripts.
  • transcription control signals e.g., promoters, operators, enhancers
  • translational control signals e.g., ribosome binding sites, Shine-Dalgarno sequences
  • plant refers to whole plants, plant organs (e.g. leaves, stems roots, etc), seeds, plant cells and the like. Plants contemplated for use in the practice of the present invention include both monocotyledons and dicotyledons.
  • Target plants include, but are not limited to, the following: cereals (wheat, barley, rye, oats, rice, sorghum and related crops); beet (sugar beet and fodder beet); pomes, stone fruit and soft fruit (apples, pears, plums, peaches, almonds, cherries, strawberries, raspberries and black-berries); leguminous plants (beans, lentils, peas, soybeans); oil plants (rape, mustard, poppy, olives, sunflowers, coconut, castor oil plants, cocoa beans, groundnuts); cucumber plants (marrows, cucumbers, melons); fibre plants (cotton, flax, hemp, jute); citrus fruit (oranges, lemons, grapefruit, mandarins); vegetables (spinach, lettuce, asparagus, cabbages, carrots, onions, tomatoes, potatoes, paprika); lauraceae (avocados, cinnamon, camphor); or plants such as maize, tobacco, nuts, coffee, sugar cane, tea, vines
  • Transgenic plants as defined in the context of the present invention include plants (as well as parts and cells of said plants) and their progeny which have been genetically modified using recombinant techniques to cause production of at least one polypeptide and/or polynucleotide of the present invention in the desired plant or plant organ.
  • Transgenic plants can be produced using techniques known in the art, such as those generally described in A. Slater et al., Plant Biotechnology - The Genetic Manipulation of Plants, Oxford University Press (2003), and P. Christou and H. Klee, Handbook of Plant Biotechnology, John Wiley and Sons (2004).
  • a polynucleotide of the present invention may be expressed constitutively in the transgenic plants during all stages of development. Depending on the use of the plant or plant organs, the polynucleotides may be expressed in a stage-specific manner. Furthermore, the polynucleotides may be expressed tissue-specifically.
  • regulatory sequences which are known or are found to cause expression of a polynucleotide of interest in plants may be used in the present invention.
  • the choice of the regulatory sequences used depends on the target plant and/or target organ of interest.
  • Such regulatory sequences may be obtained from plants or plant viruses, or may be chemically synthesized. Such regulatory sequences are well known to those skilled in the art.
  • Constitutive plant promoters are well known. Further to previously mentioned promoters, some other suitable promoters include but are not limited to the nopaline synthase promoter, the octopine synthase promoter, CaMV 35S promoter, the ribulose-l ,5-bisphosphate carboxylase promoter, Adhl-based pEmu, Actl, the SAM synthase promoter and Ubi promoters and the promoter of the chlorophyll a/b binding protein. Alternatively it may be desired to have the transgene(s) expressed in a regulated fashion.
  • tissue-specific regulated genes and/or promoters include genes encoding the seed storage proteins (such as napin, cruciferin, ⁇ -conglycinin, glycinin and phaseolin), zein or oil body proteins (such as oleosin), or genes involved in fatty acid biosynthesis (including acyl carrier protein, stearoyl-ACP desaturase, and fatty acid desaturases (fad 2- I)), and other genes expressed during embryo development (such as Bce4).
  • tissue-specific regulated genes and/or promoters include genes encoding the seed storage proteins (such as napin, cruciferin, ⁇ -conglycinin, glycinin and phaseolin), zein or oil body proteins (such as oleosin), or genes involved in fatty acid biosynthesis (including acyl carrier protein, stearoyl-ACP desaturase, and fatty acid desaturases (fad 2- I)), and other genes expressed during embryo development (such as Bce4).
  • tissue-specific promoters include those that direct expression in leaf cells following damage to the leaf (for example, from chewing insects), in tubers (for example, patatin gene promoter), and in fiber cells (an example of a developmentally-regulated fiber cell protein is E6 fiber.
  • transformation and/or regeneration techniques are available for the introduction of an expression construct containing a nucleic acid sequence of interest into the target plants.
  • Such techniques include but are not limited to transformation of protoplasts using the calcium/polyethylene glycol method, electroporation and microinjection or (coated) particle bombardment.
  • transformation systems involving vectors are widely available, such as viral and bacterial vectors (e.g. from the genus Agrobacterium). After selection and/or screening, the protoplasts, cells or plant parts that have been transformed can be . regenerated into whole plants, using methods known in the art. The choice of the transformation and/or regeneration techniques is not critical for this invention.
  • PCR polymerase chain reaction
  • Southern blot analysis can be performed using methods known to those skilled in the art.
  • Expression products of the transgenes can be detected in any of a variety of ways, depending upon the nature of the product, and include Western blot and enzyme assay.
  • One particularly useful way to quantitate expression and to detect replication in different plant tissues is to use a reporter gene, such as GUS.
  • Heterologous DNA can be introduced, for example, into fertilized mammalian ova.
  • totipotent or pluripotent stem cells can be transformed by microinjection, calcium phosphate mediated precipitation, liposome fusion, retroviral infection or other means, the transformed cells are then introduced into the embryo, and the embryo then develops into a transgenic animal.
  • developing embryos are infected with a retrovirus containing the desired DNA, and transgenic animals produced from the infected embryo.
  • the appropriate DNAs are coinjected into the pronucleus or cytoplasm of embryos, preferably at the single cell stage, and the embryos allowed to develop into mature transgenic animals.
  • Another method used to produce a transgenic animal involves microinjecting a nucleic acid into pro-nuclear stage eggs by standard methods. Injected eggs are then cultured before transfer into the oviducts of pseudopregnant recipients.
  • Transgenic animals may also be produced by nuclear transfer technology. Using this method, fibroblasts from donor animals are stably transfected with a plasmid incorporating the coding sequences for a binding domain or binding partner of interest under the control of regulatory sequences. Stable transfectants are then fused to enucleated oocytes, cultured and transferred into female recipients.
  • Antibodies are also be produced by nuclear transfer technology. Using this method, fibroblasts from donor animals are stably transfected with a plasmid incorporating the coding sequences for a binding domain or binding partner of interest under the control of regulatory sequences. Stable transfectants are then fused to enucleated oocytes, cultured and transferred into female recipients.
  • the invention also provides monoclonal or polyclonal antibodies to polypeptides of the invention or fragments thereof.
  • the present invention further provides a process for the production of monoclonal or polyclonal antibodies to polypeptides of the invention.
  • an antibody "specifically binds" refers to the ability of the antibody to bind to at ' least one polypeptide of the present invention but not other known olfactory receptors.
  • an antibody " of the invention is an antagonist of an olfactory receptor of the invention.
  • epitope refers to a region of a polypeptide of the invention which is bound by the antibody.
  • An epitope can be administered to an animal to generate antibodies against the epitope, however, antibodies of the present invention preferably specifically bind the epitope region in the context of the entire polypeptide.
  • polyclonal antibodies are desired, a selected mammal (e.g., mouse, rabbit, goat, horse, etc.) is immunised with an immunogenic polypeptide of the invention. Serum from the immunised animal is collected and treated according to known procedures. If serum containing polyclonal antibodies contains antibodies to other antigens, the polyclonal antibodies can be purified by immunoaffinity chromatography. Techniques for producing and processing polyclonal antisera are known in the art. In order that such antibodies may be made, the invention also provides polypeptides of the invention or fragments thereof haptenised to another polypeptide for use as immunogens in animals. Monoclonal antibodies directed against polypeptides of the invention can also be readily produced by one skilled in the art.
  • Immortal antibody-producing cell lines can be created by cell fusion, and also by other techniques such as direct transformation of B lymphocytes with oncogenic DNA, or transfection with Epstein- Barr virus. Panels of monoclonal antibodies produced can be screened for various properties; i.e., for isotype and epitope affinity.
  • An alternative technique involves screening phage display libraries where, for example the phage express scFv fragments on the surface of their coat with a large variety of complementarity determining regions (CDRs). This technique is well known in the art.
  • the term "antibody”, unless specified to the contrary, includes fragments of whole antibodies which retain their binding activity for a target antigen. Such fragments include Fv, F(ab') and F(ab')2 fragments, as well as single chain antibodies (scFv). Furthermore, the antibodies and fragments thereof may be humanised antibodies, for example as described in EP-A-239400.
  • Antibodies of the invention may be bound to a solid support and/or packaged into kits in a suitable container along with suitable reagents, controls, instructions and the like.
  • antibodies of the present invention are detectably labeled.
  • Exemplary detectable labels that allow for direct measurement of antibody binding include radiolabels, fluorophores, dyes, magnetic beads, chemiluminescers, colloidal particles, and the like.
  • Examples of labels which pe ⁇ nit indirect measurement of ⁇ binding include enzymes where the substrate may provide for a coloured or fluorescent product.
  • Additional exemplary detectable labels include covalently bound enzymes capable of providing a detectable product signal after addition of suitable substrate. Examples of suitable enzymes for use in conjugates include horseradish peroxidase, alkaline phosphatase, malate dehydrogenase and the like. Where not commercially available, such antibody-enzyme conjugates are readily produced by techniques known to those skilled in the art.
  • detectable labels include biotin, which binds with high affinity to avidin or streptavidin; fluorochromes (e.g., phycobiliproteins, phycoerythrin and allophycocyanins; fluorescein and Texas red), which can be used with a fluorescence activated cell sorter; haptens; and the like.
  • the detectable label allows for direct measurement in a plate luminometer, e.g., biotin.
  • Such labeled antibodies can be used in techniques known in the art to detect polypeptides of the invention.
  • the present invention provides screening methodologies useful in the identification of compounds which bind to and/or modulate the activity of the olfactory receptor genes, mRNA and proteins described herein.
  • Such compounds will include molecules that agonize or antagonize olfactory receptor function.
  • Screening methodologies to identify compounds that bind and/or modulate the activity of olfactory receptors are known in the art.
  • Such compounds include endogenous cellular components which interact with the identified genes and proteins in vivo.
  • cell lysates or tissue homogenates may be screened for proteins or other compounds which bind to one of the olfactory receptor genes, mRNA or proteins of the invention.
  • Binding compounds can include, but are not limited to, other cellular proteins. Binding compounds can also include, but are not limited to, peptides such as, for example, soluble peptides, including, but not limited to, Ig-tailed fusion peptides, antibodies such as those described herein, and small organic or inorganic molecules. Such compounds can include organic molecules (e.
  • peptidomimetics that bind to the receptor and either mimic the activity triggered by the natural odorant ligand (namely, agonists); as well as peptides, antibodies and other organic compounds that mimic the receptor (or a portion thereof) and bind to and "neutralize” natural odorant ligand.
  • Such compounds identified in a screen for binding to the receptor can be assayed for their effects on receptor signalling.
  • Particularly useful molecules that bind to and/or modulate olfactory receptor activity are small molecules, most preferably volatile small molecules, that function as odorants.
  • odorant as employed herein refers to a molecule that has the potential to bind to an olfactory receptor.
  • odorant ligand refers to the interaction of ligands with the receptor polypeptide where the ligands may serve as either agonists and/or antagonist ' s of a given receptor or receptor function. This effect may not be direct, but merely by altering the binding of an odorant receptor to another ligand.
  • An odorant ligand may thus directly cause a perception of odor (an agonist), or may block the perception of odor (an antagonist).
  • An odorant ligand may include, but is not limited to, molecules which interact with polypeptides involved in olfactory sensation.
  • Binding of a modulator (ligand) to a receptor of the invention can be examined in vitro with soluble or solid state reactions, using a full-length receptor molecule or a chimeric molecule such as an extracellular domain or transmembrane region, or combination thereof, of an receptor of the invention covalently linked to a heterologous signal transduction domain, or a heterologous extracellular domain and/or transmembrane region covalently linked ' to the transmembrane and/or cytoplasmic domain of an olfactory receptor.
  • ligand-binding domains of the protein of interest can be used in vitro in soluble or solid state reactions to assay for ligand binding.
  • a chimeric receptor will be made that comprises all or part of an olfactory receptor polypeptide, as well an additional sequence that facilitates the localization of the olfactory receptor to the membrane, such as a rhodopsin, e. g., an N-terminal fragment of a rhodopsin protein.
  • Ligand binding to an olfactory receptor of the invention, a domain, or chimeric protein (also referred to herein as a fusion protein) can be tested in solution, in a bilayer membrane, attached to a solid phase, in a lipid monolayer, or in vesicles. Binding of a modulator can be tested using, e.
  • spectroscopic characteristics e. g., fluorescence, absorbance, refractive index
  • hydrodynamic e. g., shape
  • chromatographic e. g., shape
  • solubility properties e.g., changes in spectroscopic characteristics (e. g., fluorescence, absorbance, refractive index) hydrodynamic (e. g., shape), chromatographic, or solubility properties.
  • assays may involve displacing a radioactively or fluorescently labeled ligand, and measuring changes in intrinsic fluorescence or changes in proteolytic susceptibility, etc.
  • Methods for screening odorant compounds using olfactory receptors in neuronal cells are known in the art (WO 98/50081 ; Duchamp-Viret et al., 1999; Sato et al., 1994; Malnic et al., 1999; Zhao et al., 1998).
  • the invention provides methods and compositions for expressing the olfactory receptors of the invention in cells to screen for odorants that can specifically bind an olfactory receptor of the invention, and for determining the effect (e. g., biochemical or electrophysiological) of such binding on cell physiology.
  • Any cell expression system can be used, e. g., insect or mammalian (for example HEK293, CHO or COS cells) cell expression systems.
  • Cells that normally express olfactory receptors can be used, particularly to study the physiological effect of an odorant on a cell. Isolation and/or culturing of such cells and their transformation with the olfactory receptor-expressing sequences of the invention can be done with routine methods (Vargas, 1999; Coon et al., 1989).
  • Several methods of measuring G-protein activity are known to those of skill in the art and can be used in conjunction with the methods of the present invention, including but not limited to measuring calcium ion or cyclic AMP concentration in the cells. Such methods are described in Howard et al.
  • patch-clamping of individual cells can be done.
  • Patch-clamp recordings of the olfactory receptor cell membrane can measure membrane conductances. Some conductances are gated by odorants in the cilia and depolarize the cell through cAMP-or IP3-sensitive channels, depending on the species. Other conductances are activated by membrane depolarization and/or an increased intracellular Ca2+ concentration (Trotier, 1994).
  • Changes in calcium ion levels in the cell after exposure of the cell to known or potential odorant/ligands can be detected by a variety of means.
  • cells can be pre-loaded with reagents sensitive to calcium ion transients.
  • Techniques for the measurement of calcium transients are known in the art. For example, Kashiwayanagi (1996) measured both of inositol 1,4,5-trisphosphate induces inward currents and Ca2+ uptake in frog olfactory receptor cells.
  • intracellular calcium concentration is measured in the screening assays of the instant application by using a Fluorometric Imaging Plate Reader (“FLIPR”) system (Molecular Devices, Inc.), which provides the advantages of automated, high-throughput screening, see also Sullivan et al., 1999, "Measurement of [Ca2+] i using the fluorometric imaging plate reader (FLIPR), "In Calcium Signaling Protocols, ed Lambert, D. G. , pp. 125-136 (New Jersey: Humana Press); or in US 6,004, 808, which employs Fura-PE3 (Molecular Probes, Inc., Eugene, OR) as a stain of calcium ions.
  • FLIPR Fluorometric Imaging Plate Reader
  • physiologic activity mechanisms can also be measured, e. g., plasma membrane homeostasis parameters (including lipid second messengers), and cellular pH changes (see, e. g., Silver, 1998).
  • in vitro synthesised mRNA coding for a polypeptide of the invention can be injected into Xenopus oocytes allowing electrophysiological or calcium imaging of odorant-driven cell excitation.
  • a typical principle of the assays used to identify compounds that bind to olfactory receptors of the invention involves preparing a reaction mixture of an said receptor and a test compound under conditions and for a time sufficient to allow the two components to interact and bind, thus forming a complex which can be removed and/or detected in the reaction mixture.
  • one method to conduct such an assay involves attaching the receptor or the test substance onto a solid phase and detecting receptor/test compound complexes anchored on the solid phase at the end of the reaction.
  • the receptor can be anchored onto a solid surface, and the test compound, which is not anchored, can be labeled, either directly or indirectly.
  • microtiter plates can conveniently be utilized as the solid phase.
  • the anchored component can be immobilized by non-covalent or covalent attachments.
  • Non-covalent attachment can be accomplished by simply coating the solid surface with a solution of the protein and drying.
  • an immobilized antibody preferably a monoclonal antibody, specific for the protein to be immobilized can be used to anchor the protein to the solid surface.
  • the surfaces can be prepared in advance and stored.
  • the nonimmobilized component is added to the coated surface containing the anchored component. After the reaction is complete, unreacted components are removed (e. g., by washing) under conditions such that any complexes formed will remain immobilized on the solid surface.
  • the detection of complexes anchored on the solid surface can be accomplished in a number of ways.
  • the detection of label immobilized on the surface indicates that complexes were formed.
  • an indirect label can be used to detect complexes anchored on the surface; e. g., using a labeled antibody specific for the previously nonimmobilized component (the antibody, in turn, can be directly labeled or indirectly labeled with a labeled anti-Ig antibody).
  • a reaction can be conducted in a liquid phase, the reaction products separated from unreacted components, and complexes detected; e. g., using an immobilized antibody specific for an olfactory receptor of the invention or the test compound to anchor any complexes formed in solution, and a labeled antibody specific for the other component of the possible complex to detect anchored complexes.
  • High throughput screening assays can also be used to identify compounds that bind and/or modulate an olfactory receptor of the invention.
  • the high throughput assays of the invention it is possible to screen up to several thousand different ligands or modulators in a single day.
  • each well of a microtiter plate can be used to run a separate assay against a selected potential modulator, or, if concentration or incubation time effects are to be observed, every 5-10 wells can test a single modulator.
  • a single standard microtiter plate can assay about 100 (e. g., 96) modulators. If 1536 well plates are used, then a single plate can easily assay from about 1000 to about 1500 different compounds. It is possible to assay several plates per day. More recently, microfluidic approaches to reagent manipulation have been developed.
  • methods can be employed which result in the simultaneous identification of genes which encode proteins interacting with an olfactory receptor of the invention. These methods include, for example, probing expression libraries with labeled polypeptide of the invention, using this protein in a manner similar to the well known technique of antibody probing of ⁇ gtl 1 libraries.
  • plasmids are constructed that encode two hybrid proteins: one consists of the DNA-binding domain of a transcription activator protein fused to a known protein, in this case, a polypeptide of the invention, and the other consists of the activator protein's activation domain fused to an unknown protein that is encoded by a cDNA, preferably an insect (more preferably a Lepidopteran) antennal or maxillary palp cDNA, which has been recombined into this plasmid as part of a cDNA library.
  • the plasmids are transformed into a strain of the yeast Saccharomyces cerevisiae that contains a reporter gene (e.
  • Computer modeling and searching technologies permit identification of compounds that can bind olfactory receptors of the invention, including compounds that can modulate olfactory receptor activity.
  • the identification of such a compound may also allow the active sites or regions of the receptor to be identified.
  • Such active sites might typically be odorant ligand binding sites, such as the interaction domains of odorant ligands with the receptor.
  • the three dimensional geometric structure of olfactory receptor or the active site thereof can be determined. This can be done by known methods, including X-ray crystallography, which can determine a complete molecular structure. Solid or liquid phase NMR can also be used to determine certain intra-molecular distances within the active site and/or in the odorant ligand/receptor complex. Any experimental method of structure determination can be used to obtain partial or complete geometric structures.
  • the geometric structures may be measured with a completed odorant ligand, natural or artificial, which may increase the accuracy of the receptor structure, or active site structure, that is determined.
  • Methods of computer based numerical modeling can be used to complete the structure (e. g., in embodiments wherein an incomplete or insufficiently accurate structure is determined) or to improve its accuracy. Any method recognized in the art may be used, including, but not limited to, parameterized models specific to particular biopolymers such as proteins or nucleic acids, molecular dynamics models based on computing molecular motions, statistical mechanics models based on the ⁇ nal ensembles, or combined models.
  • the three-dimensional structure of an olfactory receptor of the invention can be used to identify antagonists or agonists through the use of computer modeling using a docking program such as GRAM, DOCK, or AUTODOCK (Dunbrack et al., 1997).
  • Computer programs can also be employed to estimate the attraction, repulsion, and steric hindrance of a candidate compound to the polypeptide.
  • the tighter the fit e.g., the lower the steric hindrance, and/or the greater the attractive force
  • the more potent the potential agonist or antagonist will be since these properties are consistent with a tighter binding constant.
  • the more specificity in the design of a potential agonist or antagonist the more likely that it will not interfere with other proteins.
  • a potential compound could be obtained, for example, using methods of the invention such as by screening a random peptide library produced by a recombinant bacteriophage or a chemical library. A compound selected in this manner could be then be systematically modified by computer modeling programs until one or more promising potential compounds are identified.
  • Such computer modeling allows the selection of a finite number of rational chemical modifications, as opposed to the countless number of essentially random chemical modifications that could be made, and of which any one might lead to a useful agonist or antagonist.
  • Each chemical modification requires additional chemical steps, which while being reasonable for the synthesis of a finite number of compounds, quickly becomes overwhelming if all possible modifications needed to be synthesized.
  • a large number of these compounds can be rapidly screened on the computer monitor screen, and a few likely candidates can be determined without the laborious synthesis of untold numbers of compounds.
  • standard molecular force fields representing the forces between constituent atoms and groups, are necessary, and can be selected from force fields known in physical chemistry.
  • Exemplary forcef ⁇ elds that are known in the art and can be used in such methods include, but are not limited to, the Constant Valence Force Field (CVFF), the AMBER force field and the CHARM force field.
  • CVFF Constant Valence Force Field
  • AMBER AMBER force field
  • CHARM CHARM force field.
  • the incomplete or less accurate experimental structures can serve as constraints on the complete and more accurate structures computed by these modeling methods. Alternatively, these methods can be used to identify improved modulating compounds from an already known modulating compound or odorant ligand.
  • the composition of the known compound can be modified and the structural effects of modification can be determined using the experimental and computer modeling methods described above applied to the new composition.
  • the altered structure is then compared to the active site structure of the compound to determine if an improved fit or interaction results.
  • systematic variations in composition such as by varying side groups, can be quickly evaluated to obtain modified binding compounds or odorant ligands of improved specificity or activity.
  • CHARMm performs the energy minimization and molecular dynamics functions.
  • QUANTA performs the construction, graphic modelling and analysis of molecular structure. QUANTA allows interactive construction, modification, visualization, and analysis of the behaviour of molecules with each other.
  • a cDNA library was constructed from dissected antennae of newly eclosed adult male Epiphyas postvittana.
  • Total RNA was made using TRIzoi (Invitrogen) from at least 1000 antennae according to the manufacturer's instructions.
  • mRNA was then prepared from total RNA using Dynabeads (Dynal) and a cDNA library constructed using the ⁇ -ZAP II system (Statagene), both according to the manufacturer's instructions. , This resulted in a cDNA library containing approximately 10 6 pfu. Plasmids from the phage cDNA libraries were mass excised according to the manufacturer's recommendations (Stratagene).
  • Plasmid extractions were then undertaken on individual bacterial colonies and 5161 clones were sequenced from the 5' end. Big Dye Terminator sequencing reactions were resolved on either ABI377, ABI3100 or ABI3700 sequencers ⁇ • according to the manufacturer's instructions (Applied Biosystems).
  • the 5161 EST sequences were automatically trimmed of vector, adapter and low quality sequence regions, before being uploaded into a relational database.
  • Automatic annotation was performed using the HortResearch BioPipe sequence annotation pipeline (a cluster based annotation system written in PERL (R. Crowhurst, unpublished) utilising the relational database MySQL (http://www.mysql.com)).
  • the EST clustering phase was performed using the TIGR Gene Indices Clustering Tools (http://www.tigr.org/tdb/tgi/software/). Resulting contig sequences were compared to GenBank using tblastn (Altschul et al., 1990).
  • RACE was employed to isolate a full length cDNA of EposOKi using antennal cDNA.
  • One hundred pairs of male antennae were collected from 2-3 day old moths and frozen immediately in liquid nitrogen.
  • Total RNA extraction was performed using the TRIzoi (Invitrogen) method following the manufacturer's instructions and the resulting RNA pellet was resuspended in 50 ⁇ l of DEPC-treated water.
  • First strand cDNA was synthesised from 1 ⁇ g of total RNA using Superscript III reverse transcriptase (Invitrogen) and oligodT primer (RoRJdT) 6 :
  • EposOKi 5 ' ATCGATGGTCGACGCATGCGGATCCAAAGCTTGAATTCGAGCTCTTTTTTTTTTTTT 3'
  • the synthesis was performed in accordance with the instructions for Superscript III.
  • the 3' end of the EposOKi gene was amplified from male antenna] cDNA using 3' RACE PCR.
  • a forward primer (EposOR3 F: 5' ACATCGCCACATTCATTTTCAA 3') (SEQ ID NO:24) designed from the 5' end of the EposOR.3 EST #22464 sequence was used together with the oligodT primer (RoRJdTi 6 ) which primes to the mRNA poly A + tail.
  • Two microlitres of 10 fold diluted cDNA was used as template in a 50 ⁇ l reaction consisting of, 1 ⁇ l of each primer at 10 ⁇ M concentration, 5 ⁇ l of dNTP mix (Invitrogen) at 2 mM concentration, 5 ⁇ l of 10 x PCR buffer (-Mg 2+ ), 1.5 ⁇ l of 50 mM MgCl 2 and 0.5 ⁇ l Platinum Taq Polymerase (Invitrogen).
  • the thermocycling conditions used were 94°C for 2 min, then 30 cycles of 94 0 C for 10 s, 55°C for 30 s, 72 0 C for 1 min and a final extension of 72°C for 10 min.
  • PCR products were examined by running 10 ⁇ l on a 1 % agarose gel and staining with ethidium bromide.
  • the method used for 5' RACE was adapted from the Invitrogen 5' RACE Kit manual.
  • First strand cDNA was synthesised using the outer gene specific primer EposOR3 5RACE2 (5 '-TCCAGATTGAGGAGTATGAAGGTC-S ') (SEQ ID NO:25).
  • the cDNA was purified using the PCR purification kit (Roche) according to the kit protocol, the final step was performed with 40 ⁇ l of elution buffer. Nucleotides encoding a homopolymeric tail of cysteine residues were then added to the 3' end of the cDNA using Terminal Transferase (Roche).
  • Ten microlitres of the purified cDNA was used in a 20 ⁇ l tailing reaction together with 2 ⁇ l of a 10 mM dCTP solution, 4 ⁇ l of 5 x tailing buffer, 4 ⁇ l of 25 mM COCl 2 and 1 ⁇ l of TdT enzyme (Roche).
  • the reagents were mixed well and incubated at 37°C for 1 h after which time the enzyme was heat inactivated by incubating at 65 0 C for 15 min.
  • the tailed cDNA was then directly amplified by two rounds of PCR using the appropriate gene specific primers.
  • 5 ⁇ l of the tailed cDNA was used in a 50 ⁇ l reaction with 2 ⁇ l of EposOR.3 RACE2 at 10 ⁇ M, 2 ⁇ l of the AAP primer (5'- GGCCACGCGTCGACTAGTACGGGIIGGGIIGGGIIG-3') (SEQ ID NO:26) at 10 ⁇ M, 5 ⁇ l of dNTP mix (Invitrogen) at 2 mM concentration, 5 ⁇ l of 10 x PCR buffer (- Mg 2+ ), 1.5 ⁇ l of 50 mM MgCl 2 and 0.75 ⁇ l Platinum Taq Polymerase (Invitrogen).
  • Thermocycling conditions were as follows, 94°C for 2 min, then 30 cycles of 94 0 C for 10 s, 50 0 C for 30 s, 72°C for 1 min and a final extension of 72°C for 10 min.
  • One microlitre was taken from the first PCR reaction tube to be used as template for the second round of PCR.
  • the reaction conditions for this PCR were the same as for the first except that a nested gene specific primer (EposOR3 5RACE1 ; 5'- CGTTGAAAATGAATGTGGCGATGT-3 ') (SEQ ID NO:27) was used together with the AUAP primer (5 '-GGCCACGCGTCGACTAGTAC-S') (SEQ ID NO:28).
  • the blue/white screen was used to select for cells containing plasmids with PCR product inserts. Individual white colonies were picked and screened by PCR to confirm that they had inserts of the correct size. The colony was picked from the plate with a pipette tip and placed into a PCR tube containing 7 ⁇ l of water.
  • PCR products were analysed on a 1% agarose gel and stained with ethidium bromide.
  • Colonies with inserts of the correct size were grown in 4 ml of 2YT media supplemented with 200 ⁇ g/ml "1 ampicillin, at 37°C overnight in a shaking incubator. Plasmid DNA was then purified from the cell culture using the QIAprep Spin Miniprep Kit (Qiagen) following the manufacturer's instructions. The presence and size of the plasmid inserts was again checked by digestion with the restriction enzyme EcoRl, which cuts either side of the insert within the plasmid DNA. The digestion products were analysed on a 1% agarose gel. Plasmids containing the correct insert size were sequenced in both directions on an ABI 3100 genetic sequencer.
  • DNA sequence analysis was performed with Sequencher v4.2 software (Gene Codes).
  • the original DNA sequence of the corresponding EST was imported into the Sequencher project and aligned with the new sequence to confirm there was a perfect match between the overlapping regions of the sequences. This provided confidence that the new sequence was valid.
  • the predicted protein translation of the new sequence was imported into the alignment programme ClustalX 1.83 (Thompson et al.,1997) and compared to known protein sequences of other insect receptors to identify regions of homology also to provide affirmation of the sequence's validity.
  • Neighbour joining trees of Lepidopteran ORs were calculated using VectorNTi suite based on a ClustalX alignment.
  • EposOR3 The transmembrane domains of EposOR3 were predicted using the online programme TMHMM 2.0 (Krogh, et al., 2001 ; Sonnhammer et al., 1998), which is found through the Centre for Biological Sequence Analysis (CBS), the TMAP programme (Persson et al., 1994), which is part of the European Molecular Biology Open Software Suite (EMBOSS).
  • CBS Centre for Biological Sequence Analysis
  • EMBOSS European Molecular Biology Open Software Suite
  • RNA extraction The four tissue types, collected from male and female moths, for expression analysis were antennae (collected during daylight hours), antennae (collected during night time hours), bodies (minus head and legs), and legs (one representative of each of the three pairs from each moth). Antennal, body and leg tissue was removed from male and female 2-3 day old adult moths. The separate tissues were snap frozen immediately with liquid nitrogen and stored at -8O 0 C. Total RNA was extracted from all eight tissue types using the TRIzol Reagent (Invitrogen) protocol as per the manufacturer's instructions. The resulting RNA pellets were resuspended in DEPC- treated water, 50 ⁇ l for antennae and leg samples and 75 ⁇ l for body tissue, and heated to 65 0 C for 10 min. RNA quantification was then performed with an Agilent 8453 UV/Visible spectrophotometer.
  • RNA Total RNA, from the eight different tissues, was first DNase treated using DNaseI Amplification Grade (Invitrogen) according to manufacturer's instructions. Five micrograms of total RNA was used per DNase reaction and the total volume scaled up accordingly. The RNA was purified and concentrated with the Qiagen RNeasy MiniElute Kit (Qiagen). One microlitre of the RNA elutant was diluted 10 fold and 1 ⁇ l of this was used for quantification with a Nanodrop spectrophotometer (NanoDrop Technologies). Triplicate cDNA transcription reactions and a negative control (without reverse transcriptase enzyme) were performed for each of the eight tissues.
  • DNaseI Amplification Grade Invitrogen
  • cDNA was reverse transcribed from 0.5 ⁇ g of total RNA in a 20 ⁇ l reaction with the following conditions; 500 ng oligo dT15 (Promega), 500 ng random hexamers (Promega), 500 ⁇ M of each dNTP (Invitrogen), Ix transcription buffer (Invitrogen), 5 mM DTT, 200 LJ SuperscriptTM RNase H " III reverse transcriptase (Invitrogen).
  • the RNA template, oligo dT15, random hexamers and dNTPs were mixed together and the volume made up to 14 ⁇ l with DEPC-treated water. The sample was heated to 65°C for 5 min and then cooled immediately on ice.
  • the transcription buffer, DTT and Superscript III enzyme were added to the reaction and mixed well before incubating at 25°C for 5 min followed by 5O 0 C for 1 h.
  • each of the triplicate reactions was made up to 100 ⁇ l (5 fold dilution) with distilled water. To compensate for differences in cDNA production, the triplicate reactions for each tissue sample were added together and mixed well then aliquoted back out into three separate volumes of 100 ⁇ l. The negative RT enzyme reactions were also made up to 100 ⁇ l.
  • EposOR2 Quantitative Reverse Transcription PCR
  • Primers were designed to amplify approximately lOObp products from EposOKi using Oligo Explorer 1.1.0 software (http://www.ulcu.fi/ ⁇ kuulasma/OligoSoftware) and consisted of RT OR3 forward (5'- TCATCTCCTTCGTCGTCTGTT-3') (SEQ ID NO:29) and RT OR3 reverse (5'- TCAGTTTCCCACCGCTTTCT-3') (SEQ ID NO:30).
  • the template cDNA was synthesised as described above.
  • Plate document design and instrument set up were prepared within the SDS 2.1 software (Applied Biosystems). Absolute quantification was selected as the assay type and the PCR was performed in 384 well plates (Axygen).
  • the plate document set up involved entering information about detectors used and their arrangement on the plate along with sample arrangement. Each of the eight primer pairs was set up as a separate detector, which was then associated with the appropriate sample well on the plate grid.
  • the 20 ⁇ l PCR reactions were performed with the same reaction composition as used for primer testing except for the addition of 0.4 ⁇ l of 1/1000 diluted SYBR® Green dye (Molecular Probes) in TE buffer.
  • the PCR was run on an ABI PRISM® 7900HT Fast Real-Time PCR System with the following cycling conditions 94 0 C for 2 min, then 40 cycles of 94 0 C for 10 s, 55 0 C for 30 s, 72 0 C for 15 s.
  • ⁇ data file was first opened with the programme and analysed and an appropriate manual threshold and baseline level were set.
  • the threshold level was set within the geometric phase of the logarithmic scale amplification plot.
  • the dissociation curve of each triplicate reaction was used to confirm a single PCR product had been amplified; any samples with unusual dissociation curves were not used in further analysis.
  • the amplification plots of each of the triplicates were also studied and any outlier removed if necessary.
  • the amplification efficiencies for each of the primer sets were calculated from the exported clipped data using the programme LinRegPCR (Ramakers et al., 2003).
  • the Cycle Threshold (CT) values of all the individual samples were then converted to quantities (Q) using a modified delta CT method with correction for primer amplification efficiencies (Pfaffl, 2001).
  • the normalisation factor for each tissue type was determined from the geometric mean of the housekeeping gene quantities using the software programme geNorm (Vandesompele et al, 2002). Relative expression was then calculated for each of the samples using the appropriate normalisation factor.
  • ORSR- GTTTTCATCAAACACTGACATCACC SEQ ID NO:32
  • RNA was also extracted from antennae of more distantly related Lepidopteran species, Ephestia cautella, Plodia interpunctella, Leuciris fimbriarie, Helicoverpa armigera, and Plutella xylostella using a modified guanidinium thiocyanate phenol chlorofonn extraction method as described in Clyne et al. (1999).
  • 20 - 50 antennae were used for RNA preparation.
  • Oligo dT primed cDNA synthesis using Superscript III Reverse Transcriptase (Invitrogen) was performed on the entire RNA preparation according to manufacturer's directions.
  • Degenerate primers (Forward primer: GCNGTSACNGTRAARTGGTA (SEQ ID NO:21), reverse primer: CATSACSAGNGTRAARAANSWC (SEQ ID NO:22)) were used in subsequent PCR reactions to amplify the C-terminus of the EposORS homologue. PCR was carried out using Hi-Fidelity Tag polymerase (Roche), with an annealing temperature of 56°C and MgCl concentration of 2.5mM. Resulting PCR fragments were cut from the agarose gel and purified using
  • the EposOR3 cDNA ( Figure 1) encodes a 410-aa protein with seven putative transmembrane domains, which is characteristic of the G protein-coupled receptor family ( Figure 2) and of the insect ORs, which are putative atypical GPCRs.
  • EposOR3 RT-PCR EposOR3 is expressed in adult antennal tissues but not in other adult tissues.
  • EposORS is expressed in the antennae of both males and females ( Figure 4).
  • EposOR3 Full length homologues of EposOR3 were amplified from antennal cDNA preparations of two closely related tortricid species Ctenopseustis obliquana and
  • a full length homologue of EposOR3 was identified by blasting the B. mori genome database and was constructed from a Chinese scaffold (CH381065.1- Bombyx mori strain Dazao Scaffold001484 genomic scaffold).
  • the B. mori genome database provided no indication that the relevant region of the B. mori genome comprised a gene encoding an olfactory receptor.
  • the predicted B. mori homologue shares 66% amino acid identity and over 77% amino acid similarity with EposOR3 (Table 2).
  • SEQ ID NO:34 contains 3 amino acid differences when compared to the deduced amino acid sequence (SEQ ID NO:5) obtained from our detailed analysis of the B. mori genome sequence.
  • the present inventors have discovered a family of conserved odorant receptors
  • odorant receptors are, as a general rule, highly divergent with no sequence similarity detectable between the ORs of vertebrates, insects and nematodes. Even amongst related species, it is generally the case that OR sequences have diverged more rapidly than other protein coding sequences.
  • family of insect receptors that includes dOR83b (D. melanogaster), CcOr83b (Ceratitis capitata), CeryR2 Table 3. Protein identities (above diagonal) and protein similarity (below diagonal) for C-terminal amino acids of EposOR3 and its homologues. Figures for B. mori based on use of SEQ ID NO:5.
  • dOR83b Sequence identity between dOR83b and a lepidopteran, H. zea, OR83b is 65%. dOR83b is also exceptional by virtue of being widely expressed in most, if not all, olfactory receptor neurons of D. melanogaster. Other Drosophila ORs are expressed in a subset only of ORs.
  • the EposOR3 family of ORs represents a second exception to the general rule of highly divergent ORs. The levels of identity among members of the EposOR3 family is lower than is observed among members of the dOR83b family but it is still extraordinarily high for ORs and indicative of a function that may have been conserved over a timescale of approximately 100 million years.
  • EposOR3 family differs from the OR83b family in that there is no significant sequence similarity between the EposOR3 family and the OR83b family, sharing only 13.5% identity and 27.2% similarity in E. postvittana.
  • EposOR3 homologue has been found in all lepidopterans analysed spanning a wide variety of different families. It is conceivable that, in the future, EposOR3 homologues may also be discovered in insects from orders other than Lepidoptera because the evidence that an EposOR3 homologue is absent is limited to a very small number of fully sequenced genomes representing only three of the generally recognised insect orders. It would be possible to use EposOR3 -derived conserved PCR primers to screen for the presence of EposOR3 homologues in non- lepidopteran as well as other lepidopteran species using the RT-PCR method disclosed in Methods.
  • EposOR3 or one of the homologues reported herein could be used as a template to direct the synthesis of a labelled probe using standard procedures well known to molecular biologists. Such probes could be used to probe cDNA libraries made from the antennae or heads of other lepidopteran or non-lepidopteran insect species.
  • EposOR3 or its homologues can be used directly to disrupt chemosensation in
  • EposOR3 could be ectopically expressed in an insect, using transgenic technology, or using a viral vector.
  • the Ahalo mutant has been described by Dobritsa et al. (2003). This mutant has a 100kb deletion that includes the odorant receptor genes Or22a or Or22b . These receptors are normally expressed in the ab3A neuron in wildtype flies. In the Ahalo mutants neither gene is expressed and electrophysiological recordings show the ab3A neuron is unresponsive to all odours tested, while all other classes of olfactory receptor neurons, which express different odorant receptors, show odour responses similar to those of wild type neurons. Using the GAL4/UAS system (Dobritsa et al., 2003) EposOR3 can be transformed, under the control of 22a-GAL4, in the Ahalo mutant so as to drive the expression in the ab3A neuron.
  • a cDNA containing the entire ORF of EposOR3 will be obtained by RT-PCR from antennal RNA of Epiphyas postvittana and cloned into the pUAST vector (Brand and Perrimon, 1993). This vector would be transformed into w i ⁇ s ; Ahalo Drosophila embryos as described by Spradling (1986). Briefly, 15 ⁇ g of the EposOR3- ⁇ JAS construct would be mixed with 6 ⁇ g of a helper plasmid capable of providing transposase ( ⁇ 2/3) and this would be microinjected into embryos prior to the stage of pole cell formation.
  • Epos ⁇ r3 was functionally analysed using a calcium imaging assay which has been described by Kiely et al. (2007). Briefly Spodoptera frugiperda (S f9) cells were transiently transfected with a pIB-EposOr3 vector using Escort IV (sigma).
  • Transfected cells were incubated for 48hours to allow the expression of Epos ⁇ r3 before calcium imaging of responses to ligands were assessed.
  • Fluo4 was used as a calcium indicator and fluorescence images were recorded using a Leitz digital still camera. Images were recorded every 10 seconds for 50 seconds after the addition of; saline (as a control), the test ligand and Ionomycin (to determine maximal fluorescence). Images were analysed using Metafluor® imaging system and ⁇ F was calculated for given concentrations. ⁇ F is dete ⁇ nined as the ratio of change in fluorescence from basal levels after the addition of a ligand to maximum change in fluorescence from ' basal levels after the addition of Ionomycin.
  • Ligand class Tested ligands Monoterpenes ⁇ -pinene ⁇ -pinene 1,4-cineole Limonene
  • Bombyx mori homologue (BmOr49) was also screened for responses to a subset of the ligands. Preliminary data shows this homologue at least also responds to.Citral, Geraniol and Geranyl acetate (Table 6).
  • EposOR3 or orthologs, allellic variants or mutants thereof can also be tested in Drosophila S2 cells and lepidopteran Sf9 cells as follows.
  • a full length cDNA of the entire ORF to be tested can be obtained via RT-PCR and cloned into the pAc5.1/V5-HisB and pIB/V5-His vectors (Invitrogen). These vectors can be transformed into S2 and Sf9 cells respectively. Stable cell lines can be obtained according to Invitrogen's instructions.
  • the fluorescent calcium indicator can be used to monitor changes in the intracellular calcium ion level that occurs due to the activation of a signal transduction pathway when an odour binds to an expressed odorant receptor.
  • Other fluorescent calcium indicator dyes such as Fluo-4 could also be used.
  • cells are washed in assay buffer (129.7 mM NaCl, 5.44 mM KCl, 1.2 mM MgCl 2 .6H 2 O, 4.2 mM NaHCO 3 , 7.3 mM NaH 2 PO 4 , 20 mM Hepes, 63 mM saccharose; pH 6.2) which is supplemented with 1 mM CaCl 2 , 4 ⁇ g/ml fura-2 acetoxymethyl ester (Molecular Probes), 10 mM glucose, and 1 mM probenecid, and incubated in the dark for 30 min at room temperature (22 0 C).
  • assay buffer 129.7 mM NaCl, 5.44 mM KCl, 1.2 mM MgCl 2 .6H 2 O, 4.2 mM NaHCO 3 , 7.3 mM NaH 2 PO 4 , 20 mM Hepes, 63 mM saccharose; pH 6.2
  • assay buffer 129
  • the cells are loaded with .fura-2 will be rinsed twice in assay buffer, as above, but without the Fura-2 acetoxymethyl ester.
  • 10 4 cells in assay buffer with 1 mM CaCl 2 , 10 mM glucose, and 1 mM probenecid are then transferred to each well of a 96-well plate. Fluorescence levels are measured before, and after the addition of odours to the cells using a Fluorescence plate reader (Fluostar, BMG labtechnologies). A ratio-metric analysis of the fura-2 fluorescence at two excitatory wavelengths (340nm and 380nm) is used to determine the response of the OR to the odour.
  • Odours to be tested include many plant volatiles that have previously shown to be detected by insects (see Table 7). As well as individual odours, extractions from plants that will contain many different odours will be tested in order to verify function of the OR. If a response is seen then the extractions can be separated to determine the specific ligand the OR is responding to.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Insects & Arthropods (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)

Abstract

L'invention concerne des récepteurs olfactifs d'insectes, ainsi que des variants et des mutants fonctionnels de ceux-ci. En particulier, l'invention concerne une famille hautement conservée de récepteurs olfactifs qui sont au moins trouvés dans les espèces de Lépidoptères. L'invention concerne également des polynucléotides codant pour ces récepteurs olfactifs ainsi que des vecteurs comprenant lesdits polynucléotides. De plus, la présente invention concerne des procédés d'identification de ligands odorants.
PCT/AU2007/000510 2006-04-20 2007-04-19 Récepteurs olfactifs d'insectes WO2007121512A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US74524006P 2006-04-20 2006-04-20
US60/745,240 2006-04-20

Publications (1)

Publication Number Publication Date
WO2007121512A1 true WO2007121512A1 (fr) 2007-11-01

Family

ID=38624453

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/AU2007/000510 WO2007121512A1 (fr) 2006-04-20 2007-04-19 Récepteurs olfactifs d'insectes

Country Status (1)

Country Link
WO (1) WO2007121512A1 (fr)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012061039A3 (fr) * 2010-10-25 2012-08-16 Vanderbilt University Compositions pour inhiber la capacité d'insectes à détecter des hôtes
US9578881B2 (en) 2011-05-06 2017-02-28 Vanderbilt University Compositions for inhibition of insect sensing
WO2020006108A3 (fr) * 2018-06-26 2020-03-05 Duke University Récepteurs odorants synthétiques
US10791739B2 (en) 2015-03-25 2020-10-06 Vanderbilt University Binary compositions as disruptors of orco-mediated odorant sensing
US11009502B2 (en) 2017-08-16 2021-05-18 Aromyx Corporation Ectopic olfactory receptors and uses thereof
US11092599B2 (en) 2016-02-24 2021-08-17 Aromyx Corporation Biosensor for detecting smell, scent, and taste

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6610511B1 (en) * 1999-01-25 2003-08-26 Yale University Drosophila odorant receptors
US20050153368A1 (en) * 2001-01-26 2005-07-14 Zwiebel Laurence J. Method of identifying chemical agents which stimulate odorant receptors of sensory neurons

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6610511B1 (en) * 1999-01-25 2003-08-26 Yale University Drosophila odorant receptors
US20050153368A1 (en) * 2001-01-26 2005-07-14 Zwiebel Laurence J. Method of identifying chemical agents which stimulate odorant receptors of sensory neurons

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
CHEM. SENSES, vol. 31, no. 6, 2006, pages 547 - 555 *
DATABASE GENPEPT [online] GROSSE-WILDE E., SVATOS A., KRIEGER J.: "A pheromone-binding protein mediates the bombykol-induced activation of a pheromone receptor in vitro", XP003018842, accession no. NCBI Database accession no. (NP_001036925) *
DATABASE GENPEPT [online] HOSKINS R.A. ET AL.: "Sequence Finishing and Mapping of Drosophila melanogaster Heterochromatin", XP003018841, accession no. NCBI Database accession no. (NP_523359) *
DATABASE UNIPROT [online] KRIEGER J. ET AL.: "A divergent gene family encoding candidate olfactory receptors of the moth Heliothis virescens", XP003018840, accession no. EMBL Database accession no. (Q8MMI0) *
EUR. J. NEUROSCI., vol. 16, 2002, pages 619 - 628 *
SCIENCE, vol. 316, no. 5831, 2007, pages 1625 - 1628 *

Cited By (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10701938B2 (en) 2010-10-25 2020-07-07 Vanderbilt University Composition for inhibition of insect host sensing
CN103402988A (zh) * 2010-10-25 2013-11-20 范德比尔特大学 用于抑制昆虫宿主感觉的组合物
US9332757B2 (en) 2010-10-25 2016-05-10 Vanderbilt University Composition for inhibition of insect host sensing
WO2012061039A3 (fr) * 2010-10-25 2012-08-16 Vanderbilt University Compositions pour inhiber la capacité d'insectes à détecter des hôtes
US10091997B2 (en) 2010-10-25 2018-10-09 Vanderbilt University Composition for inhibition of insect host sensing
US10813355B2 (en) 2011-05-06 2020-10-27 Vanderbilt University Compositions for inhibition of insect sensing
US10188105B2 (en) 2011-05-06 2019-01-29 Vanderbilt University Compositions for inhibition of insect sensing
US9578881B2 (en) 2011-05-06 2017-02-28 Vanderbilt University Compositions for inhibition of insect sensing
US11484032B2 (en) 2011-05-06 2022-11-01 Vanderbilt University Compositions for inhibition of insect sensing
US10791739B2 (en) 2015-03-25 2020-10-06 Vanderbilt University Binary compositions as disruptors of orco-mediated odorant sensing
US11856955B2 (en) 2015-03-25 2024-01-02 Vanderbilt University Binary compositions as disruptors of Orco-mediated odorant sensing
US11092599B2 (en) 2016-02-24 2021-08-17 Aromyx Corporation Biosensor for detecting smell, scent, and taste
US11460469B2 (en) * 2016-02-24 2022-10-04 Aromyx Corporation Biosensor for detecting smell, scent, and taste
US11009502B2 (en) 2017-08-16 2021-05-18 Aromyx Corporation Ectopic olfactory receptors and uses thereof
WO2020006108A3 (fr) * 2018-06-26 2020-03-05 Duke University Récepteurs odorants synthétiques

Similar Documents

Publication Publication Date Title
Yano et al. A SNARE complex containing SGR3/AtVAM3 and ZIG/VTI11 in gravity-sensing cells is important for Arabidopsis shoot gravitropism
Forstner et al. A receptor and binding protein interplay in the detection of a distinct pheromone component in the silkmoth Antheraea polyphemus
Yan et al. Role of tomato lipoxygenase D in wound-induced jasmonate biosynthesis and plant immunity to insect herbivores
Wang et al. Armet is an effector protein mediating aphid‐plant interactions
Voelker et al. Members of the Arabidopsis AtTPK/KCO family form homomeric vacuolar channels in planta
Gong et al. Cloning, expression and functional analysis of a general odorant‐binding protein 2 gene of the rice striped stem borer, Chilo suppressalis (Walker)(Lepidoptera: Pyralidae)
US7622269B2 (en) Methods of screening tyramine- and octopamine-expressing cells for compounds and compositions having potential insect control activity
AU2003276774B2 (en) Organ preferential genes identified by T-DNA insertional mutagenesis of rice
US9228196B2 (en) Method for changing nitrogen utilization efficiency in plants
WO2007121512A1 (fr) Récepteurs olfactifs d'insectes
Guo et al. Aldehyde dehydrogenase plays crucial roles in response to lower temperature stress in Solanum tuberosum and Nicotiana benthamiana
Waris et al. Expression profiles and biochemical analysis of chemosensory protein 3 from Nilaparvata lugens (Hemiptera: Delphacidae)
Motose et al. A NIMA‐related protein kinase suppresses ectopic outgrowth of epidermal cells through its kinase activity and the association with microtubules
Li et al. Arabidopsis NRT1. 2 interacts with the PHOSPHOLIPASE Dα1 (PLDα1) to positively regulate seed germination and seedling development in response to ABA treatment
Chen Heterotrimeric G-proteins in plant development
Duan et al. NlugOBP8 in Nilaparvata lugens involved in the perception of two terpenoid compounds from rice plant
Hariton-Shalev et al. Structural and functional differences between pheromonotropic and melanotropic PK/PBAN receptors
AU2008200389A1 (en) Insect olfactory receptors and ligands therefor
AU2005226676B2 (en) Compositions and methods for controlling insects related to the octopamine receptor
Hu et al. Isolation and characterization of Schistosoma mansoni constitutive androstane receptor
US20040248791A1 (en) Insect g protein-coupled receptor genes and uses thereof
Begum Identification and analysis of olfactory receptors from the light brown apple moth,(Epiphyas postvittana)
CN103614382B (zh) 菜青虫5-羟色胺受体基因Pr5-HT8及其应用
CN107406853A (zh) 新颖的Bt毒素受体和使用方法
JPWO2004065604A1 (ja) 幼若ホルモン酸メチル基転移酵素遺伝子およびその利用法

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 07718757

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 07718757

Country of ref document: EP

Kind code of ref document: A1