WO2007110608A2

WO2007110608A2 - Fermentation process for the production of ethanol

Info

Publication number: WO2007110608A2
Application number: PCT/GB2007/001063
Authority: WO
Inventors: Brian Hartley; Muhammad Javed
Original assignee: Bioconversion Technologies Limited
Priority date: 2006-03-24
Filing date: 2007-03-26
Publication date: 2007-10-04
Also published as: GB0605889D0; WO2007110608A3

Abstract

A fed-batch fermentation process for production of ethanol includes supplying at least one thermophilic microorganism lacking lactate dehydrogenase activity with sugars. The at least one thermophilic microorganism is maintained in redox balance. This is achieved by use of appropriate sugar feeds and/or aeration in the fermentation. Redox balance is preferably monitored and maintained using sensors. A DNA construct incorporates a nucleotide sequence which encodes a non-functional lactate dehydrogenase. The nucleotide sequence causes inactivation of lactate dehydrogenase activity in a thermophilic microorganism transformed with the DNA construct through recombination with a gene encoding lactate dehydrogenase in the genome of the thermophilic microorganism. The nucleotide sequence preferably includes a deletion within the open reading frame as compared to the nucleotide sequence of a gene encoding a functional lactate dehydrogenase. The DNA constructs may be used to produce useful thermophilic microorganisms, in particular Bacillus stearothermophilus strains. These thermophilic microorganisms are in turn useful in regulated fermentation processes to produce bioethanol.

Description

REGULATION OF MICROBIAL ETHANOL PRODUCTION

Field of the invention

This invention relates to fermentation procedures and microorganisms for use therein and in particular to the improvement of microbial ethanol production. More specifically, the invention relates to enhanced ethanol production by thermophilic bacteria, such as Bacilli from mixed sugars derived from the hydrolysis of biomass. In particular, the invention relates to improved fermentation processes in which a microorganism lacking lactate dehydrogenase activity is used to produce ethanol from mixed sugars, derived from for example agricultural and municipal waste products .

Background to the invention

Hartley, B. S. (see International Publication Number WO 88/09379) observed that a mutant thermophilic Bacillus that lacks lactate dehydrogenase activity (strain LLD-15) can metabolise a wide range of sugars anaerobically by two pathways (as shown in Figure IA) . Firstly, the well known pyruvate-formate lyase (PFL) pathway which yields 1 mol . of acetate, 1 mol. of ethanol and 2 mol. of formate per mol. of glucose equivalent consumed. Secondly, a novel anaerobic pyruvate dehydrogenase (PDH) pathway which yields 2 mol. of ethanol and 2 mol. of CO₂ per mol. of glucose equivalent consumed.

In batch fermentations at high sugars concentrations or at acid pH, PFL-flux declines and growth stops long before all sugars are consumed, but PDH flux continues. This allows high yields of ethanol (Figure IB) as required for industrial ethanol production, but the moribund cells eventually die, so a supply of fresh viable cells is needed to maintain ethanol productivity (WO 88/09379) .

To achieve commercially viable yields, WO 88/09379 envisaged a two-stage continuous "Closed System" fermentation in which sugars are fed continuously to an anaerobic ethanol production fermenter and spent cells are removed continuously from the effluent broth by centrifugation or membrane filtration. Ethanol is stripped continuously from the cell-free broth and residual sugars and by-products are fed to an aerobic fermenter in which they are converted into fresh cells. Part of the fresh cells are fed back to the production stage to maintain cell viability and the rest are used as animal feed.

Although attractive in theory, the "Closed System" was found to be impractical for two main reasons . Firstly, the ldh mutation in strain LLD-15 reverted rapidly to wild type at high sugar concentrations, so undesirable lactate production took over the production stage. Secondly, the "Closed System" proved to be extremely unstable. Variations in pH or temperature or even slight increases in sugar supply above a critical maximum, led to catastrophic death of the resident anaerobic cells. Wild type LLD-R revertants then took over before the incoming aerobic cells had time to adapt .

An alternative attempt to solve this problem (see International Publication Number WO 02/29030) involved stabilising the mutant strain by recombination within an insertion element that lies within the mutant ldh gene. The resulting mutant strain Tn-T9 was immune to reversion, but cell death still occurred at high sugar concentrations, causing washout in continuous cultures.

Summary of the invention

The present invention is based around the realisation that the problems with the prior art fermentation procedures discussed above arise at least in part because sugars uptake is unregulated in thermophiles such as B. stearothermophilus strain LLD-R, so that glycolytic flux continues to increase as external sugar concentrations rise. For example, with strain LLD-15, pyruvate secretion was seen, growth rates declined and takeovers occurred when sucrose uptake reached a critical level of 4-5 g/g cells per hour, (San Martin, R. et al., J. Gen. Microbiol. 139. 1033-1040 (1993). The inventors suggest that the PDH-pathway flux becomes saturated at this critical point, so that pyruvate accumulates, NADH levels rise and NAD levels fall. In consequence, the PDH flux begins to decline even further, because NAD is a necessary co-substrate for pyruvate dehydrogenase. This leads inevitably to a catastrophic metabolic collapse which is referred to herein as "Redox Death" (see Figure 1C for a schematic representation) . The present invention seeks to provide improved fermentation procedures which take into account the possibility of redox death through regulation of various aspects of the fermentation process.

Accordingly, in a first aspect the invention provides a fed- batch fermentation process for production of ethanol comprising controlled supply of sugars to a thermophilic microorganism lacking lactate dehydrogenase activity, - A -

wherein the thermophilic microorganism is maintained in redox balance. By "a thermophilic microorganism" is meant at least one strain, species or genus of thermophilic microorganism. Fermentation using suitable mixtures may be envisaged in the present invention. The processes of the invention have all of the advantages of a high temperature ethanol fermentation by organisms that rapidly ferment a wide range of sugars . Importantly, they circumvent the problem of "Redox Death" at high sugar concentrations, so feeds of up to 20% w/v sugars may be used, as with yeasts.

One of the principal benefits of using microorganisms such as thermophilic bacteria to produce bioethanol is that they are capable of fermenting not only all sugars utilised by yeast, but also all sugars derived from agricultural waste products, including cellulose and hemicelluloses . Accordingly, in one embodiment the sugars used in the fermentation processes of the invention are fermentation feedstocks such as those used in conventional yeast fermentations. In a further embodiment, fermentation is of mixed sugars derived from hydrolysis of cellulose, such as glucose and cellobiose. In a specific embodiment, the sugars are mixed sugars derived from hydrolysis of both cellulose and hemicellulose, preferably to include mixed pentose and hexose sugars. In one embodiment, the fermentations are of a majority of pentose sugars. In a particularly preferred embodiment, the sugars are supplied at 10-20% w/v, more preferably 12-20% w/v, and even more preferably 13-18% w/v. Alternative sugar feeds include 10- 12% w/v, 10-15% w/v and 15-20% w/v. This achieves a yield of at least 4% w/v, for example 4-8% w/v of ethanol. Fed-batch fermentation represents an intermediate production technique between batch fermentation and continuous fermentation. Use of a fed batch fermenter, as opposed to a continuous process, provides numerous advantages in the methods of the invention. In particular, the problem of reversion to expression of lactate dehydrogenase is effectively removed and ethanol production can be optimised with little or no cell growth occurring. Essentially any thermophilic microorganism that lacks lactate dehydrogenase activity may be utilised, even unstable mutants such as

Bacillus strain LLD-I5. Such strains cannot be used with high sugar feeds in batch fermentations or continuous fermentations such as the "Closed System" proposed by Hartley (see International Publication Number WO 88/09379) because of wild-type takeovers (San Martin et al . 1993) . These are avoided in regulated fed-batch systems, because there is insufficient time for takeovers before the fermenter becomes full.

Maintaining the thermophilic microorganisms in redox balance is facilitated by use of fed-batch fermentation. Redox balance is defined as a suitable balance of NAD and NADH levels such that redox death is avoided. In one preferred embodiment, the at least one thermophilic microorganism is maintained in redox balance through regulation of sugars feed rate. This is achieved through use of suitable sensors as discussed herein. The sensors are designed to control sugar feed rate so that the resident sugar concentration in the fermenter remains below the critical point at which redox death ensues. This critical point will be a variable function of the temperature, pH and feedstock composition, so reliance on predetermined protocols is unsuitable for the fermentations proposed in the present invention. The relevant parameters in the fermentation which act to indicate a move towards redox imbalance are discussed in greater detail herein.

In an alternative embodiment, the (at least one) thermophilic microorganism is maintained in redox balance through regulation of aeration of the fermentation. Thus, redox death may be avoided through use of either short pulses of aeration or a continuous low level of aeration. Of course, excessive aeration will prevent maximal ethanol yields being achieved and is therefore avoided. The aeration allows aerobic respiration pathways to be employed by the thermophilic microorganisms to achieve redox balance (as shown schematically in Figure ID) . One or more short pulses of aeration may be employed if the microorganisms are detected as out of redox balance to restore the balance and prevent redox death. Alternatively, a set level of aeration, which may optionally be variable depending upon factors such as the concentration and growth rate of the cells in the fermenter, may be utilised to avoid the cells falling out of redox balance. In one embodiment, aeration may be combined with temporary termination of sugars feed in order to allow the thermophilic microorganisms to restore redox balance as quickly as possible.

In terms of measuring redox balance, this may be done by any suitable means. In preferred embodiments, redox balance is determined by measuring rates of anaerobic CO₂ production by the (at least) one thermophilic microorganism and/or redox potential of the fermentation and/or residual sugars level in the fermentation and/or pyruvate levels in the fermentation. Under anaerobic conditions, CO₂ production by the (at least one) thermophilic microorganism corresponds to flux through the PDH pathway and thus CO2 production by the (at least one) thermophilic microorganism provides an indicator of redox balance. A drop in the rate of CO₂ production is an indicator of saturation of the PDH pathway and thus of the onset of redox death. By "residual sugars" level is meant the level of sugars present in the fermentation which are not taken up by the thermophilic microorganisms. A suitable residual sugars level can be readily determined by one skilled in the art dependent upon the specific fermentation conditions employed. Pyruvate secretion by the thermophilic microorganisms is another indicator that the microorganism is out of redox balance (see Figure 1C) due to saturation of the PDH (and PFL) pathways. Pyruvate secretion may be determined by any suitable technique, such as through use of a lactate dehydrogenase-linked spectrophotometric assay for example.

Any suitable sensor, which is compatible with the thermophilic microorganisms being used in the fermentation, for detecting the relevant indicators of redox balance may be utilised. For example, a range of suitable sensors is described in Fermentation Microbiology and Biotechnology, (2007) (Eds. El-Mansi, E M T, Bryce, C F A, Demain, A L, and Allman, A R, CRC Press, pp. 363 - 450) . Sensors may be electrode based sensors (e.g. pH sensors) or biosensors for example. Many sensors are commercially available and thus readily obtainable (such as the InPro5000 CO₂ sensor produced by Mettler-Toledo Ingold) . The sensors are preferably online sensors but samples may also be taken from the fermentation for testing as appropriate. Such a process may be automated (for example when determining if pyruvate is being secreted by the thermophilic microorganism) . Upon detection of an appropriate indicator of redox imbalance (a potential cause of redox death) the sensors will reduce sugars feed rate and/or stimulate aeration of the fermentation until the thermophilic microorganisms returns to redox balance. Thus, the sensors may be termed "feedback sensors", since they act to monitor and maintain the thermophilic microorganisms in redox balance.

Whilst thermophilic microorganisms have lower ethanol tolerance than yeasts (typically below 4% w/v) , ethanol production may advantageously be carried out at optimal growth conditions under which ethanol is readily removed through evaporation or distillation. Thus, the fermentation process of the invention may be carried out at a temperature of at least 60°C, preferably at least 70°C, such as 60 to 80⁰C or 65 to 75 "C. In optimal anaerobic growth conditions, Bacillus strain LLD-R grows very rapidly at 70 °C. In one embodiment of the invention ethanol produced in the fermentation is removed continuously so as to reduce ethanol concentration in the fermentation below the ethanol tolerance of the at least one thermophilic microorganism. Ethanol produced during the fermentation process may be continuously and conveniently removed from the high temperature fermentation by membrane and/or (mild) vacuum evaporation in specific embodiments. This will reduce the process cost and energy required to produce 95% w/v ethanol for biofuel formulations .

Any suitable thermophilic microorganism may be utilised in the processes of the invention, including the specific thermophilic microorganisms described herein. In one embodiment, the at least one thermophilic microorganism is of the genus Bacillus and preferably comprises Bacillus stearothermophilus . In a specific preferred embodiment, the Bacillus is a derivative of Bacillus stearothermophilus strain LLD-R or strain LLD-15. In a further embodiment, the thermophilic microorganism is Geobacillus thermoglucosidasius .

As stated above, the thermophilic microorganism used in the fermentation processes of the invention lacks lactate dehydrogenase activity. This may be achieved through any suitable means. In one embodiment, the at least one thermophilic microorganism lacks lactate dehydrogenase activity due to inactivation of the gene encoding lactate dehydrogenase (Idh gene) . Gene inactivation may be achieved through any suitable route. In one embodiment, the at least one thermophilic microorganism lacks lactate dehydrogenase activity due to transformation with a DNA construct comprising a nucleotide sequence encoding a non-functional lactate dehydrogenase, wherein the nucleotide sequence encoding a non-functional lactate dehydrogenase leads to inactivation of lactate dehydrogenase activity through recombination with the gene encoding lactate dehydrogenase in the genome of the thermophilic microorganism. Any DNA construct of the invention, as described in detail herein, may be utilised in the methods of the invention and thus that part of the description applies here mutatis mutandis.

Deletion of the lactate dehydrogenase gene, or at least a lack of lactate dehydrogenase activity, is essential for maximal ethanol productivity by the thermophilic microorganisms of the invention. The present inventors have devised a method of producing thermophilic microorganisms lacking lactate dehydrogenase through use of a DNA construct (plasmid) containing a gene encoding a lactate dehydrogenase which incorporates a suitable deletion in the open reading frame. Through recombination with the endogenous lactate dehydrogenase, stable deletions of lactate dehydrogenase activity may be produced. Accordingly, in a second aspect the invention provides a DNA construct comprising a nucleotide sequence encoding a non-functional lactate dehydrogenase or a portion of a lactate dehydrogenase which is inactive, wherein the nucleotide sequence encoding a nonfunctional lactate dehydrogenase or a portion of a lactate dehydrogenase which is inactive leads to inactivation of lactate dehydrogenase activity in a thermophilic microorganism transformed with the DNA construct through recombination with a gene (the endogenous gene) encoding lactate dehydrogenase in the genome of the thermophilic microorganism. The gene encoding lactate dehydrogenase may also be referred to herein as the "Idh" gene. The nucleotide sequence is typically based upon the appropriate Idh gene sequence as determined by the thermophilic microorganism of interest for use in the fermentation process. In a specific embodiment, the nucleotide sequence includes a deletion within the open reading frame as compared to the nucleotide sequence of a gene encoding a functional lactate dehydrogenase (a functional Idh gene) . Preferably, the DNA construct is incapable of replication in the thermophilic microorganism unless recombination occurs with the host genome. A gene deletion Idh cassette for inclusion in the DNA constructs of the invention may be produced by amplification of the upper and lower regions of - li ¬

the ldh gene using strain LLD-R as template. Such a construction may utilise primers comprising, consisting essentially of or consisting of the nucleotide sequences set forth as SEQ ID NO: 3 and 4 for the upper region of the ldh gene and SEQ ID NO: 5 and 6 for the lower region. Use of these primers introduces a BgIII restriction site which allows a cassette to be formed using appropriate restriction and ligation. The idΛ-cassette may be amplified using primers comprising, consisting essentially of or consisting of the nucleotide sequences set forth as SEQ ID NO: 7 and 8. This amplification introduces Xbal sites allowing cloning into a suitable DNA construct to produce a gene cassette DNA construct (such as pUCK-LC) of the invention.

In a preferred embodiment, the DNA construct of the invention is a plasmid. In one specific aspect, the DNA construct is a pUC18 derivative. A specific example is described in detail herein, including construction of a suitable ldh gene cassette which contains a deletion within the open reading frame.

The DNA constructs of the invention also preferably incorporate a suitable reporter gene as an indicator of successful transformation. In one embodiment, the reporter gene is an antibiotic resistance gene, such as a kanamycin or ampicillin resistance gene. Other reporters, such as green fluorescent protein (GFP) and beta-galactosidase (lacZ) may be utilised as appropriate. Loss of reporter function is, in subsequent generations, indicative of integration of the relevant portion of the construct

(nucleotide sequence encoding only a portion of, or a nonfunctional, lactate dehydrogenase) into the genome of the transformed microorganism. A plurality of different reporter genes may be included in the DNA constructs of the invention as appropriate.

In a still further aspect, the invention relates to a microorganism comprising a DNA construct of the invention. Preferred recipient microorganisms are heteroloactate fermentative microorganism. In particular, the invention preferably relates to thermophilic bacteria, such as those of the genus Bacillus and especially Bacillus stearothermophilus. The bacterium may be derived from strain LLD-R or LLD-15 for example. These microorganisms are preferably utilised in the processes of the invention.

The invention will now be described with reference to the following non-limiting description and figures .

Brief description of the figures

Figure 1 shows the effect of various conditions on metabolic pathways in a thermophilic microorganism in which the lactate dehydrogenase pathway has been inactivated. The thickness of the arrows indicates the relative dominance of the respective pathways.

A. Metabolic pathways active at neutral pH and in the presence of low sugars. Here the pyruvate formate lyase pathway dominates.

B. Metabolic pathways active at low pH and/or in the presence of low sugars and/or high acetate levels. Here an anaerobic pyruvate dehydrogenase pathway dominates. C. Metabolic pathways active at low pH and in the presence of high sugars. Here the cells experience metabolic stress and fall out of redox balance leading to so called "redox death".

D. Metabolic pathways active at low pH and in the presence of low sugars, under semi-aerobic conditions. Here, redox death is avoided by recycling NADH to produce NAD via the tricarboxylic acid cycle (TCA) and the electron transport chain (ETC) .

Figure 2 is a schematic representation of the pUC18 derivative plasmid termed "pUCK" . The plasmid includes a kanamycin resistance gene cloned from plasmid pUBllO into the unique Zral restriction site in pUClδ .

Figure 3 is a schematic representation of the pUCK derivative pUCK-LC. The plasmid carries an ldh gene with a deletion of 363 bp in the open reading frame.

Description of the Invention

1. Regulation of sugar feed rates in fed-batch fermentations We have seen that a simple and convenient way to avoid the problem of "redox death" in industrial fermentations would be to use fed-batch fermenters with large inocula of anaerobic cells, in which ethanol production can be optimised but little or no cell growth will occur. "Redox Death" may be avoided by using online sensors to control the sugars feed rate at or below the sugars uptake of the resident cells so that resident sugar concentrations do not rise above the "critical point", i.e. so the thermophilic microorganisms do not fall out of redox balance. Such sensors may be designed to monitor either resident sugar concentrations or broth redox potential or rates of CO₂ evolution (since under anaerobic conditions this equals the PDH-pathway flux) . A range of suitable sensors is described in Fermentation Microbiology and Biotechnology, (2007). (Eds. El-Mansi, E M T, Bryce, C F A, Demain, A L, and Allman, A R, CRC Press, pp. 363 - 450) .

Example 1.

The anaerobic fermenter contains a small volume of concentrated thermophile cells grown aerobically to late exponential phase on 2% w/v sugars at 65 ° C . The fermenter is fed with 10% w/v sugars at a variable controlled rate so that the residual sugars concentration remains below 2 % w/v. The rate of CO₂ production increases as cell growth increases and then begins to slow when the "critical point" is reached. At that point, the feed rate is gradually reduced until the rate of CO₂ production stabilises. When the fermenter is full or when all of the sugars are utilised, the cells are centrifuged. from the broth and ethanol is stripped from the supernatant by distillation or membrane pervaporation under mild vacuum. The residual sugars and acid by-products are then used to make a fresh aerobic inoculum for the next fed-batch fermenter. This simple protocol will maximise ethanol yields, but reduction of feed rates will lower volumetric productivity.

2. Semi-aerobic fed-batch fermentations .

The inventors have seen that an alternative way to avoid cell death at the critical point would be to use controlled minimal aeration to maintain cell viability. Excessive NADH produced by glycolysis would then be recycled to NAD by the tricarboxylic acid cycle (TCA) and the electron transport chain (ETC) to restore NAD/NADH balance, revive PDH flux and also provide an abundance of ATP to restore cell viability ( see Figure ID) .

Excessive aeration must be avoided as this would reduce ethanol yield, so feedback controls such as residual sugars concentration, redox potential or rates of CO₂ production would again be used to detect the critical point and to regulate aeration rates. Aeration could be continuous or episodic, by cutting off sugars feed briefly when rates of CO₂ production begin to decline, and resuming feed when cell growth returns .

Example 2. In a fed-batch fermentation such as described in Example 1, the feed-rate is cut off when the sensors detect a "critical point" . A short pulse of aeration is then applied, to allow sufficient cell growth to reduce resident sugar levels below the "critical point". Then anaerobic growth is resumed at the original feed rate. In this way a sequence of episodic- fed-batch fermentations could be performed in the same fermenter until it is full.

Alternatively, continuous minimal aeration could be used to maintain the residual sugars level or the redox potential of the broth at or below the critical point.

Example 3.

In a fed-batch fermentation such as described in Example 1, the feed rate is constant, but minimal aeration is continuously varied to maintain constant redox potential in the broth (and by inference the internal NAD/NADH ratio) until the fermenter is full.

3. Continuous monitoring of pyruvate production. Secretion of pyruvate is an infallible signal of the onset of redox death so continuous monitoring of pyruvate levels in the broth could be used as an alternative feedback control in any of the above examples . This may have advantage with crude feedstocks that may interfere with some redox sensors.

Example 4.

A fed batch fermenter as in Example 1 is automatically sampled on-line and pyruvate levels in the samples are automatically assayed by a lactate dehydrogenase-linked spectrophotometry assay. A rise above a minimal level would be the signal to reduce feed rates or begin aeration.

4. Convenient construction of novel Idh-deleted strains. It is clear that deletion of the lactate dehydrogenase gene is desirable for stable high ethanol productivity. Javed et al (see International Publication Number WO 02/29030) achieved this by recombination of a plasmid with an Insertion Element that lies within spontaneous ldh mutants derived from strain LLD-R. This avenue is not open for all strains of thermophilic Bacilli, so this invention includes a strategy that is generally applicable to all such species.

Firstly, it involves construction of a plasmid that can replicate in Bacillus strains only by recombination with the host genome, and in this case carries a gene cassette that is homologous to the host ldh coding sequence plus a gene marker which can be expressed in Bacilli. In the following Example, a Bacillus kanomycin resistance marker [kan) and a cassette carrying the ldh gene of B. stearothermophilus strain LLD-R were cloned into plasmid pUClδ, which can replicate only in gram negative microorganisms .

Example 5. Construction of a vector for ldh gene deletion.

Materials

Media and buffers

LB medium; Tryptone 10 g; Yeast Extract 5 g; NaCl 10 g; deionised water to 1 L.

Adjusted pH to 7 and autoclaved to sterilize. For plate medium 20 g/1 agar was added to the medium before autoclaving, cooled to 55⁰C and poured into sterile Petri dishes (approx. 20 ml/plate) .

For LB-amp plates filter-sterilised ampicillin solution was added to final concentration of 50 μg /ml before pouring the Petri plates.

SOC Medium: Tryptone 2.0 g; Yeast Extract 0.5 g; NaCl 0.05 g; MgCl₂.6H₂O 0.204 g; MgSO₄.7H₂O 0.247 g; Glucose 0.36 g; deionised H₂O to 100 ml. Dissolved, adjusted the pH to 7.0 and filter sterilised. TGP Medium: Tryptone 17 g; Soya peptone 3 g; K₂HPO₄ 2.5 g; NaCl 5 g; Na pyruvate 4 g; glycerol 4 ml; deionised water to 1 L Adjusted pH to 7 and autoclaved to sterilize For plate medium, 20 g/1 agar was added in the medium before autoclaving cooled to 55 °C and poured into sterile Petri dishes (approx. 25 ml/plate) . For TGP-kan plates, filter-sterilised kanamycin solution to final concentration of 10 μg /ml was added before pouring the Petri plates .

TH buffer: Trehalose 272 mM; HEPES (pH 7.5 with KOH) 8 mM; double distilled H₂O to 1 L.

Microbial strains

E. CoIi DH5-alpha - Chemically competent cells were purchased from Invitrogen (Cat .18265-017 ). Bacillus subtilis subsp. subtilis - German culture collection, DSMZ (DSM No. 10)

Bacillus stearothermophilus strain LLD-R - NCIB 12403 Bacillus stearothermophilus strain LLD-15 - NCIB 12428

Plasmids :

Plasmid pCR-Blunt and pCR-TOPO2 were obtained from Invitrogen .

Plasmid pUBllO - Bacillus subtilis BD170 strain harbouring this plasmid was obtained from German culture collection, DSMZ (DSM No. 4514) .

Plasmid pUCl8 was obtained from Sigma-Aldrich .

Construction of a Bacillus cloning vector. Plasmid pUCK-LC (Figure 2) . A kanamycin resistance gene {kan) was cloned in plasmid pUC18 at its unique Zral site which is outside of any coding region and of the reporter gene [lacZ) in the plasmid. To clone the kan gene, a 1.13 kb fragment containing the kanamycin resistance gene was PCR amplified with the primers: kan-BsZ-F (ACACAGACGTCGGCGATTTGATTCATAC - SEQ ID N0:l) and kan-BsZ-R (CGCCATGACGTCCATGATAATTACTAATACTAGG - SEQ ID NO: 2) using pUBHO plasmid as template. The Zral sites were introduced at both ends of the kan gene through the primers . The PCR product was then digested with Zral restriction endonuclease enzyme and ligated with previously Zral- digested and dephosphorylated plasmid pUClδ. The resulting plasmid pUCK (Figure 2) was then introduced into E. CoIi DH5 alpha. Positive clones were selected on LB-amp plates and confirmed by PCR and restriction analysis.

Construction of plasmid pUCK-LC which carries a deleted ldh gene (Figure 3) .

A 1.36 kb ldh cassette was designed to contain the whole ldh gene of strain LLD-R from which 363 bp of its ORF was deleted plus its flanks. The cassette was constructed by PCR amplification of the upper and lower regions of the ldh gene using strain LLD-R as template. These regions were then ligated and cloned in plasmid pϋCK. The upper region was PCR amplified using as primers: LC-U-Fl (AGGGCAATCTGAAAGGAAGGGAAAATTCC - SEQ ID NO: 3) and LC-UB-Rl TGCACAGATCTCCACCAAATCGGCGTC - SEQ ID NO : 4 ) . The lower region was PCR amplified using as primers: LC-DB-Fl (TTGAGCAGATCTTGATGCAAAACGATAAC - SEQ ID NO: 5) and LC-D-Rl (TAAAGCCGATGAGCAGCAGTTGAAG - SEQ ID NO: 6). SgIII sites were introduced into the inner primers.

The PCR products were digested with BgIII restriction endonuclease enzyme and ligated using T4 DNA ligase enzyme. Using the ligate as template, the Idh-cassette was then PCR amplified using as primers: LC-UX-F2 (ATATTATCTAGACATTACGGAAATGATAATGGC - SEQ ID NO: 7) and LC-DX-R2 (TCACAATCTAGACAATCGGCCATAAAC - SEQ ID NO : 8 ) Xbal sites were introduced at the both ends of the cassette via the primers .

The PCR product was then digested with Xbal enzyme and cloned into plasmid pUCK pre-digested with the same enzyme and dephosphorylated. The resulting plasmid pUCK-LC was then introduced into E. CoIi DH5 alpha. The positive clones were selected on LB-amp plates and confirmed by PCR and restriction analysis .

In the second step, the gene-deletion plasmid pUCK-LC is introduced into the wild type host genome by electrophoresis and single crossover recombinants are selected by screening for kanamycin resistance. From these, spontaneous double crossover recombinants are screened by loss of kanamycin resistance and for deletions within the ldh gene.

Example 6. Construction of an ldh deleted strain BCT-18 Plasmid pUCK-LC is methylated in vitro with HaeIII methylase enzyme and wild type thermophile cells e.g. strain LLD-R cells are transformed with the methylated plasmid. Positive clones are selected on TGP-Kan plates at 65⁰C and confirmed as single cross-over events by PCR amplification of the kan gene .

To achieve gene deletion by double cross-over, the positive clones are grown in TGP medium for a few generations (about 5 sub-cultures) and clones which can grow on TGP plates but not on TGP-kan plates are selected. The positive clones are then confirmed as ldh gene deletions and for the absence of the kanamycin gene. The clones are then characterised for ethanol production and C5 and Cβ sugar utilisation in shake flasks and in fermenters.

All references are incorporated herein in their entirety.

SEQUENCE LISTING

<110> Bioconversion Technologies Limited <120> Regulation of Microbial Ethanol Production

<130> P86805WO00

<150> GB 0605889.5 <151> 2006-03-24

<160> 8

<170> Patentln version 3.3

<210> 1

<211> 28

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 1 acacagacgt cggcgatttg attcatac 28

<210> 2

<211> 34 <212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 2 cgccatgacg tccatgataa ttactaatac tagg 34

<210> 3

<211> 29

<212> DNA

<213> Artificial sequence <220>

<223> Primer

<400> 3 agggcaatct gaaaggaagg gaaaattcc 29

<210> 4

<211> 27

<212> DNA <213> Artificial sequence

<220>

<223> Primer <400> 4 tgcacagatc tccaccaaat cggcgtc 27

<210> 5

<211> 29

<212> DNA

<213> Artificial sequence

<220>

<223> Primer <400> 5 ttgagcagat cttgatgcaa aacgataac 29

<210> 6 <211> 25

<212> DNA

<213> Artificial sequence

<220> <223> Primer

<400> 6 taaagccgat gagcagcagt tgaag 25

<210> 7

<211> 33

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 7 atattatcta gacattacgg aaatgataat ggc 33

<210> 8

<211> 27 <212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 8 tcacaatcta gacaatcggc cataaac 27

Claims

1. A fed-batch fermentation process for production of ethanol comprising supplying at least one thermophilic microorganism lacking lactate dehydrogenase activity with sugars, wherein the at least one thermophilic microorganism is maintained in redox balance.

2. The process of claim 1 wherein the sugars are supplied at 10-20% w/v.

3. The process of claim 1 or 2 wherein the sugars are mixed sugars including pentose sugars.

4. The process of any preceding claim wherein the at least one thermophilic microorganism is maintained in redox balance through regulation of sugars feed rate.

5. The process of any preceding claim wherein the at least one thermophilic microorganism is maintained in redox balance through regulation of aeration of the fermentation.

6. The process of any preceding claim wherein redox balance is measured by measuring rates of anaerobic CO₂ production by the at least one thermophilic microorganism and/or redox potential of the fermentation and/or residual sugars level in the fermentation and/or pyruvate levels in the fermentation.

7. The process of any preceding claim wherein the at least one thermophilic microorganism is maintained in redox balance through use of sensors.

8. The process of any preceding claim wherein ethanol is removed continuously so as to reduce ethanol concentration in the fermentation below the ethanol tolerance of the at least one thermophilic microorganism.

9. The process of claim 8 wherein ethanol is removed by evaporation .

10. The process of any preceding claim wherein the at least one thermophilic microorganism is of the genus Bacillus.

11. The process of claim 10 wherein the Bacillus is Bacillus stearothermophilus or Geobaclllus thermoglucosldasius .

12. The process of claim 11 wherein the Bacillus is a derivative of Bacillus stearothermophilus strain LLD-R or strain LLD-15.

13. The process of any preceding claim wherein the at least one thermophilic microorganism lacks lactate dehydrogenase activity due to inactivation of a gene encoding lactate dehydrogenase .

14. The process of claim 13 wherein the at least one thermophilic microorganism lacks lactate dehydrogenase activity due to transformation with a DNA construct comprising a nucleotide sequence encoding a non-functional lactate dehydrogenase, wherein the nucleotide sequence encoding a non-functional lactate dehydrogenase leads to inactivation of lactate dehydrogenase activity through recombination with the gene encoding lactate dehydrogenase in the genome of the thermophilic microorganism.

15. A DNA construct comprising a nucleotide sequence encoding a non-functional lactate dehydrogenase, wherein the nucleotide sequence encoding a non-functional lactate dehydrogenase leads to inactivation of lactate dehydrogenase activity in a thermophilic microorganism transformed with the DNA construct through recombination with a gene encoding lactate dehydrogenase in the genome of the thermophilic microorganism.

16. The DNA construct of claim 15 wherein the nucleotide sequence includes a deletion within the open reading frame as compared to the nucleotide sequence of a gene encoding a functional lactate dehydrogenase.

17. The DNA construct of claim 15 or 16 which additionally comprises at least one reporter gene.

18. The DNA construct of any one of claims 15 to 17 which is a plasmid.

19. The DNA construct of claim 18 which is a pUClδ derivative .

20. A thermophilic microorganism transformed with a DNA construct as defined in any one of claims 15 to 19.

21. The thermophilic microorganism of claim 20 which is of the genus Bacillus.

22. The thermophilic microorganism of claim 21 which is Bacillus stearothermophllus or Geobacillus thermoglucosIdasius .

23. The thermophilic microorganism of claim 22 which is a derivative of Bacillus stearothermophllus strain LLD-R or LLD-15.