WO2007111500A1 - immunisation par champignons transgeniques - Google Patents

immunisation par champignons transgeniques Download PDF

Info

Publication number
WO2007111500A1
WO2007111500A1 PCT/NL2007/000086 NL2007000086W WO2007111500A1 WO 2007111500 A1 WO2007111500 A1 WO 2007111500A1 NL 2007000086 W NL2007000086 W NL 2007000086W WO 2007111500 A1 WO2007111500 A1 WO 2007111500A1
Authority
WO
WIPO (PCT)
Prior art keywords
basidiomycete
subunit
mucosal
acid sequence
nucleic acid
Prior art date
Application number
PCT/NL2007/000086
Other languages
English (en)
Inventor
Dionisius Elisabeth Antonius Florack
Gerard Johan Adolph Rouwendal
Original Assignee
Plant Research International B.V.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Plant Research International B.V. filed Critical Plant Research International B.V.
Publication of WO2007111500A1 publication Critical patent/WO2007111500A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/02—Bacterial antigens
    • A61K39/025—Enterobacteriales, e.g. Enterobacter
    • A61K39/0258—Escherichia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/54—Medicinal preparations containing antigens or antibodies characterised by the route of administration
    • A61K2039/541—Mucosal route
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the invention relates to the field of genetic engineering, more specifically to mucosal vaccine production in mushrooms.
  • This invention relates generally to the production of vaccines in fungi and more specifically to the production of vaccines, oral vaccines and vaccine adjuvants in edible mushrooms.
  • the present invention relates more particularly to the production of transgenic mushrooms using the genes coding for the Escherichia coli enterotoxin (LT) subunits A (LT-A) and B (LT-B) or the cholera toxin counterparts CT-A, CT-B and CT, and the use thereof, alone or with other antigenic molecules, to cause immune responses in animals upon mucosal immunization.
  • LT Escherichia coli enterotoxin
  • this invention relates to methods for producing mucosal (e.g. oral) vaccines in fungi by the introduction of genes coding for immunogenic proteins or portions thereof.
  • the immunogenic proteins can be derived from disease causing entities including viruses, bacteria and other micro-organisms, which colonize or invade through mucosal surfaces. More particularly the invention relates to the introduction of genes coding for LT-B or CT-B or fusion proteins with other immunogenic peptides or proteins into fungal host cells allowing for the production of edible fruiting bodies or mushrooms having immunogenic properties.
  • the present invention offers a significant improvement in immunization technology over prior art by enabling actual immunization of animals and individuals against antigens by direct feeding of transgenic edible mushrooms or compositions comprising said mushrooms or extracts thereof.
  • Mucosal vaccines have several advantages over traditional systemic vaccines. Mucosal, in particular oral, vaccination is regarded to be an attractive alternative for injectable vaccines because a mucosal vaccine is, generally speaking, easy to apply and relatively cheap and safe. They can be administered orally or nasally rather than via injection, which is more widely accepted by the public, as well as making the vaccine simpler to administer (i.e. without skilled medical assistance) and distribute. In addition, there is less risk of needle stick injury or cross-contamination. Furthermore, mucosal vaccines can induce protection at the mucosal level, i.e. at the site of entrance of many pathogens. In contrast, injected vaccines induce a good systemic response but poor responses at mucosal surfaces.
  • Vaccine administration at a mucosal site may even be a prerequisite for the production of vaccines against certain pathogens for which no vaccine is currently available (e.g. respiratory syncytial virus (RSV) and even possibly HIV).
  • RSV respiratory syncytial virus
  • oral vaccination enables mass vaccination via food or drinking water.
  • bacterial enterotoxins such as cholera toxin (CT) from Vibrio cholera and the related E. coli heat-labile enterotoxin (LT).
  • both toxins comprise an A subunit and a pentameric ring of identical B subunits.
  • the A subunit is the toxic part of the chimaeric molecule and causes ADP-ribosylation of G S ⁇ activating adenylate cyclase leading to elevated cyclic AMP levels.
  • the primary function of the strong non-covalently associated complex comprising the pentameric B subunit lies in mediating receptor interactions that result in internalisation and uptake of the toxic A subunit.
  • the primary receptor of the ring of B subunits is the monosialoganglioside GMl [Gal( ⁇ l-3)GalNAc ⁇ (l-4)(NeuAc( ⁇ 2-3))Gal ⁇ (l- 4)Glc( ⁇ l-l) ceramide], a glycosphingolipid found ubiquitously on the cell surface of mammalian cells, including small intestine (Holmgren, 1973; Holmgren et al., 1973, 1975).
  • a mucosal carrier molecule is a molecule that interacts, e.g. via a receptor, with immuno-active cells located on the surface of mucosae, such as the mucosa of intestinal epithelium of the small intestine.
  • the B subunits of both LT (LT-B) and CT (CT-B) have been successfully used as mucosal carrier molecule in translational fusions with various antigens to shuttle these across the gut mucosal epithelium by receptor-mediated uptake (e.g.
  • Mucosal delivery such as intranasal or oral delivery of vaccines, has been shown to be successful, especially for E. coli enterotoxin LT and its subunits LT-A and LT-B, and cholera toxin CT, and CT-A and CT-B, and non-toxic derivatives thereof and prevents the effects caused by ETEC and Vibrio cholera bacteria.
  • mucosal delivery of immunogenic molecules in combination with aforementioned LT, CT, LT-B and CT-B adjuvants have been shown to induce mucosal immune responses.
  • Inoculation could be accomplished using recombinant bacteria to express pieces of proteins from the pathogen (known as antigens) that the immune system will respond to and "remember” for the next infection.
  • pathogen known as antigens
  • Another possibility is the creation of transgenic plants expressing pathogen antigens that could be eaten to administer the vaccine.
  • Certain types of transgenic plants such as banana trees and potatoes have also been modified to overexpress protein antigens from pathogens such as hepatitis B and rotavirus.
  • WO96/12801 relates to the introduction into plants of genes encoding colonization or virulence antigens or antigenic portions thereof of pathogens which colonize on or invade through mucosal surfaces of mammals.
  • the present inventors set out to find an alternative production system for mucosal vaccines.
  • the present inventors observed that several basidiomycetes especially those that produce fruiting bodies that can be eaten, collectively known as mushrooms, can be engineered to produce vaccines and can be directly applied to an animal to cause immune responses.
  • mice IgG-specific anti-LT-B immune responses in sera of mice immunized with PLX222-LTB3 extract, at day 14, 28 and 42 following priming.
  • Group 4 mice were immunized three times intragastrally (effective dose 750 nanograms each), Group 6, primed intramuscularly (effective dose 75 nanograms) followed by two intragastral booster immunizations and Group 7 intramuscularly with purified rec-LT-B purified from E.coli (effective dose 75 nanograms) at two- week intervals.
  • Measurements were performed by modified GMl-ELISA using an affinity purified antigen specific anti-mouse IgG (whole molecule; Sigma A3562)-alkaline labelled antibody and measured individually per mice. Measurements were averaged and standard deviation calculated (represented by vertical bars in chart).
  • Bacteria, yeasts and mammalian cells are being used for large scale recombinant protein production, including recombinant subunit vaccines.
  • current production systems have several drawbacks.
  • mammalian cell lines have several drawbacks including low protein titers, long fermentation times, and ongoing viral containment issues, such as contamination with hepatitis B virus which ends up the final product.
  • the use of plants has drawbacks such as low protein yield, long time to establish stable transgenic line and long generation time with respect to yield.
  • recombinant plant expression systems have been described in the art but these generally do not yield a sufficiently high level of antigenic protein to induce effective immunization.
  • the basidiomycete vaccine production system of the invention has several practical advantages over existing systems, in particular over the use of edible plants.
  • the basidiomycete expression system allows for the expression and assembly of multimeric immunogenic protein complexes, such as a protein complex based on the heat labile enterotoxin (LT) of E. coli or on the cholera toxin (CT) of Vibrio cholerae.
  • LT heat labile enterotoxin
  • CT cholera toxin
  • the invention provides a method for producing a mucosal vaccine, comprising introducing in a basidiomycete host cell a nucleic acid sequence encoding an immunogenic protein comprising a subunit of the heat labile enterotoxin (LT) of E. coli or of the cholera toxin (CT) of Vibrio cholerae, or an amino acid sequence that is at least 70% homologous to an LT or CT subunit, allowing for expression of said nucleic acid sequence and harvesting basidiomycete host cells comprising the immunogenic protein.
  • LT heat labile enterotoxin
  • CT cholera toxin
  • Vaccine refers to any composition that can induce formation of antibodies or immunity against a certain antigen upon its administration to a subject.
  • the immune response is a protective immune response.
  • the mucosal vaccine is for example an oral or a nasal vaccine. It has been shown that subunits of the LT and CT bacterial toxins can be used as a vaccine against bacterial infections.
  • the intestinal IgA response to orally administered CT-B is comparable to that seen against cholera toxin in convalescents from cholera disease.
  • the strong mucosal response of the pentameric B subunit complex of the toxins is ascribed to its ability to bind to GMl receptors of the intestinal epithelium.
  • a method of the invention comprises the expression in a basidiomycete host cell of a nucleic acid construct encoding a subunit of LT and/or a subunit of CT and/or of an amino acid sequence that is at least 80%, preferably at least 90% homologous to an LT or CT subunit.
  • Both LT-B and CT-B are potent mucosal immunogens, which among others have been used successfully as (oral) vaccine for diarrhoeal diseases such as Enterotoxigenic Escherichia coli (ETEC) (see Svennerholm et al.
  • ETEC Development of oral vaccines against enterotoxinogenic Escherichia coli Diarrhoea
  • Vaccine 1989 Vol.7 pp. 196-198.
  • Disease caused by ETEC follows ingestion of contaminated food or water and is characterized by profuse watery diarrhoea lasting for several days. It may lead to dehydration and malnutrition in young children in developing countries.
  • ETEC is the most frequently isolated enteropathogen in community-based studies of children aged less than 5 years in the developing world, and probably accounts for approximately 200 million diarrhoea episodes and 380.000 deaths annually. ETEC is also the number one cause of travellers' diarrhoea, affecting individuals from industrialized countries travelling to developing regions of the world.
  • the invention provides a method for producing a mucosal vaccine against ETEC, comprising the recombinant expression of at least one LT subunit, preferably a B-subunit, in a basiodiomycete host cell.
  • the CT or LT-B subunits can be expressed in combination with a non-toxic variant of their respective A-subunit. It is also possible to express in the basidiomycete host cell a hybrid complex comprising B-subunits of LT and an A subunit of CT, and vice versa.
  • Non-toxic A-subunit mutants are known in the art, see for example Stevens et al., "Effects of Site-Directed Mutagenesis of Escherichia coli Heat-Labile Enterotoxin on ADP-Ribosyltransferase Activity and Interaction with ADP-Eibosylation Factors.” Infect Immun.
  • Vaccines comprising (recombinant) B subunits of the bacterial toxins are capable of eliciting an antibody response to the pentameric ring of the bacterial toxin, thereby inhibiting its interaction with the epithelial receptor and subsequent internalisation and uptake of the toxic A subunit.
  • a vaccine may comprise additional antigens, either expressed in the basidiomycete host cell or added exogenously to basidiomycete host cell material.
  • one or more bacterial antigen(s) may be included, either as recombinantly produced antigens, e.g. co-expressed in the basidiomycete host cell, or as killed or inactivated bacterial cells.
  • the invention provides for the manufacture of CT or LT subunits in a basidiomycete host cell, which subunit can serve on its own as antibacterial vaccine and/or adjuvant. When fused to an antigen of interest, it can serve as mucosal carrier molecule to enhance antigen uptake and internalisation. Basidiomycetes are phylogenetically much closer to animals than yeasts
  • the basidiomycete can produce edible fruiting bodies, also referred to as edible mushrooms.
  • An edible basidiomycete is suitable for ingestion by mammal or other animals including humans.
  • Many edible mushrooms belong to the order of Agaricales within the subdivision of Basidiomycetes.
  • the family of Agaricaceae is large and includes many familiar mushrooms. For instance, Agaricus bisporus is the common cultivated white button mushroom.
  • Pleurotus ostreatus belonging to the family of Pleurotaceae, is a commercially important edible mushroom commonly known as the oyster mushroom.
  • This fungus is industrially produced as human food, and it accounts for nearly a quarter of the world mushroom production.
  • Members of other families within the subclass of holobasidiomycetida may of course also be used, such as Schizophyllacea.
  • the use of a basiodiomycete for the production of mucosal vaccines has several advantages over the use of edible plants for that purpose.
  • fungi like basidiomycetes are cultured under fully conditioned and contained (i.e. indoor) conditions.
  • Transgenic plants on the other hand, are typically grown in open fields for economical reasons but this requires the strict observance of various regulatory matters to avoid any risks associated with the storage, crossing and pollen production of transgenic plants.
  • basidiomycetes Beside the contained culture conditions for basidiomycetes, sporeless mutants can be used to avoid any degree of spore spreading.
  • the use of basidiomycetes considerably reduces the length of time it takes to get a product from idea to marketplace ("time-to-market") when compared to the use of edible plants as production system.
  • time-to-market the time required to establish a transgenic organism is roughly the same for a plant as for a basidiomycete, the subsequent stages of bulk production of the immunogenic protein proceeds must faster in basidiomycetes.
  • Within two weeks following inoculation of basidiomycete mycelium there is a massive production of fruiting bodies (mushrooms) expressing the protein.
  • the basiodiomycetes can produce a large biomass on a relatively small surface area.
  • the establishment of seed-banks, master-cell banks, which is highly important for the production process and the registration in the pharmaceutical area, is far more convenient when using basidiomycetes as compared to using plants. Selected mycelia can simply be cryo-preserved. Since it is not necessary to generate a homozygous line which is stable for the introduced trait (e.g. LT-B), as would be required for plant seed banks, the establishment of a transgenic basidiomycete seed- or master cell bank is simpler than establishing the same for transgenic plant seeds.
  • a basidiomycete is selected from the group consisting of Agaricus arvensis, Agaricus bisporus, Agaricus blazei, Agrocybe aegerita, Coprinus cinereus, Lentinus edodes, Lepista nuda, Pleurotus ostreatus, Phanerochaete chrysosporium, Schizophyllum commune, Hypsizygus tessulatus, Pholiota nameko, Boletus edulis, Flammulina ⁇ elutipes, Heridum erinaceus, Vol ⁇ ariella vol ⁇ acea, Grifola frondosa, Ganoderma lucidum, Tremella fuciformis, Auricularia auricular, Lyophy ⁇ lum descastes, Naemataloma sublaterium, Stropharia rugoso-annulata and Cordyceps sinense.
  • the basidiomycete can be cultured on artificial medium.
  • a Schizophyllum spp. is used such as S. ses.
  • a sporeless basidiomycete in a method of the invention such as the Pleurotis ostreatus mutant PLX222, is advantageous because it does not require culturing in contained environments.
  • the basidiomycte host cell needs to be provided with one or more heterologous genes encoding immunogenic vaccine components, it is of course required that the basidiomycete can be transformed or otherwise provided with a heterologous DNA construct. Methods to transform basidiomycetes are known in the art (see for example Alves et al., Appl Environ Microbiol. 2004;70(ll):6379; Godio et al., Curr Genet. 2004 Oct 5; Schuurs et al., Genetics. 1997;147(2):589; WO95/02691).
  • the basidiomycete host cell can be provided with a second nucleic acid sequence encoding an antigen of interest in order to produce a vaccine against an antigen other than the CT or LT complex.
  • the antigen of interest can be selected from the group consisting of bacterial antigens, viral antigens, human auto-antigens, protozoal antigens and fungal antigens.
  • the basidiomycete is transformed with a first nucleic acid encoding an LT-B subunit and with a second nucleic acid encoding an antigen of interest, such as a bacterial antigen selected from fimbriae antigens including E. coli surface antigens (CSs) and colonization factor antigens (CFAs).
  • CSs E. coli surface antigens
  • CFAs colonization factor antigens
  • both the B-subunits of CT and LT can be used successfully as carrier molecules for shuttling antigens across mucosal epithelium by receptor-mediated uptake.
  • Fusion of an antigen of interest, for instance a viral antigen, to the carrier molecule may be used to enhance the uptake and delivery of the antigen of interest to MALT inductive sites so as to increase B- and T- cell activation.
  • an antigen of interest may be fused to at least one of said CT or LT subunits.
  • the basidiomycete host cell is genetically modified to express an LT-B or CT-B subunit, wherein at least one of the B-subunits is genetically fused to an antigen of interest.
  • All B subunits may be fused to the same type or to a distinct type of antigen. It may be advantageous to leave at least one B subunit unaltered (i.e. not fused to an antigen) to reduce steric hindrance and enhance functional pentamer formation.
  • a non-toxic CT-A or LT-A subunit may be fused to an antigen of interest.
  • CT-A or LT-A fusions can be co- expressed with either unaltered or fused B-subunits. It will be clear that in this way many types of multivalent immunogenic protein components or complexes can be expressed and assembled by a basiodimycete host cell, and that the host cell material is advantageously used for mucosal vaccination. Gene expression in basidiomycetes requires a certain nucleotide composition and is enhanced by the presence of introns (Schuren and Wessels, 1998; Lugones et al, 1999; Ma et al., 2001; Scholtmeijer et al., 2001).
  • the nucleic acid sequence encoding an immunogenic protein has a G/C content of at least 50% and no stretches of about 10 nucleotides or less with more than 90%A or T. Therefore, genes from heterologous sources may require modification to achieve a sufficiently high expression level in a basidiomycete host cell.
  • an immunogenic protein in basidiomycetes its complete open reading frame is typically cloned into an expression vector suitable for transformation of basidiomycetes.
  • the expression vector preferably also comprises nucleic acid sequences that regulate transcription initiation and termination. It is also preferred to incorporate at least one selectable marker gene to allow for selection of transformants.
  • Expression of a vaccine such as LT-B can be achieved using a basidiomycete promoter, e.g. a constitutive promoter or an inducible promoter. Especially suited are constitutive promoters derived from genes encoding enzymes involved in the glycolytic pathway.
  • gpdA glyceraldehyde-3- phosphate dehydrogenase
  • This promoter is preferred for constitutive expression when recombinant DNA material is expressed in a basidiomycete host.
  • Other examples are the phosphoglycerate kinase (pgk) promoter, the pyruvate kinase (pki) promoter, TPI, the triose phosphate isomerase (tpi) promoter, the APC synthetase subunit g (oliC) promoter and the acetamidase (amdS) promoter of a basidiomycete (WO96/41882).
  • a basidiomycete gpd (glyceraldehyde-3- phosphate dehydrogenase gene) promoter or part thereof is used, for instance (a part of) the S. ses gpd promoter or the Lentinus edodes gpd promoter.
  • said gpd promoter includes intron 1 to enhance expression of the heterologous gene (Ma et al., 2001).
  • a basidiomycete is provided with a plasmid comprising the nucleic acid sequence of a synthetic gene for LT-B optimized for expression in basidiomycetes by altering the codon usage, flanked by a basidiomycete gpd promoter sequence, optionally including intron 1, and a basidiomycete terminator sequence.
  • LT-B expression in S. ses is achieved by the construction of a vector comprising a S. ses derived promoter and a S. ses derived terminator with an artificially added intron flanking the insertion site of the LT-B gene and a gene cassette featuring a phleomycin resistance marker (Schuren and Wessels, 1994).
  • inducible promoters are the basidiomycete promoters of the following genes: xylanase A (xylA), glucoamylase A (glaA), cellobiohydrolase (cbh), amylase (amy), invertase (sue) and alcohol dehydrogenase alcA, TAKA amylase and amyloglucosidase (ACT) (see WO96/41882).
  • WO2004/039985 discloses fungal transcription promoters that are suitably used for expression of heterologous genes in a basidiomycete.
  • WO2004/039985 discloses that three genes of the basidiomycete Agaricus bisporus, abstl, rafe and mag2, are active substantially only during stage 1, or later, of the development of the fruiting body of the fungus.
  • Heterologous DNA under the control of the expression mechanisms of these fungal genes allows for selective expression at this stage of development of the fungus, rather than during growth of the mycelium. In that way, little or no metabolic energy need be diverted from mycelium growth, thereby maximising easily harvestable fruiting body mass and concomitant tissue capable of expressing the heterologous gene once it is switched on.
  • the construct encoding an LT or CT subunit can be transferred to a basidiomycete according to standard procedures.
  • protoplasts of basidiomycete monokaryon are transformed as described in Schuren and Wessels (1994). Transformants can be selected on selection medium. After some time, mycelial plugs can be harvested and cultured further on fresh medium.
  • the invention allows for the recombinant production of a vaccine of interest in a basidiomycete.
  • a vaccine of interest is LT-B , such that the resulting mushroom expressing the molecule is to be provided to an animal or human for prophylactic reasons.
  • the method of the invention is also useful for the manufacture of a peptide or protein for use in vaccine compositions and mucosal administration by providing the mushroom with the appropriate gene in combination with those coding for LT-B.
  • Expression of the recombinant peptide or protein in a basidiomycete can be achieved using a suitable expression vector in a similar manner as described above for the expression of heterologous LT-B.
  • the resulting mushroom expressing both proteins can be harvested according to common procedures or extracted involving tissue extraction, centrifugation and chromatographic steps depending on the nature of the protein of interests.
  • a nucleic acid construct encoding a synthetic gene for an LT or CT subunit, a manganese peroxidase signal peptide sequence and an expression cassette comprising a gpd promoter, without intron 1, and a terminator sequence.
  • the invention furthermore provides a basidiomycete host cell provided with a nucleic acid construct of the invention.
  • the invention relates to the use of a basidiomycete as a recombinant expression system for the production of a mucosal vaccine, e.g. oral or nasal vaccine, preferably wherein the basidiomycete produces edible fruiting bodies, more preferably wherein the basidiomycete is S. ses or P. ostreatus.
  • a method for the mucosal, e.g. oral, immunization of a subject, like an animal including humans comprising administering to said subject at least one dose of an effective amount of a mucosal/oral vaccine obtainable by the method according to the invention using a basidiomycete host cell.
  • said administering comprises the direct mucosal application of basidiomycete host cells comprising the at least first immunogenic protein.
  • the basidiomycete host cells can be applied in various ways to the mucosal surface. For example in an essentially intact form, such as through oral ingestion of (freeze-dried) mushroom, or as an extract or (partially) purified immunogenic protein, optionally together with a pharmaceutically relevant carrier.
  • an essentially intact form such as through oral ingestion of (freeze-dried) mushroom, or as an extract or (partially) purified immunogenic protein, optionally together with a pharmaceutically relevant carrier.
  • a synthetic gene coding for LT-B was designed for optimal expression in basidiomycetes using a codon usage table made from published sequences.
  • a signal peptide sequence of a manganese peroxidase from Pleurotus (POU21878; Pleurotus ostreatus manganese peroxidase gene (Mnp), accession U21878) was introduced in front of the coding sequence for the mature LT-B protein.
  • the resulting nucleotide sequence optimized for expression in Pleurotus was:
  • the synthetic gene was cloned downstream of a fragment of the S. ses GPD promoter into a vector that also contained the phleomycin resistance marker suitable for selection of transformants in S. ses (Schuren and Wessels, 1994).
  • strain 4-40 was crossed with compatible wild type strain 4-39 and grown for one week at 24 0 C in the light.
  • S. ses was grown in minimal medium (MM) either solidified or not solidified with 1.5% agar (Dons et al., 1979).
  • strain 4-40 was grown from a mycelial homogenate for 2 days at 24°C and 225 rpm in 100 ml of MM in 250-ml flasks.
  • Pleurotus ostreatus was grown on MMP-medium comprising 10 g/1 malt- extract, 5 g/1 mycological peptone, 2.09 g/1 MOPS and 17.5 g/1 select agar, adjusted to pH 7.0, at 24°C.
  • S. sesadas strain 4-40 was transformed as described previously (Schuren and Wessels, 1994), except that it was protoplasted in 1 M MgSO 4 containing 1 mg.mLf 1 of lysing enzymes from Trichoderma harzianum (Sigma). Then, 5 to 10 ⁇ g of DNA was added to 3 x 10 7 protoplasts in 100 ⁇ L of 1 M sorbitol. Transformants were selected on MM plates containing 25 ⁇ g.mL 1 of phleomycin (Cayla, Toulouse, France). To reduce the exposure to the mutagenic phleomycin, putative resistant colonies were transferred to MM without the agent. To this end, single hyphae were isolated using an inverted microscope to visualize them.
  • Mycelium of a sporeless mutant of P. ostreatus grown on MMP plates for 4 to 5 days in the dark was harvested and transferred to Warring blender and 100 ml of DT-80 medium was added (Me, T., Hyundai, Y., Watanabe, T., Kuwahara, M. (2001) Efficient transformation of filamentous fungus Pleurotus ostreatus using single-strand carrier DNA. Applied Micirobiol. Biotechnol. 55: 563-565).
  • Mycelium was ground, homogenized and filtered to obtain protoplasts essentially as described by Irie et al. (2001). Transformation of protoplast was as described by Nissan et al.
  • Extraction buffer was 25 mM sodium phosphate pH 6.6, 100 mM NaCl, 1 mM ethylenediamine tetraacetic acid (EDTA), 50 mM sodium ascorbate, 1% Triton X-100 and 20 mM sodium metabisulphite.
  • the amount of functional vaccine comprising pentameric LT-B was estimated by a modified ganglioside GMl enzyme-linked immunosorbent assay (GMl- ELISA).
  • GMl- ELISA modified ganglioside GMl enzyme-linked immunosorbent assay
  • Microtiter plates PolySorp Immunoplates, Nunc were coated with monosialoganglioside GMl from bovine brain (Sigma Aldrich, St. Louis, USA) at 5 ⁇ g/mL in phosphate buffered saline (PBS).
  • Extracts were adjusted to 50 mM Tris-HCl pH 7.4, 0.2 M NaCl, 1 mM EDTA and 20 mM sodiummetabisulphite (TEAN) and loaded onto the D-galactose column fixed to an FPLC (BioRad, Veenendaal, The
  • the resulting nucleotide sequence for the expression cassette comprising the gpd-promoter and chimeric LT-B gene with manganese peroxidase signal peptide was: GTCGACGCGCCACCCAGCCTATCCCGCGCGGGTCGGGACCCAAAATAAG GCGGCCCCGCCGCGCCCCGTCGGGCGAGCGGGTGTGTATCTACGAACGG AACTGGGAGGCGACTCGGAAGAGTTTGGTTAGAAAGGGGAACACCATCG CGGACGGCCCAGTGCTCTGGGGGTCGCAGCTGACGTGCATTGTGTTCAAT TCTGACGCTGTGGCATGTAAGGAACGTGCTCGGGATCGGAGGGTGGCGC GAGAGCCTCTTCGGTGTGAGATTAGTAACTGTACTGCGAAGCCGCGGAGGTTAGGATGAGAGGTAGACAGGGTCGCAGCCCAGGTGCGAGAAGGACT GCGAAGGACTGTTCTTCGACCGCACCTGCAATTGCGCGCATGGATAGA ATAGAGCGTCGCCCTCGAGGGGGGG
  • Extracts of 15 independent transgenic S. ses mycelia and control untransformed mycelium were analysed for expression of GMl -binding LT-B by ELISA. To this end 1, 2 and 5 microliters of extract in PBS with 0.2%
  • Tween-20 were allowed to bind overnight to GMl according to protocol.
  • the amount of LT-B present in samples was calculated from a standard curve made by spiking known amounts of recombinant LT-B (rec-LT-B) produced and purified from E.coli with similar amounts of extracts from untransformed control mycelium.
  • the amount of GMl-binding LT-B present in the respective extract is summarized in Table 1 as percentage of total soluble protein (TSP) and per gram fresh weight (FW) as calculated from the known amount of strating material that was extracted.
  • Table 1 Production of biologically active recombinant LT-B in Schizophyllum commune mycelium and fruiting bodies. Ganglioside GMl binding was determined by GMl-ELISA.
  • Mushrooms were induced on control untransformed mycelium and dikaryotic mycelia of transgenic S.commune 3 and 5.
  • the amount of rec-LT-B present in these mushrooms was 0 ⁇ g/g FW control, 4.5 ⁇ g/g FW transgenic S.commune number 3 and 0.54 ⁇ g/g FW for number 5.
  • the amount of LT-B in PLX222-LTB3 extract was determined by GMl-ELISA using a PLX222 control extract spiked with known amounts of pure recombinant Escherichia coli LT-B as standard. The concentration was approximately 1500 nanograms per milliliter PLX222-LTB3 extract.
  • mice Female Balb/C OlaHsd (V) mice were from Harlan. Five (5) animals per group were immunized at a one prime and two booster immunization regime at two weeks interval. Blood of individual animals was collected by orbital puncture at day 0 (pre -immune), day 14 (post priming), day 28 and day 42. For the analysis of mucosal immune responses, feces was collected at day 0, 14, 28 and 42 and pooled per group.
  • One control group (group 1) was immunized by subcutaneous injection of 500 microliter PLX222 extract (negative control) and one group intramuscularly with 50 microliter PBS spiked with Escherichia coli rec-LT-B (1500 nanograms per milliliter; effective dose 75 nanograms; Group 7).
  • mice immunized by intragastral intubation of 500 microliters of PLX222-LTB3 extract (effective dose 750 nanograms; Group 4) and another group was first primed by intramuscular injection of 50 micoliters of PLX222- LTB3 extract (effective dose 75 nanograms; Group 6), followed by two oral boosters (intragastral) with 500 microliter extract.
  • Additional groups comprised mice immunized intramuscularly with 50 microliters PLX222-LTB3 extract (Group 2), subcutaneously with 500 microliters PLX222-LTB3 (Group 3), and intranasally with 20 microliters of PLX222-LTB3 extract (effective dose 30 nanograms)
  • feces was first extracted with blocking buffer (2% skimmed milk, 0.1 % BSA in PBS supplemented with 0.2% Tween-20) at a 2:5 ratio (wt/vol; 200 milligrams of pooled faeces extracted with 500 microliters). The feces extract was centrifuged for 10 min at 14000 rpm at 4°C to remove debris and supernatant was collected in fresh tubes for measurements.
  • blocking buffer 2% skimmed milk, 0.1 % BSA in PBS supplemented with 0.2% Tween-20
  • Serum (IgG and IgA) and mucosal (IgA) responses to LT-B were measured by a modified GMl-ELISA as follows: microplates (NUNC Maxisorp Barco immunoplates) were coated with monosialoganglioside GMl at 5 micrograms/mL. After blocking plates with blocking buffer, 100 nanograms of purified E.coli rec-LT-B were added per well in PBS supplemented with 0.2% Tween-20 and allowed to bind overnight at 4°C. After washing the plates twice with demi water, sera and feces extracts were loaded in serial twofold dilutions in blocking buffer, and allowed to bind for 1 hr at room temperature.
  • mice belonging to group 7 injected intramuscularly with 75 nanograms of purified JE.cof ⁇ -derived rec-LT-B.
  • anti-LT-B immune responses in 4/5 mice were significantly increased whereas at day 42 all 5/5 mice had high anti- LT-B IgG-specif ⁇ c antibody responses ( Figure 1).
  • No clear anti-LT-B IgG- and IgA-specific responses could be measured for Groups 1 to 6.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Oncology (AREA)
  • Communicable Diseases (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Mycology (AREA)
  • Epidemiology (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne le génie génétique, plus spécifiquement la production d'un vaccin muqueux dans des champignons. Elle a pour objet un procédé de production d'un vaccin muqueux comprenant l'introduction dans une cellule-hôte de basidiomycète d'une séquence d'acide nucléique encodant une protéine immunogénique qui comporte une séquence d'acide aminé homologue à au moins 70 % à une sous-unité de l'entérotoxine labile à la chaleur (LT) d'E. coli ou à une sous-unité de la toxine cholérique (CT) de Vibrio cholerae, ce qui permet l'expression de ladite séquence d'acide nucléique et la récolte de cellules-hôtes de basidiomycète comportant la protéine immunogénique. L'invention a également pour objet l'emploi d'un basidiomycète comme système d'expression recombinante pour la production d'un vaccin muqueux, de préférence un basidiomycète produisant des corps fructifiants comestibles tel que S. commune ou P. ostreatus, ainsi qu'un procédé d'immunisation par voie muqueuse d'un sujet comprenant l'administration audit sujet d'au moins une dose d'une quantité efficace d'un vaccin muqueux obtenu par un procédé objet de l'invention.
PCT/NL2007/000086 2006-03-27 2007-03-27 immunisation par champignons transgeniques WO2007111500A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP06075703 2006-03-27
EP06075703.6 2006-03-27

Publications (1)

Publication Number Publication Date
WO2007111500A1 true WO2007111500A1 (fr) 2007-10-04

Family

ID=36793519

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/NL2007/000086 WO2007111500A1 (fr) 2006-03-27 2007-03-27 immunisation par champignons transgeniques

Country Status (1)

Country Link
WO (1) WO2007111500A1 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102920016A (zh) * 2012-11-09 2013-02-13 成都宏亿实业集团有限公司 一种牛肝菌提取物及其制备方法和应用
WO2022000201A1 (fr) * 2020-06-29 2022-01-06 肇庆大华农生物药品有限公司 Immunopotentialisateur et son application dans un vaccin contre la grippe aviaire

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1995002691A2 (fr) * 1993-07-13 1995-01-26 Bromyc B.V. Production et application de mycelium et de sporophores de champignons transgeniques
WO1996012801A1 (fr) * 1994-10-24 1996-05-02 The Texas A & M University System Immunisation par voie orale a l'aide de plantes transgeniques

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1995002691A2 (fr) * 1993-07-13 1995-01-26 Bromyc B.V. Production et application de mycelium et de sporophores de champignons transgeniques
WO1996012801A1 (fr) * 1994-10-24 1996-05-02 The Texas A & M University System Immunisation par voie orale a l'aide de plantes transgeniques

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
CANTO TOMAS ET AL: "Translocation of Tomato bushy stunt virus P19 protein into the nucleus by ALY proteins compromises its silencing suppressor activity.", JOURNAL OF VIROLOGY SEP 2006, vol. 80, no. 18, September 2006 (2006-09-01), pages 9064 - 9072, XP002447019, ISSN: 0022-538X *
FINGERUT ET AL: "Vaccine and adjuvant activity of recombinant subunit B of E. coli enterotoxin produced in yeast", VACCINE, BUTTERWORTH SCIENTIFIC. GUILDFORD, GB, vol. 23, no. 38, 7 September 2005 (2005-09-07), pages 4685 - 4696, XP005021731, ISSN: 0264-410X *
SHIN S J ET AL: "Induction of antigen-specific immune responses by oral vaccination with Saccharomyces cerevisiae expressing Actinobacillus pleuropneumoniae ApxIIA", FEMS IMMUNOLOGY AND MEDICAL MICROBIOLOGY, ELSEVIER SCIENCE B.V., AMSTERDAM, NL, vol. 43, no. 2, 1 February 2005 (2005-02-01), pages 155 - 164, XP004728177, ISSN: 0928-8244 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102920016A (zh) * 2012-11-09 2013-02-13 成都宏亿实业集团有限公司 一种牛肝菌提取物及其制备方法和应用
WO2022000201A1 (fr) * 2020-06-29 2022-01-06 肇庆大华农生物药品有限公司 Immunopotentialisateur et son application dans un vaccin contre la grippe aviaire

Similar Documents

Publication Publication Date Title
Gunasekaran et al. A review on edible vaccines and their prospects
US6019982A (en) Mutant enterotoxin effective as a non-toxic oral adjuvant
DE69736226T2 (de) Verfahren zur anregung einer immunantwort durch verabreichung von nutzorganismen, die intimin allein oder als fusionsprotein mit einem oder mehreren anderen antigenen exprimieren
Wu et al. Induction of mucosal and systemic immune responses by intranasal immunization using recombinant cholera toxin B subunit as an adjuvant
CN100460013C (zh) 口服重组幽门螺杆菌疫苗及其制备方法
JP2531498B2 (ja) 新規ハイブリッドポリペプチドをコ―ドするｄｎａ
JP2005535298A (ja) グルカンベースのワクチン
Kumar et al. Production of hepatitis B surface antigen in recombinant plant systems: an update
WO1999047167A1 (fr) Enterotoxine a double mutation pouvant etre utilisee comme adjuvant
US20100255033A1 (en) Non-toxic double mutant forms of pertussis toxin as adjuvants
CN101972475A (zh) 一种细菌多糖-蛋白结合疫苗及其制备方法
AU781175B2 (en) Recombinant toxin A/toxin B vaccine against Clostridium Difficile
US20020015708A1 (en) Recombinant vaccines against ibdv
Ricci et al. Immunogenicity of the B monomer of Escherichia coli heat-labile toxin expressed on the surface of Streptococcus gordonii
EP2167664B1 (fr) Opéron hybride pour l'expression d'antigènes du facteur de colonisation (cf) d'escherichia coli entérotoxinogène
US5595901A (en) Method for obtaining protective active and inactive adenylate cyclase from Bordetella parapertussis
WO2000050074A2 (fr) Compositions de vaccin a neisseria et procedes correspondants
Yu et al. Novel approaches to oral vaccines: delivery of antigens by edible plants
CA2645365C (fr) Polysaccharides capsulaires de type 5 et de type 8 des souches surproductrices de staphylococcus aureus
WO2007111500A1 (fr) immunisation par champignons transgeniques
US6602507B1 (en) Synthetic peptides from streptococcal M protein and vaccines prepared therefrom
US6722062B2 (en) Capsular polysaccharides from enterococci
KR101150847B1 (ko) 어류의 연쇄상구균 백신 조성물
Korcová et al. Immunomodulative properties of conjugates composed of detoxified lipopolysaccharide and capsular polysaccharide of Vibrio cholerae O135 bound to BSA-protein carrier
RU2407792C1 (ru) СПОСОБ ПОЛУЧЕНИЯ IgAl-ПРОТЕАЗЫ ИЗ КУЛЬТУРЫ NEISSERIA MENINGITIDIS СЕРОГРУППЫ А И ИММУНОГЕННЫЙ ПРЕПАРАТ НА ЕЕ ОСНОВЕ

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 07747268

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 07747268

Country of ref document: EP

Kind code of ref document: A1