WO2007104979A1

WO2007104979A1 - Virus-like particles of rift valley fever virus

Info

Publication number: WO2007104979A1
Application number: PCT/GB2007/000889
Authority: WO
Inventors: Polly Roy; Li Liu
Original assignee: London School Of Hygiene & Tropical Medicine
Priority date: 2006-03-15
Filing date: 2007-03-14
Publication date: 2007-09-20
Also published as: GB0605265D0

Abstract

The present invention relates to a virus-like particle (VLP) comprising structural proteins from the rift valley fever virus (RVFV). The present invention also relates to a RVFV nucleocapsid-like structure (NLS). The present invention also relates to methods of generating the VLP and NLS, and methods of using the VLP and NLS.

Description

Virus-Like Particles of Rift Valley Fever Virus

NLSs or VLPs have been generated for a number of viruses, including rotaviruses, parvoviruses, papillomaviruses, HIV, Ebola virus, SARS coronavirus, by expressing respective structural proteins in recombinant systems (see Noad and Roy, Trends Microbiol, ϋ, 438-444, 2003). The VLPs are often similar to their corresponding viruses in morphology and are good antigens to elicit neutralization antibodies in animals. As the structures contain no virus genomes, VLPs are good materials for vaccines and for a range of studies, such as investigation of virus morphology and particle assembly and entry for highly virulent viruses.

RVFV belongs to the Phlebovirus genus of the Bunyaviridae family. It is transmitted by many species of mosquitoes, and periodically causes epidemics and epizootics in North

Africa and the Arabian peninsula within periods of mosquito activities (Gad et al,

Trans. R. Soc. Trop. Med. Hyg., 81, 694-8, 1987; Meadors et al, Vaccine, 4, 179-84,

1986). Infection of humans provokes a wide range of symptoms, from benign febrile to fatal encephalitis, retinitis, and hepatitis associated with haemorrhages. In livestock and wild ruminants it causes teratogeny and abortion in pregnant animals and produces a high rate of mortality in young animals.

RVFV is an enveloped virus of 90 to 110 nm in size, with a core element of 80 to 85 nm (Ellis et al, J. Med. Virol, 24, 161-74, 1988; Ellis et al, J. Gen. Virol. 42, 329-37, 1979). Its genome consists of single-stranded, tripartite RNA, among which the large (L) and the medium (M) segments are negative polarity, and the small (S) fragment is ambisense polarity. The L segment codes for the RNA-dependent RNA polymerase, which is packed together with the RNA fragments inside virus particles (Muller et al, J. Gen. Virol, 75, 1345-52, 1994). The S segment encodes two proteins: the structural nucleoprotein (N) in the anti-genomic sense; and the non-structural (NS) protein in the genomic sense (Giorgi et al, Virology 180, 738-53, 1991). The N protein is associated with genome RNA and packed inside of the virus particle, and the NS protein plays a role to block interferon production by inhibiting host gene transcription (Billecocq et al., J. Virol, 78, 9798-806, 2004). The M segment codes for a polypeptide precursor, from which the structural glycoproteins (Gn and Gc) and two non-structural proteins (78kDa and 14 kDa) are produced by cleavage (Collett, Virology, 151_., 151-6, 1986); Kakach et al, Virology, 170, 505-10, 1989; Suzich et al, Virology 164, 478-86, 1988).

There are five ATG starting codons standing on the precursor ORF at nucleotides positions 21, 136, 174, 411 and 426, respectively, before the Gn ORF initiates at position 480. By deletion experiments, it was found that the relative expression levels of Gn and Gc protein in recombinant vaccinia virus infected cells are dependent on the start site. The start at the 4^th ATG at position 411 gives the highest expression level. If the sequence above the Gn protein start site is deleted, the translation of Gn is totally eliminated and the level of Gc production reduces by 99 percent, even if an ATG is created at the beginning of the Gn ORF (Kakach et al, J. Virol, 62, 826-33, 1988). In the meantime, when the precursor sequence is present but the second, third, fourth and fifth ATGs are progressively mutated to non-methionine codons, the more the number of ATG changes, the less expression of Gn is observed. However, the Gc expression is only partially affected by the mutations and around 50% of Gc is produced in all mutated constructs, suggesting that Gc may also have an internal translational site that is independent from the precursor sequence (Suzich et al, J. Virol, 64, 1549-55, 1990). The Gc and Gn are thought to form heterodimers, which consist of the spiky structures that embed onto the outside of the envelope (Anderson et al, Virology, 161, 91-100, 1987; Gerrard et al, J. Virol, 76, 12200-10, 2002), though Uukuniemi virus Gc alone can form stable homodimers in vitro and Gn can form homodimers at pH above 6.4 (Ronka et al, Virology, 211, 241-250, 1995). The virus envelopes are derived from host cells, presumably the membrane of endoplasmic reticulum, Golgi apparatus or cellular surface membranes (Anderson et al, 1987 {supra); Ellis et al, 1988 {supra)). Several RVFV vaccines are produced using either formalin-inactivated virus or chemically mutated RVFV. The formalin inactivated vaccine is an inefficient vaccine as it requires multiple doses over a 30 day period and an annual booster (Kark et al, Vaccine, 3, 117-22, 1985). A chemically mutated virus (MP12) has been demonstrated to efficiently protect against clinical disease and does not cause abortion or teratogeny in cattle (Morrill et al, Vaccine, 9, 35-41, 1991; Morrill et al, Am. J. Vet. Res., 5_8, 1104-9, 1997). However, a recent publication reports 2 abortions in 50 vaccinated sheep and 14% teratological effects in newborn lambs (Hunter et al, Onderstepoort J. Vet. Res., 69, 95-8, 2002). In addition, the possibility of mutations of inactivated virus and/or the recombination/consortment of inactivated and wild-type viruses is a potential risk for the populations.

An alternative approach for generating efficient and safe RVFV vaccines has been investigated. Evidence indicates that immunization of animals with vaccinia virus recombinants expressing the glycoproteins Gn/Gc or Gn alone elicits neutralizing antibody responses and the animals are protected from otherwise lethal challenges with RVFV (Collett et al, In "The biology of negative strand viruses" (B. Mahy, and D. Kolakofsky, Eds.), pp. 321-329, 1987. Elsevier Science Publishing Inc., New York; Schmaljohn et al., Virology, 170, 184-92, 1989). Neutralization protections are also obtained with inoculation of lysates of cells infected with recombinant baculovirus co- expressing Gc and Gn proteins or with only Gn. Passive transfer of sera from Gn/Gc recombinant-immunized mice also gives good protection to mice from RVFV challenge (Schmaljohn et al., 1989 (supra).

Although separate or co-expression of the structural proteins has been reported in bacteria, vaccinia and baculovirus systems (Collett et al., 1987 (supra); Keegan et al., J. Virol, 58, 263-70, 1986; Schmaljohn et al, 1989 (supra); Suzick et al, 1990 (supra)), generation of VLPs has not been observed. As VLPs have the advantage of not only containing the structural proteins and no virus genomes but also retaining the outermost structures of virus particles, VLPs are more likely to mimic the wild-type virus particles than a collection of separate structural proteins. The production of VLPs is a new approach to generate efficient and safe vaccines. Using the baculovirus and insect system to produce VLPs has additional advantages of mimicking mammalian post-translational modifications and allows the production of large amount of VLPs in a short time (Luckow et al., Bio/Technology, 6, 47-55, 1998).

Previous work on expression of proteins from the Bunyaviridae as a basis for candidate vaccines using the baculovirus system has focussed on synthesis of the N, Gl and G2 proteins. Schmaljohn et al., (Virology, 170, 184-92, 1989), found that expression of Gl, G2 and varying amounts of pre-glycoproteins from RVF M polyprotein were processed to yield proteins indistinguishable from virus derived Gl and G2 by gel electrophoresis. Furthermore, lysates from cells expressing Gl and G2 provided some protection against lethal challenge with RVF in mice, hi addition, Pekosz et al, (J. Virol, 69, 3475-81, 1995), found that a baculovirus expressed truncated, soluble, version of the La Crosse virus (LAC) Gl provided a 'robust immune response' and protection against lethal challenge by LAC. However, it should be noted that the one recorded attempt to produce VLP in baculovirus infected insect cells to Hantaan virus, another member of the Bunyaviridae by co-expressing the complete S and M genome segments resulted in inefficient production of VLP in insect cells (Betenbaugh et ah, Virus Res., 38, 111-24, 1995).

The present invention provides a virus-like particle (VLP) comprising the N protein and the Gc protein from rift valley fever virus (RVFV), wherein the virus-like particle does not comprise RVFV nucleic acid.

The VLP of the present invention may additionally comprise the Gn protein from RVFV or a truncated version of the Gn protein from RVFV.

Preferably the VLP of the present invention comprises the N protein, the Gc protein and the Gn protein from RVFV.

The VLP of the present invention can be used to raise an immune reaction against RVFV (i.e., to elicit neutralising antibodies against RVFV) and can therefore be used to vaccinate an animal against RVFV. RVFV is a bunyavirus. Bunyaviruses are known to assemble intracellular^ by a budding process at the smooth surface vesicles in the Golgi area, where morphologically mature bunyavirus particles form within cytoplasmic vesicles that fuse with the plasma membrane to release particles. In view of this unusual mode of assembly, it was surprising that VLPs of a virus of the bunyaviridae family could be produced.

Although VLP have now been generated in insect cells to a number of animal viruses, (Noad & Roy et al., Trends Microbiol, ϋ, 438-444, 2003), attempts to efficiently generate VLPs in this system to a member of the Bunyaviridae family had previously failed (Betenbaugh et al, Virus Res., 38, 111-24, 1995). For this reason those skilled in the art did not consider it possible that VLPs to RVFV would be able to efficiently assemble into immunogenic VLPs on expression in insect cells. It is therefore surprising and unexpected that it was possible to efficiently recover immunogenic VLPs for RVFV from insect cells.

The RVFV may be any strain of RVFV. Preferably the RVFV is the ZH501 or ZH548 strain. There are also 2 avirulent strains, namely M12 (derived from ZH548) and C13. The genes used by the inventors to express the RVFV proteins in the appended examples were cloned from Ml 2.

The term "virus-like particles (VLP)" is well known to those skilled in the art and refers to particles that are similar to the parent virus in morphology and can be used to raise an immune response against the parent virus. The virus-like particles do not comprise any viral nucleic acid and therefore do not replicate. Preferably, the virus-like particles are morphologically indistinguishable from the parent virus.

RVFV is a well known and well characterised virus. The N protein of the RVFV is the structural nucleoprotein. The sequence of the N protein is disclosed in Giorgi et al., 1991 (supra) and shown as nucleotides 915 to 1652 of SEQ ID No.l. The term "N protein" as used herein refers to the N protein of the RVFV and any functional homologs thereof. A functional homolog is a protein that raises substantially the same immunological reaction as the N protein and/or binds the same specific nucleic acid fragments and derivatives as the N protein. Preferably the functional homolog has at least 90%, more preferably at least 95% sequence identity to the N protein.

The Gn protein (also referred to as the G2 protein) is a structural glycoprotein. The Gc protein (also referred to as the Gl protein) is also a structural glycoprotein. The Gn and Gc proteins are derived from the M segment. IyI RNA sequence of ZH501 is disclosed in Collett, 1986 (supra) and Collett et al, Virology, 144, 228-245, 1985; the M RNA sequence of strain Zh548-M12 is disclosed in Takehara et al, Virology, 196, 452-457, 1989. The M sequence of strain ZH501 is shown in SEQ ID No.2, wherein Gn is present at nucleotides 480-2090, and Gc is present at nucleotides 2091-3638. The M sequence of strain ZH548-M12 is shown in SEQ ID No.3, wherein Gn is present at nucleotides 480-2090, and Gc is present at nucleotides 2091-3638. Kakach et al, 1989 (supra) and Suzich et al, 1988 (supra) provide analysis of gene transcription and translation. The term "Gn protein" as used herein refers to the Gn protein of the RVFV and any functional homologs thereof. A functional homolog is a protein that raises substantially the same immunological reaction as the Gn protein. The functional homolog may be a fragment that contains the Golgi recognition signal or the protein expression signal. Preferably the functional homolog has at least 90%, more preferably at least 95% sequence identity to the Gn protein. The term "Gc protein" as used herein refers to the Gc protein of the RVFV and any functional homologs thereof. A functional homolog is a protein that raises substantially the same immunological reaction as the Gc protein. The functional homolog may be a fragment that contains the endoplasmic reticulum retention signal. Preferably the functional homolog has at least 90%, more preferably at least 95% sequence identity to the Gc protein.

A truncated version of the Gn protein is a version of the Gn protein that has been truncated. The Gn protein may be truncated at one or both of the N-terminal and C- terminal ends. The Gn protein is preferably truncated by at least 20%, more preferably at least 50% and most preferably at least 75%. Preferably the truncated Gn protein only comprises the first 55 amino acids from the N-terminal end of the protein.

The present invention also provides a NLS comprising the N protein from the RVFV, wherein the NLS does not comprise RVFV nucleic acids. The NLS may be used to raise an immune response against RVFV. The NLS has the advantage of retaining the nucleocapsid structure of RVFV and contains no virus genome,

The present invention also provides a baculo virus or bacmid encoding at least one of the following RVFV proteins: the N protein, the Gc protein and the Gn protein or a truncated version of the Gn protein. Preferably the protein is operably linked to the baculovirus polyhedron promoter. Suitable baculoviruses and bacmids are well known to those skilled in the art. A suitable bacmid is BAclO:KOi₆₂₉ (see Zhao et al., Nucleic Acids Research, 31., e6, 2003).

The baculovirus or bacmid of the present invention allows the production of the RVFV protein by infecting an insect cell with the baculovirus or bacmid and causing the protein to be expressed.

The present invention also provides a transfer vector encoding at least one of the following RVFV proteins: the N protein, the Gc protein and the Gn protein or a truncated version of the Gn protein. The sequence encoding the one or more proteins is flanked by baculovirus sequences allowing homologous recombination between the transfer vector and baculovirus sequences so that the sequences encoding the one or more proteins can be inserted into the baculovirus sequences. The transfer vector preferably comprises an origin of replication allowing the transfer vector to replicate in prokaryotic cells, especially E. coli, and an origin of replication allowing the transfer vector to replicate in insect cells. As will be appreciated by those skilled in the art, the transfer vector may comprise additional elements such as selectable markers, promoters, etc. that may assist with the transfer of the sequences encoding the one or more proteins. Suitable transfer vectors are well known to those skilled in the art, for example pRN16, wherein sequences encoding the RVFV proteins can be incorporated into the vector. pRN16 was constructed from pAcCL29 (Livingstone et al., Nucleic Acids Research, 17, 2366, 1989). The present invention also provides a cell containing the baculovirus or bacmid of the present invention. The cell may be any cell allowing propagation of the baculovirus or bacmid. Preferably the cell is an insect cell, such as Spodoptera frugiperda (e.g., cell Hne sF-21 or Sf9).

The present invention also provides a cell containing the transfer vector of the present invention. The cell may be a prokaryotic or eukaryotic cell. Preferably the cell is E. coli or an insect cell, such as a Spodoptera frugiperda cell (e.g., cell line sf-21 or Sf9).

The present invention also provides a cell containing the VLP or NLS of the present invention. Preferably the cell is an insect cell, such as Spodoptera frugiperda (e.g., cell line sF-21 or Sf9).

The present invention also provides a pharmaceutical composition comprising the VLP of the present invention or the NLS of the present invention in combination with a pharmaceutically acceptable carrier, adjuvant or vehicle.

Suitable, pharmaceutically acceptable carriers, adjuvants or vehicles are discussed below.

The present invention also provides the VLP of the present invention for use in therapy.

The present invention also provides the use of the VLP of the present invention in the manufacture of a medicament for vaccinating an individual against RVFV.

The present invention also provides a method for vaccinating an individual against RVFV comprising delivering an effective amount of the VLP of the present invention to the individual.

The present invention also provides the NLS of the present invention for use in therapy.

The present invention also provides the use of the NLS of the present invention in the manufacture of a medicament for vaccinating an individual against RVFV. The present invention also provides a method for vaccinating an individual against RVFV comprising delivering an effective amount of the NLS of the present invention to the individual.

The VLP or NLS of the present invention may be used to deliver a gene or immunogenic peptide to a cell. In particular, the VLP or NLS may be used to deliver any nucleic acid molecule (e.g., foreign nucleic acid), a peptide, a drug, a catalyst, an enzyme or a chemical compound. The VLP or NLS may also be used as nanoparticles.

The VLP or NLS of the present invention may be provided in combination with any pharmaceutically acceptable carrier, adjuvant or vehicle. Pharmaceutically acceptable carriers, adjuvants and vehicles that may be used include, but are not limited to, ion exchangers, alumina, aluminum stearate, lecithin, serum proteins, such as human serum albumin, buffer substances such as phosphates, glycine, sorbic acid, potassium sorbate, partial glyceride mixtures of saturated vegetable fatty acids, water, salts or electrolytes, such as protamine sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, zinc salts, colloidal silica, magnesium trisilicate, polyvinyl pyrrolidone, cellulose-based substances, polyethylene glycol, sodium carboxymethylcellulose, polyacrylates, waxes, polyethylene- polyoxypropylene-block polymers, polyethylene glycol and wool fat.

The VLP or the NLS of this invention may be administered orally, parenterally, by inhalation spray. Preferably the VLP or the NLS is administered orally or by injection. The VLP or the NLS of this invention may be formulated with any conventional non- toxic pharmaceutically-acceptable carriers, adjuvants or vehicles. The term parenteral as used herein includes subcutaneous, intracutaneous, intravenous, intramuscular, intraarticular, intrasynovial, intrasternal, intrathecal, intralesional and intracranial injection or infusion techniques.

The VLP or the NLS may be in the form of a sterile injectable preparation, for example, as a sterile injectable aqueous or oleaginous suspension. This suspension may be formulated according to techniques known in the art using suitable dispersing or wetting agents (such as, for example, Tween 80) and suspending agents. The sterile injectable preparation may also be a sterile injectable solution or suspension in a nontoxic parenterally-acceptable diluent or solvent, for example, as a solution in 1,3- butanediol. Among the acceptable vehicles and solvents that may be employed are mannitol, water, Ringer's solution and isotonic sodium chloride solution. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose, any bland fixed oil may be employed including synthetic mono- or diglycerides. Fatty acids, such as oleic acid and its glyceride derivatives are useful in the preparation of injectables, as are natural pharmaceutically-acceptable oils, such as olive oil or castor oil, especially in their polyoxyethylated versions. These oil solutions or suspensions may also contain a long-chain alcohol diluent or dispersant such as Ph. HeIv or a similar alcohol.

The VLP or the NLS may be orally administered in any orally acceptable dosage form including, but not limited to, capsules, tablets, and aqueous suspensions and solutions. In the case of tablets for oral use, carriers which are commonly used include lactose and com starch. Lubricating agents, such as magnesium stearate, are also typically added. For oral administration in a capsule form, useful diluents include lactose and dried corn starch. When aqueous suspensions are administered orally, the active ingredient is combined with emulsifying and suspending agents. If desired, certain sweetening and/or flavouring and/or colouring agents may be added.

The amount of VLP or NLS to be delivered to an individual or non-human animal can be determined using standard techniques; however, generally, the amount to be delivered should be in the range of O.Olmg to 100 mg.

The present invention further provides a method for producing the VLP of the present invention comprising transfecting an insect cell with a baculovirus or bacmid encoding the N protein and the Gc protein of RVFV, culturing the transfected insect cell under suitable conditions in order to lead to the production of the encoded RVFV proteins and to the formation of the VLP. The VLP may then by harvested from the transfected cells, using standard techniques. The baculovirus or bacmid may additionally encode the Gn protein of RVFV or a truncated version of the Gn protein. As will be appreciated by those skilled in the art, the RVFV proteins may be encoded on one or more baculoviruses or bacmids, For example, each protein may be encoded on a separate baculovirus or bacmid.

The present invention further provides a method for producing the NLS of the present invention comprising transfecting an insect cell with a baculovirus or bacmid encoding the N protein of RVFV, culturing the transfected insect cell under suitable conditions in order to lead to the production of the encoded RVFV protein and to the formation of the nucleocapsid-like structure. The nucleocapsid-like structure may then by harvested from the transfected cells, using standard techniques.

The present invention is now described by way of example only with reference to the following figures.

Figure 1 shows the expression and purification of nucleocapsid (N) protein of RVFV. Sf9 cells were inoculated with Recombinant baculovirus containing the coding region of N protein. Four days later the media was harvested. (A) Purified N proteins in Coomassie brilliant blue staining (lane 2) and Western blotting (Lane 3) were compared with total proteins from infected insect cells. Protein markers are included (M) and sizes are shown at the right in kDa. (B) Detection of the purified N protein using gel filtration. The relative elution positions of molecular markers are included with molecular weight indicated above the curve. (C) Particles can be seen under EM using purified N protein samples.

Figure 2 shows that the co-expression of N and Gc proteins in insect cells produced virus-like structures released in the medium after four days incubation with recombinant baculovirus. (A) protein analysis on SDS-Polyacrylamide. Lysates (lane 1 to 4) and purified (lane 5 and 6) samples were compared. N protein can be detected in N and 4^th Gn_mut/Gc co-expression sample (lane 1 and 5), though the amount is significantly less than in the N alone expression sample (lane 2 and 6). Two negative controls, e.g. expression of a GFP protein (lane 3) and healthy insect cell sample (lane 4) are included. Lane 7 is loaded with protein markers, with molecular weight labelled on the right in kDa. (B) Negative staining sample of purified N-Gn_mut/Gc sample showing tender VLP structures with variable shapes and sizes. Figure 3 shows that the expression of N, Gn and Gc proteins produced VLPs. (A) Detection of viral proteins in purified samples by Western blotting. Samples were purified from clarified medium by ultra-centrifugation and glycerol/potassium tartrate gradient (lane 2, and 4-6). Lane 2 was stained with Coomassie brilliant blue and lane 4- 6 were hybridised with monoclonal antibody against either Gn (Lane 4) or N (lane 5), or with polyclonal antibody against RVFV virus (strain Zinga) (lane 6), respectively. Cell lysates are included either stained with Coomassie brilliant blue (lane 1) or hybridised with antibody against Gn (lane 3). Protein markers are loaded in lane 7, with the molecular weight shown at the right of the panel in kDa. (B) Negative staining of purified VLP.

Figure 4 shows the Immunogold labelling of purified RVFV VLPs. Panel A: antibody against Gc. The first and second antibodies were both diluted 100 times before labelling. Panel B: antibody against Gn. First antibody was diluted 100 times and the second antibody was diluted 500 times. Gold size: 5 nm.

Figure 5 shows VLP assembling in insect cells. (A): matured VLPs were released into vacuoles. Membranes similar to the vacuole boundaries were around the matured particles. (B): immature viral structures without envelopes assembled in the cytoplasm.

EXAMPLES

MATERIAL AND METHODS

Source of viral material and antibodies

Purified RVFV viral RNAs were obtained from Dr. Mark Outlaw, National Collection for Pathogenic Viruses, Porton Down, UK. Monoclonal antibodies, anti-Gn (R1-4D4-1- 2a, R1-3C10-1-1, R2-1E4-1-1-2), anti-Gc (R4-6G4-1-1, R4-4G11-1-1, R1-1G6-1-2), and anti-N (R3-1D8-1-1), were provided by Dr. Connie Schmaljohn and Ms Cindy A. Rossi in US army Medical Research Institute of Infectious Diseases, against Gn, Gc or N protein (generated by J. Meegan, J. Smith and J. Dalrymple, Virology Division, U. S. Army Medical Research Institute for Infectious Diseases, Frederick, MD). Monoclonal antibodies anti-N (1D8), anti-Gl (1G6), anti-G2 (4D4), and polyclonal antibody against RVFV vims stain Zinga were from Dr. Michele Bouloy and Dr. Agnes Billecocq, Institut Pasteur.

Plasmid construction The full-length cDNA of M segment was obtained by reverse PCR using primers 5'- ACGCGTGTCGACACACAAAGATGGTGCATTAAATGTATG -3' (SEQ ID No. 4) and 5'-GAATTCAGATCTACACAAAGACCGGTGCAACTTC -3' (SEQ ID No. 5), and the cDNA of N protein coding region was generated by reverse PCR using primers 5'-GTCGACGGATCCCCATGGACAACTATCAAGAGCTTCG-S ' (SEQ ID NO.6) and 5 '-CTCGAGGAATTCAGATCTTAGGCTGCTGTCTTGTAAGCC-S ' (SEQ ID No. 7). The PCR products were cloned into ρM83B (Liu and Lomonossoff, in preparation) and translation Context sequences were added by site-directed mutagenesis before the 4^th ATG for Gn/Gc with primer 5'- GGTCTTCCATGGCGGCCGCCCGGGCTG CATCCAAC-3' (SEQ ID NO. 8), or before the start codon of N with primer 5 ' -

GTTGTCCATGGCGGCCGCGTCGACCTGCAG -3' (SEQ ID No. 9). pM83B was constructed by replacing the polycloning site of pM81B (Liu and Lomonossoff, 2002) with sequence ttaattaagaattcgagctccaccgcggtggcggccgctctagaactagtggatcccccgggctgcatccaacgcgtatggtc gacctgcagggtaccccatgggatatcaagcttggcgcgcc (SEQ ID No. 10). The fragment containing the N ORF and the context was transferred to transfer vector pRN16 (R. Noad), derived from CL29 (Livingstone et al, Nuc. Acid Res., J7, 2366, 1989), to produce pRN-N. pRN16 was constructed by inserting a BstXI-Hindlll fragment from pAcCL29 (Livingstone and Jones, 1989 {supra) into pBacPAK8 (Clontech, California). The fragment including the context and the sequence from the 4^th ATG to the end of Gn was inserted to pRN16 to get pRN-4thGn/Gc. The EcoRV-Kpnl fragment of pRN- 4^thGn/Gc, which contained the polyhedron promoter and Gn/Gc genome, was inserted to pRN-N to construct pRN-Ns-4^thGn/Gc. A frameshift construct which had an extra C between the 625^th and 626^th nucleotides of M segment, and brought a frameshift after translating 47 amino acid of Gn and stopped after 8 further amino acids, was inserted into pRNlδ to create pRN-Ns-Gn_mut/Gc.

Expression in insect cells Bacmid BAclO:KOi₆₂₉ (Zhao et al., Nuc. Acid Res., 31, e6, 2003) was co-transfected with transfer plasmid pRN-N, pRN-N-4^thGn_mut/Gc and pRN-N-4^tbGn/Gc into Spodoptera frugiperda cell line sf-21, to get recombinant baculoviruses containing respective expression cassettes. A modified protocol was used to combine the co- transformation and plaque assay. Plaques were picked up after six days of co- transfection. Recombinant baculoviruses were stored at 4⁰C and insect cell line sf9 were infected for virus amplification, protein expression and VLP generations.

SDS-polyacrylamide gel electrophoresis and Western blotting. Polyacrylamide gels (7.5 to 10%) were applied to analyse the protein expressions (Laemmli, Nature, 227, 680-681, 1970). Proteins were either stained with Coomassie brilliant blue or transferred to a cellulose nitrate membrane (Schleicher & Schuell) using a semi-dry transfer cell (Bio-Rad) for Western blotting analysis (Sambrook, Fritsch, and Maniatis, 1989 "Molecular Cloning; A laboratory manual." Second Ed. Cold Spring Harbor Laboratory Press). Mice Anti-Gn, -Gc and -virus monoclonal or polyclonal antibodies were diluted 2000 times before use and the anti-mouse IgG conjugated with alkaline phosphatase (Sigma) was diluted 15,000 times.

VLP purification Cell culture media were clarified by centrifugation for 20 minutes at 9000 rpm at 4⁰C in a JAl 4 rotor (Beckman, CA). The supernatants were precipitated through a cushion of 5 ml of 20% (w/v) sucrose in TNE buffer (100 mM Tris-HCl, pH 7.4; 100 mM NaCl; 1 mM EDTA) by rate-zonal centrifugation (SW28 for 2 hours at 25,000 rpm). The pellet was re-suspended in TNE and the solution was layered either onto density sucrose gradients (Schmaljohn et al, J. Infect. Dis., 148, 1005-1012, 1983) and centrifuged for 4 hours or onto positive density potassium tartrate/negative viscosity glycerol gradients (Obijeski et al, J. Gen. Virol, 22, 21-33, 1974) and centrifuged for 18 hours in SW28 rotor at 28,000 rpm. Visual bands were collected, diluted with TNE and centrifuged with sucrose cushion. The pellet was re-suspended in TNE and stored at 4⁰C.

Purified N protein was also further analysed by size exclusion liquid chromatography (SEC) gel filtration using Superdex 200 HR 10/30 (Amersharn Biosciences). Electron microscopy (EM) All samples were examined in a Jeol 1200EX transmission microscope.

Negative staining. A purified sample was spun in a micro-centrifuge at full speed for 10 minutes. An aliquot of the supernatant was placed on a carbon-coated grid, dried with the edge of a piece of filter paper and stained with a drop of 3% phosphotungstic acid (pH6.8) (Ellis et al, 1979 (supra)).

Immuno-gold labelling. Samples were loaded onto grids and dried as for negative staining and blocked with 100 mg/ml BSA. A mixture of anti-Gn or anti-Gc antibodies were then placed onto the grid for 15 minutes, washed with PBS and blocked with BSA. Gold particles (Sigma, 5 or 15 nM in sizes) solutions conjugated with anti-mice antibody was then added. After final washing and drying, the grid was stained with 3% phosphotungstic acid (pH6.8) (Tan et al., J. Virol., 75, 3937-3947, 2001).

Thin-section. Cultured Sf9 cells were collected by spinning down at 1000 rpm for 2 minutes and washed once with serum-free fresh culture medium. The final cell pellet was fixed with 2% glutaraldehyde in serum-free fresh culture medium and embedded in agar, and cut into smaller cubes. The cubes were embedded in epoxy resin and ultra sections were cut, mounted onto formva-coated grid, and stained with 2% uracil acetate, pH5.5 (Ellis et al, 1979 {supra)).

RESULTS

N protein expression produced NLP structures N protein expression and the possibility of forming NLSs was investigated in insect cells. After two days of culturing insect cells infected by recombinant baculovirus containing the N coding segment, a large amount of N protein was detected in both insect cell lysate and in the medium using polyacrylamide gel and western blot (Figure IA). N proteins in the supernatant was further purified using ultracentrifugation precipitation, sucrose gradient or gel filtration. The gel filtration data shows that N protein can form multimers and even some higher structures (Figure IB). The possible structure of N protein in purified samples was investigated under electron microscope. Unique particles without spiky structure can be seen (Figure 1C) i.e., NLS.

N and Gc co-expression generated tender VLP with different shapes and sizes A Gn mutated construct N-4^thGn_mut/Gc was used to investigate if N and Gc expression can form any virus-like structures. This construct contains two expression cassettes, driven by separate polyhedron promoters. One cassette contains the M polypeptide ORF starting from the 4^th ATG and had an extra C between the 625^th and 626^th nucleotides, which causes a frame-shift after translating 47 amino acid of Gn and stops after 8 further amino acids. The other cassette contains the N ORF. This choice was based on the fact that Gc protein is not expressed alone in insect cells and that it is also likely to be translated from an unknown internal site (Suzich et al., 1990 (supra)). The results show that N protein was easily detected but Gc did not form a strong band in PAGE gels (Figure 2A). Although the monoclonal antibodies did not recognize Gc in Western blot, purified material from visual gradient band contained significant amount of VLP with spiky structure at the surface of particles (Figure 2B). The results suggest that either N protein and Gc together produced some type of VLP or that Gn was translated at an alternative internal site and the truncated Gn was still functional to form the VLPs.

Co-expression of full-length Gn/Gc and N proteins produced large amount of VLPs indistinguishable to wild-type R VFV particles

N and Gn/Gc coding region, together with part of the leader sequence from 4^th ATG in the M segment, were co-expressed. While N protein formed a strong band in PAGE gels, Gc and Gn did not show clearly. In Western blot N and Gn proteins were both detected in the cells after three to four days infection of recombinant baculoviruses (Figure 3A).

In order to investigate if the expressed viral proteins were released to the medium, the medium was centrifuged using SW28 for two hours. The pellets were further purified by glycerol/potassium tartrate gradient. Western blot confirmed that the N and Gn proteins are in the purified fraction from the medium (Figure 3A). Moreover, nonuniform VLPs were accumulated in large amount after the purification (Figure 3B). Immuno-Gold labelling demonstrated that the spike structures contained both Gn and Gc protein.

Immuno-gold labelling was applied to the fraction containing the VLPs. Mixed antibodies against Gn or Gc were used separately in the experiments. The results show that the VLPs were labelled with both Gn and Gc antibodies, though Gn antibody worked better than Gc (Figure 4).

The ultra-thin section of insect cells confirmed that VLPs were matured in vacuoles Matured VLPs were released into vacuoles of insect cells after 2 days following infection with recombinant baculovirus containing all three RVFV structural proteins (Figure 5A). Large amounts of immature structures accumulated in the cytoplasm. Those immature structures had not obtained outside envelopes from the Golgi (Figure 5B).

DISCUSSION

The inventors expressed the structural proteins of RVFV using a baculovirus system in insect cells. When the N protein was expressed alone, it formed NLSs, which were released outside the insect cells. When a construct containing a frame-shifted Gn plus full-length Gc and N ORFs were co-expressed, tender virus-like particles containing spike structures of various shape and sizes were produced. When full-length Gn/Gc and N proteins were expressed together, more uniformed particles were produced in insect cells. The particles matured in the vacuole structures and were released in the culture medium. The inventors have successfully purified a large amount of VLPs from the culture medium. These particles contained heterogeneous spike structures on the outside of the particles and are indistinguishable from RVFV particles.

There is limited data about the nucleocapsid structures of Rift Valley fever virus. In general, the nucleocapsid structures of Bunyaviridae are speculated as being linear along with their RNA segments and capable of forming circular structures as the terminals of each RNA segment are complementary (Le May et ah, J. Virol., 79, 11974-80, 2005; Pettersson et al., J. Virol, 15, 386-392, 1975). The Hantaan virus N protein expressed in baculovirus and Vaccinia virus systems forms linear structures similar to the nucleoprotein-RNA assembly of the virus (Betenbaugh et al, Virus Res., 38, 111-124, 1995).Our results raised an interesting question whether the NLS formed differently with or without its genome fragments.

The fact that large amounts of N protein were purified from the culture medium when N protein was expressed alone, indicates it might have an independent pathway to be released, i.e., without the help of Gn, Gc or the viral genome segments. It seems quite a common phenomenon as some groups of viral N proteins expressed alone are also released outside cells (Betenbaugh et al, 1995 (supra); Jiang et al, J. Virol., 66, 6527- 6532, 1992; Kirnbauer et al, PNAS USA, 89, 12180-12184, 1992; Laurent et al, J. Virol, 68, 6794-6798, 1994).

The expression of N and Gc proteins lead to the formation of tender VLPs with various shape and sizes. As the construct included a frame-shifted Gn ORP, which can produce a 47 amino acid N-terminal peptide or can produce the C-terminal of the Gn peptide, including the Golgi retention signal if its ORP contains an internal translational signal, the inventors cannot exclude the possibility that a truncated Gn protein exists and helps to form the spike structure. Indeed, it is noticed that about half of the RVFV Gc protein is produced independently from the five ATGs located at the N-terminal of the pre- glycoprotein region. This excludes the possibility of a sub-genomic RNA and suggest there may be an internal translation initiation site (Suzich et al, 1990 (supra)). Since the C-terminal of Gn contains the Golgi retention signal and is important in the transport and maturation of virus particles (Gerrard et al, 2002 (supra)), the results suggest that the potentially truncated Gn may be produced and is functional to support the transport and maturation.

The inventors efficiently generated RVFV VLPs indistinguishable from RFVF virus particles with co-expression of Gn/Gc and N proteins in insect cells. Compared to the co-expression of Gn_mut/Gc and N proteins, the full-length ORFs generated more uniformed particles. This suggests that full-length Gn protein is required for the stable morphology and spike structures, even if the truncated Gn is enough to help to produce and release VLPs. The matured VLPs produced in insect cells are similar to those produced in mammalian cells. In mammalian cells RVFV virus particles are released to vacuoles of the Golgi or endoplasmic reticular sources (Anderson et al., 1987 (supra); Ellis et al., 1979 (supra)). Beside the mature VLPs in vacuoles, the inventors have found large amount of immature viral structures around obscure structures without a surrounding membrane. It needs further investigation to understand the property of these structures.

This is the first example showing that a Bunyaviridae VLP is efficiently generated in a baculovirus system. By expressing the M and S segment of Hantaan virus, VLPs are assembled in mammalian cells using recombinant vaccinia virus but are not produced in insect cells with similar recombinant baculovirus (Betenbaugh et al., 1995 (supra)). The success of efficiently producing RVFV VLPs in insect cells and successfully recovering VLPs from culture media, together with the finding that Gn and Gc proteins produced in recombinant Vaccinia virus and recombinant baculovirus efficiently trigger immune reactions in mice to lethal RVFV infections (Collett et al., 1987 (supra); Schmaljohn et al., I989(supra)) indicate that this is a powerful system enabling the production of large amounts of RVFV VLPs for vaccine production.

All documents cited above are incorporated herein by reference.

Claims

1. A virus-like particle (VLP) comprising the N protein and the Gc protein from rift valley fever virus (RVFV), wherein the VLP does not comprise RVFV nucleic acid.

2. The VLP of claim 1, which additionally comprises the Gn protein from RVFV or a truncated version of the Gn protein from RVFV.

3. The VLP of claim 1, which comprises the N protein, the Gc protein and the Gn protein from RVFV.

4. The VLP of claim 2, which additionally comprises the truncated Gn protein, wherein the truncated Gn protein only comprises the first 55 amino acids from the N- terminal end of the protein.

5. A nucleocapsid-like structure (NLS) comprising the N protein from the RVFV, wherein the NLS does not comprise RVFV nucleic acid.

6. A baculovirus or bacmid encoding at least one of the following RVFV proteins: the N protein, the Gc protein and the Gn protein or a truncated version of the Gn protein.

7. The baculovirus or bacmid of claim 6, wherein the encoded protein is operably linked to the baculovirus polyhedron promoter.

8. A transfer vector encoding at least one of the following RVFV proteins: the N protein, the Gc protein and the Gn protein or a truncated version of the Gn protein, wherein the sequence encoding the one or more proteins is flanked by baculovirus sequences allowing homologous recombination between the transfer vector and baculovirus sequences.

9. The transfer vector according to claim 8 that comprises an origin of replication allowing the transfer vector to replicate in prokaryotic cells, and an origin of replication allowing the transfer vector to replicate in insect cells.

10. A cell containing the baculovirus or bacmid of claim 6 or claim 7.

11. The cell of claim 10, wherein the cell is a eukaryotic cell.

12. The cell according to claim 11, wherein the cell is a Spodoptera frugiperda cell.

13. A cell containing the transfer vector of any one of claims 8 or 9.

14. The cell of claim 13, wherein the cell is a prokaryotic cell.

15. The cell of claim 13, wherein the cell is a eukaryotic cell.

16. The cell according to claim 15, wherein the cell is an insect cell.

17. A pharmaceutical composition comprising the VLP of any one of claims 1 to 4 in combination with a pharmaceutically acceptable carrier, adjuvant or vehicle.

18. A pharmaceutical composition comprising the NLS of claim 5 in combination with a pharmaceutically acceptable carrier, adjuvant or vehicle.

19. The VLP of any one of claims 1 to 4 for use in therapy.

20. Use of the VLP of any one of claims 1 to 4 in the manufacture of a medicament for vaccinating an individual against RVFV.

21. A method for vaccinating an individual against RVFV comprising delivering an effective amount of a VLP according to any one of claims 1 to 4 to the individual.

22. The NLS according to claim 4 for use in therapy.

23. Use of the NLS according to claim 4 in the manufacture of a medicament for vaccinating an individual against RVFV.

24. A method for vaccinating an individual against RVFV comprising delivering an effective amount of the NLS according to claim 4 to the individual.

25. A method for producing the VLP of claim 1, comprising transfecting an insect cell with a baculovirus or bacmid encoding the N protein and the Gc protein of RVFV, culturing the transfected insect cell under suitable conditions in order to lead to the production of the encoded RVFV proteins and to the formation of the VLP.

26. A method for producing the VLP of claim 2, comprising transfecting an insect cell with a baculovirus or bacmid encoding the RVFV N protein, the RVFV Gc protein and the RVFV Gn protein or a truncated version thereof, culturing the transfected insect cell under suitable conditions in order to lead to the production of the encoded RVFV proteins and to the formation of the VLP.

27. A method for producing the NLS of claim 4 comprising transfecting an insect cell with a baculovirus or bacmid encoding the N protein of RVFV, culturing the transfected insect cell under suitable conditions in order to lead to the production of the encoded RVFV protein and to the formation of the NLS.