WO2007100568A2 - T cell receptors and related materials and methods of use - Google Patents

T cell receptors and related materials and methods of use Download PDF

Info

Publication number
WO2007100568A2
WO2007100568A2 PCT/US2007/004454 US2007004454W WO2007100568A2 WO 2007100568 A2 WO2007100568 A2 WO 2007100568A2 US 2007004454 W US2007004454 W US 2007004454W WO 2007100568 A2 WO2007100568 A2 WO 2007100568A2
Authority
WO
WIPO (PCT)
Prior art keywords
cells
tcr
seq
cancer
isolated
Prior art date
Application number
PCT/US2007/004454
Other languages
French (fr)
Other versions
WO2007100568A3 (en
Inventor
Qiong J. Wang
Kenichi Hanada
James C. Yang
Original Assignee
Government Of The United States Of America, Represented By The Secretary, Department Of Health And Human Services
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Government Of The United States Of America, Represented By The Secretary, Department Of Health And Human Services filed Critical Government Of The United States Of America, Represented By The Secretary, Department Of Health And Human Services
Publication of WO2007100568A2 publication Critical patent/WO2007100568A2/en
Publication of WO2007100568A3 publication Critical patent/WO2007100568A3/en
Priority to US12/196,833 priority Critical patent/US7820174B2/en
Priority to US12/870,941 priority patent/US8431690B2/en
Priority to US13/851,473 priority patent/US9567387B2/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503Immunoglobulin superfamily
    • C07K14/7051T-cell receptor (TcR)-CD3 complex
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides

Definitions

  • RCC Clear cell renal cell carcinoma
  • FGF-5 fibroblast growth factor-5
  • the invention provides an isolated or purified T cell receptor (TCR) having antigenic specificity for a cancer antigen, e.g., a renal cell carcinoma antigen, wherein the TCR recognizes the cancer antigen in a major histocompatibility complex (MHC)- independent manner.
  • TCR can comprise specified amino acid sequences as described herein.
  • the inventive TCR can comprise the amino acid sequence of SEQ ID NOs: 16-21, SEQ ID NOs: 7 and 8, or SEQ ID NOs: 3 and 4.
  • the invention also provides related polypeptides and proteins, as well as related nucleic acids, recombinant expression vectors, host cells, and populations of cells. Further provided by the invention are antibodies, or an antigen binding portion thereof, and pharmaceutical compositions relating to the TCRs of the invention.
  • inventive method of detecting the presence of cancer in a host comprises (i) contacting a sample comprising cells of the cancer with any of the inventive TCRs, polypeptides, proteins, nucleic acids, recombinant expression vectors, host cells, populations of host cells, or antibodies, or antigen binding portions thereof, described herein, thereby forming a complex, and (ii) detecting the complex, wherein detection of the complex is indicative of the presence of cancer in the host.
  • the inventive method of treating or preventing cancer in a host comprises administering to the host any of the TCRs, polypeptides, or proteins described herein, any nucleic acid or recombinant expression vector comprising a nucleotide sequence encoding any of the TCRs, polypeptides, proteins described herein, or any host cell or population of host cells comprising a recombinant vector which encodes any of the TCRs, polypeptides, or proteins described herein, in an amount effective to treat or prevent cancer in the host.
  • Figure 1 A is a graph of the IFN- ⁇ secretion ( ⁇ g/ml) by cells of Microwell HC/2G upon stimulation with autologous EBV-B (EBV-B #1) or RCC (RCC #1) cells.
  • Figure IB is a graph of the IFN- ⁇ secretion (pg/ml) by HC/2G-1 T cell clones upon stimulation with a panel of HLA-mismatched renal tumors (RCC #1-11), EBV-Bs (EBV-B #1-11 and 888 EBV-B), melanoma tumors (888 Tc, 624 Tc, 938 Tc, 526 Tc, 1937 Tc, 2370 Tc, 2195 Tc, 2359 Tc, and 2230 Tc), other tumor lines (BIC, BE-3, TC71, MDA435S, MDA386, SKN-AS, H2228, H2087, 293 Tc, COS7), normal epithelial and fibroblasts (MJW
  • FIG. 1 C is a graph of the % specific lysis of target cells by HC/2G- 1 T cell clones at the indicated effector cellttarget cell (E:T) ratios.
  • the target cells included RCC tumor cells (RCC #1 (dotted line with ⁇ ), RCC #2 (dashed line with •), RCC # 5 (solid line with ⁇ ), RCC #6 (dotted line with ⁇ ), RCC #7 (dashed line with ⁇ ), RCC #8 (dashed and dotted line with A), RCC #9 (dashed line with •), and RCC #10 (dashed and dotted line with •)) and negative controls (RCC #11 (dashed line with ⁇ ), EBV-B #1 (solid line with ⁇ ), ELW91 (solid line with •), MAS90 (dotted line with T) 5 MJW90 (dashed line with ⁇ ), WLC89 (dashed line with ⁇ ), K562 (dashed line with A), and Daudi (d
  • Figure 2A is a set of flow cytometry graphs of HC/2G- 1 cells stained with PE- labeled mouse IgGi antibody and FITC-labeled mouse IgGi antibody (first graph on left), PE- labeled anti-CD3 antibody and FITC-labeled anti-CD4 antibody (second graph from left), PE-labeled anti-CD56 antibody and FITC-labeled anti-CDl6 antibody (third graph from left), PE-labeled anti-CD 161 antibody and FITC-labeled anti-CD57 antibody (fourth graph from left), and PE-labeled anti-CD3 antibody and FITC-labeled anti-TCR ⁇ / ⁇ (g/d) chains antibody (fifth graph from left).
  • Figure 2B is a graph of the cytokine secretion (IL-IRa, IL-3, IL-4, IL-5, IL-10, IL-13, IL-17, IL-18, and GMCSF) of HC/2G-1 T cell clones upon stimulation with EBV-B #1 (solid bars), RCC #1 (diagonal lined bars), EBV #11 (crisscrossed bars), and RCC #11 (vertical lined bars) cells.
  • EBV-B #1 solid bars
  • RCC #1 diagonal lined bars
  • EBV #11 crisscrossed bars
  • RCC #11 vertical lined bars
  • Figure 3 A is a flow cytometry graph of HC/2G-1 cells stained with PE-labeled TCR ⁇ / ⁇ chain antibody (solid line) and with an isotype-matched control antibody (PE- labeled anti-IgGi; dotted line).
  • Figure 3B is a set of graphs of the IFN- ⁇ secretion (pg/ml) by HC/2G-1 T cell clones (top graph), MW 5H-5 cells (middle graph), and HC lOC-3 cells (bottom graph) upon stimulation with autologous RCC cells pre-treated without (No Ab) or with anti-HLA Class I, anti-HLA Class II, anti-TCR ⁇ / ⁇ (TCR a/b), or anti-CD4 antibodies.
  • Figure 4A is a set of flow cytometry graphs of HC/2G-1 cells stained with PE- labeled V ⁇ 2 antibody and FITC-labeled anti-CD4 antibody (top) and of cells electroporated with rnRNA encoding the TCR of HC/2G-1 cells (bottom row) with 0 (first graph on left), 1 (second graph from the left), 2 (third graph from left), and 4 (fourth graph from the left) ⁇ g per 10 6 cells stained with PE-labeled V ⁇ 2 antibody and FITC-labeled anti-CD3 antibody.
  • Figure 4B is a graph of the IFN- ⁇ secretion (pg/ml) by cells electroporated with rnRNA encoding the ⁇ chain of the HC/2G-1 TCR (vertical lined bars), the ⁇ chain of the HC/2G-1 TCR (crisscrossed bars), or both chains of the HC/2G-1 TCR (dotted bars), or untransfected (dashed lined bars) upon stimulation with RCC #6 cells (left panel) or negative control cells (RCC #11 cells; right panel).
  • Figure 4C is a graph of the IFN- ⁇ secretion (pg/ml) by cells electroporated with 0, 1, 2, or 4 ⁇ g mRNA encoding both chains of the HC/2G-1 TCR upon stimulation with RCC cells (RCC #1 (crisscrossed bars), RCC #5 (zigzagged bars), RCC #6 (solid bars), RCC #7 (diagonal lined bars), RCC #8 (dotted bars), RCC #10 (bars with plus signs bars), and RCC #11 (bars with triangles)) or with medium only (horizontal lined bars). Also shown (left panel) is the IFN- ⁇ secretion (pg/ml) by positive control cells (HC/2G-1 cells).
  • Figure 4D is a graph of the IFN- ⁇ secretion (pg/ml) by PBLs transfected with mRNA encoding HC/2G-1 TCR or untransfected and non-enriched (PBL) or enriched for CD8 (CDS enriched) or CD4 (CD4 enriched) expression upon stimulation with RCC tumor cells (RCC #1 (crisscrossed bars), RCC #5 (zigzagged bars), RCC #6 (solid bars), RCC #7 (diagonal lined bars), RCC #8 (dotted bars), RCC #10 (bars with plus signs), and RCC #11 (bars with triangles)), with human embryonic kidney cells transduced with adenovirus (293 Tc (open bars)), with melanoma cells (624 Tc (vertical lined bars)), or with medium only (horizontal lined bars).
  • RCC tumor cells RCC #1 (crisscrossed bars), RCC #5 (zigzagged bars), RCC #6 (solid bars), RCC #7 (diagonal
  • Figure 5 A is an illustration of the retroviral vector encoding the HC/2G-1 TCR used to transduce cells.
  • Figure 5B is a set of flow cytometry graphs of PBMCs from allogeneic donors (#1-4; first, second, third, and fourth graphs from the left, respectively) transduced with retroviral vector encoding HC/2G-1 TCR and stained with PE-labeled anti-V ⁇ 2 antibody (y- axis) or FITC-labeled anti-CD3 antibody (x-axis).
  • Figure 5 C is a graph of the IFN- ⁇ secretion (pg/ml) by PBMCs from allogeneic donor #1 transduced with retroviral vector encoding GFP (PBMC #1/GFP) or HC/2G-1 TCR (PBMC #1/E8) upon stimulation with RCC tumor cells (RCC #1 (crisscrossed bars), RCC #5 (zigzagged bars), RCC #6 (solid bars), RCC #7 (dashed lined bars), RCC #8 (dotted bars), RCC #10 (bars with plus signs), and RCC #11 (bars with triangles)), with melanoma tumor cells (624 Tc; vertical lined bars), or with medium alone (open bars).
  • RCC tumor cells RCC #1 (crisscrossed bars), RCC #5 (zigzagged bars), RCC #6 (solid bars), RCC #7 (dashed lined bars), RCC #8 (dotted bars), RCC #10 (bars with plus signs), and RCC #11 (bars with triangles
  • FIG. 5D is a graph of the IFN- ⁇ secretion (pg/ml) by PBMCs transduced with retroviral vector encoding GFP (PBL/GFP) or HC/2G-1 TCR (PBL/E8) and enriched for CD8 (CD8/GFP and CD8/E8) or CD4 (CD4/GFP and CD4/E8) expression upon stimulation with RCC tumor cells (RCC #1 (crisscrossed bars), RCC #5 (zigzagged bars), RCC #6 (solid bars), RCC #7 (dashed lined bars), RCC #8 (dotted bars), and RCC #11 (bars with triangles)) or with melanoma tumor cells (624 Tc cells (vertical lined bars), or with medium alone (open bars).
  • RCC tumor cells RCC #1 (crisscrossed bars), RCC #5 (zigzagged bars), RCC #6 (solid bars), RCC #7 (dashed lined bars), RCC #8 (dotted bars), and RCC #1
  • the invention provides an isolated or purified T cell receptor (TCR) having antigenic specificity for a cancer antigen, wherein the TCR recognizes the cancer antigen in a major histocompatibility complex (MHC)-independent manner.
  • TCR T cell receptor
  • MHC major histocompatibility complex
  • the phrase "having antigenic specificity" as used herein means that the TCR can specifically bind to and immunologically recognize the cancer antigen, such that binding of the TCR to the cancer antigen elicits an immune response.
  • cancer antigen refers to any molecule (e.g., protein, peptide, lipid, carbohydrate, etc.) solely or predominantly expressed or over-expressed by a tumor cell or cancer cell, such that the antigen is associated with the tumor or cancer.
  • the cancer antigen can additionally be expressed by normal, non-tumor, or non-cancerous cells.
  • normal, non-tumor, or noncancerous cells are normally expressed by normal, non-tumor, or noncancerous cells.
  • the tumor or cancer cells can over-express the antigen or express the antigen at a significantly higher level, as compared to the expression of the antigen by normal, non-tumor, or noncancerous cells.
  • the cancer antigen can additionally be expressed by cells of a different state of development or maturation.
  • the cancer antigen can be additionally expressed by cells of the embryonic or fetal stage, which cells are not normally found in an adult host.
  • the cancer antigen can be additionally expressed by stem cells or precursor cells, which cells are not normally found in an adult host.
  • the cancer antigen can be an antigen expressed by any cell of any cancer or tumor, including the cancers and tumors described herein.
  • the cancer antigen may be a cancer antigen of only one type of cancer or tumor, such that the cancer antigen is associated with or characteristic of only one type of cancer or tumor.
  • the cancer antigen may be a cancer antigen (e.g., may be characteristic) of more than one type of cancer or tumor.
  • the cancer antigen may be expressed by both breast and prostate cancer cells and not expressed at all by normal, non-tumor, or non-cancer cells.
  • the cancer antigen is a kidney cancer antigen.
  • the cancer antigen is a renal cell carcinoma (RCC) antigen.
  • the inventive TCRs are able to recognize a cancer antigen in a major histocompatibility complex (MHC)-independent manner.
  • major histocompatibility complex (MHC)-independent manner means that the TCR, upon binding to the cancer antigen, can elicit an immune response in the absence of binding to a classical MHC molecule.
  • the classical MHC molecule can be any classical MHC molecule known in the art, e.g., an MHC Class I molecule, an MHC Class II molecule, HLA-A molecules, HLA-B molecules, HLA-C molecules, HLA-DR molecules, HLA-DP molecules, etc.
  • Classical MHC molecules are known in the art.
  • the inventive TCR may, however, bind to the cancer antigen in a manner which requires a minor MHC molecule.
  • the minor MHC can be an HLA-E molecule, an HLA-G molecule, a CDl molecule, e.g., CDIa, CDIb, CDIc, CDId, etc.
  • the inventive TCRs are able to recognize a cancer antigen in a CD8- and/or CD4 -independent manner, which manner may be a result of the inventive TCRs being able to recognize a cancer antigen in an MHC-independent manner.
  • CD8- and/or CD4-independent manner is meant that the inventive TCRs, upon binding to a cancer antigen, can elicit an immune response in the absence of a CD8 or CD4 molecule, or both a CD8 and CD4 molecule, expressed on the cell expressing the inventive TCR or in the absence of a functional CD8 or CD4 molecule, or both.
  • the inventive TCRs do not have a preference for CD8 or CD4 and can function in the context of either a CD8 or CD4 molecule.
  • the invention provides a TCR comprising two polypeptides (i.e., polypeptide chains), such as an ⁇ chain of a TCR, a ⁇ chain of a TCR, a ⁇ chain of a TCR, a ⁇ chain of a TCR, or a combination thereof.
  • polypeptides chains of TCRs are known in the art.
  • the polypeptides of the inventive TCR can comprise any amino acid sequence, provided that the TCR has antigenic specificity for a cancer antigen and can recognize the cancer antigen in an MHC-independent manner.
  • the TCR comprises two polypeptide chains, each of which comprises a variable region comprising a complementarity determining region (CDR) 1, a CDR2, and a CDR3 of a TCR.
  • CDR complementarity determining region
  • the first polypeptide chain comprises a CDRl comprising the amino acid sequence of SEQ ID NO: 16 (CDRl of ⁇ chain), a CDR2 comprising the amino acid sequence of SEQ ID NO: 17 (CDR2 of ⁇ chain), and a CDR3 comprising the amino acid sequence of SEQ ID NO: 18 (CDR3 of ⁇ chain), and the second polypeptide chain comprises a CDRl comprising the amino acid sequence of SEQ ID NO: 19 (CDRl of ⁇ chain), a CDR2 comprising the amino acid sequence of SEQ ID NO: 20 (CDR2 of ⁇ chain), and a CDR3 comprising the amino acid sequence of SEQ ID NO: 21 (CDR3 of ⁇ chain).
  • the inventive TCR can comprise the amino acid sequences selected from the group consisting of SEQ ID NOs: 16-18, 19-21, and 16-21.
  • the TCR comprises the amino acid sequences of SEQ ID NOs: 16-21.
  • the TCR can comprise an amino acid sequence of a variable region of a TCR comprising the CDRs set forth above.
  • the TCR can comprise the amino acid sequence of SEQ ID NO: 7 (the variable region of an ⁇ chain) or 8 (the variable region of a ⁇ chain), or both SEQ ID NOs: 7 and 8.
  • the inventive TCR comprises the amino acid sequences of SEQ ID NOs: 7 and 8.
  • the TCR can comprise an ⁇ chain of a TCR and a ⁇ chain of a TCR.
  • Each of the ⁇ chain and ⁇ chain of the inventive TCR can independently comprise any amino acid sequence.
  • the ⁇ chain comprises the variable region of an ⁇ chain as set forth above.
  • the inventive TCR can comprise the amino acid sequence of SEQ ID NO: 3.
  • An inventive TCR of this type can be paired with any ⁇ chain of a TCR.
  • the ⁇ chain of the inventive TCR comprises the variable region of a ⁇ chain as set forth above.
  • the inventive TCR can comprise the amino acid sequence of SEQ ID NO: 4.
  • the inventive TCR therefore, can comprise the amino acid sequence of SEQ ID NO: 3 or 4, or both SEQ ID NOs: 3 and 4.
  • the inventive TCR comprises the amino acid sequences of SEQ ID NOs: 3 and 4.
  • polypeptide as used herein includes oligopeptides and refers to a single chain of amino acids connected by one or more peptide bonds.
  • the functional portion can be any portion comprising contiguous amino acids of the TCR of which it is a part, provided that the functional portion specifically binds to the cancer antigen.
  • the term "functional portion" when used in reference to a TCR refers to any part or fragment of the TCR of the invention, which part or fragment retains the biological activity of the TCR of which it is a part (the parent TCR).
  • Functional portions encompass, for example, those parts of a TCR that retain the ability to specifically bind to the cancer antigen (e.g., in an MHC-independent manner), or detect, treat, or prevent cancer, to a similar extent, the same extent, or to a higher extent, as the parent TCR.
  • the functional portion can comprise, for instance, about 10%, 25%, 30%, 50%, 68%, 80%, 90%, 95%, or more, of the parent TCR.
  • the functional portion can comprise additional amino acids at the amino or carboxy terminus of the portion, or at both termini, which additional amino acids are not found in the amino acid sequence of the parent TCR.
  • the additional amino acids do not interfere with the biological function of the functional portion, e.g., specifically binding to a cancer antigen in an MHC-independent manner, having the ability to detect cancer, treat or prevent cancer, etc. More desirably, the additional amino acids enhance the biological activity, as compared to the biological activity of the parent TCR.
  • the polypeptide can comprise a functional portion of either or both of the ⁇ and ⁇ chains of the TCRs of the invention, such as a functional portion comprising one of more of CDRl, CDR2, and CDR3 of the variable region(s) of the ⁇ chain and/or ⁇ chain of a TCR of the invention.
  • the polypeptide can comprise a functional portion comprising the amino acid sequence of SEQ ID NO: 16 (CDRl of ⁇ chain), 17 (CDR2 of ⁇ chain), 18 (CDR3,of ⁇ chain), 19 (CDRl of ⁇ chain), 20 (CDR2 of ⁇ chain), 21 (CDR3 of ⁇ chain), or a combination thereof.
  • the inventive polypeptide comprises a functional portion comprising SEQ ID NOs: 16-18, 19-21, or all of SEQ ID NOs: 16-21. More preferably, the polypeptide comprises a functional portion comprising the amino acid sequences of SEQ ID NOs: 16-21.
  • the inventive polypeptide can comprise, for instance, the variable region of the inventive TCR comprising a combination of the CDR regions set forth above.
  • the TCR can comprise the amino acid sequence of SEQ ID NO: 7 (the variable region of an ⁇ chain) or 8 (the variable region of a ⁇ chain), or both SEQ ID NOs: 7 and 8.
  • the polypeptide comprises the amino acid sequence of SEQ ID NO: 8 or the amino acid sequences of SEQ ID NOs: 7 and 8.
  • the inventive polypeptide can comprise the entire length of an ⁇ or ⁇ chain of one of the TCRs described herein.
  • the inventive polypeptide can comprise an amino acid sequence of SEQ ID NO: 3 or 4.
  • the polypeptide of the invention can comprise both chains of the TCRs described herein.
  • the inventive polypeptide can comprise both amino acid sequences of SEQ ID NOs: 3 and 4.
  • the invention further provides an isolated or purified protein comprising at least one of the polypeptides described herein.
  • protein is meant a molecule comprising one or more polypeptide chains.
  • the protein of the invention can comprise a first polypeptide chain comprising the amino acid sequence of SEQ ID NO: 7 and a second polypeptide chain comprising the amino acid sequence of SEQ ID NO: 8.
  • the protein of the invention can, for example, comprise a first polypeptide chain comprising the amino acid sequence of SEQ ID NO: 3 and a second polypeptide chain comprising the amino acid sequence of SEQ ID NO: 4.
  • the protein of the invention can be a TCR.
  • the inventive protein can be a fusion protein.
  • the invention also provides a fusion protein comprising at least one of the inventive polypeptides described herein along with at least one other polypeptide.
  • the other polypeptide can exist as a separate polypeptide of -the fusion protein, or can exist as a polypeptide, which is expressed in frame (in tandem) with one of the inventive polypeptides described herein.
  • the other polypeptide can encode any peptidic or proteinaceous molecule, or a portion thereof, including, but not limited to an immunoglobulin, CD3, CD4, CD8, an MHC molecule, a CDl molecule, e.g., CDIa, CDIb, CDIc, CDId, etc.
  • the fusion protein can comprise one or more copies of the inventive polypeptide and/or one or more copies of the other polypeptide.
  • the fusion protein can comprise 1, 2, 3, 4, 5, or more, copies of the inventive polypeptide and/or of the other polypeptide.
  • Suitable methods of making fusion proteins are known in the art, and include, for example, recombinant methods. See, for instance, Choi et al., MoL B ⁇ otechnol. 31: 193- 202 (2005).
  • the protein of the invention can be a ' recombinant antibody comprising at least one of the inventive polypeptides described herein.
  • "recombinant antibody” refers to a recombinant (e.g., genetically engineered) protein comprising at least one of the polypeptides of the invention and a polypeptide chain of an antibody, or a portion thereof.
  • the polypeptide of an antibody, or portion thereof can be a heavy chain, a light chain, a variable or constant region of a heavy or light chain, a single chain variable fragment (scFv), or an Fc, Fab, or F(ab)2* fragment of an antibody, etc.
  • polypeptide chain of an antibody, or portion thereof can exist as a separate polypeptide of the recombinant antibody.
  • the polypeptide chain of an antibody, or portion thereof can exist as a polypeptide, which is expressed in frame (in tandem) with the polypeptide of the invention.
  • the polypeptide of an antibody, or portion thereof can be a polypeptide of any antibody or any antibody fragment, including any of the antibodies and antibody fragments described herein.
  • Functional variants encompass, for example, those variants of the TCR, polypeptide, or protein described herein (the parent TCR, polypeptide, or protein) that retain the ability to specifically bind to the cancer antigen for which the parent TCR has antigenic specificity or to which the parent polypeptide or protein specifically binds (e.g., in an MHC-independent manner), to a similar extent, the same extent, or to a higher extent, as the parent TCR, polypeptide, or protein.
  • the functional variant can, for instance, be at least about 30%, 50%, 75%, 80%, 90%, 98% or more identical in amino acid sequence to the parent TCR, polypeptide, or protein.
  • the functional variant can, for example, comprise the amino acid sequence of the parent TCR, polypeptide, or protein with at least one conservative amino acid substitution.
  • Conservative amino acid substitutions are known in the art, and include amino acid substitutions in which one amino acid having certain physical and/or chemical properties is exchanged for another amino acid that has the same chemical or physical properties.
  • the conservative amino acid substitution can be an acidic amino acid substituted for another acidic amino acid (e.g., Asp or GIu), an amino acid with a nonpolar side chain substituted for another amino acid with a nonpolar side chain (e.g., Ala, GIy, VaI, He, Leu, Met, Phe, Pro, Trp, VaI, etc.), a basic amino acid substituted for another basic amino acid (Lys, Arg, etc.), an amino acid with a polar side chain substituted for another amino acid with a polar side chain (Asn, Cys, GIn, Ser, Thr, Tyr, etc.), etc.
  • an amino acid with a polar side chain substituted for another amino acid with a polar side chain e.g., Asp or GIu
  • an amino acid with a nonpolar side chain substituted for another amino acid with a nonpolar side chain e.g., Ala, GIy, VaI, He, Leu, Met, Phe, Pro, Trp
  • the functional variants can comprise the amino acid sequence of the parent TCR, polypeptide, or protein with at least one non-conservative amino acid substitution.
  • the non-conservative amino acid substitution it is preferable for the non-conservative amino acid substitution to not interfere with or inhibit the biological activity of the functional variant.
  • the non-conservative amino acid substitution enhances the biological activity of the functional variant, such that the biological activity of the functional variant is increased as compared to the parent TCR, polypeptide, or protein.
  • the TCR, polypeptide, or protein can consist essentially of the specified amino acid sequence or sequences described herein, such that other components of the functional variant, e.g., other amino acids, do not materially change the biological activity of the functional variant.
  • the inventive TCR, polypeptide, or protein can, for example, consist essentially of the amino acid sequence of SEQ ID NO: 3 or 4, or both SEQ ID NOs: 3 and 4.
  • the inventive TCRs, polypeptides, or proteins can consist essentially of the amino acid sequence(s) of SEQ ID NO: 7 or 8, or both SEQ ID NOs: 7 and 8.
  • inventive TCRs, polypeptides, or proteins can consist essentially of the amino acid sequence of SEQ ID NO: 16 (CDRl of ⁇ chain), 17 (CDR2 of ⁇ chain), 18 (CDR3 of ⁇ chain), 19 (CDRl of ⁇ chain), 20 (CDR2 of ⁇ chain), 21 (CDR3 of ⁇ chain), or any combination thereof, e.g., SEQ ID NOs: 16-18, 19-21, or 16-21.
  • the TCRs, polypeptides, and proteins of the invention can be of any length, i.e., can comprise any number of amino acids, provided that the TCRs, polypeptides, or proteins (or functional portions or functional variants thereof) retain their biological activity, e.g., the ability to specifically bind to a cancer antigen in an MHC-independent manner, detect cancer in a host, or treat or prevent cancer in a host, etc.
  • the polypeptide can be 50 to 5000 amino acids long, such as 50, 70, 75, 100, 125, 150, 175, 200, 300, 400, 500, 600, 700, 800. 900, 1000 or more amino acids in length.
  • the polypeptides of the invention also include oligopeptides.
  • the TCRs, polypeptides, and proteins of the invention (including functional portions and functional variants) of the invention can comprise synthetic amino acids in place of one or more naturally-occurring amino acids.
  • synthetic amino acids include, for example, aminocyclohexane carboxylic acid, norleucine, ⁇ -amino n- decanoic acid, homoserine, S-acetylaminomethyl-cysteine, trans-3- and trans-4- hydroxyproline, 4-aminophenylalanine, 4- nitrophenylalanine, 4-chlorophenylalanine, 4- carboxyphenylalanine, ⁇ -phenylserine ⁇ -hydroxyphenyl alanine, phenylglycine, ⁇ - naphthylalanine, cyclohexylalanine, cyclohexylglycine, indoline-2-carboxylic acid, 1,2,3,4- tetrahydroisoquino
  • the TCRs, polypeptides, and proteins of the invention can be glycosylated, amidated, carboxylated, phosphorylated, esterified, N-acylated, cyclized via, e.g., a disulfide bridge, or converted into an acid addition salt and/or optionally dimerized or polymerized, or conjugated.
  • the TCRs, polypeptides, and proteins of the invention are in the form of a salt, preferably, the polypeptides are in the form of a pharmaceutically acceptable salt.
  • Suitable pharmaceutically acceptable acid addition salts include those derived from mineral acids, such as hydrochloric, hydrobromic, phosphoric, metaphosphoric, nitric, and sulphuric acids, and organic acids, such as tartaric, acetic, citric, malic, lactic, fumaric, benzoic, glycolic, gluconic, succinic, and arylsulphonic acids, for example, /?-toluenesulphonic acid.
  • mineral acids such as hydrochloric, hydrobromic, phosphoric, metaphosphoric, nitric, and sulphuric acids
  • organic acids such as tartaric, acetic, citric, malic, lactic, fumaric, benzoic, glycolic, gluconic, succinic, and arylsulphonic acids, for example, /?-toluenesulphonic acid.
  • TCR, polypeptide, and/or protein of the invention can be obtained by methods known in the art. Suitable methods of de novo synthesizing polypeptides and proteins are described in references, such as Chan et al., Fmoc Solid Phase Peptide Synthesis, Oxford University Press, Oxford, United Kingdom, 2005; Peptide and Protein Drug Analysis, ed. Reid, R., Marcel Dekker, Inc., 2000; Epitope Mapping, ed. Westwoood et al., Oxford University Press, Oxford, United Kingdom, 2000; and U.S. Patent No. 5,449,752.
  • polypeptides and proteins can be recombinantly produced using the nucleic acids described herein using standard recombinant methods. See, for instance, Sambrook et al., Molecular Cloning: A Laboratory Manual. 3 rd ed., Cold Spring Harbor Press, Cold Spring Harbor, NY 2001 ; and Ausubel et al., Current Protocols in Molecular Biology. Greene Publishing Associates and John Wiley & Sons, NY, 1994.
  • TCRs, polypeptides, and proteins of the invention can be isolated and/or purified from a source, such as a plant, a bacterium, an insect, a mammal, e.g., a rat, a human, etc. Methods of isolation and purification are well-known in the art.
  • a source such as a plant, a bacterium, an insect, a mammal, e.g., a rat, a human, etc. Methods of isolation and purification are well-known in the art.
  • the TCRs, polypeptides, and/or proteins described herein can be commercially synthesized by companies, such as Synpep (Dublin, CA), Peptide Technologies Corp. (Gaithersburg, MD), and Multiple Peptide Systems (San Diego, CA).
  • the inventive TCRs, polypeptides, and proteins can be synthetic, recombinant, isolated, and/or purified.
  • conjugates e.g., bioconjugates, comprising any of the inventive TCRs, polypeptides, or proteins (including any of the functional portions or variants thereof), nucleic acids, recombinant expression vectors, host cells, populations of host cells, or antibodies, or antigen binding portions thereof.
  • Conjugates, as well as methods of synthesizing conjugates in general, are known in the art (See, for instance, Hudecz, F., Methods MoI. Biol. 298: 209-223 (2005) and Kirin et al. 3 Inorg Chem. 44(15): 5405-5415 (2005)).
  • nucleic acid comprising a nucleotide sequence encoding any of the TCRs, polypeptides, or proteins described herein (including functional portions and functional variants thereof).
  • nucleic acid includes “polynucleotide,” “oligonucleotide,” and “nucleic acid molecule,” and generally means a polymer of DNA or RNA, which can be single-stranded or double-stranded, synthesized or obtained (e.g., isolated and/or purified) from natural sources, which can contain natural, non-natural or altered nucleotides, and which can contain a natural, non-natural or altered internucleotide linkage, such as a phosphoroamidate linkage or a phosphorothioate linkage, instead of the phosphodiester found between the nucleotides of an unmodified oligonucleotide.
  • the nucleic acid does not comprise any insertions, deletions, inversions, and/or substitutions. However, it may be suitable in some instances, as discussed herein, for the nucleic acid to comprise one or more insertions, deletions, inversions, and/or substitutions.
  • the nucleic acids of the invention are recombinant.
  • the term "recombinant" refers to (i) molecules that are constructed outside living cells by joining natural or synthetic nucleic acid segments to nucleic acid molecules that can replicate in a living cell, or (ii) molecules that result from the replication of those described in (i) above.
  • the replication can be in vitro replication or in vivo replication.
  • the nucleic acids can be constructed based on chemical synthesis and/or enzymatic ligation reactions using procedures known in the art. See, for example, Sambrook et al., supra, and Ausubel et al., supra.
  • a nucleic acid can be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed upon hybridization (e.g., phosphorothioate derivatives and acridine substituted nucleotides).
  • modified nucleotides that can be used to generate the nucleic acids include, but are not limited to, 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxymethyl) uracil, 5- carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N 6 -isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N 6 -substituted adenine, 7-methylguanine, 5-methylaminomethyluracil, 5- methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueo
  • the nucleic acid can comprise any nucleotide sequence which encodes any of the TCRs, polypeptides, or proteins, or functional portions or functional variants thereof.
  • the nucleic acid can comprise a nucleotide sequence comprising SEQ ID NO: 1, 2, 5, or 6, both SEQ ID NOs: 1 and 2, or both SEQ ID NOs: 5 and 6.
  • the nucleotide sequence alternatively can comprise a nucleotide sequence which is degenerate to SEQ ID NO: 1, 2, 5, or 6, or which comprises a nucleotide sequence comprising a nucleotide sequence degenerate to SEQ ID NO: 1 and a nucleotide sequence degenerate to SEQ ID NO: 2 or comprising a nucleotide sequence degenerate to SEQ ID NO: 5 and a nucleotide sequence degenerate to SEQ ID NO: 6.
  • the nucleic acid comprises a nucleotide sequence comprising SEQ ID NO: 1, 2, or 6, SEQ ID NOs: 1 and 2, or SEQ ID NOs: 5 and 6, or a nucleotide sequence which is degenerate thereto.
  • the invention also provides an isolated or purified nucleic acid comprising a nucleotide sequence which is complementary to the nucleotide sequence of any of the nucleic acids described herein or a nucleotide sequence which hybridizes under stringent conditions to the nucleotide sequence of any of the nucleic acids described herein.
  • the nucleotide sequence which hybridizes under stringent conditions preferably hybridizes under high stringency conditions.
  • high stringency conditions is meant that the nucleotide sequence specifically hybridizes to a target sequence (the nucleotide sequence of any of the nucleic acids described herein) in an amount that is detectably stronger than non-specific hybridization.
  • High stringency conditions include conditions which would distinguish a polynucleotide with an exact complementary sequence, or one containing only a few scattered mismatches from a random sequence that happened to have a few small regions (e.g., 3-10 bases) that matched the nucleotide sequence. Such small regions of complementarity are more easily melted than a full-length complement of 14-17 or more bases, and high stringency hybridization makes them easily distinguishable.
  • Relatively high stringency conditions would include, for example, low salt and/or high temperature conditions, such as provided by about 0.02-0.1 M NaCl or the equivalent, at temperatures of about 50-70 0 C.
  • nucleic acids of the invention can be incorporated into a recombinant expression vector.
  • the invention provides recombinant expression vectors comprising any of the nucleic acids of the invention.
  • the term "recombinant expression vector” means a genetically-modified oligonucleotide or polynucleotide construct that permits the expression of an mRNA, protein, polypeptide, or peptide by a host cell, when the construct comprises a nucleotide sequence encoding the mRNA, protein, polypeptide, or peptide, and the vector is contacted with the cell under conditions sufficient to have the mRNA, protein, polypeptide, or peptide expressed within the cell.
  • the vectors of the invention are not naturally-occurring as a whole. However, parts of the vectors can be naturally-occurring.
  • the inventive recombinant expression vectors can comprise any type of nucleotides, including, but not limited to DNA and RNA, which can be single-stranded or double-stranded, synthesized or obtained in part from natural sources, and which can contain natural, non-natural or altered nucleotides.
  • the recombinant expression vectors can comprise naturally-occurring, non-naturally-occuring internucleotide linkages, or both types of linkages.
  • the non-naturally occurring or altered nucleotides or internucleotide linkages does not hinder the transcription or replication of the vector.
  • the recombinant expression vector of the invention can be any suitable recombinant expression vector, and can be used to transform or transfect any suitable host.
  • Suitable vectors include those designed for propagation and expansion or for expression or both, such as plasmids and viruses.
  • the vector can be selected from the group consisting of the pUC series (Fermentas Life Sciences), the pBluescript series (Stratagene, LaJolla, CA), the pET series (Novagen, Madison, WI), the pGEX series (Pharmacia Biotech, Uppsala, Sweden), and the pEX series (Clontech, Palo Alto, CA).
  • Bacteriophage vectors such as ⁇ GTIO, ⁇ GTl 1, ⁇ ZapII (Stratagene), ⁇ EMBL4, and ⁇ NMl 149, also can be used.
  • the recombinant expression vector is a viral vector, e.g., a retroviral vector.
  • the recombinant expression vectors of the invention can be prepared using standard recombinant DNA techniques described in, for example, Sambrook et al., supra, and Ausubel et al., supra.
  • Constructs of expression vectors, which are circular or linear, can be prepared to contain a replication system functional in a prokaryotic or eukaryotic host cell.
  • Replication systems can be derived, e.g., from CoIEl, 2 ⁇ plasmid, ⁇ , S V40, bovine papilloma virus, and the like.
  • the recombinant expression vector comprises regulatory sequences, such as transcription and translation initiation and termination codons, which are specific to the type of host (e.g., bacterium, fungus, plant, or animal) into which the vector is to be introduced, as appropriate and taking into consideration whether the vector is DNA- or RNA- based.
  • regulatory sequences such as transcription and translation initiation and termination codons, which are specific to the type of host (e.g., bacterium, fungus, plant, or animal) into which the vector is to be introduced, as appropriate and taking into consideration whether the vector is DNA- or RNA- based.
  • the recombinant expression vector can include one or more marker genes, which allow for selection of transformed or transfected hosts.
  • Marker genes include biocide resistance, e.g., resistance to antibiotics, heavy metals, etc., complementation in an auxotrophic host to provide prototrophy, and the like.
  • Suitable marker genes for the inventive expression vectors include, for instance, neomycin/G418 resistance genes, hygromycin resistance genes, histidinol resistance genes, tetracycline resistance genes, and ampicillin resistance genes.
  • the recombinant expression vector can comprise a native or normative promoter operably linked to the nucleotide sequence encoding the TCR, polypeptide, or protein (including functional portions and functional variants thereof), or to the nucleotide sequence which is complementary to or which hybridizes to the nucleotide sequence encoding the TCR, polypeptide, or protein.
  • a native or normative promoter operably linked to the nucleotide sequence encoding the TCR, polypeptide, or protein (including functional portions and functional variants thereof), or to the nucleotide sequence which is complementary to or which hybridizes to the nucleotide sequence encoding the TCR, polypeptide, or protein.
  • promoters e.g., strong, weak, inducible, tissue-specific and developmental-specific, is within the ordinary skill of the artisan.
  • the combining of a nucleotide sequence with a promoter is also within the skill of the artisan.
  • the promoter can be a non- viral promoter or a viral promoter, e.g., a cytomegalovirus (CMV) promoter, an SV40 promoter, an RSV promoter, and a promoter found in the long-terminal repeat of the murine stem cell virus.
  • a viral promoter e.g., a cytomegalovirus (CMV) promoter, an SV40 promoter, an RSV promoter, and a promoter found in the long-terminal repeat of the murine stem cell virus.
  • CMV cytomegalovirus
  • the inventive recombinant expression vectors can be designed for either transient expression, for stable expression, or for both. Also, the recombinant expression vectors can be made for constitutive expression or for inducible expression. Further, the recombinant expression vectors can be made to include a suicide gene.
  • suicide gene refers to a gene that causes the cell expressing the suicide gene to die.
  • the suicide gene can be a gene that confers sensitivity to an agent, e.g., a drug, upon the cell in which the gene is expressed, and causes the cell to die when the cell is contacted with or exposed to the agent.
  • agent e.g., a drug
  • the invention further provides a host cell comprising any of the recombinant expression vectors described herein.
  • the term "host cell” refers to any type of cell that can contain the inventive recombinant expression vector.
  • the host cell can be a eukaryotic cell, e.g., plant, animal, fungi, or algae, or can be a prokaryotic cell, e.g., bacteria or protozoa.
  • the host cell can be a cultured cell or a primary cell, i.e., isolated directly from an organism, e.g., a human.
  • the host cell can be an adherent cell or a suspended cell, i.e., a cell that grows in suspension. Suitable host cells are known in the art and include, for instance, DH5 ⁇ E. coli cells, Chinese hamster ovarian cells, monkey VERO cells, COS cells, HEK293 cells, and the like.
  • the host cell is preferably a prokaryotic cell, e.g., a DH5 ⁇ cell.
  • the host cell is preferably a mammalian cell. Most preferably, the host cell is ( a human cell. While the host cell can be of any cell type, can originate from any type of tissue, and can be of any developmental stage, the host cell preferably is a peripheral blood lymphocyte (PBL). More preferably, the host cell is a T cell.
  • PBL peripheral blood lymphocyte
  • the T cell can be any T cell, such as a cultured T cell, e.g., a primary T cell, or a T cell from a cultured T cell line, e.g., Jurkat, SupTl, etc., or a T cell obtained from a mammal. If obtained from a mammal, the T cell can be obtained from numerous sources, including but not limited to blood, bone marrow, lymph node, the thymus, or other tissues or fluids. T cells can also be enriched for or purified.
  • the T cell is a human T cell. More preferably, the T cell is a T cell isolated from a human.
  • the T cell can be any type of T cell and can be of any developmental stage, including but not limited to, CD4 + /CD8 + double positive T cells, CD4 + helper T cells, e.g., Thi and Th 2 cells, CD8 + T cells (e.g., cytotoxic T cells), peripheral blood mononuclear cells (PBMCs), peripheral blood leukocytes (PBLs), tumor infiltrating cells (TILs), memory T cells, na ⁇ ve T cells, and the like.
  • the T cell is a CDS + T cell or a CD4 + T cell.
  • the population of cells can be a heterogeneous population comprising the host cell comprising any of the recombinant expression vectors described, in addition to at least one other cell, e.g., a host cell (e.g., a T cell), which does not comprise any of the recombinant expression vectors, or a cell other than a T cell, e.g., a B cell, a macrophage, a neutrophil, an erythrocyte, a hepatocyte, an endothelial cell, an epithelial cells, a muscle cell, a brain cell, etc.
  • a host cell e.g., a T cell
  • a cell other than a T cell e.g., a B cell, a macrophage, a neutrophil, an erythrocyte, a hepatocyte, an endothelial cell, an epithelial cells, a muscle cell, a brain cell, etc.
  • the population of cells can be a substantially homogeneous population, in which the population comprises mainly of host cells (e.g., consisting essentially of) comprising the recombinant expression vector.
  • the population also can be a clonal population of cells, in which all cells of the population are clones of a single host cell comprising a recombinant expression vector, such that all cells of the population comprise the recombinant expression vector.
  • the population of cells is a clonal population comprising host cells comprising a recombinant expression vector as described herein.
  • the invention further provides an antibody, or antigen binding portion thereof, which specifically binds to a functional portion of any of the TCRs described herein.
  • the functional portion specifically binds to the cancer antigen, e.g., the functional portion comprising the amino acid sequence SEQ ID NO: 16 (CDRl of ⁇ chain), 17 (CDR2 of ⁇ chain), 18 (CDR3 of ⁇ chain), 19 (CDRl of ⁇ chain), 20 (CDR2 of ⁇ chain), 21 (CDR3 of ⁇ chain), SEQ ID NO: 7, SEQ ID NO: 8, or a combination thereof, e.g., 16-18, 19-21, and 16-21.
  • the functional portion comprises the amino acid sequences of SEQ ID NOs: 16-21.
  • the antibody, or antigen binding portion thereof binds to an epitopewhich is formed by all 6 CDRs (CDRl -3 of the alpha chain and CDRl -3 of the beta chain).
  • the antibody can be any type of immunoglobulin that is known in the art.
  • the antibody can be of any isotype, e.g., IgA, IgD, IgE, IgG, IgM, etc.
  • the antibody can be monoclonal or polyclonal.
  • the antibody can be a naturally-occurring antibody, e.g., an antibody isolated and/or purified from a mammal, e.g., mouse, rabbit, goat, horse, chicken, hamster, human, etc.
  • the antibody can be a genetically-engineered antibody, e.g., a humanized antibody or a chimeric antibody.
  • the antibody can be in monomelic or polymeric form.
  • the antibody can have any level of affinity or avidity for the functional portion of the inventive TCR.
  • the antibody is specific for the functional portion of the inventive TCR, such that there is minimal cross-reaction with other peptides or proteins.
  • Methods of testing antibodies for the ability to bind to any functional portion of the inventive TCR include any antibody-antigen binding assay, such as, for example, radioimmunoassay (RIA), ELISA, Western blot, immunoprecipitation, and competitive inhibition assays (see, e.g., Janeway et al., infra, and U.S. Patent Application Publication No. 2002/0197266 Al).
  • RIA radioimmunoassay
  • ELISA ELISA
  • Western blot Western blot
  • immunoprecipitation immunoprecipitation
  • competitive inhibition assays see, e.g., Janeway et al., infra, and U.S. Patent Application Publication No. 2002/0197266 Al.
  • Suitable methods of making antibodies are known in the art. For instance, standard hybridoma methods are described in, e.g., K ⁇ hler and Milstein, Eur. J. Immunol., 5, 511-519 (1976), Harlow and Lane (eds.), Antibodies: A Laboratory Manual, CSH Press (1988), and CA. Janeway et al. (eds.), Immunobiology, 5 th Ed., Garland Publishing, New York, NY (2001)). Alternatively, other methods, such as EBV-hybridoma methods (Haskard and Archer, J. Immunol.
  • Phage display furthermore can be used to generate the antibody of the invention.
  • phage libraries encoding antigen-binding variable (V) domains of antibodies can be generated using standard molecular biology and recombinant DNA techniques (see, e.g., Sambrook et al. (eds.), Molecular Cloning, A Laboratory Manual, 3 rd Edition, Cold Spring Harbor Laboratory Press, New York (2001)). Phage encoding a variable region with the desired specificity are selected for specific binding to the desired antigen, and a complete or partial antibody is reconstituted comprising the selected variable domain.
  • Nucleic acid sequences encoding the reconstituted antibody are introduced into a suitable cell line, such as a myeloma cell used for hybridoma production, such that antibodies having the characteristics of monoclonal antibodies are secreted by the cell (see, e.g., Janeway et al., supra, Huse et al., supra, and U.S. Patent 6,265,150).
  • a suitable cell line such as a myeloma cell used for hybridoma production, such that antibodies having the characteristics of monoclonal antibodies are secreted by the cell (see, e.g., Janeway et al., supra, Huse et al., supra, and U.S. Patent 6,265,150).
  • Antibodies can be produced by transgenic mice that are transgenic for specific heavy and light chain immunoglobulin genes. Such methods are known in the art and described in, for example U.S. Patents 5,545,806 and 5,569,825, and Janeway et al., supra. [0077] Methods for generating humanized antibodies are well known in the art and are described in detail in, for example, Janeway et al., supra, U.S. Patents 5,225,539, 5,585,089 and 5,693,761, European Patent No. 0239400 Bl, and United Kingdom Patent No. 2188638. Humanized antibodies can also be generated using the antibody resurfacing technology described in U.S.
  • the invention also provides antigen binding portions of any of the antibodies described herein.
  • the antigen binding portion can be any portion that has at least one antigen binding site, such as Fab, F(ab') 2 , dsFv, sFv, diabodies, and triabodies.
  • a single-chain variable region fragment (sFv) antibody fragment which consists of a truncated Fab fragment comprising the variable (V) domain of an antibody heavy chain linked to a V domain of a light antibody chain via a synthetic peptide, can be generated using routine recombinant DNA technology techniques (see, e.g., Janeway et al., supra).
  • disulfide-stabilized variable region fragments (dsFv) can be prepared by recombinant DNA technology (see, e.g., Reiter et al., Protein Engineering, 7, 697-704 (1994)).
  • Antibody fragments of the invention are not limited to these exemplary types of antibody fragments.
  • the antibody, or antigen binding portion thereof can be modified to comprise a detectable label, such as, for instance, a radioisotope, a fluorophore (e.g., fluorescein isothiocyanate (FITC), phycoerythrin (PE)), an enzyme (e.g., alkaline phosphatase, horseradish peroxidase), and element particles (e.g., gold particles).
  • FITC fluorescein isothiocyanate
  • PE phycoerythrin
  • an enzyme e.g., alkaline phosphatase, horseradish peroxidase
  • element particles e.g., gold particles.
  • inventive TCRs, polypeptides, proteins, (including functional portions and functional variants thereof), nucleic acids, recombinant expression vectors, host cells (including populations thereof), and antibodies (including antigen binding portions thereof) can be isolated and/or purified.
  • isolated means having been removed from its natural environment.
  • purified means having been increased in purity, wherein “purity” is a relative term, and not to be necessarily construed as absolute purity.
  • the purity can be at least about 50%, can be greater than 60%, 70% or 80%, or can be 100%.
  • inventive TCRs, polypeptides, proteins (including functional portions and variants thereof), nucleic acids, recombinant expression vectors, host cells (including populations thereof), and antibodies (including antigen binding portions thereof), all of which are collectively referred to as "inventive TCR materials" hereinafter, can be formulated into a composition, such as a pharmaceutical composition.
  • the invention provides a pharmaceutical composition comprising any of the TCRs, polypeptides, proteins, functional portions, functional variants, nucleic acids, expression vectors, host cells (including populations thereof), and antibodies (including antigen binding portions thereof), and a pharmaceutically acceptable carrier.
  • inventive pharmaceutical compositions containing any of the inventive TCR materials can comprise more than one inventive TCR material, e.g., a polypeptide and a nucleic acid, or two or more different TCRs.
  • the pharmaceutical composition can comprise an inventive TCR material in combination with another pharmaceutically active agents or drugs, such as a chemotherapeutic agents, e.g., asparaginase, busulfan, carboplatin, cisplatin, daunorubicin, doxorubicin, fluorouracil, gemcitabine, hydroxyurea, methotrexate, paclitaxel, rituximab, vinblastine, vincristine, etc.
  • the carrier is a pharmaceutically acceptable carrier.
  • the carrier can be any of those conventionally used and is limited only by chemico-physical considerations, such as solubility and lack of reactivity with the active compound(s), and by the route of administration.
  • the pharmaceutically acceptable carriers described herein, for example, vehicles, adjuvants, excipients, and diluents, are well-known to those skilled in the art and are readily available to the public. It is preferred that the pharmaceutically acceptable carrier be one which is chemically inert to the active agent(s) and one which has no detrimental side effects or toxicity under the conditions of use.
  • compositions of the invention are exemplary and are in no way limiting. More than one route can be used to administer the inventive TCR materials, and in certain instances, a particular route can provide a more immediate and more effective response than another route.
  • Topical formulations are well-known to those of skill in the art. Such formulations are particularly suitable in the context of the invention for application to the skin.
  • Formulations suitable for oral administration can consist of (a) liquid solutions, such as an effective amount of the inventive TCR material dissolved in diluents, such as water, saline, or orange juice; (b) capsules, sachets, tablets, lozenges, and troches, each containing a predetermined amount of the active ingredient, as solids or granules; (c) powders; (d) suspensions in an appropriate liquid; and (e) suitable emulsions.
  • Liquid formulations may include diluents, such as water and alcohols, for example, ethanol, benzyl alcohol, and the polyethylene alcohols, either with or without the addition of a pharmaceutically acceptable surfactant.
  • Capsule forms can be of the ordinary hard- or soft-shelled gelatin type containing, for example, surfactants, lubricants, and inert fillers, such as lactose, sucrose, calcium phosphate, and corn starch.
  • Tablet forms can include one or more of lactose, sucrose, mannitol, corn starch, potato starch, alginic acid, microcrystalline cellulose, acacia, gelatin, guar gum, colloidal silicon dioxide, croscarmellose sodium, talc, magnesium stearate, calcium stearate, zinc stearate, stearic acid, and other excipients, colorants, diluents, buffering agents, disintegrating agents, moistening agents, preservatives, flavoring agents, and other pharmacologically compatible excipients.
  • Lozenge forms can comprise the inventive TCR material in a flavor, usually sucrose and acacia or tragacanth, as well as pastilles comprising the inventive TCR material in an inert base, such as gelatin and glycerin, or sucrose and acacia, emulsions, gels, and the like containing, in addition to, such excipients as are known in the art.
  • an inert base such as gelatin and glycerin, or sucrose and acacia, emulsions, gels, and the like containing, in addition to, such excipients as are known in the art.
  • the inventive TCR material can be made into aerosol formulations to be administered via inhalation.
  • aerosol formulations can be placed into pressurized acceptable propellants, such as dichlorodifluoromethane, propane, nitrogen, and the like. They also may be formulated as pharmaceuticals for non-pressured preparations, such as in a nebulizer or an atomizer. Such spray formulations also may be used to spray mucosa.
  • Formulations suitable for parenteral administration include aqueous and non-aqueous, isotonic sterile injection solutions, which can contain anti-oxidants, buffers, bacteriostats, and solutes that render the formulation isotonic with the blood of the intended recipient, and aqueous and non-aqueous sterile suspensions that can include suspending agents, solubilizers, thickening agents, stabilizers, and preservatives.
  • the inventive TCR material can be administered in a physiologically acceptable diluent in a pharmaceutical carrier, such as a sterile liquid or mixture of liquids, including water, saline, aqueous dextrose and related sugar solutions, an alcohol, such as ethanol or hexadecyl alcohol, a glycol, such as propylene glycol or polyethylene glycol, dimethylsulfoxide, glycerol, ketals such as 2,2- dimethyl-l,3-dioxolane-4-methanol, ethers, poly(ethyleneglycol) 400, oils, fatty acids, fatty acid esters or glycerides, or acetylated fatty acid glycerides with or without the addition of a pharmaceutically acceptable surfactant, such as a soap or a detergent, suspending agent, such as ⁇ ectin, carbomers, methylcellulose, hydroxypropylmethyl cellulose, or carboxymethylcellulose, or emulsifying agents and other pharmaceutical adjuvants
  • Oils which can be used in parenteral formulations include petroleum, animal, vegetable, or synthetic oils. Specific examples of oils include peanut, soybean, sesame, cottonseed, corn, olive, petrolatum, and mineral. Suitable fatty acids for use in parenteral formulations include oleic acid, stearic acid, and isostearic acid. Ethyl oleate and isopropyl myristate are examples of suitable fatty acid esters.
  • Suitable soaps for use in parenteral formulations include fatty alkali metal, ammonium, and triethanolamine salts
  • suitable detergents include (a) cationic detergents such as, for example, dimethyl dialkyl ammonium halides, and alkyl pyridinium halides, (b) anionic detergents such as, for example, alkyl, aryl, and olefin sulfonates, alkyl, olefin, ether, and monoglyceride sulfates, and sulfosuccinates, (c) nonionic detergents such as, for example, fatty amine oxides, fatty acid alkanolamides, and polyoxyethylenepolypropylene copolymers, (d) amphoteric detergents such as, for example, alkyl- ⁇ -aminopropionates, and 2-alkyl-imidazoline quaternary ammonium salts, and (e) mixtures thereof.
  • the parenteral formulations will typically contain from about 0.5% to about 25% by weight of the inventive TCR material in solution. Preservatives and buffers may be used. In order to minimize or eliminate irritation at the site of injection, such compositions may contain one or more nonionic surfactants having a hydrophile-lipophile balance (HLB) of from about 12 to about 17. The quantity of surfactant in such formulations will typically range from about 5% to about 15% by weight. Suitable surfactants include polyethylene glycol sorbitan fatty acid esters, such as sorbitan monooleate and the high molecular weight adducts of ethylene oxide with a hydrophobic base, formed by the condensation of propylene oxide with propylene glycol.
  • HLB hydrophile-lipophile balance
  • parenteral formulations can be presented in unit-dose or multi-dose sealed containers, such as ampoules and vials, and can be stored in a freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid excipient, for example, water, for injections, immediately prior to use.
  • sterile liquid excipient for example, water
  • Extemporaneous injection solutions and suspensions can be prepared from sterile powders, granules, and tablets of the kind previously described.
  • injectable formulations are in accordance with the invention.
  • the requirements for effective pharmaceutical carriers for injectable compositions are well-known to those of ordinary skill in the art (see, e.g., Pharmaceutics and Pharmacy Practice, J.B. Lippincott Company, Philadelphia, PA 5 Banker and Chalmers, eds., pages 238-250 (1982), and ASHP Handbook on Injectable Drugs, Toissel, 4th ed., pages 622-630 (1986)).
  • administering cells e.g., dendritic cells
  • the cells are administered via injection.
  • inventive TCR materials can be made into suppositories by mixing with a variety of bases, such as emulsifying bases or water-soluble bases.
  • bases such as emulsifying bases or water-soluble bases.
  • Formulations suitable for vaginal administration can be presented as pessaries, tampons, creams, gels, pastes, foams, or spray formulas containing, in addition to the active ingredient, such carriers as are known in the art to be appropriate.
  • inventive TCR materials of the invention can be formulated as inclusion complexes, such as cyclodextrin inclusion complexes, or liposomes.
  • the amount or dose of the inventive TCR material administered should be sufficient to effect, e.g., a therapeutic or prophylactic response, in the subject or animal over a reasonable time frame.
  • the dose of the inventive TCR material should be sufficient to bind to a cancer antigen, or detect, treat or prevent cancer in a period of from about 2 hours or longer, e.g., 12 to 24 or more hours, from the time of administration, hi certain embodiments, the time period could be even longer.
  • the dose will be determined by the efficacy of the particular inventive TCR material and the condition of the animal (e.g., human), as well as the body weight of the animal (e.g., human) to be treated. [0096] Many assays for determining an administered dose are known in the art.
  • an assay which comprises comparing the extent to which target cells are lysed or IFN- ⁇ is secreted by T cells expressing the inventive TCR, polypeptide, or protein upon administration of a given dose of such T cells to a mammal among a set of mammals of which is each given a ' different dose of the T cells, could be used to determine a starting dose to be administered to a mammal.
  • the extent to which target cells are lysed or IFN- ⁇ is secreted upon administration of a certain dose can be assayed by methods known in the art, including, for instance, the methods described herein as Example 1.
  • the dose of the inventive TCR material also will be determined by the existence, nature and extent of any adverse side effects that might accompany the administration of a particular inventive TCR material. Typically, the attending physician will decide the dosage of the inventive TCR material with which to treat each individual patient, taking into consideration a variety of factors, such as age, body weight, general health, diet, sex, inventive TCR material to be administered, route of administration, and the severity of the condition being treated.
  • the dose ofrthe inventive TCR material can be about 0.001 to about 1000 mg/kg body weight of the subject being treated/day, from about 0.01 to about 10 mg/kg body weight/day, about 0.01 mg to about 1 mg/kg body weight/day.
  • inventive TCR materials of the invention can he modified in any number of ways, such that the therapeutic or prophylactic efficacy of the inventive TCR materials is increased through the modification.
  • inventive TCR materials can be conjugated either directly or indirectly through a linker to a targeting moiety.
  • the practice of conjugating compounds, e.g., inventive TCR materials, to targeting moieties is known in the art. See, for instance, Wadwa et al., J. Drug Targeting 3: 111 (1995) and U.S. Patent No. 5,087,616.
  • targeting moiety refers to any molecule or agent that specifically recognizes and binds to a cell-surface receptor, such that the targeting moiety directs the delivery of the inventive TCR materials to a population of cells on which surface the receptor is expressed.
  • Targeting moieties include, but are not limited to, antibodies, or fragments thereof, peptides, hormones, growth factors, cytokines, and any other natural or non-natural ligands, which bind to cell surface receptors (e.g., Epithelial Growth Factor Receptor (EGFR), T-cell receptor (TCR), B- cell receptor (BCR), CD28, Platelet-derived Growth Factor Receptor (PDGF), nicotinic acetylcholine receptor (nAChR), etc.).
  • EGFR Epithelial Growth Factor Receptor
  • TCR T-cell receptor
  • BCR B- cell receptor
  • CD28 CD28
  • PDGF Platelet-derived Growth Factor Receptor
  • nAChR nicotinic acetylcholine receptor
  • sites on the inventive TCR materials which are not necessary for the function of the inventive TCR materials, are ideal sites for attaching a linker and/or a targeting moiety, provided that the linker and/or targeting moiety, once attached to the inventive TCR materials, do(es) not interfere with the function of the inventive TCR materials, i.e., the ability to bind to a cancer antigen, or to detect, treat, or prevent cancer.
  • inventive TCR materials can be modified into a depot form, such that the manner in which the inventive TCR materials is released into the body to which it is administered is controlled with respect to time and location within the body (see, for example, U.S. Patent No. 4,450,150).
  • Depot forms of inventive TCR materials can be, for example, an implantable composition comprising the inventive TCR materials and a porous or non-porous material, such as a polymer, wherein the inventive TCR materials is encapsulated by or diffused throughout the material and/or degradation of the non-porous material.
  • the depot is then implanted into the desired location within the body and the inventive TCR materials are released from the implant at a predetermined rate.
  • inventive pharmaceutical compositions, TCRs, polypeptides, proteins, nucleic acids, recombinant expression vectors, host cells, or populations of cells can be used in methods of treating or preventing cancer.
  • inventive TCRs are believed to bind specifically to a cancer antigen, e.g., a renal cell carcinoma antigen, such that the TCR (or related inventive polypeptide or protein) when expressed by a cell is able to mediate an immune response against the cell expressing the cancer antigen.
  • the invention provides a method of treating or preventing cancer in a host, comprising administering to the host any of the TCRs, polypeptides, or proteins described herein, any nucleic acid or recombinant expression vector comprising a nucleotide sequence encoding any of the TCRs, polypeptides, proteins described herein, or any host cell or population of cells comprising a recombinant vector which encodes any of the TCRs, polypeptides, or proteins described herein, in an amount effective to treat or prevent cancer in the host.
  • inventive methods can provide any amount of any level of treatment or prevention of cancer in a mammal.
  • the treatment or prevention provided by the inventive method can include treatment or prevention of one or more conditions or symptoms of the disease, e.g., cancer, being treated or prevented.
  • prevention can encompass delaying the onset of the disease, or a symptom or condition thereof.
  • a method of detecting the presence of cancer in a host comprises (i) contacting a sample comprising cells of the cancer any of the inventive TCRs, polypeptides, proteins, nucleic acids, recombinant expression vectors, host cells, populations of cells, or antibodies, or antigen binding portions thereof, described herein, thereby forming a complex, and detecting the complex, wherein detection of the complex is indicative of the presence of cancer in the host.
  • the sample of cells of the cancer can be a sample comprising whole cells, lysates thereof, or a fraction of the whole cell lysates, e.g., a nuclear or cytoplasmic fraction, a whole protein fraction, or a nucleic acid fraction.
  • the contacting step can take place in vitro or in vivo with respect to the host.
  • the contacting is in vitro.
  • detection of the complex can occur through any number of ways known in the art.
  • the inventive TCRs, polypeptides, proteins, nucleic acids, recombinant expression vectors, host cells, populations of cells, or antibodies, or antigen binding portions thereof, described herein can be labeled with a detectable label such as, for instance, a radioisotope, a fluorophore (e.g., fluorescein isothiocyanate (FITC), phycoerythrin (PE)), an enzyme (e.g., alkaline phosphatase, horseradish peroxidase), and element particles (e.g., gold particles).
  • a detectable label such as, for instance, a radioisotope, a fluorophore (e.g., fluorescein isothiocyanate (FITC), phycoerythrin (PE)), an enzyme (e.g., alkaline phosphatase, horseradish peroxidase), and element particles (e.g., gold particles).
  • a detectable label such as
  • the cancer can be any cancer, including any of acute lymphocytic cancer, acute myeloid leukemia, alveolar rhabdomyosarcoma, bone cancer, brain cancer, breast cancer, cancer of the anus, anal canal, or anorectum, cancer of the eye, cancer of the intrahepatic bile duct, cancer of the joints, cancer of the neck, gallbladder, or pleura, cancer of the nose, nasal cavity, or middle ear, cancer of the oral cavity, cancer of the vulva, chronic lymphocytic leukemia, chronic myeloid cancer, colon cancer, esophageal cancer, cervical cancer, gastrointestinal carcinoid tumor.
  • the cancer is kidney cancer. More preferably, the cancer is RCC.
  • the host referred to in the inventive methods can be any host.
  • the host is a mammal.
  • the term "mammal” refers to any mammal, including, but not limited to, mammals of the order Rodentia, such as mice and hamsters, and mammals of the order Logomorpha, such as rabbits. It is preferred that the mammals are from the order Carnivora, including Felines (cats) and Canines (dogs). It is more preferred that the mammals are from the order Artiodactyla. including Bovines (cows) and Swines (pigs) or of the order Perssodactyla, including Equines (horses). It is most preferred that the mammals are of the order Primates, Ceboids, or Simoids (monkeys) or of the order Anthropoids (humans and apes). An especially preferred mammal is the human.
  • RCC renal cell carcinoma
  • EBV-Bs Epstein-Barr virus- transformed B cells
  • Tumor lines which were used as controls in the experiments, were obtained from the laboratories of the Surgery Branch of the National Cancer Institute (Bethesda, MD, USA), and maintained in RPMI 1640 supplemented with 10% FBS.
  • Human primary renal epithelial cells were either purchased from Cambrex Bioscience (Walkersville, MD, USA) or gifts from Dr. Scbtt Garrett (University of North Dakota, Grand Forks, ND, USA).
  • MoAbs monoclonal antibodies
  • FITC fluorescein isothiocyanate
  • PE phycoerytherin
  • PE phycoerytherin
  • PE-labeled anti-human IgG isotypes anti-CD3, anti-CD4, anti-CD8, anti-TCR ⁇ / ⁇ , anti-CD56, and anti-CD161 were purchased from BD Pharmingen (San Jose, CA, USA).
  • PE-labeled anti-V ⁇ 2 antibodies were purchased from Beckman Coulter (Miami, FL, USA).
  • This example demonstrates a method of making a T cell clone having antigenic specificity for a renal cell carcinoma antigen and demonstrates the biological activity of that clone.
  • CD8 + - and/or CD4 + -enriched T cells were stimulated with Day 6 dendritic cells (DCs) co-cultured with UV-irradiated autologous tumor cells, as described previously with some modifications (Wang et al., 2005, supra).
  • DCs dendritic cells
  • CD14 + DCs were isolated from patient peripheral blood mononuclear cells (PBMC) using CD 14 microbeads according to the manufacturer's instructions (Miltenyi Biotec Inc. Auburn, CA), and cultured in RPMI 1640 supplemented with 10% human serum (HS; Valley Biomedical Inc.
  • Day 6 DCs monocyte-derived DCs
  • UV-irradiated tumor cells UVB; 312mm; Spectroline, Westbury, NY
  • RPMI 1640 UV-irradiated tumor cells
  • IFN- ⁇ 1000 U/ml each
  • Pierce Biotechnology, Inc. Rockford, IL, USA overnight in 96- well round-bottom plates.
  • CD8 + -enriched T cells (Miltenyi CD8 + Cell Isolation Kit II) and CD4 + - enriched, CD25-depleted T cells (Miltenyi CD4 + Cell Isolation Kit II and CD25 microbeads) were isolated and added to DC- tumor co-culture in RPMI supplemented with 10% HS. IL-2 (120 IU/ml), and CD40L (500 ng/ml; Immunex, Seattle, WA, USA).
  • T cells were re-stimulated once by transferring them to a second identically prepared DC-tumor culture. Testing the T cells for IFN- ⁇ production upon co-culturing with autologous EBV-B or RCC cells occurred 7 days after restimulation. Microwells, which had an IFN- ⁇ concentration of at least 100 pg/ml when co-cultured with autologous renal tumor (RCC #1) cells and twice that when co- cultured with with with autologous EBV-B cells (EBV-B #1), were deemed as positive. T cell clones were derived from the cultures of these positive microwells by limiting dilution, and expanded, when the clones were positive for IFN- ⁇ secretion upon co-culturing with autologous EBV tumor cells.
  • RCC #1 autologous renal tumor
  • EBV-B #1 autologous EBV-B #1
  • T cells from Microwell HC/2G that met the criteria of having an IFN- ⁇ concentration of at least 100 pg/ml and twice that of a co-culture with EBV- B cells.
  • T cell clone HC/2G-1 was derived from Microwell HC/2G by plating 1 cell per well in a limiting dilution assay.
  • HC/2G-1 (1 x 10 4 cells/well) was co-cultured with a panel of HLA-mismatched renal tumors, EBV-Bs, melanoma tumors, other tumor lines, normal human epithelial lines and fibroblasts overnight and tested for IFN- ⁇ secretion by ELISA.
  • Figure IB T cell clone HC/2G-1 secreted IFN- ⁇ when stimulated with multiple HLA mismatched renal tumors.
  • a standard 4-hour 51 Cr-release assay was performed to test the cytotoxicity of T cells against tumors. Briefly, target cells were labeled for 1 h at 37°C with 51 Cr (200 ⁇ Ci; AmershamBiosciences; Piscataway, NJ). Labeled target cells were then washed three times and plated in triplicate at a concentration of 1 x 10 4 per well in 96- well round-bottom plates. Effector cells (HC/2G-1 T cell clones) were prepared and added to target cells at various E:T ratios. After a 4-hour incubation, the supernatant was harvested and counted on a Wallac 1470 Wizard automatic gamma counter.
  • T cell clone HC/2G-1 lysed multiple HLA mismatched renal tumors. Specifically, RCC #1, 2, and 5-10 cells were lysed by the T cell clones. [0119] .
  • This example demonstrated a method of making a T cell clone specific for a renal cell carcinoma antigen. This example further demonstrated that the T cell clone HC/2G-1 recognized a majority of renal tumors.
  • HC/2G-1 T cell clones were stained with the FITC- and PE-labeled anti-human MoAbs described above, and analyzed by FACScan. As shown in Figures 2A and 3A, the T cell clones were positive for expression of TCR ⁇ and ⁇ chains, CD3, CD4, and CD56 and negative for expression of CD 16, CD57, CD 161, and TCR ⁇ and ⁇ chains.
  • HC/2G-1 T cell clones (1 x 10 4 per well) were co-cultured with autologous tumor cells (RCC#1 and EBV-B#1) or allogeneic tumor cells (RCC#11 and EBV-B #11) overnight, and the supernatant was collected and tested for cytokine secretion by SearchLightTM (Pierce Biotechnology, Inc., Rockford, IL).
  • SearchLightTM Pier Biotechnology, Inc., Rockford, IL
  • HC/2G-1, EBV-Bs and RCCs cultured alone were also included in the assay.
  • HC/2G-1 T cell clones secreted multiple cytokines upon stimulation with autologous RCC cells.
  • HC/2G-1, EBV-Bs and RCCs cultured alone showed no or very little cytokine secretion (data not shown).
  • HLA-B44-restricted CTL clone (MW/5H-5) and HLA-class II-restricted CD4 + T cell clone (HC/lOC-3) were co-cultured with their autologous tumors. The supernatants were harvested and assayed for IFN- ⁇ concentration by ELISA.
  • the reactivity of HC/2G-1 T cell clones was blocked by anti-TCR antibodies, not blocked by anti-HLA Class II antibodies, and partially blocked by anti-HLA Class I antibodies.
  • the anti-HLA Class I antibodies blocked the activity of MW/5H-5 cells, and the anti-HLA Class II antibodies effectively blocked the activity of HC/lOC-3 cells, as expected.
  • This example demonstrates a method of producing allogeneic cells expressing the TCR of HC/2G-1 T cell clones and the biological activity thereof.
  • Total RNA from T cell clone HC/2G-1 was purified from T cells using an RNeasy Mini Kit (Qiagen, Valencia, CA, USA).
  • Primers having a nucleotide sequence complementary to the V end of the coding sequences of TGR ⁇ and ⁇ chains were synthesized (Operon Technologies, Huntsville, AL) to make full-length cDNAs.
  • the primers sequences were as follows: Ca (TCAGCTGGACCACAGCCGCAGC; SEQ ID NO: 9), C ⁇ l (TCAGAAATCCTTTCTCTTGACCATG; SEQ ID NO: 10) and C ⁇ 2
  • RACE reaction was performed by using a SMARTTM RACE cDNA Amplification Kit (Clontech, Mountain View, CA) following the manufacturer's protocol.
  • the RACE cDNAs ( ⁇ lkb) were obtained with Ca and C ⁇ 1 primers and then ligated into a pCR2.1 vector with a TA Cloning® Kit (Invitrogen Life Technologies).
  • SEQ ID NOs: 1-4 The sequences of HC/2G-1 TCR ⁇ and ⁇ chains are found herein as SEQ ID NOs: 1-4, wherein SEQ ID NO: 1 is the nucleotide sequence for TCR ⁇ , SEQ ID NO: 2 is the nucleotide sequence for TCR ⁇ , SEQ ID NO: 3 is the amino acid sequence for TGR a, and SEQ ID NO: 4 is the amino acid sequence for TCR ⁇ .
  • PBMC from allogeneic donors were stimulated with 50 ng/ml OKT3 for 3 days, washed, and resuspended in OPTI-MEM (Invitrogen Life Technologies) at 2.5 x 10 7 /ml.
  • PBMC 50-200 ⁇ l
  • mRNA mRNA
  • Electroporation was performed at 400V per 500 ⁇ s using an ECM830 Electro Square Wave Porator (Harvard Apparatus BTX).
  • the cells were transferred to fresh RPMI supplemented with 10% HS and 300 IU/ml IL-2, and incubated at 37°C.
  • Electroporated cells were analyzed for the expression of V ⁇ 2 by flow cytometry. As shown in Figure 4A, the electroporated cells expressed V ⁇ 2, meaning that the cells expressed the HC/2G-1 TCR ⁇ and ⁇ mRNAs.
  • the activity of the electroporated cells was then analyzed by assaying IFN- ⁇ secretion upon stimulation with renal tumors. Specifically, OKT-3 stimulated T cells electroporated with mRNAs of either the HC/2G-1 TCR ⁇ chain, HC/2G-1 TCR ⁇ chain, or both (2 ⁇ g each) were co-cultured with renal tumors overnight and tested for IFN- ⁇ secretion. RCC#11 was used as a negative control. As shown in Figure 4B, both TCR chains were required for TCR recognition of tumor cells.
  • T cells (1 x 10 5 ) electroporated with mRNAs (1-4 ⁇ g/10 6 cells) were co-cultured with renal tumors, as well as control cells overnight, and the supernatants were harvested and tested for IFN- ⁇ secretion.
  • HC/2G-1 T cell clones were included in the same assay as a positive control.
  • allogeneic T cells electroporated with HC/2G-1 TCR mRNAs recognize a variety of renal tumors.
  • OKT-3 stimulated allogeneic PBMC, CD8 + -enriched, and CD4 + -enriched cells were electroporated with HC/2G-1 TCR mRNAs (2 ⁇ g/ml) and co-cultured with renal tumors overnight. The supernatants were harvested and tested for IFN- ⁇ secretion. RCC#11, 293 Tc, and 624 Tc served as negative controls in the assay. The V ⁇ 2 expression of OKT-3 stimulated PBL, CD8 + -enriched, and CD4 + -enriched cells were also assayed and compared to the expression of CD3, CD8, and CD4, respectively.
  • This example demonstrates a method of producing allogeneic PBMCs retro virally transduced with nucleic acids encoding the TCR of HC/2G-1 T cell clones and the activity of the transduced cells.
  • HC/2G-1 TCR ⁇ and ⁇ chains were ligated into a pMSGVl plasmid, which is a derivative of the murine stem cell virus-based splice-gag vector (pMSGV), as described in previous publications with some modifications (Cohen et al., 2005, supra).
  • TCR ⁇ and ⁇ chain cDNAs were amplified by PCR using the following pairs of oligonucleotide primers to introduce appropriate restriction enzyme sites for subcloning: TCR ⁇ forward 5'- TCTAGCCATGGCACTTTCTAGCCTGC-3' (SEQ ID NO: 12) and reverse 5'- ATAGCGGCCGCTCAGCTGGACCACAG-3' (SEQ ID NO: 13); TCR ⁇ primer forward 5'- ATCTACTCGAGATGCTGCTGCTTCTGCTGCTGCTTCTG-S' (SEQ ID NO: 14) and reverse S'-TCTGCAGAATTCGGCTTCAGAAATCCTTTCTCTTG-S' (SEQ ID NO: 15).
  • the vector was assembled by ligation of four DNA fragments: pMSGVl (Ncol/EcoRl), TCR- ct cDNA (Nc ⁇ l/Not ⁇ ), internal ribosomal entry site (ERES) (Notl/Xho ⁇ ), and TCR- ⁇ cDNA (xhol/EcoW) (Figure 5A).
  • PBMCs from allogeneic donors were stimulated with OKT-3 (50 ng/ml) and IL-2 (300 IU/ml).
  • the stimulated cells were added to RetroNectin (Takara Bio Inc. Japan), subsequently added to retrovirus pre-coated 24-well plates at 5 x 10 5 /ml, and incubated overnight at 37°C in a 5% CO 2 incubator. The procedure was repeated twice and the cells were split as necessary to maintain a cell density between 0.5 and 2 X 10 6 cells/ml.
  • the expresssion of V ⁇ 2 of the TCR was assayed to determine the retroviral transduction efficiency.
  • Packaging cell line PGl 3 transduced with retroviral HC/2G-1 TCR was cloned by limiting dilution. Clone E8 was selected for the remaining experiments. OKT-3 stimulated PBMCs from 4 different donors were transduced with Clone ES three times and tested for CD3 and V ⁇ 2 expression by flow cytometry three days post-transduction. PBMCs without transduction were used as controls (not shown). As shown in Figure 5B, TCR transduced- PBMCs expressed V ⁇ 2, indicating that the transduced cells expressed the TCR of HC/2G-1 T cell clones.
  • TCR-transduced PBMC (1 x 10 5 /well) were co- cultured with renal tumors overnight and tested for IFN- ⁇ secretion.
  • GFP-transduced PBMC and HC/2G-1 (1 x 10 4 /well) served as negative and positive controls, respectively.
  • PBMCs transduced with HC/2G-1 TCR recognized a variety of renal tumors.
  • CD8- and CD4-enriched cells were isolated from GFP- or TCR-transduced PBMCs.
  • the recognition by HC/2G-1 TCR in TCR-transduced PBMCs was both CD8- and CD4-independent.
  • TIL Human TILs from the tumors of patients are expanded as described in Walter et al., New England J. of Med. 333: 1038-1044 (1995). Briefly, TIL are expanded in the rapid expansion protocol (REP) in the presence of OKT3 and allogeneic feeder PBMCs. On day 7, TIL are transduced by exposing cells to Retronectin-coated plus TCR vector-coated tissue culture plates and incubated on the plates overnight. The transduction is repeated on the following day in the same manner. Cells are then washed and maintained in CM supplemented with IL-2.
  • REP rapid expansion protocol
  • cells are assayed for activity by co-incubating transduced cells (1 x 10 5 cells per well of a flat-bottom 96 well plate) with 1 x 10 5 target cells (e.g., RCC cells). After 24 hours of incubation, supernatants are harvested and IFN ⁇ is quantified by ELISA capture assay. The cells which release >200 pg/ml IFN ⁇ against the appropriate target cells (e.g., RCC cells) are further expanded. FACS analysis for the specific V ⁇ gene protein is used to detect the transduced genetic material. The level of the transduced V ⁇ gene expression is expected to be >5% prior to cell infusion. [0145] Active transduced TIL are further expanded by stimulating with OKT3, allogeneic feeder cells, and IL-2. These components are mixed together in a tissue culture flask and transduced TIL are added to the flask.
  • PBLs are isolated by leukopheresis. Lymphocytes are separated by centrifugation on a Ficoll cushion, washed in HBSS, then resuspended at a concentration of 1 x 106 cells/ml in T cell culture medium supplemented with 50 ng/ml OK.T3, 300 IU/ml IL-2, and 5% human AB serum. After 2 days of culture, cells are collected, resuspended in fresh medium without OKT3, plated onto tissue culture plates pre-coated with Retronectin and the TCR retroviral vectors, and incubated overnight. The transduction is repeated the following day.
  • the PBLs are assayed for the presence of V ⁇ gene expression and for activity as described above. At least 10% of more of the transduced cells are expected to express the V ⁇ gene. Also, transduced cells are expected to release >200 pg/ml IFN ⁇ against the appropriate target cells.
  • TIL or PBLs are infused into RCC patients by intravenous infusion plus IV -IL-2 (720,000 IU/kg q8h for a maximum of 15 doses). Patients' blood samples are obtained and are tested for T cells expressing the V ⁇ gene at I 5 3, 6, and 12 months after infusion. RCC tumor regression is expected to ensue.

Landscapes

  • Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Medicinal Chemistry (AREA)
  • Toxicology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Cell Biology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

The invention provides an isolated or purified T cell receptor (TCR) having antigenic specificity for a cancer antigen, e.g., a renal cell carcinoma antigen, wherein the TCR recognizes the cancer antigen in a major histocompatibility complex (MHC)-independent manner. Also provided are related polypeptides, proteins, nucleic acids, recombinant expression vectors, isolated host cells, populations of cells, antibodies, or antigen binding portions thereof, and pharmaceutical compositions. The invention further provides a method of detecting the presence of cancer in a host and a method of treating or preventing cancer in a host using the inventive TCRs or related materials.

Description

T CELL RECEPTORS AND RELATED MATERIALS AND METHODS OF USE
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This patent application claims the benefit of U.S. Provisional Patent Application No. 60/776,194, filed February 24, 2006, and U.S. Provisional Patent Application No. 60/811,422, filed June 7, 2006, which are each incorporated by reference.
BACKGROUND OF THE INVENTION
[0002] Clear cell renal cell carcinoma (RCC) is the most common renal tumor with an incidence of about 30,000 cases per year in the United States (Motzer et al., New Engl. J. Med. 335: 865-875 (1996)). For patients with metastatic RCC, the 5-year survival rate is approximately 10% because RCC is highly resistant to most chemotherapies (Motzer et al., J. Urol 163: 408-417 (2000)). RCC has been considered immunogenic, and 10-20% of RCC patients with metastases can respond to cytokine-based therapy (e.g., interleukin (IL)-2 or IL- 2 combined with interferon (IFN)-α) (Yang et al., J. CHn. Oncol. 21 : 3127-3132 (2003); Tourani et al., J. Clin. Oncol. 21: 3987-3994 (2003)) with some of these patients appearing to be cured.
[0003] Despite the immunogenicity of RCC, there has been little progress in treating metastatic RCC patients with immunotherapy since the advent of IL-2 (Bleumer et al., Eur. Urol. 44: 65-75 (2003)). There have been major problems in defining the molecular basis of the immune response to RCC, in contrast to the rapid progress with human melanoma. This is largely due to a lack of a source of RCC-reactive T cells, again in contrast to melanoma, where IL-2 cultured tumor-infiltrating lymphocytes are often tumor reactive. Recently, Hanada et al. successfully generated a CD8+ T-cell clone from a patient with metastatic RCC, which recognized fibroblast growth factor (FGF)-5 (Hanada et al., Cancer Res. 61 : 5511- 5516 (2001); Hanada et al., Nature 427: 252-256 (2004)). FGF-5 proved to be one of a few RCC antigens that are suitable for clinical therapy because it is overexpressed in many tumors, but not in normal tissues. Yet, this remains only one of very few successful examples of generating RCC-reactive T cells by culturing TILs.
[0004] In view of the foregoing, there is a need in the art for RCC-reactive T cells for use in treating RCC patients. The invention provides such T cells and methods of treating cancer, especially RCC. BRIEF SUMMARY OF THE INVENTION
[0005] The invention provides an isolated or purified T cell receptor (TCR) having antigenic specificity for a cancer antigen, e.g., a renal cell carcinoma antigen, wherein the TCR recognizes the cancer antigen in a major histocompatibility complex (MHC)- independent manner. The TCR can comprise specified amino acid sequences as described herein. For instance, the inventive TCR can comprise the amino acid sequence of SEQ ID NOs: 16-21, SEQ ID NOs: 7 and 8, or SEQ ID NOs: 3 and 4.
[0006] The invention also provides related polypeptides and proteins, as well as related nucleic acids, recombinant expression vectors, host cells, and populations of cells. Further provided by the invention are antibodies, or an antigen binding portion thereof, and pharmaceutical compositions relating to the TCRs of the invention.
[0007] Methods of detecting the presence of cancer in a host and methods of treating or preventing cancer in a host are further provided by the invention. The inventive method of detecting the presence of cancer in a host comprises (i) contacting a sample comprising cells of the cancer with any of the inventive TCRs, polypeptides, proteins, nucleic acids, recombinant expression vectors, host cells, populations of host cells, or antibodies, or antigen binding portions thereof, described herein, thereby forming a complex, and (ii) detecting the complex, wherein detection of the complex is indicative of the presence of cancer in the host. [0008] The inventive method of treating or preventing cancer in a host comprises administering to the host any of the TCRs, polypeptides, or proteins described herein, any nucleic acid or recombinant expression vector comprising a nucleotide sequence encoding any of the TCRs, polypeptides, proteins described herein, or any host cell or population of host cells comprising a recombinant vector which encodes any of the TCRs, polypeptides, or proteins described herein, in an amount effective to treat or prevent cancer in the host.
BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWING(S)
[0009] Figure 1 A is a graph of the IFN-γ secretion (ρg/ml) by cells of Microwell HC/2G upon stimulation with autologous EBV-B (EBV-B #1) or RCC (RCC #1) cells. [0010] Figure IB is a graph of the IFN-γ secretion (pg/ml) by HC/2G-1 T cell clones upon stimulation with a panel of HLA-mismatched renal tumors (RCC #1-11), EBV-Bs (EBV-B #1-11 and 888 EBV-B), melanoma tumors (888 Tc, 624 Tc, 938 Tc, 526 Tc, 1937 Tc, 2370 Tc, 2195 Tc, 2359 Tc, and 2230 Tc), other tumor lines (BIC, BE-3, TC71, MDA435S, MDA386, SKN-AS, H2228, H2087, 293 Tc, COS7), normal epithelial and fibroblasts (MJW90, WLC89, MAS90, HREl, HRE2, 1290 Fibr., 1383 Fibr., 1102 Fibr., 1700 Fibr., 1612 Fibr., and Fibr. #6). [0011] Figure 1 C is a graph of the % specific lysis of target cells by HC/2G- 1 T cell clones at the indicated effector cellttarget cell (E:T) ratios. The target cells included RCC tumor cells (RCC #1 (dotted line with ♦ ), RCC #2 (dashed line with •), RCC # 5 (solid line with ▼), RCC #6 (dotted line with ■), RCC #7 (dashed line with ♦ ), RCC #8 (dashed and dotted line with A), RCC #9 (dashed line with •), and RCC #10 (dashed and dotted line with •)) and negative controls (RCC #11 (dashed line with ▼), EBV-B #1 (solid line with ■), ELW91 (solid line with •), MAS90 (dotted line with T)5 MJW90 (dashed line with ■), WLC89 (dashed line with ♦ ), K562 (dashed line with A), and Daudi (dashed and dotted line with Φ) cells).
[0012] Figure 2A is a set of flow cytometry graphs of HC/2G- 1 cells stained with PE- labeled mouse IgGi antibody and FITC-labeled mouse IgGi antibody (first graph on left), PE- labeled anti-CD3 antibody and FITC-labeled anti-CD4 antibody (second graph from left), PE-labeled anti-CD56 antibody and FITC-labeled anti-CDl6 antibody (third graph from left), PE-labeled anti-CD 161 antibody and FITC-labeled anti-CD57 antibody (fourth graph from left), and PE-labeled anti-CD3 antibody and FITC-labeled anti-TCR γ/δ (g/d) chains antibody (fifth graph from left).
[0013] Figure 2B is a graph of the cytokine secretion (IL-IRa, IL-3, IL-4, IL-5, IL-10, IL-13, IL-17, IL-18, and GMCSF) of HC/2G-1 T cell clones upon stimulation with EBV-B #1 (solid bars), RCC #1 (diagonal lined bars), EBV #11 (crisscrossed bars), and RCC #11 (vertical lined bars) cells.
[0014] Figure 3 A is a flow cytometry graph of HC/2G-1 cells stained with PE-labeled TCR α/β chain antibody (solid line) and with an isotype-matched control antibody (PE- labeled anti-IgGi; dotted line).
[0015] Figure 3B is a set of graphs of the IFN-γ secretion (pg/ml) by HC/2G-1 T cell clones (top graph), MW 5H-5 cells (middle graph), and HC lOC-3 cells (bottom graph) upon stimulation with autologous RCC cells pre-treated without (No Ab) or with anti-HLA Class I, anti-HLA Class II, anti-TCR α/β (TCR a/b), or anti-CD4 antibodies. [0016] Figure 4A is a set of flow cytometry graphs of HC/2G-1 cells stained with PE- labeled Vβ2 antibody and FITC-labeled anti-CD4 antibody (top) and of cells electroporated with rnRNA encoding the TCR of HC/2G-1 cells (bottom row) with 0 (first graph on left), 1 (second graph from the left), 2 (third graph from left), and 4 (fourth graph from the left) μg per 106 cells stained with PE-labeled Vβ2 antibody and FITC-labeled anti-CD3 antibody. [0017] Figure 4B is a graph of the IFN-γ secretion (pg/ml) by cells electroporated with rnRNA encoding the α chain of the HC/2G-1 TCR (vertical lined bars), the β chain of the HC/2G-1 TCR (crisscrossed bars), or both chains of the HC/2G-1 TCR (dotted bars), or untransfected (dashed lined bars) upon stimulation with RCC #6 cells (left panel) or negative control cells (RCC #11 cells; right panel). [0018] Figure 4C is a graph of the IFN-γ secretion (pg/ml) by cells electroporated with 0, 1, 2, or 4 μg mRNA encoding both chains of the HC/2G-1 TCR upon stimulation with RCC cells (RCC #1 (crisscrossed bars), RCC #5 (zigzagged bars), RCC #6 (solid bars), RCC #7 (diagonal lined bars), RCC #8 (dotted bars), RCC #10 (bars with plus signs bars), and RCC #11 (bars with triangles)) or with medium only (horizontal lined bars). Also shown (left panel) is the IFN-γ secretion (pg/ml) by positive control cells (HC/2G-1 cells). [0019] Figure 4D is a graph of the IFN-γ secretion (pg/ml) by PBLs transfected with mRNA encoding HC/2G-1 TCR or untransfected and non-enriched (PBL) or enriched for CD8 (CDS enriched) or CD4 (CD4 enriched) expression upon stimulation with RCC tumor cells (RCC #1 (crisscrossed bars), RCC #5 (zigzagged bars), RCC #6 (solid bars), RCC #7 (diagonal lined bars), RCC #8 (dotted bars), RCC #10 (bars with plus signs), and RCC #11 (bars with triangles)), with human embryonic kidney cells transduced with adenovirus (293 Tc (open bars)), with melanoma cells (624 Tc (vertical lined bars)), or with medium only (horizontal lined bars).
[0020] Figure 5 A is an illustration of the retroviral vector encoding the HC/2G-1 TCR used to transduce cells.
[0021] Figure 5B is a set of flow cytometry graphs of PBMCs from allogeneic donors (#1-4; first, second, third, and fourth graphs from the left, respectively) transduced with retroviral vector encoding HC/2G-1 TCR and stained with PE-labeled anti-Vβ2 antibody (y- axis) or FITC-labeled anti-CD3 antibody (x-axis).
[0022] Figure 5 C is a graph of the IFN-γ secretion (pg/ml) by PBMCs from allogeneic donor #1 transduced with retroviral vector encoding GFP (PBMC #1/GFP) or HC/2G-1 TCR (PBMC #1/E8) upon stimulation with RCC tumor cells (RCC #1 (crisscrossed bars), RCC #5 (zigzagged bars), RCC #6 (solid bars), RCC #7 (dashed lined bars), RCC #8 (dotted bars), RCC #10 (bars with plus signs), and RCC #11 (bars with triangles)), with melanoma tumor cells (624 Tc; vertical lined bars), or with medium alone (open bars). [0023] Figure 5D is a graph of the IFN-γ secretion (pg/ml) by PBMCs transduced with retroviral vector encoding GFP (PBL/GFP) or HC/2G-1 TCR (PBL/E8) and enriched for CD8 (CD8/GFP and CD8/E8) or CD4 (CD4/GFP and CD4/E8) expression upon stimulation with RCC tumor cells (RCC #1 (crisscrossed bars), RCC #5 (zigzagged bars), RCC #6 (solid bars), RCC #7 (dashed lined bars), RCC #8 (dotted bars), and RCC #11 (bars with triangles)) or with melanoma tumor cells (624 Tc cells (vertical lined bars), or with medium alone (open bars). DETAILED DESCRIPTION OF THE INVENTION
[0024] The invention provides an isolated or purified T cell receptor (TCR) having antigenic specificity for a cancer antigen, wherein the TCR recognizes the cancer antigen in a major histocompatibility complex (MHC)-independent manner.
[0025] The phrase "having antigenic specificity" as used herein means that the TCR can specifically bind to and immunologically recognize the cancer antigen, such that binding of the TCR to the cancer antigen elicits an immune response.
[0026] The term "cancer antigen" as used herein refers to any molecule (e.g., protein, peptide, lipid, carbohydrate, etc.) solely or predominantly expressed or over-expressed by a tumor cell or cancer cell, such that the antigen is associated with the tumor or cancer. The cancer antigen can additionally be expressed by normal, non-tumor, or non-cancerous cells. However, in such cases, the expression of the cancer antigen by normal, non-tumor, or noncancerous cells is not as robust as the expression by tumor or cancer cells. In this regard, the tumor or cancer cells can over-express the antigen or express the antigen at a significantly higher level, as compared to the expression of the antigen by normal, non-tumor, or noncancerous cells. Also, the cancer antigen can additionally be expressed by cells of a different state of development or maturation. For instance, the cancer antigen can be additionally expressed by cells of the embryonic or fetal stage, which cells are not normally found in an adult host. Alternatively, the cancer antigen can be additionally expressed by stem cells or precursor cells, which cells are not normally found in an adult host. [0027] The cancer antigen can be an antigen expressed by any cell of any cancer or tumor, including the cancers and tumors described herein. The cancer antigen may be a cancer antigen of only one type of cancer or tumor, such that the cancer antigen is associated with or characteristic of only one type of cancer or tumor. Alternatively, the cancer antigen may be a cancer antigen (e.g., may be characteristic) of more than one type of cancer or tumor. For example, the cancer antigen may be expressed by both breast and prostate cancer cells and not expressed at all by normal, non-tumor, or non-cancer cells. In a preferred embodiment of the invention, the cancer antigen is a kidney cancer antigen. In a more preferred embodiment, the cancer antigen is a renal cell carcinoma (RCC) antigen. [0028] Without being bound to any particular theory, the inventive TCRs are able to recognize a cancer antigen in a major histocompatibility complex (MHC)-independent manner. By "major histocompatibility complex (MHC)-independent manner" as used herein means that the TCR, upon binding to the cancer antigen, can elicit an immune response in the absence of binding to a classical MHC molecule. The classical MHC molecule can be any classical MHC molecule known in the art, e.g., an MHC Class I molecule, an MHC Class II molecule, HLA-A molecules, HLA-B molecules, HLA-C molecules, HLA-DR molecules, HLA-DP molecules, etc. Classical MHC molecules are known in the art. The inventive TCR may, however, bind to the cancer antigen in a manner which requires a minor MHC molecule. For purposes herein, the minor MHC can be an HLA-E molecule, an HLA-G molecule, a CDl molecule, e.g., CDIa, CDIb, CDIc, CDId, etc.
[0029] Furthermore, without being bound to any particular theory, the inventive TCRs are able to recognize a cancer antigen in a CD8- and/or CD4 -independent manner, which manner may be a result of the inventive TCRs being able to recognize a cancer antigen in an MHC-independent manner. By "CD8- and/or CD4-independent manner," is meant that the inventive TCRs, upon binding to a cancer antigen, can elicit an immune response in the absence of a CD8 or CD4 molecule, or both a CD8 and CD4 molecule, expressed on the cell expressing the inventive TCR or in the absence of a functional CD8 or CD4 molecule, or both. Unlike traditional TCRs, the inventive TCRs do not have a preference for CD8 or CD4 and can function in the context of either a CD8 or CD4 molecule.
[0030] The invention provides a TCR comprising two polypeptides (i.e., polypeptide chains), such as an α chain of a TCR, a β chain of a TCR, a γ chain of a TCR, a δ chain of a TCR, or a combination thereof. Such polypeptides chains of TCRs are known in the art. The polypeptides of the inventive TCR can comprise any amino acid sequence, provided that the TCR has antigenic specificity for a cancer antigen and can recognize the cancer antigen in an MHC-independent manner.
\[0031] In a preferred embodiment of the invention, the TCR comprises two polypeptide chains, each of which comprises a variable region comprising a complementarity determining region (CDR) 1, a CDR2, and a CDR3 of a TCR. Preferably, the first polypeptide chain comprises a CDRl comprising the amino acid sequence of SEQ ID NO: 16 (CDRl of α chain), a CDR2 comprising the amino acid sequence of SEQ ID NO: 17 (CDR2 of α chain), and a CDR3 comprising the amino acid sequence of SEQ ID NO: 18 (CDR3 of α chain), and the second polypeptide chain comprises a CDRl comprising the amino acid sequence of SEQ ID NO: 19 (CDRl of β chain), a CDR2 comprising the amino acid sequence of SEQ ID NO: 20 (CDR2 of β chain), and a CDR3 comprising the amino acid sequence of SEQ ID NO: 21 (CDR3 of β chain). In this regard, the inventive TCR can comprise the amino acid sequences selected from the group consisting of SEQ ID NOs: 16-18, 19-21, and 16-21. Preferably the TCR comprises the amino acid sequences of SEQ ID NOs: 16-21.
[0032] Alternatively or additionally, the TCR can comprise an amino acid sequence of a variable region of a TCR comprising the CDRs set forth above. In this regard, the TCR can comprise the amino acid sequence of SEQ ID NO: 7 (the variable region of an α chain) or 8 (the variable region of a β chain), or both SEQ ID NOs: 7 and 8. Preferably, the inventive TCR comprises the amino acid sequences of SEQ ID NOs: 7 and 8.
[0033] Alternatively or additionally, the TCR can comprise an α chain of a TCR and a β chain of a TCR. Each of the α chain and β chain of the inventive TCR can independently comprise any amino acid sequence. Preferably, the α chain comprises the variable region of an α chain as set forth above. In this regard, the inventive TCR can comprise the amino acid sequence of SEQ ID NO: 3. An inventive TCR of this type can be paired with any β chain of a TCR. Preferably, the β chain of the inventive TCR comprises the variable region of a β chain as set forth above. In this regard, the inventive TCR can comprise the amino acid sequence of SEQ ID NO: 4. The inventive TCR, therefore, can comprise the amino acid sequence of SEQ ID NO: 3 or 4, or both SEQ ID NOs: 3 and 4. Preferably, the inventive TCR comprises the amino acid sequences of SEQ ID NOs: 3 and 4.
[0034] Also provided by the invention is an isolated or purified polypeptide comprising a functional portion of any of the TCRs described herein. The term "polypeptide" as used herein includes oligopeptides and refers to a single chain of amino acids connected by one or more peptide bonds.
[0035] With respect to the inventive polypeptides, the functional portion can be any portion comprising contiguous amino acids of the TCR of which it is a part, provided that the functional portion specifically binds to the cancer antigen. The term "functional portion" when used in reference to a TCR refers to any part or fragment of the TCR of the invention, which part or fragment retains the biological activity of the TCR of which it is a part (the parent TCR). Functional portions encompass, for example, those parts of a TCR that retain the ability to specifically bind to the cancer antigen (e.g., in an MHC-independent manner), or detect, treat, or prevent cancer, to a similar extent, the same extent, or to a higher extent, as the parent TCR. In reference to the parent TCR, the functional portion can comprise, for instance, about 10%, 25%, 30%, 50%, 68%, 80%, 90%, 95%, or more, of the parent TCR. [0036] The functional portion can comprise additional amino acids at the amino or carboxy terminus of the portion, or at both termini, which additional amino acids are not found in the amino acid sequence of the parent TCR. Desirably, the additional amino acids do not interfere with the biological function of the functional portion, e.g., specifically binding to a cancer antigen in an MHC-independent manner, having the ability to detect cancer, treat or prevent cancer, etc. More desirably, the additional amino acids enhance the biological activity, as compared to the biological activity of the parent TCR. [0037] The polypeptide can comprise a functional portion of either or both of the α and β chains of the TCRs of the invention, such as a functional portion comprising one of more of CDRl, CDR2, and CDR3 of the variable region(s) of the α chain and/or β chain of a TCR of the invention. In this regard, the polypeptide can comprise a functional portion comprising the amino acid sequence of SEQ ID NO: 16 (CDRl of α chain), 17 (CDR2 of α chain), 18 (CDR3,of α chain), 19 (CDRl of β chain), 20 (CDR2 of β chain), 21 (CDR3 of β chain), or a combination thereof. Preferably, the inventive polypeptide comprises a functional portion comprising SEQ ID NOs: 16-18, 19-21, or all of SEQ ID NOs: 16-21. More preferably, the polypeptide comprises a functional portion comprising the amino acid sequences of SEQ ID NOs: 16-21.
[0038] Alternatively or additionally, the inventive polypeptide can comprise, for instance, the variable region of the inventive TCR comprising a combination of the CDR regions set forth above. In this regard, the TCR can comprise the amino acid sequence of SEQ ID NO: 7 (the variable region of an α chain) or 8 (the variable region of a β chain), or both SEQ ID NOs: 7 and 8. Preferably, the polypeptide comprises the amino acid sequence of SEQ ID NO: 8 or the amino acid sequences of SEQ ID NOs: 7 and 8.
[0039] Alternatively or additionally, the inventive polypeptide can comprise the entire length of an α or β chain of one of the TCRs described herein. In this regard, the inventive polypeptide can comprise an amino acid sequence of SEQ ID NO: 3 or 4. Alternatively, the polypeptide of the invention can comprise both chains of the TCRs described herein. For example, the inventive polypeptide can comprise both amino acid sequences of SEQ ID NOs: 3 and 4.
[0040] The invention further provides an isolated or purified protein comprising at least one of the polypeptides described herein. By "protein" is meant a molecule comprising one or more polypeptide chains.
[0041] The protein of the invention can comprise a first polypeptide chain comprising the amino acid sequence of SEQ ID NO: 7 and a second polypeptide chain comprising the amino acid sequence of SEQ ID NO: 8. The protein of the invention can, for example, comprise a first polypeptide chain comprising the amino acid sequence of SEQ ID NO: 3 and a second polypeptide chain comprising the amino acid sequence of SEQ ID NO: 4. In this instance, the protein of the invention can be a TCR. Alternatively, if, for example, the protein comprises a single polypeptide chain comprising SEQ ID NO: 3 and SEQ ID NO: 4, or if the first and/or second polypeptide chain(s) of the protein further comprise(s) other amino acid sequences, e.g., an amino acid sequence encoding an immunoglobulin or a portion thereof, then the inventive protein can be a fusion protein. In this regard, the invention also provides a fusion protein comprising at least one of the inventive polypeptides described herein along with at least one other polypeptide. The other polypeptide can exist as a separate polypeptide of -the fusion protein, or can exist as a polypeptide, which is expressed in frame (in tandem) with one of the inventive polypeptides described herein. The other polypeptide can encode any peptidic or proteinaceous molecule, or a portion thereof, including, but not limited to an immunoglobulin, CD3, CD4, CD8, an MHC molecule, a CDl molecule, e.g., CDIa, CDIb, CDIc, CDId, etc.
[0042] The fusion protein can comprise one or more copies of the inventive polypeptide and/or one or more copies of the other polypeptide. For instance, the fusion protein can comprise 1, 2, 3, 4, 5, or more, copies of the inventive polypeptide and/or of the other polypeptide. Suitable methods of making fusion proteins are known in the art, and include, for example, recombinant methods. See, for instance, Choi et al., MoL Bϊotechnol. 31: 193- 202 (2005).
[0043] The protein of the invention can be a' recombinant antibody comprising at least one of the inventive polypeptides described herein. As used herein, "recombinant antibody" refers to a recombinant (e.g., genetically engineered) protein comprising at least one of the polypeptides of the invention and a polypeptide chain of an antibody, or a portion thereof. The polypeptide of an antibody, or portion thereof, can be a heavy chain, a light chain, a variable or constant region of a heavy or light chain, a single chain variable fragment (scFv), or an Fc, Fab, or F(ab)2* fragment of an antibody, etc. The polypeptide chain of an antibody, or portion thereof, can exist as a separate polypeptide of the recombinant antibody. Alternatively, the polypeptide chain of an antibody, or portion thereof, can exist as a polypeptide, which is expressed in frame (in tandem) with the polypeptide of the invention. The polypeptide of an antibody, or portion thereof, can be a polypeptide of any antibody or any antibody fragment, including any of the antibodies and antibody fragments described herein.
[0044] Included in the scope of the invention are functional variants of the inventive TCRs, polypeptides, and proteins described herein. The term "functional variant" as used herein refers to a TCR, polypeptide, or protein having substantial or significant sequence identity or similarity to a parent TCR, polypeptide, or protein, which functional variant retains the biological activity of the TCR, polypeptide, or protein of which it is a variant. Functional variants encompass, for example, those variants of the TCR, polypeptide, or protein described herein (the parent TCR, polypeptide, or protein) that retain the ability to specifically bind to the cancer antigen for which the parent TCR has antigenic specificity or to which the parent polypeptide or protein specifically binds (e.g., in an MHC-independent manner), to a similar extent, the same extent, or to a higher extent, as the parent TCR, polypeptide, or protein. In reference to the parent TCR, polypeptide, or protein, the functional variant can, for instance, be at least about 30%, 50%, 75%, 80%, 90%, 98% or more identical in amino acid sequence to the parent TCR, polypeptide, or protein. [0045] The functional variant can, for example, comprise the amino acid sequence of the parent TCR, polypeptide, or protein with at least one conservative amino acid substitution. Conservative amino acid substitutions are known in the art, and include amino acid substitutions in which one amino acid having certain physical and/or chemical properties is exchanged for another amino acid that has the same chemical or physical properties. For instance, the conservative amino acid substitution can be an acidic amino acid substituted for another acidic amino acid (e.g., Asp or GIu), an amino acid with a nonpolar side chain substituted for another amino acid with a nonpolar side chain (e.g., Ala, GIy, VaI, He, Leu, Met, Phe, Pro, Trp, VaI, etc.), a basic amino acid substituted for another basic amino acid (Lys, Arg, etc.), an amino acid with a polar side chain substituted for another amino acid with a polar side chain (Asn, Cys, GIn, Ser, Thr, Tyr, etc.), etc.
[0046] Alternatively or additionally, the functional variants can comprise the amino acid sequence of the parent TCR, polypeptide, or protein with at least one non-conservative amino acid substitution. In this case, it is preferable for the non-conservative amino acid substitution to not interfere with or inhibit the biological activity of the functional variant. Preferably, the non-conservative amino acid substitution enhances the biological activity of the functional variant, such that the biological activity of the functional variant is increased as compared to the parent TCR, polypeptide, or protein.
[0047] The TCR, polypeptide, or protein can consist essentially of the specified amino acid sequence or sequences described herein, such that other components of the functional variant, e.g., other amino acids, do not materially change the biological activity of the functional variant. In this regard, the inventive TCR, polypeptide, or protein can, for example, consist essentially of the amino acid sequence of SEQ ID NO: 3 or 4, or both SEQ ID NOs: 3 and 4. Also, for instance, the inventive TCRs, polypeptides, or proteins can consist essentially of the amino acid sequence(s) of SEQ ID NO: 7 or 8, or both SEQ ID NOs: 7 and 8. Furthermore, the inventive TCRs, polypeptides, or proteins can consist essentially of the amino acid sequence of SEQ ID NO: 16 (CDRl of α chain), 17 (CDR2 of α chain), 18 (CDR3 of α chain), 19 (CDRl of β chain), 20 (CDR2 of β chain), 21 (CDR3 of β chain), or any combination thereof, e.g., SEQ ID NOs: 16-18, 19-21, or 16-21. [0048] The TCRs, polypeptides, and proteins of the invention (including functional portions and functional variants) can be of any length, i.e., can comprise any number of amino acids, provided that the TCRs, polypeptides, or proteins (or functional portions or functional variants thereof) retain their biological activity, e.g., the ability to specifically bind to a cancer antigen in an MHC-independent manner, detect cancer in a host, or treat or prevent cancer in a host, etc. For example, the polypeptide can be 50 to 5000 amino acids long, such as 50, 70, 75, 100, 125, 150, 175, 200, 300, 400, 500, 600, 700, 800. 900, 1000 or more amino acids in length. In this regard, the polypeptides of the invention also include oligopeptides.
[0049] The TCRs, polypeptides, and proteins of the invention (including functional portions and functional variants) of the invention can comprise synthetic amino acids in place of one or more naturally-occurring amino acids. Such synthetic amino acids are known in the art, and include, for example, aminocyclohexane carboxylic acid, norleucine, α-amino n- decanoic acid, homoserine, S-acetylaminomethyl-cysteine, trans-3- and trans-4- hydroxyproline, 4-aminophenylalanine, 4- nitrophenylalanine, 4-chlorophenylalanine, 4- carboxyphenylalanine, β-phenylserine β-hydroxyphenyl alanine, phenylglycine, α- naphthylalanine, cyclohexylalanine, cyclohexylglycine, indoline-2-carboxylic acid, 1,2,3,4- tetrahydroisoquinoline-3-carboxylic acid, aminomalonic acid, aminomalonic acid monoamide, N'-benzyl-N'-methyl-lysine, N',N'-dibenzyl-lysine, 6-hydroxylysine, ornithine, α-aminocyclopentane carboxylic acid, α-aminocyclohexane carboxylic acid, α- aminocycloheptane carboxylic acid, α-(2-amino-2-norbornane)-carbpxylic acid, α,γ- diaminobutyric acid, α,β-diaminopropionic acid, homophenylalanine, and α-tert- butylglycine.
[0050] The TCRs, polypeptides, and proteins of the invention (including functional portions and functional variants) can be glycosylated, amidated, carboxylated, phosphorylated, esterified, N-acylated, cyclized via, e.g., a disulfide bridge, or converted into an acid addition salt and/or optionally dimerized or polymerized, or conjugated. [0051] When the TCRs, polypeptides, and proteins of the invention (including functional portions and functional variants) are in the form of a salt, preferably, the polypeptides are in the form of a pharmaceutically acceptable salt. Suitable pharmaceutically acceptable acid addition salts include those derived from mineral acids, such as hydrochloric, hydrobromic, phosphoric, metaphosphoric, nitric, and sulphuric acids, and organic acids, such as tartaric, acetic, citric, malic, lactic, fumaric, benzoic, glycolic, gluconic, succinic, and arylsulphonic acids, for example, /?-toluenesulphonic acid.
[0052] The TCR, polypeptide, and/or protein of the invention (including functional portions and functional variants thereof) can be obtained by methods known in the art. Suitable methods of de novo synthesizing polypeptides and proteins are described in references, such as Chan et al., Fmoc Solid Phase Peptide Synthesis, Oxford University Press, Oxford, United Kingdom, 2005; Peptide and Protein Drug Analysis, ed. Reid, R., Marcel Dekker, Inc., 2000; Epitope Mapping, ed. Westwoood et al., Oxford University Press, Oxford, United Kingdom, 2000; and U.S. Patent No. 5,449,752. Also, polypeptides and proteins can be recombinantly produced using the nucleic acids described herein using standard recombinant methods. See, for instance, Sambrook et al., Molecular Cloning: A Laboratory Manual. 3rd ed., Cold Spring Harbor Press, Cold Spring Harbor, NY 2001 ; and Ausubel et al., Current Protocols in Molecular Biology. Greene Publishing Associates and John Wiley & Sons, NY, 1994. Further, some of the TCRs, polypeptides, and proteins of the invention (including functional portions and functional variants thereof) can be isolated and/or purified from a source, such as a plant, a bacterium, an insect, a mammal, e.g., a rat, a human, etc. Methods of isolation and purification are well-known in the art. Alternatively, the TCRs, polypeptides, and/or proteins described herein (including functional portions and functional variants thereof) can be commercially synthesized by companies, such as Synpep (Dublin, CA), Peptide Technologies Corp. (Gaithersburg, MD), and Multiple Peptide Systems (San Diego, CA). In this respect, the inventive TCRs, polypeptides, and proteins can be synthetic, recombinant, isolated, and/or purified.
[0053] Included in the scope of the invention are conjugates, e.g., bioconjugates, comprising any of the inventive TCRs, polypeptides, or proteins (including any of the functional portions or variants thereof), nucleic acids, recombinant expression vectors, host cells, populations of host cells, or antibodies, or antigen binding portions thereof. Conjugates, as well as methods of synthesizing conjugates in general, are known in the art (See, for instance, Hudecz, F., Methods MoI. Biol. 298: 209-223 (2005) and Kirin et al.3 Inorg Chem. 44(15): 5405-5415 (2005)).
[0054] Further provided by the invention is a nucleic acid comprising a nucleotide sequence encoding any of the TCRs, polypeptides, or proteins described herein (including functional portions and functional variants thereof).
[0055] By "nucleic acid" as used herein includes "polynucleotide," "oligonucleotide," and "nucleic acid molecule," and generally means a polymer of DNA or RNA, which can be single-stranded or double-stranded, synthesized or obtained (e.g., isolated and/or purified) from natural sources, which can contain natural, non-natural or altered nucleotides, and which can contain a natural, non-natural or altered internucleotide linkage, such as a phosphoroamidate linkage or a phosphorothioate linkage, instead of the phosphodiester found between the nucleotides of an unmodified oligonucleotide. It is generally preferred that the nucleic acid does not comprise any insertions, deletions, inversions, and/or substitutions. However, it may be suitable in some instances, as discussed herein, for the nucleic acid to comprise one or more insertions, deletions, inversions, and/or substitutions. [0056] Preferably, the nucleic acids of the invention are recombinant. As used herein, the term "recombinant" refers to (i) molecules that are constructed outside living cells by joining natural or synthetic nucleic acid segments to nucleic acid molecules that can replicate in a living cell, or (ii) molecules that result from the replication of those described in (i) above. For purposes herein, the replication can be in vitro replication or in vivo replication. [0057] The nucleic acids can be constructed based on chemical synthesis and/or enzymatic ligation reactions using procedures known in the art. See, for example, Sambrook et al., supra, and Ausubel et al., supra. For example, a nucleic acid can be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed upon hybridization (e.g., phosphorothioate derivatives and acridine substituted nucleotides). Examples of modified nucleotides that can be used to generate the nucleic acids include, but are not limited to, 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxymethyl) uracil, 5- carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-substituted adenine, 7-methylguanine, 5-methylaminomethyluracil, 5- methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine, 5'- methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil- 5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2- thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methylester, 3- (3-amino-3-N-2-carboxypropyl) uracil, and 2,6-diaminopurine. Alternatively, one or more of the nucleic acids of the invention can be purchased from companies, such as Macromolecular Resources (Fort Collins, CO) and Synthegen (Houston, TX).
[0058] The nucleic acid can comprise any nucleotide sequence which encodes any of the TCRs, polypeptides, or proteins, or functional portions or functional variants thereof. For example, the nucleic acid can comprise a nucleotide sequence comprising SEQ ID NO: 1, 2, 5, or 6, both SEQ ID NOs: 1 and 2, or both SEQ ID NOs: 5 and 6. The nucleotide sequence alternatively can comprise a nucleotide sequence which is degenerate to SEQ ID NO: 1, 2, 5, or 6, or which comprises a nucleotide sequence comprising a nucleotide sequence degenerate to SEQ ID NO: 1 and a nucleotide sequence degenerate to SEQ ID NO: 2 or comprising a nucleotide sequence degenerate to SEQ ID NO: 5 and a nucleotide sequence degenerate to SEQ ID NO: 6. Preferably, the nucleic acid comprises a nucleotide sequence comprising SEQ ID NO: 1, 2, or 6, SEQ ID NOs: 1 and 2, or SEQ ID NOs: 5 and 6, or a nucleotide sequence which is degenerate thereto.
[0059] The invention also provides an isolated or purified nucleic acid comprising a nucleotide sequence which is complementary to the nucleotide sequence of any of the nucleic acids described herein or a nucleotide sequence which hybridizes under stringent conditions to the nucleotide sequence of any of the nucleic acids described herein. [0060] The nucleotide sequence which hybridizes under stringent conditions preferably hybridizes under high stringency conditions. By "high stringency conditions" is meant that the nucleotide sequence specifically hybridizes to a target sequence (the nucleotide sequence of any of the nucleic acids described herein) in an amount that is detectably stronger than non-specific hybridization. High stringency conditions include conditions which would distinguish a polynucleotide with an exact complementary sequence, or one containing only a few scattered mismatches from a random sequence that happened to have a few small regions (e.g., 3-10 bases) that matched the nucleotide sequence. Such small regions of complementarity are more easily melted than a full-length complement of 14-17 or more bases, and high stringency hybridization makes them easily distinguishable. Relatively high stringency conditions would include, for example, low salt and/or high temperature conditions, such as provided by about 0.02-0.1 M NaCl or the equivalent, at temperatures of about 50-70 0C. Such high stringency conditions tolerate little, if any, mismatch between the nucleotide sequence and the template or target strand, and are particularly suitable for detecting expression of any of the inventive TCRs. It is generally appreciated that conditions can be rendered more stringent by the addition of increasing amounts of formamide. [0061] The nucleic acids of the invention can be incorporated into a recombinant expression vector. In this regard, the invention provides recombinant expression vectors comprising any of the nucleic acids of the invention. For purposes herein, the term "recombinant expression vector" means a genetically-modified oligonucleotide or polynucleotide construct that permits the expression of an mRNA, protein, polypeptide, or peptide by a host cell, when the construct comprises a nucleotide sequence encoding the mRNA, protein, polypeptide, or peptide, and the vector is contacted with the cell under conditions sufficient to have the mRNA, protein, polypeptide, or peptide expressed within the cell. The vectors of the invention are not naturally-occurring as a whole. However, parts of the vectors can be naturally-occurring. The inventive recombinant expression vectors can comprise any type of nucleotides, including, but not limited to DNA and RNA, which can be single-stranded or double-stranded, synthesized or obtained in part from natural sources, and which can contain natural, non-natural or altered nucleotides. The recombinant expression vectors can comprise naturally-occurring, non-naturally-occuring internucleotide linkages, or both types of linkages. Preferably, the non-naturally occurring or altered nucleotides or internucleotide linkages does not hinder the transcription or replication of the vector. [0062] The recombinant expression vector of the invention can be any suitable recombinant expression vector, and can be used to transform or transfect any suitable host. Suitable vectors include those designed for propagation and expansion or for expression or both, such as plasmids and viruses. The vector can be selected from the group consisting of the pUC series (Fermentas Life Sciences), the pBluescript series (Stratagene, LaJolla, CA), the pET series (Novagen, Madison, WI), the pGEX series (Pharmacia Biotech, Uppsala, Sweden), and the pEX series (Clontech, Palo Alto, CA). Bacteriophage vectors, such as λGTIO, λGTl 1, λZapII (Stratagene), λEMBL4, and λNMl 149, also can be used. Examples of plant expression vectors include pBIOl, pBI101.2, ρBI101.3, pBI121 and pBIN19 (Clontech). Examples of animal expression vectors include pEUK-Cl, pMAM and pMAMneo (Clontech). Preferably, the recombinant expression vector is a viral vector, e.g., a retroviral vector.
[0063] The recombinant expression vectors of the invention can be prepared using standard recombinant DNA techniques described in, for example, Sambrook et al., supra, and Ausubel et al., supra. Constructs of expression vectors, which are circular or linear, can be prepared to contain a replication system functional in a prokaryotic or eukaryotic host cell. Replication systems can be derived, e.g., from CoIEl, 2 μ plasmid, λ, S V40, bovine papilloma virus, and the like.
[0064] Desirably, the recombinant expression vector comprises regulatory sequences, such as transcription and translation initiation and termination codons, which are specific to the type of host (e.g., bacterium, fungus, plant, or animal) into which the vector is to be introduced, as appropriate and taking into consideration whether the vector is DNA- or RNA- based.
[0065] The recombinant expression vector can include one or more marker genes, which allow for selection of transformed or transfected hosts. Marker genes include biocide resistance, e.g., resistance to antibiotics, heavy metals, etc., complementation in an auxotrophic host to provide prototrophy, and the like. Suitable marker genes for the inventive expression vectors include, for instance, neomycin/G418 resistance genes, hygromycin resistance genes, histidinol resistance genes, tetracycline resistance genes, and ampicillin resistance genes.
[0066] The recombinant expression vector can comprise a native or normative promoter operably linked to the nucleotide sequence encoding the TCR, polypeptide, or protein (including functional portions and functional variants thereof), or to the nucleotide sequence which is complementary to or which hybridizes to the nucleotide sequence encoding the TCR, polypeptide, or protein. The selection of promoters, e.g., strong, weak, inducible, tissue-specific and developmental-specific, is within the ordinary skill of the artisan. Similarly, the combining of a nucleotide sequence with a promoter is also within the skill of the artisan. The promoter can be a non- viral promoter or a viral promoter, e.g., a cytomegalovirus (CMV) promoter, an SV40 promoter, an RSV promoter, and a promoter found in the long-terminal repeat of the murine stem cell virus.
[0067] The inventive recombinant expression vectors can be designed for either transient expression, for stable expression, or for both. Also, the recombinant expression vectors can be made for constitutive expression or for inducible expression. Further, the recombinant expression vectors can be made to include a suicide gene.
[0068] As used herein, the term "suicide gene" refers to a gene that causes the cell expressing the suicide gene to die. The suicide gene can be a gene that confers sensitivity to an agent, e.g., a drug, upon the cell in which the gene is expressed, and causes the cell to die when the cell is contacted with or exposed to the agent. Suicide genes are known in the art (see, for example, Suicide Gene Therapy: Methods and Reviews, Springer, Caroline J. (Cancer Research UK Centre for Cancer Therapeutics at the Institute of Cancer Research, Sutton, Surrey, UK), Humana Press, 2004) and include, for example, the Herpes Simplex Virus (HSV) thymidine kinase (TK) gene, cytosine daminase, purine nucleoside phosphorylase, and nitroreductase. [0069] The invention further provides a host cell comprising any of the recombinant expression vectors described herein. As used herein, the term "host cell" refers to any type of cell that can contain the inventive recombinant expression vector. The host cell can be a eukaryotic cell, e.g., plant, animal, fungi, or algae, or can be a prokaryotic cell, e.g., bacteria or protozoa. The host cell can be a cultured cell or a primary cell, i.e., isolated directly from an organism, e.g., a human. The host cell can be an adherent cell or a suspended cell, i.e., a cell that grows in suspension. Suitable host cells are known in the art and include, for instance, DH5α E. coli cells, Chinese hamster ovarian cells, monkey VERO cells, COS cells, HEK293 cells, and the like. For purposes of amplifying or replicating the recombinant expression vector, the host cell is preferably a prokaryotic cell, e.g., a DH5α cell. For purposes of producing a recombinant TCR, polypeptide, or protein, the host cell is preferably a mammalian cell. Most preferably, the host cell is(a human cell. While the host cell can be of any cell type, can originate from any type of tissue, and can be of any developmental stage, the host cell preferably is a peripheral blood lymphocyte (PBL). More preferably, the host cell is a T cell.
[0070] For purposes herein, the T cell can be any T cell, such as a cultured T cell, e.g., a primary T cell, or a T cell from a cultured T cell line, e.g., Jurkat, SupTl, etc., or a T cell obtained from a mammal. If obtained from a mammal, the T cell can be obtained from numerous sources, including but not limited to blood, bone marrow, lymph node, the thymus, or other tissues or fluids. T cells can also be enriched for or purified. Preferably, the T cell is a human T cell. More preferably, the T cell is a T cell isolated from a human. The T cell can be any type of T cell and can be of any developmental stage, including but not limited to, CD4+/CD8+ double positive T cells, CD4+ helper T cells, e.g., Thi and Th2 cells, CD8+ T cells (e.g., cytotoxic T cells), peripheral blood mononuclear cells (PBMCs), peripheral blood leukocytes (PBLs), tumor infiltrating cells (TILs), memory T cells, naϊve T cells, and the like. Preferably, the T cell is a CDS+ T cell or a CD4+ T cell.
[0071] Also provided by the invention is a population of cells comprising at least one host cell described herein. The population of cells can be a heterogeneous population comprising the host cell comprising any of the recombinant expression vectors described, in addition to at least one other cell, e.g., a host cell (e.g., a T cell), which does not comprise any of the recombinant expression vectors, or a cell other than a T cell, e.g., a B cell, a macrophage, a neutrophil, an erythrocyte, a hepatocyte, an endothelial cell, an epithelial cells, a muscle cell, a brain cell, etc. Alternatively, the population of cells can be a substantially homogeneous population, in which the population comprises mainly of host cells (e.g., consisting essentially of) comprising the recombinant expression vector. The population also can be a clonal population of cells, in which all cells of the population are clones of a single host cell comprising a recombinant expression vector, such that all cells of the population comprise the recombinant expression vector. In one embodiment of the invention, the population of cells is a clonal population comprising host cells comprising a recombinant expression vector as described herein.
[0072] The invention further provides an antibody, or antigen binding portion thereof, which specifically binds to a functional portion of any of the TCRs described herein. Preferably, the functional portion specifically binds to the cancer antigen, e.g., the functional portion comprising the amino acid sequence SEQ ID NO: 16 (CDRl of α chain), 17 (CDR2 of α chain), 18 (CDR3 of α chain), 19 (CDRl of β chain), 20 (CDR2 of β chain), 21 (CDR3 of β chain), SEQ ID NO: 7, SEQ ID NO: 8, or a combination thereof, e.g., 16-18, 19-21, and 16-21. More preferably, the functional portion comprises the amino acid sequences of SEQ ID NOs: 16-21. In a preferred embodiment, the antibody, or antigen binding portion thereof, binds to an epitopewhich is formed by all 6 CDRs (CDRl -3 of the alpha chain and CDRl -3 of the beta chain). The antibody can be any type of immunoglobulin that is known in the art. For instance, the antibody can be of any isotype, e.g., IgA, IgD, IgE, IgG, IgM, etc. The antibody can be monoclonal or polyclonal. The antibody can be a naturally-occurring antibody, e.g., an antibody isolated and/or purified from a mammal, e.g., mouse, rabbit, goat, horse, chicken, hamster, human, etc. Alternatively, the antibody can be a genetically- engineered antibody, e.g., a humanized antibody or a chimeric antibody. The antibody can be in monomelic or polymeric form. Also, the antibody can have any level of affinity or avidity for the functional portion of the inventive TCR. Desirably, the antibody is specific for the functional portion of the inventive TCR, such that there is minimal cross-reaction with other peptides or proteins.
[0073] Methods of testing antibodies for the ability to bind to any functional portion of the inventive TCR are known in the art and include any antibody-antigen binding assay, such as, for example, radioimmunoassay (RIA), ELISA, Western blot, immunoprecipitation, and competitive inhibition assays (see, e.g., Janeway et al., infra, and U.S. Patent Application Publication No. 2002/0197266 Al).
[0074] Suitable methods of making antibodies are known in the art. For instance, standard hybridoma methods are described in, e.g., Kδhler and Milstein, Eur. J. Immunol., 5, 511-519 (1976), Harlow and Lane (eds.), Antibodies: A Laboratory Manual, CSH Press (1988), and CA. Janeway et al. (eds.), Immunobiology, 5th Ed., Garland Publishing, New York, NY (2001)). Alternatively, other methods, such as EBV-hybridoma methods (Haskard and Archer, J. Immunol. Methods, 74(2), 361-67 (1984), and Roder et al., Methods Enzymol., 121, 140-67 (1986)), and bacteriophage vector expression systems (see, e.g., Huse et al., Science, 246, 1275-81 (1989)) are known in the art. Further, methods of producing antibodies in non-human animals are described in, e.g., U.S. Patents 5,545,806, 5,569,825, and 5,714,352, and U.S. Patent Application Publication No. 2002/0197266 Al). [0075] Phage display furthermore can be used to generate the antibody of the invention. In this regard, phage libraries encoding antigen-binding variable (V) domains of antibodies can be generated using standard molecular biology and recombinant DNA techniques (see, e.g., Sambrook et al. (eds.), Molecular Cloning, A Laboratory Manual, 3rd Edition, Cold Spring Harbor Laboratory Press, New York (2001)). Phage encoding a variable region with the desired specificity are selected for specific binding to the desired antigen, and a complete or partial antibody is reconstituted comprising the selected variable domain. Nucleic acid sequences encoding the reconstituted antibody are introduced into a suitable cell line, such as a myeloma cell used for hybridoma production, such that antibodies having the characteristics of monoclonal antibodies are secreted by the cell (see, e.g., Janeway et al., supra, Huse et al., supra, and U.S. Patent 6,265,150).
[0076] Antibodies can be produced by transgenic mice that are transgenic for specific heavy and light chain immunoglobulin genes. Such methods are known in the art and described in, for example U.S. Patents 5,545,806 and 5,569,825, and Janeway et al., supra. [0077] Methods for generating humanized antibodies are well known in the art and are described in detail in, for example, Janeway et al., supra, U.S. Patents 5,225,539, 5,585,089 and 5,693,761, European Patent No. 0239400 Bl, and United Kingdom Patent No. 2188638. Humanized antibodies can also be generated using the antibody resurfacing technology described in U.S. Patent 5,639,641 and Pedersen et al., J. MoI. Biol, 235, 959-973 (1994). [0078] The invention also provides antigen binding portions of any of the antibodies described herein. The antigen binding portion can be any portion that has at least one antigen binding site, such as Fab, F(ab')2, dsFv, sFv, diabodies, and triabodies. [0079] A single-chain variable region fragment (sFv) antibody fragment, which consists of a truncated Fab fragment comprising the variable (V) domain of an antibody heavy chain linked to a V domain of a light antibody chain via a synthetic peptide, can be generated using routine recombinant DNA technology techniques (see, e.g., Janeway et al., supra). Similarly, disulfide-stabilized variable region fragments (dsFv) can be prepared by recombinant DNA technology (see, e.g., Reiter et al., Protein Engineering, 7, 697-704 (1994)). Antibody fragments of the invention, however, are not limited to these exemplary types of antibody fragments.
[0080] Also, the antibody, or antigen binding portion thereof, can be modified to comprise a detectable label, such as, for instance, a radioisotope, a fluorophore (e.g., fluorescein isothiocyanate (FITC), phycoerythrin (PE)), an enzyme (e.g., alkaline phosphatase, horseradish peroxidase), and element particles (e.g., gold particles). [0081] The inventive TCRs, polypeptides, proteins, (including functional portions and functional variants thereof), nucleic acids, recombinant expression vectors, host cells (including populations thereof), and antibodies (including antigen binding portions thereof), can be isolated and/or purified. The term "isolated" as used herein means having been removed from its natural environment. The term "purified" as used herein means having been increased in purity, wherein "purity" is a relative term, and not to be necessarily construed as absolute purity. For example, the purity can be at least about 50%, can be greater than 60%, 70% or 80%, or can be 100%.
[0082] The inventive TCRs, polypeptides, proteins (including functional portions and variants thereof), nucleic acids, recombinant expression vectors, host cells (including populations thereof), and antibodies (including antigen binding portions thereof), all of which are collectively referred to as "inventive TCR materials" hereinafter, can be formulated into a composition, such as a pharmaceutical composition. In this regard, the invention provides a pharmaceutical composition comprising any of the TCRs, polypeptides, proteins, functional portions, functional variants, nucleic acids, expression vectors, host cells (including populations thereof), and antibodies (including antigen binding portions thereof), and a pharmaceutically acceptable carrier. The inventive pharmaceutical compositions containing any of the inventive TCR materials can comprise more than one inventive TCR material, e.g., a polypeptide and a nucleic acid, or two or more different TCRs. Alternatively, the pharmaceutical composition can comprise an inventive TCR material in combination with another pharmaceutically active agents or drugs, such as a chemotherapeutic agents, e.g., asparaginase, busulfan, carboplatin, cisplatin, daunorubicin, doxorubicin, fluorouracil, gemcitabine, hydroxyurea, methotrexate, paclitaxel, rituximab, vinblastine, vincristine, etc. [0083] Preferably, the carrier is a pharmaceutically acceptable carrier. With respect to pharmaceutical compositions, the carrier can be any of those conventionally used and is limited only by chemico-physical considerations, such as solubility and lack of reactivity with the active compound(s), and by the route of administration. The pharmaceutically acceptable carriers described herein, for example, vehicles, adjuvants, excipients, and diluents, are well-known to those skilled in the art and are readily available to the public. It is preferred that the pharmaceutically acceptable carrier be one which is chemically inert to the active agent(s) and one which has no detrimental side effects or toxicity under the conditions of use.
[0084] The choice of carrier will be determined in part by the particular inventive TCR material, as well as by the particular method used to administer the inventive TCR material. Accordingly, there are a variety of suitable formulations of the pharmaceutical composition of the invention. The following formulations for oral, aerosol, parenteral, subcutaneous, intravenous, intramuscular, intraarterial, intrathecal, interperitoneal, rectal, and vaginal administration are exemplary and are in no way limiting. More than one route can be used to administer the inventive TCR materials, and in certain instances, a particular route can provide a more immediate and more effective response than another route. [0085] Topical formulations are well-known to those of skill in the art. Such formulations are particularly suitable in the context of the invention for application to the skin.
[0086] Formulations suitable for oral administration can consist of (a) liquid solutions, such as an effective amount of the inventive TCR material dissolved in diluents, such as water, saline, or orange juice; (b) capsules, sachets, tablets, lozenges, and troches, each containing a predetermined amount of the active ingredient, as solids or granules; (c) powders; (d) suspensions in an appropriate liquid; and (e) suitable emulsions. Liquid formulations may include diluents, such as water and alcohols, for example, ethanol, benzyl alcohol, and the polyethylene alcohols, either with or without the addition of a pharmaceutically acceptable surfactant. Capsule forms can be of the ordinary hard- or soft-shelled gelatin type containing, for example, surfactants, lubricants, and inert fillers, such as lactose, sucrose, calcium phosphate, and corn starch. Tablet forms can include one or more of lactose, sucrose, mannitol, corn starch, potato starch, alginic acid, microcrystalline cellulose, acacia, gelatin, guar gum, colloidal silicon dioxide, croscarmellose sodium, talc, magnesium stearate, calcium stearate, zinc stearate, stearic acid, and other excipients, colorants, diluents, buffering agents, disintegrating agents, moistening agents, preservatives, flavoring agents, and other pharmacologically compatible excipients. Lozenge forms can comprise the inventive TCR material in a flavor, usually sucrose and acacia or tragacanth, as well as pastilles comprising the inventive TCR material in an inert base, such as gelatin and glycerin, or sucrose and acacia, emulsions, gels, and the like containing, in addition to, such excipients as are known in the art.
[0087] The inventive TCR material, alone or in combination with other suitable components, can be made into aerosol formulations to be administered via inhalation. These aerosol formulations can be placed into pressurized acceptable propellants, such as dichlorodifluoromethane, propane, nitrogen, and the like. They also may be formulated as pharmaceuticals for non-pressured preparations, such as in a nebulizer or an atomizer. Such spray formulations also may be used to spray mucosa.
[0088] Formulations suitable for parenteral administration include aqueous and non-aqueous, isotonic sterile injection solutions, which can contain anti-oxidants, buffers, bacteriostats, and solutes that render the formulation isotonic with the blood of the intended recipient, and aqueous and non-aqueous sterile suspensions that can include suspending agents, solubilizers, thickening agents, stabilizers, and preservatives. The inventive TCR material can be administered in a physiologically acceptable diluent in a pharmaceutical carrier, such as a sterile liquid or mixture of liquids, including water, saline, aqueous dextrose and related sugar solutions, an alcohol, such as ethanol or hexadecyl alcohol, a glycol, such as propylene glycol or polyethylene glycol, dimethylsulfoxide, glycerol, ketals such as 2,2- dimethyl-l,3-dioxolane-4-methanol, ethers, poly(ethyleneglycol) 400, oils, fatty acids, fatty acid esters or glycerides, or acetylated fatty acid glycerides with or without the addition of a pharmaceutically acceptable surfactant, such as a soap or a detergent, suspending agent, such asφectin, carbomers, methylcellulose, hydroxypropylmethyl cellulose, or carboxymethylcellulose, or emulsifying agents and other pharmaceutical adjuvants. [0089] Oils, which can be used in parenteral formulations include petroleum, animal, vegetable, or synthetic oils. Specific examples of oils include peanut, soybean, sesame, cottonseed, corn, olive, petrolatum, and mineral. Suitable fatty acids for use in parenteral formulations include oleic acid, stearic acid, and isostearic acid. Ethyl oleate and isopropyl myristate are examples of suitable fatty acid esters.
[0090] Suitable soaps for use in parenteral formulations include fatty alkali metal, ammonium, and triethanolamine salts, and suitable detergents include (a) cationic detergents such as, for example, dimethyl dialkyl ammonium halides, and alkyl pyridinium halides, (b) anionic detergents such as, for example, alkyl, aryl, and olefin sulfonates, alkyl, olefin, ether, and monoglyceride sulfates, and sulfosuccinates, (c) nonionic detergents such as, for example, fatty amine oxides, fatty acid alkanolamides, and polyoxyethylenepolypropylene copolymers, (d) amphoteric detergents such as, for example, alkyl-β-aminopropionates, and 2-alkyl-imidazoline quaternary ammonium salts, and (e) mixtures thereof. [0091] The parenteral formulations will typically contain from about 0.5% to about 25% by weight of the inventive TCR material in solution. Preservatives and buffers may be used. In order to minimize or eliminate irritation at the site of injection, such compositions may contain one or more nonionic surfactants having a hydrophile-lipophile balance (HLB) of from about 12 to about 17. The quantity of surfactant in such formulations will typically range from about 5% to about 15% by weight. Suitable surfactants include polyethylene glycol sorbitan fatty acid esters, such as sorbitan monooleate and the high molecular weight adducts of ethylene oxide with a hydrophobic base, formed by the condensation of propylene oxide with propylene glycol. The parenteral formulations can be presented in unit-dose or multi-dose sealed containers, such as ampoules and vials, and can be stored in a freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid excipient, for example, water, for injections, immediately prior to use. Extemporaneous injection solutions and suspensions can be prepared from sterile powders, granules, and tablets of the kind previously described.
[0092] Injectable formulations are in accordance with the invention. The requirements for effective pharmaceutical carriers for injectable compositions are well-known to those of ordinary skill in the art (see, e.g., Pharmaceutics and Pharmacy Practice, J.B. Lippincott Company, Philadelphia, PA5 Banker and Chalmers, eds., pages 238-250 (1982), and ASHP Handbook on Injectable Drugs, Toissel, 4th ed., pages 622-630 (1986)). Preferably, when administering cells, e.g., dendritic cells, the cells are administered via injection. [0093] Additionally, the inventive TCR materials, or compositions comprising such inventive TCR materials, can be made into suppositories by mixing with a variety of bases, such as emulsifying bases or water-soluble bases. Formulations suitable for vaginal administration can be presented as pessaries, tampons, creams, gels, pastes, foams, or spray formulas containing, in addition to the active ingredient, such carriers as are known in the art to be appropriate.
[0094] It will be appreciated by one of skill in the art that, in addition to the above- described pharmaceutical compositions, the inventive TCR materials of the invention can be formulated as inclusion complexes, such as cyclodextrin inclusion complexes, or liposomes. [0095] For purposes of the invention, the amount or dose of the inventive TCR material administered should be sufficient to effect, e.g., a therapeutic or prophylactic response, in the subject or animal over a reasonable time frame. For example, the dose of the inventive TCR material should be sufficient to bind to a cancer antigen, or detect, treat or prevent cancer in a period of from about 2 hours or longer, e.g., 12 to 24 or more hours, from the time of administration, hi certain embodiments, the time period could be even longer. The dose will be determined by the efficacy of the particular inventive TCR material and the condition of the animal (e.g., human), as well as the body weight of the animal (e.g., human) to be treated. [0096] Many assays for determining an administered dose are known in the art. For purposes of the invention, an assay, which comprises comparing the extent to which target cells are lysed or IFN-γ is secreted by T cells expressing the inventive TCR, polypeptide, or protein upon administration of a given dose of such T cells to a mammal among a set of mammals of which is each given a'different dose of the T cells, could be used to determine a starting dose to be administered to a mammal. The extent to which target cells are lysed or IFN-γ is secreted upon administration of a certain dose can be assayed by methods known in the art, including, for instance, the methods described herein as Example 1. [0097] The dose of the inventive TCR material also will be determined by the existence, nature and extent of any adverse side effects that might accompany the administration of a particular inventive TCR material. Typically, the attending physician will decide the dosage of the inventive TCR material with which to treat each individual patient, taking into consideration a variety of factors, such as age, body weight, general health, diet, sex, inventive TCR material to be administered, route of administration, and the severity of the condition being treated. By way of example and not intending to limit the invention, the dose ofrthe inventive TCR material can be about 0.001 to about 1000 mg/kg body weight of the subject being treated/day, from about 0.01 to about 10 mg/kg body weight/day, about 0.01 mg to about 1 mg/kg body weight/day. [0098] One of ordinary skill in the art will readily appreciate that the inventive TCR materials of the invention can he modified in any number of ways, such that the therapeutic or prophylactic efficacy of the inventive TCR materials is increased through the modification. For instance, the inventive TCR materials can be conjugated either directly or indirectly through a linker to a targeting moiety. The practice of conjugating compounds, e.g., inventive TCR materials, to targeting moieties is known in the art. See, for instance, Wadwa et al., J. Drug Targeting 3: 111 (1995) and U.S. Patent No. 5,087,616. The term "targeting moiety" as used herein, refers to any molecule or agent that specifically recognizes and binds to a cell-surface receptor, such that the targeting moiety directs the delivery of the inventive TCR materials to a population of cells on which surface the receptor is expressed. Targeting moieties include, but are not limited to, antibodies, or fragments thereof, peptides, hormones, growth factors, cytokines, and any other natural or non-natural ligands, which bind to cell surface receptors (e.g., Epithelial Growth Factor Receptor (EGFR), T-cell receptor (TCR), B- cell receptor (BCR), CD28, Platelet-derived Growth Factor Receptor (PDGF), nicotinic acetylcholine receptor (nAChR), etc.). The term "linker" as used herein, refers to any agent or molecule that bridges the inventive TCR materials to the targeting moiety. One of ordinary skill in the art recognizes that sites on the inventive TCR materials, which are not necessary for the function of the inventive TCR materials, are ideal sites for attaching a linker and/or a targeting moiety, provided that the linker and/or targeting moiety, once attached to the inventive TCR materials, do(es) not interfere with the function of the inventive TCR materials, i.e., the ability to bind to a cancer antigen, or to detect, treat, or prevent cancer.
[0099] Alternatively, the inventive TCR materials can be modified into a depot form, such that the manner in which the inventive TCR materials is released into the body to which it is administered is controlled with respect to time and location within the body (see, for example, U.S. Patent No. 4,450,150). Depot forms of inventive TCR materials can be, for example, an implantable composition comprising the inventive TCR materials and a porous or non-porous material, such as a polymer, wherein the inventive TCR materials is encapsulated by or diffused throughout the material and/or degradation of the non-porous material. The depot is then implanted into the desired location within the body and the inventive TCR materials are released from the implant at a predetermined rate. [00100] It is contemplated that the inventive pharmaceutical compositions, TCRs, polypeptides, proteins, nucleic acids, recombinant expression vectors, host cells, or populations of cells can be used in methods of treating or preventing cancer. Without being bound to a particular theory, the inventive TCRs are believed to bind specifically to a cancer antigen, e.g., a renal cell carcinoma antigen, such that the TCR (or related inventive polypeptide or protein) when expressed by a cell is able to mediate an immune response against the cell expressing the cancer antigen. In this regard, the invention provides a method of treating or preventing cancer in a host, comprising administering to the host any of the TCRs, polypeptides, or proteins described herein, any nucleic acid or recombinant expression vector comprising a nucleotide sequence encoding any of the TCRs, polypeptides, proteins described herein, or any host cell or population of cells comprising a recombinant vector which encodes any of the TCRs, polypeptides, or proteins described herein, in an amount effective to treat or prevent cancer in the host.
[0100] The terms "treat," and "prevent" as well as words stemming therefrom, as used herein, do not necessarily imply 100% or complete treatment or prevention. Rather, there are varying degrees of treatment or prevention of which one of ordinary skill in the art recognizes as having a potential benefit or therapeutic effect. In this respect, the inventive methods can provide any amount of any level of treatment or prevention of cancer in a mammal. Furthermore, the treatment or prevention provided by the inventive method can include treatment or prevention of one or more conditions or symptoms of the disease, e.g., cancer, being treated or prevented. Also, for purposes herein, "prevention" can encompass delaying the onset of the disease, or a symptom or condition thereof.
[0101] Also provided is a method of detecting the presence of cancer in a host. The method comprises (i) contacting a sample comprising cells of the cancer any of the inventive TCRs, polypeptides, proteins, nucleic acids, recombinant expression vectors, host cells, populations of cells, or antibodies, or antigen binding portions thereof, described herein, thereby forming a complex, and detecting the complex, wherein detection of the complex is indicative of the presence of cancer in the host.
[0102] With respect to the inventive method of detecting cancer in a host, the sample of cells of the cancer can be a sample comprising whole cells, lysates thereof, or a fraction of the whole cell lysates, e.g., a nuclear or cytoplasmic fraction, a whole protein fraction, or a nucleic acid fraction.
[0103] For purposes of the inventive detecting method, the contacting step can take place in vitro or in vivo with respect to the host. Preferably, the contacting is in vitro. [0104] Also, detection of the complex can occur through any number of ways known in the art. For instance, the inventive TCRs, polypeptides, proteins, nucleic acids, recombinant expression vectors, host cells, populations of cells, or antibodies, or antigen binding portions thereof, described herein, can be labeled with a detectable label such as, for instance, a radioisotope, a fluorophore (e.g., fluorescein isothiocyanate (FITC), phycoerythrin (PE)), an enzyme (e.g., alkaline phosphatase, horseradish peroxidase), and element particles (e.g., gold particles). [0105] For purposes of the inventive methods, wherein host cells or populations of cells are administered, the cells can be cells that are allogeneic or autologous to the host. Preferably, the cells are autologous to the host.
[0106] With respect to the inventive methods, the cancer can be any cancer, including any of acute lymphocytic cancer, acute myeloid leukemia, alveolar rhabdomyosarcoma, bone cancer, brain cancer, breast cancer, cancer of the anus, anal canal, or anorectum, cancer of the eye, cancer of the intrahepatic bile duct, cancer of the joints, cancer of the neck, gallbladder, or pleura, cancer of the nose, nasal cavity, or middle ear, cancer of the oral cavity, cancer of the vulva, chronic lymphocytic leukemia, chronic myeloid cancer, colon cancer, esophageal cancer, cervical cancer, gastrointestinal carcinoid tumor. Hodgkin lymphoma, hypopharynx cancer, kidney cancer, larynx cancer, liver cancer, lung cancer, malignant mesothelioma, melanoma, multiple myeloma, nasopharynx cancer, non-Hodgkin lymphoma, ovarian cancer, pancreatic cancer, peritoneum, omentum, and mesentery cancer, pharynx cancer, prostate cancer, rectal cancer, renal cancer (e.g., renal cell carcinoma (RCC)), small intestine cancer, soft tissue cancer, stomach cancer, testicular cancer, thyroid cancer, ureter cancer, and urinary bladder cancer. Preferably, the cancer is kidney cancer. More preferably, the cancer is RCC. [0107] The host referred to in the inventive methods can be any host. Preferably, the host is a mammal. As used herein, the term "mammal" refers to any mammal, including, but not limited to, mammals of the order Rodentia, such as mice and hamsters, and mammals of the order Logomorpha, such as rabbits. It is preferred that the mammals are from the order Carnivora, including Felines (cats) and Canines (dogs). It is more preferred that the mammals are from the order Artiodactyla. including Bovines (cows) and Swines (pigs) or of the order Perssodactyla, including Equines (horses). It is most preferred that the mammals are of the order Primates, Ceboids, or Simoids (monkeys) or of the order Anthropoids (humans and apes). An especially preferred mammal is the human.
EXAMPLES
[0108] The following examples further illustrate the invention but, of course, should not be construed as in any way limiting its scope.
[0109] The following cell lines and antibodies were used in the examples described herein:
[0110] Tumor lines from renal cell carcinoma (RCC) patients and Epstein-Barr virus- transformed B cells (EBV-Bs) were established as described previously (Wang et al., J. Immunother. 28: 551-559 (2005)). RCC lines were maintained in Dulbecco's Modified Eagle Medium (DMEM; ϊnvitrogen Life Technologies, Gaithersburg, MD, USA) supplemented with 10% fetal bovine serum (FBS; Invitrogen Life Technologies). EBV-B cells were maintained in RPMI 1640 (Life Technologies) containing 10% FBS. Tumor lines, which were used as controls in the experiments, were obtained from the laboratories of the Surgery Branch of the National Cancer Institute (Bethesda, MD, USA), and maintained in RPMI 1640 supplemented with 10% FBS. Human primary renal epithelial cells were either purchased from Cambrex Bioscience (Walkersville, MD, USA) or gifts from Dr. Scbtt Garrett (University of North Dakota, Grand Forks, ND, USA).
[0111] For immunophenotyping, monoclonal antibodies (MoAbs), including fluorescein isothiocyanate (FITC)-labeled anti-human IgG isotypes, anti-CD3, anti-CD4, anti-CD8, anti- CD 16, anti-CD57, and anti-TCRγ/δ, and phycoerytherin (PE)-labeled anti-human IgG isotypes, anti-CD3, anti-CD4, anti-CD8, anti-TCRα/β, anti-CD56, and anti-CD161 were purchased from BD Pharmingen (San Jose, CA, USA). PE-labeled anti-Vβ2 antibodies were purchased from Beckman Coulter (Miami, FL, USA).
[0112] For blocking experiments, W6/32 (anti-pan HLA class I) and IVA 12 (anti-pan HLA class II) were kind gifts of Dr. Paul Robbins (National Cancer Institute). Purified anti- human TCRα/β antibody was purchased from BD Pharmingen.
EXAMPLE 1
[0113] This example demonstrates a method of making a T cell clone having antigenic specificity for a renal cell carcinoma antigen and demonstrates the biological activity of that clone.
[0114] To establish RCC-specific T cells,. CD8+- and/or CD4+-enriched T cells (Miltenyi Biotec Inc, Auburn, CA) were stimulated with Day 6 dendritic cells (DCs) co-cultured with UV-irradiated autologous tumor cells, as described previously with some modifications (Wang et al., 2005, supra). Briefly, CD14+ DCs were isolated from patient peripheral blood mononuclear cells (PBMC) using CD 14 microbeads according to the manufacturer's instructions (Miltenyi Biotec Inc. Auburn, CA), and cultured in RPMI 1640 supplemented with 10% human serum (HS; Valley Biomedical Inc. Winchester, VA), GM-CSF (1000 U/ml; Peprotech, Rocky HiII, NJ), and IL-4 (1000 U/ml; Peprotech) for 6 days to generate monocyte-derived DCs (herein referred to as Day 6 DCs). To stimulate T cells, Day 6 DCs were co-cultured with UV-irradiated tumor cells (UVB; 312mm; Spectroline, Westbury, NY) at 1 : 1 ratio in RPMI 1640 supplemented with 10% HS in the presence of GM-CSF, IL-4, and IFN-α (1000 U/ml each); Pierce Biotechnology, Inc. Rockford, IL, USA) overnight in 96- well round-bottom plates. On the next day, the DC-tumor co-culture plates were replenished with fresh RPMI 1640 supplemented with ,10% HS, GM-CSF, and IL-4. CD8+-enriched T cells (Miltenyi CD8+ Cell Isolation Kit II) and CD4+- enriched, CD25-depleted T cells (Miltenyi CD4+ Cell Isolation Kit II and CD25 microbeads) were isolated and added to DC- tumor co-culture in RPMI supplemented with 10% HS. IL-2 (120 IU/ml), and CD40L (500 ng/ml; Immunex, Seattle, WA, USA). Seven days later, T cells were re-stimulated once by transferring them to a second identically prepared DC-tumor culture. Testing the T cells for IFN-γ production upon co-culturing with autologous EBV-B or RCC cells occurred 7 days after restimulation. Microwells, which had an IFN-γ concentration of at least 100 pg/ml when co-cultured with autologous renal tumor (RCC #1) cells and twice that when co- cultured with with autologous EBV-B cells (EBV-B #1), were deemed as positive. T cell clones were derived from the cultures of these positive microwells by limiting dilution, and expanded, when the clones were positive for IFN-γ secretion upon co-culturing with autologous EBV tumor cells.
[0115] As shown in Figure IA, T cells from Microwell HC/2G that met the criteria of having an IFN-γ concentration of at least 100 pg/ml and twice that of a co-culture with EBV- B cells.
[0116] T cell clone HC/2G-1 was derived from Microwell HC/2G by plating 1 cell per well in a limiting dilution assay. HC/2G-1 (1 x 104 cells/well) was co-cultured with a panel of HLA-mismatched renal tumors, EBV-Bs, melanoma tumors, other tumor lines, normal human epithelial lines and fibroblasts overnight and tested for IFN-γ secretion by ELISA. As shown in Figure IB, T cell clone HC/2G-1 secreted IFN-γ when stimulated with multiple HLA mismatched renal tumors.
[0117] A standard 4-hour 51Cr-release assay was performed to test the cytotoxicity of T cells against tumors. Briefly, target cells were labeled for 1 h at 37°C with 51Cr (200 μCi; AmershamBiosciences; Piscataway, NJ). Labeled target cells were then washed three times and plated in triplicate at a concentration of 1 x 104 per well in 96- well round-bottom plates. Effector cells (HC/2G-1 T cell clones) were prepared and added to target cells at various E:T ratios. After a 4-hour incubation, the supernatant was harvested and counted on a Wallac 1470 Wizard automatic gamma counter. Maximum 51Cr release was determined by adding 2% SDS to the target cells, and spontaneous 51Cr release was determined by adding medium to the target cells. The percentage of specific lysis was calculated as follows: [(experimental cpm — spontaneous cpm)/ (maximum cpm — spontaneous cpm)] x 100. [0118] As shown in Figure 1C, T cell clone HC/2G-1 lysed multiple HLA mismatched renal tumors. Specifically, RCC #1, 2, and 5-10 cells were lysed by the T cell clones. [0119] . This example demonstrated a method of making a T cell clone specific for a renal cell carcinoma antigen. This example further demonstrated that the T cell clone HC/2G-1 recognized a majority of renal tumors.
EXAMPLE 2
[0120] This example demonstrates a characterization of T cell clone HC/2G1. [0121] HC/2G-1 T cell clones were stained with the FITC- and PE-labeled anti-human MoAbs described above, and analyzed by FACScan. As shown in Figures 2A and 3A, the T cell clones were positive for expression of TCR α and β chains, CD3, CD4, and CD56 and negative for expression of CD 16, CD57, CD 161, and TCR γ and δ chains. [0122] HC/2G-1 T cell clones (1 x 104 per well) were co-cultured with autologous tumor cells (RCC#1 and EBV-B#1) or allogeneic tumor cells (RCC#11 and EBV-B #11) overnight, and the supernatant was collected and tested for cytokine secretion by SearchLight™ (Pierce Biotechnology, Inc., Rockford, IL). As a control, HC/2G-1, EBV-Bs and RCCs cultured alone were also included in the assay. As shown in Figure 2B, HC/2G-1 T cell clones secreted multiple cytokines upon stimulation with autologous RCC cells. In contrast, HC/2G-1, EBV-Bs and RCCs cultured alone showed no or very little cytokine secretion (data not shown).
EXAMPLE 3
[0123] This example demonstrates that the activity of HC/2G-1 T cell clones was mediated through the TCR and was independent of MHC molecules of HLA Class I and HLA Class II.
[0124] Autologous RCC cells (RCC#1; 5 x 104 cells in 100 μl) were incubated with each blocking mAb (anti-HLA class I, anti-HLA class II, anti-TCRoc/β and anti-CD4) at the concentration of 10 μg/ml for 30 min at 37°C in a flat-bottom 96-weIl plate. HC/2G-1 T cells (1 to 5 x 104 cells/well) were then added and incubated with target cells overnight at 37°C. As a control, HLA-B44-restricted CTL clone (MW/5H-5) and HLA-class II-restricted CD4+ T cell clone (HC/lOC-3) were co-cultured with their autologous tumors. The supernatants were harvested and assayed for IFN-γ concentration by ELISA. [0125] As shown in Figure 3B, the reactivity of HC/2G-1 T cell clones was blocked by anti-TCR antibodies, not blocked by anti-HLA Class II antibodies, and partially blocked by anti-HLA Class I antibodies. In contrast, the anti-HLA Class I antibodies blocked the activity of MW/5H-5 cells, and the anti-HLA Class II antibodies effectively blocked the activity of HC/lOC-3 cells, as expected.
[0126] This example demonstrated that the T cell clone HC/2G-1 acts through its TCR and in an MHC-independent manner. f
EXAMPLE 4
[0127] This example demonstrates a method of producing allogeneic cells expressing the TCR of HC/2G-1 T cell clones and the biological activity thereof. [0128J Total RNA from T cell clone HC/2G-1 was purified from T cells using an RNeasy Mini Kit (Qiagen, Valencia, CA, USA). Primers having a nucleotide sequence complementary to the V end of the coding sequences of TGR α and β chains were synthesized (Operon Technologies, Huntsville, AL) to make full-length cDNAs. The primers sequences were as follows: Ca (TCAGCTGGACCACAGCCGCAGC; SEQ ID NO: 9), Cβl (TCAGAAATCCTTTCTCTTGACCATG; SEQ ID NO: 10) and Cβ2
(CTAGCCTCTGGAATCCTTTCTCTTG; SEQ ID NO: 11). RACE reaction was performed by using a SMART™ RACE cDNA Amplification Kit (Clontech, Mountain View, CA) following the manufacturer's protocol. The RACE cDNAs (~lkb) were obtained with Ca and Cβ 1 primers and then ligated into a pCR2.1 vector with a TA Cloning® Kit (Invitrogen Life Technologies). The sequences of HC/2G-1 TCR α and β chains are found herein as SEQ ID NOs: 1-4, wherein SEQ ID NO: 1 is the nucleotide sequence for TCR α, SEQ ID NO: 2 is the nucleotide sequence for TCR β, SEQ ID NO: 3 is the amino acid sequence for TGR a, and SEQ ID NO: 4 is the amino acid sequence for TCR β.
[0129] In vitro transcription of TCR α and β chains was performed using mMESSAGE mMACHINE ULTRA according to the manufacturer's recommendations (Arnbion Inc., Austin, TX, USA). The RNA was purified using the RNAeasy Mini Kit (Qiagen, Valencia, CA, USA). The electroporation of mRNAs of TCR α and β chains was performed as described previously (Cohen et al., J. Immunol. 175: 5799-5808 (2005)). In summary, PBMC from allogeneic donors were stimulated with 50 ng/ml OKT3 for 3 days, washed, and resuspended in OPTI-MEM (Invitrogen Life Technologies) at 2.5 x 107/ml. PBMC (50-200 μl) were mixed with mRNA at various amounts and transferred to pre-chilled 2-mm cuvettes (Harvard Apparatus BTX, Holliston, MA, USA). Electroporation was performed at 400V per 500 μs using an ECM830 Electro Square Wave Porator (Harvard Apparatus BTX). Following electroporation, the cells were transferred to fresh RPMI supplemented with 10% HS and 300 IU/ml IL-2, and incubated at 37°C.
[0130] Electroporated cells were analyzed for the expression of Vβ2 by flow cytometry. As shown in Figure 4A, the electroporated cells expressed Vβ2, meaning that the cells expressed the HC/2G-1 TCR α and β mRNAs.
[0131] The activity of the electroporated cells was then analyzed by assaying IFN-γ secretion upon stimulation with renal tumors. Specifically, OKT-3 stimulated T cells electroporated with mRNAs of either the HC/2G-1 TCR α chain, HC/2G-1 TCR β chain, or both (2 μg each) were co-cultured with renal tumors overnight and tested for IFN-γ secretion. RCC#11 was used as a negative control. As shown in Figure 4B, both TCR chains were required for TCR recognition of tumor cells.
[0132] T cells (1 x 105) electroporated with mRNAs (1-4 μg/106 cells) were co-cultured with renal tumors, as well as control cells overnight, and the supernatants were harvested and tested for IFN- γ secretion. HC/2G-1 T cell clones were included in the same assay as a positive control. As shown in Figure 4C, allogeneic T cells electroporated with HC/2G-1 TCR mRNAs recognize a variety of renal tumors.
[0133] OKT-3 stimulated allogeneic PBMC, CD8+-enriched, and CD4+-enriched cells were electroporated with HC/2G-1 TCR mRNAs (2 μg/ml) and co-cultured with renal tumors overnight. The supernatants were harvested and tested for IFN-γ secretion. RCC#11, 293 Tc, and 624 Tc served as negative controls in the assay. The Vβ2 expression of OKT-3 stimulated PBL, CD8+-enriched, and CD4+-enriched cells were also assayed and compared to the expression of CD3, CD8, and CD4, respectively. As shown in Figure 4D, the recognition of HC/2G-1 TCR to renal tumors was neither CD8- nor CD4-dependent. [0134] This example demonstrated that allogeneic cells expressing the TCR of HC/2G-1 T cell clones can recognize a variety of RCC cells in a CD8- and CD4-independent manner.
EXAMPLE 5
[0i35] This example demonstrates a method of producing allogeneic PBMCs retro virally transduced with nucleic acids encoding the TCR of HC/2G-1 T cell clones and the activity of the transduced cells.
[0136] HC/2G-1 TCR α and β chains were ligated into a pMSGVl plasmid, which is a derivative of the murine stem cell virus-based splice-gag vector (pMSGV), as described in previous publications with some modifications (Cohen et al., 2005, supra). Briefly, TCR α and β chain cDNAs were amplified by PCR using the following pairs of oligonucleotide primers to introduce appropriate restriction enzyme sites for subcloning: TCR α forward 5'- TCTAGCCATGGCACTTTCTAGCCTGC-3' (SEQ ID NO: 12) and reverse 5'- ATAGCGGCCGCTCAGCTGGACCACAG-3' (SEQ ID NO: 13); TCR β primer forward 5'- ATCTACTCGAGATGCTGCTGCTTCTGCTGCTGCTTCTG-S' (SEQ ID NO: 14) and reverse S'-TCTGCAGAATTCGGCTTCAGAAATCCTTTCTCTTG-S' (SEQ ID NO: 15). The vector was assembled by ligation of four DNA fragments: pMSGVl (Ncol/EcoRl), TCR- ct cDNA (Ncόl/Notϊ), internal ribosomal entry site (ERES) (Notl/Xhoϊ), and TCR-β cDNA (xhol/EcoW) (Figure 5A).
[0137] To produce retrovirus, Phoenix Eco cells was transfected with 24 μg of pMSGVl - HC/2G-1 plasmid DNA using Lipofectamine 2000 (Invitrogen Life Technologies). Two days later, the supernatant was harvested and used to infect a PG13 packaging line. The PG13- transduced cells were then cloned by limiting dilution. The presence of TCR genes was verified by dot-blot assay. The biological activities of retrovirus were determined by infecting SupTl with PGl 3 packaging clones and analyzed by flow cytometry. [0138] Two days before retroviral transduction, PBMCs from allogeneic donors were stimulated with OKT-3 (50 ng/ml) and IL-2 (300 IU/ml). The stimulated cells were added to RetroNectin (Takara Bio Inc. Japan), subsequently added to retrovirus pre-coated 24-well plates at 5 x 105/ml, and incubated overnight at 37°C in a 5% CO2 incubator. The procedure was repeated twice and the cells were split as necessary to maintain a cell density between 0.5 and 2 X 106 cells/ml. The expresssion of Vβ2 of the TCR was assayed to determine the retroviral transduction efficiency.
[0139] Packaging cell line PGl 3 transduced with retroviral HC/2G-1 TCR was cloned by limiting dilution. Clone E8 was selected for the remaining experiments. OKT-3 stimulated PBMCs from 4 different donors were transduced with Clone ES three times and tested for CD3 and Vβ2 expression by flow cytometry three days post-transduction. PBMCs without transduction were used as controls (not shown). As shown in Figure 5B, TCR transduced- PBMCs expressed Vβ2, indicating that the transduced cells expressed the TCR of HC/2G-1 T cell clones.
[0140] Three days after transduction, TCR-transduced PBMC (1 x 105/well) were co- cultured with renal tumors overnight and tested for IFN-γ secretion. GFP-transduced PBMC and HC/2G-1 (1 x 104/well) served as negative and positive controls, respectively. As shown in Figure 5 C, PBMCs transduced with HC/2G-1 TCR recognized a variety of renal tumors. [0141] CD8- and CD4-enriched cells were isolated from GFP- or TCR-transduced PBMCs. As shown in Figure 5D, the recognition by HC/2G-1 TCR in TCR-transduced PBMCs was both CD8- and CD4-independent.
[0142] This example demonstrated that allogeneic PBMCs can be transduced to express the TCR of HC/2G-1 T cell clones and have activity that is similar to HC/2G-1.
EXAMPLE 6
[0143] This example demonstrates a method of treating cancer in a patient. [0144] Human TILs from the tumors of patients are expanded as described in Walter et al., New England J. of Med. 333: 1038-1044 (1995). Briefly, TIL are expanded in the rapid expansion protocol (REP) in the presence of OKT3 and allogeneic feeder PBMCs. On day 7, TIL are transduced by exposing cells to Retronectin-coated plus TCR vector-coated tissue culture plates and incubated on the plates overnight. The transduction is repeated on the following day in the same manner. Cells are then washed and maintained in CM supplemented with IL-2. Eight days later, cells are assayed for activity by co-incubating transduced cells (1 x 105 cells per well of a flat-bottom 96 well plate) with 1 x 105 target cells (e.g., RCC cells). After 24 hours of incubation, supernatants are harvested and IFNγ is quantified by ELISA capture assay. The cells which release >200 pg/ml IFNγ against the appropriate target cells (e.g., RCC cells) are further expanded. FACS analysis for the specific Vβ gene protein is used to detect the transduced genetic material. The level of the transduced Vβ gene expression is expected to be >5% prior to cell infusion. [0145] Active transduced TIL are further expanded by stimulating with OKT3, allogeneic feeder cells, and IL-2. These components are mixed together in a tissue culture flask and transduced TIL are added to the flask.
[0146] PBLs are isolated by leukopheresis. Lymphocytes are separated by centrifugation on a Ficoll cushion, washed in HBSS, then resuspended at a concentration of 1 x 106 cells/ml in T cell culture medium supplemented with 50 ng/ml OK.T3, 300 IU/ml IL-2, and 5% human AB serum. After 2 days of culture, cells are collected, resuspended in fresh medium without OKT3, plated onto tissue culture plates pre-coated with Retronectin and the TCR retroviral vectors, and incubated overnight. The transduction is repeated the following day. Two days after this last transduction, the PBLs are assayed for the presence of Vβ gene expression and for activity as described above. At least 10% of more of the transduced cells are expected to express the Vβ gene. Also, transduced cells are expected to release >200 pg/ml IFNγ against the appropriate target cells.
[0147] The active and transduced TIL or PBLs are infused into RCC patients by intravenous infusion plus IV -IL-2 (720,000 IU/kg q8h for a maximum of 15 doses). Patients' blood samples are obtained and are tested for T cells expressing the Vβ gene at I5 3, 6, and 12 months after infusion. RCC tumor regression is expected to ensue.
[0148] This example demonstrates a method of treating renal cell carcinoma in a patient. [0149] All references, including publications, patent applications, and patents, cited herein are hereby incorporated by reference to the same extent as if each reference were individually and specifically indicated to be incorporated by reference and were set forth in its entirety herein.
[0150] The use of the terms "a" and "an" and "the" and similar referents in the context of describing the invention (especially in the context of the following claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. The terms "comprising," "having," "including," and "containing" are to be construed as open-ended terms (i.e., meaning "including, but not limited to,") unless otherwise noted. Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., "such as") provided herein, is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention. [0151] Preferred embodiments of this invention are described herein, including the best mode known to the inventors for carrying out the invention. Variations of those preferred embodiments may become apparent to those of ordinary skill in the art upon reading the foregoing description. The inventors expect skilled artisans to employ such variations as appropriate, and the inventors intend for the invention to be practiced otherwise than as specifically described herein. Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context.

Claims

CLAIM(S):
1. An isolated or purified TCR comprising the amino acid sequences of SEQ ID NOs: 16-21.
2. The isolated or purified TCR of claim 1, comprising the amino acid sequences of SEQ ID NOs: 7 and 8.
3. The isolated or purified TCR of claim 2, comprising the amino acid sequences of SEQ ID NOs: 3 and 4.
4. An isolated or purified polypeptide comprising a functional portion of the TCR of any of claims 1 to 3, wherein the functional portion comprises the amino acid sequences of SEQ ID NOs: 16-2.1.
5. The isolated or purified polypeptide of claim 4, wherein the portion comprises the amino acid sequence of SEQ ID NO: 8 or the amino acid sequences of SEQ ID NOs: 7 and 8.
6. The isolated or purified polypeptide of claim 5, comprising an amino acid sequence of SEQ ID NO: 3 or 4, or both SEQ ID NOs: 3 and 4.
7. An isolated or purified protein comprising at least one of the polypeptides of any of claims 4 to 6.
8. The isolated or purified protein of claim 7, comprising a first polypeptide chain comprising the amino acid sequence of SEQ ID NO: 7 and a second polypeptide chain comprising the amino acid sequence of SEQ ID NO: 8.
9. The isolated or purified protein of claim 8, comprising a first polypeptide chain comprising the amino acid sequence of SEQ ID NO: 3 and a second polypeptide chain comprising the amino acid sequence of SEQ ID NO: 4.
10. The isolated or purified protein of any of claims 7 to 9, wherein the protein is a fusion protein.
11. The isolated or purified protein of any of claims 7 to 10, wherein the protein is a recombinant antibody.
12. An isolated or purified nucleic acid comprising a nucleotide sequence encoding the TCR of any of claims 1 to 3, the polypeptide of any of claims 4 to 6, or the protein of any of claims 7 to 11.
13. The isolated or purified nucleic acid of claim 12, wherein the nucleotide sequence comprises SEQ ID NO: 1, 2, or 6, both SEQ ID NOs: 1 and 2, or both SEQ ID NOs: 5 and 6.
14. An isolated or purified nucleic acid comprising a nucleotide sequence which is complementary to the nucleotide sequence of the nucleic acid of claim 12 or 13.
15. An isolated or purified nucleic acid comprising a nucleotide sequence which hybridizes under stringent conditions to the nucleotide sequence of the nucleic acid of claim 12 or 13.
16. A recombinant expression vector comprising the nucleic acid of any of claims 12 to 15.
17. The recombinant expression vector of claim 16, wherein the vector is a retroviral vector.
18. An isolated host cell comprising the recombinant expression vector of claim 16 or 17.
19. The isolated host cell of claim 18, wherein the cell is a peripheral blood lymphocyte (PBL).
20. The isolated host cell of claim 19, wherein the PBL is a CD8+ T cell or a CD4+ T cell.
21. A population of cells comprising at least one host cell of any of claims 18 to 20.
22. An antibody, or antigen binding portion thereof, which specifically binds to a functional portion of the TCR of any of claims 1 to 3, wherein the functional portion comprises the amino acid sequences of SEQ ID NOs: 16-21.
23. A pharmaceutical composition comprising the TCR of any of claims 1 to 3, the polypeptide of any of claims 4 to 6, the protein of any of claims 7 to 11, the nucleic acid of any of claims 12 to 15, the recombinant expression vector of claim 16 or 17, the host cell of any of claims 18 to 20, the population of cells of claim 21, the antibody, or antigen binding portion thereof, of claim 22, and a pharmaceutically acceptable carrier.
24. A method of detecting the presence of cancer in a host, comprising:
(i) contacting a sample comprising cells of the cancer with the TCR of any of claims 1 to 3, the polypeptide of any of claims 4 to 6, the protein of any of claims 7 to 11, the nucleic acid of any of claims 12 to 15, the recombinant expression vector of claim 16 or 17, the host cell of any of claims 18 to 20, the population of cells of claim 21, or the antibody, or antigen binding portion thereof, of claim 22, thereby forming a complex, and (ii) detecting the complex, wherein detection of the complex is indicative of the presence of cancer in the host.
25. A method of treating or preventing cancer in a host, comprising administering to the host the TCR of any of claims 1 to 3, the polypeptide of any of claims 4 to 6, the protein of any of claims 7 to 11, the nucleic acid of claim 12 or 13, a recombinant expression vector comprising the nucleic acid, a host cell comprising the recombinant expression vector, or a population of cells comprising the host cell, in an amount effective to treat or prevent cancer in the host.
26. The method of claim 23 or 24, wherein the cancer is kidney cancer.
27. The method of claim 25, wherein the kidney cancer is renal cell carcinoma (RCC).
28. The method of any of claims 23 to 26, wherein the host cell is a cell that is autologous to the host.
29. The method of any of claims 23 to 26, wherein the cells of the population are cells that are autologous to the host.
PCT/US2007/004454 2006-02-24 2007-02-22 T cell receptors and related materials and methods of use WO2007100568A2 (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
US12/196,833 US7820174B2 (en) 2006-02-24 2008-08-22 T cell receptors and related materials and methods of use
US12/870,941 US8431690B2 (en) 2006-02-24 2010-08-30 T cell receptors and related materials and methods of use
US13/851,473 US9567387B2 (en) 2006-02-24 2013-03-27 T cell receptors and related materials and methods of use

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US77619406P 2006-02-24 2006-02-24
US60/776,194 2006-02-24
US81142206P 2006-06-07 2006-06-07
US60/811,422 2006-06-07

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US12/196,833 Continuation-In-Part US7820174B2 (en) 2006-02-24 2008-08-22 T cell receptors and related materials and methods of use

Publications (2)

Publication Number Publication Date
WO2007100568A2 true WO2007100568A2 (en) 2007-09-07
WO2007100568A3 WO2007100568A3 (en) 2008-03-13

Family

ID=38459523

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2007/004454 WO2007100568A2 (en) 2006-02-24 2007-02-22 T cell receptors and related materials and methods of use

Country Status (1)

Country Link
WO (1) WO2007100568A2 (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010022198A2 (en) * 2008-08-22 2010-02-25 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services T cell receptors and related materials and methods of use
WO2010089412A1 (en) * 2009-02-09 2010-08-12 Helmholtz Zentrum Muenchen Deutsches Forschungszentrum Fuer Gesundheit Und Umwelt (Gmbh) Repertoire of allo-restricted peptide-specific t cell receptor sequences and use thereof
US20120009162A1 (en) * 2009-04-03 2012-01-12 Masaki Yasukawa T cell receptor and nucleic acid encoding the receptor
EP3515935A4 (en) * 2016-09-23 2019-09-04 Lion TCR Pte. Ltd. An hbv antigen specific binding molecules and fragments thereof

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001073032A2 (en) * 2000-03-27 2001-10-04 Corixa Corporation Compositions and methods for the therapy and diagnosis of prostate cancer
WO2003000928A2 (en) * 2001-06-25 2003-01-03 Buadbo Aps Methods for identification of cancer cell surface molecules and cancer specific promoters, and therapeutic uses thereof
EP1275400A1 (en) * 2001-07-05 2003-01-15 GSF-Forschungszentrum für Umwelt und Gesundheit GmbH Therapeutic composition of non MHC-restricted T-cells/NK-cells and MHC-restricted cells for the treatment of tumors
WO2005056595A2 (en) * 2003-12-06 2005-06-23 Imperial Innovations Limited T cell receptor specific for wilms tumor antigen

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001073032A2 (en) * 2000-03-27 2001-10-04 Corixa Corporation Compositions and methods for the therapy and diagnosis of prostate cancer
WO2003000928A2 (en) * 2001-06-25 2003-01-03 Buadbo Aps Methods for identification of cancer cell surface molecules and cancer specific promoters, and therapeutic uses thereof
EP1275400A1 (en) * 2001-07-05 2003-01-15 GSF-Forschungszentrum für Umwelt und Gesundheit GmbH Therapeutic composition of non MHC-restricted T-cells/NK-cells and MHC-restricted cells for the treatment of tumors
WO2005056595A2 (en) * 2003-12-06 2005-06-23 Imperial Innovations Limited T cell receptor specific for wilms tumor antigen

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
ENGELS BORIS ET AL: "Redirecting human T lymphocytes toward renal cell carcinoma specificity by retroviral transfer of T cell receptor genes." HUMAN GENE THERAPY JUL 2005, vol. 16, no. 7, July 2005 (2005-07), pages 799-810, XP002460992 ISSN: 1043-0342 *
JANTZER P ET AL: "Human renal cell carcinoma antigen-specific CTLs: antigen-driven selection and long-term persistence in vivo." CANCER RESEARCH 15 JUL 1998, vol. 58, no. 14, 15 July 1998 (1998-07-15), pages 3078-3086, XP002460991 ISSN: 0008-5472 *
SCHENDEL D J ET AL: "Cellular and molecular analyses of major histocompatibility complex (MHC) restricted and non-MHC-restricted effector cells recognizing renal cell carcinomas: Problems and perspectives for immunotherapy" JOURNAL OF MOLECULAR MEDICINE, SPRINGER VERLAG, DE, vol. 75, no. 6, 1997, pages 400-413, XP002217506 ISSN: 0946-2716 *
WANG QIONG J ET AL: "Generating renal cancer-reactive T cells using dendritic cells (DCs) to present autologous tumor." JOURNAL OF IMMUNOTHERAPY (HAGERSTOWN, MD. : 1997) 2005 NOV-DEC, vol. 28, no. 6, November 2005 (2005-11), pages 551-559, XP009093116 ISSN: 1524-9557 cited in the application *

Cited By (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7820174B2 (en) 2006-02-24 2010-10-26 The United States Of America As Represented By The Department Of Health And Human Services T cell receptors and related materials and methods of use
US9567387B2 (en) 2006-02-24 2017-02-14 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services T cell receptors and related materials and methods of use
US8431690B2 (en) 2006-02-24 2013-04-30 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services T cell receptors and related materials and methods of use
EP2679598A1 (en) * 2008-08-22 2014-01-01 The United States of America as represented by the Secretary, Department of Health and Human Services T cell receptors and related materials and methods of use
WO2010022198A2 (en) * 2008-08-22 2010-02-25 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services T cell receptors and related materials and methods of use
AU2009282886B2 (en) * 2008-08-22 2014-02-27 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services RCC Tcell receptors and related materials and methods of use
WO2010022198A3 (en) * 2008-08-22 2010-04-15 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Rcc t cell receptors and related materials and methods of use
WO2010089412A1 (en) * 2009-02-09 2010-08-12 Helmholtz Zentrum Muenchen Deutsches Forschungszentrum Fuer Gesundheit Und Umwelt (Gmbh) Repertoire of allo-restricted peptide-specific t cell receptor sequences and use thereof
AU2010210083B2 (en) * 2009-02-09 2015-07-02 Helmholtz Zentrum Muenchen Deutsches Forschungszentrum Fuer Gesundheit Und Umwelt (Gmbh) Repertoire of allo-restricted peptide-specific T cell receptor sequences and use thereof
AU2010210083C1 (en) * 2009-02-09 2015-11-26 Helmholtz Zentrum Muenchen Deutsches Forschungszentrum Fuer Gesundheit Und Umwelt (Gmbh) Repertoire of allo-restricted peptide-specific T cell receptor sequences and use thereof
US9409969B2 (en) 2009-02-09 2016-08-09 Helmholtz Zentrum München Deutsches Forschungszentrum Für Gesundheit Und Umwelt (Gmbh) Repertoire of allo-restricted peptide-specific T cell receptor sequences and use thereof
US20120009162A1 (en) * 2009-04-03 2012-01-12 Masaki Yasukawa T cell receptor and nucleic acid encoding the receptor
EP3515935A4 (en) * 2016-09-23 2019-09-04 Lion TCR Pte. Ltd. An hbv antigen specific binding molecules and fragments thereof

Also Published As

Publication number Publication date
WO2007100568A3 (en) 2008-03-13

Similar Documents

Publication Publication Date Title
US9567387B2 (en) T cell receptors and related materials and methods of use
EP3636665B1 (en) T cell receptors recognizing mhc class ii-restricted mage-a3
EP3527584B1 (en) Medical use of cells comprising anti-ny-eso-1 t cell receptors
EP2016102B1 (en) Chimeric t cell receptors and related materials and methods of use
EP3533802B1 (en) Anti-ssx-2 t cell receptors and related materials and methods of use
EP3392270B1 (en) T cell receptors recognizing hla-a1- or hla-cw7-restricted mage
EP2828290B1 (en) Anti-mesothelin chimeric antigen receptors
WO2012054825A1 (en) Anti-mage-a3 t cell receptors and related materials and methods of use
WO2008039818A2 (en) Modified t cell receptors and related materials and methods
WO2010088160A1 (en) T cell receptors and related materials and methods of use
WO2009042570A2 (en) Modified t cell receptors and related materials and methods
AU2015346350B2 (en) Anti-thyroglobulin t cell receptors
WO2007100568A2 (en) T cell receptors and related materials and methods of use

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase in:

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 07751228

Country of ref document: EP

Kind code of ref document: A2