WO2007107807A1

WO2007107807A1 - Production of alpha-linolenic acid in sunflower

Info

Publication number: WO2007107807A1
Application number: PCT/IB2006/000708
Authority: WO
Inventors: Villoo Morawala Patell; K. R. Rajyashri
Original assignee: Avestha Gengraine Technologies Pvt. Ltd
Priority date: 2006-03-21
Filing date: 2006-03-21
Publication date: 2007-09-27
Also published as: WO2007107853A2; WO2007107853A3

Abstract

The following invention relates to the method of transformation of Sunflower with Agrobacterium tumefaciens harboring the recombinant vector comprising the nucleic acid sequence encoding the enzyme, Delta- 15 desaturase required for alpha-linolenic acid biosynthesis, driven by ubiquitin promoter. Further disclosed are the nucleic acid sequences, constructs, vectors comprising the gene encoding for Delta- 15 desaturase enzyme required for the alpha-linolenic acid production in functional combination with the heterologous regulatory sequences and the host cells into which the vectors have been introduced. Further aspects of the invention relates to the selection and regeneration of the putative transformants based on a method of positive selection using Xylose as a selectable marker.

Description

Production of Alpha-Linolenic Acid in Sunflower

The Field of Invention:

The following invention relates to the method of transformation of Sunflower with Agrobacterium tumefaciens harboring the recombinant vector comprising the nucleic acid sequence encoding the enzyme, Delta- 15 desaturase required for alpha-linolenic acid biosynthesis, driven by ubiquitin promoters. Further disclosed are the nucleic acid sequences, constructs, vectors comprising the gene encoding for Delta- 15 desaturase enzyme required for the alpha-linolenic acid production in functional combination with the heterologous regulatory sequences and the host cells into which the vectors have been introduced. Further aspects of the invention relates to the selection and regeneration of the putative transformants based on a method of positive selection using Xylose as a selectable marker.

The Background of Invention:

Unsaturated fatty acids such as linoleic (C.sub.l8.DELTA.sup.9, 12) and alpha-linolenic (C.sub.l8.DELTA.Sup.9, 12,15) acids are essential dietary constituents that cannot be synthesized by vertebrates since vertebrate cells can introduce double bonds at the DELTA. sup.9 position of fatty acids but cannot introduce additional double bonds between the. DELTA.sup.9 double bond and the methyl-terminus of the fatty acid chain. Because they are precursors of other products, linoleic and.- alpha-linolenic acids are essential fatty acids, and are usually obtained from plant sources.

The present invention is related to the production of one of the most significant polyunsaturated fatty acid belonging to the n-3 (omega-3) fatty acid family — Alpha- linolenic acid. It is a polyunsaturated fatty acid with 18 carbon atoms. It is not produced by the body and hence has to be a part of the diet to maintain health. Alpha-linolenic acid is found in soyabean and canola oils, flaxseeds, walnuts, dark green leafy vegetables and purslane etc. Flax seed is the most abundant source of this fatty acid. The suggested minimum requirement of alpha-linolenic acid for an individual is 0.2% of dietary energy. On the other hand the WHO/FAO have recommended a minimum intake of alpha-linolenic acid of 0.5% of dietary energy and the recent international workshop held in USA has recommended 1%. This significant intake relies upon the fact that the biochemical structure of this fatty acid is important and makes it a key player in immunity, vision, cell membranes and the production of hormone like compounds. The n-6 to n-3 ratio of polyunsaturated fatty acids in the food is very important, and an optimal ratio 4 to 1 in diet is a major issue. Traditional diets present absolute or relative deficiency of n-3 polyunsaturated fatty acids, and a ratio 15-20 to 1.

The Benefits of Alpha-linolenic acid:

1. Heart Diseases: Although n-3 fatty acids have little or no effect on the total blood cholesterol levels, a substantial amount of recent work has focused on their ability to reduce blood triglyceride levels, both in the fasting state and following a meal. This together with the evidence that long chain n-3 fatty acids reduce the risk of having a fatal heart attack indicates an important role in maintaining heart health. A number of mechanisms have been proposed, including the protection against blood clot formation (thrombosis), protection against heart arrhythmias and the beneficial impact on blood pressure. Links have also been proposed between n-3 fatty acid intake, triacylglycerol response and the improved insulin sensitivity.

2. Hypertension: Several studies have indicated that diets and/or supplements rich in omega-3 fatty acids lower blood pressure significantly in people with hypertension. Arthritis: Research studies have indicated that omega-3 supplements (rich in ALA) can reduce the tenderness in joints, decrease morning stiffness and improve mobility.

3. Inflammatory Bowel Disease (IBD): Some people with Crohn's disease (CD), one of the form of IBD, have low levels of omega-3 fatty acids in their bodies. Evidence suggests that the fish oil supplements containing omega-3 fatty acids may reduce symptoms of CD and ulcerative colitis (another Inflammatory Bowel Disease), particularly if used in addition to medication. Preliminary animal studies have found that ALA may actually be more effective than EPA and DHA found in the fish oil supplements, but further studies in humans are needed to confirm these findings.

4. Eating Disorders: Studies suggest that men and women with anorexia nervosa have lower than the optimal levels of polyunsaturated fatty acids (alpha-linolenic acid and gamma-linolenic acid). To prevent the complications associated with essential fatty acid deficiencies, some experts recommend that treatment programs for anorexia nervosa include PUFA-rich foods or supplements.

In addition to addressing all of the above conditions, alpha-linolenic acid serves as the main precursor molecule for the biosynthesis of other major polyunsaturated fatty acids, which include Eicosapentanoic acid, and Docosahexaenoic acid, which is very much essential for the growth and the well being of infants and adults.

Considering the immense significance of this PUFA, tremendous efforts have been directed to the production of these omega-3 fatty acids through manipulation of microbial cells, plants and animals. Our invention aims at producing this speciality fatty acid ALA in significant amounts by transforming the Sunflower plant with the Delta- 15 desaturase thereby accounting for a safe, cost-efficient manner so as to garner the maximum therapeutic value from this fatty acid.

The enzyme involved in the synthesis of alpha-linolenic acid from linolenic acid is introduced into the sunflower plant. Sunflower is attractive to growers as an alternative cash crop usually grown under contract. The new early maturing type offers producers in short season areas the opportunity to diversify rotations. It has agronomic advantages associated with a large seeded, drought tolerant crop. The large seed allows for deep seeding in the dry conditions. It roots deeper and can utilize nitrogen and moisture making it a good stubble crop in the dark brown and black zone areas. It may also be chosen to as an alternative to some of the oil crops since it is not attacked by most insects. The nutritional benefits of sunflower seeds are exceptional. They serve as one of the richest source of Vitamin E with 50.27 IU for three and a half ounces (100 grams) and hence serve as a powerful antioxidant that rids the body of harmful free radicals that pose risk for heart diseases. Raw sunflower seeds contain impressive figures. Usually found in trace quantities, thiamin 41mg, riboflavin 0.04 mg, niacin 0.81mg and folate 40.88 meg for 1 ounce (28 grams). It also contains 6.68 mg calcium, 0.39 mg iron, 20.38 mg magnesium, 39.63 mg potassium, and 0.29 mg zinc. Raw sunflower seeds are also high in phosphorous, eat them in small quantities to prevent loss of calcium.

An increase in the production of alpha-linolenic acid in addition to the plethora of nutritional benefits that it possesses can be highly beneficial. Our invention aims to produce alpha-linolenic acid in the Sunflower plant. Sunflower oil is rich in PUFAs. Though it contains high levels of linoleic acid, the pathways required for the production of alpha-linolenic acid and its derivative — Docosahexaenoic acid are absent. This could increase their potential value both in domestic and export markets as there is a market trend towards products that help to reduce blood cholesterol levels. There are also market opportunities for use as birdseed and the potential for use in feed rations high in energy and protein. There is interest in using it for dairy cattle to increase milk production too.

It is the purpose of the present invention to respond to the aforementioned need by providing a new variety of cash crop having a nutritional significance by virtue of the described technology that teaches the method of transformation of the delta- 15 desaturase gene into the host plant that leads to the conversion of linoleic acid to alpha-linolenic acid satisfying the need for the dietary provision of the referred polyunsaturated fatty acid. Also described is the method of selection and regeneration of the putative transformants.

The attractiveness of this selection system is the use of a positive selectable marker for an efficient transformation and regeneration system. This positive selectable marker enables the identification and selection of genetically modified cells through imparting to the transformed cells the ability to metabolise compounds that cannot be metabolised by the non-transformed cells. The addition of this new compound in the culture medium, as nutrient source during the regeneration process, allows the normal growth and differentiation of transformed cells, while non-transformed are unable to grow and regenerate de novo plants. (Haldrup et al., 1998,2001; Joersbo et al., 1998,1999,2000; Negrotto et al., 2000; Wang et al., 2000).

Prior Art

Sunflower is naturally susceptible to gene transfer from Agrobacterium tumefaciens. Several reports described a method to regenerate cultured sunflower tissues from several explant types (e.g. Bohorova et al. 1986; Schmitz and Schnabl 1989; Binding et al. 1981; Wilcox McCann et al. 1988 and Witrzens et al. 1988). The availability of sunflower lines that have the potential for regeneration from embryogenic callus has lead to the production of the first transgenic plants (Everett, et al. 1987). All described methods make use of a callus phase to regenerate shoots and most of the regeneration protocols take at least several months.

The published patent Document WO2004005442 titled " Methods of production of the conjugated polyunsaturated fatty acids comprising at least two double bonds in plants." relates to the method of producing conjugated fatty acids comprising at least two preferably three, double bonds in eukaryotes especially plants and a method of producing oils and/or triglycerides having an increased content of conjugated and/or unconjugated polyunsaturated fatty acids comprising at least two, preferably three double bonds. The invention also relates to a method for producing conjugated linoleic acid in eukaryotes, esp. plants and a method for producing oils and/or triglycerides having an increased amount of conjugated linoleic acid. Further disclosed are the nucleic acid sequences, nucleic acid constructs, vectors and organisms containing the said nucleic acid sequences and/or vectors. The invention finally relates to the fatty acid mixtures and the triglycerides having an increased content of conjugated and/or unconjugated polyunsaturated fatty acids comprising at least two preferably three double bonds sp.conjugated linoleic acid and the used thereof. Our invention more specifically relates to the method of transformation of Helianthus annuus with the delta- 15 desaturase nucleic acid sequence for the conversion of linoleic acid to alpha-linolenic acid not disclosed in the prior art.

The Patent Number WO9846764 describes seeds, plants and oils are provided having high oleic acid; low linoleic acid; and low linoleic acid plus linolenic acid; and advantageous functional or nutritional properties. Plants are disclosed that contain a mutation in a delta- 12 or delta- 15 fatty acid desaturase gene. Preferred plants are rapeseed and sunflower plants. Plants carrying such mutant genes have altered fatty acid composition in seeds. In one embodiment, a plant contains a mutation in a region having the conserved motif His-Xaa-Xaa-Xaa-His, found in delta- 12 and delta- 15 fatty acid desaturases. A preferred motif has the sequence His-Glu-Cys-Gly-His. A preferred mutation in this motif has the amino acid sequence His-Lys-Cys-Gly-His. Nucleic acid fragments are disclosed that comprise a mutant delta- 12 or delta- 15 fatty acid desaturase gene sequence. The aforementioned application does not disclose any method of transformation and relates to mutational analysis of the delta- 12 and delta- 15 fatty acid desaturase genes.

The patent Application WO02064745 describes the transformation and regeneration of sunflower from cotyledons.

Cloning of DELTA.15 -desaturases from various organisms is described in PCT publication WO 93/11245.

The subject invention is distinct with respect to every aspect of the technical features delineated and is readily distinguishable from the cited prior art. The present invention overcomes the limitations of the prior art that does not teach the art of transformation of the said gene in a recalcitrant plant such as Sunflower, moreover based on a method of positive selection using the selectable marker gene such as Xylose Isomerase. Sunflower being an important oilseed crop and being characterized with comparatively high percentages of linoleic acid that forms the substrate of the enzyme delta- 15 desaturase for conversion to alpha-linolenic acid.

Sunflower being an important oil seed crop and being characterized with comparatively high percentages of linoleic acid that forms the substrate of the enzyme delta- 15 desaturase for conversion to alpha-linolenic acid is an appropriate host plant for the transformation of delta- 15 desaturase gene and is a expedient source for obtaining high levels of alpha-linolenic acid. The source of the delta- 15 desaturase gene in the current invention is Brassica juncea and has been befittingly codon optimized for its expression in the host plant. Additionally, it has to be noted herein that a transformation efficiency of 9-12 % has not been reported in any of the referred prior art.

SUMMARY OF THE INVENTION:

The present invention is directed to the transformation of delta- 15 desaturase gene into sunflower with Agrobacterium tumefaciens harboring the recombinant vector comprising the nucleic acid sequence encoding the enzyme delta- 15 desaturase.

A particular aspect of the invention is directed to the isolation of the delta- 15 desaturase gene construct from Brassica juncea.

Yet another aspect of the invention relates to the sequence optimization of the gene sequence for the expression of the said nucleotide sequence to be operable in the host plant.

A further aspect of the invention pertains to the construction of the sequence optimized desaturase gene in functional combination with heterologous regulatory sequences.

Specifically the most desired aspect of the invention relates to the transformation of the constructed vector into the host plant, distinctly teaching a person skilled in art the method of explant preparation, infection, co-cultivation as well as the method of selection and regeneration of the transformed explants. Additionally, the confirmation for integration of the said gene into the genome of the explant has been done through PCR and RT PCR analysis. The corresponding enzyme produced, for instance, α-Linolenic acid may be added to pharmaceutical compositions, nutritional compositions and to other valuable products.

Listings of the Figures:

Fig 1: Strategy followed for the cloning of AGT-D15-XI in pCAMBIA 1390

Fig 2: Amplification of AGT-D15-XI using primers specific to Δ-15, XI and Ubiquitin promoter.

Fig 3: Map of AGT-D15-XI construct

Fig 4: A) SEA Explants on I^st Selection Media. B) & C) Elongation Media D) Rooting Media E) & F) Plantlets in Hardening stage.

Fig 5: Amplification of SEA explants transformed with AGT-Δ15-XI vector with Δ 15 desaturase. lOOng of genomic DNA of rooted plantlets amplified with Δ 15 desaturase primers . Lanes 1-23: Amplification of transgenic plants 1-23; Lane 24: Positive control; Lane M: lkb Ladder. Plasmids carrying the Δ 15 -desaturase gene was used as the positive control.

Fig 6: cDNA amplification of the sevenΔ15 transgenic plantlets. Lane 1-7: dl5 amplicons from the seven transgenic plant samples; Lane 8: Positive control (dl5 plasmid); Lane 9: Negative control (Control cDNA) Lane 10: Water Control Lane 11& 12 Control genomic DNA. Description of Sequence Listings:

SEQ ID NO 1: Sequence of the amino acid optimized Δ15 Desaturase gene

SEQ ID NO 2: Sequence of Xylose isomerase gene used in the study

SEQ ID NO 3: pCAMBIA 1390 Vector Sequence

SEQ ID NO 4: Sequence of the Ubiquitin Promoter.

The Detailed Description of the Invention:

Sunflower (Helianthus annum L.) is one of the three most important annual oil-bearing crops worldwide. The oil is rich in unsaturated fatty acids, containing large amounts of vitamin E and is easy to refine. As a crop, sunflower is valuable because it is well adapted to grow on marginal land in many areas of the temperate zones of the world. The establishment of procedures for obtaining sunflower transgenic plants will contribute to the development of improved germplasm and many opportunities for biotechnology to contribute to the production of superior quality lines.

In this invention we report the introduction and expression of a foreign gene in the Sunflower plant that encodes the enzyme delta- 15 desaturase for the conversion of linoleic acid to alpha-linolenic acid and the method of regenerating the transgenic plant through a method of positive selection.

This invention relates to a method of transformation of Sunflower plant to produce alpha- linolenic acid, which can be technically employed by one skilled in the art.

Definitions: In context of this disclosure, the term "delta- 15 desaturase" refers to a fatty acid desaturase that catalyses the formation of a double bond between carbon positions 3 & 4 (numbered from the methyl end), i.e., those that correspond to carbon positions 15 & 16 (numbered from the carbonyl carbon) of an 18 carbon fatty acyl chain and carbon positions 13 & 14 (numbered from carbonyl carbon) of a 16 carbon long fatty acyl chain.

As used herein, "transformation" refers generally to the incorporation of foreign DNA into the host cell. The following examples will further illustrate the present invention.

Also for the purposes of the following invention the following terms are defined as follows:

"Promoter" refers to a DNA sequence in a gene; usually upstream (5') to its coding sequence, which controls the expression of the coding sequence by providing the recognition for RNA polymerase and other factors required for proper transcription. Promoters may also contain DNA sequences that are involved in the binding of protein factors, which control the effectiveness of transcription initiation in response to physiological or developmental conditions.

"Gene" refers to the nucleic acid fragment that expresses a specific protein, including regulatory sequences preceeding (5 'non-coding) and the following (3 'non-coding) of the coding region.

"Fatty acid desaturase genes" refers to a nucleic acid fragment that expresses a protein with fatty acid desaturase activity.

"Messenger RNA (mRNA) refers to RNA that is without introns and that can be translated into protein by the cell. "cDNA" refers to a double stranded DNA that is complementary to and derived from mRNA. ORF, "Open reading frame" refers to the coding sequence uninterrupted by introns between initiation and termination codons that encodes an amino acid.

EXAMPLE 1:

Cloning of Δ-15 desaturase into pCAMBIA-XI

The Δ-15 desaturase gene from the endoplasmic reticulum of Brassica napus is an 1154bp transcript. Primers were designed to amplify the ORF (Open Reading Frame) of Δ-15 desaturase from the cDNA in tissues of B.napus expressing the gene. B. juncea seeds (BPR559) were treated with 10 μM Abscisic acid for 2 days (Zou et al, 1995). Total RNA was isolated from lOOmg of the germinating seedlings of B.juncea using Trizol method and mRNA isolation from the total RNA was done using Oligotex-mRNA kit (Cat.No.70022). The mRNA was reverse transcribed using oligo dT primers. lOOng of the cDNA was amplified with Δ-15 desaturase specific primers given below:

Δ 15 desaturase-Forward 5' -ATGGTTGTTGCTATGGACCAGCGC-3'

Δ 15 desaturase-Reverse 5 ' -TTAATTGATTTTAGATTTGTCAGAAGCATAAACGTAG-S '

Table 1: Sequence of the primers designed for amplification of Δ-15 desaturase from B.juncea.

The amplified fragment of 1.2kb was cloned into pGEM-T easy vector and the insert sequenced for confirmation. The sequence was modified by multisite directed mutagenesis to substitute amino acids, which differ from those seen in B.napus D- 15 desaturase. The resulting sequence is hence sequence optimized In the present invention it was desirable to modify a portion of the sequence encoding the polypeptide having delta- 15 desaturase activity, to enhance the expression of the gene in Helianthus annuus. The sequence-optimized delta- 15 desaturase created herein is represented in SEQ ID No: 1. The sequence represented in the SEQ ID No: 1 was cloned into pCAMBlA 1390 under the ubiquitin promoter, carrying Xylose Isomer ase (XI) gene from Schizochytrium SC-I Primers were designed to amplify the ORP of the amino acid optimized Δ 15-desaturase gene of B. juncea in pGEM-T Easy vector.

Primers designed for Δ 15 desaturase:

Δl 5desaturase-Forward 5' AGAAGGAGATAAACAATGGTTGTTGCTATGG 3'

Δ15 desaturase-Reverse 5' GGACTAGTCCTTAATTGATTTTAGATTTGTCAGAAGCATAAACCGTAG 3'

Table 2: Sequence of the primers designed for amplification of Δ-15 desaturase Kpnl & Spel sites.

The amplified fragment was restricted with Kpnl and Spel and directionally cloned into the corresponding site of the pCAMBIA vector carrying Ubiquitin promoter. The entire cassette comprising of Ubiquitin promoter followed by the Δ 15-desaturase gene was restricted and directionally cloned into AGT-CO-XI vector (carrying the Xylose Isomer ase positive selectable marker) at BamHI and Spel Sites to obtain AGT-D 15-XI. The detailed diagrammatic representation of the cloning strategy followed is depicted in the Fig. No 1.

Strategy followed for the cloning of AGT-D15-XI in pCAMBIA 1390 is as follows:

Step 1: Xylose Isomerase gene (XI) in pGEM-T Easy vector (GEM-XI) was digested with Xhol and cloned into pCAMBIA 1390 at Xhol sites to obtain AGT-CO-XI.

Step 2: Δ-15 desaturase gene (Del 15) in pGEM-T Easy vector (GEM-D 15) was digested with Kpnl/Spel enzymes and cloned into pCAMBIA 1380 vector carrying the Ubiquitin promoter between the Kpnl/Spel sites. Step 3: The cassette of Ubiquitin and the Δ-15 desaturase gene pCAMBIA 1380 was digested with BamHI/Spel enzymes and cloned into AGT-CO-XI between BamHI/Spel sites to obtain AGT-Dl 5-XI.

Amplification of AGT-Dl 5-XI using primers specific to Δ-15, XI and Ubiquitin promoter has been represented in the Fig No: 2.

The construct was sequenced for validation and the validated AGT-D 15 -XI used for transformation experiments. Fig No: 3. The present invention contemplates the use of any such vector comprising the nucleic acid fragment of Δ-15 desaturase and the nucleic acids thereof.

The validated AGT-D 15 -XI plasmid was transformed into Agrobacterium tumefaciens strain GV3101 (An et al.1988) and confirmed through amplification of the colonies using primers specific for Δ-15 and XI genes.

EXAMPLE: 2

TRANSFORMATION OF HELIANTHUS ANNUUS WITH AGT-D15-XI.

A further aspect of the instant invention teaches the method of transformation of the constructed vector into the host plant, Helianthus annus to those of ordinary skill in the art.

Plant Material:

Helianthus annum CMS234B, a sunflower variety, which is an inbred maintainer line for parental line of KBSHl Hybrid, and a short duration variety (90-100 days) with oil content of 35% was used for the transformation.

Explant Preparation The seeds were dehusked and sterilised in 70% alcohol for 2 minutes and treated with 0.1% Mercuric Chloride for 4 minutes. The seeds were then vigorously washed with sterile water 4-5 times, followed by imbibition in water for at least 2 hours at 25° C.

The split embryonic axis was isolated by the method according to Barbara (1990) with some modification. After sterilization of the seed, the papery translucent seedcoat and thin transparent endosperm layer within was carefully peeled away. To dissect the shoot meristem the first cut was made through the cotyledons, parallel to the line where the two cotyledons are attached. If present the primordial leaves from the tip of the shoot apical meristem became visible, these were carefully cut away. Then tissue containing the root meristem was removed. The last cut was made directly through the centre of the shoot apical meristem. Explants were then collected on moistened filter paper until co-culture.

Bacterial strain and culture:

Agrobacterium tumefaciens strain GV3101 harboring the binary vector AGT-Δ15-XI from the glycerol stock were grown overnight in Luria-Bertani (LB) containing Rifampicin (lOμg/ml), Gentamycin (lOμg/ml) and Kanamycin (50μg/ml). The culture was further diluted at 1:10 ratio in fresh LB medium containing Rifampicin (5μg/ml), Gentamycin (5μg/ml) and Kanamycin (25μg/ml) and grown exponentially for a period of 4-6 hrs to reach the desire O.D.

Infection:

The Agrobacterium culture GV3101 carrying the binary vector AGT-D 15 -XI, were centrifuged at 6000 rpm for 5 min at 4⁰C and then washed and diluted in Murashige & Skoog salts + B5 Vitamins + 3% Sucrose liquid medium to an O.D 600 of 1.0. The excised explants were then immediately transferred to a vacuum infiltration flask containing 25 ml of the resuspended culture. Vacuum at 200 atm pressure for 15 min was applied and quickly released. The culture was then drained off completely and the explants collected on a blotting filter paper.

Co-cultivation:

The explants were transferred to co- cultivation medium (Murashige & Skoog salts+ B5 Vitamins+ 0.5mg/l BAP+ 2gm/l sucrose) for 2days at 26⁰C under dark in BOD.

Selection and Regeneration

After two days of co cultivation the explants were washed thoroughly with Murashige & Skoog salts+ B5 Vitamins + 3% Sucrose + Cefotaxime 250mg/l. The explants were then transferred to Selection and regeneration medium (Murashige & Skoog salts+ B5 Vitamins + 0.5mg/l BAP + 15gm/l D-Xylose + 5gm/lSucrose + 250mg/l Cefotaxime) and kept under photoperiod of 16hr light and 8hr dark condition for 2-3 weeks. After the selection period the shoots were subcultured onto Elongation and multiple shoot induction medium (¹A Strength Murashige & Skoog salts+ B5 Vitamins + O.Olmg/1 GA₃ + 0.05mg/l BAP). After 2 weeks the elongated shoots were transferred to rooting medium (¹Z₂ Strength Murashige & Skoog salts + B5 Vitamins O.Olmg/1 IBA). The root initiation was observed after 2weeks. The rooted plants before transferring to soil were hardened for 2 days in water.

The Fig No: 4 represents the different stages of regeneration of the explants on subsequent positive selection mediums.

Confirmation of Transgenic plants by PCR:

Explants selected for fifteen days on selection medium was studied for integration of Δ 15 genes into the genome of the explant. Genomic DNA was isolated from the plantlets by CTAB Extraction method from lOOmg leaf tissue, which was selected for 3 weeks, the DNA was amplified with primers specific for Δ 15 desaturase of AGT-D15-XI.

I₅ A total of 50 putative transgenic shootlets carrying Dl 5 gene have been obtained using positive selection. These plants have been confirmed by PCR analysis of leaf tissue. The results of the representative plantlets are depicted in the Fig No: 5

Transcription of D-15 desaturase in the transgenic plants:

Total RNA was extracted from lOOmg of leaf tissue of transgenic sunflower plants (confirmed by PCR) using Trizol Method. cDNA was prepared using M-MuLV RT-PCR Kit (Bangalore Genei -KT74) as per the manual instructions. cDNA was amplified with gene specific Δ15 desaturase primers. The results obtained are represented in the Fig. No: 6.

Analysis for the presence of α -Linolenic Acid in transgenic leaves:

Leaves of control and transgenic plants were collected and ground to fine powder, total lipid was extracted using Folch method of extracting with 2:1 v/v of chloroform: methanol. This was then kept in parallel synthesiser for about 4 hours and the aqueous phase was filtered with filter paper. Fatty acids were extracted, esterified and GC-MS analysis was carried out with Agilent 6890 N gas Chromatograph connected to Agilent 5973 mass spectrometer and GC on HP 6850 Series gas chromatograph equipped with a FID detector at IICT, Hyderabad.

The GC-MS detection was performed at 70 eV (m/z 50-550; source at 230 °C and quadruple at 150 °C) in the EI mode with a capillary column (30 m, HP-5ms, WCOT, i.d. 0.25 mm, film thickness 0.25 mm, oven 2 min at 150 ⁰C, 6 °C min-1 to 300 ⁰C, 20 min at 300 °C, Helium carrier gas flow, 1.0 ml/min, split ratio 50:1). For GC-FID, the capillary column DB-23 (30m, WCOT, i.d. 0.25 mm, film thickness 0.5 mm) was used. The oven temperature was programmed as 2 min at 160 °C, 6 ⁰C min-1 to 180 ⁰C, 2 min at 180 °C, 4 ⁰C min-1 to 230 °C and 10 min at 230 °C, with N2 carrier gas flow, 1.5 ml/min, and injector temp at 230 °C and detector temp at 250 °C; split ratio 50:1.

Results: α -Linolenic Acid was detected in the leaves of transgenic plants carrying Δ15 desaturase gene.

Claims

We Claim,

I) A method of transformation of Helianthus annuus with Agrobacterium tumefaciens harboring the recombinant vector comprising the nucleic acid sequence encoding the enzymes required for the alpha-linolenic acid biosynthesis, comprising of:

a) Construction of the recombinant vector incorporating the nucleic acid sequence encoding the enzyme delta- 15 desaturase. b) Agrobacterium mediated gene transfer of the vector of step a) into the plant cells or plant tissues of Helianthus annuus under conditions optimal for infection. c) A step of selection of the putative transformants from the population of genetically non-transformed plant cells/tissues on a selection medium. d) A step of regeneration of the selected plant cells or plant tissues of the host plant of step b)

2) A method of obtaining the nucleic acid fragment encoding the delta- 15 desaturase enzyme comprising:

a) designing primers for amplification of the open reading frame of delta- 15 desaturase gene in Brassica juncea. b) Amplification of cDNA of Brassica juncea with the designed primers of step a) c) The amplified nucleic acid sequence wherein at least one of the nucleotide sequence is modified in that the expression of the thus modified DNA occurs in the host plant. d) The nucleic acid sequence encoding delta- 15 desaturase and having a nucleic acid sequence selection from the group comprising SEQ IDl and the complementary strand thereof.

3) A method according to step a) of claim 1, wherein the sequence represented in SEQ ID 1 is introduced into vector pC AMBIA 1390 operably linked to a ubiquitin promoter. 4) The vector construct comprising the isolated nucleic acid sequence of SEQ IDl operably linked to the ubiquitin promoter.

5) The vector construct of claim 4 comprising a selectable marker gene.

6) The vector construct of claim 4, wherein the selectable marker gene is xylose isomerase.

7) A method according to any of the preceding claims, wherein the corresponding amino acid sequence of the expressed protein is represented in SEQ ID 1.

8) A method according to claim 1, wherein the host plant species used is Helianthus annuus.

9) A method according to claiml, wherein the step of transformation includes a stage- wise co-cultivation of explants is used which comprises:

a) A step of preparing an explant by excision of the split embryonic axis to remove the cotelydons, radicula, and the leaf primordia in order to expose the meristem. b) A step of culturing the microorganisms belonging to the genus Agrobacterium tumefaciens comprising the nucleic acid sequences required for Alpha-linolenic acid production. c) A step of infection and the co-cultivation of the said explants with the Agrobacterium containing culture medium of step b) under vacuum at 200 atm pressure for 15 minutes and the subsequent transfer into the co-cultivation medium 2 days at 26 ° C under dark. d) A step of transferring the explants into the selection and the regeneration medium containing a selection agent cultured under photo period of 16 hours light and 8 hours dark condition for 2-3 hours. e) A step of subsequent transfer of the selected explants into the elongation and the shoot induction medium. f) A step further comprising the regeneration of the selected transformed shoots into the host plant of claim 4.

10) A method according to the preceding claim, characterized in that the confirmation of transformation of the said selectable marker gene in the regenerated plantlets is done using the known molecular techniques of screening.

11) A method of production of alpha-linolenic acid by providing the host plant cell comprising a) The nucleic acid sequence encoding delta- 15 desaturase polypeptide. b) Culturing the host plant cells under conditions wherein the nucleic acid sequence encoding the enzyme delta- 15 desaturase is expressed and linoleic acid is converted to alpha-linolenic acid c) Optionally recovering the alpha-linolenic acid of step b)

12) The culture of the plant cells produced by the method according to any of the said preceding claims wherein the cells are enriched with the polyunsaturated fatty acid alpha- linolenic acid.

13) A plant that has been regenerated from the culture of the plant cells of claim 11

14) A transgenic plant comprising the isolated nucleic acid of claim 2) wherein the said nucleic acid sequence is integrated into the genome of the said plant by Agrobacterium mediated gene transfer.

15) The progeny of the transgenic plant of claim 14.

16) The seeds of the transgenic plant of Claim 14.