WO2007099994A1

WO2007099994A1 - Novel carbonyl reductase, gene for the reductase, vector, transformant, and method for production of optically active alcohol utilizing these materials

Info

Publication number: WO2007099994A1
Application number: PCT/JP2007/053739
Authority: WO
Inventors: Tozo Nishiyama; Noriyuki Kizaki; Yoshihiko Yasohara
Original assignee: Kaneka Corporation
Priority date: 2006-03-02
Filing date: 2007-02-28
Publication date: 2007-09-07

Abstract

The object is to provide a method for producing (R)-1-(3,4-dimethoxyphenyl)-2-propanol with good efficiency. Thus, disclosed are: a polypeptide which is isolated from Pseudomonas stutzeri and is capable of reducing 3,4-dimethoxyphenylacetone asymmetrically to produce (R)-1-(3,4-dimethoxyphenyl)-2-propanol; DNA encoding the polypeptide; a transformant capable of producing the polypeptide; and a method for production of an optically active alcohol by reducing a carbonyl compound using the polypeptide or the transformant.

Description

Specification

Novel carbonyl reductase, its gene, vector, transformant, and method for producing optically active alcohol using them

Technical field

The present invention relates to a novel carbonyl reductase, its gene, a vector containing the gene, a transformant transformed with the vector, and a method for producing an optically active alcohol using them. Background art

Optically active alcohols such as (R) — 1 — (3,4-dimethoxyphenyl) — 2 — propanol are useful compounds as synthetic raw materials and intermediates for agricultural chemicals and pharmaceuticals. As a method of asymmetrically reducing 3,4_dimethoxyphenylacetone to produce (R) — 1- (3,4-dimethoxyphenyl) 1 2-propanol, There is known a reduction method using cells of microorganisms belonging to the genus of media and Pseudomonas (Patent Document 1). Also, the alcohol dehydrogenase derived from the genus Leifsonia asymmetrically reduces 3,4-dimethoxyphenylacetone to produce (R) -1- (3,4-dimethoxyphenyl) -1-2-propanol. Is known (Non-Patent Document 1).

Patent Document 1: Patent No. 3587569

Non-Patent Document 1: Kousuke Inoue et al, Tetrahedron: Asymmetry (2005) 16, 253 9-2549

Disclosure of the invention

Problems to be solved by the invention

[0003] The present invention is a method using a microorganism of Patent Document 1 described above and a novel carbonyl reductase, a gene thereof, a vector containing the gene, and transformation using the vector, which are different from the enzymes disclosed in Non-Patent Document 1. It is an object of the present invention to provide a method for producing an optically active alcohol using the transformed transformant. Means for solving the problem

[0004] The present invention has one or more of the following features. [0005] (1) One feature of the present invention is the following DNA (a) or (b).

(a) DNA comprising the base sequence shown in SEQ ID NO: 1 in the sequence listing;

(b) Hybridizing with DNA containing a nucleotide sequence complementary to the nucleotide sequence shown in SEQ ID NO: 1 in the sequence listing under stringent conditions and reducing a compound having a carbonyl group to produce an optically active alcohol DNA encoding a polypeptide having the activity of

(2) Another feature of the present invention is the following DNA (a) or (b):

(b) Hybridizes under stringent conditions with DNA containing a base sequence complementary to the base sequence shown in SEQ ID NO: 1 in the sequence listing and asymmetrically reduces 3,4-dimethoxyphenylacetone. , (R) _l_ (3,4-dimethoxyphenyl) _2_DNA encoding a polypeptide having an activity to produce propanol.

[0007] (3) Another feature of the present invention is the following polypeptide (a) or (b).

(a) a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 2 in the sequence listing;

(b) A polypeptide comprising an amino acid sequence showing 80% homology (identity) with the amino acid sequence shown in SEQ ID NO: 2 in the sequence listing, and asymmetric 3,4-dimethoxyphenylacetone A polypeptide having an activity of reducing to form (R) -l- (3,4-dimethoxyphenyl) -2-propanol.

[0008] (4) Another feature of the present invention is DNA encoding the polypeptide according to (3).

[0009] (5) Another feature of the present invention is that a compound encoded by the DNA according to any one of (1), (2), and (4) and having a carbonyl group is reduced. A polypeptide having an activity of producing optically active alcohols.

[0010] (6) Another feature of the present invention is encoded by the DNA described in either (2) or (4), and asymmetrically reduces 3,4-dimethoxyphenylacetone. , (R) — 1— (3, 4-Dimethoxy diphenyl) — a polypeptide having activity to produce 2-propanol.

[0011] (7) Another feature of the present invention is a vector comprising the DNA according to any one of (1), (2), and (4).

[8] Another feature of the present invention is the vector according to claim 7, further comprising DNA encoding a polypeptide having glucose dehydrogenase activity. [0013] (9) Another feature of the present invention is a transformant obtained by transforming a host cell with the vector according to any one of (7) and (8).

(10) Another feature of the present invention is the transformant according to (9), wherein the host cell is Escherichia coli.

(11) Another feature of the present invention is that the polypeptide according to (3), (5) or (6), or the transformant according to (9) or (10) A method for producing an optically active alcohol, characterized by reacting with a compound having a ru group.

[0016] Other features and effects of the present invention will become apparent from the following embodiments, examples, drawings, and the like.

The invention's effect

The present invention provides a novel carbonyl reductase, its gene, a vector containing the gene, a transformant transformed with the vector, and a method for producing an optically active alcohol using them.

Brief Description of Drawings

[0018] FIG. 1 shows a production method and structure of a recombinant vector pNPSG as an embodiment of the present invention.

BEST MODE FOR CARRYING OUT THE INVENTION

Hereinafter, the present invention will be described in detail using embodiments. The present invention is not limited by these.

[0020] 1. Polypeptide

The “polypeptide” of the present invention is asymmetrically produced by reducing a compound having a carbonyl group and producing an optically active alcohol, preferably 3,4-dimethoxyphenylaceton. It is a polypeptide having the activity of reducing to produce (R) _l_ (3,4-dimethoxyphenyl) _2_propanol. Such a polypeptide can be isolated from organisms such as microorganisms having the activity.

[0021] As an embodiment of the polypeptide of the present invention, a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 of the sequence listing encoded by the base sequence shown in SEQ ID NO: 1 of the sequence listing can be mentioned. In addition, a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 2 in the sequence listing. It has a certain degree of homology (identity) with the peptide, and asymmetrically reduces 3,4-dimethoxyphenyl ketone, and (R) — 1- (3, 4-dimethoxyphenyl) 1) A polypeptide having an activity to produce 2-propanol is equivalent to the polypeptide and is included in the present invention.

[0022] Here, the sequence homology is obtained when, for example, two amino acid sequences are compared and analyzed using the homology search program FASTA (WR Pearson & DJ Lipman PNAS (1988) 85: 2444-2448). Represented by the Identity value for. As a polypeptide having a homology of a certain value or more with a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 in the sequence listing, the homology with the polypeptide is 80% or more, preferably 90% or more, more preferably May include polypeptides that are 95% or more.

[0023] Conventionally, as a polypeptide having an activity to asymmetrically reduce 3,4-dimethoxyphenylacetone to produce (R) _ 1 _ (3, 4-dimethoxy) _ 2 _propanol, Alcohol dehydrogenase derived from the genus Leifsonia has been reported (Non-patent Document 1: Kous uke Inoue et al, Tetrahedron: Asymmetry (2005) 16 2539-2549). However, the amino acid sequence homology between this polypeptide and the polypeptide of the present embodiment is 33.5%, which is essentially different from the polypeptide of the present embodiment.

[0024] A homology search of the amino acid sequence shown in SEQ ID NO: 2 of the Sequence Listing using the above-described homology search program FASTA revealed that it was approximately 73% homologous to the 3-hydroxyacyl CoA dehydrogenase derived from Pseudomonas putida. showed that. 3—Hydroxylacyl CoA dehydrogenase is a class 1—multifunctional protein with high activity against hydroxyacyl CoA with 12 to 16 carbon atoms, class 2—approximately 35,000 molecular weight, 6 carbon atoms. Has high activity against hydroxyacil CoA, classification 3_molecular weight about 28,000, high activity against hydroxyacinole CoA with 14 carbon atoms, and 3 types of enzymes with different properties (Akio Kobayashi et al, J. Biochem. (1996) 119 775-782, Shuichi Furuta et al, Biochimica Biophysica Acta (1997) 1350 317-324, Joseph J. Barycki et al, Biochem istry (1999 ) 38 5786-5798). The polypeptide of the embodiment of the present invention exhibits about 73% homology with 3-hydroxyasinole CoA dehydrogenase belonging to the above-mentioned class 3. However, the substrate specificity of dehydrogenases belonging to this category 3 is 4 to 16 carbon atoms. It has only been reported to have a reducing activity against β-ketoesters such as 3-ketosil CoA (Akio Kobayashi et al, J. Biochem. (1996) 119 775-782). Based on the technical common knowledge of those skilled in the art, the polypeptide of the embodiment of the present invention showing high homology with a 3-hydroxylacyl CoA dehydrogenase belonging to Category 3 is significantly different in structure from β-ketoesters. In general, asymmetric reduction of dimethoxyphenylacetone cannot be achieved.

[0025] The "polypeptide" of the present invention is, for example, a DNA that hybridizes under stringent conditions with a DNA consisting of a base sequence complementary to the base sequence IJ shown in SEQ ID NO: 1 in the sequence listing. After ligation to an appropriate vector, it is obtained by introducing it into an appropriate host cell and expressing it. In addition, for example, according to a known method described in Current Protocols in Molecular Biology (John Wiley and Sons, Inc., 1989) and the like, amino acid substitution is performed on a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 in the sequence listing. It can also be obtained by causing insertions, deletions or additions. The number of amino acids causing substitution, insertion, deletion or addition is not limited as long as the activity of the polypeptide of the embodiment is not lost, but it is preferably 50 amino acids or less, more preferably 30 No more than amino acids, more preferably no more than 10 amino acids, most preferably no more than 5.

[0026] The microorganism that is the origin of the polypeptide of the present invention is not particularly limited, and examples thereof include bacteria belonging to the genus Pseudomonas, which is particularly preferred, as Pseudomonas' Sulle (Pseudomonas ^ ϋί ^ ii) List NBRC 13596 shares. The microorganisms can be obtained from the Biological Genetic Resource Department (NBRC: Kiyotsutsu Kazusa 2_5 -8 Chiba Prefecture), National Institute of Biotechnology, Biotechnology Division, National Institute for Product Evaluation and Technology (NBRC).

[0027] As a medium for culturing the microorganism that is the source of the polypeptide of the present invention, as long as the microorganism grows, a normal liquid nutrient medium containing a carbon source, a nitrogen source, inorganic salts, organic nutrients, etc. Can be used.

[0028] Isolation of the polypeptide from the microorganism that is the source of the polypeptide of the present invention can be carried out by appropriately combining known protein purification methods. For example, it can be implemented as follows. First, the microorganism is cultured in an appropriate medium, and centrifuged from the culture solution. Or, the cells are collected by filtration. The obtained cells are crushed by a physical method using an ultrasonic breaker or glass beads, and then the cell residue is removed by centrifugation to obtain a cell-free extract. And salting out (ammonium sulfate precipitation, sodium phosphate precipitation, etc.), solvent precipitation (protein fraction precipitation with acetone or ethanol, etc.), dialysis, gel filtration chromatography, ion exchange chromatography, reverse phase chromatography, By using a technique such as ultrafiltration alone or in combination, the polypeptide of the present invention is isolated from the cell-free extract.

[0029] 2. DNA

The “DNA” of the present invention is asymmetric with a DNA encoding a polypeptide having an activity of reducing a compound having a carbonyl group to produce an optically active alcohol, preferably 3,4-dimethoxyphenylacetone. It is a DNA that encodes a polypeptide having the activity of reducing and producing (R) -1- (3,4-dimethoxyphenyl) -2-propanol. In a host cell introduced according to the method described below, Any untranslated region may be included as long as it can express the polypeptide. If the polypeptide can be obtained, a person skilled in the art can obtain the DNA of the present invention from a microorganism that is the origin of the polypeptide by a known method. For example, the DNA of the present invention can be obtained by the method shown below.

[0030] First, the isolated polypeptide of the present invention is digested with an appropriate endopeptidase, and the resulting peptide fragment is fractionated by reverse phase HPLC. Then, for example, a part or all of the amino acid sequences of these peptide fragments are determined by ABI492 type sequencer (Applied Biosystems).

[0031] Based on the amino acid sequence information thus obtained, a PCR (Polymerase Chain Reaction) primer for amplifying a part of DNA encoding the polypeptide is synthesized. Next, chromosomal DNA of the microorganism that is the origin of the polypeptide is prepared by a conventional DNA isolation method, for example, the method of Visser et al. (Appl. Microbiol. Biotechnol., 53, 415 (2000)). Using this chromosomal DNA as a saddle, PCR is performed using the PCR primers described above, a part of the DNA encoding the polypeptide is amplified, and the nucleotide sequence is determined. For example, ABI373A DNA Sequencer (Applied Biosystems) Etc.).

[0032] Once the partial nucleotide sequence of the DNA encoding the polypeptide is clarified, for example, i—PCR method (Nucl. Acids Res., 16, 8186 (1988)) is used to determine the entire sequence. be able to.

[0033] As an embodiment of the DNA of the present invention thus obtained, a DNA containing the base sequence shown in SEQ ID NO: 1 in the Sequence Listing can be mentioned. Further, it has a base sequence in which one or several bases are substituted, inserted, deleted and / or added in SEQ ID NO: 1, and 3,4-dimethoxyphenylacetone is asymmetrically reduced. , (R) -1- (3,4-dimethoxyphenyl) -2-DNA encoding a polypeptide having activity to produce propanol is included in the present invention. The “several bases” is not limited as long as the polypeptide encoded by DNA does not lose the above activity, but is preferably 150 bases or less, more preferably 100 bases or less, and even more preferably 50 No more than bases, most preferably no more than 25 bases.

[0034] Further, a polypeptide comprising the base sequence represented by SEQ ID NO: 1 having a homology of 80% or more, preferably 90% or more, more preferably 95% or more and having the above activity. DNA encoding a tide is included in the present invention.

[0035] Furthermore, it is a DNA that hybridizes under stringent conditions with DNA consisting of a base sequence complementary to the base sequence shown in SEQ ID NO: 1 in the sequence listing, and asymmetric with 3,4-dimethoxyphenylacetone. The DNA of the present invention also includes a DNA that encodes a polypeptide having an activity of being reduced to form (R) -1- (3,4-dimethoxyphenyl) -2-propanol. Furthermore, it is DNA that hybridizes under stringent conditions with DNA consisting of a nucleotide sequence complementary to the nucleotide sequence shown in SEQ ID NO: 1 and has an activity of reducing a compound having a carbonyl group to produce an optically active alcohol. A DNA encoding a polypeptide having the above is also included in the DNA of the present invention.

[0036] A DNA comprising a base sequence complementary to the base sequence shown in SEQ ID NO: 1 in the sequence listing and a DNA that hybridizes under stringent conditions include colony'hybridization method, plaque'hybridizer. DN consisting of a base sequence complementary to the base sequence shown in SEQ ID NO: 1 in the sequence listing when the hybridization method or Southern hybridization method is performed. A force A DNA that specifically forms a hybrid.

Here, the stringent conditions are, for example, 75 mM trisodium citrate, 750 mM sodium chloride, 0.5% sodium dodecyl sulfate, 0.1% ushi serum albumin, 0.1% polyvinylinole. After hybridization at 65 ° C in an aqueous solution composed of pyrrolidone and 0.1% Ficoll 400 (Amersham Biosciences), 15 mM trisodium citrate, 150 mM sodium chloride, and 0. The conditions under which cleaning is performed at 60 ° C using an aqueous solution composed of 1% sodium dodecyl sulfate. Preferably, after hybridization under the above conditions, washing is performed at 65 ° C. using an aqueous solution composed of 15 mM trisodium citrate, 150 mM sodium chloride, and 0.1% sodium dodecinole sulfate. More preferably, the washing is performed at 65 ° C. using an aqueous solution composed of 1.5 mM trisodium citrate, 15 mM sodium chloride, and 0.1% sodium dodecyl sulfate.

[0038] Unless otherwise specified, the isolation of the above-described DNA described in this specification and the genetic manipulation such as vector preparation and transformation described below are described in Molecular Cloning 2nd Edition (Cold Spring Harbor Laboratory Press, 1989) and the like. Further,% used in the description of the present specification assumes% (w / V) unless otherwise specified.

[0039] 3. Vector

The “vector” of the present invention is not particularly limited as long as it can express the gene encoded by the DNA in a suitable host cell. Examples of such vectors include plasmid vectors, phage vectors, cosmid vectors, and shuttle vectors capable of exchanging genes with other host strains can also be used.

[0040] Such vectors usually contain regulatory elements such as lacUV5 promoter, trp promoter, trc promoter, tac promoter, lpp promoter, tufB promoter, recA promoter, pL promoter, etc., and are operable with the DNA of the present invention. It can be suitably used as an expression vector comprising an expression unit linked to the. For example, PUCN18 described later can be used preferably.

[0041] The regulatory elements include functional promoters and any associated transcription elements (eg, Enhancer, CCAAT box, TATA box, SPI site, etc.).

[0042] The term "operably linked" above means that a gene regulatory force such as a promoter that regulates the expression of a gene, an enhancer, etc. is linked in a state capable of operating in a host cell. Say. It is well known to those skilled in the art that the type and kind of the control factor can vary depending on the host. As an example of the vector of the present invention, a plasmid pNPS described later in which the DNA shown in SEQ ID NO: 1 is introduced into the above pUCN18 can be mentioned (see Example 3).

[0043] 4. Host cells

Examples of the “host cell” described in the present specification include bacteria, yeast, filamentous fungi, plant cells, animal cells and the like, but Escherichia coli, which is preferred by bacteria from the introduction and expression efficiency, is particularly preferable. The vector containing the DNA of the present invention can be introduced into a host cell by a known method. When Escherichia coli is used as a host cell, the vector can be introduced into the host cell by using, for example, a commercially available coli HB101 recombinant cell (manufactured by Takara Bio Inc.).

[0044] 5. Transformant

The “transformant” of the present invention can be obtained by incorporating DNA encoding the polypeptide of the present invention into the vector and introducing it into a host cell. The “transformant” of the present invention includes not only cultured cells but also processed products thereof. As used herein, treated products include, for example, cells treated with a surfactant or an organic solvent, dried cells, disrupted cells, crude cell extracts, etc., and those obtained by immobilizing them by known means. This means that as long as the activity of asymmetrically reducing 3,4-dimethoxyphenylacetone to produce (R) — 1- (3,4-dimethoxyphenol) —2_propanol remains included. Culture of the transformant of the present invention can be performed using a normal liquid nutrient medium containing a carbon source, a nitrogen source, inorganic salts, organic nutrients and the like as long as it grows.

[0045] Examples of the transformant of the present invention include coli HBlOl (pNPS) described later (see Example 5).

[0046] 6. Method for producing optically active alcohol “Production of optically active alcohols” of the present invention is a transformant comprising a compound having a carboxy group serving as a substrate and a polypeptide of the present invention or DNA encoding the polypeptide in a suitable solvent. Can be added. If necessary, a coenzyme such as NADH may be added.

[0047] For the reaction, an aqueous solvent may be used, or an aqueous solvent and an organic solvent may be mixed and used. Examples of the organic solvent include toluene, ethyl acetate, n-butyl acetate, hexane, isopropanol, diisopropyl ether, methanol, acetone, dimethyl sulfoxide and the like. The reaction is carried out at a temperature of 10 ° C to 70 ° C, for example, and the pH of the reaction solution is maintained at 4 to 10 for example. The reaction can be carried out batchwise or continuously. In the case of a batch system, the reaction substrate is added at a charge concentration of, for example, 0.1% to 70% (w / v).

[0048] Examples of the “compound having a carbonyl group” as a substrate include, for example, 3, 4-dimethoxyphenylacetone and the like, which are reduced under the above reaction conditions and converted into “optically active alcohol” If it is, it will not be specifically limited.

[0049] Under the above reaction conditions, when 3,4 dimethoxyphenylacetone is used as a substrate, (R 1) 1 (3,4-dimethoxyphenyl) 2 propanol is obtained.

[0050] Optically active alcohols generated by the reaction can be purified by a conventional method. For example, a reaction solution containing optically active alcohols produced in the reaction is extracted with an organic solvent such as ethyl acetate or toluene, and the organic solvent is distilled off under reduced pressure, followed by distillation, recrystallization, chromatography, etc. It can refine | purify by processing.

[0051] 7. Modification of production method of optically active alcohol

By contacting and reacting the polypeptide of the present invention, a compound having a carbonyl group, and a coenzyme such as NADH as necessary, the compound having the carbonyl group is reduced asymmetrically. Optically active alcohols can be produced. At this time, as the reaction proceeds, coenzymes such as NADH are converted to oxidized forms. At this time, a polypeptide having the ability to convert this oxidized coenzyme into a reduced form (hereinafter referred to as coenzyme regeneration ability) and a compound serving as a substrate for the polypeptide are converted to the polypeptide of the present invention. The amount of coenzyme used can be reduced by carrying out the reaction in the presence of. [0052] Examples of the polypeptide having coenzyme regeneration ability include hydrogenase, formate dehydrogenase, alcohol dehydrogenase, aldehyde dehydrogenase, glucose 6-phosphate dehydrogenase, and gnolecose dehydrogenase. . Preferably, glucose dehydrin enzyme is used.

[0053] Examples of vectors in which both the DNA encoding the polypeptide of the present invention and the DNA encoding the polypeptide having coenzyme regeneration ability are incorporated include the above-described expression vector pNPS and glucose dehydration derived from Bacillus megaterium Examples include pNPSG, which will be described later, into which an enzyme gene has been introduced (see Example 4).

[0054] A transformant containing both a DNA encoding the polypeptide of the present invention and a DNA encoding a polypeptide having a coenzyme regeneration ability has a DNA encoding the polypeptide of the present invention and a coenzyme regeneration ability. In addition to incorporating both of the DNAs encoding the polypeptides in the same vector and introducing them into host cells, these two types of DNA are incorporated into two different vectors of different incompatibility groups, They can also be obtained by introducing the two vectors into the same host cell. An example of a transformant containing both the DNA encoding the polypeptide of the present invention and the DNA encoding a polypeptide capable of coenzyme regeneration is obtained by transforming coli HB101 with the above-described pNPSG. Examples thereof include coli HBlOl (pNPSG) described later (see Example 5).

[0055] The culture of a transformant containing both the DNA encoding the polypeptide of the present invention and the DNA encoding the polypeptide having the coenzyme regeneration ability is a normal carbon source as long as it grows. , Using a liquid nutrient medium containing nitrogen sources, inorganic salts, organic nutrients, etc.

[0056] When an optically active alcohol is produced by combining the polypeptide of the present invention and a polypeptide having a coenzyme regenerating ability, the above reaction composition contains a polypeptide having a coenzyme regenerating ability (for example, glucose dehydrogenation). Enzyme) and its substrate compound (eg, dalcose) are further added. Optically active alcohols can be produced in the same manner using a transformant containing both the DNA encoding the polypeptide of the present invention and the DNA encoding a polypeptide having coenzyme regeneration ability. In particular, the polypeptides of the present invention. When a transformant containing both a DNA encoding a peptide and a DNA encoding a polypeptide having a coenzyme regeneration ability or a processed product thereof, a polypeptide having a coenzyme regeneration ability (for example, glucose The production of optically active alcohols can be performed more efficiently.

[0057] As described above, according to the present invention, the polypeptide of the present invention can be efficiently produced, and by using it, for example, (R) — 1 — (3,4-dimethoxyphenyl) ) An excellent method for producing useful optically active alcohols including 2_propanol is provided (see Example 7).

Example

[0058] Hereinafter, the present invention will be described in detail with reference to Examples, but the present invention is not limited thereto. In addition, the detailed operation method related to the recombinant DNA technology used in the following examples is described in the following document:

Molecular lonmg 2nd Edition (old Spring Harbor Laboratory Press, 1989), Current Protocols in Molecular Biology (Greene Publishing Associates and Wiley-Interscien ce)

[Example 1] Purification of polypeptide

According to the following method, 3,4-dimethoxyphenylacetone was asymmetrically reduced from Pseudomonas stutzeri (Pseudomonas stutzeri) NB RC13596 (R) — 1- (3,4-dimethoxyphenyl) _ Polypeptides with activity to produce 2_propanol were isolated and purified to a single. Unless otherwise specified, purification operations were performed at 4 ° C.

[0060] The reduction activity for 3,4-dimethoxyphenylacetone was obtained by adding 2 mM substrate 3,4-dimethoxy to lOOmM phosphate buffer (pH 6.5) containing 0.4% (v / v) dimethylol sulfoxide. Add siphenylacetone, 0.167 mM coenzyme NADH, and crude enzyme 30. It was calculated from the rate of decrease in absorbance at a wavelength of 340 nm when reacted with C for 1 minute. Under this reaction condition, the activity to oxidize 1 / i mol NADH to NAD per minute is defined as limit.

[0061] (Cultivation of microorganisms)

To 5L jar mentor (manufactured by Maruhishi Bio-Engy), meat extract 10g, peptone 15g, Prepare 3 L of liquid medium (pH 6) with a composition of 5 g yeast extract, 3 g sodium salt, 3 g Ade-Kinol LG-109 (manufactured by NOF Corporation) and 0.1 g (Les, per liter), 120 ° C And steam sterilized for 20 minutes. This medium was inoculated with 30 ml of the culture solution of Pseudomonas ϋ CBRC 596RC previously cultured in the same medium, stirring speed 400 rpm, aeration rate 0.9 NL / min, 25 Culturing was carried out at ° C for 37 hours.

[0062] (Preparation of cell-free extract)

Bacteria were collected from the culture broth by centrifugation and washed with 0.85% aqueous sodium chloride solution. The cells are suspended in a 40 mM phosphate buffer (pH 7.5) containing a protease inhibitor cocktail (Roche), crushed using a SONIFIER250 ultrasonic crusher (BRANSON), and then centrifuged. The cell residue was removed to obtain a cell-free extract.

[0063] (Heat treatment)

The cell-free extract obtained above was treated at 45 ° C. for 20 minutes, and then the insoluble fraction was removed by centrifugation to obtain a heat-treated cell-free extract.

[0064] (Ammonium sulfate fraction)

Ammonium sulfate was added to the heat-treated cell-free extract obtained above to a final concentration of 1 M and stirred for 1 hour, and then the precipitate was removed by centrifugation. Ammonium sulfate was added to the supernatant to a final concentration of 3M, and after stirring for 1 hour, a precipitate was obtained by centrifugation. This precipitate was dissolved in 40 mM phosphate buffer (pH 7.5) and dialyzed overnight against the same buffer.

[0065] (DEAE— TO YOPEARL column chromatography)

The active fraction of the ammonium sulfate fraction was applied to a DEAE-TOYOPEARL 650M (Tosohichi Co., Ltd.) column (30 ml) pre-equilibrated with 40 mM phosphate buffer (pH 7.5) to elute the active fraction. . The active fractions, 10 mM phosphate buffer solution _(P H7. 5) was dialyzed overnight at, 10 mM phosphate buffer (pH7. 5) (manufactured by Tosoh Corporation) DEAE-TOYOPEARL 650M, previously equilibrated with The column was applied to a column (30 ml) to adsorb the active fraction. After washing the strength ram with the same buffer, the active fraction was eluted with a NaCl linear gradient (from 0 M to 0.2 M).

[0066] (Phenyl— TOYOPEARL column chromatography) DEAE—dissolve ammonium sulfate in the active fraction obtained by TOYOPEARL column chromatography to a final concentration of 0.8 M, and pre-load with 10 mM phosphate buffer (ρΗ7.5) containing 0.8 M ammonium sulfate. The column was applied to an equilibrated Phenyl-TOYOPEARL 650M (Tosoh Corp.) column (4 ml) to adsorb the active fraction. After washing the column with the same buffer, the active fraction was eluted with a linear gradient of ammonium sulfate (from 0.8 M to 0 M). The active fraction was collected and dialyzed overnight against 10 mM phosphate buffer (pH 7.5).

The active fraction obtained by Phenyl-TOYOPEARL column chromatography was applied to a Blue Sepharose 6 Fast Flow (Amersham Biosciences) column (2 ml) pre-equilibrated with 10 mM phosphate buffer (pH 7.5). The active fraction was adsorbed. After washing the column with the same buffer, the active fraction was eluted with NaCl stepwise (from 0M to 2M every 0.2M) to obtain a purified preparation of a single polypeptide by electrophoresis.

[0068] (Example 2) Gene cloning

(Create PCR primers)

The purified polypeptide obtained in Example 1 was denatured in the presence of 8M urea, and then digested with achromobacterium-derived ricinoleendopeptidase (manufactured by Wako Pure Chemical Industries, Ltd.). The amino acid sequence of the obtained peptide fragment was converted to ABI492. Type protein sequencer (manufactured by PerkinElmer). Primer 1: 5 ′ —ATGCARATHMGNGAYAARGT— 3 ′ (SEQ ID NO: 3 in the sequence listing) for amplifying a part of the gene encoding the polypeptide by PCR based on the DNA sequence predicted from this amino acid sequence, and Primer 2: 5′—GTCATNACNCGDATNCCRAA—3 ′ (SEQ ID NO: 4 in the sequence listing) was synthesized.

[0069] (Amplification of gene by PCR)

Pseudomonas stutzeri cultivated in the same manner as in Example 1 NBRC13596 strain cell strength, et al. G NOME DNA KIT (manufactured by B-BIo gene) was used, and chromosomal DNA was extracted according to the handling instructions. . Next, PCR was performed using the DNA primers 1 and 2 prepared above and the resulting chromosomal DNA as a saddle. A DNA fragment of about 0.6 kbp, which is considered to be part of the offspring, was amplified. PCR was performed using TaKaRa Ex Taq (manufactured by Takara Bio Inc.) as a DNA polymerase, and the reaction conditions were in accordance with the handling instructions. Using this DNA fragment as a cage, its nucleotide sequence was analyzed using ABI PRISM Dye Terminator Cycle Sequencing Ready Reaction Kit (Perkin Elmer) and ABI 373A DNA Sequencer (Perkin Elmer). The nucleotide sequence found as a result is shown in SEQ ID NO: 5 in the sequence listing.

[0070] (i Determination of the full-length sequence of the gene of interest by one PCR method)

The chromosomal DNA of Pseudomonas stutzeri NBRC135 96 strain prepared above was completely digested with restriction enzyme Pstl, and the resulting mixture of DNA fragments was intramolecularly cyclized with T4 ligase. Using this as a saddle type, the entire base sequence of the gene containing the base sequence shown in SEQ ID NO: 5 was determined by i-PCR method (Nucl. Acids Res., 16, 8186 (1988)). The results are shown in SEQ ID NO: 1 in the sequence listing. i-PCR was performed using TaKaRa Ex Taq (manufactured by Takara Bio Inc.) as a DNA polymerase, and the reaction conditions were in accordance with the instruction manual.

(Example 3) Construction of expression vector

Obtained in Example 2 using primer 3: 5'—GGGAGAGCCATATGCAGATTCGCGACAAGGTA— 3 ′ (sequence table 1J number 6) and primer 4: 5′-TCTCTGGAATTCTCACTTGGCGGCCATGC GCAA-3 ′ (sequence number 7 in the sequence table) Pseudomonas ^ ϋί ^ ιΐ Perform PCR using the chromosomal DNA of NBRC13596 strain as a saddle.

[0072] As a result, a double-stranded DNA in which an Ndel recognition site was added to the start codon portion of the gene consisting of the base sequence shown in SEQ ID NO: 1 in the sequence listing and an EcoRI recognition site was added immediately after the termination codon was obtained. It was. SEQ ID NO: 2 in the sequence listing shows the amino acid sequence encoded by the gene consisting of the base sequence shown in SEQ ID NO: 1. PCR was performed using Pyrobest DNA Polymerase (manufactured by Takara Bio Inc.) as a DNA polymerase, and the reaction conditions were in accordance with the instruction manual.

[0073] The DNA fragment obtained by the above PCR was digested with Ndel and EcoRI, and the 185th T of plasmid pUCNl8 (pUC18 (manufactured by Takara Bio Inc.) was changed to A by PCR to change the Ndel substrate. The plasmid was newly introduced with the Ndel site by modifying the GC of positions 471 to 472 to TG, and inserted between the Ndel recognition site downstream of the lac promoter and the EcoRI recognition site. A replacement vector pNPS was constructed. In addition, the description of the 185th chome and the 471_472th 0th used here was in accordance with the description of 0611: 6 & 1 ^ Accession No. L09136.

[0074] m4) Glucose deflation

Primer 5: 5 '-CAGGAGCTCTAAGGAGGTTAACAATGTATAAAG-3' (SEQ ID NO: 8 in the sequence listing) and primer 6: 3 '_CACGGATCCTTATCCGCGTCCTGCTTGG 1 5' (SEQ ID NO: 9 in the sequence listing) were used to create plasmid pGDKl (Eur. J. Biochem., 186, 389 (1989), which can be obtained and prepared by those skilled in the art), and the glucose is dehydrogenase derived from Bacillus megaterium IAM 1030 (hereinafter referred to as GDH). ) Obtain double-stranded DNA with a ribosome binding sequence of E. coli 5 bases upstream from the start codon of the gene, a Sacl recognition site added just before it, and a BamHI recognition site added just after the stop codon. did.

[0075] The obtained DNA fragment was digested with Sacl and BamHI and inserted between the Sacl recognition site downstream of the lac promoter of plasmid pNP S described in Example 3 and the BamHI recognition site to construct a recombination vector pNPSG. did. Figure 1 shows the pNPSG production method and structure. In the figure, RPS gene represents a gene encoding the polypeptide of the present invention.

(Example 5) Production of transformant

Using the recombinant vector pNPS constructed in Example 3, coli HB101 complex cell (manufactured by Takara Bio Inc.) was transformed to obtain £ coli HBlOl (pNPS).

[0077] Similarly, using the recombinant vector pNPSG constructed in Example 4, I coH H B101 competent cells (manufactured by Takara Bio Inc.) were transformed to obtain £ coli HBlOKpNPS G).

[0078] The bacteriological properties of Escherichia coli HB101 are described in "BI 0 CHEMICALS F OR LIFE SCIENCE" (Toyobo Co., Ltd., 1993, pages 116 to 119) and various other known literatures. Are described and well known to those skilled in the art. The above Escherichia coli HB101 (pNPS) and Escherichia coli HB101 (pNPSG) ), Except for the ability to produce specific enzymes by genetic recombination,

Escherichia coli) Has the same mycological characteristics as HB101.

[0079] me) Kai Yun! ^ ¾ί

Each of the two transformants obtained in Example 5 and a transformant containing the vector plasmid pUCN18, £ coli HB101 (pUCN18) (comparative example), were mixed with 2 X containing 200 x gZ ml of ampicillin. YT medium (tryptone 1.6%, yeast extract 1.0% NaCl 0.5% pH 7.0) was inoculated into 5 ml, and cultured with shaking at 37 ° C for 24 hours. The cells were collected by centrifugation and suspended in 5 ml of lOOmM phosphate buffer (pH 6.5). This was crushed using a UH-50 type ultrasonic homogenizer (manufactured by SMT), and the cell residue was removed by centrifugation to obtain a cell-free extract. Table 1 shows the specific activity of the 34-dimethoxyphenylacetone reducing activity and GDH activity of this cell-free extract.

[0080] Table 1: Specific activity of cell-free extracts

[0081] [Table 1]

3, 4-Dimethoxyphenylacetone

Strain name GDH activity (U / m _g) of reducing activity (U / mg)

E. co! I HB101 (pUCN18) N.D.N.D.

E. coM HBI OKpNPS) 0.01 N.D.

E. co! I HBI OKpNPSG) 0.01 99.6

N.D .; not detectable

[0082] As shown in Table 1, in both of the two transformants obtained in Example 5, expression of 3,4-dimethoxyphenylacetone reducing activity was observed. In addition, GDH expression was also observed in fE. Coli HBIOKpNPSG) containing the GDH gene.

[0083] The 3,4-dimethoxyphenylacetone reduction activity was measured by the method described in Example 1.

GDH activity was measured by adding glucose 0 · 1340, coenzyme NAD 2 mM, and crude enzyme solution to 1M Tris-HCl buffer (ρΗ8 · 0) and reacting at 25 ° C for 1 minute, and increasing the absorbance at a wavelength of 340 nm. Calculated from speed. Under these reaction conditions, the enzyme activity that reduces 1 / i mol of NAD to NADH per minute was defined as limit.

(Example 7) Production of (R) -1 mono (3,4-dimethoxyphenyl) 2-propanol using a transformant To 1 ml of E coli HBlOl (pNPSG) culture solution cultured in the same manner as in Example 6, 10 mg of dalcose, 5 mg of NADlmg, 3,4 dimethoxyphenenoreacese was added and stirred at 30 ^° C for 20 hours. .

[0085] After completion of the reaction, the reaction solution was extracted with ethyl acetate, and the obtained organic layer was dried over anhydrous sodium sulfate. After removing sodium sulfate by centrifugation and distilling off the organic solvent under reduced pressure, (R) -1- (3,4-dimethoxyphenyl) -1-propanol was obtained by TLC. The optical purity of this product is 98.3. /. It was ee.

[0086] The optical purity of (R) _ 1 _ (3,4-dimethoxyphenyl) _ 2 _ propanol was measured by high-speed liquid chromatography (column: CHIRALP AK AD- H QD4.6 (6 mm × 250 mm), eluent: n-hexane / ethanol = 95Z5, flow rate: lmlZmin, detection: 254 nm, column temperature: room temperature).

[0087] (Example 8) Polypeptide ¾'cochlea

0. In lOOmM phosphate buffer (ρΗ6 · 5) containing 2% (v / v) dimethyl sulfoxide, the final concentration of carbohydrate compound as the substrate is lmM and the coenzyme NADH is 0. Each was dissolved to 167 mM. An appropriate amount of the purified polypeptide prepared in Example 1 was added thereto, and the reaction was performed at 30 ° C for 3 minutes. From the rate of decrease in absorbance of the reaction solution at a wavelength of 340 nm, the reduction activity for each carbonyl compound was calculated and expressed as a relative value when the activity for 3,4 dimethoxyphenylacetone was 100%. It was shown to. As is clear from Table 2, the polypeptide of the present invention showed reducing activity against a wide range of carbonyl compounds.

[0088] Table 2: Reduction activity for carbonyl compounds

[0089] [Table 2] 兀 Substrate Relative activity (%)

3,4-Dimethoxyphenylacetone 100 Ethyl benzoyl acetate 1 1 1 2 Diacetyl 1 439

3-black mouth 1,4-pentadione 4056

2 -Octanon 523

2-pyridine power rubaaldehyde 981

Claims

The scope of the claims

[1] DNA of (a) or (b) below:

[2] DNA of (a) or (b) below:

(b) Hybridizes under stringent conditions with DNA containing a base sequence complementary to the base sequence shown in SEQ ID NO: 1 in the sequence listing and asymmetrically reduces 3,4-dimethoxyphenylacetone. , (R) -1-(3, 4-Dimethoxyphenyl)-DNA encoding a polypeptide having an activity to produce 2-propanol.

[3] The following polypeptide (a) or (b):

(b) A polypeptide comprising an amino acid sequence showing 80% homology (identity) with the amino acid sequence shown in SEQ ID NO: 2 in the sequence listing, and asymmetric 3,4-dimethoxyphenylacetone Which has the activity of reducing it to produce (R) _l_ (3,4-dimethoxyphenyl) _2_propanol.

[4] DNA encoding the polypeptide according to claim 3.

[5] A polypeptide having the activity of reducing the compound encoded by the DNA according to any one of claims 1, 2 and 4 and having a carbonyl group to produce an optically active alcohol.

[6] It is encoded by the DNA of claim 2 and 4, and 3,4-dimethoxyphenylacetone is asymmetrically reduced to give (R) —1- (3,4-dimethoxyphenyl). E) A polypeptide having the activity of producing 2-propanol.

[7] A vector comprising the DNA according to any one of claims 1, 2 and 4.

[8] The vector according to claim 7, further comprising DNA encoding a polypeptide having gnolecose dehydrogenase activity.

[9] Obtained by transforming a host cell with the vector according to any one of claims 7 to 8. Transformant.

10. The transformant according to claim 9, wherein the host cell is E. coli.

[11] An optically active alcohol, comprising reacting the polypeptide according to claim 3, 5 or 6 or the transformant according to claim 9 or 10 with a compound having a carbonyl group. Manufacturing method.